DOCSLIB.ORG

Differentially Expressed Genes Are Marked by Histone 3 Lysine 9 Trimethylation in Human Cancer Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Differentially Expressed Genes Are Marked by Histone 3 Lysine 9 Trimethylation in Human Cancer Cells Oncogene (2008) 27, 2412–2421 & 2008 Nature Publishing Group All rights reserved 0950-9232/08 $30.00 www.nature.com/onc ORIGINAL ARTICLE Differentially expressed genes are marked by histone 3 lysine 9 trimethylation in human cancer cells JK Wiencke1, S Zheng1, Z Morrison1 and R-F Yeh2 1Laboratory of Neuro and Molecular Epidemiology, Ambulatory Care AC-34, Department of Neurological Surgery, University of California San Francisco, San Francisco, CA, USA and 2Department of Epidemiology and Biostatistics, Center for Bioinformatics and Molecular Biostatistics, University of California San Francisco, San Francisco, CA, USA Histone H3 lysine 9trimethylation (H3K9Me3) has been H3K9Me3 in three studied genes (HOXA9, TMS1, associated with transcriptional repression, but recent RASSF1A). The localization of H3K9Me3 downstream findings implicate this chromatin modification in transcrip- of the TSSs of expressed genes and not within promoter tional activation and mRNA elongation by RNA polymer- regions of hypermethylated and silenced genes is consistent ase II. Here, we applied immunoprecipitation (IP) with a with the proposed coupling of H3K9Me3 with RNA custom DNA tiling microarray containing many transcrip- polymerase II. Our results indicate a need for revising tion factors important in development and cancer (for aspects of the histone code involving H3 lysine methylation. example homeotic genes; N ¼ 683 total genes) to explore Awareness of H3K9Me3 as a mark of gene activity, not the relationship between H3K9Me3 and other histone repression, is especially important for the classification of modifications with the differential expression of genes. human cancer using chromatin and histone profiles. Cancer cell lines derived from different tissues (2 leukemia, Oncogene (2008) 27, 2412–2421;doi:10.1038/sj.onc.1210895; 2 medulloblastoma) were characterized with IP antibodies published online 29 October 2007 to H3K9Me3, H3K4 dimethylation (H3K4Me2) and H3K9acetylation (H3K9Ac). MV4-11 is known to over- Keywords: chromatin immunoprecipitation;histone express the HOXA9 and MEIS1 genes, whereas D283 methylation;histone acetylation;tiling array;homeobox; overexpresses the OTX2 homeobox gene. Gene expression histone code was assessed by Affymetrix U133 array. Mapping the number and size of histone markings demonstrated significant colocalization of H3K9Ac and H3K4Me2 with H3K9Me3, indicating a pattern of putative ‘activating’ and ‘repressive’ markings. The median site size was 600–821 bp Introduction and 72–95% or 53–80% of chromatin signal sites were located within 1 kb or 500 bp of transcription start sites Aberrant gene expression in human cancer is thought to (TSS), respectively. A relatively small number of genes be mediated in part through post-translational modifica- displayed additional H3K9Me3 sites in the 50-region distant tions of histone and other DNA binding proteins, which from the TSS. Comparing genes with modification sites to alter the functional properties of chromatin (Gregory those without sites in their promoters confirmed the positive and Shiekhattar, 2004). Covalent modifications of associations of H3K9Ac and H3K4Me2 with gene expres- histone H3 have been widely studied as pivotal in the sion and revealed that H3K9Me3 is associated with active regulation of gene transcription. A ‘histone code’ genes rather than being a repressive marking as previously hypothesis has evolved to explain how combinations of thought. The positive regulatory effect of all three types of modifications affect transcriptional regulation (Strahl modifications were quantitatively correlated with site size, and Allis, 2000;Turner, 2000). In mammals, histone H3 and applied to absolute gene expression within a single cell lysine 9 acetylation (H3K9Ac) and H3 lysine 4, 36 and 79 line as well as relative expression among pairs of cell lines. methylation are linked with active transcription, whereas Extended patterns of H3K9Me3 upstream of some genes methylation of histone H3 lysine 9, 27 and histone H4 (for example HOXA9 and OTX2) may result from the lysine 20 are associated with transcriptionally silent action of multiple promoter elements. We found an inverse heterochromatin. The division of chromatin patterns relationship between promoter DNA hypermethylation and into exclusive active and repressive domains has been questioned by recent studies. For example, human T cells display both H3K9 acetylation and H3K27 trimethyla- Correspondence: Dr JK Wiencke, Department of Neurological tion among many transcribed genes (Roh et al., 2006). Surgery, Laboratory of Neuro and Molecular Epidemiology, Expressed genes in human (Azuara et al., 2006) and Ambulatory Care AC-34, University of California San Francisco, mouse (Bernstein et al., 2006) embryonic stem cells were 1 Irving St., Box no 441, San Francisco, CA, USA. E-mail: [email protected] identified that displayed both activating and repressive Received 13 February 2007;revised 9 September 2007;accepted 11 histone markings. The latter study termed these see- September 2007;published online 29 October 2007 mingly conflicting histone patterns ‘bivalent’ chromatin Histone 3 lysine 9 trimethylation marks expressed genes JK Wiencke et al 2413 structures (Bernstein et al., 2006). Recently, Vakoc et al. and are associated with a different age at onset, tumor (2005) presented a surprising finding that H3K9Me3 was location and survival times compared with classic or present in the transcribed region of eight genes that they anaplastic types (de Haas et al., 2006). Our results show examined. This observation seems at variance with the that HOXA9, MEIS1, OTX2 and many other genes well described association of H3K9Me3 with both expressed in cancer cells contain overlapping histone constitutive (Peters et al., 2003) and facultative hetero- modifications that include H3K9Ac, H3K4Me2 and chromatin (Heard et al., 2001). Vakoc et al. (2005) H3K9Me3. further reported that heterochromatin protein 1g (HP1g), which contains a chromo-domain predicted to recognize H3K9 methylation, is also present in the transcribed region and may form a complex with RNA Results polymerase II. Importantly, they demonstrated the H3K9Me3, H3K4Me2 and H3K9Ac modifications specificity of the antibodies they used in their chIP overlap the TSS of genes experiments and ruled out cross-reactivity of H3K9Me3 A description of the 683 genes on the tiling array is with other markings that could have produced spurious provided in Supplementary Table 1. The single gene raw results. These and other observations indicate that RNA data applicable to Figures 1–4 is provided in Supple- polymerase II associates with chromatin modifications mentary Table 2. Using ChIP-on-chip analyses that that include histone H3K9 methylation, a mark most interrogated promoter regions covering upstream 5 kb commonly associated with gene silencing (Eissenberg and downstream 1 kb of 683 genes, we found that all and Shilatifard, 2006). A subsequent report showed that three histone modifications overlapped significantly with H4K20 monomethylation, another modification linked the TSS of genes on our platform, with 72–95 or 53–80% with repression, may also be a mark of transcript of chromatin signal sites were located within 1 kb or elongation (Vakoc et al., 2006). Here, we tested whether H3K9Me3 is associated with 500 bp of TSSs, respectively. The three modifications have similar size distributions with medians ranging differentially expressed genes in human cancer cells and from 600 to 821 bp. Results illustrating these findings for specifically genes that control the action of many transcription factors responsible for maintaining the the MV4-11 cell line are depicted in Figure 1. Note that the site size can be regarded as a surrogate measure for differentiated state of cells. We examined the relationship the strength, or more precisely, the extensiveness of of H3K9Me3 with H3K4Me2 and H3K9Ac modifica- the chromatin modification, since they were defined tions in human cancer cell lines using chromatin by neighboring, statistically significant probes in IP- immunoprecipitation and a custom-designed DNA tiling enriched DNA compared to the input controls (see microarray (ChIP-on-chip). The array interrogates 5 kb Materials and methods for the exact definition). For each upstream and 1 kb downstream of the TSS of 683 genes including all known homeodomain transcription factors of the histone markings there was an apparent decreased signal intensity immediately upstream of the TSS. and many other cancer association genes (for example Similar results were obtained with Rch, D283 and Daoy MAGE genes). The 50-location of probes allows us to examine whether H3K9Me3 is restricted to the regions (data not shown). The smoothed curve in panel d of around and downstream of TSSs as predicted (Vakoc Figure 1 shows a subtle difference in the distribution et al., 2005, 2006). Gene expression was assessed by the of the histone marks with slightly more H3K9Ac and 0 to TSSs compared Affymetrix HGU133 Plus 2.0 expression microarray. We H3K4Me2 signals being located 3 with H3K9Me3. examined two cell lines in depth: MV4-11 and D283, both of which overexpress homeobox genes. MV4-11 is a biphenotypic leukemic cell that contains a t(4;11) H3K9Me3, H3K4Me2 and H3K9Ac modifications translocation and resultant fusion protein that activates overlap each other the mixed lineage leukemia (MLL)gene(Canaaniet al., We calculated the relative location of histone markings 2004). MLL is homologous to the Drosophila Trithorax with respect to each
Load more

Recommended publications
  • Podocyte Specific Knockdown of Klf15 in Podocin-Cre Klf15flox/Flox Mice Was Confirmed
    SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1: Podocyte specific knockdown of Klf15 in Podocin-Cre Klf15flox/flox mice was confirmed. (A) Primary glomerular epithelial cells (PGECs) were isolated from 12-week old Podocin-Cre Klf15flox/flox and Podocin-Cre Klf15+/+ mice and cultured at 37°C for 1 week. Real-time PCR was performed for Nephrin, Podocin, Synaptopodin, and Wt1 mRNA expression (n=6, ***p<0.001, Mann-Whitney test). (B) Real- time PCR was performed for Klf15 mRNA expression (n=6, *p<0.05, Mann-Whitney test). (C) Protein was also extracted and western blot analysis for Klf15 was performed. The representative blot of three independent experiments is shown in the top panel. The bottom panel shows the quantification of Klf15 by densitometry (n=3, *p<0.05, Mann-Whitney test). (D) Immunofluorescence staining for Klf15 and Wt1 was performed in 12-week old Podocin-Cre Klf15flox/flox and Podocin-Cre Klf15+/+ mice. Representative images from four mice in each group are shown in the left panel (X 20). Arrows show colocalization of Klf15 and Wt1. Arrowheads show a lack of colocalization. Asterisk demonstrates nonspecific Wt1 staining. “R” represents autofluorescence from RBCs. In the right panel, a total of 30 glomeruli were selected in each mouse and quantification of Klf15 staining in the podocytes was determined by the ratio of Klf15+ and Wt1+ cells to Wt1+ cells (n=6 mice, **p<0.01, unpaired t test). Supplementary Figure 2: LPS treated Podocin-Cre Klf15flox/flox mice exhibit a lack of recovery in proteinaceous casts and tubular dilatation after DEX administration.
    [Show full text]
  • Network Assessment of Demethylation Treatment in Melanoma: Differential Transcriptome-Methylome and Antigen Profile Signatures
    RESEARCH ARTICLE Network assessment of demethylation treatment in melanoma: Differential transcriptome-methylome and antigen profile signatures Zhijie Jiang1☯, Caterina Cinti2☯, Monia Taranta2, Elisabetta Mattioli3,4, Elisa Schena3,5, Sakshi Singh2, Rimpi Khurana1, Giovanna Lattanzi3,4, Nicholas F. Tsinoremas1,6, 1 Enrico CapobiancoID * a1111111111 1 Center for Computational Science, University of Miami, Miami, FL, United States of America, 2 Institute of Clinical Physiology, CNR, Siena, Italy, 3 CNR Institute of Molecular Genetics, Bologna, Italy, 4 IRCCS Rizzoli a1111111111 Orthopedic Institute, Bologna, Italy, 5 Endocrinology Unit, Department of Medical & Surgical Sciences, Alma a1111111111 Mater Studiorum University of Bologna, S Orsola-Malpighi Hospital, Bologna, Italy, 6 Department of a1111111111 Medicine, University of Miami, Miami, FL, United States of America a1111111111 ☯ These authors contributed equally to this work. * [email protected] OPEN ACCESS Abstract Citation: Jiang Z, Cinti C, Taranta M, Mattioli E, Schena E, Singh S, et al. (2018) Network assessment of demethylation treatment in Background melanoma: Differential transcriptome-methylome and antigen profile signatures. PLoS ONE 13(11): In melanoma, like in other cancers, both genetic alterations and epigenetic underlie the met- e0206686. https://doi.org/10.1371/journal. astatic process. These effects are usually measured by changes in both methylome and pone.0206686 transcriptome profiles, whose cross-correlation remains uncertain. We aimed to assess at Editor: Roger Chammas, Universidade de Sao systems scale the significance of epigenetic treatment in melanoma cells with different met- Paulo, BRAZIL astatic potential. Received: June 20, 2018 Accepted: October 17, 2018 Methods and findings Published: November 28, 2018 Treatment by DAC demethylation with 5-Aza-2'-deoxycytidine of two melanoma cell lines Copyright: © 2018 Jiang et al.
    [Show full text]
  • 22 Ultra-Conserved Elements in Vertebrate and Fly Genomes Mathias Drton Nicholas Eriksson Garmay Leung
    22 Ultra-Conserved Elements in Vertebrate and Fly Genomes Mathias Drton Nicholas Eriksson Garmay Leung Ultra-conserved elements in an alignment of multiple genomes are consecutive nucleotides that are in perfect agreement across all the genomes. For aligned vertebrate and fly genomes, we give descriptive statistics of ultra-conserved elements, explain their biological relevance, and show that the existence of ultra-conserved elements is highly improbable in neutrally evolving regions. 22.1 The data Our analyses of ultra-conserved elements are based on multiple sequence align- ments produced by MAVID [Bray and Pachter, 2004]. Prior to the alignment of multiple genomes, homology mappings (from Mercator [Dewey, 2005]) group into bins genomic regions that are anchored together by neighboring homolo- gous exons. A multiple sequence alignment is then produced for each of these alignment bins. MAVID is a global multiple alignment program, and therefore homologous regions with more than one homologous hit to another genome may not be found aligned together. Table 22.1 shows an example of Merca- tor’s output for a single region along with the beginning of the resulting MAVID multiple sequence alignment. Species Chrom. Start End Alignment Dog chrX 752057 864487 + A----AACCAAA--------- Chicken chr1 122119382 122708162 − TGCTGAGCTAAAGATCAGGCT Zebrafish chr9 19018916 19198136 + ------ATGCAACATGCTTCT Pufferfish chr2 7428614 7525502 + ---TAGATGGCAGACGATGCT Fugufish asm1287 21187 82482 + ---TCAAGGG----------- Table 22.1. Mercator output for a single bin, giving the position and orientation on the chromosome. Notice that the Fugu fish genome has not been fully assembled into chromosomes (cf. Section 4.2). The vertebrate dataset consists of 10,279 bins over 9 genomes (Table 22.2).
    [Show full text]
  • Analysis of Early Changes in DNA Methylation in Synovial Fibroblasts
    www.nature.com/scientificreports OPEN Analysis of early changes in DNA methylation in synovial fbroblasts of RA patients before diagnosis Received: 14 November 2017 Emmanuel Karouzakis1, Karim Raza2,4, Christoph Kolling 3, Christopher D. Buckley 2, Accepted: 26 March 2018 Stefen Gay1, Andrew Filer2,5 & Caroline Ospelt1 Published: xx xx xxxx DNA methylation is an important epigenetic modifcation that is known to be altered in rheumatoid arthritis synovial fbroblasts (RASF). Here, we compared the status of promoter DNA methylation of SF from patients with very early RA with SF from patients with resolving arthritis, fully established RA and from non-arthritic patients. DNA was hybridized to Infnium Human methylation 450k and 850k arrays and diferential methylated genes and pathways were identifed. We could identify a signifcant number of CpG sites that difered between the SF of diferent disease stages, showing that epigenetic changes in SF occur early in RA development. Principal component analysis confrmed that the diferent groups of SF were separated according to their DNA methylation state. Furthermore, pathway analysis showed that important functional pathways were altered in both very early and late RASF. By focusing our analysis on CpG sites in CpG islands within promoters, we identifed genes that have signifcant hypermethylated promoters in very early RASF. Our data show that changes in DNA methylation difer in RASF compared to other forms of arthritis and occur at a very early, clinically yet unspecifc stage of disease. The identifed diferential methylated genes might become valuable prognostic biomarkers for RA development. Rheumatoid arthritis (RA) is a chronic, destructive autoimmune arthritis that afects 0.5–1% of the population worldwide.
    [Show full text]
  • Histone Modifications of H3k4me3, H3k9me3 and Lineage Gene Expressions in Chimeric Mouse Embryo
    Original Article Histone Modifications of H3K4me3, H3K9me3 and Lineage Gene Expressions in Chimeric Mouse Embryo Maryam Salimi, Ph.D.1, Abolfazl Shirazi, Ph.D.2, 3*, Mohsen Norouzian, Ph.D.1*, Mohammad Mehdi Mehrazar, M.Sc.2, Mohammad Mehdi Naderi, Ph.D.2, Mohammad Ali Shokrgozar, Ph.D.4, Mirdavood Omrani, Ph.D.5, Seyed Mahmoud Hashemi, Ph.D.6 1. Department of Biology and Anatomical Sciences, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran 2. Reproductive Biotechnology Research Center, Avicenna Research Institute, ACECR, Tehran, Iran 3. Department of Gametes and Cloning, Research Institute of Animal Embryo Technology, Shahrekord University, Shahrekord, Iran 4. National Cell Bank of Iran, Pasteur Institute of Iran, Tehran, Iran 5. Department of Medical Genetics, Shahid Beheshti University of Medical Sciences, Tehran, Iran 6. Department of Immunology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran *Corresponding Addresses: P.O.Box: 19615/1177, Reproductive Biotechnology Research Center, Avicenna Research Institute, ACECR, Tehran, Iran P.O.Box: 1985717-443, Department of Biology and Anatomical Sciences, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran Emails: [email protected], [email protected] Received: 4/October/2018, Accepted: 18/February/2019 Abstract Objective: Chimeric animal exhibits less viability and more fetal and placental abnormalities than normal animal. This study was aimed to determine the impact of mouse embryonic stem cells (mESCs) injection into the mouse embryos on H3K9me3 and H3K4me3 and cell lineage gene expressions in chimeric blastocysts. Materials and Methods: In our experiment, at the first step, incorporation of the GFP positive mESCs (GFP-mESCs) 129/Sv into the inner cell mass (ICM) of pre-compacted and compacted morula stage embryos was compared.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • 1 a Search for Novel Cancer/Testis Antigens in Lung Cancer Identifies
    Author Manuscript Published OnlineFirst on June 26, 2014; DOI: 10.1158/0008-5472.CAN-13-3725 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. A search for novel cancer/testis antigens in lung cancer identifies VCX/Y genes expanding the repertoire of potential immunotherapeutic targets Ayumu Taguchi1*, Allen D. Taylor2, Jaime Rodriguez1, Müge Çeliktaş3, Hui Liu1, Xiaotu Ma4, Qing Zhang2, Chee-Hong Wong2, Alice Chin2, Luc Girard5,6, Carmen Behrens7, Wan L. Lam8, Stephen Lam8, John D. Minna5,6,9, Ignacio I. Wistuba1, Adi F. Gazdar5,10, and Samir M. Hanash3 1Departments of Translational Molecular Pathology, 3Clinical Cancer Prevention, and 7Thoracic/Head and Neck Medical Oncology, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Blvd., Houston, TX 77030, USA 2Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue N., Seattle, WA 98109, USA 4Department of Molecular and Cell Biology, Center for Systems Biology, The University of Texas Southwestern Medical Center at Dallas, 800 W. Campbell Road, Dallas, TX 75080, USA 5Hamon Center for Therapeutic Oncology Research and Departments of 6Pharmacology, 9Internal Medicine, and 10Pathology, The University of Texas Southwestern Medical Center at Dallas, 5323 Harry Hines Blvd., Dallas, TX 75390, USA 8Department of Integrative Oncology, British Columbia Cancer Research Centre, 675 West 10th Avenue, Vancouver, BC V521L3, Canada Corresponding Author: *Correspondence should be addressed to Ayumu Taguchi, Department of Translational and Molecular Pathology, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030, USA; email: [email protected]; fax: 713-563-5746; phone: 713-563-8069. 1 Downloaded from cancerres.aacrjournals.org on September 24, 2021.
    [Show full text]
  • Simultaneous Epigenetic Perturbation and Genome Imaging Reveal Distinct Roles of H3k9me3 in Chromatin Architecture and Transcription
    University of Massachusetts Medical School eScholarship@UMMS Open Access Publications by UMMS Authors 2020-12-08 Simultaneous epigenetic perturbation and genome imaging reveal distinct roles of H3K9me3 in chromatin architecture and transcription Ying Feng East China University of Science and Technology Et al. Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/oapubs Part of the Amino Acids, Peptides, and Proteins Commons, Genetics and Genomics Commons, and the Structural Biology Commons Repository Citation Feng Y, Wang Y, Wang X, He X, Yang C, Naseri A, Pederson T, Zheng J, Zhang S, Xiao X, Xie W, Ma H. (2020). Simultaneous epigenetic perturbation and genome imaging reveal distinct roles of H3K9me3 in chromatin architecture and transcription. Open Access Publications by UMMS Authors. https://doi.org/ 10.1186/s13059-020-02201-1. Retrieved from https://escholarship.umassmed.edu/oapubs/4502 Creative Commons License This work is licensed under a Creative Commons Attribution 4.0 License. This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in Open Access Publications by UMMS Authors by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. Feng et al. Genome Biology (2020) 21:296 https://doi.org/10.1186/s13059-020-02201-1 RESEARCH Open Access Simultaneous epigenetic perturbation and genome imaging reveal distinct roles of H3K9me3 in chromatin architecture and transcription Ying Feng1†, Yao Wang2,3†, Xiangnan Wang4, Xiaohui He4, Chen Yang5, Ardalan Naseri6, Thoru Pederson7, Jing Zheng5, Shaojie Zhang6, Xiao Xiao8, Wei Xie2,3* and Hanhui Ma4* * Correspondence: xiewei121@ tsinghua.edu.cn; mahh@ Abstract shanghaitech.edu.cn †Ying Feng and Yao Wang Introduction: Despite the long-observed correlation between H3K9me3, chromatin contributed equally to this work.
    [Show full text]
  • MAGEB2 (NM 002364) Human Tagged ORF Clone – RG205338
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG205338 MAGEB2 (NM_002364) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: MAGEB2 (NM_002364) Human Tagged ORF Clone Tag: TurboGFP Symbol: MAGEB2 Synonyms: CT3.2; DAM6; MAGE-XP-2 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG205338 representing NM_002364 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCTCGTGGTCAGAAGAGTAAGCTCCGTGCCCGTGAGAAACGCCGCAAGGCCCGAGATGAGACCCGGG GTCTCAATGTTCCTCAGGTCACTGAAGCAGAGGAAGAAGAGGCCCCCTGCTGTTCCTCTTCTGTTTCTGG GGGTGCTGCTTCAAGCTCTCCTGCTGCTGGCATTCCCCAGAAGCCTCAGAGAGCCCCAACCACTGCCGCT GCTGCAGCTGCGGGTGTTTCATCCACAAAATCTAAAAAAGGTGCCAAGAGCCACCAAGGTGAGAAAAATG CAAGTTCCTCCCAGGCCTCAACATCTACTAAGAGCCCAAGCGAAGATCCTCTAACCAGGAAGTCAGGGTC GTTGGTGCAGTTCCTGTTGTACAAGTATAAAATAAAAAAGTCCGTTACAAAGGGAGAAATGCTGAAAATT GTTGGCAAAAGGTTCAGGGAGCACTTCCCTGAGATCCTCAAGAAAGCCTCTGAGGGCCTCAGTGTTGTCT TTGGCCTTGAGCTGAATAAAGTCAACCCCAACGGCCACACTTACACCTTCATCGACAAGGTAGACCTCAC TGATGAGGAATCCCTGCTCAGTTCCTGGGACTTTCCCAGGAGAAAGCTTCTGATGCCTCTCCTGGGTGTG ATCTTCTTAAATGGCAACTCAGCTACTGAGGAAGAGATCTGGGAATTCCTGAATATGTTGGGAGTCTATG ATGGAGAGGAGCACTCAGTCTTTGGGGAACCCTGGAAGCTCATCACCAAAGATCTGGTGCAGGAAAAATA TCTGGAGTACAAGCAGGTGCCCAGCAGTGATCCCCCACGCTTTCAATTCCTGTGGGGTCCGAGAGCCTAT GCTGAAACCAGCAAGATGAAAGTCCTGGAGTTTTTGGCCAAGGTAAATGGTACCACCCCCTGTGCCTTCC
    [Show full text]
  • Deciphering the Histone Code to Build the Genome Structure
    bioRxiv preprint doi: https://doi.org/10.1101/217190; this version posted November 20, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Deciphering the histone code to build the genome structure Kirti Prakasha,b,c,* and David Fournierd,* aPhysico-Chimie Curie, Institut Curie, CNRS UMR 168, 75005 Paris, France; bOxford Nanoimaging Ltd, OX1 1JD, Oxford, UK; cMicron Advanced Bioimaging Unit, Department of Biochemistry, University of Oxford, Oxford, UK; dFaculty of Biology and Center for Computational Sciences, Johannes Gutenberg University Mainz, 55128 Mainz, Germany; *Correspondence: [email protected], [email protected] Histones are punctuated with small chemical modifications that alter their interaction with DNA. One attractive hypothesis stipulates that certain combinations of these histone modifications may function, alone or together, as a part of a predictive histone code to provide ground rules for chromatin folding. We consider four features that relate histone modifications to chromatin folding: charge neutrali- sation, molecular specificity, robustness and evolvability. Next, we present evidence for the association among different histone modi- fications at various levels of chromatin organisation and show how these relationships relate to function such as transcription, replica- tion and cell division. Finally, we propose a model where the histone code can set critical checkpoints for chromatin to fold reversibly be- tween different orders of the organisation in response to a biological stimulus. DNA | nucleosomes | histone modifications | chromatin domains | chro- mosomes | histone code | chromatin folding | genome structure Introduction The genetic information within chromosomes of eukaryotes is packaged into chromatin, a long and folded polymer of double-stranded DNA, histones and other structural and non- structural proteins.
    [Show full text]
  • Dynamics of Transcription-Dependent H3k36me3 Marking by the SETD2:IWS1:SPT6 Ternary Complex
    bioRxiv preprint doi: https://doi.org/10.1101/636084; this version posted May 14, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Dynamics of transcription-dependent H3K36me3 marking by the SETD2:IWS1:SPT6 ternary complex Katerina Cermakova1, Eric A. Smith1, Vaclav Veverka2, H. Courtney Hodges1,3,4,* 1 Department of Molecular & Cellular Biology, Center for Precision Environmental Health, and Dan L Duncan Comprehensive Cancer Center, Baylor College of Medicine, Houston, TX, 77030, USA 2 Institute of Organic Chemistry and Biochemistry, Czech Academy of Sciences, Prague, Czech Republic 3 Center for Cancer Epigenetics, The University of Texas MD Anderson Cancer Center, Houston, TX, 77030, USA 4 Department of Bioengineering, Rice University, Houston, TX, 77005, USA * Lead contact; Correspondence to: [email protected] Abstract The genome-wide distribution of H3K36me3 is maintained SETD2 contributes to gene expression by marking gene through various mechanisms. In human cells, H3K36 is bodies with H3K36me3, which is thought to assist in the mono- and di-methylated by eight distinct histone concentration of transcription machinery at the small portion methyltransferases; however, the predominant writer of the of the coding genome. Despite extensive genome-wide data trimethyl mark on H3K36 is SETD21,11,12. Interestingly, revealing the precise localization of H3K36me3 over gene SETD2 is a major tumor suppressor in clear cell renal cell bodies, the physical basis for the accumulation, carcinoma13, breast cancer14, bladder cancer15, and acute maintenance, and sharp borders of H3K36me3 over these lymphoblastic leukemias16–18. In these settings, mutations sites remains rudimentary.
    [Show full text]
  • Assessing the Epigenetic Status of Human Telomeres
    cells Perspective Assessing the Epigenetic Status of Human Telomeres María I. Vaquero-Sedas and Miguel A. Vega-Palas * Instituto de Bioquímica Vegetal y Fotosíntesis, CSIC-Universidad de Sevilla, 41092 Seville, Spain * Correspondence: [email protected] Received: 19 July 2019; Accepted: 5 September 2019; Published: 7 September 2019 Abstract: The epigenetic modifications of human telomeres play a relevant role in telomere functions and cell proliferation. Therefore, their study is becoming an issue of major interest. These epigenetic modifications are usually analyzed by microscopy or by chromatin immunoprecipitation (ChIP). However, these analyses could be challenged by subtelomeres and/or interstitial telomeric sequences (ITSs). Whereas telomeres and subtelomeres cannot be differentiated by microscopy techniques, telomeres and ITSs might not be differentiated in ChIP analyses. In addition, ChIP analyses of telomeres should be properly controlled. Hence, studies focusing on the epigenetic features of human telomeres have to be carefully designed and interpreted. Here, we present a comprehensive discussion on how subtelomeres and ITSs might influence studies of human telomere epigenetics. We specially focus on the influence of ITSs and some experimental aspects of the ChIP technique on ChIP analyses. In addition, we propose a specific pipeline to accurately perform these studies. This pipeline is very simple and can be applied to a wide variety of cells, including cancer cells. Since the epigenetic status of telomeres could influence cancer cells proliferation, this pipeline might help design precise epigenetic treatments for specific cancer types. Keywords: telomeres; epigenetics; chromatin immunoprecipitation; microscopy; human; cancer 1. The Epigenetic Nature of Human Telomeres Has Remained Controversial The length of telomeres and the chromatin organization of telomeric regions influence telomeres function [1].
    [Show full text]