Depletion of the Chromatin Remodeler CHD4 Sensitizes AML Blasts to Genotoxic Agents and Reduces Tumor Formation Justin Sperlazza Virginia Commonwealth University

Virginia Commonwealth University VCU Scholars Compass

Human and Molecular Genetics Publications Dept. of Human and Molecular Genetics

2015 Depletion of the chromatin remodeler CHD4 sensitizes AML blasts to genotoxic agents and reduces tumor formation Justin Sperlazza Virginia Commonwealth University

Mohamed Rahmani Virginia Commonwealth University

Jason Beckta Virginia Commonwealth University

See next page for additional authors

Follow this and additional works at: http://scholarscompass.vcu.edu/hgen_pubs Part of the Medical Sciences Commons

Downloaded from http://scholarscompass.vcu.edu/hgen_pubs/32

This Article is brought to you for free and open access by the Dept. of Human and Molecular Genetics at VCU Scholars Compass. It has been accepted for inclusion in Human and Molecular Genetics Publications by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. Authors Justin Sperlazza, Mohamed Rahmani, Jason Beckta, Mandy Aust, Elisa Hawkins, Shou Zhen Wang, Sheng Zu Zhu, Shreya Podder, Catherine Dumur, Kellie Archer, Steven Grant, and Gordon D. Ginder

This article is available at VCU Scholars Compass: http://scholarscompass.vcu.edu/hgen_pubs/32 From www.bloodjournal.org by guest on November 20, 2015. For personal use only. Regular Article

MYELOID NEOPLASIA Depletion of the chromatin remodeler CHD4 sensitizes AML blasts to genotoxic agents and reduces tumor formation

Justin Sperlazza,1,2 Mohamed Rahmani,2,3 Jason Beckta,2,4 Mandy Aust,2 Elisa Hawkins,2 Shou Zhen Wang,2 Sheng Zu Zhu,2 Shreya Podder,2 Catherine Dumur,2,5 Kellie Archer,2,6 Steven Grant,2-4 and Gordon D. Ginder2,3,7

1Cancer and Molecular Medicine PhD Program, 2Massey Cancer Center, and 3Department of Internal Medicine, 4Department of Biochemistry and Molecular Biology, 5Department of Pathology, 6Department of Biostatistics, and 7Department of Human and Molecular Genetics, Virginia Commonwealth University, Richmond, VA

Key Points Chromodomain helicase DNA-binding protein 4 (CHD4) is an ATPase that alters the phasing of nucleosomes on DNA and has recently been implicated in DNA double- • CHD4 depletion sensitizes stranded break (DSB) repair. Here, we show that depletion of CHD4 in acute myeloid AML cells but not normal leukemia (AML) blasts induces a global relaxation of chromatin that renders cells more CD341 progenitors to susceptible to DSB formation, while concurrently impeding their repair. Furthermore, genotoxic agents by relaxing CHD4 depletion renders AML blasts more sensitive both in vitro and in vivo to genotoxic chromatin and impairing DSB agents used in clinical therapy: daunorubicin (DNR) and cytarabine (ara-C). Sensitization repair. to DNR and ara-C is mediated in part by activation of the ataxia-telangiectasia mutated pathway, which is preliminarily activated by a Tip60-dependent mechanism in response • CHD4 depletion modulates to chromatin relaxation and further activated by genotoxic agent–induced DSBs. This expression of AML cell genes sensitization preferentially affects AML cells, as CHD4 depletion in normal CD341 that regulate tumor formation hematopoietic progenitors does not increase their susceptibility to DNR or ara-C. in vivo and colony formation in Unexpectedly, we found that CHD4 is necessary for maintaining the tumor-forming vitro. behavior of AML cells, as CHD4 depletion severely restricted the ability of AML cells to form xenografts in mice and colonies in soft agar. Taken together, these results provide evidence for CHD4 as a novel therapeutic target whose inhibition has the potential to enhance the effectiveness of genotoxic agents used in AML therapy. (Blood. 2015;126(12):1462-1472) Introduction

Acute myeloid leukemia (AML) is a malignancy that arises from the cells can evade cell death following chemotherapy-induced DSBs by impaired differentiation of hematopoietic progenitors, resulting in the repairing damage through numerous repair mechanisms. However, accumulation of immature myeloid blasts in the bone marrow. Despite malignant cells tend to be more susceptible to DSB insults due to their advances in our understanding and management of AML, the overall rapid proliferation, deregulated cell-cycle checkpoints, and inactive 5-year survival is only 24% due to the low remission and high relapse DNA repair machinery.10 Recently, the chromatin structure surround- rates in older patients and those with complex tumor genotypes.1 Cur- ing a DSB has emerged as a key determinant of the kinetics and rent AML management begins with induction chemotherapy, generally mechanism of repair. Thus, chromatin-remodeling enzymes that regu- consisting of an anthracycline, such as daunorubicin (DNR), supple- late chromatin architecture have been identified as key mediators of the mented with cytarabine (ara-C). Combined DNR/ara-C regimens achieve DSB repair process, as they are needed to relax the chromatin structure overall complete remission (CR) rates ranging from 53% to 58%,2 surrounding DSBs for efficient repair to occur.11-14 although recent studies suggest that increasing the DNR dose may Chromodomain helicase DNA-binding protein 4 (CHD4) is a widely yield tangible benefits to the CR rates and survival of a subset of pa- conserved member of the sucrose nonfermenting 2 superfamily of tients.3,4 Regimens containing various combinations of anthracyclines chromatin-remodeling ATPases that is capable of altering the phasing and high-dose ara-C also form the foundation of salvage therapy for of nucleosomes on DNA.15-18 This ATPase is a core subunit of the patients with relapsed disease.5,6 corepressor nucleosome remodeling and deacetylase (NuRD) complex The anthracycline DNR is a topoisomerase inhibitor that induces that has been shown to play a significant role in DNA methylation- DNA double-stranded breaks (DSBs), which are highly cytotoxic.7 dependent transcriptional repression, particularly the repression of Similarly, the nucleoside analog ara-C also induces DNA damage, hypermethylated tumor suppressor genes in cancer.19-21 Additionally, including DSBs, during DNA synthesis through inhibition of DNA recent studies found that CHD4 is rapidly recruited to sites of polymerase and incorporation into DNA.8,9 Both normal and leukemic DSBs,22,23 where it facilitates an E3 ubiquitin ligase RNF8-dependent

Submitted March 2, 2015; accepted July 27, 2015. Prepublished online as The publication costs of this article were defrayed in part by page charge Blood First Edition paper, August 11, 2015; DOI 10.1182/blood-2015-03- payment. Therefore, and solely to indicate this fact, this article is hereby 631606. marked “advertisement” in accordance with 18 USC section 1734.

The microarray data reported in this article have been deposited in the Gene Expression Omnibus database (accession number GSE71865). The online version of this article contains a data supplement. © 2015 by The American Society of Hematology

1462 BLOOD, 17 SEPTEMBER 2015 x VOLUME 126, NUMBER 12 From www.bloodjournal.org by guest on November 20, 2015. For personal use only.

BLOOD, 17 SEPTEMBER 2015 x VOLUME 126, NUMBER 12 CHD4 DEPLETION IN AML CELLS 1463 relaxation of the surrounding chromatin to promote the recruitment In vivo studies were approved by the VCU Institutional Animal Care of other repair machinery, such as RNF168 and BRCA1.24 and Use Committee. Female NOD scid g mice (NSG; The Jackson Labo- 6 In this study, we investigate the dual functionality of CHD4 in the ratory) were engrafted IV via the tail vein with 5 3 10 luciferase-expressing context of AML. We show that CHD4 is necessary for the efficient U937 cells. Tumor progression was monitored by the total radiance generated repair of DSBs within AML cells, and that AML cells partially depleted within each mouse upon subcutaneous administration of luciferin as measured by the IVIS 200 imaging system (Xenogen Corporation). Once tumor of CHD4 are more susceptible to clinically used DNA-damaging engraftment was confirmed, the mice were treated with a previously described agents,suchasDNRandara-C,bothinvitroandinvivo.Additionally, model of the human “7 1 3” induction therapy.33,34 Briefly, this regimen we demonstrate that the depletion of CHD4 in AML cells reduces their consisted of 3 consecutive daysof Doxorubicin (100 mg/kg; Selleck Chemicals) potential to form mouse xenografts and markedly inhibits their ability to and ara-C (33 mg/kg; Selleck Chemicals) given IV by tail-vein injection, generate colonies. We show that both of these phenotypes are consistent followed by 2 additional days of ara-C (33 mg/kg) given by intraperitoneal with gene expression alterations resulting from CHD4 depletion. injection. Importantly, all of these events occur preferentially in AML cells, Colony-forming assays were performed as previously described.28 For AML 1 as similar depletion of CHD4 in normal CD34 hematopoietic pro- cell lines, 5000 cells were suspended in 1 mL of 13 RPMI supplemented with genitor cells does not result in similar phenotypes. Taken together, 0.35% agarose (Difco), 10% FBS, and 2% penicillin/streptomycin and plated the present findings highlight for the first time the therapeutic poten- into a well of a 12-well plate. Cells were allowed to grow for 14 days and colonies fi . 1 tial of targeting CHD4 in AML. were identi ed as having 50 cells. For CD34 cells, the Methocult H4434 Classic kit (StemCell Technologies) was used. Microarray analysis was performed using HG-U133Ax2 GeneChips (Affymetrix). Quality of the hybridization was assessed by examining the average background, scaling factor, the percentage of probe sets called Methods present by the detection call algorithm, and the 39:59 ratio for glyceraldehyde- 3-phosphate dehydrogenase (GAPDH) and ACTIN. Each GeneChip was Cells independently normalized using quantile normalization and the robust Human AML U937 and MV4-11 cells were described previously.25 OCI-AML3 multiarray average method was applied to probe-set expression summa- 35 cells were purchased from Deutsche Sammlung von Mikroorganismen und ries. For each probe set, a moderated t test was used to make compari- 36,37 Zellkulturen (DSMZ; Braunschweig, Germany). Cells were cultured in RPMI sons using the limma Bioconductor package in the R programming 38 1640 (Gibco) supplemented with 10% fetal bovine serum (FBS; Atlas) and 2% environment. The P values were used in estimating the false discovery 39 penicillin/streptomycin. Cell numbersweremeasuredbyaCellometerAutoT4 rate (FDR) using the Benjamini and Hochberg method and probe sets (Nexcelom Bioscience). having an FDR , 0.05 were considered significant. Pathway analysis of the significant probe sets was performed using the Ingenuity Pathway Analysis Isolation of primary cells software (Qiagen).

This study was approved by the Virginia Commonwealth University (VCU) Statistical analysis Investigational Review Board and samples were collected with patient consent. Bone marrow was collected from AML patients with high disease load (.90% Resultsareshownasmeans1 standard deviation (SD) unless otherwise stated. blasts in the marrow) and mononuclear cells were isolated by Ficoll-Hypaque P values were calculated by the Student t test. gradient separation as described previously.25 Normal CD341 hematopoietic progenitor cells were isolated from deidentified apheresis units discarded by the VCU Bone Marrow Transplant Unit as described previously.26 All primary cells were cultured in StemSpan serum-free expansion medium with 13 CC100 cytokine mix (StemCell Technologies) and 2% penicillin/streptomycin. Results Short hairpin RNA (shRNA) constructs were created as described pre- CHD4 is necessary for maintaining heterochromatin in viously.26 Briefly, CHD4 target sequences (shCHD4-1: CGGTGAGATCATCC- AML blasts TGTGTGATA; shCHD4-2: GGACCTGAATGATGAGAAACAGA) and the 27 Tip60 target sequence (CCTCAATCTCATCAACTACTA) were cloned into As CHD4 is a chromatin-remodeling ATPase,15-18 we investigated fl agreen uorescent protein (GFP)-expressing pRRL.H1.shRNA vector and pack- the effect of CHD4 depletion on the overall chromatin structure of aged into a lentivirus through calcium phosphate transfections in 293T cells. AML cells. Integration of a CHD4-targeting shRNA (shCHD4-1) Immunoblotting was performed as described previously.28,29 Blots were into the AML cell lines U937, MV4-11, and AML-3 by a lentiviral imaged and quantitated using a Li-Cor Odyssey Fc Imager. Primary antibodies for the antigens studied were obtained from several sources: H3K9ac, H3, vector resulted in the robust depletion of the CHD4 protein (sup- Blood H4K8ac, H4, cleaved-caspase 3, phosphorylated ataxia-telangiectasia mutated plemental Figure 1A, see supplemental Data available at the (p-ATM; S1981), and ATM, all from Cell Signaling; CHD4 from Millipore; Web site). When compared with control cells in which a scrambled, poly(ADP-ribose) polymerase (PARP) from Biomol Research Laboratories; nontargeting shRNA was integrated, cells depleted of CHD4 were E2F1 from Santa Cruz Biotechnology; and a-tubulin from Calbiochem. found to have a global increase in the euchromatin-associated Confocal microscopy was performed on a Zeiss 720 Meta microscope as acetylation of histone H3 lysine 9 and histone H4 lysine 8 (Figure 1A; previously described.30 Primary antibodies used were against H3K9me3 and supplemental Table 1) and disruption of heterochromatin-associated g-H2A.X (Millipore). Images were quantified using the Velocity Image Analysis trimethyl-histone H3 lysine 9 foci (Figure 1B). These results indicate software (PerkinElmer). that inhibition of CHD4 function induces a global relaxation of the Comet assays were performed under neutral conditions using the Trevigen chromatin structure in AML blasts. CometAssay kit with modifications as previously described.31 Comets were quantitated by CASPLab Comet Assay software.32 Depletion of CHD4 renders AML blasts more sensitive to DSB Cell sensitivity to DNR and ara-C damage and impairs the repair of DSBs

Cells were incubated with DNR (Sigma-Aldrich) or ara-C (Sigma-Aldrich) for Because chromatin-remodeling enzymes have been found to play 11,14 24 hours and a 7-aminoactinomycin D (7AAD; Sigma-Aldrich) stain read by key roles in mediating the repair of DSBs, we investigated a FACSCanto Cell Analyzer (BD) was used to determine cell viability. whether CHD4isinvolved inDSB repair inAML blasts. We subjected From www.bloodjournal.org by guest on November 20, 2015. For personal use only.

1464 SPERLAZZA et al BLOOD, 17 SEPTEMBER 2015 x VOLUME 126, NUMBER 12

Figure 1. CHD4 is necessary for the maintenance of heterochromatin and the efficient repair of DNA DSBs in AML blasts. AML cell lines were infected by lentivirus to integrate either a nontargeting, scrambled (Sc) shRNA or a CHD4-targeting shRNA. (A) Depletion of CHD4 leads to a global increase in euchromatin- associated histone H3K9 and H4K8 acetylation. (B) DepletionofCHD4alsoresultsinadisruptionof heterochromatin-associated histone H3K9me3 foci in U937 cells as shown by staining with anti-H3K9me3 antibody. (C) U937 cells were exposed to 6 Gy of radiation to induce DNA DSBs. DSB formation and repair was monitored over a 4-hour time course using a neutral comet assay. CHD4-depleted cells displayed significantly more evidence of DSBs and were delayed in their repair (n . 50 comets). (D) The results of the comet assay were confirmed by staining for Y-H2A.X foci and calculating the fluorescent intensity per nucleus (n . 60 cells per time point). (E) Representative images of the Y-H2A.X stain. *P , .05.

U937 cells to 6 Gy of radiation and detected DSBs using a neutral Figure 3). Thus, in AML cells, inhibition of CHD4 impedes the repair of comet assay over a 4-hour time course (Figure 1C). CHD4-depleted DSBs and increases susceptibility to their formation. cells demonstrated significantly more evidence of DSBs 1 hour after radiation exposure, suggesting that inhibition of CHD4 rendered the Inhibition of CHD4 renders AML blasts more sensitive to DNR cells more susceptible to the formation of DSBs. The tail moment of and ara-C in vitro control cells returned to baseline after just 2 hours, indicating that cells expressing wild-type levels of CHD4 are capable of rapidly Having determined that CHD4 affects the formation and repair of DSB repairing radiation-induced DSBs to levels below the detection limits in AML cells, we hypothesized that AML cells depleted of CHD4 of the assay. However, the tail moment of the CHD4-depleted cells would be more sensitive to the DSB-inducing agents DNR and ara-C. remained elevated throughout the 4-hour course of the experiment, To test this hypothesis, we incubated the AML cells for 24 hours with indicating that CHD4 is required for the efficient repair of DSBs in clinically relevant concentrations of either DNR (Figure 2A) or ara-C AML cells. (Figure 2B) and the assessed their viability with 7AAD staining. At all To confirm our observations from the neutral comet assay, we DNR and ara-C concentrations tested, significantly more cell death performed immunostaining for gH2A.X foci, a histone marker of was observed in the AML cells depleted of CHD4, with some con- DSBs, over the 4-hour time course (Figure 1D-E). Cells depleted of centrations resulting in as much as a fivefold increase in cell death. CHD4 contained a significant increase in gH2A.X foci at 0.5 hours Similar results were obtained when we depleted CHD4 in a primary postradiation exposure and the number of foci remained elevated AML sample (098-8712-3A). To confirm that the increase in sensitivity above that in control cells over the 4-hour time course. Similar to DNR and ara-C was not the result of an off-target effect of the shRNA results were obtained for MV4-11 and AML-3 (supplemental construct used, a second CHD4-targeted shRNA construct (shCHD4-2; Figure 2). supplemental Figure 1A-B) was tested and induced a similar increase We then confirmed that the DSBs observed over the 4-hour time in sensitivity to DNR (supplemental Figure 4). Thus, knockdown of course were not the result of apoptosis, as neither PARP nor caspase-3 CHD4 with 2 independent shRNA constructs enhanced the in vitro cleavage occurred throughout the 4-hour time course (supplemental sensitivity of AML cells to DNR and ara-C. From www.bloodjournal.org by guest on November 20, 2015. For personal use only.

BLOOD, 17 SEPTEMBER 2015 x VOLUME 126, NUMBER 12 CHD4 DEPLETION IN AML CELLS 1465

Figure 2. Inhibition of CHD4 renders AML blasts more sensitive to DNR and ara-C in vitro. U937, MV4-11, and AML-3 human AML cell lines and a primary AML sample were incubated with various concentrations of (A) DNR or (B) ara-C for 24 hours in vitro. Cell viability was assayed using a 7AAD stain and quantified by flow cytometry. For all AML cells and concentrations of DNR/ara-C tested, AML cells depleted of CHD4 displayed significantly more cell death compared with controls. P , .05 for every data point tested; n 5 3 biological replicates for each data point.

As DNR is a fluorescent-intercalating agent40 and CHD4 depletion suggesting that posttranscriptional alterations could account for the induces a global relaxation of chromatin in AML blasts, we tested discrepancy in the observed amount of CHD4 protein. whether CHD4-depleted cells were more susceptible to DNR intercalation. Incubation of U937 cells for 2 hours with 200 ng/mL DNR Inhibition of CHD4 sensitizes AML blasts to DNR and ara-C in fi fl caused signi cantly more DNR uorescent signal inside the nuclei of a xenograft model CHD4-depleted cells (supplemental Figure 5). This finding is consistent with increased DNR intercalation within CHD4-depleted cells. Having demonstrated that depletion of CHD4 preferentially increases the sensitivity of AML cells to DNR and ara-C in vitro, we tested the Inhibition of CHD4 does not sensitize normal CD341 progenitor effect of CHD4 depletion in AML cells in vivo. To this end, we used “ 1 ” cells to DNR and ara-C a previously described mouse xenograft model of the human 7 3 induction regimen33,34 that consists of 5 continuous days of ara-C We next investigated whether the increased sensitivity to DNR and ara-C treatment and doxorubicin coadministered on days 1 through 3. In this induced by CHD4 inhibition occurs preferentially in AML blasts. model, the anthracycline doxorubicin is substituted for the anthracy- We depleted CHD4 in CD341 hematopoietic progenitor cells iso- cline DNR used in humans due to the systemic toxicity of the latter in lated from the mobilized blood of 3 normal donors (supplemental mice.33 Luciferase-expressing U937 cells were systemically engrafted Figure 1E). Following incubation for 24 hours with DNR and ara-C, by tail-vein injection into NSG mice (n 5 3 mice per condition) and CD341 cells did not display a significant increase in sensitivity to disease progression was monitored by total radiance (measured in DNR (Figure 3A) or ara-C (Figure 3B). photons/second/centimeter2/steradian) generated within each mouse To gain insight into how CHD4 depletion might preferentially upon subcutaneous administration of luciferin. sensitize leukemic cells, we compared the total endogenous CHD4 The treatment regimen was initiated once a systemic xenograft protein levels in CD341 cells from the 3 normal donors to that in 3 was confirmedandmicewerereimaged7dayslater,atimewehad AML cell lines (U937, MV4-11, AML-3) and blasts isolated from the previously observed to yield the maximum drug-induced antitumor bone marrow of 3 different AML patients whose marrow contained effect. Posttreatment, mice engrafted with control cells displayed, .90% blasts. AML cell lines and primary AML blasts contained on on average, 43% of their total pretreatment radiance. However, 1 average ;50% less CHD4 total protein than CD34 cells (Figure 3C; mice engrafted with CHD4-depleted cells displayed only 20% of supplemental Figure 1E). Surprisingly, AML cell lines and primary their pretreatment radiance (Figure 4A), indicating that AML blasts AML samples did not have significantly different amounts of CHD4 depleted of CHD4 are indeed more sensitive to DNR and ara-C 1 messenger RNA (mRNA) compared with the normal CD34 progenitors, treatment in vivo. From www.bloodjournal.org by guest on November 20, 2015. For personal use only.

1466 SPERLAZZA et al BLOOD, 17 SEPTEMBER 2015 x VOLUME 126, NUMBER 12

Figure 3. Inhibition of CHD4 does not sensitize normal CD341 progenitor cells to DNR and ara-C. CD341 hematopoietic progenitors were isolated from the 3 normal donors. Depletion of CHD4 did not significantly increase the sensitivity of the CD341 cells to either (A) DNR or (B) ara-C. (C) The CD341 cells were found to contain significantly more endogenous CHD4 protein than the AML cell lines (U937, MV4-11, AML-3) and primary AML blasts isolated from the bone marrow of 3 patients. Interestingly, there was no differ- ence in CHD4 mRNA between the CD341 and AML cells. *P , .05. N.S., not statistically significant.

Mice were then followed for survival, until a humane end point was CHD4 depletion alters expression of genes involved in reached (Figure 4B). Untreated mice engrafted with CHD4-depleted tumor formation cells survived significantly longer than those engrafted with control To gain insight into the molecular basis for this loss of colony-forming cells. The survival of the mice engrafted with CHD4-depleted cells further improved with the addition of the drug regimen. Once the mice potential, we performed microarrays to investigate transcriptional alter- reached their humane end points, bone marrow was collected and ations that result from the depletion of CHD4. Probe sets were consid- , analyzed. In the marrow of mice that received the shCHD4-depleted ered to be differentially expressed if the FDR was 0.05, which resulted cells, the AML cells retained ;75% knockdown of CHD4 mRNA in 1320 and 675 differentially expressed genes in U937 and MV4-11, compared with cells from the bone marrow of mice containing the respectively. We then used a downstream effects analysis in the Ingenuity control shRNA (data not shown). Pathway Analysis (IPA) software to interpret the biological implications of gene expression alterations (Figure 5C). According to this analysis, Inhibition of CHD4 improves survival in mice CHD4 depletion resulted in a net decrease in the expression of genes previously reported to increase the colony-forming potential of tumor Despite injection with equivalent numbers of viable leukemic cells cells and concomitantly induced the expression of genes previously re- at the same time, mice engrafted with CHD4-depleted cells harbored ported to decrease the colony-forming potential of tumor cells. Taken significantly lower tumor burden than mice engrafted with control cells together, the IPA analysis predicted a significant decrease in the colony when therapy was initiated. CHD4 depletion did not significantly alter formation potential of both U937 and MV4-11 cells. the in vitro (supplemental Figure 6) or in vivo (supplemental Figure 7) We then used quantitative polymerase chain reaction to validate the proliferation rate, nor did it alter the cell-cycle distribution of the expression alterations of several genes whose differential expression has tested AML cell lines (supplemental Figure 8). Therefore, proliferative previously been shown to significantly alter the colony formation of alterations are unlikely to account for the discrepancy in the tumor AML and hematopoietic stem cells, including Myc and PCGF2.42-44 burden between mice engrafted with control vs CHD4-depleted cells. Consistent with the microarray data, Myc was found to be downregulated An alternative explanation is that CHD4 depletion reduces the and PCGF2 was found to be upregulated in the CHD4-depleted AML tumor-forming capacity of the leukemic cells. We performed soft cells (supplemental Figure 10). An additional 7 genes were also validated agar colony-forming assays, as leukemic cells capable of forming in CHD4-depleted AML cells (supplemental Figure 11). In conjunction colonies in soft agar have been shown to possess the ability to initiate with the IPA analysis, these results indicate that transcriptional alterations disease in vivo.41 Indeed, CHD4 depletion sharply reduced the induced by the depletion of CHD4 can at least partially explain the formation of AML colonies in soft agar (Figure 5A-B; supplemental decrease in colony-forming potential in AML cells. Figure 9), suggesting that CHD4 is required to maintain the full tumor- In contrast to the findings in AML cells, depletion of CHD4 did not 1 forming ability of these cells. significantly alter the colony-forming potential of CD34 cells isolated From www.bloodjournal.org by guest on November 20, 2015. For personal use only.

BLOOD, 17 SEPTEMBER 2015 x VOLUME 126, NUMBER 12 CHD4 DEPLETION IN AML CELLS 1467

Figure 4. Inhibition of CHD4 sensitizes AML blasts to DNR and ara-C in a xenograft model. Equal numbers of luciferase-expressing Scramble and shCHD4 U937 cells were engrafted into NSG mice by tail-vein injection and tumor burden was noninvasively monitored by measuring the total radiance generated upon subcutaneous administration of luciferin. (A) Once a tumor was well established (as seen in the pretreatment panels), the mice were treated with 5 continuous days of ara-C, with concurrent doxorubicin on days 1 through 3. Posttreat- ment, mice engrafted with control cells were found to possess 43% of their pretreatment radiance, whereas mice engrafted with CHD4-depleted cells possessed 20% (P , .001). (B) The mice were followed for survival. CHD4 depletion alone resulted in a 7-day improvement in mouse survival. Treatment with Doxorubicin/ara-C improved the survival of the mice engrafted with CHD4- depleted cells by an additional 4 days. *P , .05.

from normal donors (Figure 5D; supplemental Figure 12). Consistent depletion of CHD4 would induce a Tip60-dependent activation of with this observation, the expression of neither Myc nor PCGF2 was ATM. Accordingly, a 10-fold increase in the phosphorylation of S1981 1 signiﬁcantly altered in the CHD4-depleted CD34 cells (supplemental on ATM in U937 cells was observed upon the depletion of CHD4. Figure 10). However, the phosphorylation of ATM remained at control levels upon concomitant depletion of Tip60 in CHD4-depleted cells (Figure 6A; Inhibition of CHD4 activates the ATM signaling pathway to supplemental Table 2). This observation indicates that inhibition of induce apoptosis CHD4 does induce a Tip60-dependent activation of ATM. We next sought to investigate the ATM pathway in AML cells in As AML cells depleted of CHD4 are more sensitive to DSB-inducing response to DNR. As expected, ATM is autophosphorylated in a dose- agents, we investigated the role of the ATM pathway. The serine/ dependent manner in both control and shCHD4 cells. However, a threonine kinase ATM is a master regulator of the DSB repair response signiﬁcant increase in the amount of p-ATM was detected at each and is classically activated by autophosphorylation of serine 1981 in DNR concentration tested in CHD4-depleted cells (Figure 6B). In- response to double-stranded DNA breaks.10,45 Recently, the protein terestingly, depletion of CHD4 also increased the level of total ATM by acetyl-transferase Tip60 was found to activate ATM in response to threefold. Once active, ATM induces numerous downstream phos- chromatin relaxation.46 Because depletion of CHD4 led to a global phorylation events that signal for cell survival by initiating the repair relaxation of the chromatin structure of AML cells, we hypothesized that of DSBs or it can trigger apoptosis.10,47 E2F1 is a proapoptotic From www.bloodjournal.org by guest on November 20, 2015. For personal use only.

1468 SPERLAZZA et al BLOOD, 17 SEPTEMBER 2015 x VOLUME 126, NUMBER 12

Figure 5. CHD4 depletion dramatically decreases the tumor-forming behavior of AML cells and modulates expression of genes associated with tumor colony formation. CHD4-depleted cells were inhibited in their ability to engraft into the NSG mice. CHD4 depletion severely reduced the ability of U937 and MV4-11 cell lines to form colonies in soft agar. (A) Representative images (203) of colonies. (B) Quantitation of AML colonies (*P , .05, n 5 3). (C) Microarray arrays were performed to determine the gene expression alterations associated with CHD4 depletion. Ingenuity Pathway Analysis software was used to interpret the data and predicted a significant decrease in the colony-forming potential in both U937 and MV4-11 (activation Z score of 22.044 and 22.002, respectively). (D) Depletion of CHD4 in CD341 hematopoietic progenitors isolated from 3 normal donors did not result in a significant decrease in colony formation. transcription factor that is stabilized by ATM through phosphorylation of CHD4 (Figure 6D). E2F1 did not undergo a DNR dose-dependent of Serine-31.48 E2F1 is stabilized in U937 cells in a DNR dose- stabilization when the ATM inhibitor KU60019 was added, indicat- dependent manner in control cells (Figure 6C); however, signiﬁcantly ing that the observed dose-dependent stabilization requires ATM more E2F1 is stabilized in response to DNR in cells partially depleted (Figure 6E). Ultimately, the increased activation of ATM and the From www.bloodjournal.org by guest on November 20, 2015. For personal use only.

BLOOD, 17 SEPTEMBER 2015 x VOLUME 126, NUMBER 12 CHD4 DEPLETION IN AML CELLS 1469

Figure 6. Inhibition of CHD4 activates the ATM signaling pathway to induce increased apoptosis. (A) Depletion of CHD4 in U937 cells induces a significant activation of ATM, which is blocked by the concurrent depletion of Tip60. (B) Upon addition of DNR, ATM is activated in a concentration-dependent manner, with significantly more activation in the CHD4- depleted cells. (C) Once active, ATM acts on its downstream targets, including stabilizing the proapoptotic transcription factor E2F1. E2F1 is stabilized in a DNR concentration-dependent manner, (D) with significantly more being stabilized in the CHD4-depleted cells. (E) This stabilization is diminished upon the addition of the ATM inhibitor KU60019. (F) Ultimately, in response to the DNR, CHD4-depleted AML cells display elevated markers of apoptosis, including PARP and Caspase-3 cleavage.

subsequently increased downstream proapoptotic signaling in re- to efficiently repair the resulting genotoxic agent–induced DSBs sponse to DNR in CHD4-depleted AML cells resulted in increased (Figure 1). Probing ATM pathway components in CHD4-depleted apoptosis compared with control cells (Figure 6F). AML cells revealed a Tip60-mediated activation of ATM prior to DNA damage as well as an ATM-dependent stabilization of the proapoptotic transcription factor E2F1 upon induction of DSBs (Figure 6). Taken together, these results indicate that targeting CHD4 could increase the Discussion sensitivity of AML cells to genotoxic agents commonly used in therapy through a combination of increased susceptibility to the formation of CHD4 and its associated NuRD complex have emerged as key DSBs and inhibition of their repair (Figure 7). mediators of the double-stranded DNA damage repair pathway11,12 and DepletionofCHD4in3AMLcelllinesandaprimaryAMLpatient gene expression, most notably repression of hypermethylated tumor sample increased the in vitro sensitivity to clinically relevant concen- suppressor genes in cancer.19,20 Here, we describe the first study that trations of single-agent DNR and ara-C (Figure 2). Importantly, the examines the interplay of CHD4’s dual functionality in AML. We increased sensitivity to DNR and ara-C occurred preferentially in AML 1 observed that the partial depletion of CHD4 in AML cells induces cells, as normal CD34 hematopoietic progenitors partially depleted a global relaxation of the chromatin structure (Figure 1), which is similar of CHD4 did not demonstrate a similar increase in susceptibility to previous reports in Ramos49 and HeLa50 cell lines. CHD4-depleted (Figure 3). We hypothesize that the preferential sensitivity of AML AML cells were also found to be more susceptible to the formation of cells to CHD4 depletion may reflect disparate levels of endogenous 1 DSBs (Figure 1), consistent with evidence that CHD4 protects U2OS CHD4 between normal CD34 cells and AML cells, as AML cell lines osteosarcoma cells from ionizing radiation22,23,51 and that relaxed and primary AML cells appear to contain significantly less total endog- chromatin is more susceptible to the formation of DSBs than condensed enous CHD4 protein compared with normal CD341 progenitor cells chromatin.52,53 In addition, our results show that the DNA of CHD4- (Figure 3C). It remains uncertain whether the diminished levels of depleted cells were more exposed to intercalation by DNR (supple- CHD4proteininAMLcellsreflect the normal differentiation of myeloid mental Figure 5), consistent with the greater capacity of anthracyclines to lineage cells or are associated in a yet-to-be determined way with the bind nucleosome-free DNA.54 CHD4-depleted AML cells also failed tumorigeneic capacity of AML. In any case, these findings argue that From www.bloodjournal.org by guest on November 20, 2015. For personal use only.

1470 SPERLAZZA et al BLOOD, 17 SEPTEMBER 2015 x VOLUME 126, NUMBER 12

Figure 7. Model of CHD4 enhancement of genotoxic agent-induced apoptosis through DSB repair inhibition and chromatin relaxation. In AML blasts, depletion of CHD4 relaxes the chromatin, resulting in the activation of ATM through Tip60 and thereby primes the cells for apoptotic signaling. Moreover, the relaxed chromatin is more susceptible to genotoxic agent-induced DSBs. Additionally, CHD4-deficient blasts have impaired DSB repair, resulting in the accumulation of more DSBs and further activation of ATM through the classical Mre11, Rad50, NBs1 (MRN) complex. The net activation of ATM in CHD4-depleted cells increases its downstream proapoptotic signaling cascade, thereby resulting in apoptotic cell death.

a threshold level of CHD4 may be required for efficient DSB repair, implications for disease outcomes in light of the role of tumor- implying that leukemia cells containing less endogenous CHD4 may be forming behavior in disease relapse.41,61-68 more vulnerable to CHD4 inhibition than their normal counterparts. In a clinically relevant mouse model of induction therapy, NSG mice engrafted with CHD4-depleted U937 cells displayed increased drug sensitivity and survival (Figure 4). An unexpected and important Acknowledgments finding was that depletion of CHD4 significantly reduced the tumor fl burden of the xenografts, which resulted in an additional treatment- The authors thank Julie Farnsworth for assistance with ow cytometry independent increase in survival. We also observed that depletion of experiments, Dr Richard Moran, Dr Kristoffer Valerie, and Mary Jeannette Sperlazza for helpful discussions and manuscript critiques, CHD4 sharply reduces the growth of AML colonies in soft agar, but not the growth of normal donor CD341 hematopoietic progenitor colonies. and Amy Jones for assistance in manuscript preparation. This suggests that a minimal level of CHD4 is necessary for the This work was supported by the National Institutes of Health, maintenance of tumor-forming behavior of leukemic cells, consistent National Cancer Institute (NIH-NCI) R01 CA 67708 (S.G.) and with evidence that CHD4 and its associated NuRD complex regulate Leukemia & Lymphoma Society of America grant 6472-15 (S.G.), genes implicated in the tumor-initiating state of glioblastoma.55 NIH National Institute of Diabetes and Digestive and Kidney The role of CHD4 in AML appears to be quite complex, as it exhibits Diseases R01 DK 29902 (G.D.G.), Virginia Commonwealth Uni- a prooncogenic function through its role in tumor formation, but con- versity (VCU) Massey Cancer Center Support grant from the NCI currently displays a tumor suppressor function in its facilitation of DSB 5P30 CA016059, and VCU Center for Clinical and Translational repair. We attribute this apparent discrepancy to the diverse roles that Research grant NIH ULITR000058. Services and products in support of the research project were generated by the VCU Massey Cancer CHD4 fulfills within a cell, including regulating gene expression and facilitating DNA repair. This exhibition of both prooncogenic and tumor Center Flow Cytometry, Biostatistics, and Tissue and Data Acqui- suppressor properties is shared with other chromatin modifiers such as sition and Analysis Core Shared Resources, supported, in part, with HDAC156 and EZH257,58 and may reflect a general property of epige- funding from the NIH-NCI Cancer Center Support grant P30 netic regulators. Regardless, the data presented here suggest that CHD4 CA016059. Microscopy was performed at the VCU Department of represents a plausible, new therapeutic target in AML. As combina- Anatomy and Neurobiology Microscopy Facility and supported, in tions of anthracyclines and ara-C form the foundation of both AML part, by funding from the NIH National Institute of Neurological induction and salvage therapy, inhibiting CHD4 might enhance the Disorders and Stroke Center Core grant 5 P30 NS047463 and, in part, efficacy of current regimens without increasing the required doses of from the NIH-NCI Cancer Center Support grant P30 CA016059. these agents. This would be of particular interest for anthracycline-based regimens, as the maximum lifetime dose of anthracyclines is severely limited by a cumulative, dose-dependent cardiotoxicity,59 although Authorship study of CHD4 inhibition in cardiac tissue is needed to corroborate this. Furthermore, the chromatin-relaxation effect of CHD4 inhibition Contribution: J.S., M.R., and G.D.G. designed and planned experi- may have additional implications for anthracycline-based therapy, as ments; J.S., J.B., M.A., E.H., S.Z.W., S.Z.Z., S.P., and C.D. anthracyclines have been found to displace nucleosomes from tran- performed experiments; J.S., M.R., K.A., S.G., and G.D.G. analyzed scription start sites of genes located in regions of relaxed chromatin data; and J.S. and G.D.G. wrote the manuscript. which deregulates the transcriptome and drives apoptosis in AML Conflict-of-interest disclosure: The authors declare no competing cells.60 Thus, inhibition of CHD4 may also potentiate DNA damage- financial interests. independent mechanisms of anthracycline-mediated antileukemic activ- Correspondence: Gordon D. Ginder, Massey Cancer Center, ities. Finally, given the role of CHD4 in maintaining the tumor-forming VirginiaCommonwealthUniversity, 401 College St, Room GRL-135, behavior of AML cells, CHD4 inhibition could have broader Richmond, VA 23298; e-mail: [email protected]. From www.bloodjournal.org by guest on November 20, 2015. For personal use only.

BLOOD, 17 SEPTEMBER 2015 x VOLUME 126, NUMBER 12 CHD4 DEPLETION IN AML CELLS 1471

References

1. Byrd JC, MrózekK, Dodge RK, et al; Cancer and 17. Xue Y, Wong J, Moreno GT, Young MK, CôtéJ, program for the comet assay. Mutat Res. 2003; Leukemia Group B (CALGB 8461). Pretreatment Wang W. NURD, a novel complex with both ATP- 534(1-2):15-20. cytogenetic abnormalities are predictive of dependent chromatin-remodeling and histone 33. Zuber J, Radtke I, Pardee TS, et al. Mouse induction success, cumulative incidence of deacetylase activities. Mol Cell. 1998;2(6): models of human AML accurately predict relapse, and overall survival in adult patients with 851-861. chemotherapy response. Genes Dev. 2009;23(7): de novo acute myeloid leukemia: results from 18. Zhang Y, LeRoy G, Seelig HP, Lane WS, 877-889. Cancer and Leukemia Group B (CALGB 8461). Reinberg D. The dermatomyositis-specific 34. Wunderlich M, Mizukawa B, Chou F-S, et al. AML Blood. 2002;100(13):4325-4336. autoantigen Mi2 is a component of a complex cells are differentially sensitive to chemotherapy 1 containing histone deacetylase and nucleosome 2. Tefferi A, Letendre L. Going beyond 7 3 treatment in a human xenograft model. Blood. remodeling activities. Cell. 1998;95(2):279-289. regimens in the treatment of adult acute myeloid 2013;121(12):e90-e97. leukemia. J Clin Oncol. 2012;30(20):2425-2428. 19. Cai Y, Geutjes E-J, de Lint K, et al. The NuRD 35. Irizarry RA, Bolstad BM, Collin F, Cope LM, complex cooperates with DNMTs to maintain 3. LöwenbergB, Ossenkoppele GJ, van Putten W, Hobbs B, Speed TP. Summaries of Affymetrix silencing of key colorectal tumor suppressor et al; Dutch-Belgian Cooperative Trial Group for GeneChip probe level data. Nucleic Acids Res. genes. Oncogene. 2014;33(17):2157-2168. Hemato-Oncology (HOVON); German AML Study 2003;31(4):e15. Group (AMLSG); Swiss Group for Clinical Cancer 20. Lai AY, Wade PA. Cancer biology and NuRD: 36. Smyth GK. Linear models and empirical bayes Research (SAKK) Collaborative Group. High-dose a multifaceted chromatin remodelling complex. methods for assessing differential expression in daunorubicin in older patients with acute myeloid Nat Rev Cancer. 2011;11(8):588-596. leukemia [published correction appears in N Engl microarray experiments. Stat Appl Genet Mol Biol. J Med. 2010;362(12):1155]. N Engl J Med. 2009; 21. Mian OY, Wang SZ, Zhu SZ, et al. Methyl-binding 2004;3:Article 3. domain protein 2-dependent proliferation and 361(13):1235-1248. 37. Gentleman RC, Carey VJ, Bates DM, et al. survival of breast cancer cells. Mol Cancer Res. Bioconductor: open software development for 4. Fernandez HF, Sun Z, Yao X, et al. Anthracycline 2011;9(8):1152-1162. dose intensification in acute myeloid leukemia. computational biology and bioinformatics. 22. Polo SE, Kaidi A, Baskcomb L, Galanty Y, N Engl J Med. 2009;361(13):1249-1259. Genome Biol. 2004;5(10):R80. Jackson SP. Regulation of DNA-damage 38. R Core Team. R: a language and environment 5. Herzig RH, Lazarus HM, Wolff SN, Phillips GL, responses and cell-cycle progression by the for statistical computing. Vienna, Austria: Herzig GP. High-dose cytosine arabinoside chromatin remodelling factor CHD4. EMBO J. R Foundation for Statistical Computing; 2015. therapy with and without anthracycline 2010;29(18):3130-3139. antibiotics xfor remission reinduction of acute 39. Benjamini Y, Hochberg Y. Controlling the false 23. Larsen DH, Poinsignon C, Gudjonsson T, et al. nonlymphoblastic leukemia. J Clin Oncol. 1985; discovery rate: a practical and powerful approach The chromatin-remodeling factor CHD4 3(7):992-997. to multiple testing. J R Stat Soc B. 1995;57(1): coordinates signaling and repair after DNA 289-300. 6. Reese ND, Schiller GJ. High-dose cytarabine damage. J Cell Biol. 2010;190(5):731-740. (HD araC) in the treatment of leukemias: a review. 40. Than Htun M. Photophysical study on 24. Luijsterburg MS, Acs K, Ackermann L, et al. A Curr Hematol Malig Rep. 2013;8(2):141-148. daunorubicin by fluorescence spectroscopy. new non-catalytic role for ubiquitin ligase RNF8 in J Lumin. 2009;129(4):344-348. 7. Minotti G, Menna P, Salvatorelli E, Cairo G, unfolding higher-order chromatin structure. EMBO Gianni L. Anthracyclines: molecular advances and J. 2012;31(11):2511-2527. 41. Dick JE. Stem cell concepts renew cancer pharmacologic developments in antitumor activity 25. Rahmani M, Aust MM, Attkisson E, Williams DC research. Blood. 2008;112(13):4793-4807. and cardiotoxicity. Pharmacol Rev. 2004;56(2): Jr, Ferreira-Gonzalez A, Grant S. Dual inhibition 42. Pan X-N, Chen J-J, Wang L-X, et al. Inhibition of 185-229. of Bcl-2 and Bcl-xL strikingly enhances PI3K c-Myc overcomes cytotoxic drug resistance in 8. Xie C, Edwards H, Xu X, et al. Mechanisms of inhibition-induced apoptosis in human myeloid acute myeloid leukemia cells by promoting synergistic antileukemic interactions between leukemia cells through a GSK3- and Bim- differentiation. PLoS One. 2014;9(8):e105381. dependent mechanism. Cancer Res. 2013;73(4): valproic acid and cytarabine in pediatric acute 43. Kajiume T, Ninomiya Y, Ishihara H, Kanno R, 1340-1351. myeloid leukemia. Clin Cancer Res. 2010;16(22): Kanno M. Polycomb group gene mel-18 5499-5510. 26. Amaya M, Desai M, Gnanapragasam MN, et al. modulates the self-renewal activity and cell cycle 9. Galmarini CM, Mackey JR, Dumontet C. Mi2b-mediated silencing of the fetal g-globin gene status of hematopoietic stem cells. Exp Hematol. Nucleoside analogues: mechanisms of drug in adult erythroid cells. Blood. 2013;121(17): 2004;32(6):571-578. 3493-3501. resistance and reversal strategies. Leukemia. 44. Guo W-J, Zeng M-S, Yadav A, et al. Mel-18 acts 2001;15(6):875-890. 27. Li Y, Tsun A, Gao Z, et al. 60-kDa Tat-interactive as a tumor suppressor by repressing Bmi-1 10. Jekimovs C, Bolderson E, Suraweera A, Adams protein (TIP60) positively regulates Th-inducing expression and down-regulating Akt activity in POK (ThPOK)-mediated repression of breast cancer cells. Cancer Res. 2007;67(11): M, O’Byrne KJ, Richard DJ. Chemotherapeutic 1 compounds targeting the DNA double-strand eomesodermin in human CD4 T cells. J Biol 5083-5089. Chem. 2013;288(22):15537-15546. break repair pathways: the good, the bad, and the 45. Derheimer FA, Kastan MB. Multiple roles of ATM promising. Front Oncol. 2014;4:86. 28. Rahmani M, Dai Y, Grant S. The histone in monitoring and maintaining DNA integrity. 11. Stanley FKT, Moore S, Goodarzi AA. CHD deacetylase inhibitor sodium butyrate interacts FEBS Lett. 2010;584(17):3675-3681. synergistically with phorbol myristate acetate chromatin remodelling enzymes and the DNA 46. Kaidi A, Jackson SP. KAT5 tyrosine (PMA) to induce mitochondrial damage and damage response. Mutat Res. 2013;750(1-2): phosphorylation couples chromatin sensing to apoptosis in human myeloid leukemia cells 31-44. ATM signalling. Nature. 2013;498(7452):70-74. through a tumor necrosis factor-alpha-mediated 12. O’Shaughnessy A, Hendrich B. CHD4 in the DNA- process. Exp Cell Res. 2002;277(1):31-47. 47. Shiloh Y, Ziv Y. The ATM protein kinase: damage response and cell cycle progression: not regulating the cellular response to genotoxic 29. Rahmani M, Davis EM, Bauer C, Dent P, Grant S. so NuRDy now. Biochem Soc Trans. 2013;41(3): stress, and more. Nat Rev Mol Cell Biol. 2013; Apoptosis induced by the kinase inhibitor BAY 777-782. 14(4):197-210. 43-9006 in human leukemia cells involves 13. Murga M, Jaco I, Fan Y, et al. Global chromatin down-regulation of Mcl-1 through inhibition of 48. Biswas AK, Johnson DG. Transcriptional and compaction limits the strength of the DNA translation. J Biol Chem. 2005;280(42): nontranscriptional functions of E2F1 in response damage response. J Cell Biol. 2007;178(7): 35217-35227. to DNA damage. Cancer Res. 2012;72(1):13-17. 1101-1108. 30. Golding SE, Rosenberg E, Neill S, Dent P, Povirk 49. Sims JK, Wade PA. Mi-2/NuRD complex function 14. Price BD, D’Andrea AD. Chromatin remodeling at LF, Valerie K. Extracellular signal-related kinase is required for normal S phase progression and DNA double-strand breaks. Cell. 2013;152(6): positively regulates ataxia telangiectasia mutated, assembly of pericentric heterochromatin. Mol Biol 1344-1354. homologous recombination repair, and the DNA Cell. 2011;22(17):3094-3102. 15. Tong JK, Hassig CA, Schnitzler GR, Kingston RE, damage response. Cancer Res. 2007;67(3): 50. Pegoraro G, Kubben N, Wickert U, GöhlerH, Schreiber SL. Chromatin deacetylation by an 1046-1053. Hoffmann K, Misteli T. Ageing-related chromatin ATP-dependent nucleosome remodelling 31. Menon VR, Peterson EJ, Valerie K, Farrell NP, defects through loss of the NURD complex. Nat complex. Nature. 1998;395(6705):917-921. Povirk LF. Ligand modulation of a dinuclear Cell Biol. 2009;11(10):1261-1267. 16. Wade PA, Jones PL, Vermaak D, Wolffe AP. platinum compound leads to mechanistic 51. Smeenk G, Wiegant WW, Vrolijk H, Solari AP, A multiple subunit Mi-2 histone deacetylase from differences in cell cycle progression and arrest. Pastink A, van Attikum H. The NuRD chromatin- Xenopus laevis cofractionates with an associated Biochem Pharmacol. 2013;86(12):1708-1720. remodeling complex regulates signaling and Snf2 superfamily ATPase. Curr Biol. 1998;8(14): 32. KońcaK, Lankoff A, Banasik A, et al. A cross- repair of DNA damage. J Cell Biol. 2010;190(5): 843-846. platform public domain PC image-analysis 741-749. From www.bloodjournal.org by guest on November 20, 2015. For personal use only.

1472 SPERLAZZA et al BLOOD, 17 SEPTEMBER 2015 x VOLUME 126, NUMBER 12

52. Falk M, Lukasova E, Gabrielova B, Ondrej V, 58. Karanikolas BD, Figueiredo ML, Wu L. Polycomb 64. Borghesi L. Hematopoiesis in steady-state versus Kozubek S. Chromatin dynamics during DSB group protein enhancer of zeste 2 is an oncogene stress: self-renewal, lineage fate choice, and the repair. Biochim Biophys Acta. 2007;1773(10): that promotes the neoplastic transformation of conversion of danger signals into cytokine signals 1534-1545. a benign prostatic epithelial cell line. Mol Cancer in hematopoietic stem cells. J Immunol. 2014; 53. Nackerdien Z, Michie J, B¨ohmL. Chromatin Res. 2009;7(9):1456-1465. 193(5):2053-2058. decondensed by acetylation shows an elevated 59. Volkova M, Russell R III. Anthracycline 65. Steidl U, Steidl C, Ebralidze A, et al. A distal single radiation response. Radiat Res. 1989;117(2): cardiotoxicity: prevalence, pathogenesis and nucleotide polymorphism alters long-range 234-244. treatment. Curr Cardiol Rev. 2011;7(4):214-220. regulation of the PU.1 gene in acute myeloid 54. Fritzsche H, W¨ahnertU, Chaires JB, Dattagupta 60. Pang B, Qiao X, Janssen L, et al. Drug-induced leukemia. J Clin Invest. 2007;117(9):2611-2620. N, Schlessinger FB, Crothers DM. Anthracycline histone eviction from open chromatin contributes antibiotics. Interaction with DNA and to the chemotherapeutic effects of doxorubicin. 66. Weidenaar AC, ter Elst A, Koopmans-Klein G, nucleosomes and inhibition of DNA synthesis. Nat Commun. 2013;4:1908. et al. High acute myeloid leukemia derived Biochemistry. 1987;26(7):1996-2000. VEGFA levels are associated with a specific 61. Er T-K, Tsai S-M, Wu S-H, et al. Antioxidant vascular morphology in the leukemic bone 55. Chudnovsky Y, Kim D, Zheng S, et al. ZFHX4 status and superoxide anion radical generation in marrow. Cell Oncol (Dordr). 2011;34(4): interacts with the NuRD core member CHD4 and acute myeloid leukemia. Clin Biochem. 2007; 289-296. regulates the glioblastoma tumor-initiating cell 40(13-14):1015-1019. state. Cell Reports. 2014;6(2):313-324. 62. Cook AM, Li L, Ho Y, et al. Role of altered 67. Dawson MJ, Trapani JA. IFI 16 gene encodes 56. Santoro F, Botrugno OA, Dal Zuffo R, et al. A dual growth factor receptor-mediated JAK2 signaling in a nuclear protein whose expression is induced by role for Hdac1: oncosuppressor in tumorigenesis, growth and maintenance of human acute myeloid interferons in human myeloid leukaemia cell lines. oncogene in tumor maintenance. Blood. 2013; leukemia stem cells. Blood. 2014;123(18): J Cell Biochem. 1995;57(1):39-51. 121(17):3459-3468. 2826-2837. 68. Siva K, Jaako P, Miharada K, et al. SPARC is 57. Simon C, Chagraoui J, Krosl J, et al. A key role for 63. Laranjeira P, Rodrigues R, Carvalheiro T, et al. dispensable for murine hematopoiesis, despite EZH2 and associated genes in mouse and human Expression of CD44 and CD35 during normal and its suspected pathophysiological role in adult T-cell acute leukemia. Genes Dev. 2012; myelodysplastic erythropoiesis. Leuk Res. 2015; 5q-myelodysplastic syndrome. Leukemia. 2012; 26(7):651-656. 39(3):361-370. 26(11):2416-2419. From www.bloodjournal.org by guest on November 20, 2015. For personal use only.

2015 126: 1462-1472 doi:10.1182/blood-2015-03-631606 originally published online August 11, 2015

Depletion of the chromatin remodeler CHD4 sensitizes AML blasts to genotoxic agents and reduces tumor formation

Justin Sperlazza, Mohamed Rahmani, Jason Beckta, Mandy Aust, Elisa Hawkins, Shou Zhen Wang, Sheng Zu Zhu, Shreya Podder, Catherine Dumur, Kellie Archer, Steven Grant and Gordon D. Ginder

Updated information and services can be found at: http://www.bloodjournal.org/content/126/12/1462.full.html Articles on similar topics can be found in the following Blood collections Myeloid Neoplasia (1422 articles)

Information about reproducing this article in parts or in its entirety may be found online at: http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests

Information about ordering reprints may be found online at: http://www.bloodjournal.org/site/misc/rights.xhtml#reprints

Information about subscriptions and ASH membership may be found online at: http://www.bloodjournal.org/site/subscriptions/index.xhtml

Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036. Copyright 2011 by The American Society of Hematology; all rights reserved.