MORPHOLOGIC AND GENOMIC CHARACTERISATION

OF THE KOALA CHLAMYDIA PNEUMONIAE STRAIN

Candice Melissa Mitchell

Bachelor of Applied Science (Honours I), QUT 2006

Institute of Health and Biomedical Innovation

School of Life Sciences

Queensland University of Technology

Brisbane, Australia

A thesis submitted for the degree of Doctor of Philosophy of the

Queensland University of Technology

2010

ii

LIST OF KEYWORDS

Chlamydia pneumoniae; Chlamydia; pathogen; respiratory; characterisation; developmental cycle; elementary body; reticulate body; inclusion morphology; genome; genomic comparison; bioinformatics; single nucleotide polymorphism;

SNP; PCR; gene sequencing.

iii

ABSTRACT

Chlamydia pneumoniae is a common human and animal pathogen associated with a wide range of upper and lower respiratory tract infections. In more recent years there has been increasing evidence to suggest a link between C. pneumoniae and chronic diseases in humans, including atherosclerosis, stroke and Alzheimer’s disease. C. pneumoniae human strains show little genetic variation, indicating that the human-derived strain originated from a common ancestor in the recent past. Despite extensive information on the genetics and morphology processes of the human strain, knowledge concerning many other hosts (including marsupials, amphibians, reptiles and equines) remains virtually unexplored. The koala (Phascolarctos cinereus) is a native Australian marsupial under threat due to habitat loss, predation and disease. Koalas are very susceptible to chlamydial infections, most commonly affecting the conjunctiva, urogenital tract and/or respiratory tract. To address this gap in the literature, the present study (i) provides a detailed description of the morphologic and genomic architecture of the C. pneumoniae koala (and human) strain, and shows that the koala strain is microscopically, developmentally and genetically distinct from the

C. pneumoniae human strain, and (ii) examines the genetic relationship of geographically diverse C. pneumoniae isolates from human, marsupial, amphibian, reptilian and equine hosts, and identifies two distinct lineages that have arisen from animal-to-human cross species transmissions.

Chapter One of this thesis explores the scientific problem and aims of this study, while Chapter Two provides a detailed literature review of the background in this field of work. Chapter Three, the first results chapter, describes the morphology and developmental stages of C. pneumoniae koala isolate LPCoLN, as revealed by fluorescence and transmission electron microscopy. The profile of this isolate, when cultured in HEp-2 human epithelial cells, was quite different to the human

iv

AR39 isolate. Koala LPCoLN inclusions were larger; the elementary bodies did not have the characteristic pear-shaped appearance, and the developmental cycle was completed within a shorter period of time (as confirmed by quantitative real-time PCR). These in vitro findings might reflect biological

differences between koala LPCoLN and human AR39 in vivo.

Chapter Four describes the complete genome sequence of the koala respiratory

pathogen, C. pneumoniae LPCoLN. This is the first animal isolate of C.

pneumoniae to be fully-sequenced. The genome sequence provides new insights

into genomic ‘plasticity’ (organisation), evolution and biology of koala LPCoLN,

relative to four complete C. pneumoniae human genomes (AR39, CWL029, J138 and TW183). Koala LPCoLN contains a plasmid that is not shared with any of the human isolates, there is evidence of gene loss in nucleotide salvage pathways, and there are 10 hot spot genomic regions of variation that were previously not identified in the C. pneumoniae human genomes. Sequence (partial-length) from a second, independent, wild koala isolate (EBB) at several gene loci confirmed that the koala LPCoLN isolate was representative of a koala C. pneumoniae strain. The combined sequence data provides evidence that the C. pneumoniae animal (koala LPCoLN) genome is ancestral to the C. pneumoniae human genomes and that human infections may have originated from zoonotic infections.

Chapter Five examines key genome components of the five C. pneumoniae genomes in more detail. This analysis reveals genomic features that are shared by and/or contribute to the broad ecological adaptability and evolution of C. pneumoniae. This analysis resulted in the identification of 65 gene sequences for further analysis of intraspecific variation, and revealed some interesting differences, including fragmentation, truncation and gene decay (loss of redundant ancestral traits). This study provides valuable insights into metabolic

v

diversity, adaptation and evolution of C. pneumoniae.

Chapter Six utilises a subset of 23 target genes identified from the previous genomic comparisons and makes a significant contribution to our understanding of genetic variability among C. pneumoniae human (11) and animal (6 amphibian, 5 reptilian, 1 equine and 7 marsupial hosts) isolates. It has been shown that the animal isolates are genetically diverse, unlike the human isolates that are virtually clonal. More convincing evidence that C. pneumoniae originated in animals and recently (in the last few hundred thousand years) crossed host species to infect humans is provided in this study. It is proposed that two animal-to-human cross species events have occurred in the context of the results, one evident by the nearly clonal human genotype circulating in the world today, and the other by a more animal-like genotype apparent in Indigenous

Australians.

Taken together, these data indicate that the C. pneumoniae koala LPCoLN isolate has morphologic and genomic characteristics that are distinct from the human isolates. These differences may affect the survival and activity of the C. pneumoniae koala pathogen in its natural host, in vivo. This study, by utilising the genetic diversity of C. pneumoniae, identified new genetic markers for distinguishing human and animal isolates. However, not all C. pneumoniae isolates were genetically diverse; in fact, several isolates were highly conserved, if not identical in sequence (i.e. Australian marsupials) emphasising that at some stage in the evolution of this pathogen, there has been an adaptation/s to a particular host, providing some stability in the genome. The outcomes of this study by experimental and bioinformatic approaches have significantly enhanced our knowledge of the biology of this pathogen and will advance opportunities for the investigation of novel vaccine targets, antimicrobial therapy, or blocking of pathogenic pathways.

vi

LIST OF PUBLICATIONS AND MANUSCRIPTS

The following is a list of publications and manuscripts that have been prepared in conjunction with this thesis.

MitchellU CM,U Mathews SA, Theodoropoulos C and Timms P (2009). In vitro

characterisation of koala Chlamydia pneumoniae: morphology, inclusion

development and doubling time. Veterinary Microbiology. 136, 91-99.

Myers GSA, Mathews SA, Eppinger M, MitchellU C,U O’Brien KK, White OR,

Benahmed F, Brunham RC, Read TD, Ravel J, Bavoil PM and Timms P (2009).

Evidence that human Chlamydia pneumoniae was zoonotically acquired. Journal of Bacteriology. 191, 7225-7233.

MitchellU CM, U Hovis KM, Bavoil P, Myers GSA, Carrasco JA and Timms P (2010).

Comparative genomics of Chlamydia pneumoniae of human and animal origins highlights genetic diversity in the species. BMC Genomics. (Submitted with revisions, February 2010).

MitchellU CM, U Hutton S, Myers GSA, Brunham R and Timms P (2010). Chlamydia

pneumoniae is genetically diverse in animals and appears to have crossed the

host barrier to humans on (at least) two occasions. PLoS Pathogens. (In Press).

vii

THESIS-ASSOCIATED ABSTRACTS AND PRESENTATIONS

Invited Speaker:

ƒ MitchellU CM U and Timms P (2008). Chlamydial infections in koalas. Wildlife

animals and careers day, Currumbin Wildlife Sanctuary, Currumbin, Australia.

ƒ MitchellU CM U and Timms P (2008). Genomic and morphological characterisation of

the koala strain of Chlamydia pneumoniae. Harvard Medical School, Boston,

United States.

Oral Presentations:

ƒ MitchellU CM U and Timms P (2008). Koala (LPCoLN) Chlamydia pneumoniae: A

genetic and morphological characterisation. IHBI inspires conference, Gold

Coast, Australia.

ƒ MitchellU CM, U Mathews S and Timms P (2007). Analysis of the koala Chlamydia

strain. Second Australian International Chlamydia Conference, Brisbane,

Australia.

Poster presentations:

ƒ MitchellU CM, U Myers GSA and Timms P (2009). Koala Chlamydia pneumoniae:

Evolutionary insights into the MAC/perforin. Complement, perforins and bacterial

CDCs: The hole family, Prato, Italy.

ƒ MitchellU CM, U Mathews SA, Theodoropoulos C, Myers GSA and Timms P (2008).

Morphological and comparative genomic analysis of koala Chlamydia

viii

pneumoniae. Wildlife animals and careers day, Currumbin Wildlife Sanctuary,

Currumbin, Australia.

ƒ MitchellU CM, U Mathews SA, Theodoropoulos C, Myers GSA and Timms P (2008).

Characterisation of koala Chlamydia pneumoniae: Genetic and morphological

analysis. 108th American Society for Microbiology general meeting, Boston,

United States.

ƒ MitchellU CM, U Mathews SA, Theodoropoulos C, Myers GSA and Timms P (2007).

Morphological and comparative genomic analysis of koala Chlamydia

pneumoniae. The International Conference on Genome Informatics (GIW), Gold

Coast, Australia.

ƒ MitchellU CM, U Mathews SA, Theodoropoulos C, Myers GSA and Timms P (2007).

Morphological and comparative genomic analysis of koala Chlamydia

pneumoniae. IHBI inspires conference, Brisbane, Australia.

ƒ MitchellU CM, U Mathews SA, Theodoropoulos C, Myers GSA and Timms P (2007).

Morphological and comparative genomic analysis of koala Chlamydia

pneumoniae. Faculty of Science Postgraduate and Research Showcase, Brisbane,

Australia.

ix

TABLE OF CONTENTS

Page TITLE PAGE i CERTIFICATE RECOMMENDING ACCEPTANCE ii LIST OF KEYWORDS iii ABSTRACT iv LIST OF PUBLICATIONS AND MANUSCRIPTS vii TABLE OF CONTENTS x LIST OF ABBREVIATIONS xvii STATEMENT OF ORIGINAL AUTHORSHIP xx ACKNOWLEDGEMENTS xxi

CHAPTER ONE. INTRODUCTION 1

1.1 A description of the scientific problem investigated 2 1.2 The overall objectives of the study 4 1.3 The specific aims of the study 4 1.4 An account of scientific progress linking the scientific papers 5 1.5 References 7

CHAPTER TWO. LITERATURE REVIEW 8

2.1 Terminology and nomenclature 9 2.2 Brief history of Chlamydia taxonomy 9 2.2.1 Taxonomic confusion to the present day 12 2.3 Chlamydiosis 16 2.3.1 Human chlamydioses 16 2.3.1.1 Chlamydia trachomatis 16 2.3.1.2 Chlamydia pneumoniae 17 2.3.2 Animal chlamydioses and zoonoses 19 2.3.2.1 Chlamydia psittaci 19 2.3.2.2 Chlamydia suis 20 2.3.2.3 Chlamydia pecorum 21 2.3.2.4 Chlamydia abortus 22 2.3.2.5 Chlamydia felis 23 2.3.2.6 Chlamydia muridarum 23 2.3.2.7 Chlamydia caviae 24

x

2.3.2.8 Chlamydia pneumoniae 25 2.3.3 Chlamydial disease in the koala 25 2.3.4 Parachlamydiaceae 28 2.3.5 Simkaniaceae 29 2.3.6 Waddliaceae 29 2.3.7 Criblamydiaceae 29 2.3.8 Piscichlamydiaceae 30 2.3.9 Rhabdochlamydiaceae 30 2.4 The chlamydial developmental cycle 30 2.4.1 Incomplete development and chlamydial persistence 32 2.5 Chlamydial morphology 33 2.5.1 Chlamydia pneumoniae morphology 35 2.6 Methods for exploring Chlamydia pneumoniae 37 2.6.1 Cell culture 37 2.6.2 Animal models of Chlamydia pneumoniae infection and disease 38 2.6.3 Surrogate genetic systems 39 2.7 The chlamydial genome 40 2.7.1 Comparative analysis of Chlamydia pneumoniae human genomes 42 2.7.2 Characterisation of Chlamydia pneumoniae animal isolates at 44 several gene loci: 16S and 23S rRNA, ompA, ompB and groESL 2.7.3 Gene gain and gene loss in Chlamydia pneumoniae human 45 2.7.3.1 Tryptophan biosynthesis operon 45 2.7.4 The cryptic chlamydial plasmid 47 2.8 Typing of Chlamydia 49 2.8.1 Egg yolk sac inoculation 49 2.8.2 Microimmunofluoresence 50 2.8.3 Polymerase Chain Reaction (PCR) and Restriction Fragment 50 Length Polymorphism (RFLP) 2.8.4 Pulse-field gel electrophoresis (PFGE) 50 2.8.5 PCR and sequencing 51 2.8.6 Multi Locus Sequence Typing (MLST) 52 2.8.7 Variable Number of Tandem Repeats (VNTR) 53 2.9 Concluding remarks 54 2.10 References 56

Figures 1 Phylogenetic and sequence similarity (%) of the 16S rRNA gene 13 2 Phylogenetic comparisons of the Chlamydiaceae 14

xi

3 The chlamydial developmental cycle 31 4 Chlamydia pneumoniae EB morphology in HeLa 229 cells at 60hpi 36 5 Human Chlamydia pneumoniae plasticity zone 43 6 Pathways for the biosynthesis of tryptophan 46

Tables 1 Taxonomy within the order Chlamydiales 15 2 Morphological features of chlamydiae 34 3 Chlamydiaceae genome features with suspected host and niche 41 specific genes

CHAPTER THREE. In vitro characterisation of koala Chlamydia pneumoniae: 84 morphology, inclusion development and doubling time

Statement of Joint Authorship 85 Abstract 87 Introduction 88 Materials and Methods 89 Results 93 Discussion 102 Conclusion 106 Acknowledgements 106 References 107 Figures 1 Confocal micrographs of C. pneumoniae 95 2 Transmission electron micrographs of koala C. pneumoniae 98 inclusion development in HEp-2 cells 3 Transmission electron micrographs of C. pneumoniae 100 LPCoLN (A) and AR39 (B) in HEp-2 cells at 72h p.i. 4 Transmission electron micrographs of C. pneumoniae LPCoLN 101 at 36h p.i, and AR39 at 48h p.i, in HEp-2 cells Tables 1 C. pneumoniae LPCoLN and AR39 inclusion development in 96 HEp-2 cells 2 Ultrastructural differentiation of inclusion characteristics of 96 C. pneumoniae LPCoLN and AR39 isolates at 72 h p.i

xii

CHAPTER FOUR. Evidence that human Chlamydia pneumoniae was 111 zoonotically acquired

Statement of Joint Authorship 112 Abstract 114 Introduction 115 Materials and Methods 116 Results 120 Discussion 125 Acknowledgements 136 References 137 Figures 1 Comparative analysis of sequenced C. pneumoniae genomes 117 2 Synonymous SNP phylogenetic tree using all sequenced 123 C. pneumoniae genomes 3 Phylogeny of all animal chlamydiae and C. pneumoniae, using 124 111 highly conserved gene clusters 4 Annotated detail of additional regions shown in Figure 1 with 126 high SNP accumulation, showing SNP location and type Tables 1 Total SNPs in sequenced C. pneumoniae genomes, using C 118 pneumoniae AR39 as reference pneumoniae AR39 as reference 2 Breakdown of predicted protein orthologs in all human-derived 122 C. pneumoniae genomes, compared to C. pneumoniae LPCoLN using the Blast Score Ratio method (Rasko et al., 2005) 3 Total (a) Synonymous and (b) Nonsynonymous SNPs identified 122 between C. pneumoniae genomes, showing shared (italics) and Supplementary files 142 Figure 1 Synteny plots derived using the BLAST Score Ratio method 142 (Rasko et al., 2005) Table 1 Unique C. pneumoniae LPCoLN CDSs identified by BSR 143 analysis (BSR ≤ 0.4) compared to C. pneumoniae AR39

xiii

CHAPTER FIVE. Comparative genomics of Chlamydia pneumoniae of human 147 and animal origins highlights genetic diversity in the species

Statement of Joint Authorship 148 Abstract 151 Introduction 152 Materials and Methods 154 Results 155 Discussion 167 Conclusions 173 Acknowledgements 174 References 175 Figures 1 Organisation of the C. pneumoniae plasticity zone 159 2 Phylogeny of the chlamydial plasmid 166 Tables

1 Chlamydiaceae1B genome features with suspected host and 161 niche specific genes Supplementary files 185 Figures 1 Polymorphic outer membrane protein features of 184 C. pneumoniae 2 Refer to the CD version of this thesis 185 3 Chlamydia MACPF 185 4 Chlamydia has lost several steps in the pyrmidine biosynthesis 186 pathway 5 Refer to the CD version of this thesis 186 Tables 1 Categories of targets for investigation 187 2 C. pneumoniae-specific genes 190 3 Polymorphic outer membrane protein features of C. pneumoniae 194 4 T3S homolog comparisons 195 5 Refer to the CD version of this thesis 196 6 List of C. pneumoniae target genes 196

Data 1 Plasmid similarity scores (%). 197

xiv

CHAPTER SIX. Chlamydia pneumoniae is genetically diverse in animals and 198 appears to have crossed the host barrier to humans on (at least) two occasions

Statement of Joint Authorship 199 Abstract 201 Author Summary 202 Introduction 202 Materials and Methods 205 Results and Discussion 210 Conclusions 224 Acknowledgements 227 References 228 Figures 1 Sequence comparison of CPK_ORF00679 212 2 Variable number of tandem repeats polymerase chain reaction 215 (PCR) for the pmpG6 gene Supplementary files 234 Figures 1 Phylogenetic trees (A-V) of C. pneumoniae isolates 234 2-23 Refer to the CD version of this thesis 245 Tables 1 Chlamydia pneumoniae isolates used in this study 247 2 Synonymous SNP profile for 10 selected genes and genotype 249 Designation 3 Oligonucleotide primers used in this study 253 Text 1 Key genomic data supporting two evolutionary lineages 255

CHAPTER SEVEN. GENERAL DISCUSSION 257

7.1 Discussion 258 7.2 What did the common ancestor of the current C. pneumoniae 273 human and animal strains most likely look like or resemble? 7.3 An evolutionary hypothesis of C. pneumoniae 274 7.4 Novel targets for detection and epidemiological investigation of 277 C. pneumoniae of human and animal origin

xv

7.5 Recommendations for researchers, veterinarians and animal 280 care/service workers 7.5.1 Recommendations for researchers 280 7.5.2 Recommendations for veterinarians and animal care workers 282 7.6 Conclusions 282 7.7 Future directions 283 7.8 References 285

Figures 1 Chlamydia pneumoniae evolutionary hypothesis 275 2 Predicted migration patterns of Chlamydia pneumoniae 276 3 Approximate genomic localisation of selected target genes 279

Table 1 Novel targets for detection and epidemiological investigation of 278 C. pneumoniae

xvi

LIST OF ABBREVIATIONS

16S rRNA 16S ribosomal ribonucleic acid protein

1979 Human nasopharyngeal isolate, Australia

2040.3 Frog paraffin isolate, Switzerland accB Acetyl-coA carboxylase, biotin carboxyl carrier protein accC acetyl-CoA carboxylase, biotin carboxylase add AMP adenosine deaminase

AB Aberrant body

A03 Human coronary atheroma isolate, USA

AR39 Human pharyngeal isolate, USA

AroAA-Hs Aromatic amino acid hydroxylase

B10, B26, B37 Bandicoot nasal isolate, Australia

Bp Base pair/s

BGMK Blue Green Monkey Kidney

BMTF-type 1/2 Frog paraffin isolate, Australia

Burpyth Snake lung isolate, USA

CDS Coding sequence

Cham Chameleon paraffin isolate, Africa

CP_0505 Hypothetical protein

CP_0880 Hypothetical protein

CP_1042 Hypothetical protein

CPK_ORF00201 Extracellular repeat, HAF family auto-transporter beta

domain

CPK_ORF00342 Hypothetical protein

CPK_ORF00392 Hypothetical protein

CPK_ORF00497 Hypothetical protein

CPK_ORF00617 Hypothetical protein

xvii

CPK_ORF00661 Hypothetical protein

CPK_ORF00678 Hypothetical protein

CPK_ORF00679 Conserved hypothetical, Lamin 2-like protein

CPK_ORF00681 Hypothetical protein

CPK_ORF00687 Hypothetical protein

CPK_ORF00729 Bacteriophage remnants

CPK_ORF00730 Bacteriophage remnants

CPXT1 Frog liver isolate, Africa

CWL029 Human orpharyngeal isolate, USA

DE177 Frog liver isolate, Central African Republic

DNA Deoxyribonucleic acid

EB Elementary body

EBB Koala pharnygeal isolate, Australia

GBF Frog lung isolate, Australia groESL Heat shock protein guaA GMP synthase guaB IMP dehydrogenase

GST Turtle heart isolate, Australia

HAF HAF family-autotransporter beta-domain

HeLa Human genital epithelial cell line

Helicase/CPK_ORFA00005 Replicative DNA helicase, dnaB; plasmid

HEp-2 Human Epithelial cell line

HL Heteroploid Line cells

Hpi Hours post infection

Iguana Iguana paraffin isolate, Central America

IOL207 Human conjunctival isolate, Iran

J138 Human pharyngeal isolate, Japan

Kb Kilo base/s

xviii

LKK1 Human pharyngeal isolate, Korea

LPCoLN Lone Pine Connor (koala) Left Nasal (cavity) isolate

MACPF/CPK_ORF00685 Membrane Attack Complex / Perforin

McCoy Mouse fibroblast cell line

N16 Horse nasal isolate, UK nSNP Non-synonymous single nucleotide polymorphism omcA, omcB Outer membrane complex ompA, MOMP Major Outer Membrane Protein ompB Outer Membrane Protein B

ORF Open Reading Frame

PCR Polymerase Chain Reaction pfk Diphosphate-fructose-6-phosphate 1 phosphotransferase

PGP3D/CPK_ORFA00007 Conserved hypothetical protein; plasmid pmpE/F2 Polymorphic outer membrane protein pmpE/F3 Polymorphic outer membrane protein pmpG6 Polymorphic outer membrane protein

Pot37 Potoroo pharyngeal isolate, Australia

Pufadd Snake paraffin isolate, USA

RB Reticulate Body

SctC/CPK_ORF00106 Type III secretion system protein

SH511 Human nasopharyngeal isolate, Australia

SNP Single Nucleotide Polymorphism

SSR2/CPK_ORFA00003 Site-specific recombinase II; plasmid sSNP Synonymous Single Nucleotide Polymorphism

TOR1 Human brain isolate, Canada

TW183 Human conjunctival isolate, Taiwan

TWAR TW183 (ocular) and AR39 (respiratory) isolates

WA97001 Human nasopharyngeal isolate, Australia

xix

STATEMENT OF ORIGINAL AUTHORSHIP

The work contained in this thesis has not been previously submitted for a degree or diploma at this or any other higher education institution. To the best of my knowledge and belief, the thesis contains no material previously published or written by any other person(s) except where due reference is made.

xx

ACKNOWLEDGEMENTS

It is a pleasure to thank the many colleagues, friends and family who have generously offered their help, advice and encouragement over the past three years.

First of all, I would like to thank my supervisor, Prof. Peter Timms, for the patient guidance, advice and encouragement he has provided for the duration of my time, as his student. I am grateful to have had the opportunity to work with a supervisor who was enthusiastic about my project, and who handled my many questions and manuscript drafts expeditiously.

I would like to thank all members of my Infectious Diseases research group for their skillful and supportive discussions, with particular mention to Assoc Prof.

Louise Hafner, Dr Sarah Mathews, Prof. Ken Beagley and Dr Charles Wan. Thank you also to my ‘second group’, the Cancer group, who provided many great discussions and support along the way. I would particularly like to thank Mitch

Lawrence, Carson Stephens, Mark Adams, John Hooper and Johnny Lai. Thank you to Dongsheng Li and Wen Liu for their many helpful suggestions.

I especially would like to thank my mum, dad, Nat and Cuddles (dog) for their endless support and encouragement during the ups and downs of my research.

Most importantly, my family believed in me, at times, more than I believed in myself.

Thank you to my friends (Shreema Merchant, Anita Jones, Kelly Cunningham,

Ashkan Amirshahi, Alex Stephens and Raquel Lo) who have made my time in the lab more enjoyable and for the many excuses to go out and have an iced- chocolate and cake (Liz Leddy, Priya Shah and Danielle Borg). A special thank

xxi

you goes to Elise Pelzer, for her continued friendship, encouragement, and optimism throughout this entire journey.

I am also grateful to the reviewers of this thesis, for their valuable time, comments and recommendations.

I would like to express my sincere gratitude to the Institute of Health and

Biomedical Innovation / Queensland University of Technology for providing me with the opportunity to undertake this research, and for giving me the opportunity to attend conferences and meet many interesting people.

Finally, this PhD project would not have been possible without the financial assistance of the Australian Government, by way of an Australian Postgraduate

Award, and the Institute of Health and Biomedical Innovation for their top-up stipend. I would also like to thank the Queensland University of Technology travel assistance and conference grants-in-aid scheme, for their financial assistance.

xxii Chapter 1: Introduction

CHAPTER ONE

INTRODUCTION

- 1 - Chapter 1: Introduction

1.1 A Description of the Scientific Problem Investigated

Chlamydia pneumoniae is a common human and animal pathogen associated with a range of upper and lower respiratory tract infections. Infection with C. pneumoniae is geographically widespread, with 70% of the human (adult) population showing serological evidence of previous exposure (Grayston et al.,

1990; Saikku, 1992; Ekman et al., 1993; Einarsson et al., 1994). It has also been shown that C. pneumoniae (human) disseminates to non-respiratory sites, possibly via circulating monocytes, where it might contribute to the pathogenesis of cardiovascular disesae (Moazed et al., 1998).

Since the first isolation of C. pneumoniae strain TWAR in 1965, studies of human isolates have shown that they are extremely similar (>99% identity) at the DNA level, providing limited insight into the dynamics of infection. Despite the isolation of C. pneumoniae from a broad range of cold and warm-blooded animal hosts (horses, koalas, bandicoots, frogs, snakes, turtles and lizards), knowledge concerning the animal strains remains virtually unexplored morphologically and genetically. Specifically, animal strain characterisation has focused on partial sequences of three conserved genes including 16S rRNA, ompA and omcB.

Chlamydiae are very efficient intracellular pathogens of humans and animals. To be successful pathogens, the chlamydiae have established ways to gain entry into the host cell and evade host immune recognition (Zhong et al., 1999; Zhong et al., 2000). They have undergone a degree of gene loss and rely on their host for essential nutrients (e.g. amino acids and energy) to be able to infect their target host cell, complete an infection cycle and release viable progeny to infect new cells (Sakharkar et al., 2004). Since 1998, whole genomes of an increasing number of chlamydial strains have been sequenced. Genomic comparisons with these strains are providing new insights into species-specific requirements,

- 2 - Chapter 1: Introduction tropism, pathogenicity (capacity to cause disease) and virulence (degree of disease).

Currently, there are five complete C. pneumoniae genome sequences available online at http://www.ncbi.nlm.nih.gov. Four genomes (human hosts) are remarkably stable with a very highly conserved gene content (>99% similarity) and gene organisation, which means that little evolutionary or genotypic insight has been gained. Therefore, in order to advance our knowledge of evolution and common biological process required for C. pneumoniae infection, it was necessary to sequence the complete genome of an animal strain. Our group at

QUT was involved in the first genome sequence of an animal strain, from a koala

(LPCoLN isolate) with respiratory distress during an outbreak that occurred at

Lone Pine Koala Sanctuary in Brisbane, Australia.

Epidemiological studies of C. pneumoniae in humans indicate that the pathogen

is widespread and re-occurrence of infection is not uncommon (Grayston et al.,

1990; Saikku, 1992; Ekman et al., 1993; Einarsson et al., 1994). The dynamics of infection may be host-dependent, although the prevalence of C. pneumoniae in animal populations also appears to be geographically widespread. As

mentioned, genotyping of C. pneumoniae isolates, particularly of animal origin,

has been limited to the partial-length sequencing of three genes (16S rRNA,

ompA and omcB) that offer some indication of diversity, although in cases where

a common genotype may be geographically spread, these genes were not highly

discriminatory. Evidently, comparative genomics with the newly sequenced koala

LPCoLN isolate will enable the selection of highly informative gene targets and

biomarkers for future studies. The identification of highly discriminatory genetic

markers is essential for effective monitoring, clinical management and treatment

of C. pneumoniae as well as for epidemiological studies.

- 3 - Chapter 1: Introduction

1.2 The Overall Objectives of the Study

The overall objective of this study was to expand the current knowledge of C. pneumoniae from human and animal hosts. More specifically, the project was designed to investigate morphological differences between koala LPCoLN and human AR39 in vitro and to identify genetic differences from sequence comparisons of all available isolates as a step towards better diagnostic markers for epidemiology studies and infection control of C. pneumoniae.

1.3 The Specific Aims of the Study

1. To further characterise the in vitro morphology and developmental cycle of

the C. pneumoniae koala isolate (LPCoLN), relative to the human (AR39)

isolate (Chapter Three).

2. To contribute to the sequencing project of our US collaborators and analyse

the C. pneumoniae koala genome (Chapter Four).

3. To compare C. pneumoniae genomes of human and koala to identify

potential species/strain-specific target genes (Chapter Five).

4. To compare gene sequences of C. pneumoniae isolates of human and animal

origin to determine the evolutionary relationship between the selected genes

(Chapter Six).

- 4 - Chapter 1: Introduction

1.4 An Account of Scientific Progress Linking the Scientific

Papers

The four papers presented as part of this thesis are directly linked to the topic of

C. pneumoniae characterisation. The first results chapter of this thesis, Chapter

Three, presents a detailed exploration of the morphological and developmental characteristics between a C. pneumoniae koala LPCoLN isolate and a C.

pneumoniae human AR39 isolate, using microscopy and quantitative real time

PCR. As we have shown, there were several differences (inclusion size, EB

morphology and growth rate) between the koala LPCoLN and human AR39

isolates. These differences may be attributable to the small number of variable

genes or extrachromosomal elements identified in a comparison of the five C.

pneumoniae genomes (Chapter Four). Unlike the highly conserved C.

pneumoniae human (AR39, CWL029, J138 and TW183) genomes, the koala

LPCoLN genome had subtle genomic variations to the C. pneumoniae human

genomes, providing new insights into the global gene variation, evolution and

biology of C. pneumoniae (Chapter Four).

To further investigate the level of genetic variability within the C. pneumoniae

koala LPCoLN genome, key genome components were analysed in more detail

(Chapter Five). The focus was to identify similarities and differences between the

C. pneumoniae koala and human genomes so that we could select key target genes for the analysis of ‘unsequenced’ isolates. This analysis enabled the identification of koala and human strain-specific genes that may be relevant to host specificity or virulence of C. pneumoniae. Such components included genes and gene families with previously established virulence determinants, outer membrane proteins, nucleotide and biosynthetic pathways, and hypothetical proteins that may be worth further investigating.

- 5 - Chapter 1: Introduction

Another important consideration in determining the genetic diversity of this pathogen was to include additional geographically diverse C. pneumoniae human and animal isolates in the analysis (Chapter Six). A subset of 23 target genes identified in our previous comparisons, were selected for the analysis of 11 human and 19 animal isolates from amphibian, reptilian, equine and marsupial hosts. However, due to technical difficulties with some of the DNA preparations, we could not obtain reliable sequence for all genes from all the isolates. Despite this, we were able to show that the animal isolates were more genetically diverse than human isolates, which were virtually clonal. From this analysis, we hypothesised that, due to the genetic patterns of diversity, C. pneumoniae originated in animals and recently (in the last few hundred thousand years) crossed host species to infect humans on at least two occasions. One lineage was evident by the nearly clonal human genotype circulating in the world today and the other by a more animal-like genotype apparent in Indigenous

Australians.

It is important to note that this thesis is written in the format of a series of manuscripts and chapters in accordance with the Queensland University of

Technology theses by submitted manuscript guidelines. Chapter Two is a review of the literature. Chapters Three to Six have been submitted and/or accepted for publication in journals. The format differs (according to individual journal requirements) among these chapters and has been adjusted to fit the layout of this thesis. Chapter Seven is an overarching discussion of the main features of this study.

- 6 - Chapter 1: Introduction

1.5 References

Einarsson S, Sigurdsson HK, Magnusdottir SD, Erlendsdottir H, Briem H and Gudmundsson S (1994). Age specific prevalence of antibodies against Chlamydia pneumoniae in Iceland. Scandinavian Journal of Infectious Diseases. 26, 393– 397.

Ekman MR, Leinonen M, Syrjälä H, Linnanmäki E, Kujala P and Saikku P (1993). Evaluation of serological methods in the diagnosis of Chlamydia pneumoniae pneumonia during an epidemic in Finland. European Journal of Clinical Microbiology and Infectious Diseases. 12, 756–760.

Grayston JT, Campbell LA, Kuo CC, Mordhorst CH, Saikku P, Thom DH and Wang SP (1990). A new respiratory tract pathogen: Chlamydia pneumoniae strain TWAR. The Journal of Infectious Diseases. 161, 618-625.

Moazed TC, Kuo CC, Grayston TJ and Campbell LA (1998). Evidence of systemic dissemination of Chlamydia pneumoniae via macrophages in the mouse. The Journal of Infectious Diseases. 177, 1322-1325.

Saikku P (1992). The epidemiology and significance of Chlamydia pneumoniae. Journal of Infection. 24, 27-34.

Sakharkar KR, Dhar PK and Chow VTK (2004). Genome reduction in prokaryotic obligatory intracellular parasites of humans: a comparative analysis. International Journal of Systematic and Evolutionary Microbiology. 54, 1937- 1941.

Zhong G, Fan T and Liu L (1999). Chlamydia inhibits interferon γ–inducible major histocompatibility complex class II expression by degradation of upstream stimulatory factor 1. Journal of Experimental Medicine. 189, 1931–1938.

Zhong G, Liu L, Fan T, Fan P and Ji H (2000). Degradation of transcription factor Rfx5 during the inhibition of both constitutive and interferon γ–inducible major histocompatibility complex class I expression in Chlamydia-infected cells. Journal of Experimental Medicine. 191, 1525-1534.

- 7 - Chapter 2: Literature Review

CHAPTER TWO

LITERATURE REVIEW

- 8 - Chapter 2: Literature Review

2.1U Terminology and Nomenclature

To prevent confusion and misunderstanding, the following is a list of terminology and nomenclature recognised within the chlamydial field: chlamydiae is the plural of Chlamydia, but can also be used to define the class of chlamydiae. The single order, Chlamydiales (capitalised and italicised), has seven families,

Chlamydiaceae, Parachlamydiaceae, Simkaniaceae, Waddliaceae,

Criblamydiaceae, Piscichlamydiaceae and Rhabdochlamydiaceae (capitalised and

italicised) (Greub et al., 2009). Chlamydiaceae comprises a single genus,

Chlamydia (singular, capitalised and italicised) (Moulder et al., 1984; Stephens,

1999). Chlamydiosis refers to an infection or disease caused by members of the

genus Chlamydia. Their developmental cycle involves the inter-conversion

between an elementary body (EB) and a reticulate body (RB), from within an

intracellular vacuole, termed an inclusion. An ‘isolate’ is a pure culture derived

from a population of microorganisms and a ‘strain’ is a subset of a bacterial

species that differs from other bacteria within this species.

2.2U Brief history of Chlamydia taxonomy

In 1907, Halberstaedter and Prowazek identified intracytoplasmic inclusions in epithelial scrapings from individuals with trachoma, and consequently termed them Chlamydozoa after the Greek word ‘chlamys’, meaning cloak, in reference

to the intracytoplasmic inclusion draped around the host cell nucleus

(Halberstaedter and Prowasek, 1907). Over the next few years, genital tract

infections sharing similarities to the trachoma pathogen were documented

(Lindner et al., 1909). Psittacosis (parrot fever) was first described as a human

pathogen in Switzerland in 1879 (Ritter, 1880), although it was rarely reported

until 1929-1930 when a pandemic occurred (Elkeles and Barros, 1931).

Trachoma-inclusion conjunctivitis (TRIC) and psittacosis isolates were initially

- 9 - Chapter 2: Literature Review identified as Miyagawanella species (Brumpt, 1938) and were thought to be of viral origin due to their inability to grow on artificial media and their inability to synthesise adenosine triphosphate (ATP) (Jenkins et al., 2002). Following

Bedson’s description of the unique developmental cycle of the psittacosis agent

(Bedson et al., 1930), similar structures and developmental characteristics were observed in other clinical isolates, leading to a new scientific nomenclature for these organisms causing trachoma, psittacosis and other such diseases (Page,

1968).

In 1945, there was a proposal of two type-species (Chlamydia trachomatis and

Chlamydia psittaci) on the basis of morphology, developmental cycle and group antigen (Jones et al., 1945). However, in 1953, Meyer suggested a reclassification to the genus Bedsonia (named after Sir Samuel Bedson who isolated and characterised the developmental cycle of C. psittaci), which was to be used for the next few years. During this era, ‘Bedsonia’ was referred to as a virus-like organism, because of its ability to pass through filters of 0.35 μm and the requirement of living cells for multiplication (Rockey and Matsumoto, 2000).

Eventually, scientists began to identify characteristics of bacteria: they contained both DNA and RNA, had a gram negative bacterial appearance, divide by binary fission and were susceptible to antibiotics (Moulder, 1964; Page, 1968; Riordan-

Eva, 1988). However, it was not until 1965, with the aid of tissue culture and electron microscopy, that it became evident that these organisms were not viruses, but rather bacteria. Chlamydia remained grouped with Rickettsia, another obligate intracellular pathogen, until 1966, when the genus Chlamydia and two species (C. trachomatis and C. psittaci) were re-introduced (Page,

1966). This time the nomenclature was accepted and used for many decades.

The third species, C. pneumoniae (formerly C. psittaci), was first isolated in

1965, from the conjunctiva of a Taiwanese child participating in a trachoma

- 10 - Chapter 2: Literature Review vaccine trial (Grayston, 1965; Kuo et al., 1986), and the first pharyngeal isolate was recovered from a student with pharyngitis in 1983 (Grayston et al., 1986).

Hence, all initial C. pneumoniae isolates were referred to as the TWAR (TW183-

AR39) strain of C. psittaci (Kuo et al., 1986). Over the years, with the emergence of highly discriminative techniques, it became clear that C. pneumoniae was different from C. psittaci and C. trachomatis, and was designated its own species in 1989, as a result of a unique EB morphology, DNA analysis and serology (Grayston et al., 1989). The fourth species, C. pecorum

(formerly C. psittaci), was first isolated in 1953, from the brain of a calf with sporadic encephalomyelitis (McNutt and Waller, 1940). In 1992, the species C. pecorum was designated on the basis of genetic analysis with cattle and sheep that were associated with various diseases (Fukushi and Hirai 1992).

Five additional species were designated in 1999, by Everett et al. (1999) on the basis of 16S and 23S ribosomal sequences, phenotypic and ecological differences:

(i) C. muridarum, formerly known as C. trachomatis mouse pneumonitis MoPn

(Dochez et al., 1937; Nigg, 1942), was first observed in mice by Dochez et al.

(1937), when 17 of 50 albino Swiss mice were identified with lung pathologies.

The species was designated in 1999, from sequence analyses and phenotypic differences (Everett et al., 1999).

(ii) C. suis, formerly known as C. trachomatis (Perez-Martinez and Storz, 1985;

Storz et al., 1994), was first recovered from porcine intestinal sites, and designated strain S45 (Perez-Martinez and Storz, 1985). This strain resembled

C. trachomatis and like this human pathogen, was sensitive to sulfadiazine

(Storz et al., 1994). As a result of host tropism and sequence differences, the C. trachomatis porcine strains were re-classified as C. suis (Everett et al., 1999).

- 11 - Chapter 2: Literature Review

(iii) C. felis (formerly known as C. psittaci feline pneumonitis agent) was first described by Baker (1944), as a highly infectious respiratory disease in cats, with debilitating effects and a long infection course (approximately one month).

Given its host tropism and genetic differences from other chlamydial isolates, C. felis was designated as a separate species in 1999, by Everett et al. (1999).

(iv) C. abortus (formerly known as C. psittaci immunotype 1) was first described in Scotland, by Greig (1936), who reported enzootic abortion of ewes. C. abortus isolates have a distinct serotype and are nearly identical across ribosomal and major outer membrane protein sequences. Hence, Everett et al. (1999) designated the species, C. abortus.

(v) C. caviae (formerly known as C. psittaci guinea pig conjunctivitis strain) was first described by Murray (1964), who identified chlamydial agents from conjunctival scrapings of guinea pigs. This chlamydial type was classified as C. caviae in 1999 (Everett et al., 1999).

2.2.1 Taxonomic confusion to the present day

The rapid expansion of the number of organisms within the order Chlamydiales led to the proposal of a revision to the Chlamydiaceae taxonomy to include two genera, Chlamydia (C. trachomatis, C. muridarum and C. suis) and

Chlamydophila (C. pneumoniae, C. pecorum, C. felis, C. abortus, C. psittaci and

C. caviae) on the basis of 16S ribosomal (r) RNA and 23S rRNA sequences. This reclassification appears in many recent publications, but was controversial since the renaming of Chlamydophila species led to confusion amongst clinicians and the scientific community (Schachter et al., 2001). In fact, Stephens et al. (2009) recently reported that the majority of publications will use ‘Chlamydia pneumoniae’ (81% in 2006) over ‘Chlamydophila pneumoniae’ (16% in 2006).

- 12 - Chapter 2: Literature Review

The authors further argue that the Everett et al. (1999) proposal that defined a separate genera on the basis of <95% similarity in the 16 rRNA gene was inappropriate since, with exceptions, all species are >97% (Figure 1), which is useful for speciation but not genus-level differentiation. Genome comparisons with 110 concatenated conserved chlamydial genes showed that Chlamydia

species share a close and linked evolutionary relationship (Figure 2), which

further devalues the 16S rRNA gene for chlamydial taxonomy (Stephens et al.,

2009).

Figure 1. Phylogenetic and sequence similarity (%) of the 16S rRNA gene. In this

comparison, Stephens et al. (2009) invalidate the <95% 16S rRNA similarity level proposed by

Everett et al. (1999) – for the separation of the genera. All species share > 95% sequence identity.

Figure adapted from Stephens et al., 2009.

- 13 - Chapter 2: Literature Review

Figure 2. Phylogenetic comparisons of the Chlamydiaceae. A total of 110 conserved proteins from the genomes of Chlamydia trachomatis, Chlamydia pneumoniae, Chlamydia muridarum,

Chlamydia pecorum, Chlamydia felis, Chlamydia psittaci, Chlamydia abortus and Chlamydia caviae, spanning a total of 121 674 positions with a sequence similarity of 82.2% and identity of 58.8% were analysed, with 200 bootstrap replicates. This phylogenetic analysis shows that C. trachomatis, C. muridarum, C. pneumoniae and C. pecorum cluster away from C. felis, C. caviae, C. psittaci and C. abortus, further depreciating the value of the 16S rRNA gene-based trees for taxonomic classification within the Chlamydiaceae. Figure taken from Stephens et al., 2009.

For simplicity, we have adopted the most widely accepted taxonomy that defines a single genus, Chlamydia, and nine species (Table 1) - Chlamydia trachomatis,

Chlamydia pneumoniae, Chlamydia psittaci, Chlamydia suis, Chlamydia pecorum,

Chlamydia abortus, Chlamydia felis, Chlamydia muridarum and Chlamydia caviae as proposed in this latest work (Stephens et al., 2009). Everett et al. (1999) also proposed several other families alongside Chlamydiaceae based on genotypic, phenotypic and ecological differences: Parachlamydiaceae, Simkaniaceae, and

- 14 - Chapter 2: Literature Review

Table 1. Taxonomy within the order Chlamydiales

Family I: Family II: Family III: Family IV: Family V: Family VI: Family VII:

Chlamydiaceae Parachlamydiaceae Simkaniaceae Waddliaceae Criblamydiaceae Piscichlamydiaceae Rhabdochlamydiaceae

Genus I: Genus I: Genus I: Genus I: Genus I: Genus I: Genus I:

Chlamydia Parachlamydia Simkania Waddlia Criblamydia Piscichlamydia Rhabdochlamydia

C. trachomatis P. acanthamoebae S. negevensis W. chrondrophila C. sequanensis P. salmonis R. crassificans

C. psittaci Genus II: Genus II: W. malaysiensis R. porcellionis

C. pneumoniae Protochlamydia Fritschea

C. pecorum P. amoebophila F. bemisiae

C. muridarum P. naegleriophila F. eriococci

C. suis Genus III:

C. felis Neochlamydia

C. abortus N. hartmannellae

C. caviae

- 15 - Chapter 2: Literature Review

Waddliaceae (Table 1); these new families along with four additional families

(Criblamydiaceae, Piscichlamydiaceae and Rhabdochlamydiaceae) have been accepted with caution (Draghi II et al., 2004; Kostanjsek et al., 2004; Thomas et al., 2006; Corsaro et al., 2007; Greub et al., 2009).

2.3U Chlamydiosis

2.3.1 Human chlamydioses

Although several chlamydial species are capable of infecting humans, the two major pathogens of humans are C. trachomatis and C. pneumoniae.

2.3.1.1 Chlamydia trachomatis

C. trachomatis exhibits an in vivo tropism for mucosal epithelial cells, monocytes and macrophages. There are multiple serovars with A, B and C being the most common cause of trachoma and infectious blindness (Schachter and Dawson,

1990; Thylefors et al., 1995), while the genital serovars D-K are the most prevalent cause of sexually transmitted disease in humans (Gerbase et al.,

1998). Genital tract infections can range from asymptomatic to chronic disease if left untreated - the infection gradually ascends upwards from the lower genital tract. In women, a genital tract infection may lead to pelvic inflammatory disease, tubo-ovarian abscesses, salpingitis, ectopic pregnancies and infertility.

In men, genital tract infections often include urethritis, proctitis, epididymitis and can cause sterility. Transmission from mother to foetus can occur as a result of a

C. trachomatis infection, causing low birth weight, conjunctivitis, or pneumonia in the newborn (Gerbase et al., 1998). There is, however, another class of serovars (L1-3) that cause lymphogranuloma venereum (LGV). Unlike serovars

A-K which are non-invasive (restricted to epithelial surfaces), the LGV strains are

- 16 - Chapter 2: Literature Review invasive and can cause systemic infections, proliferate in monocytes and disseminate to local lymph nodes (Schachter, 1999; Thomson et al., 2008).

2.3.1.2 Chlamydia pneumoniae

The second major human pathogen, C. pneumoniae, is probably one of the most successful chlamydial species (alongside C. psittaci), having established a niche on respiratory mucosal surfaces in a range of warm and cold-blooded hosts. The first isolation of C. pneumoniae isolate TW183 was from the conjunctiva of a child enrolled in a trachoma vaccine trial (Kuo et al., 1986). In 1971, cell culture methods were available and revealed that the C. pneumoniae TW183 isolate had round, dense inclusions that were more similar to C. psittaci, than to C. trachomatis inclusions (Grayston et al., 1989; Kuo et al., 1995). In 1968, an ocular isolate from a child in Iran was also proven to be C. pneumoniae and not associated with ocular disease (Dwyer et al., 1972). It was not until 1983 that C. pneumoniae was associated with respiratory disease, when the first respiratory isolate, AR39, was isolated from a pharyngeal swab of a patient with pharyngitis

(Grayston et al., 1986). The C. pneumoniae isolates were eventually termed

TWAR from the laboratory designation of the first ocular (TW183) and respiratory isolate (AR39) (Kuo et al., 1995). In subsequent years, TWAR was associated with respiratory outbreaks in Finnish military trainees (Kleemola et al., 1988; Ekman et al., 1993), schools (Pether et al., 1989; Hagiwara et al.,

1999), families (Blasi et al., 1994) and nursing homes (Troy et al., 1997). Since the infections and outbreaks were observed among human populations, TWAR was considered to be a human pathogen with no animal reservoir (Grayston et al., 1986; Kuo et al., 1986).

In contrast to C. trachomatis, C. pneumoniae is difficult to recover from clinical samples and viable particles are often lost during serial passage (Kuo and

- 17 - Chapter 2: Literature Review

Grayston, 1990; Roblin et al., 1992). Cell culture and microscopy have been the

‘gold standard’ for diagnosis, especially when serology has failed to detect a positive infection (Chirgwin et al., 1991). C. pneumoniae infections are more commonly associated with bronchitis, pharyngitis and community-acquired pneumonia (Kuo et al., 1995) and sero-epidemiological studies suggest that up to 70% of adults will become infected at least once in their lifetime (Peeling and

Brunham, 1996). Even more alarmingly, recent evidence demonstrates that chronic infections have been associated with atherosclerosis and stroke (Saikku et al., 1988; Grayston, 2000), myocarditis (Wesslén et al., 1992), and possibly multiple sclerosis (Sriram et al., 1998) and Alzheimer’s disease (Balin et al.,

1998).

Over the years, there have been many reports of serological evidence implicating

C. pneumoniae exposure worldwide. In 1992, Hallsworth et al. (1992) examined the seroprevalence of C. pneumoniae in three populations from Australasia (total of 352 sera), revealing up to 46% prevalence in South Australia, 55% prevalence in the Northern Territory, and 19% prevalence in Papua New Guinea.

Matsumoto et al. (2006) reported 20.3% (13/41) seroprevalence in children under the age of five, in Bangladesh. Gencay et al. (1998) reported that 19% of healthy children (from 164 sera) and 64% of healthy adults (from 247 sera) had serological signs of past C. pneumoniae in Turkey. Ben-Yaakov et al. (2002) reported the prevalence of antibodies in 53/172 (31%) children and 171/230

(74%) adults from an Israeli population without clinical evidence of respiratory infection. Furthermore, in 1998, Koh et al. (2002) reported the seroprevalence of

C. pneumoniae from a cohort of 1068 people aged 18-69, from three ethnic groups in Singapore, including Chinese (Male 76.7% and Female 68.3%), Malays

(Male 75.5% and Female 59.1%) and Asian Indians (Male 74.6% and Female

59.4%) – both genders demonstrated increased seropositivity from 46.5% (18-

29 years) to a plateau of 78.9% (40-49 years), remaining stable in 60-69 years

- 18 - Chapter 2: Literature Review of age. Although these are only a few of the many studies, these combined data confirm high prevalence of C. pneumoniae throughout the world.

2.3.2 Animal chlamydioses and zoonoses

A number of chlamydial pathogens cause disease in animals and, in a few instances, have the potential to cause disease in humans.

2.3.2.1 Chlamydia psittaci

C. psittaci is the agent of avian chlamydiosis infecting a variety of wild and domesticated birds. The pathogen can be carried in birds for many years, often without clinical manifestations until years later. As well as infections in birds, C. psittaci can directly infect humans: via (i) contact with infected birds; (ii) respiratory secretions that remain airborne for protracted periods, and; (iii) ingestion and/or inhalation of aerosolised infectious particles from faeces

(Schlossberg, 2008).

There are seven known avian serovars and 10 genotypes within the species C. psittaci, as revealed by MOMP serovar-specific epitopes, gene sequencing, MOMP restriction fragment length polymorphism, microarray, real time PCR and melt

curve analyses (Andersen 1991; Vanrompay et al., 1993; Andersen 1997; Geens

et al., 2005; Harkinezhad et al., 2007; Sachse et al., 2008; Mitchell et al.,

2009). Genotype A is endemic to psittacines (cockatoos, parrots and parkakeets)

and is well known for causing psittacosis in humans. Genotype B is endemic in

pigeons, while genotypes C and D are generally isolated from non-psittacines

(seagulls and ducks). Genotype E is present in many avian hosts worldwide,

including turkeys, ducks, pigeons and ostriches, and genotype F has been

isolated from parakeets and turkeys. The final genotype, E/B, is present among

- 19 - Chapter 2: Literature Review

German ducks, Italian pigeons and Belgian turkeys.

In birds, clinical signs of C. psittaci may include anorexia, lethargy, dyspnea, conjunctivitis, nasal or ocular discharge, pneumonia and diarrhoea (Schlossberg,

2008). In humans, psittacosis often starts with flu-like symptoms, fever, chills, cough, shortness of breath, chest pain, headache or myalgia, and occasionally results in atypical pneumonia (Nagington J, 1984; Moroney et al., 1998;

Longbottom and Coulter, 2003; Constantinescu and Scott, 2008).

2.3.2.2 Chlamydia suis

C. suis is a pathogenic agent of pigs. Other chlamydial species including C. psittaci, C. abortus and C. pecorum have also been reported in pigs, infecting the respiratory and reproductive tract (Rogers et al., 1993; Schiller et al., 1997;

Thoma et al., 1997; Busch et al., 2000). C. suis can cause asymptomatic intestinal lesions in young weanling pigs, similar to intestinal lesions in infected gnotobiotic (animal in which only certain strains of bacteria or other micro- organisms are present) piglets (Rogers and Anderson, 2000). Reinhold et al.

(2005) revealed a pathogenic role of C. suis in respiratory challenges with the porcine respiratory system. However, respiratory disease was not evident in pigs that were PCR-positive for different naturally acquired chlamydial species (C. trachomatis, C. pecorum and C. psittaci). The authors concluded that the presence of other chlamydial species in the porcine respiratory system might act as independent pathogens or ‘by-standers’ without any clinical or functional relevance (Reinhold et al., 2005).

Clinical symptoms of the porcine respiratory system include severe dyspnoea, wheezing or asthma-like breathing sounds and breathlessness (Sachse et al.,

2004; Reinhold et al., 2008). The clinical outcome of respiratory challenges with

- 20 - Chapter 2: Literature Review

C. suis in pigs has been reported as comparable to that of fulminant cases of

chlamydial infections in humans with mechanical ventilation, in relation to multi-

organ failure (Reinhold et al., 2005, 2008, 2009).

Tetracycline and its derivatives are often used for the treatment of chlamydial

infections in human and veterinary infections (Chopra et al., 2001). Although

antibiotic resistance within the Chlamydiaceae is uncommon (Lefevre et al.,

1998; Somani et al., 2000; McOrist, 2000; Suchland et al., 2003; Binet and

Maurelli, 2005), tetracycline resistance strains have been observed within C. suis

as a result of a resistance gene, tet(C), in the chromosome of diseased and

‘healthy pigs’ in the USA (Dugan et al., 2004).

2.3.2.3 Chlamydia pecorum

C. pecorum was first recovered in 1953, from the brain of a calf with sporadic

encephalomyelitis (McNutt and Waller, 1940). Since the initial isolation, C.

pecorum has been identified in many animal hosts, including sheep, cattle,

marsupials, swine and horses. C. pecorum-infected hosts are subject to a diverse

range of diseases including conjunctivitis, cystitis, encephalomyelitis, metritis/infertility, pneumonia, polyarthritis (stiff lamb disease), and intestinal infections (Schachter et al., 1974, 1975; Perez-Martinez et al., 1985; Cockram and Jackson, 1974; DeLong et al., 1986; Girjes et al., 1988). Possible modes of transmission include excretion in the faeces (Phillips and Clarkson, 1995;

Clarkson and Phillips, 1997), while other routes include direct contact or inhalation of aerosols.

In 1988, Girjes et al. (1988) made an attempt to subtype the former C. psittaci strains found in koalas, using restriction enzyme and gene probe analyses. The authors reported two distinct subtypes from diseased and infertile koalas (Type I

- 21 - Chapter 2: Literature Review and Type II). Type I was found in ocular pathotypes compared to Type II which was evident in ocular and urogenital pathotypes (Girjes et al., 1988), and was more common than Type I (Girjes et al., 1993). Later, in 1996, Glassick et al.

(1996) used PCR amplification and sequence analysis to further differentiate the two types of chlamydial infections found in koalas: koala Type-I represented C. pneumoniae infections, while koala Type-II represented C. pecorum infections.

Although both koala chlamydial types were shown to infect the eyes of koalas,

Type II strains were also associated with urogenital tract infections (typical of C. pecorum), while Type I strains were associated with respiratory symptoms

(Glassick, 1994). More recently, Mohamad et al. (2008) applied a multi-virulence locus sequence typing method for the differentiation of virulent C. pecorum strains from a wide range of hosts. This study identified promising molecular markers for C. pecorum differentiation. However, further epidemiological investigations with C. pecorum are required in order to assign virulence types

(Mohamad et al., 2008).

2.3.2.4 Chlamydia abortus

C. abortus efficiently colonises the placenta of ruminants and is a major cause of infectious abortion (Papp et al., 1993; Longbottom and Coulter 2003). The major source of infection is the placenta and uterine tissue from aborting ewes, whereby the infected ewes shed the chlamydiae for a week prior to aborting and for two weeks post abortion (Radostits et al., 2000). C. pneumoniae infection is usually undetectable until the animal aborts or gives birth to a feeble or dead foetus (Van loock et al., 2003). Infection occurs via ingestion, where it is established in the tonsil, disseminating by blood or lymph to other organs or the gastrointestinal tract (Jones and Anderson, 1988; Miller et al., 1990). Infected ewes remain fertile, and can successfully re-breed, although in some cases they may develop metritis (Wilsmore et al., 1990). C. abortus is a zoonotic pathogen,

- 22 - Chapter 2: Literature Review and pregnant women who have come into contact with infected animals are at risk of abortion and life threatening illness (Longbottom and Coulter 2003).

2.3.2.5 Chlamydia felis

C. felis was first isolated from cats with pneumonia (Baker, 1944). Since the initial isolation, C. felis has been identified worldwide in cats commonly presenting with conjunctivitis (Cello, 1971; Shewen et al., 1978; Studdert et al.,

1981; Azuma et al., 2006). Cats may initially present with a watery discharge

that later becomes mucoid or mucopurulent, and the infection can progress to an

intense conjunctivitis with hyperaemia (excessive accumulation of blood) of the

nictitating membrane, and extreme ocular discomfort (Gruffydd-Jones et al.,

2009). C. felis is unlikely in cats that have respiratory disease and no concurrent

ocular signs (Gruffydd-Jones et al., 2009), since feline herpesvirus-1 and feline

calcivirus are dominant feline respiratory infections (Zicola et al., 2009). C. felis

frequently occurs in cats under the age of one and infection is most prevalent in

multi-cat environments such as breeding catteries, with the duration of shedding

lasting for approximately 60 days (Gruffydd-Jones et al., 2009). There is

evidence of zoonotic transmission to humans (Yan et al., 2000), particularly

keratoconjunctivitis in humans, although evidence for a systemic or pneumonia

sequale in humans is lacking (Browning, 2004; Gruffydd-Jones et al., 2009).

2.3.2.6 Chlamydia muridarum

The initial isolations of C. muridarum were from the respiratory tract of mice

(Dochez et al., 1937; Nigg, 1942) and, hence forth, C. muridarum was thought

to be a respiratory pathogen (Rank, 2007). In 1943, Karr infected mice

intranasally and found that transmission was not via the respiratory route, and

later inoculated the drinking water of uninfected mice and left infected mouse

- 23 - Chapter 2: Literature Review carcasses in their cages in order to investigate the route of transmission (Karr,

1943). This led to the identification of MoPn (mouse pneuomonitis) in the lungs of several of the mice, and was taken to indicate that transmission was via the oral route, where the organisms were aspirated into the respiratory tract (Karr,

1943).

In 1981, Barron and colleagues first reported success with MoPn infection in the genital tract of mice, consistent with that of acute genital tract infections in humans. This finding led to the proposal of a model for human chlamydial genital tract infections (Barron et al., 1981). MoPn has subsequently become a popular animal model for urogenital and respiratory tract infections in mice (Ramsey et al., 1989; Hickey et al., 2004; Qiu et al., 2008; Ramsey et al., 2009).

2.3.2.7 Chlamydia caviae

C. caviae, the agent responsible for guinea pig inclusion conjunctivitis (GPIC) is predominantly found in young guinea pigs between the fourth and eighth weeks of life (Murray, 1964). C. caviae infections can range from asymptomatic to mild or severe clinical conjunctivitis, including a purulent discharge that seals the eyes, chemosis (swelling) of the conjunctiva, follicular hypertrophy, or vascularisation of the cornea with infiltration of granulation tissue (pannus)

(Murray, 1964; Lutz-Wohlgroth et al., 2006; Rodolakis and Mohamad, 2010).

An ascending genital tract infection is also possible in C. caviae-infected hosts, often involving the urethra, bladder, endometrium and fallopian tubes (Rank et al., 1990; Lutz-Wohlgroth et al., 2006). Like mice, guinea pigs are also widely used as a model for chlamydial genital tract infection in humans, because the pathology is similar to that of human C. trachomatis infections (Mount et al.,

1973; Longbottom, 2003; Rodolakis and Mohamad, 2010).

- 24 - Chapter 2: Literature Review

2.3.2.8 Chlamydia pneumoniae

The first report of C. pneumoniae in animals was in 1990, from a horse with serous nasal discharge (Wills et al., 1990). Since the initial isolation, C. pneumoniae has been detected in a broad range of cold and warm-blooded animals worldwide, and outbreaks of infection have been reported in horses

(Wills et al., 1990), frogs (Reed et al., 2000), koalas (Jackson et al., 1999) and bandicoots (Kutlin et al., 2007). The spectrum of disease varies from acute respiratory disease to necrotising myocarditis. Acute respiratory disease associated with pneumonia were reported in horses (Wills et al., 1990); mild respiratory disease, granulomatous, and pneumonia were observed in puff adders (Bodetti et al., 2002); excessive quantities of subcutaneous and coelomic clear fluid, and enlarged nodular kidneys were observed in Blue Mountains tree frogs (Bodetti et al., 2002); Green sea turtles showed signs of lethargy, anorexia and the inability to dive, while light microscopy provided evidence of necrotising myocarditis, histiocytic to fibrinous splenitis, hepatic lipidosis, and necrosis

(Bodetti et al., 2002), and; iguanas showed signs of lethargy and anorexia, with microscopy revealing diffuse necrosis of epithelial cells (Bodetti et al., 2002).

Despite the many host-species and the broad spectrum of infections associated with C. pneumoniae, the genetic diversity of these isolates has been hindered by a lack of suitable/available markers. As a result, the genetic make-up of these isolates and the host-range of this species remain largely unknown.

2.3.3 Chlamydial disease in the koala

The koala (Phascolarctos cinereus) is a native Australian marsupial commonly infected with Chlamydia (Jackson et al., 1999; Deveraux et al., 2003). While the decline in koala populations have largely been the result of hunting and a

- 25 - Chapter 2: Literature Review diminished habitat, concern for the koala exists due to an increased incidence of disease (McColl et al., 1984). Almost all Australian free-range koalas and many in captive populations are affected by C. pecorum and/or C. pneumoniae. C. pecorum is the cause of ocular and urogenital tract infections and diseases.

Keratoconjunctivitis, which if left untreated, will eventually lead to blindness.

Urinary tract infections, including pyometritis, vaginitis, salpingitis and incontinence may display the characteristic ‘wet bottom’ appearance.

Reproductive diseases including enlargement of the fallopian tube and cystic dilation of the ovarian bursae (structures that envelope the ovaries) are well- known factors of infertility (Obendorf et al., 1981; McColl et al., 1984).

Vision impairment caused by conjunctivitis is an important cause of mortality among koala populations due to an interruption in feeding abilities and increased susceptibility to motor vehicle accidents and predation by other animals

(Glassick, 1994). C. pneumoniae, which is often found in conjunction with C. pecorum (Glassick et al., 1996; Jackson et al., 1999), has been isolated from ocular, urogenital tract and respiratory sites (Jackson et al., 1999), however, the underlying pathology of C. pneumoniae at ocular and urogenital tract sites is poorly understood. Clinical signs for C. pneumoniae respiratory distress include sneezing, coughing, chest congestion, difficulty in breathing, rhinitis and in more severe cases, pneumonia (Glassick et al., 1996; Wardrop, 1997; Devereaux et al., 2003).

C. pneumoniae is readily transmitted via the respiratory route and koala populations can become infected by aerosol transmission, close contact via mating, fighting and other sources of contact. There are many unanswered questions about C. pneumoniae infections in koalas, for instance, whether C. pneumoniae infection results in long-term sequelae, and whether previous or simultaneous exposure to C. pecorum will result in a more serious/chronic

- 26 - Chapter 2: Literature Review condition.

In 1999, Jackson et al. (1999) reported an epidemiological study on the prevalence of C. pecorum and C. pneumoniae in koalas from two independent,

free-range koala populations from south-east Queensland. A total of 33 koalas

were sampled from the Mutdapilly population, and 85% of these koalas were

infected with Chlamydia; 73% were positive for C. pecorum and 24% were

positive for C. pneumoniae. The second population was from Coombabah and of

the 20 koalas examined, only 10% were infected with equal levels of C. pecorum

and C. pneumoniae (Jackson et al., 1999). There was a significant difference in

the level of infection between the two populations, with more infections in the

Mutdapilly population. The Mutdapilly population was located on cattle grazing

land, and there were fewer trees observed, compared to the Coombabah

population (Jackson et al., 1999). Sampling of the cattle in close proximity to the

Mutdapilly koala population would have been useful to rule out, or support, any

cross-host transmission of C. pecorum from cattle to koalas or vise-versa.

A second study by Deveraux et al. (2003) examined the prevalence of Chlamydia

in two additional free-range koala populations, Pine Creek State Forest (New

South Wales) and Moggill Koala Hospital (Queensland). Swab samples from

ocular, throat and urogenital sites were collected over a two-year period – 94

swab samples were collected from a total of 25 koalas in 1999, and 126 swab

samples from 36 koalas in 2000. From the 1999 koala collection, Deveraux et al.

(2003) reported that 72% (18/25) of the koalas were positive for Chlamydia;

52% (13/25) were positive for C. pecorum and 12% (3/25) were positive for C. pneumoniae. In the 2000 study, 36% (13/36) of koalas were positive for

Chlamydia; 22% (8/36) were positive for C. pecorum and 17% (6/36) were positive for C. pneumoniae. The highest rate of infection was seen at the urogenital site (77% - 10/13) in the Chlamydia positive koalas.

- 27 - Chapter 2: Literature Review

Koalas are readily susceptible to Chlamydia, often residing dormant in the koala until the koala’s immune system is challenged by one or more stressors, such as habitat destruction, environmental heat waves (due to global warming) and predators. While the infection levels appear to vary within koala populations, it is clear that Chlamydia is widely prevalent in Australian koala populations. The origin of C. pecorum in koalas is unknown, although it has been hypothesised that this species may have been introduced to Australia with European settlement.

2.3.4 Parachlamydiaceae

At present, there are three recognised genera of the family Parachlamydiaceae -

Parachlamydia, Protochlamydia and Neochlamydia (Table 1). Parachlamydia acanthamoebae naturally infect amoebae and have been recovered from environmental and clinical specimens (Michel et al., 1992; Amann et al., 1997).

More recently, there has been a causal link to lower respiratory tract infections

(Greub and Raoult, 2002; Corsaro et al., 2006).

The genus Protochlamydia comprises two species: Candidatus Protochlamydia amoebophila is an endosymbiont of Acanthamoeba species, whereas

Protochlamydia naegleriophila is an endosymbiont of Naegleria amoeba

(Collingro et al., 2005; Casson et al., 2008). N. hartmannellae is an intracellular parasite of Hartmannella vermiformis; RBs and EBs of N. hartmannellae are not surrounded by vacuoles, instead, they multiply freely in the host cell cytoplasm, and lysis of the cell occurs within a few days (Horn et al., 2000). N. hartmannellae isolates have also been recovered from environmental clinical specimens (Michel et al., 1995; von Bomhard et al., 2003; Draghi et al., 2007).

- 28 - Chapter 2: Literature Review

2.3.5 Simkaniaceae

The family Simkaniaceae consists of two genera, Simkania and Fritschea (Table

1). S. negevensis was initially discovered as a cell culture contaminant (Kahane et al., 1995) and has been associated with bronchiolitis in infants and community-acquired pneumonia in adults (Lieberman et al., 1997; Kahane et al.,

1998). The second genus, Fritschea, is associated with insects (Thao et al.,

2003) and housed within insect bacteriocytes, which contain primary and secondary endosymbionts (Clark et al., 1992).

2.3.6 Waddliaceae

At present, the family Waddliaceae contains only one genus, Waddlia (Table 1).

W. chondrophila is a Chlamydia-like organism that was first associated with bovine abortion (Dilbeck et al., 1990; Henning et al., 2002) and has since been

shown to enter and multiply in human macrophages, and induce lysis of the

infected cells (Goy et al., 2008). W. chondrophila is also considered a probable agent of human miscarriages, particularly in women who are more likely to have contact with animals (Baud et al., 2007). A second species, W. malaysiensis, has been isolated from urine samples of fruit bats in peninsular Malaysia (Chua et al., 2005).

2.3.7 Criblamydiaceae

The family Criblamydiacae contains one genus, Criblamydia. An amoebal co-

culture method was used to recover the first isolate, C. sequanensis, from water

samples of the Seine river in France (Thomas et al., 2006).

- 29 - Chapter 2: Literature Review

2.3.8 Piscichlamydiaceae

The family Piscichlamydiacae contains only one genus, Piscichlamydia (Table 1).

Candidatus P. salmonis is a Chlamydia-like organism that is associated with epitheliocystis from proliferative gills of Atlantic salmon (Draghi et al., 2004).

However, the developmental stages are different from those identified in non- prolferative gills of Atlantic salmon (Draghi et al., 2004).

2.3.9 Rhabdochlamydiaceae

There are two species in the genus Rhabdochlamydia. Candidatus R. porcellionis has been recovered from the hepatopancreas of the crustacean host, Porcellio scaber, whereas Candidatus R. crassificans is a pathogen of the cockroach,

Blatta orientalis (Corsaro et al., 2007; Kostanjek et al., 2004).

Rhabdochlamydiae have been detected in premature neonates, with signs of respiratory distress (Lamoth et al., 2009). Thus, providing a pathogenic role in humans.

2.4U The chlamydial developmental cycle

Although Chlamydiaceae exhibit a diverse host range (mammals, amphibians and reptiles), broad tissue tropism (respiratory tract, eyes and urogenital tract) and varied disease pathology (pneumonia, trachoma, genital infection) their infectious processes are uniform, surviving and multiplying within eukaryotic cells via a unique bi-phasic developmental cycle (Bedson and Bland, 1932; Bland and Canti, 1935; Rake and Jones, 1942; Stirling and Richmond, 1977; Ward

1983; Abdelrahman and Belland, 2005) (Figure 3). Chlamydia undergoes development within a parasitophorus vacuole, termed an inclusion. A primary

- 30 - Chapter 2: Literature Review

Figure 3. The chlamydial developmental cycle. (1) The chlamydial infection is initiated upon attachment of the infectious elementary body ‘EB’ to the host cell. (2) EBs are internalised within host-derived membranes, termed inclusions. (3) EBs differentiate into the metabolically active and larger reticulate bodies ‘RB’. (4-5) RBs replicate by binary fission within the chlamydial inclusion.

(6A) Many inducers of persistence (including Interferon gamma, amino acid starvation and antibiotics) will result in deviation from the ‘normal developmental cycle’, resulting in a viable but non-cultivable growth stage and the formation of large aberrant bodies, ‘ABs’. (6B) In normal development, RBs will continue to replicate. (7) Later in the infectious process, the RBs asynchronously begin to differentiate to EBs, evidence of intermediate bodies ‘IBs’ at this stage and the EBs accumulate within the inclusion. Host cells lyse (8), releasing the EBs to infect neighbouring cells for successive rounds of infection. Figure by C Mitchell, 2009.

host defense for intracellular pathogens is via vacuolar fusion with lysosomes and vacuole acidification (Kornfield and Mellman, 1989; Sinai and Joiner, 1997)

– yet, Chlamydia species modulate lysosomal fusion and block vacuolar acidification (Sinai and Joiner, 1997). In the initial stages of infection, chlamydiae express gene products to become invisible to the endocytic or lysosomal pathway but are fusogenic with sphingomyelin-containing excocytic

- 31 - Chapter 2: Literature Review vesicles that traffic sphingomyelin from the Golgi apparatus en route to the plasma membrane (Hackstadt, 1999; Fields and Hackstadt, 2002).

One of the defining characteristics of Chlamydia is the bi-phasic developmental cycle involving the interconversion between an extracellular infectious elementary body (EB) and a metabolically active reticulate body (RB).

Morphologically, EBs are small (~ 0.3 μm in diameter), highly infectious structures with round or pear-shaped outer membranes (Miyashita and

Matsumoto, 2004). By comparison, the RB is the larger (0.5 – 1 μm in diameter), non-infectious, replicative form (Rake and Jones 1942; Gutter et al.,

1973; Stirling and Richmond, 1977; Miyashita and Matsumoto, 2004). The chlamydial developmental cycle is initiated when EBs attach to and enter susceptible host cells (Figure 3). Following attachment, EBs are internalised within host-derived membranes (inclusions) and differentiate into metabolically active RBs at approximately 3 h post-infection (pi), and replicate by binary fission over a 24-48 h time period (Miyashita and Matsumoto, 2004;

AbdelRahman and Belland, 2005). The inclusion continues to expand simultaneously with the increasing chlamydial population, and later (30-72 hpi) in the infectious process, the RBs asynchronously begin to differentiate to EBs, where they accumulate within the lumen of the inclusion ready to be released upon host cell lysis at about 40-96 hpi, depending on the strain (Shaw et al.,

2000; Miyashita and Matsumoto, 2004; AbdelRahman and Belland, 2005).

2.4.1 Incomplete development and chlamydial persistence

In addition to the normal developmental cycle, Chlamydia can enter a state of persistence (Figure 3). The ability to cause a persistent infection is one of the major characteristics of chlamydial disease, which results in continual damage over time (Hammerschlag et al., 2002). The chlamydiae may persist in the host

- 32 - Chapter 2: Literature Review for months or years and are often asymptomatic during this time. Disruptions to the developmental cycle can occur when growth conditions are altered, for example by immunological responses, antibiotics, or nutrient deprivation,

resulting in the formation of large, aberrant RBs, occasionally referred to as ABs

(Hogan et al., 2003). In vitro persistence models have been shown to alter

chlamydial growth characteristics, such that enlarged RBs are formed and

incapable of binary fission and differentiation to the EB, yet are capable of

chromosomal replication (Figure 3). Recommencement of growth and the release

of infectious EBs have been observed upon removal of the stress (persistence

inducer) with the conversion of the aberrant form into an RB (Rottenberg et al.,

2002).

2.5U Chlamydial morphology

Chlamydia species have several distinguishing morphological features, including

the inclusion morphology, compression of the host cell nucleus, EB morphology

and glycogen accumulation within the inclusion (Table 2). The inclusion

morphology varies from simple round structures (C. pneumoniae) to irregular and lobular morphologies (C. caviae), presumably the result of host adaptations, access to nutrients and biogenesis and maintenance of outer membrane proteins. Compression of the nucleus is species and strain-specific – the inclusion may be compressed against the nucleus, creating a scalloped appearance, while other inclusions will grow around the nucleus and will not distort its shape (Spears and Storz, 1979; Miyashita and Matsumoto, 2004).

EBs are all enclosed within a cytoplasmic membrane and are relatively stable against mechanical agitation such as freeze-thawing, ultrasonic and osmotic shock (Miyashita and Matsumoto et al., 2004). The chlamydial EB morphology is round with the exception of C. pneumoniae which occasionally has pear-shaped

- 33 - Chapter 2: Literature Review

Table 2. Morphological features of chlamydiae

Chlamydia Chlamydia Chlamydia Chlamydia Chlamydia Chlamydia Chlamydia Chlamydia Chlamydia

trachomatis psittaci pneumoniae pecorum muridarum suis felis abortus caviae

Inclusion Oval Variable Variable Variable Variable Oval Variable Oval Variable morphology

Compression Yes No No Variable Variable No No No Yes of nucleus

Round or EB Round Round Round Round NA NA NA Round pear-shaped morphology

Glycogen Variable No No No Variable No No No No staining

- 34 - Chapter 2: Literature Review morphologies (Chi et al., 1987; Miyashita and Matsumoto, 2004). EBs are

electron-dense and the predominant proteins that offer stabilisation through

disulfide cross-linkage include the major outer membrane protein (ompA/MOMP)

and two cysteine-rich proteins, omcA and omcB (outermembrane complex),

whereas RBs possess ompA but lack any detectable omcA and omcB (Hatch et al., 1984).

Another distinguishing feature of chlamydiae is the accumulation of glycogen within inclusions identified following iodine staining. The accumulation of glycogen in chlamydial inclusions can be visualised following iodine staining, as depicted by brown-mahogany granular bodies typically indicating the chlamydial inclusion (Yong et al., 1986; Wentworth, 1973). However, several chlamydial inclusions are not recognised by iodine stain, thought to be the result of plasmid and glycogen-deficiency within the inclusion (Hammerschlag, 2004; O’Connel and Nicks, 2006). Glycogen, a branched glucose-containing polysaccharide, is a carbon and energy reserve in many bacteria. Bacilli and several enteric bacteria are known to accumulate glycogen when cell growth becomes limited by nitrogen and when carbon sources are still available (Kiel et al., 1994). The biological function and regulation of glycogen metabolism in Chlamydia is, however, poorly understood.

2.5.1 Chlamydia pneumoniae morphology

The inclusion morphology of C. pneumoniae human isolates is oval shaped in

human epithelial ‘HEp-2', human genital epithelial ‘HeLa’ and blue green monkey

kidney ‘BGMK’ cells (Carter et al., 1991; Miyashita et al., 1993; Miyashita and

Matsumoto, 2004). Previously, electron microscopic examinations of the EB

morphology were thought to be characteristic for C. pneumoniae, as defined by a

wide periplasmic space and wavy outer membrane often referred to as ‘pear-

- 35 - Chapter 2: Literature Review

Figure 4. Chlamydia pneumoniae EB morphology in HeLa 229 cells at 60 hpi. (A) Human isolate AR39 – note the pear-shaped EB morphology with a wide periplasmic space, (B) Human isolate KKpn-15 – note the round EB morphology and the narrow periplasmic space. Arrows indicate

EBs. Bar indicates 500 nm. Figure adapted from: Miyashita and Matsumoto, 2004.

shaped’ (Figure 4A) (Chi et al., 1987; Miyashita and Matsumoto, 2004).

However, in more recent years it has become clear that not all C. pneumoniae strains have the pear-shaped EB morphology. Several C. pneumoniae isolates fit the ‘pear-shaped’ criterion including: TW-183 (Chi et al., 1987), AR39 (Chi et al.,

1987), AR388 (Miyashita and Matsumoto, 2004) and AC-43 (Yamazaki, 1992) which have a wide periplasmic space and wavy outer membrane, while other C. pneumoniae isolates (Figure 4B) have round outer membranes with a narrow periplasmic space. Examples of this latter morphology include: horse isolate N16 from the United Kingdom (Wills et al., 1990), frog isolate GBF from Australia

(Berger et al., 1999), human isolate LKK-1 from Korea (Lee et al., 2003), human isolate YK-41 from Japan (Miyashita et al., 1993), human isolate IOL-207 from

Iran (Carter et al., 1991) and human isolate Kajaani-6 from Finland (Popov et al., 1991). The reason for the observed variable EB morphology remains unclear.

- 36 - Chapter 2: Literature Review

By comparison, the RB morphology is consistently round across the geographically widespread C. pneumoniae isolates (Berger et al., 1999; Popov et al., 1991; Miyashita and Matsumoto, 2004).

At present, C. pneumoniae human inclusions have not stained with iodine despite the fact that they have a complete glycogen synthesis and degradation

system, likely to support the role of glycogen synthesis and the use of glucose derivatives in chlamydial metabolism (Kalman et al., 1999).

2.6U Methods for exploring Chlamydia pneumoniae

Chlamydiae are obligate intracellular bacteria, and have no tractable genetic system, which makes these organisms difficult to investigate. Tam and colleagues successfully introduced plasmid DNA into C. trachomatis by vigorous electroporation (Tam et al., 1994), although, the plasmid was not stably maintained. This method has shown that the introduction of DNA into EBs is possible, although it does not offer a readily applicable genetic system for

Chlamydia (Scidmore et al., 1998). Thus far, attempts to establish a genetic system for manipulations of chlamydiae have had limited success (Scidmore et al., 1998; Heuer et al., 2007). To further investigate and better understand the mechanisms behind Chlamydia infections, several approaches such as cell culture, animal models, and surrogate genetic systems, are often applied. Below is a brief summary of methods, with a focus on C. pneumoniae.

2.6.1 Cell culture

Cell culture, along with inoculation of material into animals and embryonated chicken eggs were the main methods for diagnosis of chlamydial infection up until the 1980s (Gordon et al,. 1963; Gordon and Quan, 1965; Darougar et al.,

- 37 - Chapter 2: Literature Review

1971). C. pneumoniae grows poorly in cell culture, relative to C. trachomatis, and is difficult to recover in the initial culture and in serial passage due to loss of organisms during the passage (Kuo and Grayston, 1990). Chirgwin et al. (1991) isolated C. pneumoniae from 15 nasopharyngeal specimens during a study in

Brooklyn, however, only two of the specimens were positive on initial inoculation, while the remaining 13 isolates required a second or third passage.

The two most commonly used cell lines for C. pneumoniae isolation include HL cells, a heteroploid line that has a slow life cycle and is used for the propagation of respiratory viruses (Cles and Stamm, 1990), and HEp-2 cells, a human epithelial cell line derived from a larynx carcinoma (Wong et al., 1992).

Centrifugation and the incorporation of anti-metabolites (cycloheximide, emetine or mitomycin C) into the medium are required to facilitate chlamydial growth, by inhibiting host-cell metabolism (Campbell et al., 2001).

2.6.2 Animal models of Chlamydia pneumoniae infection and disease

Over the years, several animal models have been developed to investigate aspects of the disease and antibiotic susceptibility in vivo. Animal models are used extensively in an attempt to unravel the causal link between C. pneumoniae infection and cardiovascular disease. Monkey models have been used to study respiratory infections, while mouse and rabbit models have been commonly used for respiratory and cardiovascular infections (Saikku et al.,

1998). Mouse models have revealed differences in strain virulence between a

Kajaani 6 Finnish isolate (more virulent) and a TW183 Taiwanese isolate

(Kaukoranta-Tolvanen et al., 1993), while rabbit models have provided new insights into the cell types involved in infection and dissemination of the pathogen to non-respiratory sites, including the vascular wall, brain or blood monocytes (Saikku et al., 1998; Gieffers et al., 2004). Antimicrobial drug therapy studies in animal models are treated with caution because of the

- 38 - Chapter 2: Literature Review organism’s ability to persist in the host following antibiotic therapy. Animal models, however, can determine whether drug intervention can alter disease progression and are helpful in defining treatment regimens and doses for future studies (Campbell et al., 1998).

2.6.3 Surrogate genetic systems

Genetic manipulation of organisms by gene inactivation, replacement or over-

expression, is used extensively in research for the characterisation of protein

function and localisation. To date, attempts to transform foreign and

recombinant DNA into Chlamydia have had limited success (Tam et al., 1994;

Binet and Maurelli, 2009). One of the many challenges in developing a genetic

system for Chlamydia is the obligate intracellular nature of this pathogen. EBs

have spore-like cell walls that are protected by cross-linkage proteins, making

DNA insertion extremely difficult, while the RBs are encapsulated within an

inclusion (Heuer et al., 2007). Alternate approaches have included random

mutagenesis to enhance the likelihood of gene disruption, immunogenic peptides

in which chlamydial genome fragments are genetically combined with Escherichia

coli, and global transcriptome to examine expression under normal and stressful

conditions (Heuer et al., 2007).

Over the years, chlamydiologists have established the feasibility of using E. coli

and Bacillus subtilis heterologous hosts for the investigation of chlamydial

proteins (Barry et al., 1992; Watson et al., 1994; Vehmaan-Kreula et al., 2001;

Airaksinen et al., 2003). More recently, yeast has been used as a surrogate

genetic system for determining the role of CopN, a type III secretion system

protein in C. pneumoniae. Heterologous expression of C. pneumoniae CopN in

yeast and mammalian cells resulted in cell cycle arrest, revealing an essential

role for CopN during C. pneumoniae in vitro infection (Huang et al., 2008). This

- 39 - Chapter 2: Literature Review system opens doors for future experiments involving the identification and study of other proteins that may contribute to disease pathogenesis and virulence.

2.7U The chlamydial genome

Since 1998, 17 chlamydial genomes have been completely sequenced and published: six C. trachomatis (434/Bu, A/HAR-13, D/UW-3/CX, Jali20, L2b/UCH-

1/proctitis and TW5/OT), three C. muridarum (MopnTet14, Weiss, and Nigg), five C. pneumoniae (AR39, CWL029, J138, TW183 and LPCoLN), one C. abortus

(S26/3), one C. caviae (GPIC), and one C. felis genome (Fe/C-56).

The chlamydial genome is small (~1,042,519 base pair bp to 1,230,230 bp;

Table 3) relative to other bacteria. The pathogen-host relationship is thought to be a major factor leading to genome reduction, as the supply of energy, nutrients and metabolites can be obtained directly from their retrospective hosts.

Several steps involved in metabolic pathways consequently may be partially or completely lost from Chlamydia (Sakharkar et al., 2004). Alternatively, strategies for overcoming host challenges may mean that several bacterial components are lost from the genome during its long-term symbiosis with the host - thus reducing the overall genome size.

For many years, the gene encoding 16S rRNA has been the prime target of taxonomic studies (Everett et al., 1999), while other gene targets have played a less significant role. By integrating the genomic information from the whole genomes, new intra-species taxonomic targets, and species and strain-specific targets will be identified and will eventually decode pathogenic and virulent mechanisms shaping these organisms. Genome analyses have already recognised varied states of reductive evolution within the Chlamydiaceae. For example, C. caviae GPIC has an almost complete set of tryptophan biosynthesis

- 40 - Chapter 2: Literature Review

Table 3. Chlamydiaceae genome features with suspected host and niche specific genes

Protein Genome Toxin Species coding Tryptophan metabolism Plasmid size (bp) genes sequences

C. pneumoniae AR39 1229853 1052 tph Absent Absent

C. pneumoniae CWL029 1230230 1073 Tph Absent Absent

C. pneumoniae J138 1226565 1072 Tph Absent Absent

C. pneumoniae TW183 1225935 1113 Tph Absent Absent

C. pneumoniae LPCoLN 1241024 1095 tph Absent Present

C. felis Fe/C-56 1166239 1005 trpABFCDR, kynU Absent Present

C. caviae GPIC 1173390 1009 trpABFCDR, kynU, prsA, tph Present Present

C. abortus S26/3 1144377 961 Tph Absent Absent

C. muridarum Nigg 1069412 924 None Present Present

C. trachomatis serovar D 1042519 894 trpABCR Present Present

tph, tryptophan hydroxylase; trp, tryptophan biosynthesis; kynU, kynureninase; prsA, ribose-phosphate

pyrophosphokinase.

genes, while C. pneumoniae AR39, CWL029, J138, TW183 and LPCoLN, C.

abortus S26/3 and C. muridarum Nigg do not have any capacity for tryptophan

synthesis or rescue (Read et al., 2000; Read et al., 2003; Thomson et al.,

2005). Conversely, C. trachomatis D and C. felis Fe/C-56 appear to be

undergoing reductive loss (Table 3). Moreover, toxin genes that were present in

the plasticity zones of C. caviae GPIC, C. trachomatis D and C. muridarum Nigg,

are absent from C. pneumoniae AR39, CWL029, J138, TW183 and LPCoLN, C.

felis Fe/C-56, and C. abortus S26/3 genomes (Table 3) (Kalman et al., 1999;

Read et al., 2000; Azuma et al., 2006). Chlamydial genome sequencing has

enabled the detection of core genome components including, conserved and

hypervariable regions. The latter regions include species-specific deletions,

insertions, duplications, re-arrangements or are the result of gene decay.

Information derived from the sequenced genomes will help to circumvent some

- 41 - Chapter 2: Literature Review of the molecular challenges of Chlamydia, enabling researchers to decipher genes that may be involved in host tropism, pathogenicity and virulence, and identify new target genes for clinical intervention.

2.7.1 Comparative analysis of Chlamydia pneumoniae human genomes

Despite the widespread prevalence of C. pneumoniae in humans, all human isolates (studied to date) are extremely well-conserved at the DNA level. With the availability of four C. pneumoniae human genomes (AR39 - Read et al.,

2000; CWL029 - Kalman et al., 1999; J138 - Shirai et al., 2000, and; TW183 -

Geng et al., 2003), it became evident that the C. pneumoniae genomes are highly conserved in gene order and organisation and share greater than 99.9% sequence identity, with few deletions and less than 300 single nucleotide polymorphisms (SNPs) distinguishing the genomes (Read et al., 2000). The physical size of the C. pneumoniae human genome ranges from approximately

1,225,935 bp to approximately 1,230,230 bp, with an average G + C content of

40.6%. Several of the variable genes are located within the plasticity zone, a hypervariable genomic region ranging from 24-28 genes with evidence of gene fragmentation, truncation and decay particularly within the encoding hypothetical proteins AR39 587-591 and AR39 601-605 (Figure 5).

The foremost obstacle in the genomics revolution has been the large number of genes with unknown function, referred to as hypothetical genes. The hypothetical genes represent genes that do not have sufficient homology to other bacterial genes and therefore possibly encode niche or host specific proteins (Delcher et al., 1999). The most notable polymorphisms from other genomic regions were evident in the tyrosine transport protein and polymorphic outer membrane protein pmpG6 genes, with 1, 649 bp and 393 bp deletions, respectively, in the tandem repeat region (Read et al., 2000). Additionally, a

- 42 - Chapter 2: Literature Review

hypothetical conserved conserved putative conserved conserved hypothetical hypothetical dinelacton pfk accB accC MAC/perforin hypothetical lipoprotein hypothetical hypothetical hyrdrolase

689 688 687 686 685 684683 682 681 680 679 678 677 676 675

Koala LPCoLN

588 590 585 586 587 589 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611

Human AR39

180 178 183 182 181 179 177 176 175 174 173 172 171 170 169 168 167 166 165 164 163 162 161 160

Human CWL029

180 178 183 182 181 179 177 176 175 174 173 172 171 170 169 168 167 166 165 164 163 162 161 160

Human J138

183 181 186 185 184 182 180 179 178 177 176 175 174 173 172 171 170 169 168 167 166 165 164 163 162 161

Human TW183

Figure 5. Human Chlamydia pneumoniae plasticity zone. The four C. pneumoniae human isolates are highly conserved in gene order and organisation, with minimal evidence of divergence. Upon comparison with koala LPCoLN there is evidence of gene loss, fragmentation and gene decay. Genes are labelled with the published locus numbers C. pneumoniae LPCoLN (CPK), AR39 (CP), CWL029 (CPn) J138 (Cpj) and TW183 (CpB). Role categories and colours are as follows: fatty acid and phospholipid metabolism, magenta; conserved hypothetical proteins, blue; cell envelope, light green; hypothetical proteins, black; biosynthesis of purines, pyrimidines, nucleosides, and nucleotides, orange; energy metabolism, light gray; Lines connect homologs.

- 43 - Chapter 2: Literature Review novel 4,524 bp circular single-stranded DNA bacteriophage was identified solely in the human AR39 genome (Read et al., 2000). Evolutionary insight is difficult without the aid of a C. pneumoniae animal genome, although the near clonality of C. pneumoniae human isolates that are temporally and geographically separate at this point, would suggest that the present human strain is the result of a recent transfer to humans from another host (Rattei et al., 2007).

2.7.2 Characterisation of Chlamydia pneumoniae animal isolates at several gene loci: 16S and 23S rRNA, ompA, omcB and groESL

The last decade has seen the emergence of many animal C. pneumoniae isolates from a diverse range of hosts. Despite the clinical importance of C. pneumoniae, few comparisons between human and animal isolates have been made. While there have been some previous genetic studies on the C. pneumoniae animal isolates, these have generally been restricted to partial sequencing of the three genes, 16S ribosomal rRNA, ompA encoding the major outer membrane protein and omcB encoding a large cysteine rich outer membrane protein (Glassick et al., 1996; Wardrop et al., 1999; Berger et al., 1999; Hotzel et al., 2001).

Occasional sequencing of the 16-23S spacer region and the groESL gene encoding a heat schock protein has led to limited evolutionary insight. Unlike the

C. pneumoniae human isolates that are practically clonal, a comparison of the amphibian (GBF from Australia and DE177 from Africa), horse (N16 from the

United Kingdom) and koala (LPCoLN from Australia) isolates revealed genetic differences/polymorphisms among them (Berger et al., 1999; Hotzel et al.,

2001). The partial sequence analysis of these isolates revealed that the koala

LPCoLN and frog GBF isolates were identical in sequence and were more closely related to the frog DE177 isolate. By comparison, the horse N16 isolate (and human isolate) had several dissimilarities in the 5 genomic regions examined

(Hotzel et al., 2001). Thus, the dissimilarities of horse N16 may justify

- 44 - Chapter 2: Literature Review placement in to a separate subspecies of C. pneumoniae (Pettersson et al.,

1997). Genome sequence analysis of an animal C. pneumoniae strain will open

doors for new gene selection approaches, as well as improving diagnostics and

our evolutionary understanding of this widespread pathogen.

2.7.3 Gene gain and gene loss in Chlamydia pneumoniae human

The availability of several chlamydial genomes has facilitated an understanding

of gene gain and gene loss across species. Each species has a uniquely tailored

set of genes thought to be responsible for survival, pathogenicity and adaptation

to a particular niche. The Chlamydiaceae have made several adjustments to their

genomes by removing non-essential genes that are no longer required for

establishing an infection, or non-essential genes endogenously supplied by the

host, thus conserving energy expenditure in a process of reductive co-evolution.

One of the significant genome modifications within the Chlamydiaceae Family

has been the complete or almost complete loss of the tryptophan biosyntheis

operon.

2.7.3.1 Tryptophan biosynthesis operon

Tryptophan is an essential amino acid required for ‘normal’ chlamydial

development and its metabolism is a contributor to persistence and tissue

tropism (Fehlner-Gardiner et al., 2002; Caldwell et al., 2003; Akers and Tan,

2006). The ability to synthesise tryptophan is not universal in the family

Chlamydiaceae since the tryptophan biosynthesis operon is missing and in the

process of decay from several chlamydial species (Table 3), including C.

muridarum, C. abortus and all C. pneumoniae strains (Figure 6) (Kalman et al.,

1999; Read et al., 2000; Read et al., 2003; Thomson et al., 2005) analysed so

far. The absence of this operon suggests that these species must acquire

- 45 - Chapter 2: Literature Review

Figure 6. Pathways for the biosynthesis of tryptophan. de novo tryptophan biosynthesis from chorismate requires several enzymes acting in sequence. C. pneumoniae, C. abortus and C. muridarum lack all tryptophan biosynthesis genes, while C. felis (trpABFCDR), C. caviae (trpABFCDR) and C. trachomatis (trpABCR) encode many genes for tryptophan biosynthesis. Genes located in the chlamydial plasticity zone are highlighted in bold. Adapted from Fehlner-Gardiner et al., 2002 and

Woods et al., 2002.

tryptophan from their host (Thomson et al., 2005; Akers and Tan, 2006). The selective loss of genes required for tryptophan biosynthesis (Figure 6) is significant because the pro-inflammatory cytokine interferon-γ (IFN-γ) is one of the host’s defenses against chlamydial infection. IFN-γ modulates intracellular depletion of tryptophan through the induction of indoleamine 2,3-dioxygenase, depriving the chlamydiae of tryptophan and thus causing cell cycle arrest by inhibiting secondary differentiation into EBs (Dai and Gupta, 1990; Thomson et al., 2005). If proteins involved in tryptophan biosynthesis would enable

- 46 - Chapter 2: Literature Review chlamydiae to escape IFN-γ defenses and thus, establish a persistent infection,

then why have C. pneumoniae isolates lost the capacity to synthesise

tryptophan? Mammals are auxotrophic for tryptophan and obtain the amino acid

through dietary sources and microflora that can produce it de novo (Caldwell et al., 2003). Thus, C. pneumoniae must obtain tryptophan or indole from the host environment or from symbiotic microorganisms. Several microflora of the respiratory, ocular and urogenital tract produce indole, including

Peptostreptococcus species, Bacteroides species, Escherichia coli, and

Fusobacterium species, and could potentially supply C. pneumoniae with this exogenous indole (Caldwell et al., 2003). Presumably there was no strong evolutionary pressure to retain tryptophan operons as the environment must be able to provide sufficient amounts to support the growth and persistence of this pathogen.

2.7.4 The cryptic chlamydial plasmid

Plasmids are extrachromosomal genetic elements identified in many bacteria, including Chlamydia (Lovett et al., 1980; Thomas et al., 1997) (Table 3). Under most circumstances, they are not essential for survival within the host. Often, the plasmid will comprise genes that allow the bacterium to compete more successfully in adverse environments (Mikesell and Knudson, 1982). Several bacterial plasmids have been shown to encode toxins, exemplified in Bacillus anthracis (Mikesell et al., 1983) and Clostridium botulinum (Eklund et al., 1988) and/or confer antibiotic resistance, illustrated by Salmonella enterica (Wiesner et al., 2009), Vibrio species, Citrobacter species and Enterobacter species (Toranzo et al., 1984). A chlamydial plasmid is found in virtually all C. trachomatis isolates, C. pneumoniae N16 and LPCoLN, C. felis Fe/C-56, C. caviae GPIC, and

C. muridarum MoPn isolates (Thomas et al., 1997; Read et al., 2003; Pickett et al., 2005; Azuma et al., 2006). The chlamydial plasmids are highly conserved

- 47 - Chapter 2: Literature Review and consist of eight open reading frames (ORFs), designated ORF1 to ORF8

(Thomas et al., 1997). Although the function of these ORFs has been hampered by the lack of a genetic system for Chlamydia, in silico prediction of gene function and sequence homology analyses suggest that ORF1 and ORF2 are likely to encode proteins involved in plasmid replication, ORF3 is likely to encode a helicase involved in unwinding double-stranded DNA during replication, ORF 4 has an unknown function, ORF 5 may contribute to chlamydial pathogenesis, due the stimulation of macrophages to release inflammatory cytokines (Li et al.,

2008), ORF 6 has an unknown function, ORF 7 and ORF 8 are likely to encode proteins involved in the regulation of partitioning and copy number (Thomas et al., 1997).

C. trachomatis isolates generally encode a 7.5 kilo bp plasmid and eight ORFs, with less than 1% nucleotide sequence variation differentiating them (Thomas et al., 1997). However, Seth-Smith et al. (2009) recently described a plasmid

(pSW2) with a 377 bp deletion in the first predicted coding sequence (ORF1), resulting in the smallest chlamydial plasmid identified to date. This variant, obtained from a genital tract strain from Sweden had been previously undetected in routine diagnostic testing due to the 377 bp mutation that was located at the site of PCR detection (Seth-Smith et al., 2009).

Previously, the smallest chlamydial plasmid (pCpnE1) was from a horse N16 isolate of C. pneumoniae (Thomas et al., 1997). The horse N16 and koala

LPCoLN (recently identified; Myers et al., 2009) isolates are the only C. pneumoniae isolates known to encode a plasmid, as no plasmid was identified in any of the four C. pneumoniae human isolates (AR39, CWL029, J138 and

TW183) that have had their genome sequenced. The relationship between the horse N16 and koala LPCoLN plasmids is yet to be determined. While the C. pneumoniae N16 plasmid shares some similarity to other chlamydial plasmids,

- 48 - Chapter 2: Literature Review

ORF1, encoding a putative replication protein is truncated due to an internal deletion and, as a result, the horse N16 ORF1 gene is incorporated into two separate ORFs (ORF1a and ORF1b) relative to other chlamydial plasmids

(Thomas et al., 1997). Pickett et al. (2005) showed that the C. pneumoniae horse N16 plasmid had significantly lower copy numbers (~1.3 plasmids per chromosome) than that of C. trachomatis (~4.0 plasmids per chromosome), suggesting that the product of C. pneumoniae horse N16 ORF1 was not essential

for plasmid replication (Pickett et al., 2005). Although the characterisation of plasmid function has been impeded by the lack of a genetic system for

Chlamydia (Stephens RS, 1993; Thomas et al., 1997), its presence in an animal strain of C. pneumoniae may be an advantage in an unfavorable host environment, thereby, assisting the expansion of its long-term host range.

2.8U Typing of Chlamydia

Bacterial typing is important for detection and control during epidemic and endemic outbreaks, and in understanding the routes of transmission, particularly

when there is worldwide occurrence of infection and disease. Over the years,

many different approaches have been used for typing Chlamydia, including egg

yolk sac inoculation, microimmunofluouresence, Polymerase Chain Reaction

(PCR) and Restriction Fragment Length Polymorphism (RFLP), Pulsed Field Gel

Electrophoresis (PFGE), PCR and sequencing, and Multi Locus Sequence Typing

(MLST).

2.8.1 Egg yolk sac inoculation

In 1963, Wang and Grayston described a test for serological identification of C.

trachomatis by inoculating egg yolk sacs with trachoma inclusion conjunctivitis

organisms and intravenously injecting mice with the extract. The mice were

- 49 - Chapter 2: Literature Review intravenously challenged with the same or other chlamydial isolates and a protective mechanism was observed in mice receiving the same isolate during the challenge (Wang and Grayston, 1963). In 1986, Kuo et al. reported that

TWAR (C. pneumoniae) organisms grew poorly in egg yolk sac inoculation studies and intravenous, intranasal and intracerebral inoculation of mice demonstrated low virulence.

2.8.2 Microimmunofluoresence

Antigenic microimmunofluoresence (MIF) tests have been used to determine the genetic diversity within chlamydial isolates. MIF, however, is expensive, especially for large-scale epidemiological studies and cross-reactivity to other species has hindered its application (Wong et al., 1999; Perez-Martinez and

Storz, 1985). Monoclonal antibodies later replaced polyclonal antibodies, the former showing type, subspecies and species-specific reactivity (Stephens et al.,

1982; Zhang et al., 1989).

2.8.3 Polymerase Chain Reaction (PCR) and Restriction Fragment Length

Polymorphism (RFLP)

Genotyping by RFLP analysis of the PCR-amplified ompA and omp2 (major outer membrane protein genes, variable domains 1 and 2) genes was applied for detection and identification of Chlamydiaceae, whereby the PCR products were digested and the DNA patterns were resolved on polyacrylamide gels (Morre et al., 1998; Hartley et al., 2001). This typing method is simple, rapid and useful for epidemiological studies (Frost et al., 1991; Rodriguez et al., 1993).

2.8.4 Pulsed Field Gel Electrophoresis (PFGE)

- 50 - Chapter 2: Literature Review

PFGE allows extremely large DNA fragments to be resolved and is often used for genotyping bacteria. A limiting factor of this technique is a requirement for pure bacterial DNA, which means culture of the Chlamydia and purification of EBs is

essential to prevent interfering host DNA patterns (Pedersen et al., 2009).

Additionally typing by this method was found to be less discriminatory than

serotyping or ompA genotyping of Chlamydia (Rodriguez et al., 1994).

2.8.5 PCR and sequencing

Ideally, whole genome sequencing would be the preferred method for

genotyping isolates, but, this method is expensive, time consuming and

impractical for fast detection and differentiation of isolates. A more practical

approach is by polymerase chain reaction ‘PCR’ and sequencing, in which genes

from any organism can be detected by PCR amplification of the gene of interest.

One such chlamydial gene target for genotyping has included the 16S rRNA

gene, which is approximately 1, 558 bp in length, and shares greater than 80%

sequence identity across the species (Everett et al., 1999). A hypervariable 16S

rRNA signature sequence was selected for species-specific determination. A

disadvantage of this sequence (as well as other gene sequences) is that it is

difficult to resolve mixed infections due to overlaying peaks in the

chromatograms. Detection and genotyping of chlamydial isolates using the 16S-

23S intergenic spacer has also been applied due to the high intra-species

sequence conservation (Everett et al., 1999). The main target used for

genotyping is the ompA gene. The ompA gene, which encodes a single copy

gene, has five conserved regions and four variable regions (Stephens et al.,

1987; Yuan et al., 1989; Sturm-Ramirez et al., 2000). Unlike the C. trachomatis

ompA gene that flanks several regions of variation, the C. pneumoniae ompA gene is relatively conserved and genotyping isolates is not as discriminate. With the availability of whole chlamydial genomes, it is now possible to identify new

- 51 - Chapter 2: Literature Review molecular marker sets of genes for inter and intra-species genotyping.

2.8.6 Multi Locus Sequence Typing (MLST)

MLST utilises a set of seven house-keeping genes of approximately 400-500 bp for accurate sequencing of both strands. An allele is assigned to each house- keeping gene of the seven loci, and an allelic profile ‘sequence type’ is assigned to each isolate (Aanensen and Spratt, 2005). The selected house-keeping genes are ‘known’ to be genetically stable, and thus, are suitied for long-term, global and epidemiology studies (Pedersen et al., 2008). Several MLST approaches for genotyping C. trachomatis isolates have been proposed in the literature

(including Klint et al., 2007, Pannekoek et al., 2008 and Dean et al., 2009). A

MLST system for C. trachomatis was achieved based on five target genes: hctB,

CT058, CT144, CT172 and pbpB, and compared with ompA (Klint et al., 2007). A set of 47 C. trachomatis isolates (14 serotype D, 12 serotype E, 11 serotype G, and 10 serotype K) were analysed, and 37 variants were detected by MLST, while only 12 ompA variants were detected (Klint et al., 2007).

Pannekoek and colleagues (2008) used MLST of seven genes (enoA, fumC, gatA, gidA, hemN, hlfX, and oppA) on a collection of isolates from C. trachomatis (n=

26) and C. pneumoniae (n= 18). C. pneumoniae formed a uniform group, while three coherent clonal complexes were observed among the C. trachomatis strains. The authors concluded that the genetic variation between C. trachomatis and C. pneumoniae was in concordance with a later assimilation to the C. pneumoniae human host (Pannekoek et al., 2008). In 2009, a comparative genomics approach was used in order to select conserved C. trachomatis house- keeping genes (glyA, mdhC, pdhA, yhbG, pykF, lysS, and leuS), for the characterisation of 19 reference and 68 clinical isolates from six geographical regions (Dean et al., 2009). Fourty four sequence types were identified among

- 52 - Chapter 2: Literature Review the 87 isolates; 30 of which were represented by a single isolate. Several isolates from diverse geographic regions shared the same sequence type, while

trachoma isolates were restricted by continent. Phylogeny of the isolates

revealed three disease clusters, including invasive lymphogranuloma venereum strains, globally prevalent non-invasive strains, and non-prevalent strains (with a trachoma subcluster). This MLST approach may prove useful in the detection of diverse and emerging C. trachomatis strains from populations worldwide (Dean et al., 2009). However, the drawback to MLST is that sufficient numbers of isolates are required in order to differentiate the circulating types.

2.8.7 Variable Number of Tandem Repeats (VNTR)

VNTRs are stretches of DNA in which a short tandemly repeated nucleotide

sequence or motif is repeated. Thus, this form of typing is suitable for short-

term, local epidemiology (Pedersen et al., 2008). Pedersen and colleagues

(2008) developed a method for genotyping C. trachomatis isolates using PCR,

sequencing (ompA) and three VNTR loci (CT1335, CT1299, and CT1291)

(Pedersen et al., 2008). The authors investigated four groups of isolates: Group

I and II - C. trachomatis-postive patients (and their partners); Group III – patients with recurrent / persistent C. trachomatis infections, and; Group IV – new variant (nvCT) C. trachomatis isolates with a 377-bp deletion in the cryptic plasmid. The main findings were that different genotypes were found among

Group I isolates (self-reported partners) even at the ompA level, whereas the majority of Group II isolates (mutual postal address) shared the same ompA-

VNTR genotype. VNTR analysis of Group III isolates showed that the VNTRs were stable and could be valuable in epidemiological investigations, while Group IV isolates showed that the evolution of VNTRs were progressing. The authors propose that with this novel VNTR method, C. trachomatis isolates may be

- 53 - Chapter 2: Literature Review differentiated and an epidemiological association established (Pedersen et al.,

2008).

Multiple loci variable nuber of tandem repeats (VNTR) analysis (MLVA) has also been applied in order to explore the diversity among C. psittaci and C. abortus isolates (Laroucau et al., 2008 and 2009). Laroucau et al. (2008) selected 20 genetic loci for the analysis of nine avian reference C. psittaci strains from serotypes A-F. Thereafter, eight loci were retained for the analysis of 150 C. psittaci isolates from diverse geographical origins and different species of birds.

The MLVA method was highly sensitive and was considered as a high-resolution test that was able to differentiate C. psittaci isolates from diverse origins

(Laroucau et al., 2008). More recently, Laroucau et al. (2009) selected 34 genetic loci and 34 ruminant strains, and confirmed that C. abortus was a homogenous group. Additionally, the authors analysed 111 samples and five genetic loci, which enabled them to identify six C. abortus prototypes. Three of the loci had variation among genotypes, evident by the presence or absence of coding tandem repeats. Overall, the authors were able to differentiate the origin of isolates (as with C. psittaci), which is important for molecular epidemiological studies (Laroucau et al., 2009).

2.9U Concluding remarks

Chlamydiae are successful pathogens with discrete biological properties to enable efficient colonisation of mucosal surfaces, growth and division within a wide range of animal and human hosts, escape from host defences, management of the supply of essential nutrients, and the establishment of an infection. In recent years, there have been remarkable advances in methods for characterising chlamydiae, and whole-genome sequencing has already had a significant impact on our understanding of the natural history of species to their

- 54 - Chapter 2: Literature Review hosts, and pathogenic diversity across strains. The accumulated information and increasing knowledge of intra- and inter-species diversity gives hope that the not too distant future will see the identification and improvement of novel molecular targets for vaccine design and therapeutic intervention.

- 55 - Chapter 2: Literature Review

2.10U References

Aanensen D and Spratt B (2005). The multilocus sequence typing network: mlst.net. Nucleic Acids Research. 33, W728-W733.

Abdelrahman YM and Belland RJ (2005). The chlamydial developmental cycle. FEMS Microbiology Reviews. 29, 949-959.

Airaksinen U, Penttila T, Wahlstrom E, Vuola JM, Puolakkainen M and Sarvas M (2003). Production of Chlamydia pneumoniae proteins in Bacillus subtilis and their use in characterizing immune responses in the experimental infection model. Clinical and Vaccine Immunology. 10, 367-375.

Akers JC and Tan M (2006). Molecular mechanism of tryptophan-dependent transcriptional regulation in Chlamydia trachomatis. Journal of Bacteriology. 188, 4236-4243.

Amann R, Springer N, Schönhuber W, Ludwig W, Schmid EN, Müller KD and Michel R (1997). Obligate intracellular bacterial parasites of acanthamoebae related to Chlamydia spp. Applied and Environmental Microbiology. 63, 115-121.

Andersen AA (1991). Serotyping of Chlamydia psittaci isolates using serovar- specific monoclonal antibodies with the microimmunofluorescence test. Journal of Clinical Microbiology. 29, 707–711.

Andersen AA (1997). Two new serovars of Chlamydia psittaci from North American birds. Journal of Veterinary Diagnostic Investigation. 9, 159–164.

Azuma Y, Hirakawa H, Yamashita A, Cai Y, Rahman MA, Suzuki H, Mitaku S, Toh H, Goto S, Murakami T, Sugi K, Hayashi H, Fukushi H, Hattori M, Kuhara S and Shirai M (2006). Genome sequence of the cat pathogen, Chlamydophila felis. DNA Research. 13, 15-23.

Baker JA (1944). A virus causing pneumonia in cats and producing elementary bodies. The Journal of Experimental Medicine. 79, 159-172.

Balin BJ, Gérard HC, Arking EJ, Appelt DM, Branigan PJ, Abrams JT, Whittum-

- 56 - Chapter 2: Literature Review

Hudson JA and Hudson AP (1998). Identification and localization of Chlamydia pneumoniae in the Alzheimer's brain. Medical Microbiology and Immunology. 187, 23-42.

Barron AL, White HJ, Rank RG, Soloff BL and Moses EB (1981). A new animal model for the study of Chlamydia trachomatis genital infections: infection of mice with the agent of mouse pneumonitis. The Journal of Infectious Diseases. 143, 63–66.

Barry CE, Hayes SF and Hackstadt T (1992). Nucleoid condensation in Escherichia coli that express a chlamydial histone homolog. Science. 256, 377– 379.

Baud D, Thomas V, Arafa A, Regan L and Greub G (2007). Waddlia chondrophila, a potential agent of human fetal death. Emerging Infectious Diseases. 13, 1239– 1243.

Bedson SP, Western GT and Simpson SL (1930). Observations on the aetiology of psittacosis. Lancet. 1, 235-236.

Bedson SP and Bland JOW (1932). A morphological study of psittacosis virus with the description of a developmental cycle. British Journal of Experimental Pathology. 13, 461-466.

Ben-Yaakov M, Eshel G, Zaksonski L, Lazarovich Z and Boldur I (2002). Prevalence of antibodies to Chlamydia pneumoniae in an Israeli population without clinical evidence of respiratory infection. Journal of Clinical Pathology. 55, 355-358.

Berger L, Volp K, Mathews S, Speare R and Timms P (1999). Chlamydia pneumoniae in a free-ranging giant barred frog (Mixophyes iteratus) from Australia. Journal of Clinical Microbiology. 37, 2378-2380.

Binet R and Maurelli AT (2005). Frequency of spontaneous mutations that confer antibiotic resistance in Chlamydia spp. Antimicrobial Agents and Chemotherapy. 49, 2865-2873.

Binet R and Maurelli AT (2009). Transformation and isolation of allelic exchange

- 57 - Chapter 2: Literature Review mutants of Chlamydia psittaci using recombinant DNA introduced by electroporation. Proceedings of the National Academy of Sciences. 106, 292-297.

Bland JOW and Canti RG (1935). The growth and development of psittacosis virus in tissue cultures. Journal of Pathology and Bacteriology. 40, 231-241.

Blasi F, Cosentini R, Denti F, Allegra L (1994). Two family outbreaks of Chlamydia pneumoniae infection. European Respiratory Journal. 7, 102–104.

Bodetti TJ, Jacobson E, Wan C, Hafner L, Pospischil A, Rose K and Timms P (2002). Molecular evidence to support the expansion of the hostrange of Chlamydophila pneumoniae to include reptiles as well as humans, horses, koalas and amphibians. Systematic and Applied Microbiology. 25, 146-152.

Browning GF (2004). Is Chlamydophila felis a significant zoonotic pathogen? Australian Veterinary Journal. 82, 695-696.

Brumpt E (1938). Rickettsia intracellulaire stomacale (Rickettsia culicis N. Sp.) de Culex fatigans. Annales de Parasitologie Humaine et Comparee 16:153-158. In: Page LA (1968). Proposal for the recognition of two species in the genus Chlamydia Jones, Rake, and Stearns (1945). International Journal of Systematic Bacteriology. 18, 51-66.

BuschH H M, Thoma R, Schiller I, Corboz L and Pospischil A (2000). Occurrence of Chlamydiae in the genital tracts of sows at slaughter and their possible significance for reproductive failure. Journal of Veterinary Medicine. B, Infectious Diseases and Veterinary Public Health. 47, 471–480.

Caldwell HD, Wood H, Crane D, Bailey R, Jones RB, Mabey D, Maclean I, Mohammed Z, Peeling R, Roshick C, Schachter J, Solomon AW, Stamm WE, Suchland RJ, Taylor L, West SK, Quinn TC, Belland RJ and McClarty G (2003). Polymorphisms in Chlamydia trachomatis tryptophan synthase genes differentiate between genital and ocular isolates. The Journal of Clinical Investigation. 111, 1757-1769.

Campbell LA, Kuo CC and Grayston JT (1998). Chlamydia pneumoniae and cardiovascular disease. Emerging Infectious Diseases. 4, 571-579.

- 58 - Chapter 2: Literature Review

Campbell LA, Marrazzo JM, Stamm WE and Kuo CC (2001). In: Laboratory diagnosis of bacterial infections. Edited by Cimolai N. New York: Marcel Dekker. pp.795-821.

Carter MW, al-Mahdawi SA, Giles IG, Treharne JD, Ward ME and Clark IN (1991). Nucleotide sequence and taxonomic value of the major outer membrane protein gene of Chlamydia pneumoniae IOL-207. Journal of General Microbiology. 137, 465-475.

Casson N, Michel R, Muller KD, Aubert JD and Greub G (2008). Protochlamydia naegleriophila as etiologic agent of pneumonia. Emerging Infectious Diseases.

14, 168–172.

Cello RM (1971). Microbiological and immunological aspects of feline pneumonitis. Journal of the American Veterinary Medical Association. 158, 932- 938.

Chi EY, Kuo CC and Grayston JT (1987). Unique ultrastructure in the elementary body of Chlamydia sp. strain TWAR. Journal of Bacteriology. 169, 3757-3763.

Chirgwin K, Roblin PM, Gelling M, Hammerschlag MR and Schachter J (1991). Infection with Chlamydia pneumoniae in Brooklyn. The Journal of Infectious Diseases. 163, 757-761.

Chopra I and Roberts M (2001). Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiology and Molecular Biology Reviews. 65, 232-260.

Chua PK, Corkill JE, Hooi PS, Cheng SC, Winstanley C and Hart CA (2005). Isolation of Waddlia malaysiensis, a novel intracellular bacterium, from fruit bat (Eonycteris spelaea). Emerging Infectious Diseases. 11, 271–277.

Clark MA, Baumann L, Munson MA, Baumann P, Campbell BC, Duffus JE, Osborne LS, Moran NA (1992). The eubacterial endosymbionts of whiteflies (Homoptera: Aleyrodoidea) constitute a lineage distinct from the endosymbionts of aphids and mealybugs. Current Microbiology. 25, 119–123.

- 59 - Chapter 2: Literature Review

Clarkson MJ and Philips HL (1997). Isolation of faecal Chlamydia from sheep in Britain and their characterization by cultural properties. The Veterinary Journal. 153, 307-311.

Cles LD and Stamm WE (1990). Use of HL cells for improved isolation and passage of Chlamydia pneumoniae. Journal of Clinical Microbiology. 28, 938– 940.

Cockram FA and Jackson ARB (1974). Isolation of a Chlamydia from cases of keratoconjunctivitis in koalas. Australian Veterinary Journal. 50, 82.

Collingro A, Toenshoff ER, Taylor MW, Fritsche TR, Wagner M and Horn M (2005). ‘Candidatus Protochlamydia amoebophila’, an endosymbiont of Acanthamoeba spp. International Journal of Systematic Evolutionary Microbiology. 55, 1863-1866.

Comanducci M, Ricci S, Cevenini R and Ratti G (1990). Diversity of the Chlamydia trachomatis common plasmid in biovars with different pathogenicity. 23, 149-154.

Constantinescu O and Scott YG (2008). Chlamydophila psittaci in a 48-year-old man with respiratory failure. Hospital Physician. 44, 45-48.

Corsaro D and Greub G (2006). Pathogenic potential of novel Chlamydiae and diagnostic approaches to infections due to these obligate intracellular bacteria. Clinical Microbiology Reviews. 19, 283–297.

Corsaro D, Thomas V, Goy G, Venditti D, Radek R and Greub G (2007). ‘Candidatus Rhabdochlamydia crassificans’, an intracellular bacterial pathogen of the cockroach Blatta orientalis (Insecta: Bltattodea). Systematic and Applied Microbiology. 30, 221-228.

Dai W and Gupta SL (1990). Molecular cloning, sequencing and expression of human interferon-gamma-inducible indoleamine 2,3-dioxygenase cDNA. Biochemical and Biophysical Research Communications. 168, 1–8.

Darougar S, Treharne JD, Dwyer RS, Kinnison JR and Jones BR (1971). Isolation of TRIC agent (Chlamydia) in irradiated McCoy cell culture from endemic

- 60 - Chapter 2: Literature Review trachoma in field studies in Iran. Comparison with other laboratory tests for detection of Chlamydia. British Journal of Ophthalmology. 55, 591–599.

Dean D, Bruno WJ, Wan R, Gomes JP, Devignot S, Mehari T, de Vries HJ, Morré SA, Myers G, Read TD and Spratt BG (2009). Predicting phenotype and emerging strains among Chlamydia trachomatis infections. 15, 1385-1389.

Delcher AL, Kasif S, Fleischmann RD, Peterson J, White O and Salzberg SL (1999). Alignment of whole genomes. Nucleic Acids Research. 27, 2369-2376.

DeLong WJ and Magee WE (1986). Distinguishing between ovine abortion and ovine arthritis Chlamydia psittaci isolates with specific monoclonal antibodies. American Journal of Veterinary Research. 47, 1520-1523.

Devereaux LN, Polkinghorne A, Meijer A and Timms P (2003). Molecular evidence for novel chlamydial infections in the koala (Phascolarctos cinereus). Systematic and Applied Microbiology. 26, 245-253.

Dilbeck PM, Evermann JF, Crawford TB, Ward AC, Leathers CW, Holland CJ,

Mebus CA, Logan LL, Rurangirwa FR and McGuire TC (1990). IsolationH of a

previously undescribed rickettsia from an aborted bovine fetus.H Journal of Clinical Microbiology. 28, 814-816.

Dochez AR, Mills KC and Mulliken B (1937). A virus disease of Swiss mice transmissible by intranasal inoculation. Proceedings of the Society for Experimental Biology and Medicine. 36, 683-86. In: Rank RG (2007). Chlamydial diseases. In: The mouse in biomedical research. Second edition: Diseases. Edited by Fox JG, Newcomer C, Smith A, Barthold S, Quimby F and Davisson M. San Diego: Elsevier Inc. 2, 325-348.

Draghi A II, Popov VL, Kahl MM Stanton JB,, Brown CC, Tsongalis GJ, West AB and Frasca S Jr (2004). Characterization of "Candidatus Piscichlamydia salmonis" (Order Chlamydiales), a Chlamydia-Like Bacterium Associated With Epitheliocystis in Farmed Atlantic Salmon (Salmo salar). Journal of Clinical Microbiology. 42, 5286-5297.

Draghi A II, Bebak J, Popov VL, Noble AC, Geary SJ, West AB, Byrne P and Frasca S Jr (2007). Characterization of a Neochlamydia-like bacterium associated

- 61 - Chapter 2: Literature Review with epitheliocystis in cultured Arctic charr Salvelinus alpinus. Diseases of Aquatic Organisms. 76, 27-38.

Dugan J, Rockey DD, Jones L and Andersen AA (2004). Tetracycline resistance in Chlamydia suis mediated by genomic islands inserted into the Chlamydial inv- like gene. Antimicrobial Agents and Chemotherapy. 48, 3989-3995.

Dwyer RS, Treharne JD, Jones BR and Herring J (1972). Chlamydial infection. Results of micro-immunofluorescence tests for the detection of type-specific antibody in certain chlamydial infections. The British Journal of Venereal Diseases. 48, 452–459.

Eklund MW, Poysky FT, Mseitif LM and Strom MS (1988). Evidence for plasmid- mediated toxin and bacteriocin production in Clostridium botulinum type G.

AppliedH and Environmental Microbiology. H 54, 1405-1408.

Ekman MR, Grayston JT, Visakorpi R, Kleemola M, Kuo CC and Saikku P (1993).

AnH epidemic of infections due to Chlamydia pneumoniae in military conscripts.H Clinical Infectious Diseases. 17, 420-425.

Elkeles G and Barros E (1931). Die Psittakosis. Ergebnisse der Hygiene, Bakteriologie, Immunitätsforschung und experimentellen Therapie. 12, 529-639. In: Recent studies on Psittacosis (1935). Edited by Meyer KF, Eddie B and Stevens IM. American Journal of Public Health and the Nations Health. 25, 571- 579.

Everett KDE, Bush RM and Andersen AA (1999). EmendedH description of the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards for

the identification of organisms.H International Journal of Systematic and Evolutionary Bacteriology. 49, 415-440.

Fehlner-Gardiner C, Roshick C, Carlson JH, Hughes S, Belland RJ, Caldwell HD and McClarty G (2002). Molecular basis defining human Chlamydia trachomatis tissue tropism. The Journal of Biological Chemistry. 277, 26893-26903.

Fields KA and Hackstadt T (2002). The chlamydial inclusion: Escape from the

- 62 - Chapter 2: Literature Review endocytic pathway. Annual Review of Cell and Developmental Biology. 18, 221- 245.

Frost EH, Deslandes S, Veilleux S, Bourgaux-Ramoisy D (1991). Typing Chlamydia trachomatis by detection of restriction fragment length polymorphism in the gene encoding the major outer membrane protein. The Journal of Infectious Diseases. 163, 1103-1107.

Fukushi H and Hirai K (1992). Proposal of Chlamydia pecorum sp. nov. for Chlamydia strains derived from ruminants. International Journal of Systematic Bacteriology. 42, 306–308.

Geens T, Dewitte A, Boon N and Vanrompay D (2005). Development of a Chlamydophila psittaci species-specific and genotype-specific real-time PCR. Veterinary Research. 36, 787–797.

Gencay M, Dereli D, Ertem E, Serter D, Puolakkainen M, Saikku P, the study group: Boydak B, Dereli S, Özbakkaloglu B, Yorgancioglu A and Tez E (1998). Prevalence of Chlamydia pneumoniae specific antibodies in different clinical situations and healthy subjects in Izmir, Turkey. European Journal of Epidemiology. 14, 505-509.

Geng MM, Schuhmacher A, Muehldorfer I, Bensch KW, Schaefer KP, Schneider S, Pohl T, Essig A, Marre R and Melchers K (2003). The genome sequence of Chlamydia pneumoniae TW183 and comparison with other Chlamydia strains based on whole genome sequence analysis. Unpublished 2003, Submitted (MAY- 2002) to the EMBL/GenBank/DDBJ databases.

Gerbase AC, Rowley JT and Mertens TE (1998). Global epidemiology of sexually transmitted diseases. Lancet. 351, 2–4.

Gieffers J, van Zandbergen G, Rupp J, Sayk F, Kruger S, Ehlers S, Solbach W and Maass M (2004). Phagocytes transmit Chlamydia pneumoniae from the lungs to the vasculature. European Respiratory Journal. 23, 506–510.

Girjes AA, Hugall AF, Timms P and Lavin MF (1988). TwoH distinct forms of Chlamydia psittaci associated with disease and infertility in Phascolarctos

cinereus (koala).H Infection and Immunity. 56, 1897-1900.

- 63 - Chapter 2: Literature Review

Girjes AA, Hugall A, Graham DM, McCaul TF, and Lavin MF (1993). ComparisonH of type I and type II Chlamydia psittaci strains infecting koalas (Phascolarctos

cinereus).H Veterinary Microbiology. 37, 65-83.

Glassick TV (1994). A molecular analysis of koala Chlamydia psittaci isolates. Honours thesis. Queensland University of Technology, Infectious Diseases Research Group.

Glassick T, Giffard P and Timms P (1996). Outer membrane protein 2 gene sequence indicates that Chlamydia pecorum and Chlamydia pneumoniae cause infection in koalas. Systematic and Applied Microbiology. 19, 457-464.

Gordon FB, Magruder GB, Quan AL and Arm HG (1963). Cell cultures for detection of trachoma virus from experimental simian infections. Proceedings of the Society for Experimental Biology and Medicine. 112, 236–242.

Gordon FB and Quan AL (1965). Isolation of the trachoma agent in cell culture. Proceedings of the Society for Experimental Biology and Medicine. 118, 354-359.

Gordon FB, Weiss E, Quan AL and Dressler HR (1966). Observations on guinea pig inclusion conjunctivitis agent. The Journal of Infectious Diseases. 116, 203– 207.

Goy G, Croxatto A and Greub G (2008). Waddlia chondrophila enters and multiplies within human macrophages. Microbes and Infection. 10, 556-562.

Grayston JT (1965). Immunisation against trachoma. Pan American Health Organization Scientific Publication. 147, 549.

Grayston JT, Kuo CC, Wang SP and Altman J (1986). A new Chlamydia psittaci strain, TWAR, isolated in acute respiratory tract infections. The New England Journal of Medicine. 315, 161-168.

Grayston JT, Kuo CC, Campbell LA and Wang SP (1989). Chlamydia pneumoniae sp. nov. for Chlamydia sp. Strain TWAR. International Journal of Systematic Bacteriology. 39, 88-90.

Grayston JT, Campbell LA, Kuo CC, Mordhorst CH, Saikku P, Thom DH and Wang

- 64 - Chapter 2: Literature Review

SP (1990). A new respiratory tract pathogen: Chlamydia pneumoniae strain TWAR. The Journal of Infectious Diseases. 161, 618-625.

Grayston JT (2000). Background and current knowledge of Chlamydia pneumoniae and atherosclerosis. The Journal of Infectious Diseaes. 181 (Suppl 3), S402–S410.

Greig JR (1936). Enzootic abortion in ewes; a preliminary note. The Veterinary Record. 48, 1225-1227.

Greub G and Raoult D (2002). Parachlamydiaceae: potential emerging pathogens. Emerging Infectious Diseases. 8, 625–630.

Greub G (2009). Parachlamydia acanthamoebae, an emerging agent of pneumonia. Clinical Micriobiology and Infection. 15, 18-28.

Gruffydd-Jones T, Addie D, BelákH S,H Boucraut-Baralon C, EgberinkH H,H FrymusH T,H

HartmannH K,H HosieH MJ,H LloretH A,H LutzH H,H MarsilioH F,H PennisiH MG,H RadfordH AD,H ThiryH

E,H TruyenH U H and HorzinekH MC H (2009). Chlamydophila felis infection ABCD guidelines on prevention and management. Journal of Feline Medicine and Surgery. 11, 605-609.

Gutter B, Asher Y, Cohen Y and Becker Y (1973). Studies on the developmental cycle of Chlmaydia trachomatis: isolation and characterization of the initial bodies. Journal of Bacteriology. 115, 691-702.

Hackstadt T (1999). In: Chlamydia: Intracellular biology, pathogenesis, and immunity. Edited by Stephens RS. Washington DC: The American Society for Microbiology. pp.101-138.

Hagiwara K, Ouchi K, Tashiro N, Azuma M and Kobayashi K (1999). An epidemic of a pertussis-like illness caused by Chlamydia pneumoniae. The Pediatric Infectious Disease Journal. 18, 271-275.

Halberstaedter L and von Prowasek S (1907). Zur Atiologie des Trachoms. Deutsche Medizinische Wochenschrift. 33, 1285-1287.

Hallsworth PG, Wesselingh SL and McDonald PJ (1992). Development of an

- 65 - Chapter 2: Literature Review enzyme immunoassay to detect antibody to Chlamydia pneumoniae strain TWAR and its application in a limited seroepidemiological survey. Pathology. 24, 87-90.

Hammerschlag MR (2002). The intracellular life of chlamydiae. Seminars in Pediatric Infectious Diseases. 13, 239-248.

Hammerschlag MR (2004). Chlamydia trachomatis and Chlamydia pneumoniae infections in children and adolescents. Pediatrics in Review. 25, 43-51.

Hartley JC, Kaye S, Stevenson S, Bennett J and Ridgway G (2001). PCR detection and molecular identification of Chlamydiaceae species. Journal of Clinical Microbiology.39, 3072-3079.

Harkinezhad T, Verminnen K, Van Droogenbroeck C and Vanrompay D (2007). Chlamydophila psittaci genotype E/B transmission from African grey parrots to humans. Journal of Medical Microbiology. 56, 1097-1100.

Hatch TP, Allan I and Pearce JH (1984). Structural and polypeptide differences between envelopes of infective and reproductive life cycle forms of Chlamydia spp. Journal of Bacteriology. 157, 13-20.

Henning K, Schares G, Granzow H, Polster U, Hartmann M, Hotzel H, Sachse K, Peters M and Rauser M (2002). Neospora caninum and Waddlia chondrophila strain 2032/99 in a septic stillborn calf. Veterinary Microbiology. 85, 285–292.

Heuer D, Kneip C, Maurer AP and Meyer TF (2007). Tackling the intractable – approaching the genetics of Chlamydiales. International Journal of Medical Microbiology. 297, 569-576.

Hickey DK, Jones RC, Bao S, Blake AE, Skelding KA, Berry LJ and Beagley KW (2004). Intranasal immunization with C. muridarum major outer membrane protein (MOMP) and cholera toxin elicits local production of neutralising IgA in the prostate. Vaccine. 22, 4306-4315.

Hogan RJ, Mathews SA, Kutlin A, Hammerschlag M and Timms P (2003). Differential expression of genes encoding membrane proteins between acute and continuous Chlamydia pneumoniae infections. Microbial Pathogenesis. 34, 11-16.

- 66 - Chapter 2: Literature Review

Horn M, Wagner M, Müller KD, Schmid EN, Fritsche TR, Schleifer KH and Michel R (2000). Neochlamydia hartmannellae gen. nov., sp. nov. (Parachlamydiaceae), an endoparasite of the amoeba Hartmannella vermiformis. Microbiology. 146, 1231-1239.

Hotzel H, Grossmann E, Mutschmann F and Sachse K (2001). Genetic characterization of a Chlamydophila pneumoniae isolate from an African frog and comparison to currently accepted biovars. Systematic and Applied Microbiology. 24, 63-66.

Huang J, Lesser CF and Lory S (2008). The essential role of the CopN protein in Chlamydia pneumoniae intracellular growth. Nature Letters. 456, 112-115.

Jackson M, White N, Giffard P and Timms P (1999). Epizootiology of Chlamydia infections in two free-range koala populations. Veterinary Microbiology. 65, 255– 264.

Jenkins SG, Woods GL and Dumler JS (2002). Chlamydia, Mycoplasma, and Rickettsia. In: Clinical laboratory medicine. Edited by McClatchey KD. Philadelphia: Lippincott Williams and Wilkins. p.1157.

Jones H, Rake G and Stearns B (1945). Studies on lymphogranuloma venereum. III. The action of the sulfonamides on the agent of lymphogranuloma venereum. The Journal of Infectious Diseases. 76, 55-69.

Jones GE and Anderson IE (1988). Chlamydia psittaci: is tonsillar tissue the portal of entry in ovine enzootic abortion? Research in Veterinary Science. 44, 260-261.

Kahane S, Metzer E and Friedman MG (1995). Evidence that the novel microorganism 'Z' may belong to a new genus in the family Chlamydiaceae. FEMS Microbiology Letters. 126, 203-207.

Kahane S, Greenberg D, Friedman MG, Haikin H and Dagan R (1998). HighH prevalence of "Simkania Z," a novel Chlamydia-like bacterium, in infants with

acute bronchiolitis.H The Journal of Infectious Diseases. 177, 1425-1429.

Kalman S, Mitchell W, Marathe R, Lammel C, Fan J, Hyman RW, Olinger L,

- 67 - Chapter 2: Literature Review

Grimwood J, Davis RW and Stephens RS (1999). Comparative genomes of Chlamydia pneumoniae and C. trachomatis. Nature Genetics. 21, 385-389.

Karr HV (1943). Study of a latent pneumotropic virus of mice. The Journal of Infectious Diseases. 72, 108-116. In: Rank RG (2007). Chlamydial diseases. In: The mouse in biomedical research. Second edition: Diseases. Edited by Fox JG, Newcomer C, Smith A, Barthold S, Quimby F and Davisson M. San Diego: Elsevier Inc. 2, 325-348.

Kaukoranta-Tolvanen SS, Laurila AL, Saikku P, Leinonen M, Liesirova L and Laitinen K (1993). Experimental infection of Chlamydia pneumoniae in mice. Microbial Pathogenesis Journal. 15, 293-302.

Kiel JAKW, Boels JM, Beldman G and Venema G (1994). Glycogen in Bacillus subtilis: molecular characterization of an operon encoding enzymes involved in glycogen biosynthesis and degradation. Molecular Microbiology. 11, 203-218.

Kleemola M, Saikku P, Visakorpi R, Wang SP and Grayston JT (1988). EpidemicsH of pneumonia caused by TWAR, a new Chlamydia organism, in military trainees

in Finland.H The Journal of Infectious Diseases. 157, 230–236.

Klint M, Fuxelius HH, Goldkuhl RR, Skarin H, Rutemark C, Andersson SGE, Persson K and Herrmann B (2007). High-resolution genotyping of Chlamydia trachomatis strains by multilocus sequence analysis. Journal of Clinical Microbiology. 45, 1410-1414.

Koh WP, Taylor MB, Hughes K, Chew SK, Fong CW, Phoon MC, Kang KL and Chow VTK (2002). Seroprevalence of IgG antibodies against Chlamydia pneumoniae in Chinese, Malays and Asian Indians in Singapore. International Epidemiological Association. 31, 1001-1007.

Kornfeld S and Mellman I (1989). The biogenesis of lysosomes. Annual Review of Cell and Developmental Biology. 5, 483–525.

Kostanjek R, Strus J, Drobne D and Avgutin G (2004) Candidatus Rhabdochlamydia porcellionis’, an intracellular bacterium from the hepatopancreas of the terrestrial isopod Porcellio scaber (Crustacea: Isopoda). International Journal of Systematic and Evolutionary Microbiology. 54, 543-549.

- 68 - Chapter 2: Literature Review

Kuo CC, Chen HH and Wang SP (1986). Identification of a new group of Chlamydia psittaci strains called TWAR. Journal of Clinical Microbiology. 24, 1034–1037.

Kuo CC and Grayston JT (1990). Amino acid requirements for growth of Chlamydia pneumoniae in cell cultures: growth enhancement by lysine or methionine depletion. Journal of Clinical Microbiology. 28, 1098-1100.

Kutlin A, Roblin PM, Kumar S, Kohlhoff S, Bodetti T, Timms P and Hammerschlag MR (2007). Molecular characterization of Chlamydophila pneumoniae isolates from Western barred bandicoots. Journal of Medical Microbiology. 56, 407-417.

Lamoth F, Aeby S, Schneider A, Jaton-Ogay K, Vauaux B and Greub G (2009). Parachlamydia and Rhabdochlamydia in premature neonates. Emerging Infectious Diseases. 15, 2072-2075.

Laroucau K, Thierry S, Vorimore F, Blanco K, Kaleta E, Hoop R, Magnino S, Vanrompay D, Sachse K, Myers GSA, Bavoil PM, Vergnaud G and Christine Pourcel (2008). High resolution typing of Chlamydophila psittaci by multilocus VNTR analysis (MLVA). Infection, Genetics and Evolution. 8, 171-181.

Laroucau K, Vorimore F, Bertin C, Mohamad KY, Thierry S, Hermann W, Maingourd C, Pourcel C, Longbottom D, Magnino S, Sachse K, Vretou E, Rodolakis A (2009). Genotyping of Chlamydophila abortus strains by multilocus VNTR analysis. 137, 335-344.

Lee SJ, Nam EC, Won J, Park WS, Kim WJ, Han SS and Choi DJ (2003). Characterization of the first Korean isolate of a Chlamydia pneumoniae strain. Japanese Journal of Infectious Diseases. 56, 62-64.

Lefevre JC and Lepargneur JP (1998). Comparative in vitro susceptibility of a tetracycline-resistant Chlamydia trachomatis strain isolated in Toulouse (France). Journal of Sexually Transmitted Diseases. 25, 350-352.

Li Z, Chen D, Zhong Y, Wang S and Zhong G (2008). The chlamydial plasmid- encoded protein pgp3 is secreted into the cytosol of Chlamydia-infected cells. Infection and Immunity. 76, 3415-3428.

- 69 - Chapter 2: Literature Review

Lieberman D, Kahane S, Lieberman D and Friedman MG (1997). Pneumonia with serological evidence of acute infection with the Chlamydia-like microorganism 'Z'. American Journal of Respiratory and Critical Care medicine. 156, 578–82.

Lindner K, Trachomforschung Z and Augenheilkd Z (1909). Title unknown. 22, 547-549. In: Bacterial infections of Humans: Epidemiology and Control (1998). Edited by Evans A and Brachman P. New York: Plenum Medical Book Company. p.220.

Longbottom D and Coulter LJ (2003). Animal chlamydioses and zoonotic implications. Journal of Comparative Pathology. 128, 217-244.

Lovett M, Kuo KK, Holmes K and Falkow S (1980). Plasmids of the genus Chlamydia. In: Current chemotherapy and infectious diseases. Edited by Nelson J and Grassi C. Washington, DC: American Society for Microbiology. 2, 1250- 1252.

Lutz-Wohlgroth L, Becker A, Brugnera E, Huat ZL, Zimmermann D, Grimm F Haessig M, Greub G, Kaps S, Spiess B, Pospischill A and Vaughan L (2006). Chlamydiales in guinea-pigs and their zoonotic potential. Journal of Veterinary Medicine Series A – Physiology Pathology Clinical Medicine. 53, 185–93.

Matsumoto T, Matsumura K, Anwar KS, Mollah AH, Murakami H, Kobayashi I, Kawagoe K, Shiga S, Kishimoto T, Nahar N, Tateda K and Yamaguchi K (2006). Prevalence of Chlamydophila pneumoniae among Bangladeshi children under age 5 years with acute respiratory infections. Journal of Infection and Chemotherapy. 12, 139-144.

McColl KA, Martin RW, Gleeson LH, Handasyde KA and Lee AK (1984). Chlamydia infection and infertility in the female koala (Phascolarctos cinereus). Veterinary Record. 115, 655.

McNutt SH and Waller EF (1940). Sporadic bovine encephalomyelitis (Buss disease). Cornell Veterinarian. 30, 437-448.

McOrist S (2000). ObligateH intracellular bacteria and antibiotic resistance.H Trends in Microbiology. 8, 483-486.

- 70 - Chapter 2: Literature Review

Meyer KF (1953). Psittacosis Group. Annals of the New York Academy of Sciences. 56, 545-556.

Michel R, Hauröder-Philippczyk B, Müller KD and Weishaar I (1992). Observations on acanthamoebae from nasal mucosa infected by obligate intracellular parasites. Zentralbl Bakteriol Hyg. 325, 56.

Michel R, Müller KD and Schmid EN (1995). Ehrlichia-like organisms (KSL1) observed as obligate intracellular parasites of Saccamoeba species. Endocytobiosis Cell Research. 11, 69-80.

Mikesell P and Knudson GB (1982). Plasmids of Legionella species. Army Medical Research Institute of Infectious Diseases. pp.1-8.

MikesellH P,H Ivins BE, Ristroph JD and Dreier TM (1983). Evidence for plasmid- mediated toxin production in Bacillus anthracis. Infection and Immunity. 39, 371-376.

Miller MA, Turk JR, Nelson SL, Van der Lek AP, Solorzano R, Fales W, Morehouse LG and Gosser HS (1990). Chlamydial infection in aborted and stillborn lambs. Journal of Veterinary Diagnostic Investigation. 2, 55-58.

Mitchell SL, Wolff BJ, Thacker WL, Ciembor PG, Gregory CR, Everett KDE, Ritchie BW and Winchell JM (2009). Genotyping of Chlamydophila psittaci by Real-Time PCR and High-Resolution Melt Analysis. Journal of Clinical Microbiology. 47, 175- 181.

Miyashita N, Kishimoto T, Soejima R and Matsumoto A (1993). Reactivity of Chlamydia pneumoniae strains in the IDEIA CHLAMYDIA test kit designed for detection of Chlamydia trachomatis. The Japanese Association for Infectious Diseases. 67, 549-555.

Miyashita N and Matsumoto N (2004). Morphology of Chlamydia pneumoniae. In: Chlamydia pneumoniae infection and disease: infectious agents and pathogenesis. First edition. Edited by Friedman H, Yamamoto Y and Bendinelli M. New York: Springer. pp.11-28.

Mohamad KY, Roche SM, Myers G, Bavoil PM, Laroucau K, Magnino S, Lauren S,

- 71 - Chapter 2: Literature Review

Rasschaert D and Rodolakis A (2008). Preliminary phylogenetic identification of virulent Chlamydophila pecorum strains. Infection, Genetics and Evolution. 8, 764-771.

Moroney JF, Guevara R, Iverson C, Chen FM, Skelton SK, Messmer TO, Plikaytis B, Williams PO, Blake P and Butler JC (1998). Detection of chlamydiosis in a shipment of pet birds, leading to recognition of an outbreak of clinically mild psittacosis in humans. Clinical Infectious Diseases. 26, 1425-1429.

Morré SA, Ossewaarde JM, Lan J, van Doornum GJJ, Walboomers JMM, MacLaren DM, Meijer CJLM and van den Brule AJC (1998). Serotyping and Genotyping of Genital Chlamydia trachomatis Isolates Reveal Variants of Serovars Ba, G, and J as Confirmed by omp1 Nucleotide Sequence Analysis. Journal of Clinical Microbiology. 36, 345-351.

Moulder JW (1964). The psittacosis group as bacteria. New York: J. Wiley and Sons. pp.1-95.

Moulder JW, Hatch TP, Kuo CC, Schachter J and Storz J (1984). Genus I. Chlamydia, Jones, Rake and Stearns 1945. In: Bergey’s manual of systematic bacteriology. Edited by Krieg NR and Holt JG. Baltimore: Williams and Wilkins. 55, 729-739.

Mount DT, Bigazzi PE and Barron AL (1973). Experimental genital infection of male guinea pigs with the agent of guinea pig inclusion conjunctivitis and transmission to females. Infection and Immunity. 8, 925-930.

Murray ES (1964). Guinea pig inclusion conjunctivitis virus. I. Isolation and identification as a member of the psittacosis-lymophogranuloma-trachoma group. The Journal of Infectious Diseases. 114, 1-12.

Nagington J (1984). Psittacosis/Ornithosis in Cambridgeshire 1975-1983. The Journal of Hygiene. 92, 9-19.

Nigg C (1942). An unidentified virus which produces pneumonia and systemic infection in mice. Science. 95, 49–59.

Obendorf DL (1981). Pathology of the female reproductive tract in the koala,

- 72 - Chapter 2: Literature Review

Phascolarctos cinereus (Goldfuss), from Victoria, Australia. Journal of Wildlife Diseases. 17, 587-592.

O'Connell CM and Nicks KM (2006). A plasmid-cured Chlamydia muridarum strain displays altered plaque morphology and reduced infectivity in cell culture. Microbiology. 152, 1601-1607.

Page LA (1966). Revision of the family Chlamydiaceae Rake (Rickettsiales): unification of the psittacosis-lymphogranuloma venereum-trachoma group of organisms in the genus Chlamydia Jones, Rake and Stearns (1945). International Journal of Systematic and Bacteriology. 16, 223-252.

Page LA (1968). Proposal for the recognition of two species in the genus Chlamydia Jones, Rake, and Stearns (1945). International Journal of Systematic Bacteriology. 18, 51-66.

Pannekoek Y, Morelli G, Kusecek B, Morré SA, Ossewaarde JM, Langerak AA and van der Ende A (2008). Multi locus sequence typing of Chlamydiales: clonal groupings within the obligate intracellular bacteria Chlamydia trachomatis. BMC Microbiology. 8, 42

Papp JR, Shewen PE and Gartley CJ (1993). Chlamydia psittaci infection and associated infertility in sheep. The Canadian Veterinary Journal. 57, 185-9. In: Shewan PE (1980). Chlamydial infection in animals: A review. Canadian Journal of Veterinary Research. 21, 2-11.

Pedersen LN, Podenphant L, Moller JK (2008). Highly discriminative genotyping of chlamydia trachomatis using omp1 and a set of variable number tandem repeats. Clinical Microbiology and Infection. 14, 644-652.

Pedersen LN, Herrmann B and Møller JK (2009). Typing Chlamydia trachomatis: from egg yolk to nanotechnology. FEMS Immunology and Medical Microbiology. 55, 120-130.

Peeling RW and Brunham RC (1996). Chlamydiae as pathogens: new species and new issues. Emerging Infectious Diseases. 2, 307-319.

Perez-Martinez JA and Storz J (1985). Antigenic diversity of Chlamydia psittaci of

- 73 - Chapter 2: Literature Review mammalian origin determined by microimmunofluorescence. Infection and Immunity. 50, 905–910.

Pether JV, Wang SP and Grayston JT (1989). ChlamydiaH pneumoniae, strain TWAR, as the cause of an outbreak in a boys' school previously called

psittacosis.H Epidemiology and Infection. 103, 395-400.

Philips HL and Clarkson MJ (1995). Spontaneous change from overt to covert infection of Chlamydia pecorum in cycloheximide treated mouse McCoy cells. Infection and Immunity. 63, 3729-3730.

Pickett MA, Everson JS, Pead PJ and Clarke IN (2005). The plasmids of Chlamydia trachomatis and Chlamydophila pneumoniae (N16): accurate determination of copy number and the paradoxical effect of plasmid-curing agents. Microbiology. 151, 893-903.

Popov VL, Shatkin AA, Pankratova VN, Smirnova NS, von Bonsdorff CH, Ekman MR, Mörttinen A and Saikku P (1991). Ultrastructure of Chlamydia pneumoniae in cell culture. FEMS Microbiology Letters. 84, 129-134.

Qiu H, Fan Y, Joyee AG, Wang S, Han X, Bai H, Jiao L, Van Rooijen N and Yang X (2008). Type I IFNs Enhance Susceptibility to Chlamydia muridarum Lung Infection by Enhancing Apoptosis of Local Macrophages. The Journal of Immunology. 181, 2092-2102.

Radostits OM, Gay CC, Blood DC, Arundel JH and Hinchcliff KW (2000). Veterinary Medicine: A Textbook of the Diseases of Cattle, Sheep, Pigs, Goats and Horses. Ninth Edition. London: W.B Saunders. p.1259.

Rake G and Jones HP (1942). Studies on lymphogranuloma venereum I. Development of the agent in the yolk sac of the chicken embryo. The Journal of Experimental Medicine. 75, 323-338.

Ramsey KH, Newhall WJ and Rank RG (1989). Humoral immune response to chlamydial genital infection of mice with the agent of mouse pneumonitis. Infection and Immunity. 57, 2441-2446.

Ramsey KH, Sigar IM, Schripsema JH, Denman CJ, Bowlin AK, Myers GSA and

- 74 - Chapter 2: Literature Review

Rank RG (2009). Strain and Virulence Diversity in the Mouse Pathogen Chlamydia muridarum. Infection and Immunity. 77, 3284-3293.

Rank RG and Sanders MM (1990). Ascending Genital Tract Infection as a Common Consequence of Vaginal Inoculation with the Guinea Pig Inclusion Conjunctivitis Agent in Normal Guinea Pigs. In: Chlamydial Infections. Edited by Bowie WR, Caldwell HD, Jones RP, Mardh PA, Ridgway GI, Schachter J, Stamm WE and Ward ME. Cambridge: Cambridge University Press. pp.249-252.

Rank RG (2007). Chlamydial diseases. In: The mouse in biomedical research. Second edition: Diseases. Edited by Fox JG, Newcomer C, Smith A, Barthold S, Quimby F, Davisson M. San Diego: Elsevier Inc. 2, 325-348.

Rattei T, Ott S, Gutacker M, Rupp J, Maass M, Shreiber S, Solbach W, Wirth T and Gieffers J (2007). Genetic diversity of the obligate intracellular bacterium Chlamydophila pneumoniae by genome-wide analysis of single nucleotide polymorphisms: evidence for highly clonal population structure. BMC Genomics. 8, 355.

Read TD, Brunham R, Shen C, Gill S, Heidelberg J, White O, Hickey E, Peterson J, Utterback T, Berry K, Bass S, Linher K, Weidman J, Khouri H, Craven B, Bowman C, Dodson R, Gwinn M, Nelson W, DeBoy R, Kolonay J, McClarty G, Salzberg S, Eisen J and Fraser C (2000). Genome sequences of Chlamydia trachomatis MoPn and Chlamydia pneumoniae AR39. Nucleic Acids Research. 28, 1397-1406.

Read TD, Myers GS, Brunham RC, Nelson WC, Paulsen IT, Heidelberg J, Holtzapple E, Khouri H, Federova NB, Carty HA, Umayam LA, Haft DH, Peterson J, Beanan MJ, White O, Salzberg SL, Hsia RC, McClarty G, Rank RG, Bavoil PM and Fraser CM (2003). Genome sequence of Chlamydophila caviae (Chlamydia psittaci GPIC): examining the role of niche-specific genes in the evolution of the Chlamydiaceae. Nucleic Acids Research. 31, 2134-2147.

Reed KD, Ruth GR, Meyer JA and Shukla SK (2000). Chlamydia pneumoniae infection in a breeding colony of African clawed frogs (Xenopous tropicalis). Emerging Infectious Diseases. 6, 196-199.

Reinhold P, Jaeger J, Melzer F and Sachse K (2005). Evaluation of lung function

- 75 - Chapter 2: Literature Review in pigs either experimentally or naturally infected with Chlamydiaceae.

VeterinaryH Research Communications.H 29, 125-150.

Reinhold P, Kirschvink N, Theegarten D and Berndt A (2008). An experimentally induced Chlamydia suis infection in pigs results in severe lung function disorders and pulmonary inflammation. Veterinary Research. 39, 35.

Reinhold P, Hartmann H and Constable PD (2009). Characterisation of acid–base abnormalities in pigs experimentally infected with Chlamydia suis. The Veterinary Journal. 184, 212-218.

Riordan-Eva P (1988). Nomenclature of Chlamydia. International Opthalmology. 12, 15-17.

Ritter J (1880) Beitrag zur Frage des Pneumotyphus [Eine Hausepidemie in Uster (Schweiz) betreffendd]. Deutsches Archiv fur Klinische Medizin. 25, 53-96.

Roblin PM, Dumornay W and Hammerschlag MR (1992). Use of HEp-2 cells for improved isolation and passage of Chlamydia pneumoniae. Journal of Clinical Microbiology. 30, 1968-1971.

Rockey D and Matsumoto A (2000). The chlamydial developmental cycle. In: Prokaryotic development. Edited by Brun YV and Shimkets LJ. Washington DC: ASM Press. p.404.

Rodriguez P, de Barbeyrac B, Persson K, Dutilh B and Bebear C (1993). Evaluation of molecular typing for epidemiology study of Chlamydia trachomatis

genital infections. Journal of Clinical Microbiology. 31, 2238-2240.H

Rodriguez P, Allardet-Servent A, de Barbeyrac B, Ramuz M and Bebear C (1994). Genetic variability among Chlamydia trachomatis reference and clinical strains analyzed by pulsed-field gel electrophoresis. Journal of Clinical Microbiology. 32, 2921-2928.

Rodolakis A and Mohamad KY (2010). Zoonotic potential of Chlamydophila. Veterinary Microbiology. 140, 382-391.

Rogers DG, Andersen AA, Hogg A, Nielsen DL and Huebert MA (1993).

- 76 - Chapter 2: Literature Review

Conjunctivitis and keratoconjunctivitis associated with chlamydiae in swine. Journal of the American Veterinary Medical Association. 203, 1321-1323.

Rogers DG and Andersen AA (2000). IntestinalH lesions caused by a strain of

Chlamydia suis in weanling pigs infected at 21 days of age.H The Journal of Veterinary Diagnostic Investigation. 12, 233-239.

Rottenberg ME, Gigliotti-Rothfuchs A and Wigzell H (2002). The role of IFN- γ in the outcome of chlamydial infection. Current Opinion in Immunology. 14, 444- 451.

Sachse K, Grossmann E, Berndt A, Schütt C, Henning K, Theegarten D, Anhenn O and Reinhold P (2004). Respiratory chlamydial infection based on experimental aerosol challenge of pigs with Chlamydia suis. Comparative Immunology, Microbiology and Infectious Diseases. 27, 7-23.

Sachse K, Laroucau K, Hotzel H, Schubert E, Ehricht R and Slickers P (2008). Genotyping of Chlamydophila psittaci using a new DNA microarray assay based on sequence analysis of ompA genes. BMC Microbiology. 8, 63.

Saikku P, Laitinen K and Leinonen M (1998). Animal models for Chlamydia pneumoniae infection. Atherosclerosis. 140, S17–S19.

Schachter J, Banks J, Sugg N, Sung M, Storz J and Meyer KF (1974). Infection and Immunity. 9, 92-94.

Schachter J, Banks J, Sugg N, Sung M, Storz J and Meyer KF (1975). Serotyping of Chlamydia. II. Isolates of bovine origin. Infection and Immunity. 11, 904-907.

Schachter J and Dawson CR (1990). The epidemiology of trachoma predicts more blindness in the future. Scandinavian Journal of Infectious Diseases. Supplementum. 69, 55-62.

Schachter J (1999). Infection and disease epidemiology. In: Chlamydia: Intracellular biology, pathogenesis, and immunity. Edited by Stephens RS. Washington DC: The American Society for Microbiology. p.142.

Schachter J, Stephens RS, Timms P, Kuo C, Bavoil PM, Birkelund S, Boman J,

- 77 - Chapter 2: Literature Review

Caldwell H, Campbell LA, Chernesky M, Christiansen G, Clarke IN, Gaydos C, Grayston JT, Hackstadt T, Hsia R, Kaltenboeck B, Leinonnen M, Ojcius D, McClarty G, Orfila J, Peeling R, Puolakkainen M, Quinn TC, Rank RG, Raulston J, Ridgeway GL, Saikku P, Stamm WE, Taylor-Robinson DT, Wang SP and Wyrick PB (2001). Radical Changes to chlamydial taxonomy are not necessary just yet. International Journal of Systematic and Evolutionary Microbiology. 51, 249.

Schiller I, Koesters R, Weilenmann R, Thoma R, Kaltenboeck B, Heitz P and Pospischil A (1997). Mixed infections with porcine Chlamydia trachomatis/pecorum and infections with ruminant Chlamydia psittaci serovar 1 associated with abortions in swine. Veterinary Microbiology. 58, 251-260.

Schlossberg D (2008). Clinical infectious disease. New York: Cambridge University Press. p.1161.

Scidmore MA, Bannantine J and Hackstadt T (1998). Molecular approaches to studying Chlamydia. In: Bacterial pathogenesis. Edited by Williams P, Ketley J and Salmond G. United Kingdom: Academic Press. 27, 461-462.

Seth-Smith HM, Harris SR, Persson K, Marsh P, Barron A, Bignell A, Bjartling C, Clark L, Cutcliffe LT, Lambden PR, Lennard N, Lockey SJ, Quail MA, Salim O, Skilton RJ, Wang Y, Holland MJ, Parkhill J, Thomson NR and Clarke IN (2009). Co-evolution of genomes and plasmids within Chlamydia trachomatis and the emergence in Sweden of a new variant strain. BMC Genomics. 10, 239.

Shaw EI, Dooley CA, Fischer ER, Scidore MA, Fields KA and Hackstadt T (2000). Three temporal classes of gene expression during the Chlamydia trachomatis developmental cycle. Molecular Microbiology. 37, 913-925.

Shewen PE, Povey RC and Wilson MR (1978). Case report. Feline chlamydial infection. The Canadian Veterinary Journal. 19, 289-292.

Shirai M, Hirakawa H, Kimoto M, Tabuchi M, Kishi F, Ouchi K, Shiba T, Ishii K, Hattori M, Kuhara S and Nakazawa T (2000). Comparison of whole genome sequences of Chlamydia pneumoniae J138 from Japan and CWL029 from USA. Nucleic Acids Research. 28, 2311-2314.

Sinai AP and Joiner KA (1997). Safe haven: the cell biology of nonfusogenic

- 78 - Chapter 2: Literature Review pathogen vacuoles. Annual Review of Microbiology. 51, 415–462.

Somani J, Bhullar VB, Workowski KA, Farshy CE and Black CM (2000). Multiple drug-resistant Chlamydia trachomatis associated with clinical treatment failure. The Journal of Infectious Diseases. 181, 1421-1427.

SriramH S,H HMitchell W H and StrattonH C H (1998). Multiple sclerosis associated with Chlamydia pneumoniae infection of the CNS. Neurology. 50, 571-572.

Stephens RS, Tam MR, Kuo CC and Nowinski RC (1982). Monoclonal antibodies to Chlamydia trachomatis: antibody specificities and antigen characterization. The Journal of Immunology. 128, 1083–1089.

Stephens RS, Sanchez-Pescador R, Wagar EA, Inouye C and Urdea MS (1987). Diversity of Chlamydia trachomatis major outer membrane protein genes. Journal of Bacteriology. 169, 3879-3785.

Stephens RS (1993). Challenge of Chlamydia research. Infectious Agents and Disease. 1, 279-293.

Stephens RS (1999) Introduction. In: Chlamydia: Intracellular biology, pathogenesis, and immunity. Edited by Stephens RS. Washington DC: The American Society for Microbiology. p.xi.

Stephens RS, Myers G, Eppinger M and Bavoil P (2009). Divergence without difference: phylogenetics and taxonomy of Chlamydia resolved. FEMS immunology and medical microbiology. 55, 115-119.

Storz J, Baghian A and Kousoulas KG (1994). Advances in detection and differentiation of chlamydiae from animals. In: Chlamydial Infections, Proceedings of the Eighth International Symposium on Human Chlamydial Infections. Edited by Orfila J, Byrne G I, Chernesky M A, Grayston J T, Jones R B, Ridgway G L, Saikku P, Schachter J, Stamm W E and Stephens R S. Bologna, Italy: Societa Editrice Esculapio. pp.563-573.

Suchland RJ, Geisler WM and Stamm WE (2003). Methodologies and cell lines used for antimicrobial susceptibility testing of Chlamydia spp. Antimicrobial Agents and Chemotherapy. 47, 636-642.

- 79 - Chapter 2: Literature Review

Stirling P and Richmond S (1977). The developmental cycle of Chlamydia trachomatis in McCoy cells treated with cytochalasin B. Journal of General Microbiology. 100, 31-42.

Studdert MJ, Studdert VP and Wirth HJ (1981). Isolation of Chlamydia psittaci from cats with conjunctivitis. Australian Veterinary Journal. 57, 515-517.

Sturm-Ramirez K, Brumblay H, Diop K, Guèye-Ndiaye A, Sankalé JL, Thior I, N'Doye I, Hsieh CC, Mboup S and Kanki PJ (2000). Molecular epidemiology of genital Chlamydia trachomatis infection in high-risk women in Senegal, West Africa. Journal of Clinical Microbiology. 38, 138-145.

Tam JE, Davis CH, Thresher RJ and Wyrick PB (1992). Location of the origin of replication for the 7.5-kb Chlamydia trachomatis plasmid. Plasmid. 27, 231-236.

Tam JE, Davis CH, Wyrick PB (1994). Expression of recombinant DNA introduced into Chlamydia trachomatis by electroporation. Canadian Journal of Microbiology. 40, 583-591.

Thao ML, Baumann L, Hess JM, Falk BW, Ng JCK, Gullan PJ and Baumann P (2003). Phylogenetic evidence for two new insect-associated Chlamydia of the family Simkaniaceae. Current Microbiology. 47, 46–50.

ThomaH H R, Guscetti F, Schiller I, Schmeer N, Corboz L and Pospischil A (1997). Chlamydiae in porcine abortion. Veterinary Pathology. 34, 467–469.

Thomas NS, Lusher M, Storey CC and Clarke IN (1997). Plasmid diversity in Chlamydia. Microbiology. 143, 1847-1854.

Thomas V, Casson N and Greub G (2006). Criblamydia sequanensis, a new intracellular Chlamydiales isolated from Seine river water using amoebal co- culture. Environmental Microbiology. 8, 2125-2135.

Thomson NR, Yeats C, Bell K, Holden MTG, Bentley SD, Livingstone M, Cerdeno- Tarraga AM, Harris B, Doggett J, Ormond D, Mungall K, Clarke K, Feltwell T, Hance Z, Sanders M, Quail MA, Price C, Barrell BG, Parkhill J and Longbottom D (2005). The Chlamydophila abortus genome sequence reveals an array of variable proteins that contribute to interspecies variation. Genome Research. 15,

- 80 - Chapter 2: Literature Review

629-640.

Thylefors B, Negrel AD, Pararajasegaram R and Daddies KY (1995). Global data on blindness. Bulletin of the World Health Organization. 73, 115-121.

Toranzo AE, Combarro P, Lemos ML and Barja JL (1984). Plasmid coding for transferable drug resistance in bacteria isolated from cultured rainbow trout. Applied and Environmental Microbiology. 48, 872-887.

Troy CJ, Peeling RW, Ellis AG, Hockin JC, Bennett DA, Murphy MR and Sika JS (1997). Chlamydia pneumoniae as a new source of infectious outbreaks in nursing homes. The Journal of the American Medical Association. 277, 1214– 1218.

Van Loock M, Vanrompay D, Herrmann B, Vander Stappen J, Volckaert G, Goddeeris BM and Everett KDE (2003). Missing links in the divergence of Chlamydophila abortus from Chlamydophila psittaci. International Journal of Systematic and Evolutionary Microbiology. 53, 761-770.

Vanrompay D, Andersen AA, Ducatelle R and Haesebrouck F (1993). Serotyping of European isolates of Chlamydia psittaci from poultry and other birds. Journal of Clinical Microbiology. 31, 134–137.

Vehmaan-Kreula P, Puolakkainen M, Sarvas M, Welgus HG and Kovanen PT (2001). Chlamydia pneumoniae proteins induce secretion of the 92-kDa gelatinase by human monocyte-derived macrophages. Arteriosclerosis, Thrombosis, and Vascular Biology. 21, e1-e8.

von Bomhard W, Polkinghorne A, Lu ZH, Vaughan L, Vogtlin A, Zimmermann DR,

Spiess B and Pospischil A (2003). DetectionH of novel chlamydiae in cats with

ocular disease.H American Journal of Veterinary Research. 64, 1421-1428.

Wang SP and Grayston JT (1963). Classification of trachoma virus strains by protection of mice from toxic death. The Journal of Immunology. 90, 849–856. In: Pedersen LN, Herrmann B and Møller JK (2009). Typing Chlamydia trachomatis: from egg yolk to nanotechnology. FEMS Immunology and Medical Microbiology. 55, 120-130.

- 81 - Chapter 2: Literature Review

Ward ME (1983). Chlamydial classification, development and structure. British Medical Bulletin. 39, 109-115.

Wardrop S (1997). Genetic diversity of Chlamydia pecorum and Chlamydia pneumoniae infections in koalas. Honours thesis. Queensland University of Technology, Infectious Diseases Research Group.

Wardrop S, Fowler A, O’Callaghan P, Giffard P and Timms P (1999). Characterization of the koala biovar of Chlamydia pneumoniae at four gene loci-- ompAVD4, ompB, 16S rRNA, groESL spacer region. Systematic and Applied Microbiology. 22, 22-27.

Watson MW, Lambden PR, Everson JS and Clarke IN (1994). ImmunoreactivityH of the 60-kDa cysteine-rich proteins of Chlamydia trachomatis, Chlamydia

psittaci and Chlamydia pneumoniae expressed in Escherichia coli. H Journal of Clinical Microbiology. 29, 1188-1193.

Wentworth BB (1973). Use of gentamicin in the isolation of subgroup A Chlamydia. Antimicrobial Agents and Chemotherapy. 3, 698-702.

WesslénH L,H PåhlsonH C,H FrimanH G,H FohlmanH J,H LindquistH O H and JohanssonH C H (1992). Myocarditis caused by Chlamydia pneumoniae (TWAR) and sudden unexpected death in a Swedish elite orienteer. Lancet. 340, 427-428.

Wiesner M, Zaidi MB, Calva E, Fernández-Mora M, Calva JJ and Silva C (2009). Association of virulence plasmid and antibiotic resistance determinants with chromosomal multilocus genotypes in Mexican Salmonella enterica serovar Typhimurium strains. BMC Microbiology. 9, 131.

Wills JM, Watson G, Lusher M, Mair TS, Wood D and Richmond SJ (1990). Characterisation of Chlamydia psittaci isolated from a horse. Veterinary Microbiology. 24, 11-19.

Wilsmore AJ, Izzard KA, Wilsmore BC and Dagnall GJ (1990). Breeding performance of sheep infected with Chlamydia psittaci (ovis) during their preceding pregnancy. The Veterinary Record. 126, 40-41. In: Shewan PE (1980). Chlamydial infection in animals: A review. Canadian Journal of Veterinary Research. 21, 2-11.

- 82 - Chapter 2: Literature Review

Wong KH, Skelton SK and Chan YK (1992). Efficient culture of Chlamydia pneumoniae with cell lines derived from the human respiratory tract. Journal of Clinical Microbiology. 30, 1625–1630.

Wong YK, Sueur JM, Fall CH, Orfila J and Ward ME (1999). The species specificity of the microimmunofluorescence antibody test and comparisons with a time resolved fluoroscopic immunoassay for measuring IgG antibodies against Chlamydia pneumoniae. Journal of Clinical Pathology. 52, 99-102.

Wood H, Caldwell H and McClarty G (2007). Tryptophan metabolism in chlamydiae. In: Chlamydia genomics and pathogenesis. Edited by Bavoil PM and Wyrick PB. United Kingdom: Horizon Press. pp.157-169.

Yamazaki T (1992). Morphology and immunotyping of AC-43 strain of Chlamydia pneumoniae isolated from a Japanese child. The Japanese Association for Infectious Diseases. 66, 632-636.

Yan C, Fukushi H, Matsudate H, Ishihara K, Yasuda K, Kitagawa H, Yamaguchi T and Hirai K (2000). Seroepidemiological investigation of feline Chlamydiosis in cats and humans in Japan. Microbiology and Immunology. 44, 155–160.

Yong EC, Chi EY, Chen WJ and Kuo CC (1986). Degradation of Chlamydia trachomatis in human polymorphonuclear leukocytes: an ultrastructural study of peroxidase-positive phagolysosomes. Infection and Immunity. 53, 427-431.

Yuan Y, Zhang YX, Watkins NG and Caldwell HD (1989). Nucleotide and deduced amino acid sequences for the four variable domains of the major outer membrane proteins of the 15 Chlamydia trachomatis serovars. Infection and Immunity. 57, 1040-1049.

Zhang YX, Steward SJ and Caldwell HD (1989). Protective monoclonal antibodies to Chlamydia trachomatis serovar- and serogroup-specific major outer membrane protein determinants. Infection and Immunity. 57, 636-638.

Zicola A, Saegerman C, Quatpers D, Viandier J and Thiry E (2009) Feline herpesvirus 1 and feline calicivirus infections in a heterogenous cat population of a rescue shelter. Journal of Feline Medicine and Surgery. 11, 1023-1027.

- 83 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

CHAPTER THREE

RESULTS

- 84 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

STATEMENTU OF JOINT AUTHORSHIP

The authors listed below have certified that:

1. they meet the criteria for authorship in that they have participated in the conception, execution, or

interpretation, or at least that part of the publication in their field of expertise;

2. they take public responsibility for their part of the publication, except for the responsible author who

accepts overall responsibility for the publication;

3. there are no other authors of the publication according to these criteria;

4. potential conflicts of interest have been disclosed to (a) granting bodies, and (b) the editor or

publisher of Veterinary Microbiology, and;

5. they agree to the use of the publication in the student’s thesis and its publication on the Australasian

Digital Thesis database consistent with any limitations set by publisher requirements.

In the case of this chapter:

MitchellU CMU, Mathews SA, Theodoropoulos C and Timms P (2009). In vitro characterisation of koala

Chlamydia pneumoniae: morphology, inclusion development and doubling time. Veterinary

Microbiology. 136, 91-99.

Contributor Statement of Contribution

Candice Mitchell Wrote the manuscript; contributed to experimental design and research plan; (candidate) performed all experimental work except the following

Sarah Mathews Contributed to research plan development and provided feedback on experimental design and executions; critically reviewed manuscript and approved final version of manuscript

Christina Microscopy and imaging expertise; provided feedback on experimental design and Theodoropoulos executions; critically revised manuscript and approved final version of manuscript

Peter Timms Conceived of the research plan; involved in experimental planning and design; critically reviewed manuscript proofs, contributed to the intellectual input of the manuscript and approved final version of manuscript

- 85 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

- 86 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

CHAPTER THREE

Received 31 July 2008, Received in revised form 29 Septempter 2008, Accepted 1 October 2008

Keywords: Chlamydia pneumoniae, developmental cycle, elementary body, inclusion morphology,

Characterisation.

- 87 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

Introduction

The species Chlamydia pneumoniae was first designated in 1988 (Cox et al.,

1988), while previously it was known as the TWAR strain of Chlamydia psittaci.

C. pneumoniae is a respiratory pathogen in humans causing approximately 10% of community-acquired pneumonia and 5% of pharyngitis, bronchitis and sinusitis (Kuo et al., 1988). C. pneumoniae occurs worldwide and infects all age groups, with serological studies indicating that 40-60% of adults have been infected at least once in their lifetime (Peeling and Brunham, 1996). Originally thought to be a sole pathogen of humans, C. pneumoniae has been isolated from a wide range of animal hosts, including horses (Storey et al., 1993), reptiles

(Bodetti et al., 2002), amphibians (Berger et al., 1999; Bodetti et al., 2002;

Hotzel et al., 2001) and marsupials, such as koalas (Wardrop, 1997) and bandicoots (Kutlin et al., 2007), although the relationship between human and animal strains is unclear.

The koala (Phascolarctos cinereus) is a native Australian marsupial commonly infected with Chlamydia (Glassick et al., 1996; Wardrop, 1997). While the decline in koala populations has largely been the result of a diminished habitat, concern for the koala exists due to an increased incidence of disease (Jackson et al., 1999). Almost all Australian free-range koalas and many captive populations are affected by chlamydial disease (Jackson et al., 1999; Wardrop, 1997). There are two main species of Chlamydia found in koalas: C. pecorum infects the ocular and urogenital tracts and is thought to be the main cause of clinical disease in the koala (Jackson et al., 1999); and, C. pneumoniae which is often found in conjunction with C. pecorum, has been isolated from ocular, urogenital tract and respiratory sites (Devereaux et al., 2003; Jackson et al., 1999). Clinical signs for respiratory distress in the koala associated with C. pneumoniae

- 88 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

infection include sneezing, coughing, chest congestion, difficulty in breathing, rhinitis and nasal discharge (Wardrop, 1997).

Like other chlamydiae, C. pneumoniae survives and multiplies within eukaryotic cells, via a unique biphasic developmental cycle which involves the inter- conversion between an extracellular infectious elementary body (EB) and a replicative reticulate body (RB). Morphologically, the EBs are small in size (0.3 to

0.35 µm) (Miyashita and Matsumoto, 2004), internalised following phagocytosis,

and remain within the host-derived membrane-bound vacuole, termed an

inclusion. Soon after internalization, the EBs differentiate into the metabolically

active and larger (0.5 to 2.0 µm) RBs which divide by binary fission. Later in the infectious process, the RBs asynchronously begin to differentiate to EBs, and accumulate within the lumen of the inclusion until the host cell lyses, releasing the EBs to infect neighbouring cells for successive rounds of infection.

The koala C. pneumoniae LPCoLN isolate is the best characterised of all animal

C. pneumoniae isolates. Several genes have been sequenced for comparative

genomics and phylogenetic analysis (Rattei et al., 2007; Wardrop, 1997;

Wardrop et al., 1999), although there has been limited characterization of the in

vitro growth and morphological characteristics for this isolate. We therefore

conducted a study to identify any variations in growth and morphological

characteristics between a koala and human C. pneumoniae isolate.

Materials and Methods

Chlamydial isolates

- 89 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

The koala C. pneumoniae LPCoLN isolate was initially obtained from a nasal swab of a koala experiencing respiratory illness during an outbreak that occurred in a captive population of koalas at Lone Pine Koala Sanctuary (Brisbane, Australia).

Approximately 70% of the koalas developed clinical signs such as sneezing, coughing and nasal discharge. C. pneumoniae was detected by PCR and gene sequencing, and LPCoLN was isolated in cell culture. No other bacterium or virus was isolated (unpublished data, V. Nicholson). The human C. pneumoniae AR39 isolate (ATCC 53592), was originally isolated from a pharyngeal swab of a patient who presented with pharyngitis (Kuo et al., 1988).

C. pneumoniae cell culture

Human epithelial (HEp-2) cell monolayers were maintained in Dulbecco's

Modified Eagle Medium (DMEM) supplemented with 10% fetal calf serum, 50

μg/μl gentamicin and 10 mg/L streptomycin. HEp-2 cells were seeded in T-25 tissue culture flasks and on 13 mm glass coverslips placed in 24-well cell culture plates. HEp-2 cell monolayers were inoculated with C. pneumoniae LPCoLN or

AR39, at a multiplicity of infection calculated to result in 90-100% of host cells infected. Infected cells were centrifuged at 650 x g for 30 min at 25°C, after which the chlamydial inoculum was removed at 2.5 h post-infection (p.i) and replaced with DMEM containing 100 mg/ml cycloheximide. Infections were incubated at 37°C in 5% CO2 and harvested at 6, 12, 18, 24, 36, 48, 54, 60, 72 and 96 h p.i.

For one separate experiment, HEp-2 cells were inoculated with LPCoLN, incubated at 37°C for 1 h of infection, followed by a 1.5 h incubation at 32°C in

5% CO2, after which the inoculum was removed, and the HEp-2 cells were washed once with 0.5 mg/ml heparin sulphate (made up in 1X phosphate-

- 90 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

buffered saline; PBS) to prevent re-infection (Van Ooij et al., 1998; Zhang and

Stephens 1992). The cells were then maintained in DMEM containing 100 mg/ml cycloheximide and incubated at 32°C for 12, 24, 36, 48, 72 and 96 h p.i.

Titration of chlamydial infectivity

The infectivity of C. pneumoniae LPCoLN and AR39 was determined by titration of the inclusion forming units (IFU) per ml in HEp-2 cells. Infected coverslips from each time point were washed with 1X PBS, fixed in 100% methanol, and stained with (FITC)-labelled Chlamydia-specific anti-LPS monoclonal antibody

(Cellabs, Australia). Duplicate samples were counted in 15 (40X objective) fields

per dilution and the mean number of inclusions determined. The inclusions were

observed with a Leitz laborlux S fluorescence microscope (Leica Microsystems,

Wetzlar, Germany).

Microscopy of inclusion and particle morphology

Confocal Microscopy

C. pneumoniae-infected HEp-2 monolayers were cultured on coverslips at the indicated time points p.i, and washed with 1X PBS, fixed in 1 ml of 100% methanol for 10 min, stained with 10 μl of fluorescein isothiocyanate (FITC)- labelled Chlamydia-specific anti-lipopolysaccharide (anti-LPS) monoclonal

antibody (Cellabs, Australia), and mounted on to glass slides according to

manufacturer’s instructions. Confocal images were obtained using a Leica TCS

SP5 confocal laser scanning microscope (Leica Microsystems, Wetzlar, Germany)

with a 63X oil objective 1.4 NA. Excitation and emission wavelengths were

chosen from the provided software (Leica application suite for advanced

- 91 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

fluorescence) for each fluorophore used in this study.

Transmission electron microscopy (TEM)

C. pneumoniae-infected HEp-2 monolayers, cultured in T-25 tissue culture flasks were rinsed in sterile 1X PBS prior to fixation in 3% glutaraldehyde (ProSciTech) in 0.1 M cacodylate buffer (pH 7.3) at the indicated time points p.i. After 1 h fixation, the cells were scraped off the tissue culture flask, washed in buffer, post-fixed in 1% osmium tetroxide and embedded in Spurr epoxy resin according to standard procedures (Robards and Wilson, 1993). Ultrathin sections

(50-100 nm) were cut and stained with uranyl acetate and lead citrate stains, prior to examination with a JEOL 1200EX transmission electron microscope.

Quantification of C. pneumoniae growth by quantitative genomic PCR

Total host cell and C. pneumoniae genomic DNA was isolated from infected monolayers in T-25 tissue culture flasks at 12, 18 and 24 h p.i. Briefly, cell monolayers were washed with 1 ml of 1X PBS, trypsinized for 5 min, collected in

1.5 ml eppendorf tubes, and washed once in 200 µl of 1X PBS. Genomic DNA was isolated and purified using the Wizard® SV genomic DNA purification system as per manufacturer’s instructions (Promega, USA). The 16S rRNA target gene was used to quantify the chlamydial DNA using primers qrt_16SF (5’-

CTCAACCCCAAGTCAGCATT-3’) and qrt_16SR (5’-CTACGCATTTCACCGCTACA-3’) to detect an 86 bp region of the 16S rRNA gene. Chlamydial genome numbers were normalized to a 103 bp fragment of the HEp-2 host 18S rRNA sequence using primers (Lau et al., 2004) to control for differences in infection between samples. Real-time PCR reactions were performed in a final volume of 20 µl, including 0.05 µM each primer, 10 µl 2X SYBR Green (Applied Biosystems, Foster

- 92 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

City, California), and 2.0 µl DNA. Amplification conditions consisted of 10 min at

95°C, followed by 40 cycles of 15 s at 95°C and 1 min at 60°C, and a final dissociation stage. Standards of known concentration (105, 107 and 109) were

prepared for the target and house keeping genes from PCR amplified koala C.

pneumoniae and host cell DNA, and purified with a Wizard® SV gel and PCR

clean-up system according to manufacturer’s instructions (Promega, USA). The

standard curve method was applied and the copy number of the target gene in

unknown samples was determined relative to the house keeping gene for each

sample. The copy number for each sample was then normalized by dividing 18S

rRNA by 16S rRNA. All reactions were carried out using an Applied Biosystems

7300 real-time PCR system (Foster City, California).

Statistical Analysis

The mean inclusion counts with standard errors were determined. A mixed-

effects analysis of variance model was applied to real time PCR data using SPSS

version 15.0 (SPSS Inc, Michigan). Three hypotheses were considered: main

effects reflecting differences (1) in C. pneumoniae LPCoLN and AR39 isolates, (2)

across the time points observed, and (3) in their interaction effect, to consider

whether or not the time trend noted overall actually differed between the two

isolates. A preliminary analysis of the responses indicated that a log

transformation was necessary for the normal error assumption. P-

values < 0.05 (two-tailed) were considered as significant.

Results

The koala C. pneumoniae LPCoLN isolate grows markedly faster than the human AR39 isolate

- 93 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

In standard culturing of C. pneumoniae we observed that LPCoLN cultured more efficiently than AR39. We thus sought to characterize the growth characteristics of LPCoLN compared to the human AR39 isolate. Under equivalent culturing conditions we made measurements of the number and size of the inclusions by confocal microscopy, and genome equivalents using real-time PCR. At 12 h p.i,

50-70% of HEp-2 cells contained visible inclusions, but there was an obvious difference in the inclusion size; LPCoLN inclusions were larger and more defined

(Figure. 1A) compared to the smaller inclusions of AR39 (Figure 1B; Table 1). By

24 h p.i, LPCoLN inclusions were at least four times the size of AR39 (Figure 1C and D; Table 1). Some of the C. pneumoniae LPCoLN inclusions exhibited lobes, which became more obvious by 36 h p.i (Figure 1E).

Comparison of LPCoLN and AR39 isolates at both 24 and 36 h p.i clearly showed that although the inclusions were much larger for LPCoLN (Table 1), there were fewer inclusions (one to four) per host cell, and multiple inclusions were no longer observed after 36 h p.i (Table 2). Multiple inclusions were more prevalent in AR39 infections (Figure 1D and F), with a range of one to ten inclusions per host cell (as late as 72 h p.i; Figure 1J; Table 2). Between 36 and 48 h p.i, there was a distinct increase in the number of cells containing inclusions, with approximately 90 to 100% of host cells infected in both isolates under investigation. Since there were fewer inclusions per host cell and a larger inclusion size for C. pneumoniae LPCoLN was observed when compared to AR39

(Table 1), it is likely that the LPCoLN inclusions had fused, giving rise to the lobular and heterogeneous morphologies (Figure 1E, G and I). In comparison, the multiple, spherically shaped and smaller AR39 inclusions appear to become fewer between 48 h and 72 h p.i, suggesting some fusion (Figure 1F, H and J).

Interestingly, at the later time points (48 and 72 h p.i), the fluorescence intensity indicative of LPS in the LPCoLN inclusions had decreased (Figure 1G

- 94 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

Figure 1. Confocal micrographs of C. pneumoniae: LPCoLN (a, c, e, g, i) and AR39 (b, d, f, h, j) inclusions labelled with FITC conjugated anti-Chlamydia LPS and counterstained host cells with Evans blue. Scale bars represent 20 µm.

- 95 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

Table 1. C. pneumoniae LPCoLN and AR39 inclusion

development in HEp-2 cells

LPCoLN AR39

Time Width Length # Inclusions Width Length # Inclusions hpi

12 2.7 ± 0.1 a 3.1 ± 0.1a ND b 1.3 ± 0.04 1.4 ± 0.04 ND

24 6.5 ± 0.3 8.7 ± 0.6 1-4 1.6 ± 0.05 1.7 ± 0.08 1-5

36 12.6 ± 0.8 18.9 ± 1.6 1-2 3.2 ± 0.1 3.4 ± 0.1 1-22

48 12.8 ± 0.5 23.8 ± 1.6 1 3.7 ± 0.2 4.5 ± 0.3 1-10c

72 17.7 ± 1.5 24.9 ± 1.9 1 7.0 ± 0.4 7.2 ± 0.5 1-10c

a Confocal measurements (mean ± standard error; n=50) of the width and length of inclusions (µm).

b Not determined.

c Several HEp-2 cells were infected with > 20 inclusions with no evidence of fusion at this stage.

Table 2. Ultrastructural differentiation of inclusion characteristics of

C. pneumoniae LPCoLN and AR39 isolates at 72 h p.i

C. pneumoniae Koala LPCoLN Human AR39

Inclusion size (µm) at 37ºC a W: 7.9 ± 0.3 L : 14.9 ± 0.6 W: 6.0 ± 2.7 L: 7.4 ± 3.6

Inclusion size (µm) at 32ºC a W: 7.7 ± 0.3 L: 13.2 ± 0.6 Not determined

Inclusion morphology Heterogeneous, lobular, round Spherical, round

Inclusion fusionb +++ +

EB morphology Round, irregular Round, pear-shape

EB size in diameter (µm) c 0.3 to 0.4 0.3 to 0.6

Average number of EBs d 332 ± 33c 120 ± 21

RB morphology Round Round

RB size in diameter (µm) c 0.5 to 1.0 0.5 to 1.0

a Mean ± standard error (n=80) of the width (W) and length (L) of inclusions.

b Likelihood of fusion on a scale of 1 (+) to 3 (+++).

c Range; n=100 at 37 ºC. d Mean ± standard error (n=30) at 37ºC.

- 96 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

and I), as did the intensity of AR39 inclusions (Figure 1H and J), but not to the extent of LPCoLN.

Quantitative genomic PCR was performed, and chlamydial genome copies were determined for C. pneumoniae LPCoLN and AR39 DNA samples isolated at 12, 18 and 24 h p.i, and then used to compute generation times. Transmission electron microscopy analysis of 30 individual inclusions at each time point showed that only RBs were present at this time, making the calculation of RB growth rate between these times valid. The interaction term in a mixed-effects analysis of variance statistical model of the quantitative data was significant (p < 0.001), thus invalidating the reporting of the main effects. Higher average copy numbers were observed for C. pneumoniae LPCoLN than for AR39, and a generation time of 3.4-4.8 h was determined for the former. In comparison, a longer generation time of 5.8-8.6 h was observed for AR39 when grown in HEp-2 cells.

Ultrastructural analysis of koala C. pneumoniae LPCoLN development

Transmission electron micrographs of HEp-2 infected cells were used to illustrate the C. pneumoniae LPCoLN developmental stages at 6 h, 12 h, 24 h, 36 h, 48 h

and 72 h p.i (Figure 2). The EBs remain within membrane-bound vacuoles (6 h

p.i; Fig 2A) once internalized to the host cytoplasm. Within the vacuole, the EBs

re-organise into the RB forms (6-12 h p.i), as evidenced by an increase in size

(from 0.3 to 0.6 μm). At 12 h p.i, the morphologically distinct RBs were present

and in the process of binary fission (Figure 2B). By 24 h p.i, the number of RBs

had increased considerably, with further evidence of binary fission, and absence

of EBs in the inclusion (Figure 2C). The LPCoLN RBs ranged from 0.5 to 1 μm in diameter, and occasionally large aberrant RBs (ABs) were also present, which

- 97 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

Figure 2. Transmission electron micrographs of koala C. pneumoniae inclusion development in HEp-2 cells: at 6 h (A), 12 h (B), 24 h (C), 36 h (D), 48 h (E) and 72 h p.i (F).

Arrows indicate intermediate bodies, arrow heads indicate elementary bodies, and asterisks * indicate binary fission. RB, reticulate body; NU, nucleus. Scale bars represent 500 nm.

- 98 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

ranged from 1.2 to 1.5 μm in size (Figure 2D; Table 2). At 36 h p.i some RBs showed evidence of reorganization to EBs via intermediate developmental forms

(Figure 2D). Evidence of this process occurred until 72 h p.i (Figure 2F).The

LPCoLN EB morphology was distinct from AR39 (Figure 3); typically round EBs

were dominant and ranged in size from 0.3 to 0.4 μm in diameter (Figure 3A;

Table 2). The LPCoLN EBs had eccentric electron-dense cores that were surrounded by a narrow or nonexistent periplasmic space, and contained either smooth or undulating cell membranes. By comparison, the AR39 EBs had a wider periplasmic space, creating the ‘pear-shaped’ appearance. Interestingly, at 36 h p.i, fusogenic inclusions were first visible in LPCoLN (Figure 4A and B), and 48 h p.i for AR39 (Figure 4C). At approximately 48 h p.i, the LPCoLN inclusion was maturing, with an increasing number of EBs filling the inclusion (Figure 2E).

Intermediate developing forms (IBs) of the RB to EB conversion were identified, along with some aberrant, larger RBs, and typical RBs, some of which were in the process of binary fission (also evidenced with AR39).

By 72 h, LPCoLN inclusions contained more EBs per inclusion, almost three-fold the number of AR39 EBs (Table 2). Again, the LPCoLN inclusions were large compared to AR39 (Table 2), and the LPCoLN fusogenic inclusion morphologies were heterogeneously shaped, and typically lobular in appearance, as also observed by confocal microscopy (Figure 1).

HEp-2 cells contain fusogenic chlamydial inclusions at 32ºC as well as

37ºC

Previous studies have demonstrated that a reduction in the culturing temperature of C. trachomatis prevents their ability to fuse multiple inclusions

together in a single host cell (Fields et al., 2002; Van Ooij et al., 1998). We

- 99 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

Figure 3. Transmission electron micrographs of C. pneumoniae LPCoLN (A) and AR39 (B) in HEp-2 cells at 72h p.i. LPCoLN elementary bodies are round in shape and have a narrow periplasmic space, whereas AR39 EBs are pear-shaped and have a wide periplasmic space. Arrows indicate intermediate bodies, arrow heads indicate elementary bodies. Scale bars represent 500 nm.

- 100 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

Figure 4. Transmission electron micrographs of C. pneumoniae LPCoLN at 36h p.i, and

AR39 at 48h p.i, in HEp-2 cells. Fusion was evident at 32ºC (a) and 37ºC (b) for the LPCoLN isolate, and at 37ºC (c) for AR39. Arrows indicate intermediate bodies, arrow heads indicate elementary bodies, arrows with closed circles indicate inclusion fusion points, and asterisks * indicate binary fission. RB, reticulate body; NU, nucleus. Scale bars represent 1 µm.

- 101 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

sought to investigate the possibility that the formation of separate, non- fusogenic C. pneumoniae LPCoLN inclusions may also occur, when cultured at

32ºC. A key morphological feature of the development for C. pneumoniae

LPCoLN was the high level of fusion of the inclusions at 37ºC (Figure 1). When

HEp-2 cells were infected with LPCoLN at 37ºC, single and multiple inclusions

were observed at 24 h p.i (Figure 1C), but multiple inclusions were not observed after 36 h p.i (Figure 1E, G and I). In comparison, in AR39-infected cultures, the level of fusion was approximately 30-40% and multiple inclusions were observed as late as 72 h p.i (Figure 1J). An ultrastructural analysis of LPCoLN samples incubated at 32ºC showed that LPCoLN fusion was not restricted to the higher temperature of 37ºC (Figure 4A). We observed comparable size (Table 2), morphological characteristics, and inclusion fusion at 32ºC (Figure 4A) as we did at 37ºC (Figure 4B). The exact time at which inclusion fusion occurred was not determined, although our results suggest that inclusion fusion occurs between

24 and 36 h p.i for LPCoLN when cultivated at both 32ºC and 37ºC.

Discussion

Despite the available sequence analysis of C. pneumoniae LPCoLN, surprisingly little is known about its growth rate and intracellular development. This study set out to characterize the growth patterns and morphological features of the koala

LPCoLN isolate in HEp-2 cells using the human C. pneumoniae AR39 isolate as a comparison. The genome equivalents per host cell determinations revealed that

LPCoLN multiplied at a much faster rate than AR39. We also observed similar growth characteristics of LPCoLN when grown in a mouse fibroblast (McCoy) cell line as we did in the HEp-2 cell line; large inclusions with round and lobular appearances, and ease of infection in vitro, (data not shown). A direct comparison of LPCoLN and AR39 isolates in HEp-2 cells revealed consistently

- 102 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

smaller inclusions for the AR39 isolate, despite the fact that AR39 was previously propagated in a human epithelial cell line (HEp-2).

Although AR39 development has been reported (Wolf et al., 2000), the

developmental events of an animal C. pneumoniae isolate has not been

characterised until this study. Our in vitro investigation of LPCoLN has confirmed

similar developmental characteristics to other chlamydial species, in terms of EB

to RB conversion, multiplication by binary fission, and re-differentiation of RBs to

EBs. Our results have confirmed that the pear-shape characteristic of C.

pneumoniae EBs (Chi et al., 1987) is not a valid criterion for differentiating the diverse isolates of C. pneumoniae. Several C. pneumoniae isolates fit the ‘pear- shaped’ criterion including: TW-183 (Chi et al., 1987), AR39 (Chi et al., 1987), and AC-43 (Yamazaki, 1992) due to the presence of a wide periplasmic space and wavy outer membrane. However, other C. pneumoniae isolates do not conform to the pear-shaped EB morphology, and instead, possess round outer membranes with a narrow periplasmic space including: LPCoLN (this study), giant barred frog (Berger et al., 1999), LKK-1 (Lee et al., 2003), YK-41

(Miyashita et al., 1993), KKpn-1 (Miyashita et al., 1993), IOL-207 (Carter et al.,

1991), and Kajaani-6 (Popov et al., 1991). The reasoning for a variable EB morphology is unclear, although variations in EB structure and composition may be important for attachment or adherence purposes in vivo.

In this study, we identified that the LPCoLN inclusion morphology is distinct from the inclusion morphology of human C. pneumoniae isolates, with LPCoLN being heterogeneous, and frequently appearing lobular. The lobular appearance of the

LPCoLN inclusion is unlike the lobed inclusions of the formerly known C. psittaci

(GPIC) strain, which consists of several distinct, multiple, non-fusogenic lobes that appear to be independent of one another (Rockey et al., 1996). Instead, the

- 103 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

lobular appearance of LPCoLN inclusions in HEp-2 infected cells appears to be the result of partial fusion of the smaller inclusions; the point of inclusion contact permits an open communication between the inclusions. As an alternative to fusing into one continuous morphology, the outer most structure of the former, multiple inclusions were retained, giving rise to the irregular and lobed appearance. The LPCoLN fusion event was supported by the absence of multiple inclusions at later time points, excluding, but not eliminating the possibility of inclusion division. However, unlike LPCoLN, there was an increase in the number of multiple inclusions between 24 and 48 h p.i for the AR39 isolate, addressing the possibility that inclusion division may be taking place during development. In spite of this, the number of multiple inclusions after 48 h of infection appears to be lessening with some evidence of fusion.

The trend in inclusion formation varies within chlamydial species, including C. trachomatis, C. pneumoniae, C. pecorum and C. psittaci. Multiple inclusions within a single host cell can arise from an initial infection with multiple EBs or via inclusion division. In most instances, these multiple inclusions have been shown to fuse together (Matsumoto et al., 1991) forming a single inclusion that continues to develop via the conventional developmental cycle. It has also been shown with several C. trachomatis isolates (including serovars D and E) and the

C. psittaci GPIC isolate, that the fusion process of these multiple inclusions does not always occur, and the several (often smaller) inclusions remain separately within the host cells (Rockey et al., 1996; Suchland et al., 2000). This strain- dependent requirement for fused inclusions is unknown, but may be advantageous for reasons including increased surface area for greater interaction with the host. One could reasonably argue that multiple inclusions would be beneficial in terms of maintaining viability due to a larger burst size.

- 104 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

Several authors have explored the inhibition of fusion at low temperatures, specifically 32°C, in which processes involved in inclusion fusion have been recognised as temperature dependent (Fields et al., 2002; Van Ooij et al.,

1998). The LPCoLN inclusions investigated in this study were fusogenic at both

32ºC and 37ºC; although further studies would be required to adequately

address the fusion phenomenon.

Growth rate comparisons were also of interest to our study given that

microscopy examinations identified LPCoLN development to be completed sooner

than AR39. Measurements of C. pneumoniae genomes provided evidence of a

faster growth rate (3.4-4.8 h), and justification for a more rapid completion of

the LPCoLN developmental cycle. We report here, an AR39 doubling time of 5.8-

8.6 h in HEp-2 cultures, and to our knowledge, this is the first report of AR39

doubling time. A study by Mannonen et al. (2004) estimated the doubling time of

a Kajaani-6 human C. pneumoniae isolate to be 6-7 h when cultured in HL cells.

The growth differences between the LPCoLN and human isolates may be host cell

specific or the result of genomic variation. Interestingly, a recent study by

Miyairi et al. (2006) reported differences in C. trachomatis generation times; 2.2

h (serovar D), 2.4 h (serovar L2), and 3.6 h (serovar A) (Miyairi et al., 2006). It

was suggested that genital strains acquire a more efficient attachment and

uptake process than ocular strains (Miyairi et al., 2006). Furthermore, another

study (Kari et al., 2008) compared the genomes of four trachoma strains of C. trachomatis, from which a small subset of variable genes were identified. A further comparison of two C. trachomatis serovar A strains (A/HAR-13 and

A2497) showed marked differences in growth rate and burst size in vitro, and the genetic differences correlated with pathogenicity among trachoma strains, as shown by ocular infection in vivo (Kari et al., 2008). Given that different growth rates were observed for C. pneumoniae LPCoLN (nasal) and AR39 (pharyngeal)

- 105 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

isolates in this study, it remains unknown whether the differences observed reflect the pathotype of the isolate or whether the differences are the result of animal or human strain variation. It is possible that variation in growth characteristics between the LPCoLN and AR39 isolates may be a reflection of adaptation to the intracellular environment. The possibility that C. pneumoniae was originally a zoonotic pathogen may suggest that the LPCoLN isolate has a broader host range than first anticipated.

Conclusion

This is the first study to characterize the developmental events of an animal C. pneumoniae strain. Our examinations of the koala C. pneumoniae LPCoLN isolate by confocal and transmission electron microscopy revealed an unusual chlamydial morphology with lobular features, and remarkable differences from that of human C. pneumoniae strains published in other studies. Together, these findings and the analysis of the first animal (koala) C. pneumoniae genome, will clarify many aspects of animal and human C. pneumoniae diversity, and may identify genes that enable particular C. pneumoniae isolates to successfully infect and cause disease in a range of hosts.

Acknowledgements

We would like to thank John Lai and Shreema Patel Merchant for technical assistance and advice with real-time PCR; Mitchell Lawrence for real-time PCR suggestions and providing the 18S rRNA control, Deb Stenzel for TEM assistance and Diana Battistutta for technical statistical advice.

- 106 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

References

Berger L, Volp K, Mathews S, Speare R and Timms P (1999). Chlamydia pneumoniae in a free-ranging giant barred frog (Mixophyes iteratus) from Australia. Journal of Clinical Microbiology. 37, 2378-2380.

Bodetti TJ, Jacobson E, Wan C, Hafner L, Pospischil A, Rose K and Timms P (2002). Molecular evidence to support the expansion of the hostrange of Chlamydophila pneumoniae to include reptiles as well as humans, horses, koalas and amphibians. Systematic and Applied Microbiology. 25, 146-152.

Carter MW, al-Mahdawi SA, Giles IG, Treharne JD, Ward ME and Clark IN (1991). Nucleotide sequence and taxonomic value of the major outer membrane protein gene of Chlamydia pneumoniae IOL-207. Journal of General Microbiology. 137, 465-475.

Chi EY, Kuo CC and Grayston JT (1987). Unique ultrastructure in the elementary body of Chlamydia sp. strain TWAR. Journal of Bacteriology. 169, 3757-3763.

Cox R, Kuo CC, Grayston T and Campbell LA (1988). Deoxyribonucleic acid relatedness of Chlamydia sp. strain TWAR to Chlamydia trachomatis and Chlamydia psittaci. International Journal of Systematic and Evolutionary Microbiology. 38, 265-268.

Devereaux LN, Polkinghorne A, Meijer A and Timms P (2003). Molecular evidence for novel chlamydial infections in the koala (Phascolarctos cinereus). Systematic and Applied Microbiology. 26, 245-253.

Fields KA, Fischer E and Hackstadt T (2002), Inhibition of Fusion of Chlamydia trachomatis Inclusions at 32°C Correlates with Restricted Export of IncA. Infection and Immunity. 70, 3816-3823.

Glassick TV (1994). A molecular analysis of koala Chlamydia psittaci isolates. Honours thesis. Queensland University of Technology, Infectious Diseases Research Group.

- 107 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

Glassick T, Giffard P and Timms P (1996). Outer membrane protein 2 gene sequence indicates that Chlamydia pecorum and Chlamydia pneumoniae cause infection in koalas. Systematic and Applied Microbiology. 19, 457-464.

Hotzel H, Grossmann E, Mutschmann F and Sachse K (2001). Genetic characterization of a Chlamydophila pneumoniae isolate from an African frog and comparison to currently accepted biovars. Systematic and Applied Microbiology. 24, 63-66.

Jackson M, White N, Giffard P and Timms P (1999). Epizootiology of Chlamydia infections in two free-range koala populations. Veterinary Microbiology. 65, 255– 264.

Kari L, Whitmire WM, Carlson JH, Crane DD, Revenau N, Nelson DE, Mabey DC, Bailey RL, Holland MJ, McClarty G and Caldwell HD (2008). Pathogenic Diversity among Chlamydia trachomatis ocular strains in nonhuman primates is affected by subtle genomic variations. The Journal of Infectious Diseases. 197, 449-456.

Kuo CC and Grayston JT (1988). Chlamydia spp. strain TWAR A newly recognized organism associated with atypical pneumonia and other respiratory infections. Clinical Microbiology News. 10, 137-144.

Kutlin A, Roblin PM, Kumar S, Kohlhoff S, Bodetti T, Timms P and Hammerschlag MR (2007). Molecular characterization of Chlamydophila pneumoniae isolates from Western barred bandicoots. Journal of Medical Microbiology. 56, 407-417

Lau P, Nixon SJ, Parton RG, Muscat GEO (2004). ROR regulates the expression of genes involved in lipid homeostasis in skeletal muscle cells. The Journal of Biological Chemistry. 279, 36828-36840.

Lee SJ, Nam EC, Won J, Park WS, Kim WJ, Han SS and Choi DJ (2003). Characterization of the first Korean isolate of a Chlamydia pneumoniae strain. Japanese Journal of Infectious Diseases. 56, 62-64.

Mannonen L, Camping E, Penttila T, Puolakkainen M (2004). IFN-γ induced persistent Chlamydia pneumoniae infection in HL and Mono Mac 6 cells:

- 108 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

characterization by real-time quantitative PCR and culture. Microbial Pathogenesis. 36, 41-50.

Markey B, Wan C, Hanger J, Phillips C and Timms P (2007). Use of quantitative real-time PCR to monitor the shedding and treatment of chlamydiae in the koala (Phascolarctos cinereus). Veterinary Microbiology. 120, 334-342.

Matsumoto A, Bessho H, Uehira K and Suda T (1991). Morphological studies of the association of mitochondria with chlamydial inclusions and the fusion of chlamydial inclusions. Journal of Electron Microscopy (Tokyo). 40, 356-363.

Miyairi I, Mahdi OS, Ouellette SP, Belland RJ, Byrne GI (2006). Different growth rates of Chlamydia trachomatis biovars reflect pathotype. The Journal of Infectious Diseases. 194,350-357.

Miyashita N, Kishimoto T, Soejima R and Matsumoto A (1993). Reactivity of Chlamydia pneumoniae strains in the IDEIA CHLAMYDIA test kit designed for detection of Chlamydia trachomatis. The Japanese Association for Infectious Diseases. 67, 549-555.

Miyashita N and Matsumoto N (2004). Morphology of Chlamydia pneumoniae. In: Chlamydia pneumoniae Infection and Disease: Infectious Agents and Pathogenesis. First edition. Edited by Friedman H, Yamamoto Y and Bendinelli M. New York: Klumer Academic/Plenum Publishers. pp.11-28.

Peeling RW and Brunham RC (1996). Chlamydiae as pathogens: new species and new issues. Emerging Infectious Diseases. 2, 307-319.

Popov VL, Shatkin AA, Pankratova VN, Smirnova NS, von Bonsdorff CH, Ekman MR, Mörttinen A and Saikku P (1991). Ultrastructure of Chlamydia pneumoniae in cell culture. FEMS Microbiology Letters. 84, 129-134.

Robards AW, Wilson AJ (1993). Basic biological preparation techniques for TEM. In: Procedures in electron microscopy. Edited by Robards AW and Wilson AJ. Procedures in electron microscopy. England: John Wiley and Sons Ltd. 5.1-5.6.

Rockey DD, Fischer ER and Hackstadt T (1996). Temporal Analysis of the

- 109 - Chapter 3: In vitro characterisation of koala Chlamydia pneumoniae: Morphology, inclusion development and doubling time

developing Chlamydia psittaci inclusion by use of fluorescence and electron microscopy. Infection and Immunity. 64, 4269-4278.

Storey CC, Lusher M, Yates P and Richmond SJ (1993). Evidence for Chlamydia pneumoniae of non-human origin. Journal of General Microbiology. 139, 2621- 2626.

Suchland RJ, Rockey DD, Bannantine JP and Stamm WE (2000). Isolates of Chlamydia trachomatis that occupy nonfusogenic inclusions lack IncA, a protein localized to the inclusion membrane. Infection and Immunity. 68, 360-367.

Van Ooij C, Homola E, Kincaid E and Engel J (1998). Fusion of Chlamydia trachomatis-containing inclusions is inhibited at low temperatures and requires bacterial protein synthesis. Infection and Immunity. 66, 5364-5371.

Wardrop S (1997). Genetic diversity of Chlamydia pecorum and Chlamydia pneumoniae infections in koalas. Honours thesis. Queensland University of Technology, Infectious Diseases Research Group.

Wardrop S, Fowler A, O’Callaghan P, Giffard P and Timms P (1999). Characterization of the koala biovar of Chlamydia pneumoniae at four gene loci-- ompAVD4, ompB, 16S rRNA, groESL spacer region. Systematic and Applied Microbiology. 22, 22-27.

Wolf K, Fischer E and Hackstadt T (2000). Ultrastructural analysis of developmental events in Chlamydia pneumoniae-infected cells. Infection and Immunity. 68, 2379-2385.

Yamazaki T (1992). Morphology and immunotyping of AC-43 strain of Chlamydia pneumoniae isolated from a Japanese child. The Japanese Association for Infectious Diseases. 66, 632-636.

Zhang JP and Stephens RS (1992). Mechanism of C. trachomatis attachment to eukaryotic cells. Cell. 69, 861-869.

- 110 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

CHAPTER FOUR

RESULTS

- 111 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

STATEMENTU OF JOINT AUTHORSHIP

the authors listed below have certified that:

1. they meet the criteria for authorship in that they have participated in the conception, execution, or

interpretation, or at least that part of the publication in their field of expertise;

2. they take public responsibility for their part of the publication, except for the responsible author who

accepts overall responsibility for the publication;

3. there are no other authors of the publication according to these criteria;

4. potential conflicts of interest have been disclosed to (a) granting bodies, and (b) the editor or

publisher of Journal of Bacteriology, and;

5. they agree to the use of the publication in the student’s thesis and its publication on the Australasian

Digital Thesis database consistent with any limitations set by publisher requirements.

In the case of this chapter:

Myers GSA, Mathews SA, Eppinger M, UMitchell C,U O’Brien KK, White OR, Benahmed F, Brunham RC,

Read TD, Ravel J, Bavoil PM and Timms P (2009). Evidence that human Chlamydia pneumoniae was

zoonotically acquired. Journal of Bacteriology. 191, 7225-7233.

Contributor Statement of Contribution

Garry Myers Secured funding; conceived, designed and supervised the sequencing, assembly and (first author) bioinformatics analysis; primary authorship of text

Sarah Mathews Extracted DNA for sequencing and contributed to analysis

Mark Eppinger Contributed to bioinformatics analysis

Candice Mitchell Contributed to analysis, conducted PCR and gene sequencing for koala EBB isolate, (candidate) critical reading and editing of analyses and text, approved final version of manuscript

Karen O’Brien Contributed to bioinformatics analysis

Owen White Contributed to bioinformatics analysis

Faiza Benahmed Contributed to sequencing and assembly

- 112 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

Robert Brunham Contributed to securing funding

Timothy Read Contributed to securing funding

Jacques Ravel Contributed to bioinformatics analysis

Patrik Bavoil Contributed to analysis and securing funding; critical reading and editing of analyses and text, approved final version of manuscript

Peter Timms Contributed to analysis and securing funding, supervision of analyses, primary authorship of text, critical reading and editing of analyses and text, approved final version of manuscript

- 113 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

CHAPTER FOUR

- 114 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

Introduction

Zoonotic infections from wildlife were recently suggested to be the most significant growing threat to global health of all the emerging infectious diseases

(Jones et al., 2008). Chlamydia comprises a group of obligate intracellular bacterial parasites responsible for a variety of diseases in humans and animals, including several zoonoses. In 1999, Everett et al. proposed a reassignment from the single genus Chlamydia into two genera, Chlamydia and

Chlamydophila, based on apparent differential clustering of the 16S rRNA genes

(Everett et al., 1999). This change has not been widely accepted by the chlamydial research community, thus reversion to the single genus Chlamydia was recently recommended (Stephens et al., 2009). Accordingly, we use the

Chlamydia nomenclature here.

Chlamydia pneumoniae (previously known as TWAR) was first recognized as a distinct species in 1988 (Cox et al., 1988) and is widespread in human populations causing acute respiratory disease, with effective human-to-human transmission by aerosol (Saikku, 1992). It has also been associated with several human chronic diseases, including asthma (Sutherland and Martin, 2007), atherosclerosis (Watson and Alp, 2008), stroke (Elkind and Cole, 2006) and late onset Alzheimer’s disease (Balin et al., 2008). C. pneumoniae was initially identified solely in humans; however its host range is now the most cosmopolitan of all the chlamydiae, encompassing both warm and cold-blooded animals such as horses, koalas and other marsupials, amphibians and reptiles

(Bodetti et al., 2002). Populations of the Australian koala (Phascolarctos cinereus) are widely infected with two species of Chlamydia: C. pecorum and C. pneumoniae (Bodetti et al., 2002). While C. pecorum infections are present at ocular and urogenital sites, C. pneumoniae infections are commonly found in the

- 115 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

koala respiratory tract linked to symptoms of respiratory disease (Wardrop et al.,

1999), which is consistent with acute human C. pneumoniae disease.

Transmission of C. pneumoniae between animals and humans has not been documented; however two other chlamydial species, C. psittaci and C. abortus, are well known zoonotic pathogens transmitted from birds and ruminants

(Longbottom and Coulter, 2003) that cause psittacosis, a life-threatening pneumonia, and abortion respectively. Here we propose on the basis of compelling genomic and phylogenetic evidence that C. pneumoniae, a major human pathogen that is essentially clonal, was originally derived from an animal source.

The genome sequences of four epidemiologically distinct human-derived C. pneumoniae isolates have previously been determined (Kalman et al., 1999;

Read et al., 2000; Shirai et al., 2000). These isolates are perceived as being genetically homogenous; this is supported by fewer than 300 single nucleotide polymorphisms (SNPs) scattered around the chromosome in no discernible pattern (Figure 1; Table 1). Such a degree of similarity between temporally and geographically disparate isolates supports a relatively recent clonal expansion of human C. pneumoniae isolates (Rattei et al., 2007) but is otherwise uninformative for deciphering the evolutionary origin(s) of this pathogen.

Accordingly, we sequenced the complete genome of the koala C. pneumoniae isolate LPCoLN, seeking molecular insight into host specificity, evolutionary origin and pathogenicity.

Materials and Methods

The koala C. pneumoniae LPCoLN isolate was originally isolated from a nasal swab of a captive koala showing signs of respiratory illness. C. pneumoniae was

- 116 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

Figure 1. Comparative analysis of sequenced C. pneumoniae genomes. Circular representation of C. pneumoniae genomes and analyses. For each genome, data are from outermost circle to innermost. Circles 1 and 2: Tick marks represent predicted coding sequences on the plus strand of C. pneumoniae AR39 and minus strand respectively, colored by cellular role. Role categories and colors are as follows: amino acid biosynthesis, violet; biosynthesis of cofactors, prosthetic groups and carriers, light blue; cell envelope, light green; cellular processes, red; central intermediary metabolism, brown; DNA metabolism, gold; energy metabolism, light gray; fatty acid and phospholipid metabolism, magenta; protein synthesis and fate, pink; biosynthesis of purines, pyrimidines, nucleosides and nucleotides, orange; regulatory functions and signal transduction, olive; transcription, dark green; transport and binding proteins, blue-green; other categories, salmon; unknown function, gray; conserved hypothetical proteins, blue; hypothetical proteins, black; Circles

- 117 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

3 and 4: Histogram of cumulative SNP density on the plus and minus strands respectively of the

LPCoLN genome compared to AR39, using a 5000bp window. Histogram coloring: <30 SNPs, red; 20-

29 SNPs, orange; 10-19 SNPs, yellow; 0-9 SNPs, light blue. Circles 5 and 6: Tick marks represent

SNP locations on the plus (green) and minus (red) strands respectively of the LPCoLN genome.

Circles 7 and 8: Tick marks represent SNP locations on the plus (green) and minus (red) strands respectively of the TW183 genome. Circles 9 and 10: Tick marks represent SNP locations on the plus

(green) and minus (red) strands respectively of the J138 genome. Circles 11 and 12: Tick marks represent SNP locations on the plus (green) and minus (red) strands respectively of the CWL-029 genome. Ten regions of high SNP accumulation in the LPCoLN genome versus AR39 are marked with light blue radial sections and numbered. Callouts: Detail of high SNP accumulation in regions III and

VI, showing SNP location and type (synonymous, green; non-synonymous, red) within PMP clusters

(from left to right, LPCoLN gene region: ORF00989 to ORF00956; AR39 gene region: CP_0280 to

CP_0309) and the PZ (LPCoLN gene region: ORF00689 to ORF00665; AR39 gene region: CP_0585 to CP_0622) respectively. Regions highlighted with gray boxes show SNP-associated CDS fragmentation.

Table 1. Total SNPs in sequenced C. pneumoniae genomes, using

C. pneumoniae AR39 as reference.

Isolate Host species # synonymous SNPS # non-synonymous SNPs Total SNPs

TW-183 Homo sapiens 120 164 284

CWL029 Homo sapiens 120 154 274

J138 Homo sapiens 62 145 207

LPCoLN Phascolarctos cinereus 3298 2915 6213

detected by PCR and gene sequencing, and LPCoLN was grown in vitro in HEp-2 cell monolayers. No other bacterium or virus was recovered from the nasal swab.

The complete genome sequence of C. pneumoniae LPCoLN was determined using the whole-genome shotgun method (Myers et al., 2007). Physical and sequencing gaps were closed using a combination of primer walking, generation

- 118 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

and sequencing of transposon-tagged libraries of large-insert clones, and multiplex PCR (Tettelin et al., 1999). Identification of putative protein-coding

genes and annotation of the genome were performed as previously described

(Myers et al., 2007). An initial set of coding sequences (CDSs) predicted to

encode proteins was identified with GLIMMER (Delcher et al., 1999). CDSs consisting of fewer than 30 codons were eliminated. Frame-shift and point mutations were corrected or designated “authentic”, as previously described

(Myers et al., 2007). Functional assignment, identification of membrane-

spanning domains, determination of paralogous gene families, and identification

of regions of unusual nucleotide composition were performed as previously

described (Myers et al., 2007). Sequence alignments were generated using the

methods described previously (Myers et al., 2007).

C. pneumoniae LPCoLN and the genomes of four previously sequenced human- derived C. pneumoniae isolates (Kalman et al., 1999; Read et al., 2000; Shirai et al., 2000) (GenBank accession numbers: CWL029, AE001363; TW-183,

AE009440; AR39, AE002161 and J138, BA000008) were compared at the nucleotide level by suffix tree analysis using MUMmer (Delcher et al., 2002) and the data parsed by custom Perl scripts. Predicted C. pneumoniae genes were compared by BLAST against the complete set of genes from other chlamydial genomes using an E-value cut-off of 10-5. Synteny and BLAST Score Ratio analyses were performed as previously described (Rasko et al., 2005).

High quality synonymous SNPs (sSNPs) were identified by comparing the predicted genes on the closed genome of C. pneumoniae strain AR39 with the

LPCoLN genome sequence using MUMmer (Delcher et al., 2002). A polymorphic site was considered high quality when its underlying sequence comprised at least

three sequencing reads with an average Phred quality score greater than 30

(Ewing et al., 1998). sSNPs in CWL029, TW183 and J138 were similarly

- 119 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

identified although no assessment of quality could be made, as quality scores are not available for these genomes. Concatenated sSNPs for the individual C. pneumoniae isolates were further analyzed by the HKY85 method (Hasegawa et al., 1985) with 200 bootstrap replicates, and the results used to generate an unrooted phylogenetic tree according to the PhyLM algorithms (Guindon et al.,

2005).

One hundred and eleven clusters of shared proteins, with a BLAST Score Ratio greater than, or equal to 0.8 (Rasko et al., 2005), were identified between all C. pneumoniae isolates, C. pecorum E58 (Myers et al., unpublished), C. muridarum

Nigg (Read et al., 2000) (GenBank: AE002160), C. caviae GPIC (28) (GenBank:

AE015925), C. psittaci 6BC (Myers et al., unpublished) and C. abortus S26/3

(Thomson et al., 2005) (GenBank: CR848038). Protein clusters were aligned using ClustalX (Thompson et al., 1997) and back translated into nucleotide alignments using TRANSALIGN, part of the EMBOSS software package (Rice et al., 2000). Concatenated aligned genes, spanning a total of 121,674 positions with a sequence similarity of 82.2% and identity of 58.8% were further analyzed by the HKY85 method (Hasegawa et al., 1985) with 200 bootstrap replicates, and the results used to generate an unrooted phylogenetic tree according to the

PhyLM algorithms (Guindon et al., 2005).

Results

C. pneumoniae LPCoLN possesses a single, circular chromosome of 1,241,024 base pairs (bp), slightly larger (by approximately 10 kb) than the human-derived

C. pneumoniae isolates. The small cryptic chlamydial plasmid (7,655 bp) that is absent from all characterized human C. pneumoniae isolates, is present in the koala strain, and is highly conserved with previously published chlamydial

- 120 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

plasmid sequences. LPCoLN has 1,095 predicted coding sequences (CDSs), with

988 (90.2%) CDSs conserved with human C. pneumoniae isolate AR39, 14

(1.3%) divergent and 93 unique relative to AR39 (Figure 1; Table 2). Most unique CDSs encode hypothetical proteins with no currently discernible function

(Supplementary Table 1).

Comparative genomic and proteomic analyses (Rasko et al., 2005) show that the

LPCoLN genome is highly similar and syntenic with the four sequenced human- derived isolates (Supplementary Figure 1). However, unlike the small number of

SNPs found between the human-derived isolates, 6213 SNPs (3298 synonymous and 2915 non-synonymous) separate the genomes of LPCoLN and human isolate

AR39 (Tables 1; Table 3). Phylogenetic analysis of all C. pneumoniae isolates based on SNPs (Figure 2) and 111 highly conserved genes from across all sequenced animal chlamydial genomes (Figure 3) indicate that LPCoLN is basal to the sequenced C. pneumoniae isolates from humans. Thus, while LPCoLN is a

contemporary isolate, phylogeny places it closer to a presumptive ancestor of

the C. pneumoniae isolates found in human populations.

The genome-wide SNP distribution observed in the koala isolate compared to the

human-derived isolates provides further evidence for a zoonotic origin of C.

pneumoniae recovered from humans. There are ten noteworthy regions of SNP

accumulation (Figure 1; Figure 4), representing genomic “hotspots” that are

likely evolving at different rates in C. pneumoniae from koalas and humans.

Notably, many of the human isolates’ CDSs within these hotspots are truncated

or fragmented relative to LPCoLN, suggesting ongoing gene decay processes,

with presumed concomitant loss of function in human-derived C. pneumoniae.

Several of these hotspots encode known virulence or metabolic factors that

display sequence polymorphisms and are variably represented in other

- 121 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

Table 2. Breakdown of predicted protein orthologs in all human-derived

C. pneumoniae genomes, compared to C. pneumoniae LPCoLN using the

Blast Score Ratio method (Rasko et al., 2005).

Conserved (≥0.5) Unique (≤0.4) Divergent (< 0.5 & > 0.4) Total

LPCoLN vs. AR39 988 93 14 1095

LPCoLN vs. TW138 989 93 13 1095

LPCoLN vs. CWL029 955 127 13 1095

LPCoLN vs. J138 982 98 15 1095

Table 3. Total (a) Synonymous and (b) Nonsynonymous SNPs identified

between C. pneumoniae genomes, showing shared (italics) and

separating unique (bold) SNPs.

(a)

AR39 LPCoLN TW-183 CWL029 J138

LPCoLN 2969 47 43 6

TW-183 105 2980 (2922/58) 41 3

CWL029 103 2986 (2926/60) 126 (64/62) 6

J138 58 3015 (2963/52) 157 (102/55) 149 (97/52)

(b)

AR39 LPCoLN TW-183 CWL029 J138

LPCoLN 2435 80 70 18

TW-183 144 2419 (2355/64) 70 17

CWL029 125 2420 (2365/70) 123 (71/51) 17

J138 128 2527 (2417/1100 238 (127/111) 219 (108/111)

SNPs were identified in three-way genome comparisons in respect to the CDS of the reference strain C. pneumoniae AR39. The individual branch lengths of the separating SNPs are given in parenthesis.

- 122 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

Figure 2. Synonymous SNP phylogenetic tree using all sequenced C. pneumoniae genomes.

The number of separating sSNPs is denoted on each branch.

chlamydial strains display sequence polymorphisms and are variably represented in other chlamydial strains and species, including the polymorphic membrane protein (Pmp) family, secreted type III secretion (T3S) effectors, and enzymes involved in the biosynthesis of chorismate, a precursor of aromatic amino acids

(Figure 1; Figure 4). Gene truncation and fragmentation is also evident at several of these loci within the human-derived isolates, suggesting that microevolutionary processes are also ongoing in human C. pneumoniae. Of the human isolates, CWL029 consistently exhibits a higher degree of gene truncation and fragmentation in several hotspots; AR39 shows the least,

- 123 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

Figure 3. Phylogeny of all animal chlamydiae and C. pneumoniae, using 111 highly conserved gene clusters. The host range for each species is noted in parentheses; the known chlamydial zoonotic agents are boxed. The bootstrap value at each branch point is 100% unless otherwise denoted.

with TW-183 and J138 being intermediate. The largest SNP hotspot corresponds to the “plasticity zone” (PZ), a region that encapsulates much of the sequence diversity in all chlamydial genomes (Read et al., 2003). The PZ, which has been shown to contain host and/or tissue specific genes in other chlamydial species

- 124 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

(Read et al., 2000; Read et al.,2003), appears to be fully intact in the koala

isolate but is highly fragmented in all sequenced human-derived C. pneumoniae

isolates. While many small CDSs appear to be unique to human-derived C.

pneumoniae, comparison to LPCoLN reveals that several of these are actual

remnants of four larger genes (Figure 1) that are part of a previously unknown

11-member gene family encoding predicted membrane-bound proteins with

predicted membrane spanning domains.

There are only three genes of known function that are present in the human

isolates and absent from LPCoLN: guaB, guaA and add, required for the

synthesis of guanosine 5'-monophosphate, a precursor for the synthesis of

guanine nucleoside triphosphates, located in the PZ of the human-derived C.

pneumoniae isolates. However, in three of the four human isolates, guaB is

fragmented, indicating that it is presumably not essential for human infection.

Such gene fragmentation patterns are only observed in the genomes of human

isolates, and are only discernible by comparison to the koala LPCoLN genome.

This unidirectional pattern of gene fragmentation seen throughout the human-

derived C. pneumoniae genomes not only supports the phylogenetic analyses

(Figure 2; Figure 3), suggesting that animal-derived C. pneumoniae predates

human-derived C. pneumoniae, but also suggests that animals were the original

hosts for C. pneumoniae.

Discussion

Prior to this study, C. pneumoniae genome sequences were only available for four isolates, all of human origin. These genomes showed surprisingly high similarity, with an approximate total of only 300 SNPs between them. Such a high degree of genomic conservation has been hypothesized to be evidence that

- 125 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

Figure 4. Annotated detail of additional regions shown in Figure 1 with high SNP accumulation, showing SNP location and type (synonymous, green; non-synonymous, red).

Colours are used to distinguish notable annotated genes in each region. Regions highlighted with gray boxes show SNP-associated CDS fragmentation. The icon to the left of each region denotes the approximate location of each region as shown in Figure 1.

- 126 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

Figure 4. Annotated detail of additional regions shown in Figure 1 with high SNP accumulation, showing SNP location and type (synonymous, green; non-synonymous, red).

Colours are used to distinguish notable annotated genes in each region. Regions highlighted with gray boxes show SNP-associated CDS fragmentation. The icon to the left of each region denotes the approximate location of each region as shown in Figure 1.

- 127 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

Figure 4. Annotated detail of additional regions shown in Figure 1 with high SNP accumulation, showing SNP location and type (synonymous, green; non-synonymous, red).

Colours are used to distinguish notable annotated genes in each region. Regions highlighted with gray boxes show SNP-associated CDS fragmentation. The icon to the left of each region denotes the approximate location of each region as shown in Figure 1.

- 128 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

Figure 4. Annotated detail of additional regions shown in Figure 1 with high SNP accumulation, showing SNP location and type (synonymous, green; non-synonymous, red).

Colours are used to distinguish notable annotated genes in each region. Regions highlighted with gray boxes show SNP-associated CDS fragmentation. The icon to the left of each region denotes the approximate location of each region as shown in Figure 1.

- 129 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

Figure 4. Annotated detail of additional regions shown in Figure 1 with high SNP accumulation, showing SNP location and type (synonymous, green; non-synonymous, red).

Colours are used to distinguish notable annotated genes in each region. Regions highlighted with gray boxes show SNP-associated CDS fragmentation. The icon to the left of each region denotes the approximate location of each region as shown in Figure 1.

- 130 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

Figure 4. Annotated detail of additional regions shown in Figure 1 with high SNP accumulation, showing SNP location and type (synonymous, green; non-synonymous, red).

Colours are used to distinguish notable annotated genes in each region. Regions highlighted with gray boxes show SNP-associated CDS fragmentation. The icon to the left of each region denotes the approximate location of each region as shown in Figure 1.

- 131 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

C. pneumoniae was recently transmitted to humans followed by a rapid spread throughout human populations, giving little opportunity for genomic changes.

This level of homology within C. pneumoniae is in contrast to the degree of genetic variability seen in the other chlamydial species, in particular C. trachomatis, which is thought to have infected humans throughout human evolution (Carlson et al., 2005; Kari et al., 2005; Stephens et al., 1998;

Thomson et al., 2008). The host range of C. pneumoniae has been expanded significantly in the last 10 years with infections reported in horses (Stephens et al., 2009), reptiles (Bodetti et al., 2002), amphibians (Berger et al., 1999;

Bodetti et al., 2002; Hotzel et al., 2001) and several Australian marsupials, including koalas (Wardrop et al., 1999) and bandicoots (Kutlin et al., 2007).

Previous DNA sequence comparisons have focused on 16S rRNA and ompA genes. While these analyses have revealed differences between strains of human and animal origins, these differences have been minimal and relatively uninformative with regard to determinants of host specificity. Our whole-genome analysis of the koala LPCoLN isolate of C. pneumoniae has enabled insight into the genetic differences between animal and human-derived C. pneumoniae, and the putative evolutionary events that have governed the spread of this organism and shows that human isolates of C. pneumoniae exhibit more heterogeneity than previously thought.

The chlamydial cryptic plasmid is present in some chlamydial species, including

C. pneumoniae N16 isolated from horses (Pickett et al., 2005) but is absent from others. The role of the plasmid in chlamydial biology is still largely unknown. All human-derived C. pneumoniae isolates studied to date lack the plasmid, however, the koala isolate carries a full-length chlamydial plasmid, encoding all eight CDSs described in other chlamydial cryptic plasmids. Mitchell et al. (2009) reported a much faster growth rate in vitro for the koala LPCoLN isolate

- 132 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

compared to the human isolate AR39 - it is possible that one or more of the genes present on the cryptic plasmid may account for this faster growth rate.

The most compelling evidence to support that LPCoLN is either ancestral, or closely related to an ancestral form of C. pneumoniae human isolates, is the

presence of several putatively full-length CDSs in LPCoLN, which are fragmented

in human-derived C. pneumoniae, forming clusters of pseudogenes (Figure 1;

Figure 4). The MAC/perforin gene, which has been associated with virulence in

other intracellular pathogens including Toxoplasma (Kafsack et al., 2009) and

Plasmodium (Ishino et al., 2005), is a 2,457 bp CDS in LPCoLN, but is partially

truncated in all four human-derived isolates due to an 840 bp deletion towards

the 5’ end. Although the function of chlamydial MAC/perforin is currently

unknown, we predict that it may be involved in host cell egression and invasion

similar to Toxoplasma. The truncated version seen in the human isolates may

then reflect adaptation to a specific niche within humans.

All pmpE and pmpG orthologs are intact in the koala strain but are fragmented in

several of the human isolates (Figure 1). The Pmp family of proteins is

considered to represent the expansion of progenitor proteins proposed to be

involved in key roles such as adherence, immune evasion and proinflammatory

responses. In addition, orthologs of the Inc family of proteins are also

extensively fragmented in the human isolates (Figure 4). Inc proteins are a

diverse family of chlamydial type III secreted effectors; incA has been localized

to the outer face of the inclusion membrane and is involved in the homotypic

fusion of multiple inclusions of C. trachomatis. The apparent ongoing loss of

several functional pmp and inc genes in the human-derived isolates of C.

pneumoniae again suggests an adaptation to the human host. It is conceivable

that different Pmp and Inc profiles confer differential niche specificity in different

- 133 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

hosts. The fragmentation of functional pmp and inc alleles in human-derived C. pneumoniae may therefore represent an example of convergent evolution of the two species in response to properties that are specific to humans (e.g. a more effective immune response against PmpE antigens in humans or the relative unavailability of cell surface receptors to PmpE in humans vs. koalas).

Taken together, our analysis of the koala C. pneumoniae LPCoLN genome sequence, combined with phylogenetic analyses of all C. pneumoniae SNPs and the conserved chlamydial CDSs, the patterns of CDS fragmentation and plasmid loss in human-derived C. pneumoniae isolates provides strong evidence that human isolates of C. pneumoniae have derived from zoonotic C. pneumoniae, supporting the conclusion of the selected SNP analysis of Rattei et al. (2007).

Thus we propose that C. pneumoniae was originally an animal pathogen that crossed the species barrier to humans through ongoing reductive evolutionary processes and has adapted to the point where human isolates of C. pneumoniae no longer require an animal reservoir for transmission.

A limitation of our study is that it is based on the genome sequence of only one animal-derived C. pneumoniae isolate, the koala LPCoLN strain and of four human-derived C. pneumoniae isolates. Hence, key questions such as how many times has this host species jump occurred before terminal adaptation or from which specific animal host the human-derived C. pneumoniae actually originated cannot be addressed with this dataset alone. In addition to the full genome sequence from the LPCoLN isolate of koala C. pneumoniae, we also obtained and analysed a second koala C. pneumoniae isolate, EBB. This isolate was obtained from a pharyngeal swab from a koala in a wild population from a geographically separate location than LPCoLN. Nine genes were sequenced from the EBB isolate and in all cases the sequences were 100% identical to the sequences

- 134 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

obtained from the koala C. pneumoniae LPCoLN isolate (data not shown).

The koala C. pneumoniae LPCoLN isolate has been relatively well characterized previously in regards to morphological and in vitro growth characteristics. Coles et al. (2001) reported that LPCoLN produced large inclusions in both human and koala monocytes and in HEp-2 cells. Koala C. pneumoniae was able to induce foam cell formation both with and without added low-density lipoprotein, in contrast to TW183, which produced increased foam cell formation only in the presence of low-density lipoprotein. More recently, Mitchell et al. (2009) compared the in vitro growth characteristics of LPCoLN with the human isolate

AR39. LPCoLN displayed inclusions of size and morphology clearly distinct from those of the human isolate, and had a much faster doubling time (3.4-4.9 hr versus 5.9-8.7 h) when grown in HEp2 cell monolayers. Rates of inclusion fusion were also much higher with LPCoLN (100%) than with AR39 (30-40%). These biological differences between koala and human-derived C. pneumoniae are consistent with the range of genomic differences that we have identified in this work. Such phenotypic studies demonstrate the compensatory power of comparative pathogenomics in a genetically intractable organism such as C. pneumoniae. Moreover the ability to compare genome sequences of organisms infecting different hosts provides “snapshots” of the evolutionary process as if frozen in time. The search is now on to find C. pneumoniae isolates from animals that are most closely related to human-derived isolates, as this will better indicate when this host species jump may have occurred.

Our findings indicate that the high prevalence and disease burden of C. pneumoniae in humans may represent a major evolutionary and public health corollary of zoonotic infections - the emergence of a full-fledged human pathogen, transmitted without the original animal vector, causing substantial

- 135 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

acute and chronic disease sequelae.

Acknowledgements

This work was supported by the National Institute of Allergy and Infectious

Disease grant 1R01AI051472. We thank the former TIGR and current IGS

Faculty, the TIGR/IGS Informatics group for expert advice and assistance, and the JCVI Sequencing Facility.

The sequences of the C. pneumoniae LPCoLN chromosome and plasmid have been deposited in GenBank with the accession numbers CP001713 and

CP001714 respectively.

- 136 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

References

Balin BJ, Little CS, Hammond CJ, Appelt DM, Whittum-Hudson JA, Gérard and Hudson AP (2008). Chlamydophila pneumoniae and the etiology of late-onset Alzheimer's disease. Journal of Alzheimer's Disease. 13, 371-380.

Berger L, Volp K, Mathews S, Speare R and Timms P (1999). Chlamydia pneumoniae in a free-ranging giant barred frog (Mixophyes iteratus) from Australia. Journal of Clinical Microbiology. 37, 2378-2380.

Bodetti TJ, Jacobson E, Wan C, Hafner L, Pospischil A, Rose K and Timms P (2002). Molecular evidence to support the expansion of the hostrange of Chlamydophila pneumoniae to include reptiles as well as humans, horses, koalas and amphibians. Systematic and Applied Microbiology. 25, 146-152.

Carlson JH, Porcella SF, McClarty G and Caldwell HD (2005). Comparative genomic analysis of Chlamydia trachomatis oculotropic and genitotropic strains. Infection and Immunity. 73, 6407-6418.

Coles KA, Timms P and Smith DW (2001). Koala biovar of Chlamydia pneumoniae infects human and koala monocytes and induces increased uptake of lipids in vitro. Infection and Immunity. 69, 7894-7897.

Cox R, Kuo CC, Grayston T and Campbell LA (1988). Deoxyribonucleic acid relatedness of Chlamydia sp. strain TWAR to Chlamydia trachomatis and Chlamydia psittaci. International Journal of Systematic and Evolutionary Microbiology. 38, 265-268.

Delcher AL, Kasif S, Fleischmann RD, Peterson J, White O and Salzberg SL (1999). Alignment of whole genomes. Nucleic Acids Research. 27, 2369-2376.

Delcher AL, Phillippy A, Carlton J and Salzberg SL (2002). Fast algorithms for large-scale genome alignment and comparison. Nucleic Acids Research. 30, 2478-2483.

Elkind MS and Cole JW (2006). Do common infections cause stroke? Seminars in

- 137 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

Neurology. 26, 88-99.

Everett KDE, Bush RM and Andersen AA (1999). EmendedH description of the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards for

the identification of organisms.H International Journal of Systematic and Evolutionary Bacteriology. 49, 415-440.

Ewing B, Hillier L, Wendl MC and Green P (1998). Base-calling of automated sequencer traces using phred. I. Accuracy assessment. Genome Research. 8, 175-85.

Guindon S, Lethiec F, Duroux P and O. Gascuel (2005). PHYML Online--a web server for fast maximum likelihood-based phylogenetic inference. Nucleic Acids Research. 33, W557-W559.

Hasegawa, M., H. Kishino, and T. Yano (1985). Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evoluton. 22, 160-174.

Hotzel H, Grossmann E, Mutschmann F and Sachse K (2001). Genetic characterization of a Chlamydophila pneumoniae isolate from an African frog and comparison to currently accepted biovars. Systematic and Applied Microbiology. 24, 63-66.

Ishino T, Chinzei Y and Yuda M (2005). A Plasmodium sporozoite protein with a membrane attack complex domain is required for breaching the liver sinusoidal cell layer prior to hepatocyte infection. Cellular Microbiology. 7, 199-208.

Jones KE, Patel NG, Levy MA, Storeygard A, Balk D, Gittleman JL and Daszak P (2008). Global trends in emerging infectious diseases. Nature. 451, 990-993.

Kafsack BF, Pena JD, Coppens I, Ravindran S, Boothroyd JC and Carruthers VB (2009). Rapid membrane disruption by a perforin-like protein facilitates parasite exit from host cells. Science. 323, 530-533.

- 138 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

Kalman S, Mitchell W, Marathe R, Lammel C, Fan J, Hyman RW, Olinger L, Grimwood J, Davis RW and Stephens RS (1999). Comparative genomes of Chlamydia pneumoniae and C. trachomatis. Nature Genetics. 21, 385-389.

Kari L, Whitmire WM, Carlson JH, Crane DD, Revenau N, Nelson DE, Mabey DC, Bailey RL, Holland MJ, McClarty G and Caldwell HD (2008). Pathogenic Diversity among Chlamydia trachomatis ocular strains in nonhuman primates is affected by subtle genomic variations. The Journal of Infectious Diseases. 197, 449-456.

Kutlin A, Roblin PM, Kumar S, Kohlhoff S, Bodetti T, Timms P and Hammerschlag MR (2007). Molecular characterization of Chlamydophila pneumoniae isolates from Western barred bandicoots. Journal of Medical Microbiology. 56, 407-417

Longbottom D and Coulter LJ (2003). Animal chlamydioses and zoonotic implications. Journal of Comparative Pathology. 128, 217-244.

Mitchell CM, Mathews SA, Theodoropoulos C and Timms P (2009). In vitro characterisation of koala Chlamydia pneumoniae: morphology, inclusion development and doubling time. Veterinary Microbiology. 136, 91-99.

Myers GS, Parker D, Al-Hasani K, Kennan RM, Seemann T, Ren Q, Badger JH, Selengut JD, Deboy RT, Tettelin H, Boyce JD, McCarl VP, Han X, Nelson WC, Madupu R, Mohamoud Y, Holley T, Fedorova N, Khouri H, Bottomley SP, Whittington RJ, Adler B, Songer JG, Rood JI and Paulsen IT (2007). Genome sequence and identification of candidate vaccine antigens from the animal pathogen Dichelobacter nodosus. Nature Biotechnology. 25, 569-575.

Pickett MA, Everson JS, Pead PJ and Clarke IN (2005). The plasmids of Chlamydia trachomatis and Chlamydophila pneumoniae (N16): accurate determination of copy number and the paradoxical effect of plasmid-curing agents. Microbiology. 151, 893-903.

Rasko DA, Myers GS and Ravel J (2005). Visualization of comparative genomic analyses by BLAST score ratio. BMC Bioinformatics. 6, 2.

Rattei T, Ott S, Gutacker M, Rupp J, Maass M, Shreiber S, Solbach W, Wirth T and Gieffers J (2007). Genetic diversity of the obligate intracellular bacterium

- 139 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

Chlamydophila pneumoniae by genome-wide analysis of single nucleotide polymorphisms: evidence for highly clonal population structure. BMC Genomics. 8, 355.

Read TD, Brunham R, Shen C, Gill S, Heidelberg J, White O, Hickey E, Peterson J, Utterback T, Berry K, Bass S, Linher K, Weidman J, Khouri H, Craven B, Bowman C, Dodson R, Gwinn M, Nelson W, DeBoy R, Kolonay J, McClarty G, Salzberg S, Eisen J and Fraser C (2000). Genome sequences of Chlamydia trachomatis MoPn and Chlamydia pneumoniae AR39. Nucleic Acids Research. 28, 1397-1406.

Read TD, Myers GS, Brunham RC, Nelson WC, Paulsen IT, Heidelberg J, Holtzapple E, Khouri H, Federova NB, Carty HA, Umayam LA, Haft DH, Peterson J, Beanan MJ, White O, Salzberg SL, Hsia RC, McClarty G, Rank RG, Bavoil PM, Fraser CM (2003). Genome sequence of Chlamydophila caviae (Chlamydia psittaci GPIC): examining the role of niche-specific genes in the evolution of the Chlamydiaceae. Nucleic Acids Research. 31, 2134-2147.

Rice P, Longden I and Bleasby A (2000). EMBOSS: the European Molecular Biology Open Software Suite. Trends in Genetics. 16, 276-277.

Saikku P (1992). The epidemiology and significance of Chlamydia pneumoniae. Journal of Infection. 24, 27-34.

Shirai M, Hirakawa H, Kimoto M, Tabuchi M, Kishi F, Ouchi K, Shiba T, Ishii K, Hattori M, Kuhara S and Nakazawa T (2000). Comparison of whole genome sequences of Chlamydia pneumoniae J138 from Japan and CWL029 from USA. Nucleic Acids Research. 28, 2311-2314.

Stephens RS, Kalman S, Lammel C, Fan J, Marathe R, Aravind L, Mitchell W, Olinger L, Tatusov RL, Zhao Q, Koonin EV and Davis RW (1998). Genome sequence of an obligate intracellular pathogen of humans: Chlamydia trachomatis. Science. 282, 754-759.

Stephens RS, Myers G, Eppinger M and Bavoil P (2009). Divergence without difference: phylogenetics and taxonomy of Chlamydia resolved. FEMS immunology and medical microbiology. 55, 115-119.

- 140 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

Storey CC, Lusher M, Yates P and Richmond SJ (1993). Evidence for Chlamydia pneumoniae of non-human origin. Journal of General Microbiology. 139, 2621- 2626.

Sutherland ER and Martin RJ (2007). Asthma and atypical bacterial infection. Chest Journal. 132, 1962-1966.

Tettelin H, Radune D, Kasif S, Khouri H and Salzberg SL (1999). Optimized multiplex PCR: efficiently closing a whole-genome shotgun sequencing project. Genomics. 62, 500-507.

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F and Higgins DG (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research. 25, 4876- 4882.

Thomson NR, Yeats C, Bell K, Holden MTG, Bentley SD, Livingstone M, Cerdeno- Tarraga AM, Harris B, Doggett J, Ormond D, Mungall K, Clarke K, Feltwell T, Hance Z, Sanders M, Quail MA, Price C, Barrell BG, Parkhill J and Longbottom D (2005). The Chlamydophila abortus genome sequence reveals an array of variable proteins that contribute to interspecies variation. Genome Research. 15, 629-640.

Wardrop S, Fowler A, O’Callaghan P, Giffard P and Timms P (1999). Characterization of the koala biovar of Chlamydia pneumoniae at four gene loci-- ompAVD4, ompB, 16S rRNA, groESL spacer region. Systematic and Applied Microbiology. 22, 22-27.

Watson C and Alp NJ (2008). Role of Chlamydia pneumoniae in atherosclerosis. Clinical Science (London). 114, 509-531.

- 141 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

Supplementary files

Supplementary Figure 1. Synteny plots derived using the BLAST Score Ratio method

(Rasko et al., 2005). (A) LPCoLN vs. AR39; (B) LPCoLN vs. CWL029; (C) LPCoLN vs. TW-183; (D)

LPCoLN vs. J138. Each plot point represents a single peptide in the indicated C.pneumoniae genome pair. The color of each point indicates the level of similarity of that peptide in each genome pair

(Rasko et al., 2005).

- 142 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

Supplementary Table 1. Unique C. pneumoniae LPCoLN CDSs identified

by BSR analysis (BSR ≤ 0.4) compared to C. pneumoniae AR39

LPCoLN AR39 BSR CDS Description (LPCoLN)

ORF00575 ORFA00117 0.397790055 hypothetical protein

ORF00875 ORFA00239 0.39122807 hypothetical protein

ORF01039 ORFA00274 0.386925795 hypothetical protein

ORF00836 ORFA00968 0.378787879 hypothetical protein

ORF00288 ORFA00794 0.373534338 hypothetical protein

ORF00545 ORFA01253 0.372580645 hypothetical protein

ORF00555 ORFA01322 0.371816638 hypothetical protein

ORF00588 ORFA00220 0.368595041 hypothetical protein

ORF00577 ORFA00190 0.361464968 hypothetical protein

ORF00986 ORFA00179 0.360534125 hypothetical protein

ORF00728 ORFA00468 0.356716418 hypothetical protein

ORF00658 ORFA00120 0.352852853 hypothetical protein

ORF00683 ORFA01179 0.346774194 hypothetical protein

ORF01023 ORFA00054 0.341880342 hypothetical protein

ORF01009 ORFA00505 0.34015748 hypothetical protein

ORF00496 ORFA01339 0.331797235 hypothetical protein

ORF00056 ORFA00510 0.33081571 hypothetical protein

ORF00193 ORFA01270 0.328947368 hypothetical protein

ORF00687 ORFA01162 0.326572008 conserved hypothetical protein

ORF00865 ORFA00885 0.321985816 hypothetical protein

ORF00137 ORFA00416 0.321483771 hypothetical protein

ORF00342 ORFA00006 0.320474777 hypothetical protein

ORF00618 ORFA01229 0.319942611 hypothetical protein

ORF00752 ORFA00494 0.315629742 hypothetical protein

ORF00507 ORFA01400 0.31085044 hypothetical protein

- 143 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

ORF00722 ORFA00257 0.310638298 hypothetical protein

ORF00079 ORFA00989 0.308423913 putative lipoprotein

ORF00881 ORFA01052 0.30758427 hypothetical protein

ORF00882 ORFA01141 0.307219662 hypothetical protein

ORF00934 ORFA01237 0.307219662 hypothetical protein

ORF00995 ORFA01213 0.304477612 hypothetical protein

ORF00529 ORFA01183 0.304160689 hypothetical

ORF00117 ORFA01237 0.302670623 conserved hypothetical protein

ORF00095 ORFA00753 0.296346414 hypothetical protein

ORF00295 ORFA00417 0.295426452 hypothetical protein

ORF00791 ORFA01014 0.294232649 hypothetical protein

ORF00595 ORFA01226 0.290502793 hypothetical protein

ORF00980 ORFA00372 0.290502793 hypothetical protein

ORF01072 ORFA00198 0.28961039 hypothetical protein

ORF00389 ORFA00924 0.287024902 hypothetical protein

ORF00397 ORFA00991 0.274044796 hypothetical protein

ORF00891 ORFA01259 0.265776699 hypothetical protein

ORF00681 ORFA01184 0.255847953 hypothetical protein

ORF00015 ORFA00679 0.252631579 hypothetical protein

ORF00571 ORFA00781 0.25145518 hypothetical protein

ORF00957 ORFA00592 0.245654693 hypothetical protein

ORF00660 ORFA01208 0.235470942 hypothetical protein

ORF00449 ORFA00461 0.22038835 hypothetical protein

- 144 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

ORF00682 ORFA01182 0.220186335 conserved hypothetical protein

ORF00932 ORFA00418 0.217272727 hypothetical protein

ORF00297 ORFA01322 0.216 hypothetical protein

ORF00490 ORFA00105 0.21588785 hypothetical protein

ORF00361 ORFA00662 0.212149533 hypothetical protein

ORF01093 ORFA01248 0.209631728 translation releasing factor RF-2, programmed frameshift

ORF00964 ORFA00195 0.208416834 hypothetical protein

ORF00678 ORFA01134 0.202247191 conserved hypothetical protein

ORF00714 ORFA01187 0.201331115 hypothetical protein

ORF00119 ORFA01268 0.195535714 hypothetical protein

ORF00369 ORFA00320 0.177391304 conserved hypothetical protein

ORF00341 ORFA01307 0.174644243 hypothetical protein

ORF00715 ORFA01187 0.169781931 hypothetical protein

ORF00913 ORFA00440 0.147887324 RNA pseudouridine synthase family protein

ORF00437 ORFA00058 0.145321637 integral membrane protein, MarC family

ORF00153 ORFA00670 0.143243243 conserved hypothetical protein

ORF00553 ORFA01332 0.129109589 hypothetical protein

ORF00894 ORFA00113 0.120100503 putative membrane protein

ORF00249 ORFA00787 0.078153846 conserved hypothetical protein

ORF00977 ORFA00767 0.074978939 hypothetical protein

ORF00370 ORFA00189 043507589 4-diphosphocytidyl-2C-methyl-D-erythritol kinase

ORF00849 ORFA01013 0.035964912 DNA replication and repair protein RecF

ORF00997 ORFA01301 0.026199616 hypothetical protein

- 145 - Chapter 4: Evidence that human Chlamydia pneumoniae was zoonotically acquired

ORF00208 NBH 0.0001 hypothetical protein

ORF00289 NBH 0.0001 conserved hypothetical protein

ORF00304 NBH 0.0001 hypothetical protein

ORF00390 NBH 0.0001 hypothetical protein

ORF00520 NBH 0.0001 hypothetical protein

ORF00560 NBH 0.0001 hypothetical protein

ORF00569 NBH 0.0001 hypothetical protein

ORF00584 NBH 0.0001 hypothetical protein

ORF00731 NBH 0.0001 hypothetical protein

ORF00834 NBH 0.0001 hypothetical protein

ORF00972 NBH 0.0001 hypothetical protein

ORF00975 NBH 0.0001 hypothetical protein

ORF01079 NBH 0.0001 hypothetical protein

ORF01081 NBH 0.0001 hypothetical protein

- 146 - Chapter 5: Comparative genomics of Chlamydia pneumoniae of human and animal origins

highlights genetic diversity in the species

CHAPTER FIVE

RESULTS

- 147 - Chapter 5: Comparative genomics of Chlamydia pneumoniae of human and animal origins

highlights genetic diversity in the species

STATEMENT OF JOINT AUTHORSHIP

The authors listed below have certified that:

1. they meet the criteria for authorship in that they have participated in the conception, execution, or

interpretation, or at least that part of the publication in their field of expertise;

2. they take public responsibility for their part of the publication, except for the responsible author who

accepts overall responsibility for the publication;

3. there are no other authors of the publication according to these criteria;

4. potential conflicts of interest have been disclosed to (a) granting bodies, and (b) the editor or

publisher of BMC Genomics, and;

5. they agree to the use of the publication in the student’s thesis and its publication on the Australasian

Digital Thesis database consistent with any limitations set by publisher requirements.

In the case of this chapter:

Mitchell CM, Hovis KM, Bavoil P, Myers GSA, Carrasco JA and Timms P (2010). Comparative

genomics of Chlamydia pneumoniae of human and animal origins highlights genetic diversity in the

species.

BMC Genomics. (Submitted with revisions).

Contributor Statement of Contribution

Candice Mitchell Prepared the manuscript; contributed to experimental design, research plan and data (candidate) analysis; performed all experimental work except the following

Kelley Hovis Contributed with text for the type III secretion analysis; approved final version of manuscript

Patrik Bavoil Aided in data interpretation; critically revised manuscript and approved final version of manuscript

Garry Myers Interpretation and analysis of the genome

Jose Carrasco Contributed with text for the pmp analysis; critically revised manuscript and approved final version of manuscript

Peter Timms Involved in research plan; critically reviewed manuscript proofs, contributed to the intellectual input of the manuscript and approved final version of manuscript;

- 148 - Chapter 5: Comparative genomics of Chlamydia pneumoniae of human and animal origins

highlights genetic diversity in the species

contributed continual feedback on experimental design and execution

- 149 - Chapter 5: Comparative genomics of Chlamydia pneumoniae of human and animal origins

highlights genetic diversity in the species

CHAPTER FIVE

Comparative genomics of Chlamydia pneumoniae of human and

animal origins highlights genetic diversity in the species

Candice M Mitchella, Kelley M Hovisb, Patrik M Bavoilb, Garry S A Myersc, Jose A

Carrascob, and Peter Timmsa*.

aInstitute of Health and Biomedical Innovation, School of Life Sciences, Queensland University of

Technology, Kelvin Grove, Queensland, 4059, Australia

bDepartment of Microbial Pathogenesis, University of Maryland, Baltimore, Maryland 21201, USA

cInstitute for Genome Sciences, University of Maryland, Baltimore, Maryland 21201, USA

*Corresponding Author:

Email: [email protected]

Phone: +617 3138 6199

Fax: +617 3138 6030

Mailing Address: Institute of Health and Biomedical Innovation

Queensland University of Technology

Corner of Musk Avenue and Blamey St, Kelvin Grove, Queensland

4059, Australia.

BMC Genomics, Submitted for Review (November, 2009)

BMC Genomics, Submitted with Revisions (February, 2010).

- 150 - Chapter 5: Comparative genomics of Chlamydia pneumoniae of human and animal origins

highlights genetic diversity in the species

12B

13B

14B

- 151 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

CHAPTER SIX

RESULTS

- 198 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

STATEMENT OF JOINT AUTHORSHIP

The authors listed below have certified that:

1. they meet the criteria for authorship in that they have participated in the conception, execution, or

interpretation, or at least that part of the publication in their field of expertise;

2. they take public responsibility for their part of the publication, except for the responsible author who

accepts overall responsibility for the publication;

3. there are no other authors of the publication according to these criteria;

4. potential conflicts of interest have been disclosed to (a) granting bodies, and (b) the editor or

publisher of PLoS Pathogens, and;

5. they agree to the use of the publication in the student’s thesis and its publication on the Australasian

Digital Thesis database consistent with any limitations set by publisher requirements.

In the case of this chapter:

Mitchell CM, Hutton S, Myers GSA, Brunham R and Timms P (2010). Chlamydia pneumoniae is

genetically diverse in animals and appears to have crossed the host barrier to humans on (at least)

two occasions. PLoS Pathogens. (In Press).

Contributor Statement of Contribution

Candice Mitchell Wrote the manuscript; contributed to experimental design, research plan and data (candidate) analysis; performed all experimental work except the following

Susan Hutton Contributed to research proposal for ethics approval; critically reviewed manuscript and approved final version of manuscript

Garry Myers Managed the whole-genome sequencing project; revised manuscript and approved final version of manuscript

Robert Brunham Formulated the inclusion of Australian Indigenous isolates; intellectual input; critically revised manuscript and approved final version of manuscript

Peter Timms Formulated research plan; involved in design; critically reviewed manuscript proofs, contributed to the intellectual input of the manuscript and approved final version of manuscript; contributed continual feedback on experimental design and execution

- 199 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

- 200 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

CHAPTER SIX

*Corresponding Author:

PLoS Pathogens, Submitted for Review (August, 2009)

PLoS Pathogens, Submitted with Revisions (January, 2010)

PLoS Pathogens, Accepted (February, 2010)

- 201 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

Author Summary

Chlamydia pneumoniae is an intracellular bacterial pathogen with an extremely diverse host range (humans, amphibians, reptiles and marsupials). We selected

23 target genes in order to investigate genetic diversity: six of these had been lost or gained by C. pneumoniae, a further six were conserved, four were polymorphic (defined by greater than 20 SNPs per 1 kbp; in this study), six were truncated or length polymorphic in one strain or the other, and one was specific to animal C. pneumoniae isolates. Our research highlights that C. pneumoniae animal isolates are much moer genetically diverse than C. pneumoniae human isolates, and have crossed the host barrier to humans on at least two occasions.

Our study provides new insights into the evolution of this complex pathogen.

Introduction

Members of the family Chlamydiaceae are obligate intracellular pathogens of a wide range of animals, birds and humans. Of the nine currently recognised species (Chlamydia pneumoniae, Chlamydia trachomatis, Chlamydia psittaci,

Chlamydia suis, Chlamydia pecorum, Chlamydia abortus, Chlamydia felis,

Chlamydia muridarum and Chlamydia caviae), C. pneumoniae has an extremely diverse host range (like C. psittaci), being reported in humans (Grayston, 1965), horses (Storey et al., 1993), reptiles (Bodetti et al., 2002) amphibians (Bodetti et al., 2002; Berger et al., 1999; Hotzel et al., 2001) and several Australian marsupials, including koalas (Wardrop et al., 1999) and bandicoots (Kutlin et al.,

2007).

C. pneumoniae exposure is widespread in humans, with sero-prevalence studies reporting 50% infection levels by age 20 and reaching 80% in the elderly

- 202 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

(Grayston, 2000). In humans, C. pneumoniae infections can range from asymptomatic to severe respiratory disease, including pneumonia. Less common presentations include bronchitis, pharyngitis, laryngitis and sinusitis, making up

5% of cases (Kuo et al., 1995). In addition to respiratory infections in humans,

C. pneumoniae has also been associated with atherosclerosis and stroke

(Grayston, 2000; Saikku et al., 1988), myocarditis (Wesslen et al., 1992), multiple sclerosis (Sriram et al., 1998) and Alzheimer’s disease (Balin et al.,

1998).

Despite the widespread prevalence of C. pneumoniae in humans, all isolates studied to date are extremely similar at the DNA level. Four C. pneumoniae human isolates have had their full genome sequenced: AR39 (Read et al., 2000),

CWL029 (Kalman et al., 1999), J138 (Shirai et al., 2000) and TW183 (Geng et al., 2003). Genomic comparisons revealed a highly conserved (>99.9%) gene order and organisation, with few deletions and less than 300 single nucleotide polymorphisms (SNPs) distinguishing the isolates. This near clonality of C. pneumoniae human isolates that are temporally and geographically separate, has been taken to indicate that human infections are a relatively recent event

(Rattei et al., 2007) and that the efficient respiratory spread of the agent explains how 60-80% of adults worldwide have been infected at least once in their lifetime (Peeling and Brunham, 1996).

In addition to infections in humans, C. pneumoniae infections have been reported from a range of animals from an equally diverse range of body sites, including respiratory (frog, snake, bandicoot, koala, horse), liver and spleen

(frog, iguana, chameleon), heart (turtle, snake, frog), conjunctival (koala) and urogenital tract (koala) (Bodetti et al., 2002; Berger et al., 1999; Hotzel et al.,

2001; Kutlin et al., 2007; Wills et al., 1990).

- 203 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

While there have been some previous genetic studies on the C. pneumoniae animal isolates, these have generally been restricted to partial sequencing of three genes, 16S ribosomal (r) RNA, ompA (encoding the major outer membrane protein) and omcB (encoding a large cysteine-rich protein) (Berger et al., 1999;

Hotzel et al., 2001; Wardrop et al., 1999; Glassick et al., 1996). Recently, Rattei et al. (2007) examined the relationship of 38 C. pneumoniae isolates, from measurement of genetic diversity within a representative set of 232 synonymous

(s)SNPs (no amino acid change; reduced evolutionary pressure). Although only two animal isolates (koala and frog) were examined, two major points have emerged from this study (i) there were 15 genotypes and four major clusters among the isolates, and (ii) the animal lineages were basal to human lineages, suggesting recent transmission to human through successive bottlenecks

150,000 years ago (based on an Escherichia coli molecular clock). Myers et al.

(2009) recently sequenced the full genome of the C. pneumoniae koala respiratory isolate, LPCoLN. C. pneumoniae koala LPCoLN was largely homologous to the previously sequenced C. pneumoniae human isolates, although it has several key differences. There are 6,213 SNPs between the koala and human isolates, and importantly, there are several examples of genes that are full-length in the koala LPCoLN isolate, but which have become truncated and fragmented in the human isolates (Myers et al., 2009). These data strongly suggest that the koala strain is ancestral to the sequenced human isolates, and points to an animal-to-human cross host transmission event in the (recent) past.

The full genome sequence of C. pneumoniae koala LPCoLN has also enabled us to select additional target genes as the basis for an extended genetic and phylogenetic comparison between a broad range of C. pneumoniae animal (19) and human (11) isolates. The 30 C. pneumoniae isolates that we compared in the current study can be grouped into three categories: (i) seven archival samples (frogs BMTF- type 1 and BMTF-type 2, snakes Pufadd and Burpyth,

- 204 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions turtle GST, chameleon cham and iguana Iguana) for which material was no longer available, and three isolates (human LKK1, bandicoot WBB and frog

CPXT1) with sequences available in GenBank, restricting comparisons to the already published gene sequences, usually partial 16S rRNA, ompA and omcB,

(ii) five C. pneumoniae isolates which have had their entire full genome sequenced (koala LPCoLN and humans AR39, J138, CWL029 and TW183), (iii) 15 isolates which were either available as viable cultures (frog GBF, and humans

WA97001 and IOL207) or recoverable tissue material (frogs DE177 and 2040.3, bandicoots B10, B26 and B37, koala EBB, potoroo Pot37, horse N16, and humans SH-511, 1979, TOR1 and A03) which were subjected to gene-specific

PCR and sequencing.

Materials and Methods

Chlamydia pneumoniae isolates

30 isolates from 11 human, 7 marsupial, 5 reptilian, 6 amphibian and 1 equine host were analysed (Supplementary Table 1).

The C. pneumoniae Pot37 isolate was initially obtained from a pharyngeal swab of a Gilbert’s potoroo (Potorous gilbertii) from Perth, Western Australia in 2006.

The C. pneumoniae EBB isolate was isolated from a pharyngeal swab of a koala

(Phascolarctos cinereus) from Queensland, Australia in 2005.

All analyses involving the Australian Indigenous human samples were approved

by the Queensland University of Technology and the Menzies School of Health

Research, Human Research Ethics Committee.

- 205 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

Strategy for selection of genes used for comparisons

Recently, we examined five complete C. pneumoniae genomes, including koala

LPCoLN and the four available C. pneumoniae human (AR39, TW183, CWL029 and J138) genomes (Mitchell et al., unpublished data). This approach allowed us to identify regions of high SNP accumulation and to select candidate genes for comparison.

In this study, we selected 13 of these genes for comparative analysis using a broader selection of isolates, while 1 additional length variable gene, 1 polymorphic gene, 5 highly conserved genes and three plasmid genes were also selected for analysis. Our target genes could be grouped into six categories:

(i) three genes (CPK_ORF00679, AroAA-Hs and MACPF) showing length polymorphisms, of at least 100 bp between C. pneumoniae koala and human isolates. Aromatic amino acid hydroxylases (AroAA-Hs) hydroxylate phenylalanine, tyrosine, and tryptophan into tyrosine, dihydroxyphenylalanine, and 5-hydroxytryptophan, respectively (Abromaitis et al., 2009). CPK_ORF00679 and MACPF genes have an unknown role, although the MAC/perforin (MACPF) may be a potential virulence gene based on the function in other intracellular pathogens.

(ii) three polymorphic outer membrane protein genes; two (pmpE/F2 and pmpE/F3) have regions with more than 20 SNPs per 1 kbp between C. pneumoniae koala and human isolates, and one (pmpG6) varies in the number of tandem repeats.

(iii) three previously well-studied ‘conserved’ genes: 16S rRNA belongs to a small unit of ribosomes, ompA is a major outermembrane protein and omcB is a large cysteine-rich outer membrane protein; and two highly conserved genes

- 206 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

(accC and pfk) located within the plasticity zone – accC (acetyl-CoA carboxylase, biotin carboxylase) is involved in fatty acid / phospholipid metabolism and pfk

(diphosphate-fructose-6-phosphate 1-phosphotransferase) is involved in glycolysis / gluconeogenesis.

(iv) three hypothetical genes (CP_1042, CP_0880 and CP_0505) with an unknown function.

(v) two C. pneumoniae-specific genes (SctC and HAF). SctC (highly conserved) forms part of the type III secretion system and has a unique 700 bp at the 5’ region of the gene. HAF is predicted to be a HAF family-autotransporter (beta domain) protein.

(vi) seven strain-specific genes: guaA (GMP synthase), guaB (IMP dehydrogenase) and add (AMP adenosine deaminase) are located in the plasticity zone and were absent from koala LPCoLN; CPK_ORF00678 is a hypothetical gene that is absent from all four full-sequenced C. pneumoniae human isolates, and; the plasmid is an extra-chromosomal element identified in

the koala LPCoLN genome. Three plasmid genes were examined: (i) site-specific

recombinase II; SSR2, (ii) replicative DNA helicase dnaB; helicase, and (iii) a

conserved hypothetical protein; PGP3D.

The strategy involved PCR-based amplification of five human isolates and nine

animal isolates, followed by sequencing of the PCR products. Additional

sequences for 16S rRNA, ompA and omcB were retrieved for previously

sequenced human and animal C. pneumoniae isolates (refer to accession

numbers). The analysis included; (i) gene by gene sequence alignments to

identify SNPs and indels, and (ii) generation of bootstrapped phylogenetic trees.

- 207 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

PCR and sequencing

Oligonucleotide primers (Sigma-Aldrich, Castle Hill, Australia) were designed based on homology of C. pneumoniae LPCoLN and AR39 sequences (GenBank accession numbers CP001713 and AE002161) using Primer3 v. 0.4.0 (denoted by an asterisk) (http://biotools.umassmed.edu/bioapps/primer3_www.cgi)

(Rozen and Skaletsky, 2000) and two primers already published (Supplementary

Table 2). The primer pairs, expected PCR product sizes and annealing temperatures are summarised, and several of the target genes have internal primers to sequence a particular region because of sequence variation or to enable sequencing of whole PCR products (Supplementary Table 2). PCR reactions were performed in a final volume of 50 µl, including 5.0 µl 10X PCR reaction buffer (Roche, Castle Hill, Australia), 1.0 µl PCR nucleotide mix (Roche,

Castle Hill, Australia), 2.0 µl of each (10 µM) primer (Sigma-Aldrich, Castle Hill,

Australia), 0.2 µl of 5U/µl Taq DNA polymerase (Roche, Castle Hill, Australia),

2.0 µl of template and PCR grade water to a final volume of 50 µl. Amplification conditions consisted of an initial denaturation at 94°C, followed by 30 cycles of 1 min at 94°C, 1 min at the specified annealing temperature (refer to

Supplementary Table 2), 1 min at 72°C, and a final extension for 10 min at

72°C. PCR products were separated by electrophoresis and visualised by ethidium bromide (10 µg/ml) staining of a 2% agarose gel in Tris Borate EDTA

(TBE) buffer.

PCR products were purified with a PureLinkTM PCR purification kit (Invitrogen,

Australia). To confirm sequence confirmation, DNA sequencing was performed in both directions using a BigDye terminator Cycle Sequencing Ready Reaction Kit and an automated DNA sequencer AB 3730xl (Australian Genome Research

Facility, University of Queensland, Australia). A third sequence was obtained if required.

- 208 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

Sequences and Phylogeny

Nucleotide sequences were translated to amino acids using blastx

(www.ncbi.nlm.nih.gov/blast), and the nucleotide and derived amino acid sequences were then trimmed to a uniform length. Sequence alignments were generated with Geneious version 4.7 using the pairwise alignment default settings (Nucleotide Cost Matrix = 65% similarity 5.0/-4.0, Protein Cost Matrix =

Blosum62, Gap Open = 12.0, Gap Extension = 3.0, Alignment Type = global alignment with free end gaps) (Drummond et al., 2007; available at

http://www.geneious.comH ].H The amino acid colour scheme is standard where

each amino acid has an assigned colour. Phylogenetic trees were generated with

Geneious version 4.7 using the pairwise alignment default settings (described

above), and a bootstrap consensus phylogenetic tree was constructed by

Neighbor-Joining or UPGMA analysis and Jukes-Cantor correction using 1,000

bootstrap replicates (Drummond et al., 2007). Bootstrap values greater than or

equal to 50% are shown at the nodes.

Nucleotide and amino acid sequence accession numbers

The nucleotide and amino acid sequence of the target genes have been

deposited in the GenBank database, and the accession numbers are as follows:

CPK_ORF00679 GQ918195 to GQ918201; MACPF GQ918233 to GQ918240;

AroAA-Hs GQ918166 to GQ918170; pmpE/F2 GQ507462 to GQ507467; pmpE/F3

GQ918162 to GQ918165; 16S rRNA GQ507433 to GQ507442; ompA GQ918216

to GQ918222; accC GQ918224 to GQ918232, GU013548; pfk GQ918243 to

GQ918254; CP_1042 GQ918189 to GQ918194; CP_0880 GQ507456 to 507461;

CP_0505 GQ507449 to GQ507455; SctC GQ507443 to GQ507448; HAF

GQ918202 to GQ918208; guaA GQ918156 to GQ918158; guaB GQ918209 to

GQ918215; add GQ918154 to GQ918155; CPK_ORF00678 GQ918159 to

- 209 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

GQ918161; SSR2 GQ918171 to GQ918176; helicase GQ918183 to GQ918188;

PGP3D GQ918177 to GQ918182.

Results and Discussion

Nucleotide diversity reveals distinct geographical lineages

We had access to a total of 19 C. pneumoniae animal isolates (seven marsupial, six amphibian, five reptilian and one equine) and 11 C. pneumoniae human isolates (Supplementary Table 1). We targeted 23 genes from these 30 isolates for analysis. However, due to technical difficulties with some of the DNA preparations, we could not obtain reliable sequence for all genes from all the isolates. C. pneumoniae genotypes were assigned by sequence and phylogenetic analyses of nucleotide sequences. Bootstrapped phylogenetic trees are shown in

Supplementary Figure 1. Nucleotide and amino acid (aa) alignments for each gene are presented in Supplementary Figures 2-23 (see Supplementary material folder, Chapter Six). We propose, on the basis of 21 sSNPs from various genomic regions, that the C. pneumoniae isolates that were sequenced successfully could be assigned to five common genotypes, A-E (Supplementary Table 2). The same genotypes were assigned to isolates whose Genbank sequences were included in the analysis (Supplementary Table 2). The five genotypes show a distinct geographic distribution among the isolates examined (Supplementary Table 2).

Genotype A was common among Australian animals. Genotype B may be indicative of African isolates. Genotype C has a worldwide distribution and was the most common genotype identified. Genotype D was unique to Australian

Indigenous isolates. Genotype E was the most variable C. pneumoniae genotype and comprised the sole isolate from the United Kingdom. Below is a gene-by- gene comparison to highlight the potential evolutionary relationships among C. pneumoniae isolates.

- 210 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

Genes showing significant size variation / truncation / deletion between isolates

The CPK_ORF00679 (LPCoLN locus designation: CPK) gene encodes a Lamin 2- like protein, which is a conserved hypothetical protein identified in C. pneumoniae and C. felis. This gene can be used as a target gene for molecular

differentiation of C. pneumoniae. Sequence analysis of eight C. pneumoniae

human (AR39, CWL029, TW183, J138, TOR1, WA97001, SH-511 and 1979) and

four C. pneumoniae animal isolates (koala LPCoLN, bandicoot B26, frog DE177

and horse N16) revealed a distinct size variation at the 5’ end (Supplementary

Figure 2). Three animal isolates (bandicoot B26, koala LPCoLN and frog DE177)

had the full-length (833 bp) gene with only five sSNPs among them. Primer

walking was used to determine the nucleotide sequence of horse N16 and the

Indigenous human isolates when initial attempts with the degenerate primers failed to amplify a product, indicating more distantly related sequences were present. Comparison of the eight C. pneumoniae human isolates revealed the absence of 251 bp at the 5’ end of the gene of six non-Indigenous human isolates, and only two non-synonymous (n)SNPs (an amino acid change) across the gene. Interestingly, both Australian Indigenous human isolates (SH-511 and

1979) have the 251 bp extended 5’ region of the gene (translating an 83 aa segment), which is identical to the extended 5’ sequence of bandicoot B26, koala

LPCoLN and frog DE177 isolates (Figure 1). A second variable region of the gene included a 15 bp indel (insertion/deletion), translating the sequence IADRF position 244-248 aa. This five aa indel is present in isolates koala LPCoLN, bandicoot B26, frog DE177, horse N16, and humans SH-511 and 1979 (Figure

1). The second length polymorphic gene, Membrane Attack Complex/Perforin

(MACPF), remains uncharacterised in Chlamydia species, however, its role in other pathogens suggests that it may be virulence-related. Analysis of the partial-length sequence (1,939 bp) revealed only one sSNP differentiating frog

- 211 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

Figure6B 1. Sequence comparison of CPK_ORF00679. Shown is a multiple sequence alignment of

CPK_ORF00679 from bandicoot (B26), koala (LPCoLN), frog (DE177), horse (N16) and human sequences (AR39, CWL029, J138, TW183, TOR1, WA97001, 1979 and SH511. There are two distinct indels: (i) an extended upstream region, and (ii) a five amino acid indel between positions 244-248.

The alignment was generated using Geneious version 4.7, where each amino acid is assigned its own colour. White shading indicates an amino acid variant.

DE177 from koala LPCoLN and bandicoots B26 and B37 (Supplementary Figure

3). PCR confirmed the long version of the gene to be present in horse N16 (data

- 212 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions not shown), with 99% identity over the available 1,303 bp to frog DE177, koala

LPCoLN and bandicoots B26 and B37 (15 SNPs; data not shown). PCR and sequence analysis of nine C. pneumoniae human isolates (AR39, AR39-2 ‘gene sequenced in our laboratory’, CWL029, J138, TW183, TOR1, WA97001, SH511 and 1979) confirmed a length polymorphism (compared to the animal isolates), as the result of a common 840 bp internal deletion. Within this region there was a seven nucleotide indel TGATCCT between positions 1,053-1,055 bp and 1,059-

1,062, found in 10 isolates (bandicoots B26 and B37, koala LPCoLN, frog DE177, and humans AR39-2, IOL207, TOR1, WA97001, SH511 and 1979). The indel sequence was absent from the four published C. pneumoniae human genomes

(AR39, CWL029, J138 and TW183) (Supplementary Figure 3). A third polymorphism for this gene was evident in Australian Indigenous human isolates

SH511 and 1979, which lacked an additional 270 bp fragment between positions

1,333-1,602 bp. The characterisation and identification of polymorphisms within the MACPF should serve as a useful marker in future genetic investigation. For example, the MACPF gene sequence can differentiate C. pneumoniae animal isolates from Indigenous human and non-Indigenous human sources.

A significant difference between C. pneumoniae and other chlamydial species is the absence of tryptophan biosynthesis genes. Despite this absence, C. pneumoniae encodes a functional aromatic amino acid (tryptophan) hydroxylase

(AroAA-Hs) (Abromaitis et al., 2009). The C. pneumoniae aromatic amino acid hyrdoxylase has a unique, extended 5’ region among human isolates, which is absent from koala LPCoLN (Abromaitis et al., 2009). To investigate whether the

5’ region may be host specific for C. pneumoniae human isolates, we examined the sequence of a bandicoot isolate (B26) and four additional C. pneumoniae human isolates (TOR1, WA97001, SH551 and 1979). Sequence analysis confirmed the 244 bp extended 5’ region in all five isolates (identical sequence)

(Supplementary Figure 4). Therefore, the extended 5’ region does not appear to

- 213 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions be human host-specific, but may play an important role in regulating its function.

Polymorphic outer membrane protein (pmp) genes

The pmps are an important group of Chlamydia surface proteins that have been considered as potential vaccine candidates. We selected three variable pmps

(unknown function) for analysis; (i) pmpE/F2, (ii) pmpE/F3, and (iii) pmpG6.

Partial-length sequence comparisons (2,169 bp) of pmpE/F2 revealed four unique features (Supplementary Figure 5), including (i) a total of 64 scattered

SNPs (23 nSNPs; 41 sSNPs) differentiating koala LPCoLN and bandicoot B26 from all other isolates, (ii) 10 SNPs (8nSNPs; 2 sSNPs) for frog DE177, six of which were shared with LPCoLN, and four of these were also shared with human

SH511 and human 1979 isolates, (iii) four shared SNPs (3 nSNPs; 1 sSNP) between Australian Indigenous human isolates SH511 and 1979, and (iv) one nSNP differentiating human J138 from human isolates AR39, CWL029, J138,

TW183, TOR1, and WA97001.

A partial alignment (922 bp) of pmpE/F3, revealed four features (Supplementary

Figure 6), including (i) a total of 20 SNPs (8 nSNPs; 12 sSNPs) unique to koala

LPCoLN, (ii) two shared SNPs (1 nSNP; 1 sSNP) among koala LPCoLN and frog

DE177, (iii) four nSNPs unique to Australian Indigenous human isolates SH511 and 1979, and (iv) no polymorphisms among non-Indigenous human isolates

(AR39, TW183, CWL029, J138, TOR1 and WA9001).

The role of pmpG6 is unknown, but owing to the variable number of tandem repeats there may be a functional role in vivo. Koala LPCoLN and two C. pneumoniae human isolates, TW183 and CWL029, have three tandem repeats of

(i) 396 bp, (ii) 393 bp, and (iii) 387 bp, whereas human isolates J138 and AR39

- 214 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions only have two tandem repeats (missing ii – 393 bp). Primers were designed to flank the variable repeat region where a 657 bp product was indicative of 3 tandem repeats, and a 264 bp product was indicative of only 2 tandem repeats

(Figure 2). We examined eight C. pneumoniae isolates by PCR, including koala

LPCoLN and human AR39 positive controls. Five isolates were confirmed to have

three tandem repeats (koala LPCoLN, bandicoot B26, frog DE177, and humans

SH511 and 1979) and three isolates were identified with only two tandem

repeats (humans AR39, WA9701 and TOR1) (Figure 2). This gene can be used as

a marker for intra-species variation, differentiating isolates by the size of their

PCR product.

Previously well-studied genes

The 16S rRNA and ompA genes have been extensively used to distinguish and phylogenetically group chlamydial species (Zhang et al., 1993; Stothard et al.,

1998; Everett et al., 1999; Brunelle and Sensabaugh, 2006). Although not as

informative as our newly identified target genes, our analysis showed that 16S

rRNA, ompA and omcB were evolving in much the same way as our target

Figure 2. Variable number of tandem repeats polymerase chain reaction (PCR) for the pmpG6 gene. Results from isolates with varying tandem repeats are as follows: lane 1 koala

LPCoLN / 3 repeats; lane 2 bandicoot B26 / 3 repeats; lane 3 frog DE177 / 3 repeats; lane 4 human

SH511 / 3 repeats; lane 5 human 1979 / 3 repeats; lane 6 human AR39 / 2 repeats; lane 7 human

TOR1 / 2 repeats; lane 8 human WA97001 / 2 repeats; lane 9 no template control, and; lane 10 MW, molecular weight maker X (Roche, Castle Hill, Australia).

- 215 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions genes. A portion of the 16S rRNA gene sequence has been previously determined for several C. pneumoniae animal isolates, including koala LPCoLN, horse N16, frogs DE177, CPXT1, GBF, BMTF-type 1 and BMTF-type 2, snakes

Pufadd and Burpyth, turtle GST, chameleon cham, iguana Iguana, and human isolates AR39, CWL029, TW183, J138, LKK1 and IOL207 (Myers et al., 2009;

Pettersson et al., 1997; Hotzel et al., 2001; Reed et al., 2000; Berger et al.,

1999; Bodetti et al., 2002; Read et al., 2000; Kalman et al., 2000; Shirai et al.,

2000; Geng et al., 2003; Kwon et al., 2004; Wilson et al., 1996). We expanded this comparison to include the additional animal isolates frog 2040.3, bandicoots

B10, B26 and B37, potoroo Pot37, koala EBB, and human isolates TOR1,

WA97001, SH511 and 1979 (Supplementary Figure 6). As expected from previous studies, the 16S rRNA sequences were highly conserved between all animal and human isolates. However, the minor differences (SNPs) might indicate some interesting trends in C. pneumoniae evolution. Analysis of a 215 bp segment revealed seven SNPs. Of these, two were unique to horse N16

(position 88; G/A and 100; A/C). Frog DE177 had a 2 bp insertion (position 84;

T and 85; T), while frog BMTF-type 1 and snake Puffadd shared one unique bp insertion (position 28; A). /21; A/G and 51; A/G) differentiated bandicoot (B10,

B26, B37 and WBB), koala (LPCoLN and EBB), frog (GBF, 2040.3, DE177 and

CPXT1), horse N16 and Australian Indigenous human isolates (SH511 and 1979) from frog (BMTF-type 1 and BMTF-type 2), iguana (Iguana), snake (Puffadd) and non-Indigenous human isolates.

The C. pneumoniae ompA gene is much less variable, unlike other species in which several variable domain regions flank diversity. We examined the ompA variable domain 4 partial-length (258 bp) sequence of 10 human and 16 animal

C. pneumoniae isolates from diverse geographical and anatomical locations.

From the 258 bp sequence, we identified a total of 27 SNPs (12 nSNPs; 15 sSNPs). Horse N16 had the highest number of SNPs (relative to all other

- 216 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions isolates) with 19 unique SNPs (7 nSNPs; 12 sSNPs). All six marsupial isolates

(koalas LPCoLN and EBB, bandicoots B26, B37 and WBB, and potoroo Pot37) were identical in sequence, whereas all 10 human isolates (AR39, CWL029,

TW183, J138, TOR1, WA97001, IOL207, LKK1, SH511 and 1979) were identical to one another (Supplementary Figure 8). Region 221-251 bp was the most polymorphic, with a total of 16 SNPs, five of which differentiate marsupial (B26,

B37, WBB, EBB, LPCoLN and Pot37) and frog (CPXT1, DE177 and GBF) isolates from frog (BMTF-type 1), snake (Burpyth and puffadd), lizard (chameleon and iguana), turtle (GST), horse (N16) and human isolates (AR39, CWL029, J138,

TW183, IOL207, LKK1, TOR1, WA97001, 1979 and SH511) at nucleotide positions 225 (A/G), 227 (G/C), 231 (A/G), 236 (C/T) and 244 (G/A/C).

The omcB gene encodes a large cysteine-rich protein, which offers stabilisation through disulphide cross-linkage (Hatch et al., 1984). Five SNPs were identified from the partial-length (386 bp) comparison of 10 isolates (Supplementary

Figure 9). Three SNPs (2 nSNP; 1 sSNP) were associated with koala LPCoLN, frog

DE177 and frog GBF isolates. One sSNP was shared between koala LPCoLN and frog GBF, while another sSNP was unique to horse N16.

Two highly conserved genes from within the plasticity zone include accC and pfk, encoding acetyl-CoA carboxylase, biotin carboxylase and diphosphate-fructose-

6-phosphate 1-phosphotransferase, respectively. A partial length (302 bp) comparison of accC revealed only four SNPs, two (position 31; C/A and 171;

C/T) differentiated seven non-Indigenous human isolates from two Australian

Indigenous human isolates and nine animal isolates. A third SNP (position 185;

G/A) was detected in horse N16 and two human isolates (AR39 and J138). The fourth SNP (position 226; T/C) was found in horse N16 and frog 2040.3 isolates

(Supplementary Figure 10). A partial length (263 bp) comparison of pfk also revealed four SNPs, two (1 nSNP; 1 sSNP) were unique to horse N16, while two

- 217 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions additional SNPs (C/T and G/A) were conserved in koala LPCoLN, bandicoot B37 and frog GBF isolates (Supplementary Figure 11).

Hypothetical genes or unique genes showing characteristics specific to

C. pneumoniae

The CP_1042 (AR39 locus designation: CP) gene encodes a hypothetical protein, which is unique to the C. pneumoniae human genome. The four fully-sequenced

C. pneumoniae human isolates (AR39, CWL029, J138 and TW183) have the full- length (558 bp) gene, whereas koala LPCoLN is missing a 361 bp segment at the

5’ end of the gene; the remaining nucleotides do not translate a protein due to truncation mutations. In order to determine the extent to which genetic diversity occurs in other animal isolates, we examined a frog (DE177), bandicoot (B26), koala (EBB) and horse (N16) isolate, as well as four additional human isolates

(TOR1, WA97001, SH511 and 1979) across the 558 bp gene (Supplementary

Figure 12). Like koala LPCoLN, PCR (primers designed for the full-length gene) was unable to detect a product for bandicoot B26 and koala EBB isolates.

Interestingly, frog DE177 and horse N16 isolates have the full-length gene, indicating that CP_1042 is not unique to C. pneumoniae human isolates. Horse

N16 is highly variable with a total of 56 unique SNPs, one of which is shared with frog DE177 and Australian Indigenous human isolates, SH511 and 1979

(Supplementary Figure 12). All eight human isolates have the full-length gene, with only two SNPs differentiating the non-Indigenous and Australian Indigenous isolates. The fragmentation in the marsupial isolates appears to be host-specific and may not be essential for growth in the marsupial host.

The CP_0880 gene encodes a hypothetical protein, which is variable among animal C. pneumoniae isolates, making it difficult to obtain reliable sequence for frog DE177 and horse N16 isolates despite many attempts at different primer set

- 218 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions combinations. It was possible to align a partial-length sequence (845 bp) for one bandicoot (B26), two koala (LPCoLN and EBB) and eight human isolates (AR39,

CWL029, TW183, J138, TOR1, WA97001, SH511 and 1979) (Supplementary

Figure 13). Of the eight human isolates, four SNPs (2 nSNPs; 2 sSNPS) were

detected in SH511 and 1979 Australian Indigenous isolates. Bandicoot B26 and koala LPCoLN isolates were identical in sequence and had diverged from all other isolates, the result of 110 unique SNPs. Of these SNPs, 74 led to an amino acid

change, while two SNPs (1 nSNP; 1 sSNP) were shared with Australian

Indigenous human SH511 and 1979 isolates.

The CP_0505 gene encodes a hypothetical protein. Sequence analysis

(Supplementary Figure 14) of the partial-length (723 bp) gene revealed four

features (i) 12 SNPs (8 nSNPs; 4 sSNPs) unique to koala LPCoLN and bandicoots

B26 and B37, (ii) 42 SNPs (24 nSNPs; 18 sSNPs) unique to horse N16, (iii) two

SNPs (1 nSNP; 1 sSNP) unique to Australian Indigenous SH511 and 1979

isolates, while a third sSNP was shared with bandicoots B26 and B37, koala

LPCoLN and horse N16 isolates, and (iv) a single bp deletion distinguished frog

DE177 from the non-Indigenous isolates (identical sequence).

The SctC gene encodes a type III secretion system protein, which has a C. pneumoniae-specific (approximately 700 bp) 5’ region. Type III secretion system

proteins are well-conserved among Chlamydia species (and other bacteria),

therefore, it was not surprising to find little variation among the C. pneumoniae

isolates. Overall, there were five SNPs. Two nSNPs (position 232; A/C and 273;

A/C) distinguished bandicoot B26, koala LPCoLN, frog DE177 and Indigenous

human isolates SH511 and 1979 from the non-Indigenous human isolates AR39,

CWL029, J138, TW183, TOR1 and WA97001 (identical sequences). Frog DE177

had one sSNP (position 342; T/C). Koala LPCoLN and bandicoot B26 had the

same nSNP (position 429; G/T). Australian Indigenous human isolates SH511

- 219 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

1979 shared one nSNP (position 469; A/G) (Supplementary Figure 15). This 482 bp gene segment might be a useful marker for C. pneumoniae detection and differentiation of animal isolates from Indigenous and non-Indigenous human isolates, on the basis of five key SNPs.

The CPK_ORF00201 gene (termed HAF) encodes a HAF family auto-transporter beta domain protein. Nucleotide comparisons of the fully-sequenced C. pneumoniae isolates (koala LPCoLN and human AR39, CWL029, TW183 and

J138) revealed a truncated (two separate genes) homolog among human isolates; absence of a 120 bp internal segment. A partial-length (1,412 bp) comparison with seven previously un-sequenced C. pneumoniae isolates

(bandicoot B26, frog DE177, horse N16, human WA97001, TOR1, SH511 and

1979) revealed an intact, full-length gene in all seven isolates (Supplementary

Figure 16). One possible explanation for this difference may be due to sequencing error in the C. pneumoniae human genomes; the missing segment is revealed in a BLAST search. Limited sequence was available for horse N16, despite many attempts with different primer sets, suggesting that there may be more sequence variation in the region that could not be amplified. There were, however, nine unique SNPs (4 nSNPs; 5 sSNPs) detected in the horse N16 isolate. It is worth mentioning that horse N16, bandicoot B26, koala LPCoLN, frog DE177 and both Australian Indigenous human isolates (SH511 and 1979) had two common SNPs at nucleotide positions 761/T and 1,020/T, while six non-

Indigenous human isolates had C/C at these positions. These polymorphisms could be used to distinguish animal and Indigenous human isolates from non-

Indigenous human isolates.

Strain-specific genes of C. pneumoniae

- 220 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

Three genes present in the C. pneumoniae human genome, but absent from the koala LPCoLN genome include guaA (GMP synthase), guaB (IMP dehydrogenase) and add (AMP adenosine deaminase). This three-gene cluster, located in the plasticity zone, was also confirmed by PCR in the frog (DE177) and horse (N16) isolates. A comparison of guaB (Supplementary Figure 17) revealed just three

SNPs differentiating frog DE177 from the non-Indigenous human C. pneumoniae

isolates (AR39, CWL029, TW183, J138, TOR1 and WA97001), while no

polymorphisms were evident in the guaA gene (Supplementary Figure 18).

Reliable add sequence was not available for frog DE177 (Supplementary Figure

19). The horse N16 isolate had four unique SNPs for guaB (Supplementary

Figure 17); however, reliable sequence was not available for guaA and the presence of add was not definitive in the horse N16 isolate. The guaBA-add cluster was identified (identical sequence) in human isolates TOR1, WA97001 and IOL207 (limited sequence) (Supplementary Figures 17-19). Both Australian

Indigenous human isolates (SH511 and 1979) have the guaB gene with six SNPs

(4 nSNPs; 2 sSNPs) to the non-Indigenous human isolates; two SNPs were shared with frog DE177 and horse N16 isolates (Supplementary Figure 17).

Since PCR failed to amplify any product for guaA and add genes in the Australian

Indigenous human isolates (using two sets of primers for each gene from either

5’ or 3’ regions), these two genes are either absent from the genome, or are highly divergent and undetectable with our primer sets. Three additional animal isolates (koala EBB, bandicoots B26 and B37) also lack the guaBA-add cluster which suggests that it is not a core component required for C. pneumoniae survival.

The CPK_ORF00678 gene encodes a hypothetical protein, which is located within the plasticity zone of the koala LPCoLN genome. This gene was not identified in any of the four fully-sequenced C. pneumoniae human isolates (AR39, CWL029,

J138 and TW183) or subsequent human isolates (WA97001, TOR1, SH511 and

- 221 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

1979), but was detected in three additional animal isolates (bandicoot B26, frog

DE177 and horse N16) (Supplementary Figure 20). A partial-length sequence comparison (689 bp) revealed 10 SNPs (4 nSNPs; 6 sSNPs) differentiating frog

DE177 from koala LPCoLN and bandicoot B26 isolates (identical sequence). Four of these SNPs were also shared with horse N16 (Supplementary Figure 20). Of the animal isolates, horse N16 showed greater sequence divergence with 11 unique SNPs and four indels (positions 73-84, 151-305, 387-395 and 419-425).

The absence of CPK_ORF00678 from the C. pneumoniae human genome suggests that this gene may have been selected for a specific function in the animal host, and thus, provides a new animal C. pneumoniae-specific target gene.

A plasmid (7,655 bp) encoding seven ORFs (open reading frames) was identified in the koala LPCoLN genome but not in any of the C. pneumoniae human genomes (Myers et al., 2009). Thomas et al. (1997) also identified a plasmid in the horse N16 isolate, and so it was of interest to see whether additional C. pneumoniae isolates have a plasmid. Primers (Supplementary Table 2) were designed to investigate three plasmid ORFs: (i) site-specific recombinase II;

SSR2, (ii) replicative DNA helicase dnaB; helicase, and (iii) a conserved hypothetical protein; PGP3D. Seventeen isolates were examined by PCR for the presence of a plasmid, including three bandicoots (B10, B26 and B37), three frogs (GBF, DE177 and 2040.3), two koalas (LPCoLN and EBB), one potoroo

(Pot37), one horse (N16) and seven human isolates (AR39, IOL207, WA97001,

A03, TOR1, SH511 and 1979). All three plasmid ORFs were confirmed by PCR in each of the 10 animal isolates, although no human isolate was found to have

SSR2 (Supplementary Figure 20), helicase (Supplementary Figure 21) or PGP3D

(Supplementary Figure 22) ORFs. Phylogenetic comparisons revealed a high conservation among the animal isolates, with horse N16 showing the most variation (Supplementary Figure 1). Of the three ORFs, SSR2 showed evidence

- 222 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions of a length difference when compared to the horse N16 isolate. The horse N16 isolate was missing a 165 bp segment between positions 66-230 bp, while bandicoot B10, bandicoot B37, frog DE177, frog 2040.3, koala LPCoLN and frog

GBF sequences were identical and contained the whole 369 bp segment

(Supplementary Figure 20).

Phylogenetic relationships among C. pneumoniae isolates

Despite the importance and widespread prevalence of C. pneumoniae, there has

been little phylogenetic analysis to assist evolutionary and epidemiological

investigations. Therefore, in order to examine in-depth the evolutionary

relationships within C. pneumoniae, we examined several previously studied

isolates in addition to 10 novel isolates using 22 target genes selected from

various regions of the genome. We constructed rooted phylogenetic trees from

all available C. pneumoniae isolates by Neighbour-Joining and UPGMA

(Unweighted Pair Group Method with Arithmetic mean) methods. As both trees were of similar structure, only the Neighbour-Joining tree is presented

(Supplementary Figure 1). The phylogenetic patterns that we observed were congruent in 19 out of the 22 genes that we analysed. This gives us confidence that our interpretations are sound and suggests that horizontal gene transfer is not a major contributor to genetic changes in C. pneumoniae. These phylogenetic analyses led us to propose several key new findings. The Australian

Indigenous human isolates (genotype D) formed a unique group in 10 out of the

15 trees analysed. These could be clearly distinguished from the non-Indigenous human isolates (genotype C) which formed a tight cluster, regardless of their geographical origin. The evolutionary position of horse N16 (genotype E) is somewhat less confident. Horse N16 was distinct from all other isolates in at least 9 out of the 13 trees examined. However, the bootstrap values were low at

54-78%. It will be necessary to obtain additional equine isolates to confirm the

- 223 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions correct lineage of this strain. The Australian marsupial isolates formed a tight grouping (genotype A) with all genes analysed, even when they were obtained from different geographical regions within Australia. The Australian marsupial isolates shared common nucleotide substitutions with the amphibian and horse isolates originating from Australia, Africa and the United Kingdom, as did the

Australian Indigenous human isolates. Analysis of the Australian frog isolates resulted in the identification of two distinct genotypes. Genotype C was identified in two captive frog isolates from New South Wales (BMTF-type 1 and BMTF- type

2). A third free-range frog (GBF) isolate, also from New South Wales, was identical to the sequence derived from Australian marsupial isolates, from independent regions. The third isolate was therefore clustered into genotype A.

The degree of variation in the limited sequence analysed was unusual given the geographical distance from other world regions. Moreover, two African frog isolates from different regions were clustered together, in genotype B. However, a third African isolate from a chameleon was grouped with the international cluster in genotype C, comprising American snakes, an American turtle, a

Central American iguana, Australian frogs, as well as the non-Indigenous human isolates. Members of genotype C are both common and present across the globe, possibly indicating that it is a relatively recent expansion, as proposed by Rattei et al. (2007).

Conclusions

Sequence data suggests that two separate animal to human transmission events have occurred

Our aim was to determine whether our target genes could distinguish C. pneumoniae isolates from human and animal sources and to investigate their

- 224 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions genetic diversity. Previous analyses have shown that C. pneumoniae human

isolates are essentially clonal and do not provide much evolutionary insight. To

our knowledge, all previous analyses of C. pneumoniae human have focussed on non-Indigenous isolates: AR39 (USA), CWL029 (USA), TW183 (Taiwan), J138

(Japan), LKK1 (Korea), A03 (USA), TOR1 (Canada) and IOL207 (Iran). Our analysis also included a non-Indigenous human isolate from Australia

(WA97001), and more importantly, we were able to analyse two Australian

Indigenous human isolates (SH511 and 1979) which originated from geographically separate communities.

Our collective sequence data (using 23 target genes from 30 isolates) and phylogenetic analyses strongly support both the whole genome findings of Myers et al. (2009) as well as the synonymous SNP conclusions of Rattei et al. (2007) in that the extant C. pneumoniae human isolates have derived from C. pneumoniae animal isolates. Our data extends both of these studies, however, and strongly suggests two (or more) lineages of C. pneumoniae. One lineage involves amphibian isolates (DE177, CPXT1, BMTF-type 1 and BMTF-type 2), which subsequently ‘evolved’ to C. pneumoniae infections in reptiles (Iguana,

Pufadd, Burpyth, GST, cham) and via as yet undiscovered intermediates, to the dominant C. pneumoniae human clone present in the world today (AR39,

TW183, CWL029, J138, TOR1, A03, IOL207, LKK1, and WA97001). The second presumably also started with amphibian infections (as above), but then diverged into other amphibian and reptilian infections (frogs GBF and 2040.3). At this point (there are probably intermediate hosts and C. pneumoniae strains that are either extinct or as yet, undiscovered) two sub-lines are evident. One lineage has resulted in the widespread C. pneumoniae infections seen in Australian

marsupials today (koala LPCoLN, koala EBB, bandicoot B10, bandicoot B26,

bandicoot B37, bandicoot WBB and potoroo Pot37) while the second lineage has

crossed the animal-human barrier to infect Australian Aboriginals (SH511 and

- 225 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

1979). The key genomic data, which supports these lineages and their divergence is summarised in Supplementary Text S1.

Although the evolutionary time-frame of C. pneumoniae is unclear, we have described patterns of genetic differentiation whereby C. pneumoniae profiles from the Australian Indigenous human populations appear to be negatively correlated (for the most part) with the genetic differentiation in non-Indigenous human populations. The possibility that C. pneumoniae was an established pathogen in Australia before the settlement of Europeans in 1788, is one possible theory considering the characteristic diseases of a hunter-gatherer population have been described as those with low morbidity, long illness and long infection stages, such as chlamydial diseases (Gray, 1988). From ancient times, hunter-gatherer Aboriginal communities have lived in close proximity to animals, and may have been predisposed to C. pneumoniae infected animals.

However, if C. pneumoniae had been present in the Australian Indigenous population prior to European settlement, the differences observed in our target genes would suggest that the Australian Indigenous isolates have evolved independently from the non-Indigenous isolates. This trend was also observed in an Australian Indigenous and non-Indigenous cohort of Haemophillus influenzae isolates from Australia (Moor et al., 1999) where the genetic diversity and the time span from European settlement was not likely to support the amount of differentiation observed. A likely explanation for the observed diversity in our human isolates would be that C. pneumoniae may have been more recently introduced to urban non-Aboriginals from infected animals, or alternatively via native or non-native inhabitants in other regions around the world, and the infections were not derived from the Indigenous Australians; the United Kingdom horse (N16) and African frog (DE177) isolates also had indels in common to the

Australian marsupials (koalas LPCoLN and EBB, bandicoots B10, B26, B37 and

WBB, and potoroo Pot37) and Australian Indigenous human isolates, despite

- 226 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions being geographically isolated from the Australian population. There is convincing evidence that zoonotic transmission of C. pneumoniae can/has occur/ed. The finding that a genotype common to non-human and human hosts was dispersed in human carotid plaques (Cochrane et al., 2005) is not by itself conclusive evidence of zoonotic transmission, but rather highlights the need for consideration of its zoonotic potential, particularly for animal handlers and laboratory personnel.

In the present study, we observed five genotypes (A-E) based on genetic and phylogenetic data. These data revealed dominant genotypes in various regions of the world. Genotype A was prevalent among Australian animals, genotype B was identified in Africa, genotype C had the broadest distribution and was worldwide, genotype D was predominant among Indigenous Australians, while genotype E was unique to the United Kingdom. Although a very limited number of isolates were used in this study, the results clearly showed genetic diversity associated with host type and geographic locations. Based on the large number of polymorphisms between horse N16 and all other C. pneumoniae isolates, we believe that we have identified sufficient genetic differences that would accommodate the classification of horse N16 into a subspecies of C. pneumoniae, designated C. pneumoniae subsp. equi, following the proposal of

Pettersson et al. (1997). These findings of high genetic variation may represent mosaic genotypes in the population and may need to be considered as a subspecies variant within C. pneumoniae.

Acknowledgements7B

We are grateful to Konrad Sachse for providing us with DE177 DNA, Alan Hudson for providing TOR1 DNA, Ian Clarke for N16 DNA, Andreas Pospischil for 2040.3

DNA, and Margaret Hammerschlag whom provided B10, B26 and B37 DNA.

- 227 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

References

Abromaitis S, Hefty PS and Stephens RS (2009). Chlamydia pneumoniae encodes a functional aromatic amino acid hydroxylase. FEMS Immunology and Medical Microbiology. 55, 196-205.

Asche VL, Hutton SI and Douglas FP (1993). Serological evidence of the three chlamydial species in an Aboriginal community in the Northern Territory. The Medical Journal of Australia. 158, 606-604.

BalinH BJ,H GérardH HC,H ArkingH EJ,H AppeltH DM,H BraniganH PJ,H AbramsH JT,H Whittum-H

Hudson JA H and HudsonH AP H (1998). Identification and localization of Chlamydia pneumoniae in the Alzheimer's brain. Medical Microbiology and Immunology. 187, 23-42.

Berger L, Volp K, Mathews S, Speare R and Timms P (1999). Chlamydia pneumoniae in a free-ranging giant barred frog (Mixophyes iteratus) from Australia. Journal of Clinical Microbiology. 37, 2378-2380.

Blumer C, Zimmermann DR, Weilenmann R, Vaughan L and Pospischil A (2007). Chlamydiae in free-ranging and captive frogs in Switzerland. Veterinary Pathology. 44, 144-150.

Bodetti TJ, Jacobson E, Wan C, Hafner L, Pospischil A, Rose K and Timms P (2002). Molecular evidence to support the expansion of the hostrange of Chlamydophila pneumoniae to include reptiles as well as humans, horses, koalas and amphibians. Systematic and Applied Microbiology. 25, 146-152.

Brunelle BW and Sensabaugh GF (2006). The ompA Gene in Chlamydia trachomatis differs in phylogeny and rate of evolution from other regions of the genome. Infection and Immunity. 74, 578-585.

Cochrane M, Walker P, Gibbs and Timms P (2005). Multiple genotypes of

Chlamydia pneumoniae identified in human carotid plaque. Microbiology. 151,

2285-2290.

- 228 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

Coles KA, Timms P and Smith DW (2001). Koala biovar of Chlamydia pneumoniae infects human and koala monocytes and induces increased uptake of lipids in vitro. Infection and Immunity. 69, 7894-7897.

Dreses-WerringloerH U,H HBhuiyan M,H ZhaoH Y,H GérardH HC,H HWhittum-Hudson JA H and

HudsonH AP H (2008). Initial characterization of Chlamydophila (Chlamydia) pneumoniae cultured from the late-onset Alzheimer brain. International Journal of Medical Microbiology. 299, 187-201.

Drummond AJ, Ashton B, Cheung M, Heled J, Kearse M, Moir R, Stones-Havas S,. Thierer T and Wilson A (2007). Geneious version 4.7. Available:

http://www.geneious.com/H .H Accessed 13 August 2009.

Dwyer RS, Treharne JD, Jones BR and Herring J (1972). Chlamydial infection. Results of micro-immunofluorescence tests for the detection of type-specific antibody in certain chlamydial infections. The British Journal of Venereal Diseases. 48, 452–459.

Everett KDE, Bush RM and Andersen AA (1999). EmendedH description of the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards for

the identification of organisms.H International Journal of Systematic and Evolutionary Bacteriology. 49, 415-440.

Geng MM, Schuhmacher A, Muehldorfer I, Bensch KW, Schaefer KP, Schneider S, Pohl T, Essig A, Marre R and Melchers K (2003). The genome sequence of Chlamydia pneumoniae TW183 and comparison with other Chlamydia strains based on whole genome sequence analysis. Unpublished 2003, Submitted (MAY- 2002) to the EMBL/GenBank/DDBJ databases.

Glassick T, Giffard P and Timms P (1996). Outer membrane protein 2 gene sequence indicates that Chlamydia pecorum and Chlamydia pneumoniae cause infection in koalas. Systematic and Applied Microbiology. 19, 457-464.

- 229 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

Gray A (1988). Society and Culture: Demographic and Social History. In: The Australian People: An Encyclopedia of the Nation, Its People and Their Origins. Edited by Jupp J. Oakleigh: Cambridge University press. p. 88.

Grayston JT (1965). Immunisation against trachoma. Pan American Health Organization Scientific Publication. 147, 549.

Grayston JT (2000). Background and current knowledge of Chlamydia pneumoniae and atherosclerosis. The Journal of Infectious Diseaes. 181 (Suppl 3), S402–S410.

Hatch TP, Allan I and Pearce JH (1984). Structural and polypeptide differences between envelopes of infective and reproductive life cycle forms of Chlamydia spp. Journal of Bacteriology. 157, 13-20.

Hotzel H, Grossmann E, Mutschmann F and Sachse K (2001). Genetic characterization of a Chlamydophila pneumoniae isolate from an African frog and comparison to currently accepted biovars. Systematic and Applied Microbiology. 24, 63-66.

Hutton S and Dodd H (1993). C. pneumoniae successfully isolated. Current topics. 42-43.

Kalman S, Mitchell W, Marathe R, Lammel C, Fan J, Hyman RW, Olinger L, Grimwood J, Davis RW and Stephens RS (1999). Comparative genomes of Chlamydia pneumoniae and C. trachomatis. Nature Genetics. 21, 385-389.

Kuo CC and Grayston JT (1988). Chlamydia spp. strain TWAR A newly recognized organism associated with atypical pneumonia and other respiratory infections. Clinical Microbiology News. 10, 137-144.

Kuo CC, Jackson LA, Campbell LA and Grayston JT (1995).Chlamydia pneumoniae TWAR. Clinical Microbiology Reviews. 8, 451-461.

Kutlin A, Roblin PM, Kumar S, Kohlhoff S, Bodetti T, Timms P and Hammerschlag MR (2007). Molecular characterization of Chlamydophila pneumoniae isolates from Western barred bandicoots. Journal of Medical Microbiology. 56, 407-417.

- 230 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

Kwon SJ, Lee KJ, Choen DS, Kim KS and Lee SJ (2004). The sequence of 16S rRNA of Korean isolate Chlamydia pneumoniae LKK-1. Unpublished 2004, Submitted (February-2004) to the EMBL/GenBank/DDBJ databases.

Lee SJ, Nam EC, Won J, Park WS, Kim WJ, Han SS and Choi DJ (2003). Characterization of the first Korean isolate of a Chlamydia pneumoniae strain. Japanese Journal of Infectious Diseases. 56, 62-64.

Moor PE, Collignon PC and Gilbert GL (1999). Pulsed-field gel electrophoresis used to investigate genetic diversity of Haemophilus influenzae type b isolates in Australia shows differences between Aboriginal and non-Aboriginal isolates. Journal of Clinical Microbiology. 37, 1524-1531.

Myers GSA, Mathews SA, Eppinger M, Mitchell C, O’Brien KK, White OR, Benahmed F, Brunham RC, Read TD, Ravel J, Bavoil PM and Timms P (2009). Evidence that human Chlamydia pneumoniae was zoonotically acquired. Journal of Bacteriology. 191, 7225-7233.

Peeling RW and Brunham RC (1996). Chlamydiae as pathogens: new species and new issues. Emerging Infectious Diseases. 2, 307-319.

Pettersson B, Andersson A, Leitner T, Olsvik Ø, Uhlén M, Storey C and Black CM (1997). Evolutionary relationships among members of the genus Chlamydia based on 16S ribosomal DNA analysis. Journal of Bacteriology. 179, 4195-4205.

Ramirez JA (1996). Isolation of Chlamydia pneumoniae from the coronary artery of a patient with coronary atherosclerosis. Annals of Internal Medicine. 125, 979- 982.

Read TD, Brunham R, Shen C, Gill S, Heidelberg J, White O, Hickey E, Peterson J, Utterback T, Berry K, Bass S, Linher K, Weidman J, Khouri H, Craven B, Bowman C, Dodson R, Gwinn M, Nelson W, DeBoy R, Kolonay J, McClarty G, Salzberg S, Eisen J and Fraser C (2000). Genome sequences of Chlamydia trachomatis MoPn and Chlamydia pneumoniae AR39. Nucleic Acids Research. 28, 1397-1406.

Reed KD, Ruth GR, Meyer JA and Shukla SK (2000). Chlamydia pneumoniae infection in a breeding colony of African clawed frogs (Xenopous tropicalis).

- 231 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

Emerging Infectious Diseases. 6, 196-199. Rozen S and Skaletsky HJ (2000). Primer3 on the WWW for general users and for biologist programmers. In: Bioinformatics Methods and Protocols: Methods in Molecular Biology. Edited by Krawetz S and Misener S. Totowa, NJ: Humana Press. 365–386.

Saikku P, Leinonen M, Mattila K, Ekman MR, Nieminen MS, MäkeläH PH,H HuttunenH

JK H and ValtonenH V H (1988). Serological evidence of an association of a novel Chlamydia, TWAR, with chronic coronary heart disease and acute myocardial infarction. Lancet. 2, 983-986.

Shirai M, Hirakawa H, Kimoto M, Tabuchi M, Kishi F, Ouchi K, Shiba T, Ishii K, Hattori M, Kuhara S and Nakazawa T (2000). Comparison of whole genome sequences of Chlamydia pneumoniae J138 from Japan and CWL029 from USA. Nucleic Acids Research. 28, 2311-2314.

SriramH S,H HMitchell W H and StrattonH C H (1998). Multiple sclerosis associated with Chlamydia pneumoniae infection of the CNS. Neurology. 50, 571-572.

Storey CC, Lusher M, Yates P and Richmond SJ (1993). Evidence for Chlamydia pneumoniae of non-human origin. Journal of General Microbiology. 139, 2621- 2626.

Stothard DR, Boguslawski G and Jones RB (1998). Phylogenetic analysis of the Chlamydia trachomatis major outer membrane protein and examination of potential pathogenic determinants. Infection and Immunity. 66, 3618-3625.

Thomas NS, Lusher M, Storey CC and Clarke IN (1997). Plasmid diversity in Chlamydia. Microbiology. 143, 1847-1854.

Wardrop S, Fowler A, O’Callaghan P, Giffard P and Timms P (1999). Characterization of the koala biovar of Chlamydia pneumoniae at four gene loci-- ompAVD4, ompB, 16S rRNA, groESL spacer region. Systematic and Applied Microbiology. 22, 22-27.

Warren K, Swan R, Bodetti T, Friend T, Hill S and Timms P (2005). Ocular Chlamydiales infections of Western barred bandicoots (Perameles bougainville) in Western Australia. Journal of Zoo and Wildlife Medicine. 36, 100-102.

- 232 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

WesslénH L,H PåhlsonH C,H FrimanH G,H FohlmanH J,H LindquistH O H and JohanssonH C H (1992). Myocarditis caused by Chlamydia pneumoniae (TWAR) and sudden unexpected death in a Swedish elite orienteer. Lancet. 340, 427-428.

Wills JM, Watson G, Lusher M, Mair TS, Wood D and Richmond SJ (1990). Characterisation of Chlamydia psittaci isolated from a horse. Veterinary Microbiology. 24, 11-19.

Wilson PA, Phipps J, Samuel D and Saunders NA (1996). Development of a simplified polymerase chain reaction-enzyme immunoassay for the detection of Chlamydia pneumoniae. Journal of Applied Bacteriology. 80, 431-438.

Zhang YX, Fox JG, Ho Y, Zhang L, Stills HF Jr and Smith TF (1993). Comparison of the major outer-membrane protein (MOMP) gene of mouse pneuomonitis (MoPn) and hamster SFPD strains of Chlamydia trachomatis with other

Chlamydia strains.H H Molecular Biology and Evolution. 10, 1327-1342.

- 233 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

Supplementary files

Supplementary Figure 1 (Below). Phylogenetic trees (A-V) of C. pneumoniae isolates.

Phylogenetic relationships of C. pneumoniae isolates were inferred from partial nucleotide sequences,

and were constructed by Neighbor-Joining analysis and the Jukes-Cantor correction model using

1,000 bootstrap replicates. (A) CPK_ORF00679, (B) MACPF, (C) AroAA-Hs, (D) pmpE/F2, (E)

pmpE/F3, (F) 16S rRNA, (G) ompA, (H) omcB, (I) accC, (J) pfk, (K) CP_1042, (L) CP_0880, (M)

CP0505, (N) ScTc, (O) HAF, (P) guaB, (Q) guaA, (R) add, (S) CPK_ORF00678, (T) SSR2, (U)

helicase, and (V) PGP3D. There is evidence of five distinct phylogenetic groupings among isolates.

These groupings correspond to the five proposed genotypes, A-E (Supplementary Table 2). The

19/22 trees were congruent, while the phylogenetic incongruities that were observed in 3 trees (H, J

and M) may be the result of host interactions or adaptation, rather than acquisition through

horizontal transfer.The nomenclature for each isolate is shown in Supplementary Table 1.

CPK_ORF00679

- 234 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

MACPF

AroAA-Hs

- 235 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

pmpE/F2

pmpE/F3

- 236 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

16S rRNA

ompA

- 237 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

omcB

accC

- 238 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

pfk

CP1042

- 239 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

CP0880

CP0505

- 240 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

ScTc

HAF

- 241 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

guaB

add guaA

- 242 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

CPK_ORF00678

SSR2

- 243 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

helicase

PGP3D

- 244 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

Supplementary Figure files 2-23 are provided in the CD version of this thesis (see

Supplementary material folder, Chapter Six).

Supplementary Figure 2. Multiple sequence alignment of CPK_ORF00679. Note the size variation upstream and the indel at nucleotide positions 732-746.

Supplementary Figure 3. Multiple sequence alignment of MACPF. Animal isolates have the full- length gene, whereas human isolates have an 840 bp / 280 aa internal deletion. There is a seven nucleotide indel (TGATCCT) present between 1, 055-1,057 bp and 1,060-1,063 bp. An additional polymorphism (263 bp deletion) was present in two Australian Indigenous isolates SH511 and 1979 between positions 1,334-1,613.

Supplementary Figure 4. Multiple sequence alignment of AroAA-Hs. Sequence from bandicoot

(B26), koala (LPCoLN) and six human isolates (AR39, TW183, CWL029, J138, SH511 and 1979) identified a 244 bp length polymorphism upstream.

Supplementary Figure 5. Multiple sequence alignment of pmpE/F2.

Supplementary Figure 6. Multiple sequence alignment of pmpE/F3.

Supplementary Figure 7. Multiple sequence alignment of 16S rRNA.

Supplementary Figure 8. Multiple sequence alignment of ompA.

Supplementary Figure 9. Multiple sequence alignment of omcB.

Supplementary Figure 10. Multiple sequence alignment of accC.

Supplementary Figure 11. Multiple sequence alignment of pfk.

Supplementary Figure 12. Multiple sequence alignment of CP_1042. Sequence from koala

(LPCoLN), frog (DE177), horse (N16), and six human isolates (AR39, CWL029, J138, TW183, SH511 and 1979) revealed gene fragmentation in the koala LPCoLN isolate.

Supplementary Figure 13. Multiple sequence alignment of CP_0880. The two koala isolates

(LPCoLN and EBB) and bandicoot isolate (B26) are identical in sequence and have diverged genetically (110 SNPs) from the eight human isolates (AR39, CWL029, J138, TW183, TOR1,

- 245 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

WA97001, SH511 and 1979). NB. There are two shared polymorphisms (positions 714 and 818 bp) among koala LPCoLN, bandicoot B26 and Indigenous human isolates SH511 and 1979.

Supplementary Figure 14. Multiple sequence alignment of CP_0505. There are four features of interest: (i) 12 SNPs unique to koala LPCoLN and bandicoots B26 and B37, (ii) 42 SNPs unique to horse N16, (iii) two SNPs unique to Australian Indigenous SH511 and 1979 isolates, and a third sSNP is shared with horse N16, koala LPCoLN, bandicoot B26 and bandicoot B37 isolates, and (iv) a single bp deletion distinguishing frog DE177 from the non-Indigenous isolates (identical sequence).

Supplementary Figure 15. Multiple sequence alignment of SctC. This gene segment can differentiate animal isolates from Indigenous and non-Indigenous human isolates, on the basis of five key SNPs: Two SNPs (position 232; A/C and 273; A/C) distinguish bandicoot B26, koala LPCoLN, frog

DE177 and Indigenous human isolates SH511 and 1979 from the non-Indigenous human isolates

AR39, CWL029, J138, TW183, TOR1 and WA97001 (identical sequences); frog DE177 has one unique

SNP (position 342; T); koala LPCoLN and bandicoot B26 have one shared SNP (position 429; G);

Australian Indigenous human isolates SH511 1979 have one shared SNP (position 469; A).

Supplementary Figure 16. Multiple sequence alignment of HAF. The sequenced human C. pneumoniae genomes are truncated (120 bp deletion), whereas additional human isolates (TOR1,

WA97001, SH511, and 1979) and animal isolates (B26, DE177 and N16) are not truncated.

Supplementary Figure 17. Multiple sequence alignment of guaB.

Supplementary Figure 18. Multiple sequence alignment of guaA.

Supplementary Figure 19. Multiple sequence alignment of add.

Supplementary Figure 20. Multiple sequence alignment of CPK_ORF00678. Horse N16 has four indels (positions 73-84, 151-305, 387-395 and 419-425), relative to frog DE177, bandicoot B26 and koala LPCoLN.

Supplementary Figure 21. Multiple sequence alignment of SSR2. Horse N16 has a 165 bp indel at positions 66-230 bp.

Supplementary Figure 22. Multiple sequence alignment of helicase.

Supplementary Figure 23. Multiple sequence alignment of PGP3D.

- 246 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

Supplementary Table 1. Chlamydia pneumoniae isolates used in this study. Complete list of C. pneumoniae isolates and description of their natural host, year of isolation, specimen type and reference.

Location/Year Isolate Host of isolation if known Specimen type Reference

AR39 Human United States of America, 1983 Pharyngeal Read et al., 2000

CWL029 Human United States of America, 1987 Oropharyngeal Kalman et al., 1999

J138 Human Japan, 1994 Pharyngeal Shirai et al., 2000

TW183 Human Taiwan, 1965 Conjunctival Geng et al., 2003

IOL207 Human Iran, 1967 Conjunctival Dwyer et al., 1972

WA97001 Human Australia, 2001 Nasopharyngeal Coles et al., 2001

TOR1 Human Canada, NA Brain Dreses-Werringloer et al., 2008

A03 Human United States of America, NA Coronary atheroma tissue Ramirez, 1996

LKK1 Human Korea, NA Pharyngeal Lee et al., 2003

SH511 Human Australia, 1992 Nasopharyngeal Hutton and Dodd, 1993

1979 Human Australia, 1992 Nasopharyngeal Asche et al., 1993

LPCoLN Marsupial -Koala Australia, 1998 Nasal Wardrop et al., 1999

EBB Marsupial - Koala Australia, 2007 Pharyngeal This study

B10; B26; B37; WBB Marsupial –Bandicoot Australia, 2000 Nasal Warren et al., 2005;

Kutlin et al., 2007

- 247 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

Pot37 Marsupial – Potoroo Australia, 2007 Pharyngeal This study

N16 Equine – Horse United Kingdom, 1989 Nasal Storey et al., 1993

DE177 Amphibian – Frog Central African Republic, NA Liver Hotzel et al., 2001

GBF Amphibian – Frog Australia, 1997 Lung Berger et al., 1999

2040.3 Amphibian – Frog Switzerland, NA Paraffin: lung, heart, liver Blumer et al., 2007

CPXT1 Amphibian – Frog Western Africa, 1998 Liver Reed et al., 2000

BMTF- type 1 Amphibian – Frog Australia, NA Paraffin: lung, gastrointestinal and brain Bodetti et al., 2002

BMTF- type 2 Amphibian – Frog Australia, NA Paraffin: lung, gastrointestinal and brain Bodetti et al., 2002

Pufadd Reptile – Snake United States of America, NA Paraffin: respiratory tract and heart Bodetti et al., 2002

Burpyth Reptile – Snake United States of America, NA Lung Bodetti et al., 2002

GST Reptile – Turtle United States of America, 1990 Heart Bodetti et al., 2002

Cham Reptile – Chameleon Tanzania, Africa, NA Paraffin: Spleen and Liver Bodetti et al., 2002

Iguana Reptile – Iguana Central America, NA Paraffin: liver, lung, spleen, stomach, intestine Bodetti et al., 2002

NA, not available

- 248 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

Supplementary Table 2. Synonymous SNP profile for 10 selected genes and genotype designation. Complete list of C. pneumoniae isolates and corresponding nucleotide base pairs at particular locations, across eight genes. Genotypes were designated A-E. Dashes indicate no sequence analysed.

16S 16S Isolates pmpE/F2 pmpE/F2 pmpE/F3 pmpE/F3 ScTc HAF CP_0880 CP_0880 CP_0505 CP_0505 Genotype rRNA rRNA

Animal 78* 293 60 753 342 761 51 100 209 818 40 72

LPCoLN T T A A C T A C T C A G A

B10 ------A C - A G A

B26 - - A A C T A C T C A G A

B37 ------A C - - A G A

WBB ------A C - - - - A

Pot37 ------A C - - - - A

EBB ------A C T C - - A

GBF ------A C - - - - A

2040.3 ------A C - - - - A/B/D

DE177 T C G A T T A C - - - - B

CPXT1 ------A C - - - - B/D

Cham ------B/C

N16 ------A A - - A A E

- 249 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

16S 16S Isolates pmpE/F2 pmpE/F2 pmpE/F3 pmpE/F3 ScTc HAF CP_0880 CP_0880 CP_0505 CP_0505 Genotype rRNA rRNA

Animal 78 293 60 753 342 761 51 100 209 818 40 72

Iguana ------G C - - - - C

BMTF-type 1 ------G C - - - - C

BMTF-type 2 ------G C - - - - C

Burpyth ------C

Puffadd ------G C - - - - C

Human D

1979 - G G C T G C T T G A C

SH511 C C G G C T G C T T G A C

LKK-1 ------G C - - - - C

IOL207 ------G C - - - - C

TW183 C C G G C C G C C C G A C

J138 C C G G C C G C C C G A C

CWL029 C C G G C C G C C C G A C

AR39 C C G G C C G C C C G A C

AR39-2 ------C

WA97001 C C G G C C G C C C G A C

TOR1 C C G G C C G C C C G A C

A03 ------C

- 250 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

Isolates accC accC ompA ompA ompA MACPF MACPF MACPF MACPF Genotype

Animal 32 171 2 83 86 39 1074 1597 1779 LPCoLN C C C T A A C G G A B10 C C C T A A C G G A B26 C C C T A A C G G A B37 C C C T A A C G G A WBB C C C T A - - - - A Pot37 - C T A - - - - A EBB C C C T A - - - - A GBF C C C T A - - - - A 2040.3 C C ------A/B/D DE177 C C C C A A C G G B CPXT1 - - C C G - - - - B/D Cham - - C C A - - - - B/C N16 C C T T A - - - - E Iguana - - C C A - - - - C BMTF-type 1 - - C C A - - - - C BMTF-type 2 ------C Burpyth ------C Puffadd ------C Human D 1979 C C C C A G C A A C SH511 C C C C A G C A A C LKK-1 - - C C A - - - - C IOL207 - - C C A G C A A C

- 251 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

Isolates accC accC ompA ompA ompA MACPF MACPF MACPF MACPF Genotype

Animal 32 171 2 83 86 39 1074 1597 1779 TW183 A T C C A G T A A C J138 A T C C A G C A A C CWL029 A T C C A G C A A C AR39 A T C C A G T A A C AR39-2 - - - - - G T A A C WA97001 - - C C A G C A A C TOR1 - - C C A G C A A C A03 A T - - - G C A A C

* Numbers refer to the SNP position of an animal isolate

- 252 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

Supplementary8B Table 3. Oligonucleotide primers used in this study.

The9B fragment sizes are estimated from koala LPCoLN and human AR39 sequences. * Designed using Primer3 v.0.4.0.

Human AR39 Koala LPCoLN Primer annealing Predicted a Gene name Primer name Sequence (5’Æ3’) Nucleotide Nucleotide Reference temperature (°C) length (bp) position position

CPK_ORF00679* CPK_ORF679F TTGTTTTATTGGGTGCTTTGC 23-43 NA 60 800 This study CPK_ORF679R TTGAGCTAAGGTCGAGGGAAG 802-822 520-540 CPK_ORF679HFb TCGAAAAGGCGATTGTATATTG 269-290 2-23 60 539 This study MACPF* MACaF GCAACCCAATTGTGTGATTC 6-25 6-25 60 1,556/726 This study MACaR TTCTCTAACTCCTCGACTTGG 1,551-1,571 711-731 MACbF TGGCATTGGTTTTCAAGTGC 1,515-1,534 675-694 60 915 This study MACbR CTCGTCTGTGTCGTGCAAGT 2,410-2,429 1,570-1,589 MACupstreamF TCAAGCCGAAGAAAGAGAAGA NA NA 60 845 This study MACupstreamR TCTGCGCACTATAAGGAACG 723-742 AroAA-HS Cpn1046F CACCGTGCACTACTGCGAGAGAACC NA 1-22 60 810/1,093 Abromaitis et Cpn1046R CCTATTGGCAAAGTACCTCAAAACC 787-810 1,067-1,089 al., 2009 pmpE/F2* 982aF GTGTCAAAGACTCCTCCTAAGTT 1-23 1-23 56 1,554 This study 982aR AGGAGCTTTTCCTTTTGCTA 1,535-1,554 1,535-1,554 982bF GCAACAACTGCCAACTCTGA 1,447-1,466 1,447-1,466 60 795 This study 982bR TATTGTGAGCCGAGACGTTG 2,223-2,242 2,223-2,242 pmpE/F3* 983aF CGACCCATTTGTCTCAGCAT 4-23 55-74 60 1,856 This study 983aR TGTTCCGGTACTGTAGAGCTTG 1,838-1,859 1,889-1,910 983bF TGGTCTCCCTATTGGATGGA 1,804-1,823 1,855-1,874 60 1,034 This study 983bR CGGCTTTCAGCTTTCAGGTA 2,818-2,837 2,872-2,891 pmpG6* pmpG6F ACAGCTCGCTGACTGGAAAT 1,181-1,200 1,181-1,200 60 657/264 This study pmpG6R TGCCATCAAAGGTAAGAGTCG 1,817-1,837 1,424-1,444 16S rRNA 16SIGF CGGCGTGGATGAGGCAT 36-52 36-52 56 294 Everett et 16SIGR TCAGTCCCAGTGTTGGC 313-329 313-329 al., 1999 ompA* ompaF CCCTTCTGATCCAAGCTTAT 84-103 84-103 56 1,062 This study ompaR TGAGCAGCTCTCTCGTTAAT 1,126-1,145 1,126-1,145

- 253 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

accC accCF CTATAGAGCGTTTTCTGCCG 528-547 528-547 56 369 This study accCR GTAATGGTATGCTCTACCTG 876-896 876-896 Pfk pfkF AACTTCGTCTCCCCTTTCTCCCC 108-130 108-130 56 311 This study pfkR CGAACCCTCCCATGTTGTAA 399-418 399-418 accC accCF CTATAGAGCGTTTTCTGCCG 528-547 528-547 56 369 This study accCR GTAATGGTATGCTCTACCTG 876-896 876-896 Pfk pfkF AACTTCGTCTCCCCTTTCTCCCC 108-130 108-130 56 311 This study pfkR CGAACCCTCCCATGTTGTAA 399-418 399-418 CP_1042* CP1042F CAACTTTGGCGAAATCCT NA 5-22 56 523 This study CP1042R GGCAACATAAGCACAGAAAA 508-527 CP_0880* CP0880F GTCCTTATTGCTTTGCTAATCC 211-232 208-229 56 874/868 This study CP0880R GCAATTTTGGTGGAGAAAA 1,066-1,084 1,057-1,075 CP_0505* CP0505F CAAATCCTACACCGAAAACA 5-24 5-24 56 855 This study CP0505R CAAGGCAACTATGTTCCAAG 836-855 836-855 SctC* SctCF TAAAAATTCAGCAGCCTCAC 192-211 192-211 56 504 This study SctCR ACTGTTGTTGCTGCTTTCTC 676-695 676-695 HAF* HAFaF GGCACGATTATTGTTGGGTCT 601-624 601-624 60 657/537 This study HAFaR ATAAAGCCCGGCACCAAG 1,240-1,257 1,120-1,237 HAFbF AGCCTCAGATCATGAGTTCACA 1,194-1,215 1,074-1,120 60 941 This study HAFbR TCCATGGAGTAAGGACTTTCA 2,114-2,134 1,994-2,014 guaB guaBF TTCTAGTCATTGACACAGCT NA 344-363 56 670 This study guaBR GCTCTTCCAGATTCAGTAAT 994-1,013 guaA* guaAF GAGTGCAAGGAGACATTTGA NA 6-25 56 1,274 This study guaAR CTATAGTTGCTGGTGGCTTG 1,260-1,279 add* addF GAATCTTGAAAAGGAAGATTCTG NA 24-46 56 1,005 This study addR ATCCTAACTGGCAAGTAACTCTT 981-1,003 CPK_ORF00678* K00678F TTTCCCCCTACATAAAGCTGTC 17-38 NA 60 901 This study K00678R CAGTAAATCCTCAGGCCATCA 897-917 SSR2 SSR2F CTACGCTTCTGGGATTAAG 102-120 NA 54 439 This study SSR2R CGAAGAGAGATAACTTCTG Helicase HelicaseF CTGCTATGGGTAAAACAGC 674-692 NA 57 538 This study HelicaseR GCATCTTGCTCTATTTGACC PGP3D PGP3DF ACGGAGGAACAGAAATAGC 440-458 NA 57 336 This study

PGP3DR GCATTTACCCACACAACACC aGene name as annotated in this study bPrimer sequence designed based on human AR39 sequence CP_0608 * Primer sequence designed using Primer 3 NA, not available

- 254 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions

Supplementary10B Text 1 (Below). Key genomic data supporting two evolutionary lineages.

(i) The two Australian Indigenous human isolates (SH511 and 1979) have an extended 251 bp segment at the upstream region of CPK_ORF00679. This extended sequence is identical to the bandicoot (B26), koala (LPCoLN) and a frog (DE177) isolate, yet all non-Indigenous human isolates lack this segment (Supplementary Figure 2). The two Australian Indigenous human isolates, as well as frog DE177, bandicoot B26, koala LPCoLN, and N16 horse, all have the indel IADRF (positions

244-248) which is absent from the non-Indigenous human isolates (Figure 1).

(ii) The pmpE/F2 family protein gene is another example where the Australian Indigenous human isolates have several polymorphisms in common with the animal isolates; both Australian Indigenous human isolates (SH511 and 1979), one frog (DE177), one bandicoot (B26), and one koala (LPCoLN) isolate have a V at position 8, an S at position 298, and an R at position 323 of the amino acid alignment, whereas all non-Indigenous human isolates have the residues, LFL at these positions

(Supplementary Figure 5). Interestingly, the Australian Indigenous human isolates SH511 and 1979 share more sequence identity to the frog DE177 isolate and have the profile VQTDSLEKF at positions

8-16, whereas the koala and bandicoot isolates have the profile VQTNSLEKS at these positions

(Supplementary Figure 5).

(iii) The well-studied 16S rRNA gene also provides evolutionary clues (Supplementary Figure 7). Both

Australian Indigenous human isolates (SH511 and 1979) have the SNP profile AA at positions 21 and

51, matching four amphibian ‘frog’ isolates (DE177, CPXT1, 2040.3 and GBF), and seven marsupial isolates (bandicoot B10, bandicoot B26, bandicoot B37, bandicoot WBB, koala EBB, koala LPCoLN, and potoroo Pot37), whereas the eight non-Indigenous human isolates (AR39, CWL029, TW183,

J138, TOR1, WA97001, LKK1, and IOL207), two amphibians ‘frogs’ (BMTF-type 1 and BMTF-type 2), and two reptiles ‘snakes’ (Pufadd and Iguana) have the profile GG at these positions. Overall these data suggest that; (i) the common human genotype (C. pneumoniae) evident by strains AR39,

CWL029, J138, TW183, LKK1, IOL207, TOR1 and WA97001, is apparently circulating in most continents, and probably originated from a cross species transmission event from an amphibian or reptile source (frogs, turtles and snakes); (ii) the lack of genetic variability within eight non-

Indigenous human isolates and the minimal divergence observed is likely to be the result of a recent

(last few centuries) cross species transfer event to humans; (iii) the Australian Indigenous human genotype evident in the two isolates SH511 and 1979, originated from a separate cross host transmission event from one of the animals (amphibian or marsupial); and, (iv) the Australian

- 255 - Chapter 6: Chlamydia pneumoniae is genetically diverse in animals and appears to have crossed the host barrier to humans on (at least) two occassions marsupial genotype also appears to have originated from a cross host transmission event from an amphibian. We suggest that the sampling of native populations from other geographic regions will be necessary to confirm these hypotheses.

(iv) The ompA gene has six characteristic SNPs (Supplementary Figure 8): (i) six marsupial isolates

(LPCoLN, EBB, WBB, B26, B37, and Pot37), one frog (GBF) and one horse (N16) have a ‘T’ at nucleotide position 83, while the remaining 19 isolates have a ‘C’ at this position, (ii) six marsupial isolates (koala LPCoLN, koala EBB, koala WBB, bandicoot B26, bandicoot B37 and potoroo Pot37), and one frog (GBF) have an ‘A’ at position 225 and a ‘G’ at position 227, while the remaining 18 isolates have the profile ‘GC’ at these positions, (iii) six marsupial isolates (koala LPCoLN, koala EBB, koala WBB, koala B26, koala B37 and koala Pot37), and three frogs (GBF, CPXT1 and DE177) have an ‘A’ at position 231, while the remaining 16 isolates have a ‘G’ at this position, (iv) six marsupial isolates (koala LPCoLN, koala EBB, bandicoot WBB, bandicoot B26, bandicoot B37 and potoroo

Pot37), and two frogs (GBF and DE177) have a ‘C’ at position 237, while the remaining 17 isolates have a ‘T’ at this position and, (v) six marsupial isolates (koala LPCoLN, koala EBB, bandicoot WBB, bandicoot B26, bandicoot B37 and potoroo Pot37), and one frog (GBF) have a ‘G’ at position 244, while two frogs (CPXT1 and DE177) have an ‘A’ at this position, and the remaining 16 isolates have a

‘C’ at this position. The ompA gene, along with 16S rRNA also provides evidence of two separate animal-to-human transmission events.

(v) The frog (DE177), horse (N16), koala (LPCoLN) and Australian Indigenous human isolates

(SH511 and 1979) have a K at position 77 of the SctC type III secretion protein, and another K at position 91, whereas the non-Indigenous human isolates all have a T and Q at these positions

(Supplementary Figure 15).

(vi) The present or absent genes are another example of a closer association of the Australian

Indigenous human isolates with frog DE177. For instance, the frog DE177 isolate contains all three guaBA-add genes (Supplementary Figures 17-19), while the koala LPCoLN isolate contains none of them. Sequence comparisons with all eight available isolates revealed that the frog DE177, horse

N16 and both Australian Indigenous human isolates SH511 and 1979, have a G at position 240, and an A at position 463 of guaB, whereas all six non-Indigenous isolates have AG at these positions

(Supplementary Figure 17).

- 256 - Chapter 7: General Discussion

CHAPTER SEVEN

GENERAL DISCUSSION

- 257 - Chapter 7: General Discussion

7.1 Discussion

Chlamydia pneumoniae is a common human and animal pathogen associated with a wide range of diseases. Since the first isolation of C. pneumoniae strain

TWAR in 1965, there have been several analyses conducted on the morphology, developmental cycle, genetics and genomics of C. pneumoniae human isolates

(Carter et al., 1991; Popov et al., 1991; Miyashita et al., 1993; Kalman et al.,

1999; Wolf et al., 2000; Read et al., 2000; Shirai et al., 2000; Pantoja et al.,

2001; Geng et al., 2003; Miyashita and Matsumoto, 2004). While several reports have described the presence of C. pneumoniae in a variety of animal species, little or nothing is known about the growth patterns, morphologic and genomic characteristics. Moreover, genetic analysis of these isolates has often been restricted to partial sequencing of three highly conserved genes, 16S rRNA, ompA and omcB, which generally makes strain differentiation quite challenging at the molecular level. To address this gap, the present study (i) provided a detailed description of the morphologic and genomic architecture of the C. pneumoniae koala (and human) strain, and showed that the koala strain was microscopically, developmentally and genetically distinct from the human strain, and (ii) examined the genetic relationship of geographically diverse isolates from human, marsupial, amphibian, reptilian and equine hosts, and showed two distinct lineages that have arisen from animal-to-human cross species transmissions.

In Chapter Three, we provided an in-depth in vitro analysis of the morphology and growth characteristics of a C. pneumoniae animal isolate (koala LPCoLN), relative to the human AR39 isolate. It has long been known that (some) C. pneumoniae EBs have a characteristic pear-shaped morphology when grown in

HEp-2, HL and HeLa 229 cells (Chi et al., 1987; Yamazaki, 1992; Miyashita and

Matsumoto, 2004), due to a wide periplasmic space and wavy outer membrane.

- 258 - Chapter 7: General Discussion

Initially, this pear-shape was considered a valid criterion for differentiating C. pneumoniae from other species. In more recent years, however, the EB criterion for C. pneumoniae has been relaxed due to the discovery of non-pear-shaped

EBs with round outer membranes and a narrow periplasmic space (Wills et al.,

1990; Popov et al., 1991; Carter et al., 1991; Storey et al., 1993; Miyashita et al., 1993; Berger et al., 1999; Lee et al., 2003). Therefore, it was not surprising

that the EB morphology differed between the two isolates (LPCoLN and AR39)

under examination. The pear-shaped EB morphology of human AR39 when

grown in HEp-2, HL and HeLa 229 cells has been well documented in the

literature (Chi et al., 1987; Wolf et al., 2000; Miyashita and Matsumoto, 2004),

and we were able to confirm this observation in our analysis. In contrast to the

pear-shaped EB morphology, the koala LPCoLN EBs were round with a narrow or

non-existent periplasmic space when grown in HEp-2 cells (and McCoy cells; C.

Mitchell, unpublished data).

One limitation in this study relates to the representative C. pneumoniae human

isolate. The human isolate, AR39, carries an endogenous bacteriophage

φCPAR39 that is both present as infectious virions and as a replicative DNA form

(Read et al., 2000; Everson et al., 2003). This isolate is the only human isolate identified as having a phage. Whether or not the phage will affect the growth rate interpretations presented in our study is speculative. For example, whether the φCPAR39 phage imposed a metabolic burden and contributed to the slower growth of human AR39. This uncertainty could have been overcome by comparing the human AR39 isolate with a phage-free human isolate. However, a preliminary analysis of koala LPCoLN and human A03 (phage free isolate) did not show any evidence that the human A03 isolate had a faster growth rate, when cultured in McCoy (mouse fibroblast) cells (C. Mitchell, unpublished data).

- 259 - Chapter 7: General Discussion

Our analysis of the C. pneumoniae human and koala genomes revealed several regions of variation. Although we did not associate any of these regions with morphological variation between the koala and human isolates, it can be suggested that further investigation of these regions may be useful in identifying genes responsible for the EB morphology differences. It is reasonable to speculate that the EB morphology may be an indication of (i) the niche requirements, (ii) the mode of transmission, (iii) the type of infection likely to occur, (iv) the age of the cultures in vitro, and (v) the number of passages. The conclusions concerning the morphological changes between koala LPCoLN and human AR39 isolates and the consequences of these factors have not been proven, and are inconclusive.

Several chlamydial inclusion morphologies have been observed among

Chlamydia species (Spears and Storz, 1979; Rockey et al., 1996; Miyashita and

Matsumoto, 2004), and modifications to the inclusion (and inclusion membrane) represents one way that the chlamydiae survive and gain a competitive advantage within their host (Fields and Hackstadt, 2002, Hybiske and Stephens,

2007; Kumar and Valdivia, 2008). Throughout evolution, bacteria will alter their morphology in order to gain access to nutrients, move within and around target cells, and assist escape from predators using three defence strategies (i) evading capture, by the size of the bacterium (being small in size) or their speed (too fast), (ii) resisting ingestion, by the size of the bacterium (being large in size) or the length (being too long), and (iii) becoming inaccessible, by growing in aggregates or biofilms (Hackstadt, 1999; Young, 2007; Hybiske and Stephens,

2007). Under “normal C. pneumoniae growth conditions”, we identified large, heterogeneously shaped, highly-fusogenic koala LPCoLN inclusions that were distinct from the smaller, consistently round, multiple and occasionally fusogenic inclusions of human AR39 – comparable results were also observed when koala

LPCoLN was cultured in HEp-2 cells at a lowered temperature. This study is in

- 260 - Chapter 7: General Discussion agreement with the report of Coles et al. (2001), that the koala LPCoLN isolate produces large inclusions when grown in HEp-2 cells. These findings are significant, given that at some stage in the evolution of this species, C. pneumoniae has modified the size of the inclusion without potentially affecting its integrity.

Chlamydiae are very successful pathogens with intricate regulatory networks to sustain coordination of developmental events - to facilitate the conversion of infectious EBs to metabolically active RBs and reversion to EBs upon completion of their developmental cycle. During routine culturing of the C. pneumoniae koala and human isolates, we noticed that koala LPCoLN completed development earlier than human AR39, when visualised by standard light microscopy. In order to investigate this further, a series of experiments was performed. As a measure of growth rate we compared developmental stages at the ultrastructural level and found that the koala LPCoLN isolate reached maturation and host cell lysis

(approximately 48-72 hpi) sooner than human AR39 (approximately 72-96 hpi), when cultured in human epithelial cells. Moreover, real time PCR measurements of C. pneumoniae genomes also confirmed a faster growth rate in the koala

LPCoLN isolate. Recently, Miyairi et al. (2006) showed a correlation between chlamydial growth and tropic cell type used. For example, a prototype ocular strain of C. trachomatis serovar A grew faster in human conjunctival epithelial

(HCjE) cells than in human genital epithelial (HeLa) cells and vise-versa for genital strains of C. trachomatis. Therefore, one could argue that human epithelial cells as opposed to koala epithelial cells may lead to different growth rates for the koala LPCoLN isolate. However, when koala LPCoLN was cultured in a mouse fibroblast cell line (McCoy), there were no observed changes in growth or morphology of the chlamydial inclusions (C. Mitchell, unpublished data).

Miyairi et al. (2006) further reported that the growth differences between C. trachomatis serovars can be a direct reflection of the efficiency at which a

- 261 - Chapter 7: General Discussion particular developmental stage-specific host-pathogen interaction occurs and that these factors are likely to reflect tissue tropism and disease manifestations

(Miyairi et al., 2006). We presume that these factors are likely to influence strain differences within C. pneumoniae.

In the context of our results, comparison of growth and morphology revealed several biological differences between koala LPCoLN and human AR39. These findings were consistent with a range of genomic differences including the apparent loss of an extrachromosomal plasmid and evidence of gene decay (loss of ancestral function), in the C. pneumoniae human genome. Further evaluation of the C. pneumoniae genomes will clarify many aspects of human and animal strain diversity, and assist the identification of candidate modifiers of growth, morphology and pathotype in future studies.

As a framework for understanding diversity within this species, significant biological and genomic information was obtained from ‘koala LPCoLN’, the very first C. pneumoniae animal genome isolated from the nasal cavity of a koala in

Queensland, Australia. Previously, whole genome sequencing projects have focused on four C. pneumoniae (AR39, CWL029, TW183 and J138) human genomes (Kalman et al., 1999; Read et al., 2000; Shirai et al., 2000; Geng et al., 2003), sharing a highly conserved gene content and organisation. As a result of this conservation, it is difficult to envision selective pressures and identify phylogenetic relationships from a pathogen that is geographically widespread, yet also highly conserved. Chapter Four provides the first description of the koala LPCoLN genome, revealing a wealth of genetic information – including a larger genome with evidence of gene gain/loss, re-arrangements, fragmentation and truncation (particularly within the human strain), and an extrachromosomal plasmid that is absent from all four C. pneumoniae human genomes. Despite these differences, the koala LPCoLN genome is highly conserved with the four

- 262 - Chapter 7: General Discussion full-sequenced human genomes, indicating that they have evolved from a common ancestor.

The genome-wide comparison of C. pneumoniae and other animal chlamydiae genomes across 111 highly conserved genes illustrated that C. pecorum was the

closest species to C. pneumoniae. It is especially interesting that C. pecorum and

C. pneumoniae are two pathogens capable of infecting multiple host species and that these are the two chlamydial pathogens that co-exist in koalas. Although, the sequenced C. pecorum genome is of bovine origin, this genome opens doors to a new line of ‘thoughts’ (for future studies) especially when deciphering what the common ancestor of C. pneumoniae and C. pecorum may have looked like.

It was evident that the chlamydial genomes were highly conserved and shared a common evolutionary relationship, supporting the findings of Stephens et al.

(2009). The koala LPCoLN genome was basal to the human genomes and closely linked to the C. pneumoniae human isolates, with only 10 noteworthy regions of

SNP accumulation. It was apparent that each of these ‘hot spots’ had become specialised, illustrating niche adaptation between the koala and human strain.

For example, several of these genomic ‘hot spots’ comprised known virulence determinants, including the polymorphic outer membrane protein family and autotransporters.

Recently, Rattei et al. (2007) analysed a representative set of 232 synonymous polymorphisms from a collection of 38 isolates (36 human and 2 animal; koala and frog) and presented several key findings, including the identification of 15 genotypes and four clusters (no association with anatomical or geographical origin), and basal animal lineages. It was proposed that recent transmission to humans might have occurred through successive bottlenecks some 150,000 years ago (Rattei et al., 2007). Supporting the assumptions of Rattei et al.

(2007), our genomic and phlyogenetic comparisons of the five available C.

- 263 - Chapter 7: General Discussion pneumoniae genomes led to the proposal that the koala LPCoLN genome was ancestral to the four C. pneumoniae human genomes. The most convincing evidence that we obtained from our whole genome analysis to support this theory was the identification of several full-length coding sequences in the koala

LPCoLN genome that were either fragmented, truncated or in the process of gene decay in the C. pneumoniae human genomes. Moreover, the koala LPCoLN genome was larger than all four C. pneumoniae human genomes by approximately 10 kb. In this study, the C. pneumoniae human genomes were considered to have been derived from a C. pneumoniae animal strain, having become individuated and fully-adapted to humans, to the point where an animal reservoir was no longer required for continuing transmission. An important question was whether the koala LPCoLN isolate that was sequenced truly represented other C. pneumoniae koala strains. To answer this important question, a second koala isolate (EBB) from an independent and ‘wild’ koala population was sequenced (partial-length) at several gene loci, and the nucleotide and deduced amino acid sequences were identical to that of the koala

LPCoLN isolate. This combined sequence data shows directionality from koalas

(animal) to humans and it is impossible to conceive that our data would advocate the reverse situation to be an interpretation. However, the zoonotic animal strain in question remains unknown and the question can only be answered by the future discovery of isolates related to the ‘zoonotic strain’.

While zoonotic transmission of C. pneumoniae has not been proven, zoonotic infection with chlamydiae of avian (C. psittaci) and ruminant (C. abortus) origin have been reported (Roberts et al., 1967; Pospischil et al., 2002; Heddema et al., 2006; Kaibu et al., 2006; Vanrompay et al., 2007), suggesting that the possibility of a previous zoonotic transmission in C. pneumoniae is not improbable in a setting where humans come in contact with animals. In fact, there is convincing evidence to support the zoonotic potential of C. pneumoniae.

The koala (and Australian frog) genotype has previously been identified in

- 264 - Chapter 7: General Discussion

human carotid plaques (Cochrane et al., 2005), which might suggest that transmission has occurred between human and non-human sources. Multiple C. pneumoniae genotypes (worldwide and restricted to Australia) within the same carotid plaque were also identified, suggesting that infection may have occurred on different occasions, as re-infection with C. pneumoniae is possible (Cochrane et al., 2005).

From our genomic and in vitro growth comparisons we propose that the human strain (circulating worldwide) is a derivative of an ‘animal’ strain, but is incapable of infecting non-human species. The evolutionary patterns of the C. pneumoniae human genome suggests that their genome may have adapted for life within the human host as evidenced by an affinity for growth in human cell lines and weak growth in animal cell lines (Kuo et al., 1986; Cles and Stamm, 1990). This finding is consistent with the highly reduced genome of C. pneumoniae human.

By comparison, the koala LPCoLN isolate grows equally well in human (Coles et al., 2001) and animal (C. Mitchell, unpublished data) cell lines and may be utilising the genes that have been preferentially retained throughout evolution.

Therefore, we speculate that humans could possibly be infected from a C.

pneumoniae-infected koala.

C. pneumoniae is one of the most common and widespread respiratory

pathogens of humans and animals – and yet, only one C. pneumoniae animal

genome (koala LPCoLN) and four C. pneumoniae human genomes have been completely sequenced, to date. Due to the limited variation between the four C.

pneumoniae human genomes, little is known about genetic variation within this

species. Therefore, in Chapter Five, we integrated the genomic information from

the four C. pneumoniae human genomes and the newly sequenced koala LPCoLN

genome, in order to identify similarities and differences within the species. We

- 265 - Chapter 7: General Discussion then utilised this data as an approach for the identification of potential strain or species-specific target genes for genotyping additional C. pneumoniae isolates.

Through comparative genome sequence analysis, 141 C. pneumoniae-specific genes were identified and defined as having no significant homology to any other

Chlamydia species or organism. Among them were inclusion membrane protein genes (IncA) and many hypothetical protein genes, indicating many undiscovered roles for these genes. Analysis of the genome content provided insights into the genes and gene families that were stable across the genomes, including the type III secretion system apparatus, and those with spikes of genetic diversity that may be relevant for host and niche adaptations or pathogenicity and virulence. In particular, spikes of genetic diversity were evident in (i) the plasticity zone, showing evidence of gene rearrangements, gene loss and pseudogenes, mostly within the human strain, (ii) pyrimidine and purine biosynthesis pathways that were either absent or represented by few genes, which suggested that the host was the main source for the delivery of the essential nucleotides or amino acids. This would conserve energy expenditure by not having to produce the nucleotides or amino acids themselves, (iii) the pmp gene family, that appeared to be subjected to high selective pressure, as evidenced by the large number of polymorphisms and indels, (iv) the numerous hypothetical protein genes that were either conserved, unique or divergent within the C. pneumoniae species. For some of these, we would expect them to encode functions that may contribute to host specificity, pathogenicity or niche- related adaptations, and (v) the presence of a 7.6 kbp plasmid in the koala

LPCoLN genome and the presence of a 4,524 bp single-stranded DNA bacteriophage in the human AR39 genome (Read et al., 2000).

Remnants of the phage were identified in the koala LPCoLN genome, however, the sequences were incomplete and presumably non-functional. One hypothesis

- 266 - Chapter 7: General Discussion is that the φCPAR39 phage was acquired from an ancient non-human C. pneumoniae strain. Between the events of phage incorporation in the human genome, φCPAR39 became stably integrated in AR39, and presumably diverged from the human (and animal) clade. Overtime, the C. pneumoniae phage became integrated in isolates descending from AR39, and fragmented or lost in non-AR39 clades, perhaps following adaptation to new hosts. This explains why there are remnants of the phage in the more ancient, koala LPCoLN genome, and no remnants in other C. pneumoniae human isolates to date. Further investigation of the phage in C. pneumoniae human isolates (including those of

Indigenous origins) is required in order to explain the true origin of this unique phage.

We also report the discovery of C. pneumoniae human and C. pneumoniae koala strain-specific genes that were either absent from one strain or in the process of gene decay. The majority of these strain-specific genes were also species- specific and of particular interest because they may potentially be responsible for distinguishing features such as pathogenicity or host-specificity. Our analyses further highlight that the plasticity zone, as would be expected, varied in gene content, gene length and arrangement between the koala and human strain. All five C. pneumoniae plasticity zones harboured a MAC/perforin, a protein with pathogenic implications in other intracellular pathogens (Ishino et al., 2005;

Kafsack et al., 2009). The function of the MAC/perforin in chlamydiae is unknown, but it has been suggested that it may have a function similar to complement C9 in pore formation of target membranes (Ponting, 1999; Liu et al., 1995), perhaps facilitating host cell egression and invasion similar to that of

Toxoplasma gondii (Kafsack et al., 2009). The most significant difference between the C. pneumoniae koala and human MAC/perforin genes was in the

length of the gene, with the koala strain predicted to encode a full-length protein

and C. pneumoniae human strains predicted to encode a defective protein – due

- 267 - Chapter 7: General Discussion to the disruption at the middle portion of the C. pneumoniae human chromosome. This disruption is predicted to affect the structure of the protein fold (Rosado et al., 2007) and is likely to affect the function. There are, however,

MAC/perforin proteins that do not function in defence or attack. For example, the

Drosophila torso-like protein contains a MAC/perforin domain involved in embryonic development (Martin et al., 1994), while astrotactin is involved in neuronal migration along glial fibers of mammals (Zheng et al., 1996).

Chlamydial nucleotide salvage and biosynthesis pathways were of particular interest because of their relevance to host range and pathogenesis (Dean et al.,

2006). It was interesting that the ‘only’ three genes, guaA, guaB and add

(nucleotide salvaging), that were absent from the koala LPCoLN genome, but present in all four C. pneumoniae human genomes, were located within the plasticity zone. This points to the loss, not gain, of a metabolic network in the context of C. pneumoniae evolution, as frog isolate DE177 (perhaps more ancestral than koala LPCoLN) also possesses this guaBA-add cluster. Therefore, the absence of guaBA-add from the koala genome still fits into our hypothesis that the human strains are the ones undergoing genomic reduction. One of the fundamental questions that emerged from this analysis was: what pathway would koala LPCoLN utilise to make up for the absence of guaB, guaA and add?

C. pneumoniae has lost the capacity to synthesise and/or salvage nucleotides de novo, which suggests that they must obtain essential nucleotides from their host or by symbiotic microorganisms that can break down organic material to supply the nucleotides. The absence of guaBA-add from the koala isolate indicates that the genes are not required, because the host must supply enough guanine for survival and infection. But how can guanine be utilised if koala LPCoLN lacks the salvage ability? Ceballos and Hatch (1979) reported that C. psittaci 6BC is incapable of metabolising guanine because it lacks a Chlamydia-specific transferase, but could use host-generated guanine nucleotides (for example

- 268 - Chapter 7: General Discussion guanosine 5’triphosphate) as precursors for nucleic acid synthesis. Clearly koala

LPCoLN (and other guaBA-add deficient isolates) is adapted for growth in an

environment that supplies guanine. Alternatively, the cluster is in the process of

decay in C. pneumoniae, as observed in the Australian Indigenous isolates and

possibly the horse N16 isolate, and rendered non-functional or not expressed

(frameshift mutations relative to other species) in C. pneumoniae, as suggested

by Read et al. (2000).

Further analysis of the five C. pneumoniae genomes revealed a highly conserved

species-specific uridine kinase, udk gene. udk appears to be a key enzyme in C. pneumoniae nucleoside metabolism and undergoes phase variable expression

(Read et al., 2000), suggesting that it may be another means for enabling C. pneumoniae to resist or induce persistence in otherwise unfavourable conditions

(Ouellette et al., 2004). As explained previously, tryptophan is an essential amino acid required for chlamydial development, however, the ability to synthesise tryptophan is not universal since the tryptophan biosynthesis operon is in the process of decay or missing from several chlamydial species, including all C. pneumoniae isolates, C. muridarum and C. abortus (Kalman et al., 1999;

Read et al., 2000; Thomson et al., 2005). This region represents the largest loss of a contiguous genomic segment in chlamydiae and is significant because tryptophan metabolism is implicated in chlamydial persistence and tissue tropism

(Fehlner-Gardiner et al., 2002; Caldwell et al., 2003; Akers and Tan, 2006).

Because C. pneumoniae (and other Chlamydia species) is auxotrophic for tryptophan, it must be scavenged from the host during infection or from symbiotic organisms that can produce it de novo (Caldwell et al., 2003), as suggested with guaBA-add.

All sequenced C. pneumoniae isolates have a tyrP gene (single or multiple), encoding a tyrosine/tryptophan permease, which may be responsible for the

- 269 - Chapter 7: General Discussion regulation of these essential amino acids (Gieffers et al., 2003). Copy number variations of the tyrP gene have been shown to reflect vascular tropism and pathogenicity among the C. pneumoniae human isolates, whereby multiple copies (increased levels of transcript) represent respiratory isolates and single copies represent vascular strains (Gieffers et al., 2003). However, in our study, the koala LPCoLN and human J138 respiratory isolates had only one copy of tyrP, which does not support the finding by Gieffers et al. (2003). Our combined genomic and phylogenetic data indicates that koala LPCoLN is ancestral to the human isolates, and therefore it would be interesting to determine whether single or multiple copies are present in other animal isolates, to elucidate whether duplication is an evolutionary old event.

The C. pneumoniae polymorphic outer membrane (pmp) family is extremely plastic in terms of mutations, insertions and deletions, suggesting a high level of selective pressure from the host immune system, or adaptations to an unaccustomed niche. Therefore, it was not surprising that the pmps comprised up to 37% of the overall genomic variation. Moreover, most of the variation was confined to the pmpE family, which at present has no defined role in chlamydial biology. Several other interesting genes identified from comparisons, included

CPK_ORF00679, a conserved hypothetical protein that is predicted to encode a

Lamin 2-like protein (similar to homo sapiens) and CPK_ORF00201, encoding a

HAF family-autotransporter domain that may function as a regulator of virulence determinants, since autotransporters are virulence-related proteins in Gram negative bacteria (Henderson et al., 1998). The koala LPCoLN version of these genes was full-length, relative to the C. pneumoniae human gene – presumably the result of host adaptation. The list of target genes that were identified as part of this study encode a wide range of proteins involved in many (some unknown) different processes, which may significantly influence the biology and phenotype of C. pneumoniae. Further investigation of these genes will improve our

- 270 - Chapter 7: General Discussion understanding of intra-species variation, as well as provide clues to pathogenicity and disease manifestations.

Together with the results of the previous chapter, the final chapter (Chapter Six) makes a major contribution to our understanding of genetic variability within the

species C. pneumoniae. In order to assess the diversity within C. pneumoniae, our first task was to expand our collection of isolates to include additional human isolates, one horse, seven marsupial, six amphibian, and five reptilian C. pneumoniae isolates, from various geographical locations. The second task was to select a subset of target genes for comparison – a total of 23 target genes were selected. We showed that the C. pneumoniae animal isolates were

significantly more genetically diverse than C. pneumoniae human isolates. The

analysis confirmed animal versus human strain-specific genes and segments

thereof, which will be useful for future investigations dedicated to understanding

the evolutionary history and strain-specific adaptations of this pathogen.

Previously, we identified a 7.6 kbp plasmid in the koala LPCoLN genome, a

feature shared with a horse N16 isolate (Thomas et al., 1997), but not the four

fully-sequenced C. pneumoniae human (AR39, CWL029, J138 and TW183)

isolates. We screened an additional eight animal isolates (marsupial and

amphibian) and seven human isolates, and found that the plasmid was unique to

the animal lineage(s). Whether the presence of an extrachromosomal plasmid is

correlated to virulence, pathogenicity or success of the pathogen in an animal

host remains unknown. However, its absence from the human strain renders it

non-essential for infection or survival. It is quite possible that one (or more) of

the genes on the plasmid account for a much faster growth rate than human

strains. For example, the horse N16 isolate has a disruption in ORF1 of the

plasmid, a potential replication gene, and this isolate is difficult to culture in vitro

(I. Clarke, personal communication), therefore a combination of mutations and

- 271 - Chapter 7: General Discussion the deletion in ORF1 may be involved in growth rate. The amount of variation

(4%) between the horse and koala plasmids was not surprising, as the horse

N16 isolate was the most polymorphic isolate across all (non-plasmid) genes investigated. Perhaps this variation is evidence that the horse N16 isolate represents an evolutionary ‘more’ recent adaptation to a horse/animal host.

Alternatively, this sequence variation may provide justification for a separate subspecies within the species, C. pneumoniae (Pettersson et al., 1997).

We had access to a total of 19 C. pneumoniae animal isolates and 11 C. pneumoniae human isolates - the most exhaustive collection of isolates from a range of host species, investigated in the one study to date. Precautions were taken to avoid PCR contamination and amplicon carry-over; fresh gloves were worn at all times, reagents were prepared in a separate room to where genomic

DNA was added, sterile water and pipette tips with aerosol filters were used at all times, pipettes and tube racks were subjected to a UV lamp for a minimum of

30 minutes to prevent bacterial growth, and desks for the addition of genomic

DNA were rotated to minimise residual aerosol contaminaton. However, the limitations of this study were that several of the animal C. pneumoniae isolates were archival and DNA was no longer available, limiting comparisons to already published sequences. The second limitation was that some of the isolates were formalin-fixed tissues, restricting comparisons to partial-length sequences to minimise mis-incorporation of nucleotides. A third limitation was in the chosen

Taq polymerase which lacked proof-reading activity. For this reason, sequence lengths were kept to partial-length fragments and PCR fragments were sequenced in both directions, and a third sequence obtained if required. Despite these limitations, our combined analyses of the target genes and sequence polymorphisms provided us with a level of confidence with regard to the direction of evolution (summarised in section 7.3), and the proposal of five genotypes (A-E). From the analysis of genetic and phylogenetic data it was

- 272 - Chapter 7: General Discussion evident that the five genotypes showed a distinct geographic distribution.

However, additional C. pneumoniae isolates are needed to determine whether

the amount of differentiation constitutes a definite genotype designation.

7.2 What did the common ancestor of the current C. pneumoniae human and animal strains most likely resemble?

Molecular evidence to suggest that the Chlamydia genome is derived from an ancient cyanobacterium or protozoan, is that a high proportion of chlamydial proteins are similar to those of plant proteins targeting the chloroplast (an organelle that is derived from cyanobacteria, an environmental inhabitant)

(Brinkman et al., 2002). Alternatively, an ancestral Chlamydia species may have

been chimerically involved with cyanobacteria to later constitute plant plastids by

endosymbiosis (G. Greub, personal communication). The ability of C.

pneumoniae to establish an infection in Acanthamoeba (sustained viability in the

amoebal host- protozoa of soil and fresh water) and which, from the

assumptions of Essig et al. (1997), may explain the current widespread

prevalence of C. pneumoniae.

The evolution of C. pneumoniae during its adaptation to intracellular life in a

range of cold and warm blooded hosts seems to be driven, in part, by a

reduction in its genome. A comparison of genes from multiple host species has

shown that the ‘essential’ genome of C. pneumoniae arose from multiple

fragmentation events (evident across the whole C. pneumoniae human genome)

to the point where fragmented genes were no longer required for infection and

thus, lost any selective pressure to be maintained. Subsequently, the loss of

function has led to the formation of pseudogenes which have accumulated

mutations, stop codons and frame-shifts, rendering the ‘non-essential’ genes as

non-functional or deactivated and in the process of loss (e.g. guaBA-add,

- 273 - Chapter 7: General Discussion plasmid, hypothetical genes, tryptophan biosynthesis operon, etc.), as an adaptation to a host that can potentially supply essential molecules.

7.3 An evolutionary hypothesis of C. pneumoniae

From the analysis of genetic patterns and phylogentic re-constructions, it was clear that all C. pneumoniae isolates shared a common ‘unknown’ ancestor, although the number of hosts and precise date of divergence remains unclear. C. pneumoniae appears to have been in the animal host for an extended period of time. This has allowed the animal strains to adapt and evolve their own unique strains within a particular host. We hypothesise that an ancestral C. pneumoniae strain infected a progenitor animal (cold or warm-blooded), and this is where the divergence began (Figure 1). The potential bottlenecks may have originated in amphibian and reptilian animal hosts, and when Gondwanaland broke up (Figure

2), C. pneumoniae may have spread to the newly formed continents (in their retrospective animal hosts). Ancestral strains must have crossed from South

America ⇔ Africa ⇔ India ⇔ Antarctica ⇔ Australia (Figure 1). More importantly, as a result of their adaptive evolution, the infected-host species then went on to infect other animal host species (evident by the emergence of this pathogen in animal wildlife) and accumulated mutations over time. In more recent years, C. pneumoniae may have been introduced to humans by a divergent animal host on at least two separate occasions (Figure 1) as proposed by our data. Evidence to support this includes the nearly clonal C. pneumoniae human genotype identified in USA, Canada, Taiwan, Iran, Japan, Korea and Australia (non-Indigenous), most likely originating from a single amphibian or reptilian lineage, which appears to have been previously geographically widespread. This hypothesis is also supported by our observation of a separate human lineage, apparent in two

Australian Indigenous isolates from independent geographical locations that is distinct from the first lineage, and may have crossed the host barrier from

- 274 - Chapter 7: General Discussion

Figure 1. Chlamydia pneumoniae evolutionary hypothesis. C. pneumoniae appears to have been transmitted to humans on at least two occasions. One human lineage (right) shares polymorphisms with the present day reptiles and amphibians, and the second lineage (left) is present in Indigenous Australians, sharing several SNPs in common with animal C. pneumoniae isolates.

Stars represent unknown hosts in the lineage. Images are from clipart, except the Indigenous

Australian image which was obtained from http://3.bp.blogspot.com/. Figure by Mitchell and Timms,

2009 (Unpublished).

- 275 - Chapter 7: General Discussion

Figure 2. Predicted migration patterns of Chlamydia pneumoniae. Coloured arrows represent

predicted demographic movement patterns. Figure adapted from http://geology.com/pangea-H

continental-drift.gifH

- 276 - Chapter 7: General Discussion amphibians or marsupials. Although the numbers of hosts that have been infected in between these transmissions remains unclear, this trend seems to be

evident across many of our target genes investigated.

Under the assumptions of Rattei et al. (2007) and the Escherichia coli molecular clock model, C. pneumoniae may have been transmitted to humans through consecutive bottlenecks around 150,000 years ago, or sooner assuming a faster clock rate for the intracellular bacterium. The analysis of additional animal and human isolates from diverse geographical regions has filled an important gap in our understanding of C. pneumoniae diversity and will serve as a starting point

for epidemiological investigations.

7.4 Novel targets for detection and epidemiological investigation of C. pneumoniae of human and animal origin

In this project, we identified genes (and pathways) that may become novel targets for detection and epidemiological investigation of C. pneumoniae. Among these were conserved, length polymorphic and sequence polymorphic genes.

Potential target genes were confirmed by PCR and sequencing of previously unsequenced isolates (and sequenced isolates as controls) using the primers decribed in this work. Based on our experimental work with several of these target genes, we believe that our list could not only improve detection and identification of C. pneumoniae, but could be used to help guide future

experimental studies. A summary of potential candidate genes (and their

recommendations) is summarized in Table 1, while Figure 3 shows the

approximate koala LPCoLN genome location of each of the recommended genes.

The unique 5’ region of the SctC (CPK_ORF00106) gene is recommended for

‘detection’ of C. pneumoniae using PCR and gene sequencing,

- 277 - Chapter 7: General Discussion

Table 1. Novel targets for detection and epidemiological investigation of C. pneumoniae

Gene Predicted/known function Description

Novel detection of C. pneumoniae

SctC (CPK_ORF00106)* Type III secretion system protein Primers were designed to detect a 504 bp fragment that is specific to C. pneumoniae

C. pneumoniae strain differentiation

Membrane Attack MACPF (CPK_ORF00685)* Potential virulence role and length polymorphism between human and animal isolates Complex/Perforin Length polymorphism between human and animal isolates and 15 bp indel unique to Indigenous CPK_ORF00679* Hypothetical Australian isolates and animal isolates Polymorphic outer membrane pmpG6 (CPK_ORF00956) Variable numbers of tandem repeats among isolates –related to tissue tropism or pathogenicity? protein family

Unique C. pneumoniae genes

CP_1042 (CPK_ORF00237)* Hypothetical Koala strain is fragmented, while human and additional animal isolates have the ‘full-length’ CPK_ORF00678* Hypothetical Unique to animal strains (thus far)

C. pneumoniae plasmid identification

Helicase (CPK_ORFA00005) Replicative DNA helicase (dnaB) Highly conserved plasmid gene PGP3D (CPK_ORFA00007) Hypothetical Highly conserved plasmid gene

* Asterisk indicates potential candidates for epidemiological investigation of outbreaks of particular animal or human strains

- 278 - Chapter 7: General Discussion

CPK ORF00106 CPK ORF00237

C. pneumoniae Koala LPCoLN 1, 241, 024 bp 1, 095 CDSs CPK_ORF00956

CPK ORF00678 CPK_ORF00685

CPK_ORF00679

Figure 3. Approximate genomic localisation of selected target genes.

as an alternative to 16S rRNA and ompA sequences that are not species-specific.

For C. pneumoniae differentiation, primers were designed to directly distinguish

between C. pneumoniae animal and human isolates on the size of the PCR

product across several gene loci (including, MACPF, CPK_ORF00679 and

pmpG6). These size differences between isolates of animal and human origin will

have important implications for studies investigating transmission and

acquisition of C. pneumoniae, and the zoonotic potential of this pathogen.

Moreover, several human and animal isolates contain a CP_1042 (hypothetical

protein) gene, although the gene version present in the koala isolate (and

presumably additional Australian marsupial isolates) was fragmented and did not

translate an amino acid sequence, in consequence of a stop codon. This gene

may have some important biological or physiological function in non-marsupial

hosts in vivo. A second unique hypothetical protein gene likely to be involved in

- 279 - Chapter 7: General Discussion adaptive evolution (to a specific niche), is that of CPK_ORF00678, which appears to be animal host-specific and could potentially be used for human versus animal strain differentiation since this gene has not been identified in isolates of human origin, from various geographical regions, in our study. At present, the ‘cryptic’ chlamydial plasmid has not been identified in C. pneumoniae isolates of human origin. However, its presence in C. pneumoniae animal isolates implies that there may be a function (growth, pathogenicity or virulence) in the animal host.

Therefore, two plasmid genes, helicase and PGP3D are recommended for the identification of a C. pneumoniae plasmid.

7.5 Recommendations for researchers, veterinarians and animal care/service workers

C. pneumoniae is a pathogen that may or may not present clinical signs or symptoms in the infected individual. An essential factor in minimising the spread of C. pneumoniae (and other organisms) to personnel engaged in animal research or animal care is personal protection and hygiene.

7.5.1 Recommendations for researchers

First and foremost, protective clothing and eyewear must be supplied to employees and ‘worn’. Any persons working with a potential C. pneumoniae case or viable culture must wear a long-sleeve laboratory coat or protective gown

(back opening), a double layer of nitrile or latex gloves, a facemask, protective eyewear and covered footwear. All work ‘must’ be conducted in a biohazard cabinet – all ‘unknown’ specimens should be treated as ‘infectious’. C. pneumoniae is primarily a respiratory pathogen, thus, aerosols can be generated. All manipulations and materials must be contained in screw capped

- 280 - Chapter 7: General Discussion chryovials, tissue culture flasks or an appropriate container that ensures no leakage of the specimen following additional handling, processing, storage or shipment (nescofilm is advised to wrap around the opening of flasks, plates and vials). Prior to and upon exiting of the biohazard cabinet, the contained specimen must be ethanol sprayed (70-100%) continuously to ensure removal of aerosols - it is necessary to have two pairs of gloves at each time when working in the biohazard hood to ensure that the top layer is disposed prior to exiting the biohazard cabinet. All contaminated waste materials are to be decontaminated prior to dry waste or liquid waste disposal. For example, (i) all liquid containing viable chlamydial organisms and contaminated pipette tips must be disposed off in liquid waste (add 1/10 of stock sodium hypochlorite (12.5%) to the 1L or

500mL container – check that any reagents that have come in contact with the tip will not react with the hypochlorite, and with an empty container fill the liquid waste to the top with water) for a minimum of 24 hours before discarding down the sink, (ii) all dry waste (serological pipettes, paper towel, gloves, tissue culture flasks, other dry/plastic goods exposed to viable chlamydial organisms) must must be discarded in a double layered autoclave bag that is set up in the biohazard safety cabinet (make sure there is a fair amount of water ~50-100 ml in each bag to facilitate steam penetration in the bag for autoclaving), and (iii) all materials and equipment (pipettes, centrifuge, writing utensils, etc) must be

UV irradiated in the cabinet for a minimum of 45 minutes and sealed for appropriate discard.

A spill kit should be close by in case of an accident and the spill should be cleaned up by a trained staff member equipped to work with infectious material.

The use of gloves provides a measure of protection for preventing hand contamination, although, thorough hand washing is essential to ensure no contamination was transferred upon the removal of gloves.

- 281 - Chapter 7: General Discussion

7.5.2 Recommendations for veterinarians and animal care workers

All veterinary practices must be prepared for emerging zoonoses. Potential C. pneumoniae cases must be treated as ‘infectious’, such that personal protective equipment must be worn, including a disposable gown or laboratory coat, disposable gloves, a facemask, protective eyewear and footwear. Hair, skin and clothing of the handler and animal must be cleaned/washed in order to help reduce contamination. Waste (gloves, gowns, masks etc) must be double bagged

(as above) and discarded appropriately.

7.6 Conclusions

In summary, our combined data demonstrate that the C. pneumoniae koala

LPCoLN isolate is morphologically and genomically distinct from the C. pneumoniae human isolates, and thus presumably the result of selection during host adaptation. While in vivo studies are not possible in the koala system, we were able to identify significant biological differences between the C. pneumoniae koala and C. pneumoniae human isolates in vitro, mainly in terms of size, morphology, and growth. In the context of these results, the biological differences between koala and human strains are consistent with a range of genomic differences, where the koala appears to have evolutionarily retained many full-length genes and an extrachromosomal plasmid. Koala LPCoLN is capable of growth in both human (HEp-2) and animal (McCoy) cell lines, while human isolates culture more efficiently in a human epithelial cell line (Kuo et al.,

1986; Grayston, 1992). This further highlights that the koala LPCoLN isolate is more ancestral as it can readily adapt to growth in both human and animal cell lines. Furthermore, a detailed examination of the koala LPCoLN genome revealed more genetic variation in contrast to the nearly clonal C. pneumoniae human genomes, and in combination with a genetic analysis of additional animal and

- 282 - Chapter 7: General Discussion human isolates, provided compelling evidence to support the proposal that the ancestral strain originated from an animal strain.

The application of our target genes will hopefully lead to better detection of this species and may also see the increased detection of C. pneumoniae in previously

unexplored hosts. Ultimately, knowledge of species diversity will enable

chlamydiologists to better understand the ecology and extremely wide host-

range of this diverse pathogen. Moreover, this knowledge will improve our

attempts to manage and control the impact of C. pneumoniae-related disease in

humans and animals.

7.7 Future Directions

Genetic variations are capable of influencing tissue tropism and the clinical outcome of infection (Gieffers et al., 2003; Kari et al., 2008). Chlamydial genome sequencing projects have provided unique opportunities to predict and evaluate gene functions and pathways that have evolved and led to species and/or strain-specific disease phenotypes. Our study of the five C. pneumoniae

genomes represents a first step towards defining potential markers that could be

used to determine tissue tropism, clinical outcome and demographic background.

The major animal reservoir of C. pneumoniae has not been determined. Thus, a

larger prospective study of additional animal isolates from a wide range of

geographically separated hosts could determine the correlation of C. pneumoniae

animal and C. pneumoniae human isolates. Moreover, it would be interesting to

investigate the extent of diversity in Indigenous human populations from other

geographic origins to determine whether there is a higher degree of sequence

identity to non-Indigenous isolates or Australian Indigenous isolates.

- 283 - Chapter 7: General Discussion

Although the complete genome sequence of C. pneumoniae koala has provided some valuable information, our recent genetic comparisons have provided evidence of a much broader genotype within the animal species studied.

Therefore, whole-genome sequencing efforts should be focused on additional C. pneumoniae animal isolates (amphibian, reptilian or equine) to further enable the identification of key polymorphisms, gene re-arrangements, gene insertions, gene deletions and gene gain/loss within the C. pneumoniae genome. The functional implications of genetic diversity in many of our selected target genes are unknown. Additional information from cloning and expressing genes of interest may serve to elucidate functional differences. Since, chlamydiae lack a genetic system, and many of the C. pneumoniae-specific genes are hypothetical

(no significant homology to other Chlamydia species or organisms) in origin, determining their function should be one of the key focuses to better understanding their role in C. pneumoniae biology. This could be achieved through production of the recombinant protein of interest and raising monoclonal and polyclonal antibodies (for studies including subcellular localisation and immunoprecipitation), two-hybrid screening to discover protein-protein interactions, quantitative real time PCR and microarray analysis to measure expression levels. The work described in this thesis will enable a deeper investigation on C. pneumoniae diversity. The selected target genes may potentially lead to a much earlier detection and/or a more accurate means of intervention in the future.

- 284 - Chapter 7: General Discussion

7.8 References

Akers JC and Tan M (2006). Molecular mechanism of tryptophan-dependent transcriptional regulation in Chlamydia trachomatis. Journal of Bacteriology. 188, 4236-4243.

Berger L, Volp K, Mathews S, Speare R and Timms P (1999). Chlamydia pneumoniae in a free-ranging giant barred frog (Mixophyes iteratus) from Australia. Journal of Clinical Microbiology. 37, 2378-2380.

Brinkman FSL, Blanchard JL, Cherkasov A, Av-Gay Y, Brunham RC, Fernandez RC, Finlay BB, Otto SP, Ouellette FBF, Keeling PJ, Rose AM, Hancock REW and Jones SJM (2002). Evidence that plant-like genes in Chlamydia species reflect an ancestral relationship between Chlamydiaceae, Cyanobacteria, and the Chloroplast. Genome Research. 8, 1159-1167.

Caldwell HD, Wood H, Crane D, Bailey R, Jones RB, Mabey D, Maclean I, Mohammed Z, Peeling R, Roshick C, Schachter J, Solomon AW, Stamm WE, Suchland RJ, Taylor L, West SK, Quinn TC, Belland RJ and McClarty G (2003). Polymorphisms in Chlamydia trachomatis tryptophan synthase genes differentiate between genital and ocular isolates. The Journal of Clinical Investigation. 111, 1757-1769.

Carter MW, al-Mahdawi SA, Giles IG, Treharne JD, Ward ME and Clark IN (1991). Nucleotide sequence and taxonomic value of the major outer membrane protein gene of Chlamydia pneumoniae IOL-207. Journal of General Microbiology. 137, 465-475.

Ceballos MM and Hatch TP (1979). Use of HeLa cell guanine nucleotides by Chlamydia psittaci. Infection and Immunity. 25, 98-102.

Chi EY, Kuo CC and Grayston JT (1987). Unique ultrastructure in the elementary body of Chlamydia sp. strain TWAR. Journal of Bacteriology. 169, 3757-3763.

Cles LD and Stamm WE (1990). Use of HL cells for improved isolation and passage of Chlamydia pneumoniae. Journal of Clinical Microbiology. 28, 938-940.

Cochrane M, Walker P, Gibbs and Timms P (2005). Multiple genotypes of

- 285 - Chapter 7: General Discussion

Chlamydia pneumoniae identified in human carotid plaque. Microbiology. 151,

2285-2290.

Dean D, Myers GS and Read TD (2006). Lessons and challenges arising from the “first wave” of Chlamydia genome sequencing. In: Chlamydia genomics and pathogenesis. Edited by Bavoil PM and Wyrick PB. United Kingdom: Horizon Press. p.8.

Essig A, Heinemann M, Simnacher U and Marre R (1997). Infection of Acanthamoeba castellanii by Chlamydia pneumoniae. Applied and Environmental Microbiology. 63, 1396-1399.

Everson JS, Garner SA, Lambden PR, Fane BA and Clarke IN (2003). Host Range of Chlamydiaphages CPAR39 and Chp3. Journal of Bacteriology. 185, 6490-6492.

Fehlner-Gardiner C, Roshick C, Carlson JH, Hughes S, Belland RJ, Caldwell HD and McClarty G (2002). Molecular basis defining human Chlamydia trachomatis tissue tropism. The Journal of Biological Chemistry. 277, 26893-26903.

Fields KA and Hackstadt T (2002). The chlamydial inclusion: escape from the endocytic pathway. Annual Review of Cell and Developmental Biology. 18, 221- 245.

Geng MM, Schuhmacher A, Muehldorfer I, Bensch KW, Schaefer KP, Schneider S, Pohl T, Essig A, Marre R and Melchers K (2003). The genome sequence of Chlamydia pneumoniae TW183 and comparison with other Chlamydia strains based on whole genome sequence analysis. Unpublished 2003, Submitted (MAY- 2002) to the EMBL/GenBank/DDBJ databases.

Gieffers J, Durling L, Ouellette SP, Rupp J, Maass M, Byrne GI, Caldwell HD and Belland RJ (2003). Genotypic differences in the Chlamydia pneumoniae tyrP locus related to vascular tropism and pathogenicity. The Journal of Infectious Diseases. 15, 1085-1093.

Grayston TJ (1992). Chlamydia pneumoniae, strain TWAR pneumonia. Annual Review of Medicine. 43, 317-323.

- 286 - Chapter 7: General Discussion

Hackstadt T (1999). The diverse habitats of obligate intracellular parasites. Current Opinion in Microbiology. 1, 82-87.

Heddema ER, van Hannen EJ, Duim B, de Jongh BM, Kaan JA, van Kessel R, Lumeij JT, Visser CE and Vandenbroucke-Grauls CMJE (2006). An outbreak of psittacosis due to Chlamydophila psittaci genotype A in a veterinary teaching hospital. Journal of Medical Microbiology. 55, 1571-1575.

Henderson IR, Navarro-Garcia F and Nataro JP (1998). The great escape: structure and function of the autotransporter proteins. Trends in Microbiology. 6, 370-378.

Hybiske K and Stephens RS (2007). Mechanisms of host cell exit by the intracellular bacterium Chlamydia. Proceedings of the National Academy of Sciences. 104, 11430-11435.

Ishino T, Chinzei Y and Yuda M (2005). A Plasmodium sporozoite protein with a membrane attack complex domain is required for breaching the liver sinusoidal cell layer prior to hepatocyte infection. Cellular Microbiology. 7, 199–208.

Kaibu H, Iidda K, Ueki S, Ehara H, Shimasaki Y, Watanabe S, Anzai H, Takebu W, Muta T, Kusaba T, Kishimoto T and Ando S (2006). Psittacosis in all four members of a family in Nagasaki, Japan. Japanese Journal of Infectious Diseases. 59, 349–350.

Kafsack BF, Pena JD, Coppens I, Ravindran S, Boothroyd JC and Carruthers VB (2009). Rapid membrane disruption by a perforin-like protein facilitates parasite exit from host cells. Science. 323, 530–533.

Kalman S, Mitchell W, Marathe R, Lammel C, Fan J, Hyman RW, Olinger L, Grimwood J, Davis RW and Stephens RS (1999). Comparative genomes of Chlamydia pneumoniae and C. trachomatis. Nature Genetics. 21, 385-389.

Kari L, Whitmire WM, Carlson JH, Crane DD, Revenau N, Nelson DE, Mabey DC, Bailey RL, Holland MJ, McClarty G and Caldwell HD (2008). Pathogenic Diversity among Chlamydia trachomatis ocular strains in nonhuman primates is affected by subtle genomic variations. The Journal of Infectious Diseases. 197, 449-456.

- 287 - Chapter 7: General Discussion

Kumar Y and Valdivia RH (2008). Actin and intermediate filaments stabilize the Chlamydia trachomatis vacuole by forming dynamic structural scaffolds. Cell Host and Microbe. 4, 159-169.

Kuo CC, Chen HH, Wang SP, Grayston TJ (1986). Identification of a new group of Chlamydia psittaci strains called TWAR. Journal of Clinical Microbiology. 24, 1034-1037.

Lee SJ, Nam EC, Won J, Park WS, Kim WJ, Han SS and Choi DJ (2003). Characterization of the first Korean isolate of a Chlamydia pneumoniae strain. Japanese Journal of Infectious Diseases. 56, 62-64.

Liu CC, Walsh CM and Young JDE (1995). Perforin: structure and function. Immunology Today. 16, 194–201.

Martin JR, Raibaud A and Ollo R (1994). Terminal pattern elements in Drosophila embryo induced by the torso-like protein. Nature. 367, 741-745.

Miyairi I, Mahdi OS, Ouellette SP, Belland RJ and Byrne GI (2006). Different growth rates of Chlamydia trachomatis biovars reflect pathotype. The Journal of Infectious Diseases. 194, 350-357.

Miyashita N, Kishimoto T, Soejima R and Matsumoto A (1993). Reactivity of Chlamydia pneumoniae strains in the IDEIA CHLAMYDIA test kit designed for detection of Chlamydia trachomatis. The Japanese Association for Infectious Diseases. 67, 549-555.

Miyashita N and Matsumoto N (2004). Morphology of Chlamydia pneumoniae. In: Chlamydia pneumoniae Infection and Disease: Infectious Agents and Pathogenesis. First edition. Edited by Friedman H, Yamamoto Y and Bendinelli M. New York: Klumer Academic/Plenum Publishers. pp.11-28.

Ouellette SP, Belland RJ, Gieffers J and Byrne GI (2004). The biology of Chlamydia pneumoniae in cardiovascular disease pathogenesis. In: Chlamydia pneumoniae infection and disease. Edited by Friedman H, Yamamoto Y and Bendinelli M. New York: Klumer Academic/Plenum Publishers. 2004, 135–51.

- 288 - Chapter 7: General Discussion

Pantoja LG, Miller RD, Ramirez JA, Molestina RE and Summersgill JT (2001). Characterization of Chlamydia pneumoniae persistence in HEp-2 cells treated with gamma interferon. Infection and Immunity. 69, 7927-7932.

Pettersson B, Andersson A, Leitner T, Olsvik Ø, Uhlén M, Storey C and Black CM (1997). Evolutionary relationships among members of the genus Chlamydia based on 16S ribosomal DNA analysis. Journal of Bacteriology. 179, 4195-4205.

Ponting CP (1999). Chlamydial homologues of the MACPF (MAC/perforin) domain. Current Biology. 9, R911-R913.

Popov VL, Shatkin AA, Pankratova VN, Smirnova NS, von Bonsdorff CH, Ekman MR, Mörttinen A and Saikku P (1991). Ultrastructure of Chlamydia pneumoniae in cell culture. FEMS Microbiology Letters. 84, 129-134.

Pospischil A, Thoma R, Hilbe M, Grest P and Gebbers JO (2002). Abortion in woman caused by caprine Chlamydophila abortus (Chlamydia psittaci serovar I). Swiss Medical Weekly. 132, 64-66.

Rattei T, Ott S, Gutacker M, Rupp J, Maass M, Shreiber S, Solbach W, Wirth T and Gieffers J (2007). Genetic diversity of the obligate intracellular bacterium Chlamydophila pneumoniae by genome-wide analysis of single nucleotide polymorphisms: evidence for highly clonal population structure. BMC Genomics. 8, 355.

Read TD, Brunham R, Shen C, Gill S, Heidelberg J, White O, Hickey E, Peterson J, Utterback T, Berry K, Bass S, Linher K, Weidman J, Khouri H, Craven B, Bowman C, Dodson R, Gwinn M, Nelson W, DeBoy R, Kolonay J, McClarty G, Salzberg S, Eisen J and Fraser C (2000). Genome sequences of Chlamydia trachomatis MoPn and Chlamydia pneumoniae AR39. Nucleic Acids Research. 28, 1397-1406.

Roberts W, Grist NR and Giroud P (1967). Human abortion associated with infection by ovine abortion agent. British Medical Journal. 4, 37.

Rockey DD, Fischer ER and Hackstadt T (1996). Temporal analysis of the developing Chlamydia psittaci inclusion by use of fluorescence and electron microscopy. Infection and Immunity. 64, 4269-4278.

- 289 - Chapter 7: General Discussion

Rosado23B CJ, Buckle AM, Law RHP, Butcher RE, Kan W-T, Bird CH, Ung K, Browne KA, Baran K, Bashtannyk-Puhalovich TA, Faux NG, Wong W, Porter CJ, Pike RN, Ellisdon AM, Pearce MC, Bottomley SP, Emsley J, Smith AI, Rossjohn J, Hartland EL, Voskoboinik I, Trapani JA, Bird PI, Dunstone MA and Whisstock JC (2007). A common fold mediates vertebrate defense and bacterial attack. Science. 317, 1548-1551.

Shirai M, Hirakawa H, Kimoto M, Tabuchi M, Kishi F, Ouchi K, Shiba T, Ishii K, Hattori M, Kuhara S and Nakazawa T (2000). Comparison of whole genome sequences of Chlamydia pneumoniae J138 from Japan and CWL029 from USA. Nucleic Acids Research. 28, 2311-2314.

Spears P and Storz J (1979). Biotyping of Chlamydia psittaci based on inclusion morphology and response to diethylaminoethyl-dextran and cycloheximide. Infection and Immunity. 24, 224-232.

Stephens RS, Myers G, Eppinger M and Bavoil PM (2009). Divergence without differences: phylogenetics and taxonomy of Chlamydia resolved. FEMS Immunology and Medical Microbiology. 55, 115-119.

Storey CC, Lusher M, Yates P and Richmond SJ (1993). Evidence for Chlamydia pneumoniae of non-human origin. Journal of General Microbiology. 139, 2621- 2626.

Vanrompay D, Harkinezhad T, van de Walle M, Beeckman D, van Droogenbroeck C, Verminnen K, Leten R, Martel A and Cauwerts K (2007). Chlamydophila psittaci transmission from pet birds to humans. Emerging Infectious Diseases. 13, 1108-1110.

Wills JM, Watson G, Lusher M, Mair TS, Wood D and Richmond SJ (1990). Characterisation of Chlamydia psittaci isolated from a horse. Veterinary Microbiology. 24, 11-19.

Wolf K, Fischer E and Hackstadt T (2000). Ultrastructural analysis of developmental events in Chlamydia pneumoniae-infected cells. Infection and Immunity. 68, 2379-2385.

- 290 - Chapter 7: General Discussion

Yamazaki T (1992). Morphology and immunotyping of AC-43 strain of Chlamydia pneumoniae isolated from a Japanese child. The Japanese Association for Infectious Diseases. 66, 632-636.

Young KD (2007). Bacterial morphology: why have different shapes? Current Opinion in Microbiology. 10, 596–600.

Zheng C, Heintz N and Hatten ME (1996). CNS gene encoding astrotactin, which supports neuronal migration along glial fibers. Science. 272, 417.

- 291 -