Posted on Authorea 10 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158137036.64067629 — This a preprint and has not been peer reviewed. Data may be preliminary. l 00 ac ta.21) oee,itrcin ewe itnl eae aaas aemjrimpacts major have also et taxa Jankowski related 1975; distantly Weske between these and interactions and (Terborgh However, and resources taxa 2013). Futuyma similar these al. 1977; for competition. of et compete al. Pasch limits often is et 2010; taxa range ways (Abbott al. related influence various species Closely can 2005). Brown in of interactions and Kolm specialization competitive patterns Valone and increasing 1992; diversity Emerson Barton through 1988; influence and diversity Moreno (Goldberg can enhance exclusion that or competitive 2018). by interactions 1995) diversity al. effects biotic et reduce al. diversity and Faldyn may et key 2008; strength shaping Wisz Competition al. the the in 2013; et as (Tylianakis al. interactions of especially change et these climate 2017), (Blois One to of al. change susceptible climate et role themselves to Gavish are the difficult due 2017; interactions study ranges these Anderson be of species 2015; to can Schemske in al. need interac- effect 1960; shifts et growing Valiente-Banuet biotic predicted (Fischer and 2013; of diversity a that cause light species fact is that the and the there in and interactions to However, patterns shaping 2010) biotic attributed 2009). in Grytnes between Ara´ujo be al. interactions and relationship may et 2013; these (McCain the studies quantify of in and of al. McCain to distinguish role paucity 2009; et to difficult the This al. Wisz often While et 2013). (Schemske are 2009; 2018). al. tested tions al. et rarely al. is et Wisz it et 2010; Nelsen acknowledged, (Schemske Grytnes 2018; often ways is dis- al. patterns different and et biodiversity in diversity large-scale Lany affect scales 2014; predation, different Rozenfeld and at and competition species commensalism, of mutualism, tribution as such interactions Biotic broad bird across insectivorous patterns Introduction lower diversity vertebrate to shape contributing may thereby might ants ants elevations, with weaver low Competition and at songbirds Himalaya. the that prey gradients. eastern in suggest biodiversity in arthropod results increase elevations Our for low an diets. other at in ant diversity experiments have each weaver results removal ants by with and ants affected weaver bird compete weaver most without both were potentially of of Trees Lepidoptera removal components and Coleoptera prominent mid-elevations. Experimental of were and numbers and Notably, damage. low arthropods. demonstrate leaf both non-ant methods and at of molecular abundance abundance songbirds weaver using Asian and arthropod analysis the ants Diet non-ant of weaver impact elevations. greater the we low between studied Here, at we overlap Specifically, ant peaks. diet prey. aggressive elevations diversity extensive low arthropod common bird for at a insectivorous birds common and smaragdina), with very (Oecophylla compete are arthropods could ants ant other over elevations Himalaya; of low eastern clades at abundance the ants these the in if where birds of ask mid-elevations and patterns ants at diversity be absent might complementary almost example but cause such One could scales. clades spatial related large distantly between interactions Competitive Abstract 2020 5, May 3 2 1 Himalaya. eastern Supriya the K. in elevations low low to at contributor diversity a songbird as ants insectivorous with Competition onl University Cornell Chicago of University University State Arizona 1 rvrPrice Trevor , 2 n oreMoreau Corrie and , 1 3 Posted on Authorea 10 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158137036.64067629 — This a preprint and has not been peer reviewed. Data may be preliminary. 04 as e i. n i.S) ee ecmae h ito evrat n id ttelwelevation Next, low overlap. the dietary at assess birds to and absent, ants are weaver al. ants of weaver et diet where (Price the elevations Himalaya compared higher eastern we at Previous the Here, and 1977). in S2). Davidson co-occur, songbirds Fig. and they for (Brown and where between resource resource Fig.1 if competition limiting limiting see assessed for a same (also first are the pre-condition 2014) we of necessary arthropods elevation, use that A low the suggests birds. the in research overlap and at significant ants resources is weaver for taxa between compete two overlap might dietary birds birds is and of there ants diversity canopy weaver resources. lower through whether evaluated the food We to test trees for contributes To 2008). between competition elevations Mele move low to Van at due ground, 2005; ants elevations weaver Christian the these of and insectivorous on at dominance Peng and arboreal the 1997; that trees an (Basu possibility the by aggressive the on highly dominated are both are (Ghosh- and forage elevations S2) connections ants Fig. low Weaver and ants, S1 obs.). mid-elevations, Fig. Among at pers. ant 1, forests weaver 2014). (Fig. cloud Asian elevations al. the low the in et the species, absent at Price almost arthropod) diverse are and 2013; (i.e. ants al. abundant contrast, Harihar et resource highly By Schumm are greater S2). 2014; they al. Fig. with though et and even (Price associated S1 peak species Fig. The is more 1, 2014). hence, and (Fig. al. and 2019) et species individuals (Price more bird diversity supporting bird insectivorous potentially in above abundance, small peak both mid-elevation conservation) of the niche from largely for climatic dispersal explanation with consists an (associated area, 1200m mid-elevations as between greater at support elevations diversification little including for at have hypotheses, time forests greater dispersal cloud and the below, and and in historical peaks Various diversity eastern 2000m. songbird the competition and in breeding of Himalaya, hypothesis lack this eastern forests. investigated the the We cloud In be 2014). these al. could in et forests abundant Price (Price cloud and 2001; songbirds in (Heaney diverse 2013), Himalaya. maxima prey very al. arthropod abundance often for et and are ants Maveety diversity 2001) with 1987; this (Heaney (Wilson for mammals mechanism beetles capable survive small although One carabid cannot and hand, elevations, ants other 2014) higher nesting the al. On and arboreal et 1997). low whereas al. year at et with the Samson living varies 1973; throughout of found Janzen wet 1917; are are and (Wheeler that forests m temperatures places 1500m-2500 freezing cloud between in which lies persist (Janzen (Stadtm at usually cannot unclear 2400m-3300m elevation limit ants other elevational from remain The lower in of ranges that 2014). the abundance limit numbers but reasons al. in upper factors, reduce for et low geographic very world, to Longino other in the 1997; and shown or latitude al. across experimentally absent forests et forests are been lowland Samson cloud ants have However, 1973; sub-tropical montane They 2017). sub-tropical and al. 2014). and tropical et diversity. al. tropical Karban in species et 2010; of especially al. Sam patterns (Pi˜nol et arthropods, on 2002; arthropods (Sup- interactions other al. birds these of et of and effect ants predators (Floren the between important assessed amensalism are not or have Ants competition they for competition S1), Formicidae). Family evidence table ecological (Phylum Insecta, presented plementary Class songbirds for have Arthropoda, patterns: studies role (Phylum diversity several ants a complementary and While their Oscines) suggests Subfamily shaping Aves, that in Class evidence clades Chordata, related experimental al. distantly et and two M. observational between Rachel present Germain 2014; we al. in Here, many et differences (Venail Indeed, 2015). coexistence niches strong al. ecological if et that for even Pille model of 2016). Gerhold imply exclusion this 2010; role competitive theory Levine support the and studies cause coexistence Mayfield against empirical could 2000; ecological evidence (Chesson Tucker competitors different 2010; as in related substantially In al. used are advances distantly et macroecology. been between recent Pablo in G´omez ability has Juan However, 2002; attention community competitive al. much 2017). a et received al. (Webb in not filtering et species inferred abiotic has related been instead subject has closely emphasizing et patterns this competition, of Jennings diversity 2008), 1990; presence on taxa Lawton (Jablonski the related and record fact, distantly Hochberg between fossil 1989; competition the al. of taxa from effect et related the Palmeirim distantly and 197 eohlasmaragdina Oecophylla le 97.Oepsil xlnto sta ground-nesting that is explanation possible One 1987). uller ¨ 2 hc iapasa bu 0meeain(.Supriya (K. elevation 900m about at disappears which Posted on Authorea 10 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158137036.64067629 — This a preprint and has not been peer reviewed. Data may be preliminary. Osnne l 08 n cSm Gtlie l 05.Alsrpsaddtiso h tp r available are steps the of al. details et and (Callahan scripts All dada2 were packages 2015). analyses R al. the the et paper. All (Gotelli the using this vegan EcoSimR used to 2011), shell “resources”. and (Wickham and supplements the ggplot2 2018) the as “species” 2011), in as as al. Boutros elevations 18), and et diets and low = (Chen (Oksanen environment in VennDiagram at (N 2016), families programming elevations 25) (Wright DECIPHER low = or R and 2016), at (N orders the values birds ants different row in weaver considered of and we the done to species 15) case, occurrence reshuffling it each = our by of compare by (N In species frequency and elevations columns) overlap. each middle species (in niche for between at utilization of overlap birds utilization distribution resource niche resource null on estimate a randomizes information to generates algorithm given used overlap The is niche R (rows). of EcoSim (NMDS) (Gotelli distribution scaling BLAST EcoSimR 2014). multidimensional null using our non-metric Team the levels and a of Core between diagrams taxonomic venn overlap hit (R various using at overlap estimated R top mid-elevations the we in the visualized NCBI- and and sequences, low for the 2015) at contaminating used information al. birds other and taxonomic et and database and detailed ants weaver nr bacteria get of NCBI out to diets the filtering 2014) against After samples. file al. FASTA our results. from et this recovered BLAST (Dias sequences unique to script the blastplus taxcollector all in with blastn file FASTA further a used created for We then methods and Supplementary table (ASV) (see variant sequencing bp. before analysis 150 core Data than sequencing longer the Chicago, All fragments at at for removed platform. Illinois were Miniseq selected of Illumina that details) that University an bands procedure the on dimer a at sequencing primer with and core strong selection Sequencing had size DNA the products is faecal pooling, PCR to bird it barcoding, the products for because in PCR Illinois, DNA set successful Chicago, prey primer of sent this presence We indicates used TRRGACGAGAAGACCCTATA; amplification We extract. (5’-3’ DNA pair successful (2014). so primer specific, al. lns16S-short invertebrate the et following using Clarke and small kit rDNA 25 by tissue a nest a 16S and ACGCTGTTATCCCTAAGGTA) described taking we out their of blood carried by until DNeasy segment We to Qiagen samples or a the extraction. carrying these using hour amplify DNA then from were an for and DNA it protocol for ants crushing manufacturer’s extracted either weaver items, the We prey colonies, the the first. different of that happened each 25 of whichever food part from al. items, items of 10 et food items collected Zeale collected had collected following We we protocol, 2016. the April-June diet, between in ant modifications weaver QIAamp Qiagen minor examine used some To We with extraction. DNA DNA until extract ethanol elevations to 95% 3200m We (2011). kit in and S2). 2700m stored Mini table 2300m, were (Supplementary Stool 1200m, samples sites at DNA faecal samples Bengal All faecal the 2017. 82 at May collected elevations and in 2000m birds 107 and additional 200m an at caught samples faecal 41 collected methods lab Park and National Field Valley Neora analysis in India. elevation diet Sikkim, Molecular 1200m in at Park (27.0611 studied National Park also Khangchendzonga National in were Valley elevations diets Neora Bird of Bengal. site (27.03 West (26.8858 mid-elevation in Sanctuary the 2000m) Wildlife at ˜ Chapramari forests in cloud elevations broadleaved low at forests 88.8341 broadleaved subtropical moist the sites whether Study assess to design paired trees. a on using Methods abundance weaver experiment without exclusion arthropod and and reduce with removal trees significantly on ant ants herbivory weaver weaver insect a to conducted due damage and leaf ants and abundance arthropod compared we ° ,88.78 N, ° ,˜20)i etBna,Ida iddeswr tde tCarmr n ntetemperate the in and Chapramari at studied were diets Bird India. Bengal, West in 200m) ˜ E, l edokwscnutdoe pi-ueo 0421.At n id eesuidat studied were birds and Ants 2014-2016. of April-June over conducted was fieldwork All efloe h aa ieie(alhne l 06 ocntuta mlcnsequence amplicon an construct to 2016) al. et (Callahan pipeline dada2 the followed We ° )ada 30 (27.42 2300m at and E) oeaiebr it,btenArlJn 06w agt13brsadsuccessfully and birds 103 caught we 2016 April-June between diets, bird examine To ° ,88.20 N, ° ) 70 (27.43 2700m E), 3 ° μ ,88.19 N, C plmrs hi ecin to reaction) chain (polymerase PCR L ° ) 20 (27.45 3200m E), ° ,88.7707 N, ° ,88.17 N, ° ° ° E) N, E, Posted on Authorea 10 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158137036.64067629 — This a preprint and has not been peer reviewed. Data may be preliminary. h otfeun resi h idde taleeain eeLpdpeaadClotr Fg 3& S3 (Fig. Coleoptera and Lepidoptera were elevations all at diet overlap bird of because the 980 in than orders from greater 333 frequent is and this most ants weaver that The from note 325 groups). (162 elevations; elevation, contaminants these 3200m 2000m among and and the ASVs bacteria at 2700m in for birds 2300m, from filtering 1200m, 224 after at elevation, sequences sequences birds 200m supposed 1072 980 the these, was at to Of used birds table reduced pipeline. we from (Supplementary dada2 which well set the matches as from primer Squamata (ASVs) BLAST variants the as elevationsyielded sequence such though We higher amplicon taxa Even at 1331 samples. vertebrate recovered elevation. samples We some food faecal 1200m S3). amplified bird ant nine at it additional weaver invertebrate-specific, and samples 36 low-elevations be 25 additional from to at 2 DNA all species prey and and sequence bird Sikkim S2) and five in amplify table from to (Supplementary total, able mid-elevations in also were samples at 33 species from bird DNA different prey sequence and amplify (R analysis environment diet programming Molecular RStudio the in done were Results analyses belonging and All ant insects (Peng 2009). weaver of Homopterans 2014). number with al. Team the the associations Core in et removed mutualistic trees Crozier also form and We between ants 2005; we weaver count. abundance year arthropods, Christian because arthropod one other arthropod Homoptera, our on of in suborder ants from weaver the period ants change of to all to the effect the the of over values compare in number and interested all the to were month removed we to t-tests one Since added treatments. paired of control one and used period exclusion with also the We log-transformed over damage were data. leaf data the in abundance weaver zeroes Arthropod lost avoid ants. or weaver gained had without supplement. trees or the of in number presented arthropod a analysis are recorded time Data We results that tree. degree; by each at an uncertain but receiving leaves as 2016, an random trees damage April-June to 16 leaf in ants On on recorded later and tree. also of branch year We removal clipped one the treatments. receiving the the branch-clipping abundances experimental on trees and of by the herbivory beating to caused after canopy insect using month similar of disturbance trees the one index these appear the and of or mimic them each before at make to trunk 2005) Tanglefoot abundance branches (Ozanne to tree arthropod the few treatment measured paper under We the a 15 brown nests. crevices pruned ant of of of weaver trunk out and band bark the 6 treatment a the from in experimental attached ants holes the of we weaver the treatment, exclude nature all or control the remove plugged the weaver completely We of all to tree. because removed trees, unable the we were trees of of Tanglefoot We group, pairs of base cotton. treatment band 15 with the experimental a band using from applied the experiment then height in and exclusion m trees pruner and 1 tree On removal visual a tree. girth. (2) ant using the and weaver nests and of ant height tree, a branch each species, out clipped of by carried (˜0.5m) parts paired we short different herbivore a 2015 the from insect on April-June leaves on of leaf 10 In ants proxy each on assess weaver on longer-term absent to absent a of % methods % two as of absence used of trees We estimation arthropods, or estimation damage. observer of visual collected leaf presence for pairs (1) higher the by control the damage: the implied all To on leaf of abundance counted order. damage arthropod unaware we taxonomic greater leaf was with to estimated camp, abundance, them arthropods also field repeated We classified the the and tree. and counting in ethanol source mm, Later person 95% nearest containing tree. the the vials the bias, to in (2012). of length al. Pi˜nol that arthropods part by et body insects collecting used another measured the method before all at the collected times to process and similar three girth. stick, is the foliage and which a height diameter), with the 100cm tree species, beat a by ([?] We of umbrella paired upturned foliage were an the trees on beat the fell we where abundance, ants, weaver arthropod without measure To trees and present ants weaver Methods abundance Field arthropod on ants weaver of Effect eue ardttsst opr rhoo bnac n efdmg ewe re with trees between damage leaf and abundance arthropod compare to t-tests paired used We nJn 04adMy21,w esrdatrpdaudnea 7piso re with trees of pairs 17 at abundance arthropod measured we 2015, May and 2014 June In fte4 aclsmlscletda 0mad20meeain,w eeal to able were we elevations, 2000m and 200m at collected samples faecal 41 the Of 4 TM rudtetuko h rea about at tree the of trunk the around Posted on Authorea 10 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158137036.64067629 — This a preprint and has not been peer reviewed. Data may be preliminary. pce tteeeeain Piee l 04.Frhr h w otcmo rhoo resi iddiets bird in orders bird greater arthropod insectivorous a common small most because two many low important the of Further, at is 2014). presence This arthropods al. the experimentally et for arthropods. with confirmed (Price birds of elevations birds. correlates and these with mid-elevations abundance and ants at weaver at increased compete ants species weaver with to arthropods to between trees of likely led overlap on removal abundance were diet abundance ant ants significant weaver weaver arthropod show that lower if results found ask Our we to Himalaya. Moreover, out eastern set in we elevations study, 2009). this al. et In Crozier 2005; Christian hand, and other (Peng Discussion the Homopterans On -8.8 with S3). treatment associations Fig. mutualistic N=15; & form 5b t-test ants (Fig. (paired elevations exclusion all at ant ± diets weaver bird after of decreased components frequent Hemiptera most the 1.3 (treatment also significance are to experi- close on was (Lepidoptera: increase that abundance the in increase significantly for increased responsible Lepidoptera 5a). were 1.0 statistically (Fig. insects treatment controls number the not to of of respect in orders was with course taxonomic S8). increase trees the difference two mental S7, over the treatments, ants the (Figs. year, experimental by effect but the following recolonized reduced In been trees, the the had control In to trees contribute experimental 4). than might the (Fig. greater which of 0.018) year, Some was S8). = trees S7, P (Figs. treatment significant 15, on = arthropods N of t-test, (paired significant 4.67 was from increased had 9.8 homopterans) and ants trees ± arthropods(excluding these of from experiment numbers branches exclusion ants the clipped weaver and the with removal on trees from ant direction x on Weaver estimated same than 1.7 damage the ants was Leaf weaver in elevations, 3a). without trend all trees non-significant (Fig. S6b). to on a ants at (Fig. showed weaver belonging greater diet and significantly with insects bird was 3b) trees of tree (Fig. in on number each orders than the on ants common leaves However, weaver 10 most S6a). without two trees (Fig. the on ants weaver Lepidoptera, higher without and or Coleoptera with orders abundance accumulation trees gradient. in elevational arthropod on the asymptote on across of arthropods species ants absence arthropod weaver the in of difference by finer the Effect indicated or at as S5) overlap (Fig. sampling diet levels Lower of taxonomic of mid-elevation) S7). finer function Diet at Table at a level. levels. curves absent (Supplementary be are ASV scales ASV ants could taxonomic the and (weaver scales finer ants family at weaver taxonomic at order, elevation not significantly low at overlap albeit of significantly not levels, diet did overlapped the taxonomic mid-elevations and all mid-elevations and from at low significantly birds overlapped utilization from ants weaver resource birds 44%), and of random elevations Neuroptera, low Diet from (order at birds expected [lacewings of than more diets the three more all 6%)]. that plus identified Ephemeroptera, showed elevation, results (order we EcoSimR low mayflies absent), Our the and are 6%) at ants Monostilifera, present weaver Entomobryomorpha, (order orders (where worms 18 (order 3200m nemertean (Der- the springtails and earwigs of and as 2000m one 5%) between such (Thysanoptera, but elevations thrips arthropods lizards At had 5%), Sco- small 11%). and birds (Psocoptera, (order some maptera, but 5.5%) booklice centipedes 22%), as S3-S6) Gastropoda, as in (Plecoptera, well tables (class stoneflies such present Supplementary as 11%), molluscs animals orders S4, 5.5%) 11%), larger Fig. the Squamata, Haplotaxida, included & of (order (order These 2 Each weaver annelids orders. (Fig. 61%). in 33%), diets additional (all common lopendromorpha, bird nine Hymenoptera in are in and found animals (48%) also Hemiptera consumed Coleoptera samples. was Blattodea, the and diet of to ant (69%) 88% addition weaver in Lepidoptera in Coleoptera that and diet, 94% confirmed ant in analyses detected was diet Lepidoptera Molecular 200m, At S3). table Supplementary . E .9.Ti eraei xetdgvnta tcnan h uodrHmpeaadweaver and Homoptera suborder the contains it that given expected is decrease This 0.09). = P SE, 4.9 .6S,N=1,wiecnrl hwdn infiatcag bfr:7.73 (before: change significant no showed controls while 15, = N SE, 1.26 ± .1S,N=1) vrl,tedffrnebtentecag vrtm ntetetadcnrltrees control and treatment in time over change the between difference the Overall, 15). = N SE, 1.51 ± . E oto -0.5 control SE, 0.5 ± . E =5 ardtts .1 n oepeasoe large a showed Coleoptera and 0.01) = P t-test paired N=15, SE, 0.3 ± 5 efudn infiatdffrnebtennme of number between difference significant no found We n ot fe evratrmvl n exclusion, and removals ant weaver after month One . E oto -0.3 control SE, 0.9 ± . E .3.Teeorders These 0.13). = P SE, 0.4 ± .6S,atroemonth: one after SE, 1.06 ± ± . E oto 4.3 control SE, 5.5 .5S o12.73 to SE 0.95 Posted on Authorea 10 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158137036.64067629 — This a preprint and has not been peer reviewed. Data may be preliminary. ta.19) oee,cmeiinfo nohrssc sbrsadmmasmgtas otiueto contribute also might mammals and birds as year-round Samson such 1973; endotherms of cloud Janzen montane from combination 1917; of in competition (Wheeler the 25% However, rare ants that for so only 1997). unsuitable suggested are to forests significant have ants al. cloud compared why a studies et make humidity of mountains is Previous and question wet there temperatures the unanswered. cool of Still, i.e. largely 83% diversity, 2016). remains on ant McCain forests for diversity and affect support (Szewczyk ant to some mountains and interact found arid gradients precipitation temperature elevational and between along temperature relationship patterns diversity whereby explanatory important species model an ant a More there. be of taxa could 2012). meta-analysis 2014) other Kotze recent many and al. A Noreika of et diversity 1997; (Longino high forests al. beetles, the cloud et staphylinid for in Halaj as factor ants 1990; such of patterns Wilson groups, shown near-absence and have the arthropod studies (Holldobler generally, Other other spiders and and Philippines. ants the beetles responsible in between be carabid forests may patterns cloud ants diversity in with diversity complementary a mammal competition of along small suggested rodents in (2001) found and peak Heaney link who ants the Likewise (1977) similar seed-eating for US. Davidson in A the & precipitation in Himalaya. Brown annual gradient by to eastern north-south recorded response the from was in in competition patterns patterns diversity that diversity diversity 2011) idea complementary songbird and the al. ants in support with et peak lend (Acharya competition results mid-elevational density between our to and Overall, contribute diversity including 2019). could plant factors, al. ants 2011), other et from (Supriya al. contributions partly seasonality et exclude higher is (Acharya not Himalaya and productivity does eastern this primary the but in in al. predation, mid-elevations differences ant at et reduced abundance Rosumek of arthropod 2009; consequence high or a Holland relatively occupied and the Chamberlain that plants suggest 1994; from We opportunistic al. arthropods 2010). or et other facultative al. Fiala Even deter et 1977; 2016). Trager and (Bentley 2009; al. herbivory ants et reduce by sites) Chomicki nesting frequently 2007; to this visited (i.e. of known al. in is domatia et risk are Webber and found the ants interactions nectaries 1989; also reduce weaver extra-floral ant-plant we to al. bodies, of ants et as food Fiala with presence 2004a), as 1966; associations such the (Janzen mutualistic al. rewards on strong forests, them et form avoided offering populations mangrove (Offenberg by species species herbivores herbivory pest In plant beetle to many leaf reduce 2008; broadly, due a them. significantly More Mele that damage on study. showed ants Van leaf (2004b) weaver pheromones with 2005; used al. that ant correlated Christian still et weaver negatively found Offenberg are and with review 2019). and Peng leaves recent agent al. 1992; eating et A control Khoo (Thurman biological crops and 2019). a tree (Way tropical as demon- orchards al. used been in et have long ants populations Thurman been weaver pest have with trees control ants on weaver to arthropods Asian large along previously. of items guilds abundance strated dietary dietary reduced of of and patterns frequency herbivory diversity and Reduced the identity understand al. the sequencing to et on and useful (Pompanon information very PCR items 2011; that be gradients. to dietary think al. can environmental Due of we methods quantity et Still, these 2018). the (Razgour using 2012). on al. obtained information composition al. et accurate et diet Arrizabalaga-Escudero give Shokralla increasingly 2015; on not 2012; are may al. information methods species et taxonomic these Kartzinel among biases, fine-scale 2014; partitioning al. get niche et overlap to insectivorous dietary niche Brown and dietary tools of species examine ant Studies molecular to an analyses organisms. between using diet diet molecular related in of overlap S1), distantly utility quantified the table between many has demonstrates (Supplementary While that also ants levels. study work and taxonomic Our first birds higher songbirds. the between at be competition birds to taxonomic mid-elevation for all appears and at this evidence birds ants presented elevation weaver have low of and studies diet ants previous weaver the at of in diet birds overlap the for and in availability levels overlap showed food analyses reduce diet ants molecular ants elevations Our weaver weaver these Himalaya. at Since that eastern arthropods removal. suggest fewer the ant results of in weaver these presence elevations after Together, the low to abundance up. contribute in higher could than mos 6 Posted on Authorea 10 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158137036.64067629 — This a preprint and has not been peer reviewed. Data may be preliminary. cay,B . .J adr,L iaa,adB htr.21.Eeainlgainsi iddvriyin diversity bird ONE PLoS in gradients mechanisms. Elevational underlying their 2011. and Chettri. patterns Finches distribution B. Ground of and evaluation Vijayan, 6:e29097. Galapagos An L. of Himalaya: Sanders, eastern repository Ecology J. Ecol. the Comparative N. Competition. K., Interspecific B. 1977. and Acharya, github Diversity Grant. Floristic of R. Importance P. 47:151–184. the and Monogr. a of Evaluation Abbott, Gould): K. (Geospiza L. on therein. I., performed Abbott, work manuscript. the the for available accountable revised analyses held cited critically be data Literature work, T.D.P to lab agree and molecular is and C.S.M. fieldwork, publication out for carried manuscript. approval K.S. the study. analyses drafted the designed and and conceived authors for All contributions used Authors interests competing no have authors code The interests and Competing data (https://doi.org/10.5281/zenodo.2651358) Department Chicago Forest All Bengal of West material University the and the from code at fieldwork Data, our Committee for Use permission and 2702/4R-6/2015). received Care and also (1423/WL/4R-1(Part-XII)/2014 Animal We Institutional 71393). by # approved (ACUP reviewers was anonymous Schlumberger study two the This thank from to manuscript. fellowship like Science this Future also in of would the Women version from We Ethics for Museum previous grant Faculty a manuscript. Field on Explorer this a a comments Young writing and by their of a supported collection for time by was data the Research Supriya funded of Student at K. was Foundation Graduate time for collection the Supriya. Fund K. Data Hinds at Amruta Henry Fellowship to to and work. Biology grateful Grant Evolutionary lab Small are Wrayin Rufford We with Brian a Feldheim, Society, help field. Kevin Pranav Geographic for the Khan, National Chanda, Green Anubhab in Ritobroto Nair, Stefan assistance Jyothi Suresh Das, for and Tamma, Brar, Krishnapriya Priyanka Suresh Dey Thatte, Chhetri, Shankar, Abhijit Amir Prachi the Varudkar, and thank Vinod into Bawalia to insights Varughese, like original Sumit his also Jobin for would Balasubramanian, We Karmarkar, Hooper Daniel birds. Cathy Deepika and and on MS, Jablonski ants Rana, the David of of discussions, effects version for earlier competitive lab an Jablonski possible on and comments lab their Price for lab, Pfister Moreau the of of members effect thank We the al. enhance et (Davis shaping or involved in 2007) actors the Acknowledgements taxa on al. related depending is et distantly distributions, it range (Suttle between and change, dampen interactions 1998). abundance climate could species ecological to on interactions on due change these climate studies shift because more competing taxa prey potentially patterns, of for but arthropod related diversity patterns advocate distantly for such diversity We of compete As patterns compare ants taxa. and Himalaya. and patterns these eastern birds monitor the to that shaping wet important in suggest in and elevations data effects warm low experimental biotic needed. the at much and versus in are observational abiotic birds gradients our of affect elevational Overall, along ants importance abundance the postulate ant we compare of that to pattern way tests the same Experimental the elevations. much lower in distributions, ant limiting 7 l uhr aefinal gave authors All Posted on Authorea 10 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158137036.64067629 — This a preprint and has not been peer reviewed. Data may be preliminary. adn .J,M .Hne,adB .Edr.21.Ciaecag n nivsv,toia milkweed: tropical invasive, an and change Climate 99:1031–1038. 2018. Ecology Elderd. butterflies. D. monarch B. for for and trap (L.) Hunter, ecological and D. clangula an Rose, M. Bucephala goldeneyes J., De and M. F. Faldyn, fish 434:1015–1017. freshwater Nature a. between 41:99–107. speciation. Competition C. Oecologia drive prey. Giongo, 1979. can common diversity G. A. high Species O. with Lange, M. 2005. P. 12:1450013. analysis Eriksson, Kolm. Biol. metagenomic N. a. Comput. and Improving when T. C., Bioinform. NCBI-TaxCollector: mistakes B. Neves, J. Emerson, Making and attachment. V. taxonomic MPI-blastn M. wide 1998. Rossi, – and 2014. classification D. evolution Wood. performance F. S. of Triplett. 391:783–786. Xavier, and masterpiece Nature W. G. Shorrocks, A warming. E. M. B. global to 2009. Lawton, R., response H. Dias, in Robson. J. range A. species Jenkinson, in K. S. shifts S. L. predicting and J., 13:57–71. Schluns, A. News A. Davis, Myrmecol. E. Formicidae). in Newey, (Hymenoptera: insects: S. ants for 14:1160–1170. weaver P. metabarcodes Oecophylla Resour. Environmental H., Ecol. 2014. R. Mol. Cooper. Crozier, bias. A. taxonomic and Weyrich, 211:1358–1370. for concealed S. potential Phytol. through L. reveals choice New Soubrier, Partner silicoPCR mutualisms. J. ant–plant 2016. J., of Renner. L. specialization Clarke, S. 31:343–366. the S. Syst. with and evolved Ecol. Schonenberger, rewards J. Rev. sugar Staedler, floral Annu. M. diversity. Y. species G., of Chomicki, maintenance Venn of highly-customizable Mechanisms of 2000. generation 12:35. P. the Bioinformatics 2016. for Chesson, ant–plant BMC package R. a in Holmes. in VennDiagram: dependency P. diagrams 2011. context Euler S. Boutros. of and and C. synthesis P. Quantitative Johnson, and H., A. Chen, 2009. J. Holland. A. 90:2384–2392. 13:581–583. N. Ecology Han, Methods J. mutualisms. W. Nat. and protection desert A. data. A., in amplicon Rosen, S. ants Illumina J. Chamberlain, from and M. inference rodents sample McMurdie, seed-eating resolution J. between High P. DADA2: Competition J., B. 1977. re-introduced Callahan, a Davidson. and W. Symondson. murinus) 196:880–882. D. C. Science (Suncus O. and ecosystems. 23:3695–3705. Shrew W. H., Ecol. and Past, Musk J. Montazam, Mol. the Asian Brown, A. telfairii). and alien Clare, (Leiolopisma Change L. the Skink Climate Telfair’s E. between Vencatasamy, of D. competition 2013. population Cole, Dietary N. Finnegan. Burger, S. 2014. R. and S., 341:499–504. Ecol. Fitzpatrick, D. Science Brown, C. Rev. Interactions. M. Biotic Zarnetske, Annu. of Future L. and bodyguards. P. Present, forest pugnacious L., evergreen by J. wet protection Blois, a and in nectaries community Extrafloral 8:407–427. 73:173–179. ant Syst. 1977. Sci. foraging L. Curr. ground B. behaviour. the Bentley, interference Goiti. in of Ecol. U. role hierarchy Mol. and India): Competition Ghats, metabarcoding. Aihartza, (Western DNA J. 1997. by P. Garin, species Basu, I. bat Alberdi, sibling co-occurring A. of Salsamendi, partitioning 27:1273–1283. E. 37:406–415. niche Ecography Clare, Assessing interactions. biotic L. niches 2018. of E. species scaling geographic of A., The models Arrizabalaga-Escudero, 2014. in Rozenfeld. considered A. and be B., interactions M. biotic Araujo, 44:8–17. should how Biogeogr. and J. When distributions? and 2017. P. R. Anderson, 8 Posted on Authorea 10 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158137036.64067629 — This a preprint and has not been peer reviewed. Data may be preliminary. azn .H 93 we ape ftoia oig net:Eet fsaos eeaintps elevation, types, vegetation seasons, of Evolution Effects 54:687–708. Ecology insects: America. foliage insularity. Central tropical and of day, in samples of acacias Sweep time and 1973. H. ants D. between Janzen, may mutualism aggression of Interspecific Coevolution top: the 1966. 20:249–275. at H. Squeezed 91:1877–1884. D. 2010. Ecology Janzen, Levey. birds. J. tropical D. in and and ranges scales Robinson, elevational across K. constrain mismatches S. E., and J. extensions Jankowski, macroevolution: MA. and Cambridge 62:715–739. Press, interactions Evolution Belknap 5:367–371. Biotic levels. ants. Evol. 2008. The Ecol. D. Trends 1990. Jablonski, kingdoms. Wilson. between O. Competition E. and 1990. B., assessment Lawton. Holldobler, an H. J. Philippines: and 10:15–39. the E., in Biogeogr. M. Douglas-fir gradients Ecol. Hochberg, elevational in Glob. spiders along diversity on hypotheses. foraging mammal and ant patterns Small R of of 2001. effects data. R. Negative ecological L. 1997. for Heaney, Moldenke. analysis R. model A. 109:313–322. Null and Oecologia EcoSimR: Ross, canopies. W. 2015. D. J., Ellison. M. Halaj, A. and Hart, 0.1.0. M. version package E. 79:1181–1192. 2010. J., Ecol. Daniel. N. assembly community Carlos Gotelli, Anim. in Cadena J. filtering and habitat birds. and G., forest competition Jose of Tello Neotropical role T., of the Robb disentangling 139:771–801. to Brumfield natural approach Nat. A., in phylogenetic Gustavo A competition Am. Bravo interspecific Pablo, plants. of Juan with consequences Gomez and experiments Patterns field of 1992. review Barton. a M. in A. communities: gradients and 28:125–130. E., elevational Res. D. across 283:20160047. Goldberg, Ecol. foliage-arthropods Sci. Himalayas. of west Biol. abundance macroevolutionary and B and east coexistence: Soc. Distribution the Species R. 2013. Proc. 2016. M. interactions. Ghosh-Harihar, Benjamin. historical Gilbert of contingency and the T., and Jason relationships Weir Ecol. M., Funct. Rachel better). Germain 2015. far Patrick. are Venail (they and mechanisms Andreas, assembly Prinzing community of V., 29:600–614. proxies Igor not Bartish are Marten, biotic patterns Winter for Phylogenetic F., Accounting James Cahill 2017. Evol. Pille, Kunin. Ecol. Gerhold E. Methods W. models. and distribution Haase, species P. stacked Syst. Stoll, lowland 8:1092–1102. in S. Ecol. constraints tropical Kuemmerlen, alpha-diversity Rev. M. in through Annu. Marsh, interactions predators J. Specialization. C. key Ecological Y., of as Gavish, Evolution ants The Arboreal 1988. Moreno. 2002. G. 19:207–233. and ant-plant J., Linsenmair. D. Asian Futuyma, K. East E. South 131:137–144. and Oecologia a trees. of Biun, 14:64–81. rainforest Evolution Studies A. Diversity. Organic A., 1989. in Floren, Variations 79:463–470. Latitudinal Helbig. Oecologia 1960. interactions: J. borneensis. G. ant-plant A. Crematogaster A. of and by Fischer, Diversity trees Pong, Macaranga 97:186–192. Y. of Oecologia 1994. T. protection association. Maschwitz, association: ant Linsenmair. U. of E. degrees B., different K. Fiala, with and species Maschwitz, Macaranga in U. efficacy Grunsky, protective H. B., Fiala, 9 Posted on Authorea 10 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158137036.64067629 — This a preprint and has not been peer reviewed. Data may be preliminary. io,J,X saae,N aels .Mrie-iat,J .Brino,adD o.21.Atversus Ant 35:367–376. 2010. Entomol. Ecol. Sol. grove. D. citrus and organic Barrientos, an A. of J. assemblage arthropod Martinez-Vilalta, the J. on on effects Canellas, 14:49–57. effects canopies: N. exclusion Entomol. citrus Espadaler, bird For. from X. ant-exclusion Agric. of J., yield. years Pinol, fruit Eight on 2012. and Canellas. assemblage N. arthropod and the Int. Espadaler, element. X. key J., Territory a Pinol, Northern as the Formicidae) in 51:149–155. (Hymenoptera: orchards , mango Manag. mediates smaragdina in Pest interactions Oecophylla management J. ant, vocal pest weaver Integrated frugivore via the 2005. dominance using neotropical Australia, 182:E161-173. Interspecific Christian. a K. Nat. 2013. and of Am. R., structure Peng, Phelps. mice. Trophic M. singing S. neotropical in and 1989. zonation Bolker, 79:403–411. altitudinal M. Oecologia Stoleson. B. bats? S. B., and Pasch, birds and between Gorchoy, competition Community Sons. L. there & is vegan: D. Wiley community: John M., 2018. ecosystems. J. Wagner. forest Palmeirim, in H. sampling and Insect Szoecs, 2005. E. C. Stevens, O’Hara, Ozanne, B. H. R. Minchin, Henry, R. P. 271:S433–S435. M. McGlinn, Solymos, Package. Sci. J. D. P. Ecology Biol. Legendre, insect P. Simpson, B Kindt, that L. R. Lond. Friendly, Evidence M. G. Soc. 2004b. Blanchet, G. R. Aksornkoae. F. S. J., Proc. Oksanen, and pheromones. Havanon, ant S. by MacIntosh, J. deterred D. are on Nielsen, herbivores the effect G. on their M. Observations and J., 36:344–351. ecosystem 2004a. Offenberg, Biotropica mangrove Nielsen. Thai Lam. G. a mucronata M. in Rhizophora Fabricius) and of smaragdina Macintosh, herbivory (Oecophylla J. ants D. weaver distribution Aksornkoae, of increasing 16:867–881. spatial S. ecology the through Conserv. Havanon, on Insect S. evolved effect J. J., predictable interactions a Offenberg, forests. have Ant–plant contrasts urban edge in Forest 2018. beetles 2012. carabid Kotze. of Moreau. J. D. S. and 115:12253–12258. C. N., Sci. Noreika, and Acad. Ree, Natl. P. H. Proc. richness. R. interdependence. species P., Chichester. in phylogenetic Ltd, M. gradients the Sons, Elevational Nelsen, & on Wiley 2010. exclusion John competitive Grytnes. (ELS). of Sciences J.-A. effects Life and Opposing M., C. 13:1085–1093. 2010. McCain, Lett. 48:165–174. Levine. Environ. Ecol. Fauna M. communities. composition Neotropical J. community of and Stud. and structure diversity forests. M., beetle Andean Carabid M. in tropical Mayfield, 2013. seasonality on Erwin. and abundance L. altitude ant T. to out: and related drop Browne, as ants A. How R. species A., 2014. joint S. Maveety, Colwell. dynamic K. 9:e104030. R. Preisser. a and ONE L. by Branstetter, PLoS E. G. revealed and mountains. M. Orwig, differences T., A. J. niche D. Longino, Orians, abiotic M. 99:1018–1023. C. and Schaeffer, Ecology interactions N. model. R. biotic distribution Schliep, Asymmetric M. African E. by Zarnetske, partitioning 2018. L. niche Rubenstein, P. 112:8019–8024. I. dietary K., D. Sci. illuminates N. Kuzmina, Lany, metabarcoding L. Acad. M. DNA Natl. Kress, J. 2015. of between Proc. W. roles Pringle. Erickson, herbivores. competition interacting L. M. large D. for R. Coverdale, caterpillars: and C. Evidence more Wang, T. Chen, have W. A. years P. 2010. Wet 98:2370–2378. R., T. Ecology Kartzinel, 2017. Rohr. ants. by R. Holyoak. predation 277:3001–3008. J. M. and Sci. and litter and plant Biol. Grof-Tisza, Raffel, B P. R. R., Soc. R. Karban, T. Proc. Krupa, spiders. J. and J. plants carnivorous E., D. Jennings, 10 in nylpdaof Encyclopedia Posted on Authorea 10 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158137036.64067629 — This a preprint and has not been peer reviewed. Data may be preliminary. ukr .M,M .Cdte .B avlo .J ais .Frir .A rt,R rne,M R. M. macroecology. and Grenyer, and Winter, ecology R. M. community Fritz, Rosauer, conservation, A. F. for D. S. metrics Redding, Ferrier, phylogenetic W. S. D. to Davies, Purschke, 92:698–715. guide O. J. A Rev. Pavoine, T. S. Biol. 2017. Carvalho, Mooers, B. O. Mazel. A. S. W. F. Jin, Cadotte, C. S. meta-analysis. McKeon, W. L. a S. M. Helmus, mutualisms: C. protective M., Rodriguez-Cabal, ant-plant C. in A. Tucker, plants M. for Andrade, to Benefits V. Services 5:e14308. 2010. G. ONE Ecosystem Bolker. Hostetler, PLOS Provide M. A. Ants B. Weaver J. and Bhotika, Osenberg, 2019. S. D., Snyder. 7. M. Ecology E. Trager, Evol. W. birds. Ecol. Andean and Front. of Northfield, Crops. distribution D. Tree the Tropical T. in H., competition J. of Thurman, role The 1975. Weske. Diversity. S. Elevational 56:562–576. J. Ant of and Drivers J., Global Terborgh, of to Review responses Systematic grassland A 11:e0155404. reverse 2016. One interactions McCain. Plos Species M. C. 2007. and elevational T., Power. temperate Szewczyk, E. and M. tropical 315:640–642. and of Science Thomsen, Analysis climate. A. changing 2019. M. B., Price. 0. K. D. Biogeogr. Suttle, CATIE. T. / Front. and IICA abundance. Orton Sam, arthropod K. Bib. in Moreau, review. gradients bibliographic S. a C. technologies tropics: K., humid sequencing Supriya, the Next-generation in forests 2012. species Cloud bird Hajibabaei. 1987. 21:1794–1805. of T. M. Ecol. Stadtmuller, driver and the Mol. Gibson, as research. F. 10.1086/707665. limits DNA J. latitudinal doi: environmental Ecological Spall, Nat., a for L. 2019. there Am. J. Is gradient. S., Price. elevational Shokralla, T. 2009. Himalayan 40:245–269. and east Roy. Syst. Supriya, the K. Evol. K. along and patterns Ecol. White, richness Sobel, E. Rev. M. A. Annu. J. M., interactions? Cornell, Schumm, biotic elevational V. of an H. importance along Mittelbach, the abundance in G. and gradient G. diversity Ant W., D. 1997. Schemske, 29:349–363. Gonzales. Biotropica C. n/a-n/a. P. Ecography Philippines. and the Guinea. Rickart, G. in New A. gradient Pezzini, Papua E. caterpillars in F. A., of gradient Oki, predation D. biotic forest ant Samson, Y. and plant elevational avian as complete Diniz, increases damage ants a L. Herbivore of along Barbosa, 2014. role trees Novotny. U. the on V. and de of Koane, P. meta-analysis B. K., a N. Sam, plants: Neves, on S. G. Ants de 160:537–549. and 2009. Oecologia F. Gilbert, Cornelissen. Silveira, defenses. P. T. O. T. and A. Rasmussen, Fernandes, cryptic F. W. M. in B., Schnell, partitioning F. B. resource I. Rosumek, of 1:556–570. Hanmer, mechanisms Evol. into J. Ecol. insight Zeale, offers species. K. sequencing bat R. High-throughput M. Statistical 2011. Clare, for Foundation Jones. L. R E. M. computing. O., Olsson, filling statistical Razgour, Niche U. for environment Alstrom, 2014. and P. language Mohan. Austria. Tietze, A D. Vienna, R: T. Computing, and 2014. D. Singh, Team. P. 509:222–225. Johansson, Core Nature Harr, S. R B. songbirds. U. Martens, Himalayan Buchanan, of J. diversification D. Gupta, the Who K. C. slows 21:1931–1950. S. 2012. Hooper, Ishtiaq, Ecol. Taberlet. M. P. F. Mol. and D. Ghosh-Harihar, Jarman, sequencing. D., N. generation S. T. next Brown, Price, using S. assessment D. Symondson, diet C. what: O. eating W. is Deagle, E. B. F., Pompanon, 11 Posted on Authorea 10 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158137036.64067629 — This a preprint and has not been peer reviewed. Data may be preliminary. siae n1 evsdsrbtdaon h tree. the around ant distributed leaves and 10 Bird on estimated mid-elevations. not. at did other silhouette. birds (a-b) bird and the 3: elevations produced and Figure Caravaggi low blue Anthony at in phylopic.org. from shown birds taken study ants, silhouettes this weaver in between further 2014) metabarcoding examined al. 2 elevation et (Price 2000m Figure in and data 200m on at Based Site respectively. yellow for gradient. PCR same Taxon-specific the Himalaya 2011. eastern the Jones. in G. a. and 1: 11:236–244. Lees, Figure C. Resour. D. Ecol. Barker, Mol. 8:352–359. A. legends: faeces. J. L. Figure bat R G. in R. Butlin, prey in K. arthropod Data R. barcoding Sequence DNA Biological K., Big realised R. Analyze and M. 88:15–30. to distributions Zeale, v2.0 Rev. shaping DECIPHER Wardle, C. in Biol. Using Maiorano, A. interactions M. modelling. D. L. 2016. biotic Dormann, distribution E. Timmermann, Luoto, of F. Wright, species A. role M. for C. Termansen, The Kuhn, implications Damgaard, M. I. 2013. species: Schmidt, F. Hoye, of M. Svenning. C. assemblages T. N. J.-C. Lenoir, T. Ockinger, and J. Heikkinen, E. Anim. Aastrup, Pellissier, P. K. J. Normand, L. S. R. lecture. Kissling, Nilsson, Guisan, tansley D. M.-C. sixth A. W. The Grytnes, Pottier, ants. J.-A. J. Forchhammer, the S., of case M. the Wisz, success: ecological of 3:180–185. 52:457– 56:1–9. Causes Stat. Sci. Ecol. 1987. Comput. Arts O. Rev. E. Acad. Interdiscip. Wilson, Am. Wiley Proc. ggplot2. 2011. America. H. North Wickham, western of ants mountain The 569. 1917. in interactions M. ant–plant hemipteran W. of 154:353–371. and diversity Wheeler, prostomata, The Soc. domatia, 2007. Linn. bodies, J. Woodrow. food E. Bot. Annu. I. (Achariaceae): and trophobionts. Ryparosa ecology. Curtis, tree, community O. understorey S. and rainforest A. 479–503. the Phylogenies Moog, Entomol. J. 2002. L., Rev. B. Annu. Webber, Donoghue. management. M. 33:475–505. pest and Syst. in Mcpeek, Ecol. ants M. of Rev. Ackerly, Role D. The 1992. mesocosm C., 2014. a Khoo. Webb, C. in Cardinale. K. algae J. and B. green J., freshwater and M. Way, Oakley, among H. interactions 102:1288–1299. T. species Ecol. Alexandrou, J. on A. relatedness experiment. M. Fritschie, phylogenetic Agric. K. of control. Narwani, biological influence A. in Oecophylla A., ant P. weaver Venail, the on research species of 10:13–22. rodent review on Entomol. historical extinction For. A and 2008. colonization, P. competition, Mele, Van of Effects in 1995. interactions A. 267:880–883. Rey, Brown. ecological D. Science J. H. of P. diversity. J. Garcia, extinction Ramirez, and B. the N. J., M. Oviedo, T. loss: 29:299–307. Valone, R. Galetti, species species Ecol. Obeso, Beyond M. and Funct. R. 2015. Cocucci, change J. world. Navarro, A. Zamora. changing Global L. Arroyo, a R. Medel, and J. R. 2008. Verdu, Alcantara, Jordano, M. P. Traveset, M. Wardle. Gomez, J. M. A. Aizen, J. D. Garcia, A. and M. 11:1351–1363. Bascompte, A., Lett. Valiente-Banuet, J. Ecol. Didham, ecosystems. K. terrestrial in R. interactions M., J. Tylianakis, endarmsoigde vra tmlil aooi eesa sesdwt molecular with assessed as levels taxonomic multiple at overlap diet showing diagram Venn a. orlto ewe ubro ogidseisadidvdasaoga lvtoa gradient elevational an along individuals and species songbird of number between Correlation ubro rhoosblnigt h resLpdpeaadColeoptera and Lepidoptera orders the to belonging arthropods of Number aafo 4tespie o ieadseis hr n rehdwae nsadthe and ants weaver had tree one where species, and size for paired trees 34 from Data b. orlto ewe ubro ogidseisadatrpdaudnealong abundance arthropod and species songbird of number between Correlation 12 b. efdamage Leaf Posted on Authorea 10 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158137036.64067629 — This a preprint and has not been peer reviewed. Data may be preliminary. resi iddesa o lvtos(rprino niiulbrswt tlatoesqec rmthat from sequence one least at with birds individual of (Proportion individuals) elevations 18 S7) low = Fig. N at in order, diets data trees the bird one points. control from in overlapping (derived show with removal multiple orders dots and species, indicate exclusion and lines ant and lines and after size month Grey dots Darker a. for exclusion. 5 trees. paired and treatment Figure removal trees show ant dots 30 weaver and from to lines Data purple subject and pair experiment. each exclusion of member and removal ant weaver 4: Figure ubro rhoos(xldn nsadsbre ootr)bfr n n ot after month one and before Homoptera) suborder and ants (excluding arthropods of Number ieec nma bnac fmjratrpdodr ncnrladtetettesone trees treatment and control in orders arthropod major of abundance mean in Difference 13 b. rqec fdffrn arthropod different of Frequency Posted on Authorea 10 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158137036.64067629 — This a preprint and has not been peer reviewed. Data may be preliminary. 14 Posted on Authorea 10 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158137036.64067629 — This a preprint and has not been peer reviewed. Data may be preliminary. 15