In Vitro Analysis of Genetically Distinct Chlamydia Pecorum Isolates Reveals Key Growth Differences in Mammalian Epithelial and Immune Cells T ⁎ Md
Total Page：16
File Type：pdf, Size：1020Kb
Veterinary Microbiology 232 (2019) 22–29 Contents lists available at ScienceDirect Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic In vitro analysis of genetically distinct Chlamydia pecorum isolates reveals key growth differences in mammalian epithelial and immune cells T ⁎ Md. Mominul Islama, , Martina Jelocnika, Susan Ansteya, Bernhard Kaltenboeckb, Nicole Borelc, Peter Timmsa, Adam Polkinghorned a Genecology Research Centre, Faculty of Science, Health, Education and Engineering, University of the Sunshine Coast, Sippy Downs, Australia b Department of Pathobiology, Auburn University, Auburn, USA c Institute of Veterinary Pathology, University of Zurich, Switzerland d Animal Research Centre, Faculty of Science, Health, Education and Engineering, University of the Sunshine Coast, Sippy Downs, Australia ARTICLE INFO ABSTRACT Keywords: Chlamydia (C.) pecorum is an obligate intracellular bacterium that infects and causes disease in a broad range of Chlamydia pecorum animal hosts. Molecular studies have revealed that this pathogen is genetically diverse with certain isolates In vitro growth linked to different disease outcomes. Limited in vitro or in vivo data exist to support these observations, further Genetically distinct hampering efforts to improve our understanding of C. pecorum pathogenesis. In this study, we evaluated whether Developmental cycle genetically distinct C. pecorum isolates (IPA, E58, 1710S, W73, JP-1-751) display different in vitro growth phenotypes in different mammalian epithelial and immune cells. In McCoy cells, shorter lag phases were ob- served for W73 and JP-1-751 isolates. Significantly smaller inclusions were observed for the naturally plasmid- free E58 isolate. C. pecorum isolates of bovine (E58) and ovine origin (IPA, W73, JP-1-751) grew faster in bovine cells compared to a porcine isolate (1710S). C. pecorum isolates could infect but appear not able to complete their developmental cycle in bovine peripheral neutrophil granulocytes. All isolates, except 1710S, could multiply in bovine monocyte-derived macrophages. These results reveal potentially important phenotypic differences that will help to understand the pathogenesis of C. pecorum in vivo and to identify C. pecorum virulence factors. 1. Introduction 1997; van Zandbergen et al., 2004). Like other chlamydiae, C. pecorum grows intracellularly in eu- C. pecorum is an obligate intracellular pathogen with a broad host karyotic cells via a unique bi-phasic developmental cycle. The devel- range. In cattle, sheep, goats and pigs, C. pecorum is responsible for opmental cycle consists of infectious, metabolically inert and smaller several diseases, such as keratoconjunctivitis, polyarthritis, en- elementary bodies (EBs) and non-infectious, metabolically active and cephalomyelitis and abortion (Longbottom and Coulter, 2003; Walker larger reticulate bodies (RBs) (Hackstadt et al., 1997). The develop- et al., 2015). Moreover, C. pecorum is also considered a common gas- mental cycle starts with attachment to and entry of EBs into host cells. trointestinal commensal transmitted by the fecal-oral route with high Following endocytosis, the EBs rapidly differentiate into RBs. These RBs rates of asymptomatic gastrointestinal tract colonisation reported in divide by binary fission and undergo a sixfold reduction in size within both sheep and cattle (Jee et al., 2004). The progression of a primary the parasitophorous vacuole and transform back to EBs to be released gastrointestinal tract infection to a systemic infection that results in the from the host cell by lysis or extrusion as a completion of develop- characteristic chlamydial diseases in livestock is not understood yet. In mental cycle (Lee et al., 2018; Hybiske and Stephens, 2008). Interest- other chlamydiae (C. pneumoniae, C. psittaci and C. trachomatis), it has ingly, different Chlamydia isolates of the same species exhibit different been suggested that circulating monocytes may help in transferring the growth rates in vitro which might be correlated to different infection bacteria to other organs (Rupp et al., 2009; Ostermann et al., 2013) and disease outcomes (Vanrompay et al., 1996). In a mouse genital tract with different chlamydial species displaying clear phenotypic differ- infection model, C. muridarum isolates producing large numbers of EBs ences in the ability to infect and/or multiply in peripheral neutrophil are associated with high vaginal shedding and more severe pathology granulocytes and/or monocyte-derived macrophages (Koehler et al., compared to isolates which produce less EBs (Lyons et al., 2005). ⁎ Corresponding author at: Genecology Research Centre, Faculty of Science, Health, Education and Engineering, University of the Sunshine Coast, Sippy Downs, 4556, Australia. E-mail address: [email protected] (Md. M. Islam). https://doi.org/10.1016/j.vetmic.2019.03.024 Received 15 November 2018; Received in revised form 21 February 2019; Accepted 21 March 2019 0378-1135/ © 2019 Elsevier B.V. All rights reserved. Md. M. Islam, et al. Veterinary Microbiology 232 (2019) 22–29 Compared to well-studied human chlamydial species C. trachomatis, (Phillips et al., 2018). or the murine species C. muridarum, much is still to be learned about the All C. pecorum isolates were routinely propagated in McCoy cells biology of C. pecorum. Genomic analyses have revealed that C. pecorum (CRL-1696, ATCC, USA) at 37 °C, 5% CO2 in DMEM growth media isolates from koalas, sheep, cattle and pigs share a 1.1 Mbp sized highly (Gibco, Australia), supplemented with 5% heat inactivated fetal calf − conserved and syntenic genome, with any potential genetic variation serum (FCS) (Life Technologies, Australia), 120 μgml 1 streptomycin − conferring differences in virulence and tissue and/or host tropism (Sigma-Aldrich, Australia), and 50 μgml 1 Gentamycin (Gibco, contained to nucleotide variability in the genes encoding for poly- Australia). C. pecorum isolates were inoculated on McCoy cells with morphic membrane proteins (PMPs) and Type III effector (T3SS) pro- medium supplemented with 1 μg/ml of cycloheximide for 48 h (h). teins, plasticity zone and presence or absence of plasmid (Bachmann After 48 h post infection (hpi), C. pecorum was harvested by mechanical et al., 2014; Sait et al., 2014; Jelocnik et al., 2015). Two genetically disruption of cells using 3 mm glass beads in Sucrose Phosphate distinct C. pecorum isolates, identified by Multi Locus Sequence Typing Glutamate (SPG) and stocks were stored at −80 °C until further use. (MLST) and designated sequence types ST 23 and ST 69 were described The SPG media consisted of 218 mM sucrose (Sigma-Aldrich, Australia), in association with disease in geographically separated sheep flocks and 3.76 mM KH2PO4 (Sigma- Aldrich, Australia), 7.1 mM K2HPO4 (Sigma cattle herds in Australia (Jelocnik et al., 2014). More recently, it was Aldrich, Australia), and 5 mM Glutamic acid (Sigma- Aldrich, proposed that the C. pecorum plasmid in plasmid-bearing isolates may Australia), pH, 7.4. contribute to disease development (Jelocnik et al., 2015) given that, in For infection studies, bovine kidney cells (BK) (CCL-22, ATCC, other Chlamydia species, it was shown that plasmid-bearing isolates are USA), human epithelial cells HEp-2 (CCL-23, ATCC, USA) and murine more infective and are able to induce a more severe pathology in a macrophage cells RAW264.7 (CRL-2278, ATCC, USA) were cultivated genital mouse model compared to non-plasmid bearing isolates in DMEM with 5% FCS, 50 μg/ml gentamicin, 100 μg/ml streptomycin (O’Connell et al., 2007). and then infected with the above mentioned isolates as described in 2.3. In the following study, we aimed to investigate and compare the in vitro growth properties of different genetically distinct C. pecorum iso- 2.2. Purification of peripheral blood mononuclear cells (PBMC) lates in a range of mammalian cell types. A range of in vitro growth properties were selected to provide further insight into C. pecorum cell The isolation of PBMCs and growing of monocyte-derived macro- biology and in vitro infection dynamics. phages was performed according to the protocol described elsewhere (Wolf et al., 2005). Briefly, EDTA whole blood were collected from healthy cattle, after approval by the University of the Sunshine Coast 2. Methods Animal Ethics Committee (ANA18135). The whole blood was mixed with sterile PBS (1:1). Five millilitres Ficoll was added to a 15 ml 2.1. C. pecorum isolates, cell culture and culture conditions Sepmet tube and combined with 8 ml of the blood/PBS mixture into the Sepmet tube in an upright position. Following centrifugation at 1200xg The characteristics of the five C. pecorum isolates used in this study for 10 min at room temperature, PBMCs were decanted and washed are outlined in Table 1. The genetic identity of each strain was con- twice in PBS. PBMCs were resuspended in serum-free medium and firmed by amplification of the full-length C. pecorum ompA gene (1200 seeded in a concentration of 3 × 105/ml in 48-well cell culture plates. bp) using ompA F 5′ AAGCATAATCTTAGAGGTGAG 3′ and ompA R 5′ After 2 h attachment, plates were washed three times with serum-free CTGTTAGAATCTGCATTGAGC 3′ primers. The amplicons were bidir- medium to remove the unbound cells. The attached PMNs cells were ectionally Sanger sequenced (Macrogen, Korea), following sequence grown for 24 h before infection. For macrophage differentiation, bovine identity analyses using BLAST (https://blast.ncbi.nlm.nih.gov/Blast. monocytes were grown for eight