Developmental deltamethrin: Effects on cognition, neurotransmitter systems,
inflammatory cytokines and cell death
A dissertation submitted to the Graduate School of the University of Cincinnati In partial fulfillment of the requirements for the degree of
Doctor of Philosophy
In the Neuroscience Graduate Program of the College of Medicine By
Emily Pitzer B.S. Westminster College April 2020
Dissertation Committee: Steve Danzer, Ph.D. Mary Beth Genter, Ph.D. Gary Gudelsky, Ph.D. Kimberly Yolton, Ph.D. Charles Vorhees, Ph.D. (Advisor) Michael Williams, Ph.D. (Chair) ABSTRACT
Deltamethrin (DLM) is a Type II pyrethroid pesticide and is more widely used with the elimination of organophosphate pesticides. Epidemiological studies have linked elevated levels of pyrethroid metabolites in urine during development with neurological disorders, raising concern for the safety of children exposed to these agents. Few animal studies have explored the effects or mechanisms of DLM-induced deficits in behavior and cognition after developmental exposure. The aim of the present work is to examine the long-term effects of developmental (postnatal day (P) 3-20) DLM exposure in Sprague-Dawley rats on behavior, cognition, and cellular outcomes. First, the developmental effects of early DLM exposure on allocentric and egocentric learning and memory, locomotor activity, startle, conditioned freezing, and anxiety-like behaviors were assessed. The developmental effects of DLM on long-term potentiation (LTP) at
P25-35, on adult dopamine (DA) release, monoamine levels, and mRNA levels of receptors/transporters/channels were then determined. In follow-up experiments, adult
LTP, hippocampal glutamate release, terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining for cell death, as well as DA and glutamate receptors, proinflammatory cytokines, and caspase-3 for protein expression were assessed. The results show that developmental DLM causes long-lasting impairments in behavior and cognition, reduced hippocampal norepinephrine, reduced DA-stimulated release in the nucleus (n.) accumbens, reduced DA D1 receptor (DRD1) mRNA in neostriatum, but no changes in biomarkers of DA synaptic function. Increased LTP at P25-35 in DLM- treated males and females was observed and persisted into adulthood in DLM-treated males, but not females. N-Methyl-D-aspartate (NMDA) receptor subunits -NR2A were
ii increased and -NR2B decreased in the hippocampus of male DLM-treated rats with no change in hippocampal potassium-stimulated glutamate release. Developmental DLM resulted in a trend for reduced IL-1β primarily in the neostriatum and n. accumbens, and caspase-independent cell death in the hippocampus and striatum (neostriatum and n. accumbens), including increased TUNEL staining for apoptotic cells in the dentate gyrus. While the mechanism of the neurodevelopmental effects of DLM remains unknown, these data add new information about the effects of this prototypical pyrethroid on the developing brain and behavior. These experiments are an important step toward a better understanding of the potential risks to children from pyrethroid exposure.
iii ACKNOWLEDGEMENTS
I want to thank my advisor Dr. Charles Vorhees and my committee chair Dr.
Michael Williams. Without them I would not have been able to complete this process.
They provided me continual patience, mentorship and support through my entire graduate career. In addition, I want to thank my dissertation committee for their guidance and help throughout this project. I want to also thank my lab mates, who have been a continual source of laughs, encouragement, and feedback during this journey we call graduate school. I need to thank my mother and father who have continually supported me through every turn my life has taken; for the long-winded phone calls about graduate school, life in the lab, and everything in between. I also want to give a special thank you to my husband, who has shared this experience with me, overlooked the crazy work schedule, and was always honest when my writing could be better. His unwavering support and love through this challenging time has been a rock to which I could hold onto. And lastly, I need to say a little thank you to my two unofficial emotional support cats, Abner and Frankie, who have always provided me such joy after a long day’s work. Thank you, to everyone who made this possible.
iv TABLE OF CONTENTS
ABSTRACT...... ii
ACKNOWLEDGEMENTS ...... iv
TABLE OF CONTENTS ...... 1
LIST OF TABLES AND FIGURES ...... 4
LIST OF SYMBOLS ...... 6
CHAPTER 1: The Type II Pyrethroid, Deltamethrin: Use, Mechanisms and Unintended
Consequences……...... 11
Introduction ...... 12
Impact of pyrethroids in humans ...... 12
Epidemiological data ………………………………...... 13
Pesticidal Actions …………………………………………………...... 19
Voltage-gated Sodium Channels ………………………………………...... 21
Voltage-gated Calcium Channels ……………..………………………...... 24
Additional targets ………………...………………………………...... 26
Effects on neurotransmitters ………….…...……...... 29
DLM Kinetics and Metabolism ………………………………...... 33
DLM TK studies and development of PBPKs …………………...... 34
DLM Metabolism …………………………...... 38
Mechanisms of DLM induced neurotoxicity ……...... 41
Effects of pyrethroids on behavior and cognition .…………………...... 45
Developmental DLM effects on behavior and cognition ……...……...... 45
1 Conclusions ...... 49
References ...... 51
Figures and Legends ...... 74
CHAPTER 2: Deltamethrin exposure daily from postnatal day 3–20 in Sprague-Dawley rats causes long-term cognitive and behavioral deficits ...... 79
Abstract ...... 80
Introduction ...... 81
Materials and Methods ...... 83
Results ...... 93
Discussion ...... 98
Acknowledgement ………………………………………………………………………..... 105
References ...... 106
Figures and Legends ...... 116
CHAPTER 3: Developmental Deltamethrin increases apoptosis in the dentate gyrus and reduces hippocampal NMDA receptor expression without affecting hippocampal glutamate release in Sprague-Dawley rats ……………….………………...... 131
Abstract ...... 132
Introduction ...... 134
Materials and Methods ...... 138
Results ...... 147
Discussion ...... 149
References ...... 157
Figures and Legends ...... 174
2 CHAPTER 4: General Discussion ...... 187
Developmental DLM-induced behavioral and cognitive deficits ………………………. 188
Effects of DLM on monoamines ………………………………………………………….. 197
Role of glutamatergic systems and LTP in DLM induced cognitive deficits …………. 199
Developmental effects of DLM on inflammatory cytokines and cell death …………... 204
Developmental DLM-induced sex specific effects …………………………………….... 206
Conclusions ...... 207
Future directions ...... 208
References ...... 210
3 LIST OF FIGURES
CHAPTER 1
Figure 1. Chemical structure of the Type II pyrethroid, DLM ...... 74
Figure 2. VGSC subunit structure …………….……………...... 75
Table 1. Experimental outcomes: Chapter 2 and Chapter 3 ……………………………. 76
CHAPTER 2
Figure 1. Body weight ……………………………………………………………………… 116
Figure 2. Open-field (OF) locomotor activity and elevated zero maze (EZM) ……….. 118
Figure 3. Morris water maze (MWM) …………...…………………………………………119
Figure 4. Cincinnati water maze (CWM) ………………………………………………… 120
Figure 5. Acoustic and tactile startle response (ASR/TSR) …………………………… 122
Figure 6. Conditioned freezing ……………………………………………………………. 123
Figure 7. Drug challenges …………………………………………………………………. 124
Figure 8. mRNA expression, monoamines, LTP and microdialysis ………………...... 126
Table 1: Sample size of each sex for each treatment group ……………………………128
Table 2: Primer sequence of each analyzed gene for RT-PCR ………………………. 129
CHAPTER 3
Figure 1. Adult CA1 hippocampal LTP …………………………………………………... 174
Figure 2. Dopamine receptor and transporter western blots ………………………….. 176
Figure 3. AMPA receptor subunit western blots ………………………………………… 177
Figure 4. NMDA receptor subunit western blots ………………………………………... 179
Figure 5. Extracellular glutamate release ……………………………………………….. 181
4 Figure 6. Po-caspase-3 western blots …………………………………………………… 182
Figure 7. Cleaved caspase-3 western blots …………………………………………….. 183
Figure 8. TUNEL stained sections for apoptosis ……………………………………….. 184
Figure 9. Cytokine analysis ……………………………………………………………….. 186
5 LIST OF SYMBOLS
3-PBA 3-phenoxybenzoic acid 4-F-3-PBA 4-fluoro-3- phenoxybenzoic acid 5-HIAA 5-hydroxyindoleacetic acid 5-HT Serotonin 6-OHDA 6-hydroxydopamine ADHD Attention deficit hyperactivity disorder ADME Absorption, distribution, metabolism and excretion AMPA α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid AMPH Amphetamine Arc Activity-regulated cytoskeleton-associated protein ASD Autism spectrum disorder ASR Acoustic startle response AUC Area under the curve Bax Bcl-2-associated X protein BBB Blood brain barrier Bcl-2 B-cell lymphoma 2 BiP/GRP78 Binding immunoglobulin protein/ 78-kDa glucose-regulated protein BrdU 5-bromo-2-deoxyuridine CaE Carboxylesterases CaMKII Calcium/calmodulin-dependent protein kinase II cAMP Cyclic adenosine monophosphate
Cav2.2 N-type calcium channels CHARGE Childhood Autism Risks from Genetics and Environment CHMS Canadian Health Measures Survey CHOP/GADD153 C/EBP homologous protein/growth arrest and DNA damage 153 cis-DBCA cis-3-(2,2-dibromovinyl)-2,2-dimethylcyclopropane carboxylic acid
6 Cmax Maximum concentrations CNS Central nervous system CO Corn oil CREB Cyclic AMP response element–binding protein CS Choreoathetosis/salivation CWM Cincinnati water maze CYP450 Cytochrome P450 DA Dopamine DAG Diacylglycerol DAT Dopamine transporter DCCA 3-(2,2-dichlorovinyl)-2,2-dimethylycyclopropane carboxylic acid DHP Dihydropicrotoxinin DISC Diagnostic Interview Schedule for Children DLM Deltamethrin DOPAC 3,4-dihydroxyphenylacetic acid DRD1 Dopamine D1 receptor DRD2 Dopamine D2 receptor DST Development Screen Test E Embryonic day ECD Electrochemical detector eIF2α Eukaryotic translation initiating factor 2 subunit 1 EPA Environmental Protection Agency EPSPs Excitatory postsynaptic potentials ER Endoplasmic reticulum EZM Elevated zero maze fEPSPs Field excitatory postsynaptic potentials Fmr2 Family member 2 FR Fixed ratio
7 FQPA Food Quality Protection Act GABA γ-aminobutyric acid GST Glutathione-S-transferase HPLC High performance liquid chromatography HVA Homovanillic acid IFN-γ Interferon gamma IL-1α Interleukin 1 alpha IL-1β Interleukin 1 beta IL-4 Interleukin 4 IL-5 Interleukin 5 IL-6 Interleukin 6 IL-10 Interleukin 10 IL-13 Interleukin 13 IP3 Inositol triphosphate ITI inter-trial interval IVIVE In vitro to in vivo extrapolation KC/GRO Keratinocyte chemoattractant/ human growth-regulated oncogene LPO Lipid peroxidation LTD Long-term depression LTP Long-term potentiation LS Least square MPTP 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine MSD Meso Scale Discovery MWM Morris water maze NADPH Nicotinamide adenine dinucleotide phosphate NDMA N-methyl-D-aspartate NE Norepinephrine NHANES National Health and Nutrition Examination Survey
8 Nrf2 Nuclear factor erythroid 2-related factor 2 OF Open-field P Postnatal day p53 Tumor protein p53 PBPK Physiologically-based pharmacokinetics PCA Perchloric acid Pde4d-/- Phosphodiesterase 4D knockout PERK Protein kinase R-like ER kinase PKA Protein kinase A PKC Protein kinase C PKR Protein kinase R PLC Phospholipase C PNS Peripheral nervous system PPI Pre-pulse inhibition PSD-95 Post synaptic density protein QNB Quinuclidinyl benzilate R Receptor RM Repeated measure ROS Reactive oxygen species RT Reverse transcription S Segments (S1-S6) SDQ Strengths and Difficulties Questionnaire SS Short segment T Tremor TBPS t-butylbicyclophosphorothionate TK Toxicokinetic TNF-α Tumor necrosis factor alpha TSR Tactile startle response
9 TTX Tetrodotoxin TUNEL Terminal deoxynucleotidyl transferase dUTP nick end labeling VGCC Voltage gated calcium channels VGCLC Voltage-gated chloride channels VGSC Voltage-gated sodium channel
Vmax Maximum startle amplitude in mV
10 CHAPTER 1
The Type II Pyrethroid, Deltamethrin: Use, Mechanisms and Unintended
Consequences
11 Introduction
Deltamethrin (DLM) is a Type II pyrethroid pesticide used worldwide for agricultural, medical, and homeowner applications. Increased human exposure to pyrethroids during development is associated with increased likelihood of neurological disorders such as attention deficit hyperactivity disorder (ADHD), autism spectrum disorder (ASD), or developmental delay (Oulhote and Bouchard, 2013; Xue et al., 2013;
Shelton et al., 2014; Richardson et al., 2015; Wagner-Schuman et al., 2015). A few studies have explored the effects of developmental DLM exposure in animals (Aziz et al., 2001; Johri et al., 2006; Hossain et al., 2015; Richardson et al., 2015). However, these studies are limited, especially in terms of assessing cognitive outcomes, and no clear mechanism has been established for long-term deficits on learning and memory after developmental exposure. This chapter reviews the mechanism of action, metabolism, and toxicity of DLM as a prototypical Type II pyrethroid. This chapter will also present the existing data on cognitive effects following developmental DLM exposure and potential neural systems that current data indicate are impacted in DLM- induced developmental neurotoxicity.
Impact of pyrethroids in humans
As noted, pyrethroids are used in agriculture, households, schools and parks and are applied directly on children for head lice and on pets for fleas and ticks. Insect sprays and termiticides often contain pyrethroids. Aside from these exposures, all
Americans are exposed to pyrethroids as food residues on fruits and vegetables. The use of pyrethroids for insects, including insects that are disease vectors, has been in
12 widespread practice for over 30 years. During the early 2000s the U.S. Environmental
Protection Agency (EPA) began phasing out organophosphate pesticides, due to their toxicity, and this resulted in increased use of pyrethroids (Oros and Werner, 2005;
Williams et al., 2008). Human pyrethroid exposure is documented and includes women who are pregnant and children (Schettgen et al., 2002; Whyatt et al., 2002; Berkowitz et al., 2003; Heudorf et al., 2004). However, an understanding of pyrethroid developmental toxicity and its long-term effects remains unclear. The Food Quality
Protection Act (FQPA) (FQPA, 1996) requires an additional 10x safety factor for risk settings to susceptible subpopulations, which include vulnerable groups such as fetuses and children. The 10x safety or uncertainty factor can be bypassed, however, if compelling scientific data demonstrate that the pesticide does not have greater toxicity to fetuses or children.
Epidemiological data: Although pesticides help control agricultural and disease- bearing pests, the risk to fetuses and children from these chemicals is not known.
Children have greater contact with their surroundings due to increased touching of surfaces and increased hand-to-mouth behavior. Children have immature blood brain barriers (BBBs), slower clearance because of less mature metabolizing enzymes, less body fat into which pyrethroids partition, leaving more in circulation, and less plasma protein binding, leaving more available compound for transport into the brain (Anand et al., 2006b; Chen et al., 2015; Amaraneni et al., 2017; Mortuza et al., 2018; Allegaert and van den Anker, 2019). Due to these factors, evidence suggests that children may be more vulnerable to the effects of pyrethroids than adults.
13 The effects of developmental pyrethroid exposure have been examined in people to a limited extent using neurodevelopmental and neuropsychological outcomes in relation to urinary metabolites of pyrethroids. Pyrethroid exposure is estimated based on excreted metabolites. A metabolite common to several pyrethroids is 3- phenoxybenzoic acid (3-PBA), and it is the most widely used biomarker of exposure.
However, there are metabolites more specific to individual pyrethroids. DLM exposure estimated from 3-PBA and/or cis-DBCA (cis-3-(2,2-dibromovinyl)-2,2- dimethylcyclopropane carboxylic acid), whereas 4-F-3-PBA (4-fluoro-3-phenoxybenzoic acid) is a metabolite of cyfluthrin and α-cypermethrin, which are other Type II pyrethroids (Chrustek et al., 2018). 3-PBA is also a metabolite of many Type I pyrethroids, as is cis- and trans-DCCA (3-(2,2-dichlorovinyl)-2,2-dimethylycyclopropane carboxylic acid) (Chrustek et al., 2018). Some of the earliest data are from analyses from the 1999-2002 National Health and Nutrition Examination Survey (NHANES).
These data are from parent reported diagnosis of ADHD and prescriptions for ADHD medication in conjunction with urinary levels of 3-PBA, a common metabolite of pyrethroids (Richardson et al., 2015). Richardson et al. (2015) used these data in a nested case-control study and found a modest but statistically significant association between levels of 3-PBA in urine and prevalence of ADHD diagnosis in the NHANES database. The NHANES data that Richardson et al. (2015) used were from 5489 children ages 6-15 years in which 9.2% had parent-reported ADHD (Braun et al., 2006;
Bouchard et al., 2010; Richardson et al., 2015). Of the 5489 children with ADHD, 3-
PBA levels were available for 2123, from which an odds ratio of 2.3 (1.4-3.9) was found
14 for ADHD diagnosis in those with higher 3-PBA levels, showing a pyrethroid-ADHD correlation without regard to sex (Richardson et al., 2015).
The data from the NHANES were used in several studies. Wagner-Schuman et al., (2015) also utilized NHANES data to examine the association between pyrethroid exposure and ADHD. Children (n= 687; ages 8-15; 2001-2002 NHANES) were assessed for urinary 3-PBA levels and ADHD, based on criteria of the Diagnostic
Interview Schedule for Children (DISC) defined by the Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition or by prior professional diagnosis (Wagner-Schuman et al., 2015). In addition, the DISC was used to assess ADHD symptoms (Wagner-
Schuman et al., 2015). It was determined that children that had 3-PBA levels above the detectable limit were twice as likely to have ADHD compared with children with 3-PBA levels below the limit of detection, with the odds for ADHD being significant in boys but not in girls (Wagner-Schuman et al., 2015). In addition, Wagner-Schuman et al. (2015) reported that every 10-fold increase in metabolite levels coincided with a 50% increase in hyperactivity and impulsivity, but there was no association with inattention. This study corroborates the association reported by Richardson et al. (2015).
The Childhood Autism Risks from Genetics and Environment (CHARGE) study is a population based case-control study aimed at identifying factors associated with ASD, including associations with environmental agents such as pyrethroids (Hertz-Picciotto et al., 2006). Starting in 2003, the CHARGE study used parental questionnaires about environmental exposures which included residential location. From the CHARGE study, an association of gestational residential proximity to pesticide application to ASD and/or developmental delay diagnoses was found (Shelton et al., 2014). California requires
15 public reporting of commercial and agricultural pesticide use, providing the data on what pesticides were used in each location. Participants in the CHARGE study were distributed throughout California, with the greatest concentrations in Sacramento Valley, followed by San Francisco and Los Angeles. A third of the participants lived within 1.5 km of agricultural pesticide application, with pyrethroids being the second most commonly used pesticide in these areas, and organophosphates being the most used.
Data were collected from children diagnosed with ASD (N=486; age 36.7 ± 9.7 months), typically developing children (N= 316; age 36.9 ± 8.9 months), and children diagnosed with developmental delay (N=168; age 38.3 ± 8.9 months) (Shelton et al., 2014).
Participants were matched based on age, sex, and catchment area (Shelton et al.,
2014). It is important to note that more children with ASD were recruited in the course of the study than typically developing or developmental delay children, and that the developmental delay group was not as well matched in size to typically developing children as were the ASD children (Shelton et al., 2014). Although the ASD and typically developing groups had similar sociodemographic profiles, the matching was less than optimal. Nevertheless, Shelton et al. found an association between preconception and third trimester (but not first or second trimester) pyrethroid exposure and increased prevalence of ASD, as well as an association between third trimester pyrethroid exposure and increased prevalence of developmental delay (Shelton et al., 2014).
Although pyrethroids are increasing in prevalence, organophosphates are still used, and were found to also be associated with an increased risk for ASD. Shelton et al. (2014) observed increased risk for ASD when exposure occurred during gestation; specifically for third-trimester exposure (odds ratio = 2.0; 95 % Cl: 1.1, 3.6) as well as with
16 chlorpyrifos exposure during the second trimester (odds ratio = 3.3; 95% Cl: 1.5, 7.4).
Although, this research indicates the importance of studying developmental pesticide effects on behavior and cognition, the study was limited in design. Despite their use of a case control design, Shelton et al., (2014) do not provide direct pyrethroid metabolite measurements and only examined pyrethroid application in relation to residence.
Regardless, Shelton et al., (2014) data are consistent with an association of pyrethroid exposure during development and neurological disorders as found in other epidemiological studies (Richardson et al., 2015; Wagner-Schuman et al., 2015).
The Canadian Health Measures Survey (CHMS; cycle 1 2007-2009) used multistage probability sampling and oversampled selected groups to generate a
Canadian study sample (Oulhote and Bouchard, 2013). Data were collected from 1,081 children ages 6-11 years. Spot urine samples were assessed for pyrethroid metabolites. In addition, caregivers completed surveys covering the children’s behavioral problems based on the parent version of the Strengths and Difficulties
Questionnaire (SDQ) (Goodman, 1997), as well as questionnaire assessment of domestic pesticide use. Oulhote and Bouchard (2013) assessed urinary levels of pesticide metabolites. The pyrethroid metabolites cis- and trans-DCCA were found to be associated with higher scores for total difficulties on the SDQ (Oulhote and
Bouchard, 2013). The Type I pyrethroid permethrin and the Type II pyrethroids cypermethrin, and cyfluthrin, but not DLM, are all metabolized to DCCA (Barr et al.,
2010). Oulhote and Bouchard (2013) did not find an association between urinary 3-PBA questionnaire data and the SDQ, although there was an interaction between 3-PBA levels and sex in association with child behavior. 3-PBA levels were associated with
17 conduct problems in girls, but not boys, but only when analyzed in an unweighted sensitivity analysis (not taking into account the survey design) (Oulhote and Bouchard,
2013). While this study implicates pyrethroids other than DLM in adverse neurodevelopmental outcomes, it does not rule out DLM from having neurodevelopmental effects since prenatal exposures were poorly documented, assessment of exposure was by a single urine sample, and the study had insufficient sample size. Additionally, metabolite levels for cis-DBCA and 4-F-3-PBA, metabolites of DLM and cyfluthrin, respectively, were below the limit of detection in >50% of children, and no estimated associations were made for these metabolites with neurodevelopmental outcomes (Oulhote and Bouchard, 2013). Unfortunately, it cannot be determined if the undetected levels are because these children have no exposure or if exposures were too low for the method used to measure metabolites. In effect, this study compared the children with undetected metabolites with those with detectable metabolites.
Another study conducted in Jiaozuo, Henan, China in 2010 examined the effects of pyrethroid exposure in pregnant women on infant growth and development (Xue et al., 2013). They enrolled 497 mother-infant pairs and collected antenatal urine (the time during gestation that samples were collected is not specified) from the mothers (Xue et al., 2013). At one year of age, infants were assessed for physical development (i.e., weight, height, head size) and on the Development Screen Test (DST) to determine neural and mental development (Xue et al., 2013). The DST assesses movement, social adaptation, inferred intelligence, and gives a mental development index and quotient. Levels of pyrethroid metabolites in urine of mothers were negatively
18 correlated to intellectual development of the infants (Xue et al., 2013). Other factors that could affect outcomes, such as mother’s age, education, place of residence (i.e., city or country), and disease status, also correlated with infant developmental quotients and pyrethroid exposure as seen with multiple linear regression (Xue et al., 2013), indicating that pyrethroids are only one factor that was associated with cognitive development.
The studies cited above have a range of strengths and weaknesses as noted in a recent review (Burns and Pastoor, 2018). None of the epidemiological studies are definitive because human studies have many co-occurring factors and at best establish correlation but not causation. However, the data from the human studies suggest some association between increased pyrethroid metabolite levels and neurological disorders from developmental exposure. Although several of the studies are cross-sectional and have measurements from a single collection time, limiting the power of such studies to establish connection, they indicate the importance of understanding the long-term effects of developmental pyrethroid exposure. This highlights the importance of animal research to determine cause-effect relationships that are rarely possible in human studies. These human studies and recent mouse developmental studies prompted the experiments described in the following chapters.
Pesticidal Actions
Pyrethroids are synthetic derivatives from the naturally occurring insecticide pyrethrin derived from the chrysanthemum plant (Chrysanthemum cinerariaefolium).
However, pyrethrins are unstable when exposed to light, thus their structure was
19 modified by chemists to produce potent and stable insecticides. Since pyrethroids are derived from a natural substance the safety of this class of pesticides is of less concern to many than for other types of pesticides. Pyrethroids are classified by symptomology, chemical structure and/or by ion channel binding. Structurally there are two classes of pyrethroids. Type I and Type II. Specifically, Type I pyrethroids do not have a cyano moiety at the alpha-position and Type II pyrethroids, such as DLM, do have a cyano moiety (Gammon et al., 1981; Scott and Matsumura, 1983; Soderlund and Bloomquist,
1989; Soderlund et al., 2002). Besides additional cyano moieties, pyrethroids are composed of an alcohol and acid moiety with a central ester bond (Figure 1). Most pyrethroids exist as stereoisomers due to the acid moiety containing two chiral carbons and the alcohol group containing one chiral carbon. Hence, there can be up to eight stereoisomers, making pyrethroids the highest chirality group of insecticides (Perez-
Fernandez et al., 2010). This is important because chirality affects toxicity (Chapman,
1983) and cis isomers are more toxic than the trans isomers. DLM is an exception to this pattern. It elicits neurotoxic effects (Rickard and Brodie, 1985) and lacks a trans isomer, only existing in a cis configuration (Elliott et al., 1974).
The acute effects of pyrethroids are well characterized, with several reviews on their short-term effects, metabolism, and toxicity (Narahashi, 1996; Soderlund et al.,
2002; Shafer and Meyer, 2004; Shafer et al., 2005; Kaneko, 2010; Soderlund, 2012).
Pyrethroids act on the nervous system of insects by inducing uncoordinated movements, convulsions, and paralysis (Soderlund and Bloomquist, 1989). In mammals, when classified by symptoms, at higher doses, Type II pyrethroids are characterized by inducing a choreoathetosis/salivation (CS) syndrome consisting of
20 choreoathetosis (writhing) and salivation and sometimes pawing, burrowing, tremors, and clonic seizures. This is in contrast to Type I pyrethroids such as permethrin, that induce a tremor (T) syndrome consisting of fine tremors that progress to coarse, whole body tremors, prostration, along with sensitivity to stimuli, and sparring (Soderlund and
Bloomquist, 1989; Shafer et al., 2005). There are also pyrethroids whose symptom profiles are intermediate between the CS and T syndromes, which are designated mixed or Type III pyrethroids (Verschoyle and Aldridge, 1980; Soderlund et al., 2002;
Shafer et al., 2005).
Voltage-gated Sodium Channels: Another way of characterizing pyrethroids is by the receptors they affect. The main site of action of pyrethroids is on the α-subunit voltage-gated sodium channels (VGSC) (Soderlund and Bloomquist, 1989; Narahashi,
2000; Wang and Wang, 2003; Davies et al., 2007; Du et al., 2009; Silver et al., 2014;
Field et al., 2017). VGSCs are composed of an α-subunit (220–260 kDa) combined with one or more β-subunits (30–40 kDa) (Isom et al., 1992; Isom et al., 1995; Cestele and
Catterall, 2000; Morgan et al., 2000; Aman et al., 2009; Patino and Isom, 2010; Zhang et al., 2013). The α-subunit consists of intracellular N- and C-terminal domains, 4- transmembrane domains containing six transmembrane segments (S1-S6) and a short segment (SS) that forms a re-entrant loop (SS1 and SS2) between segments S5 and
S6 that confers ion-selectivity (Figure 2) (Cestele and Catterall, 2000; Catterall et al.,
2007; King et al., 2008; Wang et al., 2011; Zhang et al., 2013). The S5 and S6 segments function as the structures of the central pore for ion transfer while the S1 – S4 segments make up the voltage sensor (Figure 2) (Wang et al., 2011; Zhang et al.,
2013). The β-subunits consist of β1–β4 and there are 4 domains; an extracellular N-
21 terminal signal peptide, an immunoglobulin domain, a transmembrane domain, and an intracellular C-terminal (Figure 2) (Patino and Isom, 2010). The β-subunits do not share homology with other voltage dependent channels, i.e., they are unlike calcium or potassium channels, rather they are homologous to neural cell adhesion molecules
(Catterall, 2000a). The β-subunits are involved in the kinetics and voltage dependence of sodium channel gating, as well as modulating cell adhesion and migration (Patino and Isom, 2010; Zhang et al., 2013).
DLM binds to α-subunit VGSCs and changes the conformation of the channel.
This change opens the central pore as membrane potential changes. After movement of the voltage sensor, the inactivation gate, an intracellular loop between domains 3 and
4 (Figure 2), can then plug the channel pore blocking further ion flow (Catterall, 2000a;
Zhang et al., 2013). Pyrethroids have two binding sites on VGSCs. They bind to an intramembrane site that has a long, narrow hydrophobic pocket for lipid-soluble compounds positioned between the domain 2 S4-S5 linker and the domain 1 S5/domain
3 S6 helices (site 1) as well as a similar sequential region between domain 1 S4 and the domain 2 S6 segments (site 2), on the α-subunit (Wang and Wang, 2003; Davies et al.,
2007; Du et al., 2013; Silver et al., 2014). Although the position of these binding sites on the VGSC are symmetrical, they are not identical. Studies in which mutations are made in the second binding site had less effect on the receptors than mutations to the first binding site (greater sensitivity to pyrethroid effects on VGSC compared with site two), implying the sequence of the two binding sites differ (Du et al., 2013), but this difference has not been studied further. The location of pyrethroid interaction with the
VGSC was demonstrated by site-directed mutagenesis and oocyte expression studies
22 (Du et al., 2009; Silver et al., 2014) and corroborated using computational models (Du et al., 2013).
When bound to VGSC, pyrethroids affect channel activation, slowing channel opening and closing (Narahashi, 1996; Soderlund, 2012). Pyrethroids cause VGSCs to shift to more depolarized states making them more easily activated resulting in more action potentials (Narahashi, 1996), thus the channels open after smaller changes in membrane potential. In addition, pyrethroids hold the channel open longer, allowing more sodium ions to enter the cell also leading to more action potentials. Type II pyrethroids delay inactivation of VGSCs longer than Type I pyrethroids, causing a depolarization block where no action potentials are generated (Shafer et al., 2005).
These effects cause death in insects and contribute to the neurotoxicity in mammals.
VGSCs subunits display a temporal and regional pattern of expression throughout brain development, in which embryonic VGSC subunits are replaced with adult versions in the α- and β-subunits. The α-subunits Nav1.1, 1.2, 1.3, and 1.6 are expressed throughout the central nervous system (CNS), as well as all β-subunits
(Navβ1-4). In rodents, expression of Nav1.3 is high during embryogenesis, decreases postnatally, and is replaced by Nav1.2 as Nav1.3 decreases (Felts et al., 1997; Albrieux et al., 2004). Nav1.2 is expressed in immature rat nodes of Ranvier of retinal ganglion cells (~P9-10) and is later replaced by Nav1.6 as the process of myelination develops
(~P14) (Boiko et al., 2001). In addition, the Navβ3-subunit is replaced by Navβ1- and
Navβ2-subunit after P3 in rats. Navβ1- and Navβ2 increase during brain development until reaching adult levels (Shah et al., 2001). Perturbations of VGSCs during development impair neuronal function as seen in human mutations and when using
23 drugs that affect the VGSCs in humans (Adams et al., 1990; Claes et al., 2001; Escayg et al., 2001; Meisler et al., 2001; Wallace et al., 2001; Noebels, 2002; Shafer et al.,
2005), as well as mutation, pharmacological and knockout models in rodents (Vorhees et al., 1995; Hatta et al., 1999; Ohmori et al., 1999; Schilling et al., 1999; Planells-Cases et al., 2000; Kearney et al., 2001; Meisler et al., 2001; Shafer et al., 2005).
Mice exposed to DLM throughout gestation and lactation show decreased VGSC mRNA expression as adults, which may contribute to long-term behavioral deficits
(Magby and Richardson, 2017). It is not clear whether changes in VGSC composition caused by developmental exposure to pyrethroids contribute to their long-term effects and if so, how they do so. Importantly, mammalian sodium channels are less sensitive to pyrethroids, compared to insect channels (Soderlund, 2012). Exactly how is unclear, but differences in metabolism and toxicokinetics may play a role in species differences, but this is an area where data are sparse.
Voltage-gated Calcium Channels: Pyrethroids act not only on VGSC, they also act on other channels. Voltage gated calcium channels (VGCCs) belong to the same superfamily of ion channels as VGSCs and are signal transducers that control the influx of calcium ions into the cell (King et al., 2008). There are two types of VGCCs. They differ based on voltage dependence: (1) low-voltage activated-VGCCs are activated by small depolarizations and rapidly inactivate; (2) high-voltage activated-VGCCs are activated by large depolarization events and exhibit slow inactivation (King et al., 2008).
VGSCs and VGCCs have similar structures, with analogous organization of α subunits
(α1 for the VGCCs), that control the voltage-gated pore comprised of four repeat domains and six transmembrane segments (S1-S6) containing a re-entrant loop
24 between S5 and S6 (King et al., 2008). VGCCs differ from VGSCs in their regulatory subunits. The high voltage activated-VGCCs are made of 4-5 subunits consisting of one pore-forming an α1 subunit, an extracellular α2 subunit, a transmembrane δ subunit, an intracellular β subunit, and in some instances a transmembrane γ subunit
(Catterall, 2000b; King et al., 2008). The low voltage activated-VGCCs consist of the pore-forming α1 subunit but lack the other subunits (Perez-Reyes, 2003; Catterall et al.,
2005; King et al., 2008).
Although there are similarities between the structure of VGSC and VGCCs, there are mixed effects of pyrethroids on these channels (Soderlund et al., 2002; Shafer et al.,
2005; Soderlund, 2012). In studies of spontaneous and evoked neurotransmitter release in presynaptic terminals or brain slices, tetrodotoxin (TTX), a potent sodium channel blocker, blocks the actions of pyrethroids on the VGSCs (Symington et al.,
2007b; Symington et al., 2008). However, others report no effects of TTX on VGSCs, which by implication suggests that pyrethroids act on VGCCs (Soderlund et al., 2002;
Shafer et al., 2005; Symington et al., 2007b; Symington et al., 2008; Soderlund, 2012).
Symington et al. (2007, 2008) observed in rat brain synaptosomal preparations that a combination of TTX and DLM enhanced calcium uptake and release, effects that were blocked by the selective N-type calcium channel blocker ω-conotoxin MVIIC (Symington et al., 2007b; Symington et al., 2008). However, conflicting results come from pyrethroid calcium uptake in cultured mouse neocortical neurons. Cao et al. (2011) failed to observe any effects of pyrethroids on VGCCs in the presence of TTX, indicating that calcium influx is secondary to effects on VGSCs. These effects are important for NMDA receptors since VGSCs and sodium/calcium exchangers control
25 NMDA-R depolarization (Cao et al., 2011; Soderlund, 2012). Electrophysiological studies find that DLM has no effect on calcium currents (Soderlund et al., 2002; Shafer and Meyer, 2004; Soderlund, 2012). When isolated calcium channels are expressed in
Xenopus oocytes, on the other hand, DLM partially blocks N-type calcium channels, a high voltage activated-VGCC type expressed throughout the central and peripheral nervous systems (Symington and Clark, 2005). A T422E mutation, that mimics phosphorylation of threonine-422, in rat N-type calcium channels (Cav2.2) reversed the effect of DLM on calcium currents (Symington et al., 2007a), suggesting that DLM may regulate calcium channels, an idea consistent with enhancement of the Cav2.2 current by DLM following protein kinase C (PKC) activation in oocytes using a PKC activator to increase channel phosphorylation (Alves et al., 2010).
As noted above, VGCCs change during development, with increasing expression with age (McEnery et al., 1998). This suggests that VGCCs may play a role in the effects of pyrethroids on the developing brain, but this remains to be determined. It is also unclear if pyrethroid-induced neurotransmitter release accompanying the CS syndrome is attributable to effects on VGCCs (Soderlund et al., 2002).
Additional targets: Pyrethroids may also affect other channels and receptors.
Soderlund et al (2002) suggested that the CS syndrome could be due to effects on voltage-gated chloride channels (VGCLCs) (Soderlund et al., 2002). DLM blocks chloride conductance in rat muscle and in neuroblastoma cells, and the symptoms of
DLM are modified by activators of VGCLCs (Soderlund et al., 2002). However, blocking chloride channels in patched N1E-115 neuroblastoma cells did not correlate with pyrethroid class, indicating this would not translate to the syndromes each type
26 produces: T syndrome (Type I) and CS –(Type II) syndromes (Burr and Ray, 2004).
Specifically, the authors observed that under patch clamp conditions, Type II pyrethroids, such as esfenvalerate and λ-cyhalothrin, did not affect chloride ion channel open probability (Burr and Ray, 2004). DLM however, was observed to be effective on chloride channel open probability (Burr and Ray, 2004). By contrast, chloride channels were blocked following exposure to Type I pyrethroids (Burr and Ray, 2004). The authors suggest that since not all Type II compounds affected VGCLCs similarly this implies that CS syndromes are not produced by altered VGCLC activity. However, this assumption requires animal-based neurotoxicity studies to corroborate these findings.
Although Burr and Ray (2004) did not find a relationship between the observed actions on VGCLC open probability and pyrethroid type, the study provides information, indicating that DLM alters VGCLCs in excised inside-out membrane patches (where the membrane is detached from the rest of the cell, and the cytosolic surface of the membrane is exposed to the external media), but how this would be manifested at the whole organism level is unclear. Additional studies are needed to determine why the actions of DLM on VGCLCs differ from other Type II pyrethroids in this way, and whether this difference contributes to the cognitive effects induced by DLM.
The γ-aminobutyric acid (GABA) receptor-chloride ionophore is also implicated as a target of Type II pyrethroids. Pyrethroids have effects on the GABA receptor-chloride ionophore in vivo in drug-insecticide interaction studies, where mice and cockroaches pretreated with diazepam (a postive allosteric modulator of the GABA type A receptors) had delayed symptom onset following Type II but not Type I pyrethroid exposure
(Gammon et al., 1982). This was accompanied by delayed onset of DLM-induced burst
27 discharges in cercal motor nerves. In addition, radio-ligand assays showed that DLM inhibited [3H]-dihydropicrotoxinin (DHP) binding to GABA receptors in the rat brain
(Soderlund and Bloomquist, 1989). Intracerebral injections of Type II pyrethroids can displace [35S]-t-butylbicyclophosphorothionate (TBPS; another radioligand for GABA receptor-chloride complex) binding in rat brain membranes, and TBPS binding correlates with toxcity (Lawrence and Casida, 1983). TBPS binding does not affect binding sites for GABA or benzodiazepines on the GABA receptor-chloride ionophore
(Crofton et al., 1987; Lummis et al., 1987), indicating that a different binding site mediates this effect. Moreover, the effects of DLM on ligand binding are not consitent across species, with mammalian brain GABA receptor-chloride ionophore binding affected (Harris and Allan, 1985) but no effect in the house fly (Cohen and Casida,
1986). The effect of DLM is 1000-fold less potent as an inhibitor of GABA-dependent chloride uptake than it is at inhibiting VGSCs (Ghiasuddin and Soderlund, 1985). Given the higher concentrations of DLM required to produce effects on GABA receptors compared with VGSCs, the effects of Type II pyrethoids on these receptors may not be relevent to neurotoxicity. Pyrethroids also inhibit peripherial-type benzodiazepine receptor (Soderlund and Bloomquist, 1989), a mitochondrial protein that is a secondary site for diazapam binding (Papadopoulos, 2004). It is notable that pyrethroid interactions with this site correlate with proconvulsant effects, which in vivo are observed at doses below those inducing acute intoxification (Devaud et al., 1986;
Devaud and Murray, 1988). However, during development, DLM effects on GABA receptors and VGCLCs during critical periods may be different.
28 Overall, this section outlined that there are multiple targets for pyrethroids. Not only do they act on the VGSC, they have effects on VGCC, VGCLC, and GABA receptors. The effects of altering these channels during development could lead to deleterious effects on nervous system function. Actions of pyrethoids, such as DLM, on these channels could lead to secondary effects, such as alterations in neurotransmitter systems, which potentially affect behavior and cognition. The direct actions of DLM on ion channels could lead to changes in CNS function and neurotoxicity, with developing organisms exposed to these compounds at greater risk due to developing barriers and metabolic systems. Understanding the differences in how pyrethroid kintetics and metabolism play a role in the actions of DLM may be helpful in determining the developmental consequences of these compounds.
Effects on neurotransmitters: GABA and glutamate have been measured following pyrethroid exposure in the hippocampus of adult male rats by microdialysis.
DLM (10, 20, or 60 mg/kg; i.p.) caused a dose-dependent increase in extracellular glutamate and decrease in GABA (Hossain et al., 2008). Another Type II pyrethroid, cyhalothrin (10, 20, or 60 mg/kg; i.p.) inhibited glutamate release, while the Type I pyrethroid allethrin at 10 or 20 mg/kg; i.p. increased glutamate release but decreased it at 60 mg/kg (Hossain et al., 2008). GABA levels were decreased at 10 and 20 mg/kg of allethrin and increased after a 60 mg/kg dose and at all tested doses of cyhalothrin (10,
20, or 60 mg/kg) (Hossain et al., 2008). These data show that GABA and glutamate are affected differentially by different pyrethroids as a function of dose. Changes in GABA and glutamate by DLM, cyhalothrin, or allethrin were blocked by local infusion of TTX (1
M), except 60 mg/kg DLM, which was blocked by local infusion of the L-type Ca2+
29 channel blocker nimodipine (10 µM) (Hossain et al., 2008), suggesting that at higher doses DLM may act through VGCCs as opposed to only activating VGSC at lower DLM doses. However, none of these effects have been explored after developmental exposure.
Eriksson and Nordberg (1990) assessed the density of muscarinic and nicotinic acetylcholine receptors by measuring labeled quinuclidinyl benzilate ([3H] QNB) and
[3H] nicotine, respectively in DLM exposed mice. High and low-affinity binding sites of muscarinic receptors were assessed by measuring the displacement of [3H]
QNB/carbachol. Mice received postnatal gavage exposure to 0.71 mg/kg/d DLM for 7 days (P10-16), which resulted in increased muscarinic receptor density, increased high- affinity binding sites, and decreased percentage of low-affinity muscarinic receptor binding, as well as increased density of nicotinic receptors in the cerebral cortex 24 h after the last dose, and no effect on binding within the hippocampus (Eriksson and
Nordberg, 1990). Additionally, 1.2 mg/kg DLM (P10-16, gavage), a dose at which CS syndrome was observed, resulted in decreased [3H]-QNB binding in the hippocampus and increased [3H]-nicotine binding in the cerebral cortex, although the examination of high- vs low-affinity binding was not assessed at this dose of DLM (Eriksson and
Nordberg, 1990). Eriksson and Nordberg (1990) also assessed the effects of early life bioallethrin (0.72 mg/kg, gavage; bioallethrin being 2 of the 8 stereoisomers of allethrin), a Type I pyrethroid, on nicotinic and muscarinic receptor binding and found that these receptors were affected differently compared with DLM, high-affinity muscarinic receptor binding being decreased and low-affinity muscarinic receptor binding being increased.
Also, 0.72 mg/kg bioallethrin had no effect on muscarinic binding in the hippocampus or
30 nicotinic binding in the hippocampus or cortex, and 72 mg/kg bioallethrin had no effect at all across the study, but this dose was not used for assessment of high- or low-affinity binding assays (Eriksson and Nordberg, 1990). These results suggest cholinergic involvement, but the data are not consistent for all measurements making it difficult to interpret.
In addition to cholinergic alterations, catecholamines have been examined.
Gestational exposure (E6-15) to DLM (0.08 mg/kg, gavage) resulted in increased striatal 3,4-dihydroxyphenylacetic acid (DOPAC) levels in adult male rats, with no change in dopamine (DA) or homovanillic acid (HVA) concentrations by HPLC (Lazarini et al., 2001). The DOPAC/DA ratio was also increased in the males (Lazarini et al.,
2001). No change in DA or its metabolites were observed in female-treated rats
(Lazarini et al., 2001). The results indicate increased dopaminergic activity in rats treated prenatally with DLM. Richardson et al. (2015) found mice exposed perinatally to
DLM (E0-P21; 3 mg/kg DLM/72 h by gavage) had disrupted dopaminergic markers.
DLM exposure resulted in increased DA transporter (DAT) levels in males and females in the nucleus accumbens but not in the neostriatum. The dopaminergic neurotoxin 1- methyl-4-phenyl-1,2,3,6- tetrahydropyridine (MPTP) was used to estimate the in vivo consequences of increased DAT, and MPTP (1 mg/kg, i.p.) induced DA loss in control mice but had a greater effect in mice exposed to DLM (Richardson et al., 2015). In addition, DLM exposed mice had decreased extracellular DA release as assessed by microdialysis and increased DA D1 receptor (DRD1) levels in the nucleus accumbens in male mice and only in this region (Richardson et al., 2015). Richardson et al. (2015) also assessed the functional consequences of increased DRD1 levels using DA
31 receptor antagonists (0.025, 0.05, or 0.1 mg/kg SCH23390 (DRD1 antagonist), 0.05,
0.1, or 0.2 mg/kg eticlopride (DA D2 receptor (DRD2) antagonist)), and 0.03 or 0.06 mg/kg quinpirole (DRD2-autoreceptor antagonist)) and agonists: 0.5 mg/kg apomorphine (non-specific DA receptor agonist) and 1.0 mg/kg SKF82958 (DRD1 agonist)). The hyperactivity observed in DLM-treated male mice was normalized by the antagonists (SCH23390, eticlopride, and quinpirole) (Richardson et al., 2015). It is interesting that DLM hyperactivity is normalized with both DA antagonists and methylphenidate, a compound that blocks DA reuptake at the synapse. Apomorphine resulted in increased locomotor activity in DLM-treated male mice (but not female mice) compared with control mice even when DA was first depleted using reserpine (5 mg/kg)
(Richardson et al., 2015). SKF82958 increased locomotor activity in both control and
DLM-treated mice, however the DLM-treated mice that were administered SKF82958 displayed a greater increase in locomotor activity compared with control mice
(Richardson et al., 2015). Hence, DA alterations following developmental DLM play a role in the long-term effects of early DLM exposure. However, DA antagonists were used only to test locomotor activity in DLM-treated mice. A study of DA antagonism on cognitive behaviors is needed to provide a fuller assessment of DLM alterations to DA systems and their potential involvement in learning and memory.
These data implicate neurotransmitter changes as mechanisms for long-term
CNS effects of DLM. Among neurotransmitter systems, the dopaminergic system shows the most effects. However, it is not clear whether this is because DA signaling is the most affected or because DA has been investigated the most. Little is known about effects of DLM on glutamate, GABA, serotonin, norepinephrine, or acetylcholine.
32 Alterations within these neurotransmitter systems can have detrimental effects on behavior and cognition. In addition to neurotransmitters, DLM can activate microglia
(Hossain et al., 2016) and has long-term effects on VGSCs as noted above (Magby and
Richardson, 2017). There remains much unchartered territory in understanding the neurodevelopmental effects of DLM. In the following chapters we will characterize cognitive and behavioral effects following developmental DLM exposure and determine potential mechanisms by which those behaviors are mediated. Several of the topics outlined in this chapter guided the focus of these subsequent research chapters.
DLM Kinetics and Metabolism
DLM is used for indoor/residential pest control as well as in agriculture. Children and adults in the U.S. are estimated to be exposed to 3.0 to 0.6 μg/kg/day, respectively
(EPA, 2015; Mortuza et al., 2018). Reference levels refer to typical exposure; however, widespread use has resulted in acute neurotoxicity cases where people were accidently exposed to high doses (those far above reference levels of typical exposure) of pyrethroids (He et al., 1989; Chen et al., 1991; Vinayagam, 2017). Although, isolated cases have limited value in understanding DLM absorption, distribution, metabolism, and excretion (ADME). Instead, toxicokinetic (TK) studies provide information on internal dose, but even here, most of the data come from studies using high-doses
(Anadon et al., 1996; Anand et al., 2006a). The more recent development of physiologically based pharmacokinetic studies (PBPK) provide kinetic models of ADME parameters and permit extrapolation from animal models to people.
33 DLM TK studies and development of PBPKs: TK studies provide data on age and species differences in organ dosimetry (Felter et al., 2015). Studies with high doses of
DLM (single dose 26 mg/kg oral and 1.2 mg/kg I.V.) in rats show that DLM, which is lipophilic, is rapidly absorbed and enters the CNS and peripheral nervous system (PNS)
(Anadon et al., 1996). DLM is absorbed mostly in fat (i.e., gut wall and liver) (He et al.,
1991; Rehman et al., 2014). Adult male rats exposed to DLM (by gavage with 0.4, 2, or
10 mg/kg DLM dissolved in glycerol formal) show rapid but incomplete gastrointestinal absorption, with low accumulation in brain, and large accumulation in the fat, skin, and skeletal muscle (Kim et al., 2008b). The BBB restricts passage of pyrethroids through the microvasculature of the brain limiting CNS entry (Amaraneni et al., 2017). However, age-dependent differences in BBB permeability were found following in situ DLM (1, 10, or 50 μM 14C-DLM) perfusion in anesthetized rats.
DLM uptake is inversely related to age, such that P15 rats display 2.2-3.7 fold higher deposition than adults, and effects of DLM deposition at P21 and in adults are less pronounced (Amaraneni et al., 2017). Other studies report that immature rats are more susceptible to acute neurotoxicity at high doses than adult rats (Cantalamessa,
1993; Sheets et al., 1994). Rats P10, 21, 40, and 90 days of age exposed to 10 mg/kg
DLM p.o. in glycerol formal, had lethality at P10 and P21, whereas at P40 clearance via plasma carboxylesterases (CaEs) and liver cytochrome P450 (CYP450) was adult-like
(Anand et al., 2006b), and there was no lethality. However, Anand et al. (2006) reported that the metabolic capacity of preweaning rats is limited but capable of metabolizing DLM (2 μM) at low exposure levels when assessed in diluted plasma and liver microsomes (Anand et al., 2006b). In P15, 21, and 90 rats, clearance of 0.1, 0.25,
34 or 0.5 mg/kg DLM after oral administration in corn oil, cleared DLM from plasma within a day (Mortuza et al., 2018). Age-related differences in maximum concentrations (Cmax) and 24 h area under the curve (AUC24) values decrease with dose. This is consistent with the concept that the metabolic capacity of immature rats can eliminate DLM readily when doses are low (Anand et al., 2006a). Doses used by Mortuza et al. (2018) were estimated to be relevant to exposure in urban environments as indicated by the EPA.
For brain and liver, age-dependent differences in dosimetry (the calculated absorbed dose in the tissue resulting from exposure), did not decrease proportionately with dose
(Mortuza et al., 2018). Differences in both permeability and CYP450 and CaE activity in younger versus older organisms may account for the disparity, but what these factors are has not been established.
PBPK models also provide estimates of biological half-life, Cmax, clearance, and volume of distribution, and can be used to predict plasma and tissue concentration-time profiles (Jones and Rowland-Yeo, 2013). Mirfazaelian et al. (2006) used a PBPK model for adult male Sprague-Dawley rats that were administered DLM using flow-limited and diffusion-limited rate equations. Flow-limited equations included gastrointestinal, hepatic, brain, and other rapidly perfused tissues and diffusion-limited equations for slowly perfused tissues, such as blood/plasma and fat. Using these equations
Mirfazaelian et al. (2006) estimated that 48 h after DLM (2 or 10 mg/kg; p.o.) administration, most of the compound was cleared via hepatic biotransformation with a smaller percentage cleared by plasma CaE catabolism. DLM kinetics in blood, plasma, brain, and fat were also determined after 2 or 10 mg/kg DLM p.o., as well as, 1 mg/kg
DLM i.v. and predicted that adult male rats would have relatively low DLM levels within
35 the brain (Mirfazaelian et al., 2006). Using the same p.o. exposures calculated by the
Mirfazaelian PBPK model, rat parameters were then scaled to humans predicting threefold greater 48 h AUCs and twofold increases in peak DLM concentration in brain of humans compared to rats for a 1 mg/kg DLM p.o. dose (Godin et al., 2010). Both models estimate greater brain concentrations in humans compared to rats for a similar
DLM dose even without consideration of pharmacodynamic differences between species.
The original Mirfazaelian PBPK model was limited but has since been improved to provide more information with regard to age-dependent changes (Tornero-Velez et al., 2010). Immature rats have limited metabolic capacity compared with adults (Anand et al., 2006a; Scollon et al., 2009; Amaraneni et al., 2017) that could lead to increased brain concentrations at younger ages. The new model shows that DLM within plasma and tissue is inversely related to age (Kim et al., 2010; Tornero-Velez et al., 2010).
When P10, 21, 40, and 90 rats were administered DLM at 0.4, 2, or 10 mg/kg DLM by gavage in glycerol formal, the data showed that preweaning and postweaning DLM- treated rats had increased brain concentrations of DLM in conjunction with signs of toxicity at younger ages (Kim et al., 2010). And it was noted that plasma DLM levels did not reflect brain levels (Kim et al., 2010). Kim et al. (2010) also showed that hepatic clearance increases with maturation. In a companion study using the same ages and doses, brain concentrations (brain AUC24) of P10 rats were 3.8-fold higher than in P90 rats (Tornero-Velez et al., 2010).
The recent (Williams et al., 2019) study examined DLM levels in plasma and brain of P15 (0, 1, 2 or 4 mg/kg DLM, gavage) and adult (0, 2, 8, or 25 mg/kg DLM,
36 gavage) rats 2-8 h following administration (Williams et al., 2019). It was shown that regardless of age, dose-dependent increases in DLM were observed in brain and plasma, however at the same 2 mg/kg dose, brain levels of DLM were higher at P15 compared with adults (Williams et al., 2019). In addition, Williams et al., (2019) showed that the P15 rats DLM levels were the greatest 6 h following 4 mg/kg DLM (~151 ng/g) and only slightly dropped 2 h following, whereas adults administered a dose over 6x that amount (25 mg/kg DLM) had the highest concentration (~156 ng/g) 2 h after DLM administration, and that concentration dropped to almost half 2 h later. Signs of neurotoxicity were also examined in this study, with the 25 mg/kg DLM-treated adults showing signs of tremor and salivation, and P15 rats had tremors after 2 and 4 mg/kg
DLM over the 8 h of testing (Williams et al., 2019). Mortality was also observed in the
P15 group at all doses; however, this was not seen in the adults, who were administered increasingly higher doses than the P15 group (Williams et al., 2019).
Overall, Williams et al., (2019) study reiterates that there are age-dependent differences in metabolism and sensitivity following DLM administration.
The PBPK model has been extended for in vitro to in vivo extrapolation (IVIVE) of age-related differences in pyrethroid kinetics and neurotoxic effects (Song et al., 2019).
Liver microsomes, cytosol, and plasma derived from immature and adult rats were scaled to in vivo parameters in rats to model the in vivo time course for plasma and brain concentrations of DLM following oral doses of 0.1, 0.25, 0.5, and 5 mg/kg doses of
DLM (Song et al., 2019). They simulated age-dependent tissue levels (i.e. brain Cmax) and showed that tissue compartment partitioning and permeability were critical for brain estimates (Song et al., 2019). The model recapitulated developmental changes in
37 clearance as well as BBB maturity, which are critical in brain uptake of DLM and, therefore, of neurotoxicity. The IVIVE-based PBPK model demonstrated that there is an inverse relationship between age and uptake of DLM in brain, similar to in situ results
(Amaraneni et al., 2017). The model showed that brain concentrations were sensitive to alteration in physiological parameters (i.e., body weight, cardiac output, blood volume, hematocrit, blood flow, absorption and metabolism) (Song et al., 2019). These data aid in determining brain concentrations at different ages.
DLM metabolism: The principal routes of DLM metabolism in rodents involves ester cleavage and oxidation at the 4’ position (Soderlund and Casida, 1977; Anand et al., 2006a). CaEs, CYP450 enzymes, and glutathione-S-transferase (GST) play important roles in DLM metabolism (Yang et al., 2017; Lu et al., 2019). The structure of pyrethroids dictates the metabolic ability of CaEs and CYP450s. Pyrethroids containing a cyano group are less sensitive to oxidation and hydrolysis than pyrethroids lacking a cyano group (Soderlund and Casida, 1977). Most pyrethroids exist in two or more isoforms and studies show the trans isomer is readily hydrolyzed by esterases versus cis isomers (Soderlund and Casida, 1977). Commercial DLM is only in the cis isoform
(Elliott et al., 1974). Because of this and the fact that it contains a cyano moiety, it has a longer half-life compared with Type I pyrethroids (Anadon et al., 1996).
CaEs are widely distributed (He et al., 1991; Rehman et al., 2014) and hydrolyze
DLM to produce alcohol and acid metabolites (Satoh and Hosokawa, 2006). Hydrolysis creates carboxylic acid ester, amide, and thiol-ester groups (Soderlund and Casida,
1977; Rehman et al., 2014; Lu et al., 2019) which are conjugated and excreted in urine.
38 Interestingly, DLM is a CaE inhibitor, suggesting it inhibits its own hydrolysis (Yoon et al., 2004; Imai and Ohura, 2010; Lei et al., 2017; Wang et al., 2018).
DLM metabolism also involves CYP450 enzymes, some of which are species specific (Lu et al., 2019). CYP450s catalyze aromatic hydroxylation of DLM which is conjugated for excretion (Soderlund and Casida, 1977; Rehman et al., 2014; Lu et al.,
2019). CYP450s exhibit regional specificity in the brain (Yadav et al., 2006). The hippocampus shows higher levels of mRNA expression of CYP1A1 and hippocampus and hypothalamus exhibit higher levels of CYP2B1 expression (Yadav et al., 2006).
The pons-medulla, cerebellum, and frontal cortex have higher CYP1A2 and CYP2B2 mRNA expression (Yadav et al., 2006). Both the hippocampus and hypothalamus have longer elimination half-lives for DLM and its metabolite 4’-OH-DLM leading to slower clearance in these regions (Anadon et al., 1996). The higher CYP1A1 and CYP2B1 expression in the hippocampus and hypothalamus may account for the increased metabolites found in these regions (Anadon et al., 1996; Yadav et al., 2006). The metabolic capacity of CaEs for DLM is lower than for CYP450s in rat liver and plasma
(Anand et al., 2006a), however differences in brain metabolism have not been studied.
GST also contributes to the biodegradation of pyrethroids (Hemingway and
Ranson, 2000). GST is involved in the conjugation of electrophilic compounds with the thiol group of reduced glutathione which allows for the reduction of antioxidants
(Berdikova Bohne et al., 2007; Yang et al., 2017). The nicotinamide adenine dinucleotide phosphate (NADPH)-metabolic pathway is also involved in DLM metabolism, with DLM being metabolized in rat liver microsomes via a NADPH-
39 dependent mechanism and in human liver microsomes via a NADPH-independent mechanism (Godin et al., 2006).
Studies examining the metabolism of DLM show that it is metabolized using similar enzymes in humans and rats (Rehman et al., 2014). However, there are quantitative species differences in DLM metabolism. Humans have low serum CaE levels, whereas rodents have higher CaE levels (Li et al., 2005; Crow et al., 2007; Wang et al., 2018), suggesting slower human serum DLM metabolism compared to rodents and thus longer exposure in humans. In addition, the expression of CaE levels in humans is related to age, with adults expressing higher levels than children or fetuses also resulting in higher exposure at young ages (Satoh and Hosokawa, 2006). This age-related difference in CaEs is also found with activity. Adult microsomes (isolated fragmented endoplasmic reticulum (ER) with attached ribosome to measure metabolism in vitro) are 4 times more active than in children and 10 times less active than in fetal microsomes (Satoh and Hosokawa, 2006). Together this indicates increased exposure
(due to inefficient/developing elimination systems) of pyrethroids in a developing organism compared with a similar dose in adults.
Neurotoxicity is thought to be caused by the parent compound (Rickard and
Brodie, 1985). Active metabolites are found in vivo (Cole et al., 1982), with the main metabolites of DLM being oxidative (2’, 4’, and 5’-OH-DLM) (Romero et al., 2012; Lu et al., 2019). Romero et al. (2012) examined neurotoxicity of DLM metabolites, 2’-OH
DLM and 4’-OH-DLM 10-1000 μM, and DLM (10-1000 μM) in SH-SY5Y cells. It was shown that the metabolites 2’-OH DLM and 4’-OH-DLM were more toxic than DLM in
SH-SY5Y cells (Romero et al., 2012; Lu et al., 2019), which is contradictory to the idea
40 that neurotoxicity is caused by the parent compound. This study was in vitro, and may not apply in vivo, indicating that further studies are necessary to assess if metabolites or the parent compound are the proximate neurotoxin. Given the results of Romero et al.
(2012) on in vitro neurotoxicity, this may explain aspects of species-related differences in DLM toxicity (Lu et al., 2019), as well as suggest the necessity to examine the toxicity of DLM metabolites in vivo. Other metabolites include a trans-methyl group and ester cleavage groups to form 3-PBA and 4’ and 2’-OH-PBA (Lu et al., 2019). These metabolites (4’OH-PBA and 3-PBA) can elicit toxicity, however, not at concentrations achieved in vivo (Pesticides et al., 1986). Moreover, these metabolic data are in adult organisms not those of children.
Mechanisms of DLM induced neurotoxicity: Mechanisms of DLM neurotoxicity have been studied primarily in adult organisms, with focus on the induction of apoptosis and oxidative stress. Studies found increased levels of apoptosis in cell culture and animals following DLM exposure (Enan et al., 1996; El-Gohary et al., 1999; Wu and Liu,
2000; Hossain and Richardson, 2011; Kumar et al., 2015; Hossain et al., 2019).
Although apoptosis is a homeostatic process in the brain that occurs throughout development, it can also arise as a defense when cells are damaged by toxic compounds, including pesticides (Kumar et al., 2014). DLM induced apoptosis occurs in a concentration and time-dependent way in mammalian systems (Enan et al., 1996;
El-Gohary et al., 1999; Wu and Liu, 2000; Hsu and Chou, 2012; Kumar et al., 2014), but how it works is unclear.
Oxidative stress pathways have been proposed as mechanisms of DLM induced neurotoxicity. Oxidative stress is caused by an imbalance of reactive oxygen species
41 (ROS) production and antioxidant enzymes leading to lipid peroxidation in cells, mitochondria, and nuclear membranes, and/or protein degradation and DNA damage
(Kumar et al., 2015). DLM-treated male mice (5.6 and 18 mg/kg) show lipid peroxidation and decreased antioxidant enzymes in liver and kidney (Rehman et al.,
2006). Low doses of DLM (1.28 mg/kg and 3 mg/kg) increase lipid peroxidation, induce thiobarbituric acid-reactive substances (marker of lipid peroxidation) and decreased
GST and levels of antioxidant enzymes (superoxide dismutase, catalase, glutathione peroxidase) in the plasma and lymphoid organs of adult rats (Yousef et al., 2006; Aydin,
2011). PC12 cells exposed to DLM (10 µM/L) exhibit increased nuclear factor erythroid
2-related factor 2 (Nrf2) expression and activity (Li et al., 2007). Nrf2 regulates expression of multiple antioxidant proteins. These data indicate that DLM can induce oxidative stress, a known cause of alterations in mitochondrial membrane potential that can be a trigger for cell death.
DLM induced calcium changes also were examined as potential mechanisms of neurotoxicity. Calcium acts as an intracellular signaling molecule controlling different activities and is a potential target of DLM (Shafer and Meyer, 2004; Shafer et al., 2005).
Transient or oscillating increases in calcium regulate many cellular activities, but sustained calcium elevations lead to apoptosis (Kumar et al., 2015). DLM (5-60 µM) increases phospholipase C (PLC) in glioblastoma cells and increases calcium mobilization thereby reducing the rate of calcium/calmodulin dependent protein dephosphorylation in thymocyte suspensions (50 µM in vitro; 25 mg/kg in vivo) and predisposing the cells to apoptosis (Enan et al., 1996). PLC generates inositol triphosphate (IP3) and diacylglycerol (DAG), both of which increase intracellular calcium
42 and calcium/calmodulin dependent protein kinase that are second messengers capable of inducing DNA fragmentation and cell death.
Another mechanism by which DLM may induce calcium dependent apoptosis is through activation of the ER stress pathway. The ER is a reservoir of calcium and regulates calcium homeostasis but can lead to apoptosis via release of calcium within the lumen of the ER when overstimulated (Verkhratsky, 2005). DLM activates the ER stress pathway in vitro (Hossain and Richardson, 2011) and in vivo in adult mice
(Hossain et al., 2015). SK-N-AS cells treated with DLM display increased levels of the transcription factor C/EBP homologous protein/growth arrest and DNA damage 153
(CHOP/GADD153) (Hossain and Richardson, 2011), which are pro-apoptotic factors activated by ER stress (Oslowski and Urano, 2011; Hu et al., 2018). CHOP/GADD153 levels were also increased in adult mice treated with DLM (3 mg/kg every 3 days for 60 days) in conjunction with increased levels of binding immunoglobulin protein/78-kDa glucose-regulated protein (BiP/GRP78) (Hossain et al., 2015). BiP/GRP78 is an ER chaperone that regulates ER stress signaling, such as protein kinase R (PKR)-like ER kinase (PERK) that is important in restoring the function of the ER (Xu et al., 2005;
Wang et al., 2009). Under conditions of ER stress, BiP/GRP78 activates PERK which then phosphorylates eukaryotic translation initiation factor 2 subunit 1 (eIF2α), which inhibits the actions of eIF2α in blocking mRNA translation and protein synthesis which exacerbates ER stress (Xu et al., 2005; Wang et al., 2009). Thus, BiP/GRP78 is a regulator that reduces ER stress, however under conditions when ER stress is present,
BiP/GRP78 dissociates from ER stress signaling allowing activation of signaling cascades (Oslowski and Urano, 2011). In addition, when eIF2α remains
43 phosphorylated it can lead to CHOP activation through the suppression of B-cell lymphoma 2 (Bcl-2), an anti-apoptotic protein (Xu et al., 2005; Kim et al., 2008a), indicating the central role of eIF2α in this branch of the ER stress pathway. Increased activation of ER stress pathways also causes activation of caspases and increased
DNA fragmentation in vitro (Hossain and Richardson, 2011) and in vivo (Hossain et al.,
2015; Hossain et al., 2019), which can be blocked by a calcium chelator (BAPTA-AM 5
µM), by blocking VGSC (TTX 1 µM) or blocking ER stress (salubrinal - eIF2α inhibitor)
(Hossain and Richardson, 2011; Hossain et al., 2019).
Another mechanism for neurotoxicity may be through tumor suppressor protein p53 (p53) signaling, which is involved in apoptosis (Hughes et al., 1996; Xiang et al.,
1998) as a response to DNA damage. DLM exposure increases p53 and Bcl-2- associated X protein (Bax; which is regulated by p53) in rat brain (Wu and Liu, 2000) and cortical neurons (Wu et al., 2003). Bcl-2 was decreased in DLM-treated cortical neurons (Wu et al., 2003). Hence, multiple mechanisms are implicated in DLM-induced neurotoxicity but many of these have not been tested after developmental DLM treatment.
In summary, studies have examined the TK and PBPK of pyrethroids, including
DLM. Younger animals are more vulnerable to the effects of pyrethroids as compared with adults, as seen by higher concentrations in both blood and plasma following the same dose. Limited metabolic capabilities and developing BBB likely play a role in the differences in TK for developing and adult organisms, and result in differing neurotoxicity when exposed to the same dose. The vulnerability of younger organisms to the effects of pyrethroids highlight the importance of studying the effects of these
44 compounds during development and examining low doses of pyrethroids which do not typically affect adults.
Effects of pyrethroids on behavior and cognition
Adult rodent studies find behavioral and cognitive deficits following pyrethroid exposure. Many studies used high doses, which are less relevant to human exposures.
Wolansky and Harrill (2008) reviewed rodent neurotoxicology of pyrethroids (Wolansky and Harrill, 2008). They found that adult exposure to pyrethroids resulted in altered locomotor activity, even at doses that do not produce overt signs of neurotoxicity, impaired rotorod performance (DLM and α-cypermethrin), reduced schedule-controlled operant responding (allethrin, permethrin, cis-permethrin, DLM, cypermethrin, and fenvalerate), decreased grip strength (pyrethrum, bifenthrin, S-bioallethrin, permethrin,
β-cyfluthrin, cypermethrin, and DLM), increased acoustic startle for compounds lacking an α-cyano moiety, and decreased startle for compounds containing an α-cyano moiety
(Wolansky and Harrill, 2008). Effects on cognition have been assessed as well. Adult mice treated with 3 mg/kg DLM every 3 days for 60 days displayed deficits in hippocampal learning and memory (testing began 3 days following the last dose) with increased latency to find a submerged platform in the Morris water maze (MWM)
(Hossain et al., 2015).
Developmental DLM effects on behavior and cognition: Some studies use higher doses of DLM that are above the levels of typical human exposure as calculated by the
EPA, (3.0 and 0.6 µg/kg/day for adults and children, respectively) (EPA, 2015), and there are a lack of studies that examine the impact of developmental exposure to
45 pyrethroid. The regulatory standards set by the EPA are provided because Type I and
Type II pyrethroids are applied where people contact them on surfaces, but they are generally small doses. However, because children are more vulnerable, even lower dose limits may not be adequate. There is thus a need to study the developmental pyrethroid-induced outcomes.
Male and female rats that were administered 0.7 mg/kg DLM by gavage
(dissolved in a 20% fat emulsion of egg lectin, peanut oil, and water) from P10-16 did not have altered locomotor activity when tested at P17, however when tested in adulthood (~4 months) locomotor activity was increased (Eriksson and Fredriksson,
1991). In 6-week old male mice that were administered DLM (3 mg/kg/72 h, dissolved in corn oil and mixed with peanut butter fed to rats) from embryonic day 0 to P21 had increased locomotor activity. But the effect was only seen at intervals longer than 30 min when tested for three consecutive days; smaller, non-significant, increases were seen in females (Richardson et al., 2015). In addition, the increased activity in male
DLM-treated mice was normalized by treatment with methylphenidate (1 mg/kg)
(Richardson et al., 2015), suggesting to the authors that the change in activity induced by DLM might be related to ADHD. When tested every two weeks from 6 to 12 weeks of age, locomotor activity decreased with age but DLM-treated male mice displayed higher locomotor activity compared with control mice (Richardson et al., 2015).
However, when rats were exposed to DLM only during gestation, locomotor activity was decreased. Male rats exposed to DLM (0.08 mg/kg) from E6 to 15 were less active when tested at 60 days of age with no change in females (Lazarini et al., 2001). Johri et al. (2006) found similar results in male rat offspring exposed prenatally to DLM from E5-
46 21 (corn oil or 0.25, 0.5, or 1.0 mg/kg DLM, oral administration by unspecified methods) and the reduced activity was dose dependent at 3 weeks of age and remained at 6 and
9 weeks of age, although differences diminished with age; female offspring were not tested. Differences between studies may be due to differences in dose, species, and timing of exposure, but the exact reasons are not currently known.
Although the effects on activity differ in different developmental models,
Richardson et al. (2015), who observed hyperactivity also tested impulsivity and attention to link DLM to ADHD-like behaviors. A fixed ratio (FR) wait operant paradigm was used to test impulsivity in mice exposed to 3 mg/kg/72 h DLM from E0-P21. In this test, mice received pellets following 25 lever presses. If mice pressed the lever during the wait interval, the wait time was reset and then they had to press an additional 25 lever presses to receive a food pellet (Richardson et al., 2015). Male (but not female)
DLM-treated mice had reduced wait times and increased resets compared with controls
(Richardson et al., 2015), suggesting that the DLM mice were more impulsive.
Pyrethroid exposure resulted in alterations in startle reactivity. Adult rats show different startle responses depending on whether they are exposed to Type I or Type II pyrethroids. Type I pyrethroids result in increases and Type II pyrethroids result in decreases in acoustic startle responses (Crofton and Reiter, 1988; Williams et al., 2018,
2019). Decreased acoustic startle was observed in P15 rats (DLM 1, 2, or 4 mg/kg dissolved in corn oil, gavage), up to 8 h following dosing, whereas adults show this effect for only 4 h (Williams et al., 2019). By contrast, the Type I pyrethroid, permethrin, induced increased acoustic startle in P15 rat pups 2 h after 60, 90, or 120 mg/kg exposure in corn oil by gavage (Williams et al., 2018). In P15 rats, increased acoustic
47 startle was observed 6 h following 60 mg/kg permethrin, however 4, 6, and 8 h after 120 mg/kg permethrin resulted in decreased startle and no treatment related effects were observed after 2 h after 90 mg/kg permethrin (Williams et al., 2018). Differences in startle reactivity following Type I and Type II pyrethroids highlight how different these compounds are in their mechanisms of action and effects.
Developmental DLM exposure is linked to cognitive effects. Male mice developmentally exposed to DLM (3 mg/kg/72 h from E0-P21), exhibit deficits in working memory and attention as reflected by decreased spontaneous alternation and increased same arm entries in a Y-maze (Richardson et al., 2015). Shock motivated visual discrimination was also assessed in a Y-maze as a measure of learning in rats exposed to 1 mg/kg DLM from E14-20 (Aziz et al., 2001). For this, rats were habituated to the maze for 2-3 min, followed by 40 trials of foot shocks to induce the rats to escape to an illuminated, no shock arm. The following day the safe arm assignment was reversed. DLM-treated offspring at 6 and 12 weeks of age displayed decreased learning on the reversal phase (Aziz et al., 2001).
Several studies have observed alterations in locomotor behavior, with differences depending on dose and time of exposure. Additional studies have examined various behaviors and cognitive tasks, showing detrimental effects following developmental
DLM exposure. However, the extent of cognition examined is limited. In the subsequent chapters various aspects of cognition and behavior will be tested following developmental DLM exposure.
48 Conclusions
Associations between developmental exposure to pyrethroids and adverse neurological outcomes have been made in humans (Oulhote and Bouchard, 2013; Xue et al., 2013; Shelton et al., 2014; Richardson et al., 2015; Wagner-Schuman et al.,
2015), prompting concern over the safety of these compounds on the developing nervous system. Pyrethroids act on the VGSCs, however, they also effect other voltage gated ion channels (VGCCs and VGCLCs), and have effects on neurotransmitter systems, effects that may be detrimental during development (Shafer et al., 2005).
PBPK studies show an inverse relationship between age and uptake of DLM in brain
(Kim et al., 2010), indicating that developing organisms have greater and longer exposures than adults, making children a potentially susceptible subpopulation requiring increased protection. Few rodent studies have assessed behavioral and cognitive impairments following developmental DLM exposure (Eriksson and Fredriksson, 1991;
Aziz et al., 2001; Lazarini et al., 2001; Johri et al., 2006; Richardson et al., 2015), revealing a gap in knowledge about these compounds. My research is aimed at addressing this gap.
Subsequent chapters address gaps about developmental DLM exposure on brain, behavior/cognition, and molecular changes using Sprague-Dawley rats because of their advantages over mice for assessing cognitive function. Later chapters revisit aspects of toxicokinetics, metabolism, VGSCs, neurotransmitter systems and behaviors affected by early DLM exposure. Chapter 2 presents the results of my main experiment where the long-term effects of DLM following P3-20 treatment on behavior and cognition were tested (Table 1). Chapter 2 also examines the effects of DLM on molecular
49 changes associated with alterations in behavior following developmental DLM exposure in relation to DA, including monoamines levels, long-term potentiation (LTP), and mRNA levels of receptors, transporters, and channels (Table 1). Chapter 3 extends the molecular assessments to protein, LTP but at a later age, hippocampal glutamate release, and preliminary inflammatory and apoptotic effects (Table 1). The over-arching aim was to examine the long-term functional and biochemical effects following developmental DLM with emphasis on behavioral and cognitive effects. The data start to fill gaps in existing knowledge about the potential risks to children’s neurocognitive development.
50 References
Adams J, Vorhees CV, Middaugh LD (1990) Developmental neurotoxicity of
anticonvulsants: human and animal evidence on phenytoin. Neurotoxicology and
teratology 12:203-214.
Albrieux M, Platel J-C, Dupuis A, Villaz M, Moody WJ (2004) Early expression of
sodium channel transcripts and sodium current by cajal-retzius cells in the
preplate of the embryonic mouse neocortex. The Journal of neuroscience : the
official journal of the Society for Neuroscience 24:1719-1725.
Allegaert K, van den Anker J (2019) Ontogeny of Phase I Metabolism of Drugs. Journal
of clinical pharmacology 59 Suppl 1:S33-s41.
Alves A-M, Symington SB, Lee SH, Clark JM (2010) PKC-dependent phosphorylations
modify the action of deltamethrin on rat brain N-type (CaV2.2) voltage-sensitive
calcium channel. Pesticide Biochemistry and Physiology 97:101-108.
Aman TK, Grieco-Calub TM, Chen C, Rusconi R, Slat EA, Isom LL, Raman IM (2009)
Regulation of persistent Na current by interactions between beta subunits of
voltage-gated Na channels. The Journal of neuroscience : the official journal of
the Society for Neuroscience 29:2027-2042.
Amaraneni M, Pang J, Mortuza TB, Muralidhara S, Cummings BS, White CA, Vorhees
CV, Zastre J, Bruckner JV (2017) Brain uptake of deltamethrin in rats as a
function of plasma protein binding and blood-brain barrier maturation.
Neurotoxicology 62:24-29.
51 Anadon A, Martinez-Larranaga MR, Fernandez-Cruz ML, Diaz MJ, Fernandez MC,
Martinez MA (1996) Toxicokinetics of deltamethrin and its 4'-HO-metabolite in the
rat. Toxicology and applied pharmacology 141:8-16.
Anand SS, Bruckner JV, Haines WT, Muralidhara S, Fisher JW, Padilla S (2006a)
Characterization of deltamethrin metabolism by rat plasma and liver microsomes.
Toxicology and applied pharmacology 212:156-166.
Anand SS, Kim KB, Padilla S, Muralidhara S, Kim HJ, Fisher JW, Bruckner JV (2006b)
Ontogeny of hepatic and plasma metabolism of deltamethrin in vitro: role in age-
dependent acute neurotoxicity. Drug metabolism and disposition: the biological
fate of chemicals 34:389-397.
Aydin B (2011) Effects of thiacloprid, deltamethrin and their combination on oxidative
stress in lymphoid organs, polymorphonuclear leukocytes and plasma of rats.
Pesticide Biochemistry and Physiology 100:165-171.
Aziz MH, Agrawal AK, Adhami VM, Shukla Y, Seth PK (2001) Neurodevelopmental
consequences of gestational exposure (GD14-GD20) to low dose deltamethrin in
rats. Neuroscience letters 300:161-165.
Barr DB, Olsson AO, Wong LY, Udunka S, Baker SE, Whitehead RD, Magsumbol MS,
Williams BL, Needham LL (2010) Urinary concentrations of metabolites of
pyrethroid insecticides in the general U.S. population: National Health and
Nutrition Examination Survey 1999-2002. Environmental health perspectives
118:742-748.
Berdikova Bohne VJ, Hamre K, Arukwe A (2007) Hepatic metabolism, phase I and II
biotransformation enzymes in Atlantic salmon (Salmo Salar, L) during a 12 week
52 feeding period with graded levels of the synthetic antioxidant, ethoxyquin. Food
and chemical toxicology : an international journal published for the British
Industrial Biological Research Association 45:733-746.
Berkowitz GS, Obel J, Deych E, Lapinski R, Godbold J, Liu Z, Landrigan PJ, Wolff MS
(2003) Exposure to indoor pesticides during pregnancy in a multiethnic, urban
cohort. Environmental health perspectives 111:79-84.
Boiko T, Rasband MN, Levinson SR, Caldwell JH, Mandel G, Trimmer JS, Matthews G
(2001) Compact myelin dictates the differential targeting of two sodium channel
isoforms in the same axon. Neuron 30:91-104.
Bouchard MF, Bellinger DC, Wright RO, Weisskopf MG (2010) Attention-
deficit/hyperactivity disorder and urinary metabolites of organophosphate
pesticides. Pediatrics 125:e1270-1277.
Braun JM, Kahn RS, Froehlich T, Auinger P, Lanphear BP (2006) Exposures to
environmental toxicants and attention deficit hyperactivity disorder in U.S.
children. Environmental health perspectives 114:1904-1909.
Burns CJ, Pastoor TP (2018) Pyrethroid epidemiology: a quality-based review. Critical
reviews in toxicology 48:297-311.
Burr SA, Ray DE (2004) Structure-activity and interaction effects of 14 different
pyrethroids on voltage-gated chloride ion channels. Toxicological sciences : an
official journal of the Society of Toxicology 77:341-346.
Cantalamessa F (1993) Acute toxicity of two pyrethroids, permethrin, and cypermethrin
in neonatal and adult rats. Archives of toxicology 67:510-513.
53 Cao Z, Shafer TJ, Murray TF (2011) Mechanisms of pyrethroid insecticide-induced
stimulation of calcium influx in neocortical neurons. The Journal of pharmacology
and experimental therapeutics 336:197-205.
Catterall WA (2000a) From ionic currents to molecular mechanisms: the structure and
function of voltage-gated sodium channels. Neuron 26:13-25.
Catterall WA (2000b) Structure and regulation of voltage-gated Ca2+ channels. Annual
review of cell and developmental biology 16:521-555.
Catterall WA, Perez-Reyes E, Snutch TP, Striessnig J (2005) International Union of
Pharmacology. XLVIII. Nomenclature and structure-function relationships of
voltage-gated calcium channels. Pharmacological reviews 57:411-425.
Catterall WA, Cestele S, Yarov-Yarovoy V, Yu FH, Konoki K, Scheuer T (2007) Voltage-
gated ion channels and gating modifier toxins. Toxicon : official journal of the
International Society on Toxinology 49:124-141.
Cestele S, Catterall WA (2000) Molecular mechanisms of neurotoxin action on voltage-
gated sodium channels. Biochimie 82:883-892.
Chapman RA (1983) Chiral-phase high-performance liquid chromatographic separation
of enantiomers of pyrethroid insecticide esters derived from α-cyano-3-
phenoxybenzyl alcohol. Journal of Chromatography A 258:175-182.
Chen SY, Zhang ZW, He FS, Yao PP, Wu YQ, Sun JX, Liu LH, Li QG (1991) An
epidemiological study on occupational acute pyrethroid poisoning in cotton
farmers. British journal of industrial medicine 48:77-81.
54 Chen Y-T, Trzoss L, Yang D, Yan B (2015) Ontogenic expression of human
carboxylesterase-2 and cytochrome P450 3A4 in liver and duodenum: postnatal
surge and organ-dependent regulation. Toxicology 330:55-61.
Chrustek A, Hołyńska-Iwan I, Dziembowska I, Bogusiewicz J, Wróblewski M, Cwynar A,
Olszewska-Słonina D (2018) Current Research on the Safety of Pyrethroids
Used as Insecticides. Medicina (Kaunas, Lithuania) 54:61.
Claes L, Del-Favero J, Ceulemans B, Lagae L, Van Broeckhoven C, De Jonghe P
(2001) De novo mutations in the sodium-channel gene SCN1A cause severe
myoclonic epilepsy of infancy. Am J Hum Genet 68:1327-1332.
Cohen E, Casida JE (1986) Effects of insecticides and GABAergic agents on a house
fly [35S]t-butylbicyclophosphorothionate binding site. Pesticide Biochemistry and
Physiology 25:63-72.
Cole LM, Ruzo LO, Wood EJ, Casida JE (1982) Pyrethroid metabolism: comparative
fate in rats of tralomethrin, tralocythrin, deltamethrin, and (1R,.alpha.S)-cis-
cypermethrin. Journal of Agricultural and Food Chemistry 30:631-636.
Crofton KM, Reiter LW (1988) The effects of type I and II pyrethroids on motor activity
and the acoustic startle response in the rat. Fundamental and applied toxicology :
official journal of the Society of Toxicology 10:624-634.
Crofton KM, Reiter LW, Mailman RB (1987) Pyrethroid insecticides and radioligand
displacement from the gaba receptor chloride ionophore complex. Toxicology
Letters 35:183-190.
55 Crow JA, Borazjani A, Potter PM, Ross MK (2007) Hydrolysis of pyrethroids by human
and rat tissues: examination of intestinal, liver and serum carboxylesterases.
Toxicology and applied pharmacology 221:1-12.
Davies TG, Field LM, Usherwood PN, Williamson MS (2007) DDT, pyrethrins,
pyrethroids and insect sodium channels. IUBMB life 59:151-162.
Devaud LL, Murray TF (1988) Involvement of peripheral-type benzodiazepine receptors
in the proconvulsant actions of pyrethroid insecticides. The Journal of
pharmacology and experimental therapeutics 247:14-22.
Devaud LL, Szot P, Murray TF (1986) PK 11195 antagonism of pyrethroid-induced
proconvulsant activity. European journal of pharmacology 121:269-273.
Du Y, Lee J-E, Nomura Y, Zhang T, Zhorov BS, Dong K (2009) Identification of a cluster
of residues in transmembrane segment 6 of domain III of the cockroach sodium
channel essential for the action of pyrethroid insecticides. The Biochemical
journal 419:377-385.
Du Y, Nomura Y, Satar G, Hu Z, Nauen R, He SY, Zhorov BS, Dong K (2013) Molecular
evidence for dual pyrethroid-receptor sites on a mosquito sodium channel.
Proceedings of the National Academy of Sciences of the United States of
America 110:11785-11790.
El-Gohary M, Awara WM, Nassar S, Hawas S (1999) Deltamethrin-induced testicular
apoptosis in rats: the protective effect of nitric oxide synthase inhibitor.
Toxicology 132:1-8.
Elliott M, Farnham AW, Janes NF, Needham PH, Pulman DA (1974) Synthetic
insecticide with a new order of activity. Nature 248:710-711.
56 Enan E, Pinkerton KE, Peake J, Matsumura F (1996) Deltamethrin-induced thymus
atrophy in male Balb/c mice. Biochemical pharmacology 51:447-454.
EPA (2015) Deltamethrin: Human Health Risk Assessment for the Proposed Use of
Deltamethrin as a Mosquito Adulticide Over Agricultural Crops. DP No. D417556.
. In: (Prevention OoCSaP, ed). Washington, DC.
Eriksson P, Nordberg A (1990) Effects of two pyrethroids, bioallethrin and deltamethrin,
on subpopulations of muscarinic and nicotinic receptors in the neonatal mouse
brain. Toxicology and applied pharmacology 102:456-463.
Eriksson P, Fredriksson A (1991) Neurotoxic effects of two different pyrethroids,
bioallethrin and deltamethrin, on immature and adult mice: changes in behavioral
and muscarinic receptor variables. Toxicology and applied pharmacology 108:78-
85.
Escayg A, Heils A, MacDonald BT, Haug K, Sander T, Meisler MH (2001) A novel
SCN1A mutation associated with generalized epilepsy with febrile seizures plus--
and prevalence of variants in patients with epilepsy. Am J Hum Genet 68:866-
873.
Felter SP, Daston GP, Euling SY, Piersma AH, Tassinari MS (2015) Assessment of
health risks resulting from early-life exposures: Are current chemical toxicity
testing protocols and risk assessment methods adequate? Critical reviews in
toxicology 45:219-244.
Felts PA, Yokoyama S, Dib-Hajj S, Black JA, Waxman SG (1997) Sodium channel
alpha-subunit mRNAs I, II, III, NaG, Na6 and hNE (PN1): different expression
57 patterns in developing rat nervous system. Brain research Molecular brain
research 45:71-82.
Field LM, Emyr Davies TG, O'Reilly AO, Williamson MS, Wallace BA (2017) Voltage-
gated sodium channels as targets for pyrethroid insecticides. Eur Biophys J
46:675-679.
FQPA FQPAo (1996) In: Public Law 104-170.
Gammon DW, Brown MA, Casida JE (1981) Two classes of pyrethroid action in the
cockroach. Pesticide Biochemistry and Physiology 15:181-191.
Gammon DW, Lawrence LJ, Casida JE (1982) Pyrethroid toxicology: Protective effects
of diazepam and phenobarbital in the mouse and the cockroach. Toxicology and
applied pharmacology 66:290-296.
Ghiasuddin SM, Soderlund DM (1985) Pyrethroid insecticides: Potent, stereospecific
enhancers of mouse brain sodium channel activation. Pesticide Biochemistry and
Physiology 24:200-206.
Godin SJ, Scollon EJ, Hughes MF, Potter PM, DeVito MJ, Ross MK (2006) Species
differences in the in vitro metabolism of deltamethrin and esfenvalerate:
differential oxidative and hydrolytic metabolism by humans and rats. Drug
metabolism and disposition: the biological fate of chemicals 34:1764-1771.
Godin SJ, DeVito MJ, Hughes MF, Ross DG, Scollon EJ, Starr JM, Setzer RW, Conolly
RB, Tornero-Velez R (2010) Physiologically based pharmacokinetic modeling of
deltamethrin: development of a rat and human diffusion-limited model.
Toxicological sciences : an official journal of the Society of Toxicology 115:330-
343.
58 Goodman R (1997) The Strengths and Difficulties Questionnaire: a research note.
Journal of child psychology and psychiatry, and allied disciplines 38:581-586.
Harris RA, Allan AM (1985) Functional coupling of gamma-aminobutyric acid receptors
to chloride channels in brain membranes. Science (New York, NY) 228:1108-
1110.
Hatta T, Ohmori H, Murakami T, Takano M, Yamashita K, Yasuda M (1999) Neurotoxic
effects of phenytoin on postnatal mouse brain development following neonatal
administration. Neurotoxicology and teratology 21:21-28.
He F, Wang S, Liu L, Chen S, Zhang Z, Sun J (1989) Clinical manifestations and
diagnosis of acute pyrethroid poisoning. Archives of toxicology 63:54-58.
He FS, Deng H, Ji X, Zhang ZW, Sun JX, Yao PP (1991) Changes of nerve excitability
and urinary deltamethrin in sprayers. International archives of occupational and
environmental health 62:587-590.
Hemingway J, Ranson H (2000) Insecticide resistance in insect vectors of human
disease. Annual review of entomology 45:371-391.
Hertz-Picciotto I, Croen LA, Hansen R, Jones CR, van de Water J, Pessah IN (2006)
The CHARGE study: an epidemiologic investigation of genetic and environmental
factors contributing to autism. Environmental health perspectives 114:1119-1125.
Heudorf U, Angerer J, Drexler H (2004) Current internal exposure to pesticides in
children and adolescents in Germany: urinary levels of metabolites of pyrethroid
and organophosphorus insecticides. International archives of occupational and
environmental health 77:67-72.
59 Hossain MM, Richardson JR (2011) Mechanism of pyrethroid pesticide-induced
apoptosis: role of calpain and the ER stress pathway. Toxicological sciences : an
official journal of the Society of Toxicology 122:512-525.
Hossain MM, DiCicco-Bloom E, Richardson JR (2015) Hippocampal ER stress and
learning deficits following repeated pyrethroid exposure. Toxicological sciences :
an official journal of the Society of Toxicology 143:220-228.
Hossain MM, Liu J, Richardson JR (2016) Pyrethroid Insecticides Directly Activate
Microglia Through Interaction With Voltage-Gated Sodium Channels.
Toxicological Sciences 155:112-123.
Hossain MM, Sivaram G, Richardson JR (2019) Regional Susceptibility to ER Stress
and Protection by Salubrinal Following a Single Exposure to Deltamethrin.
Toxicological sciences : an official journal of the Society of Toxicology 167:249-
257.
Hossain MM, Suzuki T, Unno T, Komori S, Kobayashi H (2008) Differential presynaptic
actions of pyrethroid insecticides on glutamatergic and GABAergic neurons in the
hippocampus. Toxicology 243:155-163.
Hsu SS, Chou CT (2012) Deltamethrin-Induced [Ca (2)(+) ]i Rise and Death in HGB
Human Glioblastoma Cells. The Chinese journal of physiology 55:294-304.
Hu H, Tian M, Ding C, Yu S (2018) The C/EBP Homologous Protein (CHOP)
Transcription Factor Functions in Endoplasmic Reticulum Stress-Induced
Apoptosis and Microbial Infection. Frontiers in immunology 9:3083.
Hughes PE, Alexi T, Yoshida T, Schreiber SS, Knusel B (1996) Excitotoxic lesion of rat
brain with quinolinic acid induces expression of p53 messenger RNA and protein
60 and p53-inducible genes Bax and Gadd-45 in brain areas showing DNA
fragmentation. Neuroscience 74:1143-1160.
Imai T, Ohura K (2010) The role of intestinal carboxylesterase in the oral absorption of
prodrugs. Current drug metabolism 11:793-805.
Isom LL, Ragsdale DS, De Jongh KS, Westenbroek RE, Reber BF, Scheuer T, Catterall
WA (1995) Structure and function of the beta 2 subunit of brain sodium channels,
a transmembrane glycoprotein with a CAM motif. Cell 83:433-442.
Isom LL, De Jongh KS, Patton DE, Reber BF, Offord J, Charbonneau H, Walsh K,
Goldin AL, Catterall WA (1992) Primary structure and functional expression of
the beta 1 subunit of the rat brain sodium channel. Science (New York, NY)
256:839-842.
Johri A, Yadav S, Singh RL, Dhawan A, Ali M, Parmar D (2006) Long lasting effects of
prenatal exposure to deltamethrin on cerebral and hepatic cytochrome P450s
and behavioral activity in rat offspring. European journal of pharmacology
544:58-68.
Jones H, Rowland-Yeo K (2013) Basic concepts in physiologically based
pharmacokinetic modeling in drug discovery and development. CPT:
pharmacometrics & systems pharmacology 2:e63.
Kaneko H (2010) Chapter 76 - Pyrethroid Chemistry and Metabolism. In: Hayes'
Handbook of Pesticide Toxicology (Third Edition) (Krieger R, ed), pp 1635-1663.
New York: Academic Press.
Kearney JA, Plummer NW, Smith MR, Kapur J, Cummins TR, Waxman SG, Goldin AL,
Meisler MH (2001) A gain-of-function mutation in the sodium channel gene
61 Scn2a results in seizures and behavioral abnormalities. Neuroscience 102:307-
317.
Kim I, Xu W, Reed JC (2008a) Cell death and endoplasmic reticulum stress: disease
relevance and therapeutic opportunities. Nature reviews Drug discovery 7:1013-
1030.
Kim KB, Anand SS, Kim HJ, White CA, Bruckner JV (2008b) Toxicokinetics and tissue
distribution of deltamethrin in adult Sprague-Dawley rats. Toxicological sciences :
an official journal of the Society of Toxicology 101:197-205.
Kim KB, Anand SS, Kim HJ, White CA, Fisher JW, Tornero-Velez R, Bruckner JV
(2010) Age, dose, and time-dependency of plasma and tissue distribution of
deltamethrin in immature rats. Toxicological sciences : an official journal of the
Society of Toxicology 115:354-368.
King GF, Escoubas P, Nicholson GM (2008) Peptide toxins that selectively target insect
Na(V) and Ca(V) channels. Channels (Austin, Tex) 2:100-116.
Kumar A, Sasmal D, Sharma N (2014) Deltamethrin induced an apoptogenic signalling
pathway in murine thymocytes : exploring the molecular mechanism. Journal of
applied toxicology : JAT 34:1303-1310.
Kumar A, Sasmal D, Sharma N (2015) An insight into deltamethrin induced apoptotic
calcium, p53 and oxidative stress signalling pathways. Toxicology and
Environmental Health Sciences 7:25-34.
Lawrence LJ, Casida JE (1983) Stereospecific action of pyrethroid insecticides on the
gamma-aminobutyric acid receptor-ionophore complex. Science (New York, NY)
221:1399-1401.
62 Lazarini CA, Florio JC, Lemonica IP, Bernardi MM (2001) Effects of prenatal exposure
to deltamethrin on forced swimming behavior, motor activity, and striatal
dopamine levels in male and female rats. Neurotoxicology and teratology 23:665-
673.
Lei W, Wang DD, Dou TY, Hou J, Feng L, Yin H, Luo Q, Sun J, Ge GB, Yang L (2017)
Assessment of the inhibitory effects of pyrethroids against human
carboxylesterases. Toxicology and applied pharmacology 321:48-56.
Li B, Sedlacek M, Manoharan I, Boopathy R, Duysen EG, Masson P, Lockridge O
(2005) Butyrylcholinesterase, paraoxonase, and albumin esterase, but not
carboxylesterase, are present in human plasma. Biochemical pharmacology
70:1673-1684.
Li HY, Wu SY, Shi N (2007) Transcription factor Nrf2 activation by deltamethrin in PC12
cells: Involvement of ROS. Toxicol Lett 171:87-98.
Lu Q, Sun Y, Ares I, Anadón A, Martínez M, Martínez-Larrañaga M-R, Yuan Z, Wang X,
Martínez M-A (2019) Deltamethrin toxicity: A review of oxidative stress and
metabolism. Environmental research 170:260-281.
Lummis SCR, Chow SC, Holan G, Johnston GAR (1987) γ-Aminobutyric Acid Receptor
Ionophore Complexes: Differential Effects of Deltamethrin,
Dichlorodiphenyltrichloroethane, and Some Novel Insecticides in a Rat Brain
Membrane Preparation. Journal of neurochemistry 48:689-694.
Magby JP, Richardson JR (2017) Developmental pyrethroid exposure causes long-term
decreases of neuronal sodium channel expression. Neurotoxicology 60:274-279.
63 McEnery MW, Vance CL, Begg CM, Lee W-L, Choi Y, Dubel SJ (1998) Differential
Expression and Association of Calcium Channel Subunits in Development and
Disease. Journal of Bioenergetics and Biomembranes 30:409-418.
Meisler MH, Kearney J, Ottman R, Escayg A (2001) Identification of epilepsy genes in
human and mouse. Annu Rev Genet 35:567-588.
Mirfazaelian A, Kim KB, Anand SS, Kim HJ, Tornero-Velez R, Bruckner JV, Fisher JW
(2006) Development of a physiologically based pharmacokinetic model for
deltamethrin in the adult male Sprague-Dawley rat. Toxicological sciences : an
official journal of the Society of Toxicology 93:432-442.
Morgan K, Stevens EB, Shah B, Cox PJ, Dixon AK, Lee K, Pinnock RD, Hughes J,
Richardson PJ, Mizuguchi K, Jackson AP (2000) beta 3: an additional auxiliary
subunit of the voltage-sensitive sodium channel that modulates channel gating
with distinct kinetics. Proceedings of the National Academy of Sciences of the
United States of America 97:2308-2313.
Mortuza T, Chen C, White CA, Cummings BS, Muralidhara S, Gullick D, Bruckner JV
(2018) Toxicokinetics of Deltamethrin: Dosage Dependency, Vehicle Effects, and
Low-Dose Age-Equivalent Dosimetry in Rats. Toxicological sciences : an official
journal of the Society of Toxicology 162:327-336.
Narahashi T (1996) Neuronal ion channels as the target sites of insecticides.
Pharmacology & toxicology 79:1-14.
Narahashi T (2000) Neuroreceptors and ion channels as the basis for drug action: past,
present, and future. The Journal of pharmacology and experimental therapeutics
294:1-26.
64 Noebels JL (2002) Sodium channel gene expression and epilepsy. Novartis Foundation
symposium 241:109-120; discussion 120-103, 226-132.
Ohmori H, Ogura H, Yasuda M, Nakamura S, Hatta T, Kawano K, Michikawa T,
Yamashita K, Mikoshiba K (1999) Developmental neurotoxicity of phenytoin on
granule cells and Purkinje cells in mouse cerebellum. Journal of neurochemistry
72:1497-1506.
Oros DR, Werner I (2005) Pyrethroid Insecticides: An Analysis of Use Patterns,
Distributions, Potential Toxicity and Fate in the Sacramento-San Joaquin Delta
and Central Valley.
Oslowski CM, Urano F (2011) Measuring ER stress and the unfolded protein response
using mammalian tissue culture system. Methods in enzymology 490:71-92.
Oulhote Y, Bouchard MF (2013) Urinary metabolites of organophosphate and pyrethroid
pesticides and behavioral problems in Canadian children. Environmental health
perspectives 121:1378-1384.
Papadopoulos V (2004) In search of the function of the peripheral-type benzodiazepine
receptor. Endocrine research 30:677-684.
Patino GA, Isom LL (2010) Electrophysiology and beyond: multiple roles of Na+ channel
beta subunits in development and disease. Neuroscience letters 486:53-59.
Perez-Fernandez V, Garcia MA, Marina ML (2010) Characteristics and enantiomeric
analysis of chiral pyrethroids. Journal of chromatography A 1217:968-989.
Perez-Reyes E (2003) Molecular physiology of low-voltage-activated t-type calcium
channels. Physiological reviews 83:117-161.
65 Pesticides NRCCSo, Chemicals IO, Quality NRCCACoSCfE, Secretariat NRCCE
(1986) Pyrethroids: Their Effects on Aquatic and Terrestrial Ecosystems:
National Research Council of Canada, NRCC Associate Committee on Scientific
Criteria for Environmental Quality.
Planells-Cases R, Caprini M, Zhang J, Rockenstein EM, Rivera RR, Murre C, Masliah
E, Montal M (2000) Neuronal death and perinatal lethality in voltage-gated
sodium channel alpha(II)-deficient mice. Biophysical journal 78:2878-2891.
Rehman H, Ali M, Atif F, Kaur M, Bhatia K, Raisuddin S (2006) The modulatory effect of
deltamethrin on antioxidants in mice. Clinica chimica acta; international journal of
clinical chemistry 369:61-65.
Rehman H, Althbyani A, Saggu S, Zahid A, Mohan D, Ansari A (2014) Systematic
review on pyrethroid toxicity with special reference to deltamethrin. Journal of
Entomology and Zoology Studies 2:60-70.
Richardson JR, Taylor MM, Shalat SL, Guillot TS, 3rd, Caudle WM, Hossain MM,
Mathews TA, Jones SR, Cory-Slechta DA, Miller GW (2015) Developmental
pesticide exposure reproduces features of attention deficit hyperactivity disorder.
FASEB journal : official publication of the Federation of American Societies for
Experimental Biology 29:1960-1972.
Rickard J, Brodie ME (1985) Correlation of blood and brain levels of the neurotoxic
pyrethroid deltamethrin with the onset of symptoms in rats. Pesticide
Biochemistry and Physiology 23:143-156.
Romero A, Ramos E, Castellano V, Martinez MA, Ares I, Martinez M, Martinez-
Larranaga MR, Anadon A (2012) Cytotoxicity induced by deltamethrin and its
66 metabolites in SH-SY5Y cells can be differentially prevented by selected
antioxidants. Toxicology in vitro : an international journal published in association
with BIBRA 26:823-830.
Satoh T, Hosokawa M (2006) Structure, function and regulation of carboxylesterases.
Chemico-biological interactions 162:195-211.
Schettgen T, Heudorf U, Drexler H, Angerer J (2002) Pyrethroid exposure of the general
population-is this due to diet. Toxicol Lett 134:141-145.
Schilling MA, Inman SL, Morford LL, Moran MS, Vorhees CV (1999) Prenatal phenytoin
exposure and spatial navigation in offspring: effects on reference and working
memory and on discrimination learning. Neurotoxicology and teratology 21:567-
578.
Scollon EJ, Starr JM, Godin SJ, DeVito MJ, Hughes MF (2009) In vitro metabolism of
pyrethroid pesticides by rat and human hepatic microsomes and cytochrome
p450 isoforms. Drug metabolism and disposition: the biological fate of chemicals
37:221-228.
Scott JG, Matsumura F (1983) Evidence for two types of toxic actions of pyrethroids on
susceptible and DDT-resistant german cockroaches. Pesticide Biochemistry and
Physiology 19:141-150.
Shafer TJ, Meyer DA (2004) Effects of pyrethroids on voltage-sensitive calcium
channels: a critical evaluation of strengths, weaknesses, data needs, and
relationship to assessment of cumulative neurotoxicity. Toxicology and applied
pharmacology 196:303-318.
67 Shafer TJ, Meyer DA, Crofton KM (2005) Developmental neurotoxicity of pyrethroid
insecticides: critical review and future research needs. Environmental health
perspectives 113:123-136.
Shah BS, Stevens EB, Pinnock RD, Dixon AK, Lee K (2001) Developmental expression
of the novel voltage-gated sodium channel auxiliary subunit beta3, in rat CNS.
The Journal of physiology 534:763-776.
Sheets LP, Doherty JD, Law MW, Reiter LW, Crofton KM (1994) Age-dependent
differences in the susceptibility of rats to deltamethrin. Toxicology and applied
pharmacology 126:186-190.
Shelton JF, Geraghty EM, Tancredi DJ, Delwiche LD, Schmidt RJ, Ritz B, Hansen RL,
Hertz-Picciotto I (2014) Neurodevelopmental disorders and prenatal residential
proximity to agricultural pesticides: the CHARGE study. Environmental health
perspectives 122:1103-1109.
Silver KS, Du Y, Nomura Y, Oliveira EE, Salgado VL, Zhorov BS, Dong K (2014)
Voltage-Gated Sodium Channels as Insecticide Targets. Advances in insect
physiology 46:389-433.
Soderlund DM (2012) Molecular mechanisms of pyrethroid insecticide neurotoxicity:
recent advances. Archives of toxicology 86:165-181.
Soderlund DM, Casida JE (1977) Effects of pyrethroid structure on rates of hydrolysis
and oxidation by mouse liver microsomal enzymes. Pesticide Biochemistry and
Physiology 7:391-401.
Soderlund DM, Bloomquist JR (1989) Neurotoxic actions of pyrethroid insecticides.
Annual review of entomology 34:77-96.
68 Soderlund DM, Clark JM, Sheets LP, Mullin LS, Piccirillo VJ, Sargent D, Stevens JT,
Weiner ML (2002) Mechanisms of pyrethroid neurotoxicity: implications for
cumulative risk assessment. Toxicology 171:3-59.
Song G, Moreau M, Efremenko A, Lake BG, Wu H, Bruckner JV, White CA, Osimitz TG,
Creek MR, Hinderliter PM, Clewell HJ, Yoon M (2019) Evaluation of Age-Related
Pyrethroid Pharmacokinetic Differences in Rats: Physiologically-Based
Pharmacokinetic Model Development Using In Vitro Data and In Vitro to In Vivo
Extrapolation. Toxicological sciences : an official journal of the Society of
Toxicology 169:365-379.
Symington SB, Clark JM (2005) Action of deltamethrin on N-type (Cav2.2) voltage-
sensitive calcium channels in rat brain. Pesticide Biochemistry and Physiology
82:1-15.
Symington SB, Frisbie RK, Clark JM (2008) Characterization of 11 commercial
pyrethroids on the functional attributes of rat brain synaptosomes. Pesticide
Biochemistry and Physiology 92:61-69.
Symington SB, Frisbie RK, Kim H-J, Clark JM (2007a) Mutation of threonine 422 to
glutamic acid mimics the phosphorylation state and alters the action of
deltamethrin on Cav2.2. Pesticide Biochemistry and Physiology 88:312-320.
Symington SB, Frisbie RK, Lu KD, Marshall Clark J (2007b) Action of cismethrin and
deltamethrin on functional attributes of isolated presynaptic nerve terminals from
rat brain. Pesticide Biochemistry and Physiology 87:172-181.
Tornero-Velez R, Mirfazaelian A, Kim KB, Anand SS, Kim HJ, Haines WT, Bruckner JV,
Fisher JW (2010) Evaluation of deltamethrin kinetics and dosimetry in the
69 maturing rat using a PBPK model. Toxicology and applied pharmacology
244:208-217.
Verkhratsky A (2005) Physiology and pathophysiology of the calcium store in the
endoplasmic reticulum of neurons. Physiological reviews 85:201-279.
Verschoyle RD, Aldridge WN (1980) Structure-activity relationships of some pyrethroids
in rats. Archives of toxicology 45:325-329.
Vinayagam MM (2017) Molecular Mechanism of Neurodevelopmental Toxicity Risks of
Occupational Exposure of Pyrethroid Pesticide with Reference to Deltamethrin -
A Critical Review. BAOJ Pathol, an open access journal 1:1-14.
Vorhees CV, Acuff-Smith KD, Schilling MA, Moran MS (1995) Prenatal exposure to
sodium phenytoin in rats induces complex maze learning deficits comparable to
those induced by exposure to phenytoin acid at half the dose. Neurotoxicology
and teratology 17:627-632.
Wagner-Schuman M, Richardson JR, Auinger P, Braun JM, Lanphear BP, Epstein JN,
Yolton K, Froehlich TE (2015) Association of pyrethroid pesticide exposure with
attention-deficit/hyperactivity disorder in a nationally representative sample of
U.S. children. Environmental health : a global access science source 14:44.
Wallace RH, Scheffer IE, Barnett S, Richards M, Dibbens L, Desai RR, Lerman-Sagie
T, Lev D, Mazarib A, Brand N, Ben-Zeev B, Goikhman I, Singh R, Kremmidiotis
G, Gardner A, Sutherland GR, George AL, Jr., Mulley JC, Berkovic SF (2001)
Neuronal sodium-channel alpha1-subunit mutations in generalized epilepsy with
febrile seizures plus. Am J Hum Genet 68:859-865.
70 Wang D, Zou L, Jin Q, Hou J, Ge G, Yang L (2018) Human carboxylesterases: a
comprehensive review. Acta Pharmaceutica Sinica B 8:699-712.
Wang J, Yarov-Yarovoy V, Kahn R, Gordon D, Gurevitz M, Scheuer T, Catterall WA
(2011) Mapping the receptor site for alpha-scorpion toxins on a Na+ channel
voltage sensor. Proceedings of the National Academy of Sciences of the United
States of America 108:15426-15431.
Wang M, Wey S, Zhang Y, Ye R, Lee AS (2009) Role of the unfolded protein response
regulator GRP78/BiP in development, cancer, and neurological disorders.
Antioxid Redox Signal 11:2307-2316.
Wang SY, Wang GK (2003) Voltage-gated sodium channels as primary targets of
diverse lipid-soluble neurotoxins. Cellular signalling 15:151-159.
Whyatt RM, Camann DE, Kinney PL, Reyes A, Ramirez J, Dietrich J, Diaz D, Holmes D,
Perera FP (2002) Residential pesticide use during pregnancy among a cohort of
urban minority women. Environmental health perspectives 110:507-514.
Williams MK, Rundle A, Holmes D, Reyes M, Hoepner LA, Barr DB, Camann DE,
Perera FP, Whyatt RM (2008) Changes in pest infestation levels, self-reported
pesticide use, and permethrin exposure during pregnancy after the 2000-2001
U.S. Environmental Protection Agency restriction of organophosphates.
Environmental health perspectives 116:1681-1688.
Williams MT, Gutierrez A, Vorhees CV (2018) Effects of Acute Exposure of Permethrin
in Adult and Developing Sprague-Dawley Rats on Acoustic Startle Response and
Brain and Plasma Concentrations. Toxicological sciences : an official journal of
the Society of Toxicology 165:361-371.
71 Williams MT, Gutierrez A, Vorhees CV (2019) Effects of Acute Deltamethrin Exposure in
Adult and Developing Sprague Dawley Rats on Acoustic Startle Response in
Relation to Deltamethrin Brain and Plasma Concentrations. Toxicological
sciences : an official journal of the Society of Toxicology 168:61-69.
Wolansky MJ, Harrill JA (2008) Neurobehavioral toxicology of pyrethroid insecticides in
adult animals: a critical review. Neurotoxicology and teratology 30:55-78.
Wu A, Liu Y (2000) Apoptotic cell death in rat brain following deltamethrin treatment.
Neuroscience letters 279:85-88.
Wu A, Li L, Liu Y (2003) Deltamethrin induces apoptotic cell death in cultured cerebral
cortical neurons. Toxicology and applied pharmacology 187:50-57.
Xiang H, Kinoshita Y, Knudson CM, Korsmeyer SJ, Schwartzkroin PA, Morrison RS
(1998) Bax involvement in p53-mediated neuronal cell death. The Journal of
neuroscience : the official journal of the Society for Neuroscience 18:1363-1373.
Xu C, Bailly-Maitre B, Reed JC (2005) Endoplasmic reticulum stress: cell life and death
decisions. The Journal of clinical investigation 115:2656-2664.
Xue Z, Li X, Su Q, Xu L, Zhang P, Kong Z, Xu J, Teng J (2013) Effect of synthetic
pyrethroid pesticide exposure during pregnancy on the growth and development
of infants. Asia-Pacific journal of public health 25:72s-79s.
Yadav S, Johri A, Dhawan A, Seth PK, Parmar D (2006) Regional specificity in
deltamethrin induced cytochrome P450 expression in rat brain. Toxicology and
applied pharmacology 217:15-24.
72 Yang Z, Zhang Y, Jiang Y, Zhu F, Zeng L, Wang Y, Lei X, Yao Y, Hou Y, Xu L, Xiong C,
Yang X, Hu K (2017) Transcriptional responses in the hepatopancreas of
Eriocheir sinensis exposed to deltamethrin. PloS one 12:e0184581.
Yoon KJ, Hyatt JL, Morton CL, Lee RE, Potter PM, Danks MK (2004) Characterization
of inhibitors of specific carboxylesterases: development of carboxylesterase
inhibitors for translational application. Molecular cancer therapeutics 3:903-909.
Yousef MI, Awad TI, Mohamed EH (2006) Deltamethrin-induced oxidative damage and
biochemical alterations in rat and its attenuation by Vitamin E. Toxicology
227:240-247.
Zhang F, Xu X, Li T, Liu Z (2013) Shellfish toxins targeting voltage-gated sodium
channels. Mar Drugs 11:4698-4723.
73 Figures and Legends
Figure 1: Chemical structure of the Type II pyrethroid, DLM. Pyrethroids contain an alcohol and acid moiety which are connected by an ester bond. Many pyrethroids have various isomeric forms, however, DLM exists only as a cis isomer. Image is modified from Shafer, Meyer and Crofton (2005).
74
Figure 2: VGSC subunit structure. Both the α- and β-subunit representative images are displayed. The α-subunit is made up of 4 transmembrane domains (denoted by domain
I-IV), each of which are made up of 6 transmembrane segments (S1-4 make up the voltage sensor; S5-6 form the pore) and a re-entrant loop (between S5 and 6) which is involved in ion selectivity. An intracellular loop connecting domains 3 and 4 functions as the inactivation gate, which can plug the channel pore restricting ion flow. The β- subunit is a single transmembrane domain. Details on channel structure was found from several reviews on VGSCs (Wang and Wang, 2003; Catterall et al., 2007; Davies et al.,
2007; King et al., 2008; Wang et al., 2011; Du et al., 2013; Zhang et al., 2013; Silver et al., 2014).
75 Chapter Behavioral test/Assay Construct measured Age tested (P) Result Decreased locomotor activity Open-Field (OF) Novel locomotor activity 60 (0.25, 0.5, and 1 mg/kg DLM) Elevated Zero Maze (EZM) Anxiety-like behavior 61 No treatment related effects Rats learn of escape route in water mazes; assess swim Straight Channel ability 62 No treatment related effects Impaired cognitive flexibility; Decreased path efficiency and increased average heading error Allocentric, hippocampal during reversal (0.5 and 1 mg/kg dependent L&M DLM males and females) and shift (1 mg/kg DLM males) trials; Morris Water Maze (MWM) 63-85 acquisition learning spared
Egocentric, striatal dependent Impaired egocentric learning and L&M memoru; Increased errors and Cincinnati Water Maze (CWM) 86-103 latency (1 mg/kg DLM males only) Increased startle reactivity (0.5 Acoustic and Tactile startle and 1 mg/kg DLM males only); (ASR/TSR) Startle reflextivity 104 regardless of startle stimuli Acoustic startle (ASR) + Effect of prestimulus on startle prepulse inhibition (PPI) reflextivity 105 No treatment related effects
Increased freezing during Associative learning, conditioning day 1 (0.5 and 1 amygdala and hippocampal mg/kg DLM males only); Impaired dependent contextual memory - decreased freezing during contextual freezing Conditioned Freezing 106-108 day 2 (0.25 and 1 mg/kg DLM) 2 Amphetamine (AMPH) AMPH-induced locomotor Challenge activity 109 No treatment related effects Decreased locomotor activity following MK-801 administration - DLM rats under-responded to MK-801-induced locomotor hyperactivity-inducing effects of MK-801 Challenge activity 116 MK-801 (1 mg/kg DLM)
Determine levels of monoamines and (DA, NE, 5- HT) and metabolites (DOPAC, 5-HIAA, HVA) in neostriatum Tissue collected - Decreased levels of hippocampal Monoamine analysis and hippocampus 123-130 NE (0.5 and 1 mg/kg DLM)
Measure amplification of targeted DNA molecule in real time; DA and serotonin receptors and transporters and Quantitative polymerase chain VGSC subunits in neostriatum Tissue collected - Decreased Drd1 mRNA in the reaction (qPCR) and hippocampus 123-130 neostriatum * Measurement of field excitatory postsynaptic potentials (fEPSPs) in CA1 of the hippocampus; assessment of synaptic potential; cellular correlate to learning and Increased LTP response following Long-Term Potentiation (LTP) memory 25-35 tetanizing stimulus ** Measured AMPH stimulated extracellular DA release in the Decreased stimulated Stimulated DA release n. accumbens ≥ 60 extracellular DA release *
76 Measurement of field excitatory postsynaptic potentials (fEPSPs) in CA1 of the hippocampus; assessment of synaptic potential; cellular Adult Long-Term Potentiation correlate to learning and Increased LTP response following (LTP) memory ≥ 60 tetanizing stimulus ** Protein expression analysis of dopamine receptors (Drd1, Drd2) and transporter (DAT) and glutamate receptors (AMPAR subunits GluR1 and GluR2; NMDAR subunits NR1, Western Blot analysis of NR2A, and NR2B) in the Increased NR2A and decreased Dopamine and Glutamate hippocampus, n. accumbens, Tissue collected - NR2B in the hippocampus of DLM systems and neostriatum ≥ 60 treated males ** Measured potassium stimulated extracellular 3 glutamate release in the Stimulated glutamate release hippocampus ≥ 60 No treatment related effects * Tissue collected - Protein expression analysis of Pro-caspase-3: pro- and cleaved caspase-3 in 21; Cleaved No treatment related effects (** Western Blot analysis of the hippocampus, n. caspase-3: 3, 9, pro-caspase-3; *cleaved caspase- caspase-3 accumbens, and neostriatum 15, and 20 3) Increased TUNEL positive cells in Measure of DNA the hippocampus and striatum; Terminal deoxynucleotidyl fragmentation in hippocampus Dentate gyrus (region of transferase dUTP nick end and striatum; in Tissue collected - hippocampus) had increased labeling (TUNEL) situ assessment of apoptosis 21 TUNEL positive cells *
Measure protein levels of proinflammatory cytokines (IFN- γ, IL-10, IL-13, IL-1β, IL-4, IL-5, IL-6, KC/GRO, and TNF-α) in the hippocampus, n. Tissue collected - Decreased IL-1β (did not reach Cytokine assay accumbens, and neostriatum 20 significance; p=0.0616) *
Table 1: Experimental outcomes for Chapter 2 and Chapter 3. Assays, construct measured and age (P) of testing for Chapter 2 and 3. Order of testing was chosen from least stressful to more stressful to reduce the chances of testing on one test affecting the next. **1 mg/kg DLM males and females compared with controls, *1 mg/kg DLM males only compared with controls. Abbreviations: 5-HIAA, 5-hydroxyindoleacetic acid;
5-HT, serotonin; AMPH, Amphetamine; ASR/TSR, Acoustic and tactile startle response;
CWM, Cincinnati water maze; DA, dopamine; DLM, Deltamethrin; DRD1, dopamine receptor subunit D1; DRD2, dopamine receptor subunit D2; DAT, dopamine transporter;
77 DLM, deltamethrin; DOPAC, 3,4-dihydroxyphenylacetic acid; ECD, electrochemical detector; fEPSP, field excitatory postsynaptic potential; EZM, elevated zero maze;
GluR1, AMPA receptor subunit R1; GluR2, AMPA receptor subunit R2; HPLC, high performance liquid chromatograph; HVA, homovanillic acid; IFN-γ, interferon gamma;
IL-1β, interleukin 1β; IL-4, interleukin 4; IL-5, interleukin 5; IL-6, interleukin 6; IL-10, interleukin 10, IL-13, interleukin 13; KC/GRO, keratinocyte chemoattractant/ human growth-regulated oncogene; LTP, long-term potentiation; MWM, Morris water maze; N. accumbens, nucleus accumbens; NE, norepinephrine; NR1, NMDA receptor subunit
NR1; NR2A, NMDA receptor subunit NR2A; NR2B, NMDA receptor subunit NR2B; OF,
Open field; PPI, pre-pulse inhibition; qPCR, quantitative polymerase chain reaction;
TNF-α, Tumor Necrosis Factor alpha; TUNEL, Terminal deoxynucleotidyl transferase dUTP nick end labeling.
78 CHAPTER 2
Deltamethrin exposure daily from postnatal day 3-20 in Sprague-Dawley rats
causes long-term cognitive and behavioral deficits
Emily M. Pitzer*, Chiho Sugimoto*, Gary A. Gudelsky†, Courtney L. Huff Adams†,
Michael T. Williams*, and Charles V. Vorhees*,
*Dept. of Pediatrics, University of Cincinnati College of Medicine, and Division of
Neurology, Cincinnati Children’s Research Foundation, Cincinnati, OH, 45229 USA
†College of Pharmacy, University of Cincinnati, Cincinnati, OH 45267 USA
Published in Toxicological Sciences (2019)
79 ABSTRACT
Pyrethroids are synthetic insecticides that act acutely on voltage gated sodium channels to prolong channel opening and depolarization. Epidemiological studies find that exposure to pyrethroids are associated with neurological and developmental abnormalities in children. The long-term effects of Type II pyrethroids, such as deltamethrin (DLM), on development have received little attention. We exposed
Sprague-Dawley rats to DLM by gavage at doses of 0, 0.25, 0.5, and 1.0 mg/kg/day from postnatal day (P) 3-20 in a split-litter design. Following behavioral testing as adults, monoamine levels, release, and mRNA were assessed via high performance liquid chromatography, microdialysis, and qPCR, respectively. Long-term potentiation
(LTP) was assessed at P25-35. Developmental DLM exposure resulted in deficits in allocentric and egocentric learning and memory, increased startle reactivity, reduced conditioned contextual freezing, and attenuated MK-801 induced hyperactivity compared with controls. Startle and egocentric learning were preferentially affected in males. DLM-treated rats exhibited increased CA1 hippocampal LTP, decreased extracellular dopamine release by microdialysis, reduced dopamine D1 receptor mRNA expression in neostriatum, and decreased norepinephrine levels in the hippocampus.
The data indicate that neonatal DLM exposure has adverse long-term effects on learning, memory, startle, glutamatergic function, LTP, and norepinephrine.
80 INTRODUCTION
Pyrethroids are synthetic analogs of pyrethrins derived from chrysanthemums.
Pyrethroids bind to voltage gated sodium channels (VGSCs), slowing activation and inactivation that results in prolonged depolarization (Soderlund, 2012). There are two classes of pyrethroids: Type I and Type II (Soderlund, 2012). Both types prolong VGSC opening leading to repetitive action potentials, but Type II pyrethroids prolong this effect compared with Type I pyrethroids (Costa, 2013). This results in persistent depolarization, repetitive firing (Bradberry et al., 2005), and action potential blockade.
Pyrethroids are used in agriculture, households, lawns, schools, and parks, as well as directly on children for head lice, on pets for ticks and fleas, and on furniture for bedbugs. The United States Environmental Protection Agency restrictions on residential organophosphate pesticide use resulted in increased use of pyrethroids
(Power and Sudakin, 2007; Williams et al., 2008). This increase is a concern for children as they are more susceptible to the effects of these compounds than adults
(Landrigan, 1993); however, studies examining the effect of exposure to pyrethroids on brain development and behavior are limited Neurodevelopmental and behavioral outcomes in children are altered after pyrethroid exposure to 3-phenoxybenzoic acid (3-
PBA) as assessed by urinary pyrethroid metabolite levels. A study showed an inverse association between 3-PBA levels collected from prenatal urine from the pregnant mothers and cognition, social adaptation, and motor function in 1-year-old Chinese infants (Xue et al., 2013). A positive association was reported between residential proximity to where pyrethroids were used before and during gestation and diagnosis of
Autism Spectrum Disorder (ASD) or delayed cognitive and adaptive development in
81 children (Shelton et al., 2014). Urinary 3-PBA levels in children identified from the
National Health and Nutrition Examination Survey (NHANES) data were associated with higher prevalence of attention deficit hyperactivity disorder (ADHD) (Richardson et al.,
2015) and increased hyperactive-impulsive symptoms in boys (Wagner-Schuman et al.,
2015). Associations between pyrethroid metabolites in children and psychopathological disorders were also seen in a Canadian Health Measures Survey (CHMS) (Oulhote and
Bouchard, 2013).
Rodent studies indicate that developmental exposure from embryonic day 0–21 to the Type II pyrethroid deltamethrin (DLM) increases dopamine (DA) transporter and
DA D1 receptor (DRD1) levels in the nucleus accumbens, while decreasing extracellular
DA release in the striatum of adult mice (Richardson et al., 2015). In addition to alterations in DA biomarkers, Richardson et al. (2015) observed deficits in learning, memory, attention, and impulsivity, and increased open-field activity. By contrast, in adult rats, DLM alters serotonin as well as dopamine (Hossain et al., 2006; Hossain et al., 2013). Gestational DLM exposure in rats causes deficits in learning and memory when tested at 6-12 weeks of age, alters cholinergic circuitry, increases striatal DOPAC levels, alters open-field activity and rearing, and reduces cytochrome P450s (Aziz et al.,
2001; Lazarini et al., 2001; Johri et al., 2006). DLM exposure from postnatal day 10-16 alters muscarinic and nicotinic densities in hippocampus and cerebral cortex and increases spontaneous motor activity in mice (Eriksson and Nordberg, 1990; Eriksson and Fredriksson, 1991).
However, there are no data on developmental DLM exposure on striatal or hippocampal mediated learning and memory and other behaviors. Accordingly, the
82 present study investigated the long-term effects of developmental exposure to DLM by gavage on postnatal days 3-20 for effects on learning and memory, anxiety, open-field activity, startle, conditioned freezing, and activity after drug challenge.
MATERIALS AND METHODS
Animals
The protocol was approved by the Institutional Animal Care and Use Committee of Cincinnati Children’s Research Foundation and adhered to guidelines on the care and use of animals in research by the U.S. National Institutes of Health. Male and nulliparous female Sprague-Dawley rats (175-200 g upon arrival, CD IGS; strain #001,
Charles River, Raleigh, NC) were maintained on a freely available NIH-07 diet (LabDiet,
Richmond, IN) and reverse osmosis filtered/UV sterilized water. Rats were acclimated to the AAALAC International accredited vivarium for 1-3 weeks before breeding. The vivarium was maintained on a 14-10-hour light-dark cycle (lights on at 600 h) with controlled temperature (19 ± 1 ºC) and humidity (50 ± 10 %). Females were paired with males in wire bottom cages. The day a sperm plug was found was designated embryonic day 0, and females were placed in individual cages with standard bedding and stainless steel enclosure for enrichment (Vorhees et al., 2008). Day of birth was designated postnatal day 0 (P0). On P3 litters were culled to 4 males and 4 females using a random number table. On P7 rats were numbered using ear punches. Dams were weighed when offspring were P3 and weekly from P7 to the end of the experiment.
Offspring were housed 2/cage of the same sex starting on P28 when separated from dams.
83 Treatment Groups
Pups were randomly assigned to four treatment groups and given: 0 (corn oil
(CO)), 0.25, 0.5, or 1.0 mg/kg DLM (Bayer Crop Science, Frankfurt, Germany >99.9% pure). DLM was dissolved in corn oil (Acros Organics, Geel, Belgium) in a dosing volume of 5 mL/kg and administered once per day by gavage from P3-20. This period is roughly equivalent to third trimester to early postnatal development in humans and
P7-10 approximates birth (Semple et al., 2013). 32 litters were used for behavior and another 20 litters for LTP (P25-35). Ten of the former litters were used for HPLC neurotransmitter determinations or DRD1 mRNA expression by qPCR and 12 litters for dopamine release by microdialysis (see Table 1).
Behavioral Testing
Testing began on P60 (adulthood). All behaviorally tested rats received all tests in the following order: (1) open-field (OF), (2) elevated zero maze (EZM), (3) straight channel swimming, (4) Morris water maze (MWM), (5) Cincinnati water maze (CWM), (6) acoustic and tactile startle (ASR/TSR), (7) pre-pulse inhibition of acoustic startle (PPI),
(8) conditioned freezing, (9) OF with amphetamine (AMPH) challenge, and (10) OF with
MK-801 challenge. Test order was based on estimated test stress arranged from lowest to highest.
Open-field (OF)
On P60 rats were tested for locomotor activity in polycarbonate arenas (41 cm x
41 cm x 38 cm high, PAS system, San Diego Instruments, San Diego, CA). Each arena had infrared photocells positioned in the X and Y coordinates spaced 2.5 cm apart.
Rats were tested for 1 h, and data analyzed in 5-min intervals. For all tests except
84 water mazes, the apparatus was cleaned between rats with EPA-approved, non-toxic, denaturing, antimicrobial agent Process NPD (Steris Corp., St. Louis, MO).
Elevated Zero Maze (EZM)
EZM was conducted on P61. The apparatus was a circular runway constructed of grey textured aluminum with opposing closed and open quadrants. The runway is 10 cm wide, 100 cm i.d., 30 cm tall walls (infrared transparent walls on the inside) for the closed quadrants, 1.3 cm clear acrylic high curb for the open quadrants, and elevated
50 cm above the floor (Stoelting Co., Wood Dale, IL). Rats were placed in an enclosed quadrant and allowed to explore for 5 min. Movement was tracked through a camera mounted above the maze using Any-Maze software (Stoelting Co., Wood Dale, IL).
Time spent in open and closed quadrants, latency to first open entry, and number of quadrants entered were analyzed.
Straight Channel
Straight channel testing was conducted on P62. The apparatus was a 244 cm long x 15 cm wide x 50 cm deep channel filled halfway with water with a submerged platform at one end. Time to swim from one end to the other was recorded on 4 consecutive trials. Rats learn from this how to escape; latency to reach the goal is used to evaluate swimming ability, motivation, and swim speed.
Morris Water Maze (MWM)
Rats began MWM testing on P63 (Vorhees and Williams, 2006, 2014). The apparatus is a circular pool (244 cm diameter x 51 cm deep) made of laminated black polyethylene with a conical bottom filled halfway with water (25 cm depth). On the walls surrounding the maze were distinctive distal cues (posters and geometric shapes).
85 Rats were tested in four phases: acquisition, reversal, shift, and cued-random. The first
3 phases consisted of four trials/day for six days to find a hidden platform with a probe trial on day-7. The inter-trial interval (ITI) was 10-15 s. Rats not finding the platform within 2 min were placed on it for the ITI. The platform was positioned equidistant between the wall and the center and submerged ~2 cm below the surface. The platform position for acquisition was in the SW quadrant, for reversal in the NE quadrant, and for shift in the NW quadrant. Platform sizes were 10, 7, and 5 cm in diameter for acquisition, reversal, and shift, respectively. Probe trials lasted 45 s. Performance was tracked using Any-Maze (Stoelting Co., Wood Dale, IL). Latency, distance travelled, path efficiency, swim speed, and average heading error were analyzed on platform trials. On probe trials, average distance to reach the location where the platform used to be, swim speed, and average heading error were analyzed. After shift, rats were given cued-random testing. For this, black curtains were closed around the maze to block distal cues. Testing consisted of 4 trials/day for 2 days. The platform (10 cm) was marked with a yellow ball mounted on a stainless-steel rod that extended 10 cm above the water. Platform and start positions were randomized on every trial during this phase and latency recorded.
Cincinnati Water Maze (CWM)
Testing began the day following MWM on P86. The apparatus is a 10-unit multiple T water maze with dead-end T-shaped cul-de-sacs branching from a central path extending from the start to the goal where a submerged platform provided escape
(Vorhees, 1987; Vorhees et al., 2008; Braun et al., 2015; Braun et al., 2016; Vorhees and Williams, 2016). Testing was conducted under infrared light using an infrared-
86 sensitive camera mounted on the ceiling. The camera was connected to a monitor in an adjacent room where the experimenter counted errors. Rats were acclimated to the dark for no less than 5 min and were tested for 18 days, 2 trials/day (limit 5 min/trial).
Rats not finding the platform within 5 min on trial-1 were rested for 5-10 min before trial-
2 in a cage with absorbent towels. Rats reaching the goal on trial-1 received trial-2 immediately. Latency and errors (head and shoulder entries into the stem or arm of a
T) were analyzed (Vorhees and Williams, 2016). Water was maintained at 21 ± 1 ºC.
Acoustic and Tactile startle (ASR/TSR) and prepulse inhibition (PPI)
ASR/TSR and PPI were assessed for 2 days (P104-105). Testing was in SR-
LAB apparatus (San Diego Instruments, San Diego, CA). Rats were placed in acrylic cylindrical holders (size large) mounted on a flat base plate and positioned inside a sound attenuating cabinet with fan and light. Base plates have piezoelectric accelerometers attached to the underside to detect deflections. On P104, the ASR/TSR session consisted of 50 acoustic trials followed by 50 tactile trials. The tactile stimulus was a 20 ms, 60 psi air puff directed to the dorsum of the rat. The acoustic stimulus was a 20 ms, 120 dB SPL mixed frequency white noise burst (rise time 1.5 ms). On
P105, rats were tested for PPI. Rats were given 100 trials in a 5 x 5 Latin square sequence of 25 trials repeated 4 times with prepulses of 0, 73, 77, or 82 dB. Prepulses preceded pulses by 70 ms from onset to onset and each stimulus lasted 20 ms.
Maximum startle amplitude in mV (Vmax) was analyzed. The recording window was 100 ms and the ITI was 20 s. Testing began with a 5 min acclimation period prior to the start of trials.
87 Conditioned Freezing
Testing was from P106-108. The test consisted of conditioning on day-1, assessing contextual memory on day-2, and cued memory on day-3. On day-1, rats were placed in an acrylic chamber 25 cm x 25 cm (San Diego Instruments, San Diego,
CA) with a metal grid floor, LED light on the lid, and photocells to record movement.
Test chambers were situated in sound-attenuating cabinets. Day-1 lasted 12 min and consisted of 6 min of acclimation followed by 6 min with an 82 dB 30 s tone paired with a 0.9 mA, 1 s foot shock that occurred during the last one second of tone. Tone-shock pairing was repeated 3 times spaced 180 s apart. On day-2, rats were placed in the same apparatus for 6 min with no tone or foot-shock. On day-3, the rat was placed in a different, smaller, triangular black box for 6 min. For the first 3 min there was no stimulus; but for the last 3 min the tone was presented without foot-shock.
Amphetamine (AMPH) Challenge
On P109 rats were tested for AMPH-induced locomotor activity in the OF apparatus. Rats were first given 30 min of habituation, followed by injection with physiological saline (3 mL/kg, s.c.) and tested for another 30 min. Rats were then administered (+)-amphetamine sulfate (1.0 mg/kg in 3 mL/kg, s.c., free base > 99% pure; Sigma, St. Louis, MO) and placed back in the apparatus for 120 min. Dependent measures were total activity counts (successive beam breaks) and center time analyzed in 5 min intervals.
MK-801 Challenge
One week following AMPH, rats were tested for MK-801 induced activity using the same procedure. Rats were first given 30 min to re-habituate, followed by 30 min
88 after saline injection, and then 120 min following MK-801 injections (0.2 mg/kg in 3 mL/kg, s.c., Sigma-Aldrich, St. Louis, MO).
Neurotransmitters
One to two weeks following MK-801, rats were decapitated, brains removed and neostriatum and hippocampus dissected over ice, and stored at -80 oC (Williams et al.,
2007). For monoamines, tissues were weighed, sonicated in a 0.1 N perchloric acid
(PCA), and centrifuged at 2100 x g for 13 min at 4 ºC; the collected supernatant (20
µL/sample) was loaded onto a Dionex UltiMate® 3000 analytical autosampler (Thermo
Scientific) for injection into a high performance liquid chromatograph (HPLC) with an electrochemical detector (ECD). The HPLC-ECD system consisted of an ESA 5840 pump, an ESA 5020 Guard Cell, a Supelco Supelcosil™ LC-18 column (15 cm x 4.6 mm, 3 μM; Sigma-Aldrich Co.), and a Coulochem III ECD (Thermo Scientific). The pump flow rate was 0.5 mL/min at 28 °C. The guard cell potential was +350 mV and the potential of the Coulochem III was -150 mV for E1 and +250 mV for E2. Commercially available MD-TM mobile phase (Thermo Fisher Scientific) was used that consisted of
89% water, 10% acetonitrile, and 1% sodium phosphate monobasic (monohydrate).
Monoamine standards for norepinephrine (NE), DA, serotonin (5-HT) 3,4- dihydroxyphenylacetic acid (DOPAC), 5-hydroxyindoleacetic acid (5-HIAA), and homovanillic acid (HVA) were prepared in a solution of 0.1 N PCA. Monoamine standards were run individually as well as on a single chromatogram for peak verification. For a standard curve, chromatograms of all neurotransmitter standards were run at different concentrations.
89 qPCR
Tissue was collected as above. RNA was isolated from neostriatum and hippocampus of 10 control and 10 1.0 mg/kg DLM male rats. To extract hippocampal
RNA, tissue was homogenized in 1 mL of TRIzol per 50-100 mg of tissue; 0.2 mL of chloroform per 1 mL of TRIzol reagent was added to the homogenate, vortexed, and incubated for 2-3 min then centrifuged at 12,000 x g for 15 min at 2-8 oC. The RNA precipitate was isolated, and 0.5 mL of isopropyl alcohol added, then incubated for 10 min at room temperature, and centrifuged for 10 min at 12,000 x g at 2-4 oC. The supernatant was removed, and the RNA pellet washed twice with 1 mL of 75% ethanol and centrifuged at 7,500 x g for 5 min. The RNA pellet was dried and dissolved in autoclaved water. For neostriatum, RNA isolation was completed using the
RNAqueous-Micro Kit filter for smaller tissue samples. RNA was quantified by
Nanodrop (Thermo Scientific, St. Louis, MO). Reverse transcription (RT) reactions were performed using iScript RT supermix (Bio-Rad Laboratories, Inc.) combined with diluted RNA template (neostriatum concentration = 0.5 ng; hippocampal concentration =
2.0 ng) for a total volume of 20 μL. Reactions were carried out in a thermal cycler as follows: 5 min at 25 oC, 20 min at 46 oC, and 1 min at 95 oC. qPCR contained 4 µL of cDNA, 2 µL of each primer (forward and reverse), and 10 µL SYBR Green Master Mix
(Qiagen) in a 20 µL volume. The mixture was placed in 96-well plates and qPCR performed on an ABI Prism 7900HT analyzer (Applied Biosystems) using the following protocol: 50 oC for 2 min, 95 oC for 10 min, 50 cycles at 95 oC for 15 s, and 60 oC for 1 min. Primers were from Integrated DNA Technologies and selected based on primer efficiency determined to be 95-100%. Rat primer sequences are shown in Table 2.
90 Negative controls included qPCR in the absence of template. Ct values were determined using SDS 2.4 software with a threshold set at 0.5. The denaturation curve showed a single peak, representative of a single PCR product. The average Ct values from quadruplicate repeats were calculated. These were averaged with values obtained from 2 independent qPCR experiments. Changes in mRNA were quantified using the
ΔΔCt method with actin as reference (Livak and Schmittgen, 2001).
Long-Term Potentiation (LTP)
Between P25-35, male and female rats treated with 1 mg/kg DLM or CO and not behaviorally tested, were decapitated and brains dissected and placed in ice-cold artificial cerebrospinal fluid (aCSF: 124 mM NaCl, 3 mM KCl, 1.25 mM NaH2PO4/H2O, 1 mM MgCl2/6H2O, 10 mM glucose, 2 mM CaCl2, 26 mM NaHCO3) saturated with 95%
O2/5% CO2 as described (Amos-Kroohs et al., 2017). Sections were chilled for 1-2 min, trimmed, and mounted on a vibratome (Vibratome 1500, Warner Instruments, Hamden,
CT) using super glue. Ice-cold, oxygenated aCSF was added to the stage containing tissue. Parasagittal hippocampal sections (350 µm) were cut and placed in a bath of oxygenated aCSF at 32 °C. Slices rested for at least 1 h. LTP was measured in CA1 using a MED64 multielectrode system (Alpha Med Sciences, Kadoma, Japan) with an 8 x 8 array of contacts. Electrode arrays were 50 µm x 50 µm and spaced 150 µm apart
(Shimono et al., 2002). Pulses were delivered dorsally, and excitatory postsynaptic potentials (EPSPs) downstream were obtained until a stable baseline that lasted at least
10 min. Once a stable baseline was achieved, a theta burst [tetanus = 100 Hz in 10 bursts (4 pulses/burst) delivered at a frequency of 5 Hz for 2 s] was applied and field
EPSPs and EPSP slopes were recorded for 90 min. The mean baseline value was
91 calculated and percent change from baseline after the theta burst were the data analyzed.
Microdialysis
A subset of male rats (>P60) not behaviorally tested were used to examine amphetamine stimulated DA release in the N. accumbens via microdialysis. Rats were implanted with a stainless-steel guide cannula under isoflurane (2-4%; IsoThesia; Butler
Animal Health Supply, Dublin, OH) anesthesia 72 h prior to the insertion of a dialysis probe. On the morning of the dialysis experiment, a concentric style dialysis probe was inserted through the guide cannula into the N. accumbens such that the tip of the probe was located at the following coordinates: A/P, 1.2 mm relative to bregma; L, 0.8 mm; V,
-8.4 mm (Paxinos et al., 1985). The probes are connected to an infusion pump set to deliver Dulbecco’s phosphate buffered saline (2 µL/min) and an acclimation period of 3 h followed. Four baseline samples were then obtained prior to the administration of
AMPH (2 mg/kg, i.p, dissolved in saline in a dosing volume of 1 mL/kg). DA in dialysis samples was quantified by HPLC similar to those described (Nair and Gudelsky, 2004).
Placement of dialysis probes were verified in postmortem coronal sections.
Data Analyses
Some developmental effects of DLM were reported previously (Hossain et al.,
2013; Hossain et al., 2015; Richardson et al., 2015), therefore, we hypothesized deficits for these outcomes. These data were analyzed using a priori methods. Pre-planned comparisons used Dunnett’s test to compare each DLM group with CO. For these
Dunnett p-values are given, not F-ratios. However, to test for interactions, mixed linear
ANOVAs were used (SAS Proc Mixed, SAS Institute 9.3, Cary, NC). To control for litter,
92 litter was a random factor in these models. For models with a repeated measure factor, the autoregressive-1 covariance structure was used. First-order Kenward-Roger degrees of freedom were calculated. Mortality was analyzed by Chi-square.
Parametric data are presented as least square (LS) mean ± SEM. Statistical significance was set at p < 0.05.
RESULTS
Mortality and Body weight
DLM did not increase mortality. DLM decreased growth as reflected in body weight in the 1.0 mg/kg (p < 0.0001) and 0.5 mg/kg (p < 0.0001) DLM groups during dosing, regardless of sex (Fig. 1A). These weight differences in the 1.0 and 0.5 mg/kg
DLM groups persisted into adulthood compared with the CO group (Fig. 1B). There was a treatment x age interaction on body weight during treatment: P3-20
[F(51,3538)=16.85, p < 0.001] and afterward: P21-119 [F(42,2568)=2.85, p < 0.001].
Differences in body weight between treated and control rats emerged around P7 (p <
0.01) and increased from P8-20 (p < 0.0001) (Fig. 1A). Differences continued for the remainder of the experiment in the 1.0 and 0.5 mg/kg DLM groups until the end of the study at P119 (p < 0.0001) (Fig. 1B). The 0.25 mg/kg DLM group did not differ from CO controls. In addition to treatment related effects on body weight, sex main effects [P3-
20: F(1,190)=7.16, p < 0.001; P21-119: F(1,186)=1121.49, p < 0.0001] were observed during and following dosing, with females having lower body weights than males. Sex x treatment [F(3,186)=6.98, p < 0.001], sex x age [F(14,2533)=126.27, p < 0.0001], and sex x treatment x age [F(42,2568)=1.76, p < 0.001] interactions were also observed
93 following dosing from P21-119. Further analyses of the sex x treatment x age interaction showed decreased body weights for the male and female 0.5 and 1.0 mg/kg groups at all ages with the exception that on P21 there were no differences in males nor in the 0.5 mg/kg female group compared with the female CO group.
Open-Field and EZM
DLM-exposed rats, regardless of dose, displayed reduced OF activity [treatment:
F(3,298)=3.15, p<0.05] (Fig 2A); there were also main effects of interval
[F(11,2051)=165.78, p<0.0001] and sex [F(1,294)=5.75, p<0.05] and an interval x sex interaction [F(11,2051)=2.97, p < 0.001], with females more active than males. In the
EZM, there was no effect of treatment on latency to first quadrant entry, number of arm entries, or percent time in open quadrants (Fig 2B).
Straight channel swimming
No significant differences in swim latency were found (Control: 16.3 ± 0.9 s
(n=55); 0.25 mg/kg: 16.4 ± 1.0 s (n=51); 0.5 mg/kg: 17.2 ± 0.9 s (n=52); 1.0 mg/kg: 17.9
± 1.0 s (n=45)) suggesting no motor or motivation differences among the groups.
Morris Water Maze
There was no main effect of DLM on MWM acquisition for latency, swim speed, or path efficiency (Fig. 3A, B, D, respectively) or average heading error (not shown).
In reversal, both the 1.0 mg/kg (p < 0.05) and 0.5 mg/kg (p < 0.05) DLM groups had reduced path efficiency compared with CO controls (Fig 3E); also, the 1.0 mg/kg (p <
0.05) and 0.5 mg/kg (p < 0.05) dose groups had increased average heading error compared with CO controls (not shown). In addition, there was a sex main effect [path efficiency: F(1,280)=55.71, p < 0.0001; average heading error: F(1,274)=63.56, p <
94 0.0001] and a sex x day interaction [path efficiency: F(5,939)=3.63, p < 0.01; average heading error: F(5,938)=5.19, p < 0.0001]. Path efficiency and average heading error were also affected during shift. For path efficiency, the 1.0 mg/kg DLM group had reduced path efficiency (p < 0.05) compared with CO controls (Fig. 3F); there was also a sex main effect [F(1,270)=117.05, p < 0.0001], treatment x sex interaction
[F(3,270)=2.72, p < 0.05], and sex x day interaction [F(5,929)=3.76, p < 0.01]. Slice- effect ANOVAs showed, the treatment x sex interaction was in 1.0 mg/kg DLM treated males (p < 0.01) compared with CO males. For heading error, there was a sex main effect [F(1,268)=142.46, p < 0.0001], treatment x sex interaction [F(3,268)=3.05, p <
0.05)] and a sex x day interaction [F(5,935)=4.65, p < 0.001]. The treatment x sex interaction was attributable to the 1.0 mg/kg (p < 0.05) and 0.25 mg/kg treated males (p
< 0.05) having greater average heading errors compared with CO males. No effects were observed on probe trials (not shown) or cued-random trials (Fig 3C).
Cincinnati Water Maze
The learning curves for errors and latency are shown (Fig 4A & B, respectively).
No main effects were found, however, both latency and errors had significant main effects of sex [latency: F(1,427)=22.61, p < 0.0001; errors: F(1,441)=16.99, p < 0.0001] with males performing worse than females. There were, however, treatment x sex interactions [latency: F(3,427)=3.65, p < 0.01; errors: F(3,441)=3.73, p < 0.01]. Male 1 mg/kg DLM rats had increased errors (p < 0.05; Fig 4C) and latency (p < 0.01; Fig 4D) compared with CO males. Females showed no significant differences (Fig 4D & F).
95 Startle
For ASR/TSR, 1.0 mg/kg (p<0.01) and 0.5 mg/kg (p<0.05) DLM treated rats displayed increased startle compared with CO controls. However, there was a treatment x sex [F(3,138)=3.23, p < 0.05] interaction. Males had increased startle responses [F(3,138.5)=5.92, p < 0.001] that were significant in the 0.5 mg/kg (p < 0.05) and 1.0 mg/kg (p < 0.001) DLM groups compared with CO males (Fig. 5); there were no differences for females. There was also a main effect of stimulus type
[F(1,161)=643.24, p < 0.0001] and a trend for stimulus type x treatment interaction
[F(3,161)=2.64, p < 0.06]; no trend was seen on ASR trails. There were no main effects or interactions for PPI (not shown).
Conditioned Freezing
On day-1, there was no main effect of DLM, but there was a main effect for sex
[F(1,148)=29.29, p < 0.0001] and interval [F(1,174)=895.01, p < 0.0001] and a treatment x sex interaction [F(3,148)=3.10, p < 0.05]. For the latter, 1.0 mg/kg DLM treated males exhibited more freezing (p < 0.05) compared with CO controls (Fig. 6A); there were no differences for females (Fig. 6B). On day-2, the 1.0 mg/kg and 0.25 mg/kg DLM groups showed reduced contextual memory compared with CO controls, regardless of sex (p < 0.04; Fig 6C). There were no effects on cued memory (Fig 6D).
Drug Challenge
Amphetamine: There were no treatment-related effects on OF activity during habituation or after saline. After AMPH, all groups increased activity, with an interval main effect [F(23,3825)=11.75, p < 0.0001] (Fig 7A). Although the high and low dose
DLM groups trended higher than CO controls the effect was not significant (Fig 7A).
96 MK-801: After a one-week washout period, rats were tested after MK-801 challenge. There were no group differences prior to drug administration during habituation or saline (Fig. 7B). MK-801 induced increased activity and in all groups
(interval main effect [F(23,4490)=78.49, p < 0.0001]). Rats in the 1.0 mg/kg DLM group showed less drug-induced hyperactivity compared with CO control (treatment main effect: [F(3,277)=4.38, p < 0.01]; there were no differences in other groups. There was also a treatment x interval interaction [F(69,4554)=1.58, p < 0.01; Fig. 7B]; this was attributable to the higher activity at 30 min in the 0.25 mg/kg DLM group than the other groups that had similar activity as CO controls. In addition, the 1.0 mg/kg DLM treated rats exhibited lower levels of activity compared to CO controls by 30 min after MK-801 administration with 0.5 mg/kg DLM treated rats in between. mRNA and monoamine analysis
For neostriatum and hippocampus there were no effects on brain levels of DA,
DOPAC, HVA, 5-HT, or 5-HIAA. In the hippocampus, there was a decrease in NE in the 0.5 mg/kg (p < 0.05) and 1.0 mg/kg (p < 0.05) DLM groups compared with CO controls (Fig 8A). In addition, DLM 1.0 mg/kg treated males had reduced Drd1 mRNA expression in the neostriatum compared with controls [t(17)=2.33, p<0.05; Fig 8B]. No other mRNA changes detailed in Table 2 were observed.
Microdialysis
No treatment-related differences were found for basal DA release. After an acute dose of amphetamine (2 mg/kg), there were main effects of treatment [F(1,27.3)=6.94, p
< 0.05] and time [F(8,95.1)=27.73, p < 0.0001], and a treatment x time interaction
[F(8,95.1)=3.15, p < 0.01]. DA release was significantly decreased in 1.0 mg/kg DLM-
97 treated males compared with CO males at 30 (p<0.001), 60 (p<0.001), and 90 min
(p<0.05) following AMPH (Fig. 8C).
LTP
1.0 mg/kg DLM-treated rats showed increased LTP after a tetanizing stimulation compared with CO controls (Fig. 8D) [treatment: F(1,38.7)=47.35, p < 0.0001]. No differences were found prior to the tetanizing stimulus.
DISCUSSION
Pyrethroids, such as DLM, affect VGSC acutely, however the long-term consequences of developmental exposure are poorly characterized. This is the case despite the fact that exposed children are found to have neuropsychological disorders in epidemiological studies, and mice developmentally exposed have long-term physiological and behavioral changes (Aziz et al., 2001; Oulhote and Bouchard, 2013;
Xue et al., 2013; Shelton et al., 2014; Richardson et al., 2015; Wagner-Schuman et al.,
2015). The present study builds on recent mouse developmental studies to include assessment of cognitive effects in rats.
The data show that developmental DLM results in cognitive and other behavioral deficits, several of which were sexually dimorphic. Most of the effects were seen at the highest dose (1 mg/kg), fewer at the mid dose (0.5 mg/kg), and the least at the lowest dose (0.25 mg/kg). The exposure period (P3-20) was designed to span the human equivalent of third trimester in utero brain development in humans extending into the early postnatal period. This is when the cortex reaches maximum growth (Gottlieb et al., 1977; Dobbing and Sands, 1979; Kretschmann et al., 1986; Herschkowitz et al.,
98 1997; Khazipov et al., 2001; Bockhorst et al., 2008), when synaptogenesis (Zagon and
McLaughlin, 1977; Levitt, 2003) and gliogenesis (Catalani et al., 2002; Kriegstein and
Alvarez-Buylla, 2009) plateau, axonal and dendritic arborization increase (Cowan, 1979;
Bockhorst et al., 2008; Baloch et al., 2009), and neurotransmitter and receptor systems become established (Hedner et al., 1986; Romijn et al., 1991). We administered DLM orally for consistency with other studies (Aziz et al., 2001; Johri et al., 2006; Hossain et al., 2015; Richardson et al., 2015) and because ingestion is the major route by which pregnant women and chidlren are exposed.
While DLM exposure reduced growth, it did not affect swim latency in the straight water channel test or swim speed in the MWM, hence, it was not a factor in the learning and memory deficits seen on egocentric learning in the CWM or spatial learning and memory in the MWM. Unlike these tests where performance and learning can be separated, we cannot rule out possible body weight effects on other outcomes, however, the weight differences at the time of testing for the 1 mg/kg group relative to the CO controls were small (Males: 16.8% and 12.9%, Females 12.7% and 8.6% at the beginning and end of testing, respectively). Moreover, for conditioned freezing there were differential effects of DLM on contextual (affected) versus cued memory (not affected) even though body weight differences were the same throughout this test; hence, body weight differences cannot account this outcome. Moreover, body weight differences cannot explain the effects of DLM on open-field because all DLM groups were equally affected (reduced) on this test whereas body weight differences were dose-dependent. Similarly, during drug challenge, all DLM groups started out equally active despite body weight differences. After amphetamine or MK-801 were given,
99 activity changes were bidirectional (exaggerated after amphetamine and attenuated after MK-801) whereas body weight changes were unidirectional (reduced). While body weight reductions are common in developmental neurotoxicity studies, they rarely correlate with behavioral effects and the present study reinforces that dissociation.
We found that 1.0 mg/kg and 0.5 mg/kg DLM-exposed rats have impaired allocentric reversal learning in the MWM. Impairments in the MWM are indicative of hippocampal dysfunction (Morris et al., 1982). These effects were selective: spatial acquisition was spared but deficits emerged during reversal and shift. Reversal reflects cognitive flexibility and the DLM-exposed rats were impaired at adjusting to the new platform location and on shift trials as retrograde interference increased. These deficits may reflect perseveration of behaviors in which they had difficulty extinguishing previously learned habits (Vorhees and Williams, 2006). Impaired cognitive flexibility may also reflect inhibitory control deficits, since part of switching to a new goal is inhibiting the impulse to go to the previous goal location. Hippocampal endoplasmic reticulum stress and learning deficits in the MWM were reported after DLM exposure
(Hossain et al., 2015), however, ours is the first study to report deficits in cognitive flexibility. Also, in the Hossain et al. (2015) study, the dose of DLM was higher (3 mg/kg) than here and was in adult mice in which testing was done immediately following treatment (Hossain et al., 2015), whereas here there was >30 days between exposure and testing. For conditioned freezing, we found contextual deficits in the 1.0 mg/kg and
0.5 mg/kg DLM-treated groups, which is also a hippocampal mediated type of learning
(Curzon et al., 2009).
100 DLM-treated rats also had altered LTP (1 mg/kg DLM). LTP is a cellular substrate of spatial learning and memory (Morris et al., 1986; Bliss and Collingridge,
1993; Bannerman et al., 1995; Moser et al., 1998; Herring and Nicoll, 2016; Nicoll,
2017). In brain slices, after a tetanizing stimulus, DLM-treated rats showed increased
LTP compared with CO controls. At first glance this may appear paradoxical. Most studies find diminished LTP in conjunction with memory impairment, whereas our data show increased LTP with impaired memory in the MWM. However, our study is not the first to show such effects. Studies examining mice deficient in α-amino-3-hydroxy-5- methyl-4-isoxazolepropionic acid (AMPA) receptor subunit-GluR2 (Jia et al., 1996), reduced post synaptic density protein (PSD-95) (Migaud et al., 1998), reduced phosphodiesterase 4D (Pde4d-/-) (Rutten et al., 2008), and disrupted family member 2 gene (Fmr2) (Gu et al., 2002) show increased LTP in conjunction with impaired memory in MWM, conditioned fear, and/or novel object recognition. As with many biological phenomena, too little or too much deviation from homeostasis leads to dysfunction. To better understand the effects of DLM on spatial learning and memory and LTP, in future studies we will assess CA1 LTP in rats at the same age we found spatial deficits to ensure that these effects coincide. Also, we plan to assess proteins involved in the
LTP, including NMDA and AMPA receptors. We will also determine glutamate release in the hippocampus by microdialysis.
The 1.0 mg/kg-treated rats under-responded to the hyperactivity-inducing effects of MK-801 compared with CO controls. MK-801 is often used to examine hippocampal
LTP-related behavior (Coan et al., 1987; Abraham and Mason, 1988; Gilbert and Mack,
101 1990). In an open-field, MK-801 causes hyperactivity. The reduced activating effects of
MK-801 in the 1.0 mg/kg DLM group suggests glutamatergic signaling dysregulation.
DLM administration from E0-P21 in mice increased DAT and DRD1 protein expression in the offspring (Richardson et al., 2015). Based on this we predicted that
DLM would lead to CWM learning deficits since performance on this task depends on striatal DA (Braun et al., 2015; Braun et al., 2016; Vorhees and Williams, 2016). As predicted, increased latencies and errors were found and they were sexually dimorphic, with males affected. The reason for this male-specific effect is not known, but is consistent with male effects on dopaminergic markers and memory following developmental DLM exposure in mice (Richardson et al., 2015). We also found male- specific effects of DLM on ASR and TSR.
DLM-treated rats had decreased extracellular amphetamine-stimulated DA release by microdialysis in the n. accumbens, a result similar to that found in mice developmentally treated with DLM (Richardson et al., 2015). In addition, DLM-treated rats had decreased Drd1 mRNA compared with CO controls, whereas increased DRD1 protein levels in DLM-treated male mice were seen previously (Richardson et al., 2015).
Although not significant we observed a trend toward increased locomotor activity following AMPH administration in the 1.0 mg/kg and 0.25 mg/kg DLM groups, a pattern consistent with changes in DRD1. This should be tested further using selective dopaminergic agonists, such as SKF-82958. Additional studies are also needed to understand the impact of DLM on other DA biomarkers. As for differences between our data and those of Richardson et al. (2015), we note there are differences in timing, dose, species, and measures (mRNA versus protein) that may explain or partially
102 explain the different outcomes. To resolve this, we plan to assess additional DA protein biomarkers in our model. It may also be worth testing stimulated DA release in striatum and PFC to see if DA effects found in the n. accumbens occur in other DA-rich regions.
DLM-exposed rats were less active in a novel environment (first open-field test).
This is similar to what Johri et al (2006) reported after DLM, however, their exposure was prenatal. In mice given DLM throughout gestation and lactation, increased open- field activity was seen but only in males (Richardson et al., 2015). The reason for differences between studies is not clear, but we note that Johri et al. (2006) and
Richardson et al. (2015) exposed prenatally and/or both prenatally and postnatally whereas we exposed only postnatally.
VGSCs mediate the initial effects of DLM (Soderlund, 2012). Male mice exposed to 3 mg/kg DLM throughout gestation and lactation exhibit decreased VGSC subunit mRNA expression measured when they were adults (Magby and Richardson, 2017).
We did not see similar alterations in VGSC gene expression by qPCR, suggesting that species may account for this difference in outcome.
The study also has limitations: (1) DLM doses were higher than the human reference dose (0.01 mg/kg) (Goodis, 2017). However, the doses are similar to those in the literature (Aziz et al., 2001; Johri et al., 2006; Hossain et al., 2015; Richardson et al.,
2015), and below the LD50 for P11 rats of 5.1 mg/kg (Sheets et al., 1994).
Pharmacokinetic modeling suggest that humans would have higher peak DLM brain concentrations compared to rats at comparable doses (Kim et al., 2010) including in young rats (Kim et al., 2010; Williams et al., 2018) which is relevant given that children clear pyrethroids slower than adults (Crow et al., 2007), however, more research is
103 needed on dose comparability. (2) Our exposure was during the first three weeks after birth but there are no pharmacokinetic or pharmacodynamic data with this dosing regimen to help understand the internal level of exposure. (3) Biochemical assays were performed following behavior; the effect of this experience on neurochemical markers has yet to be determined. It is known that exercise and handling can affect monoamine levels in the hippocampus and striatum (Wang et al., 2013; Rabelo et al., 2015), but whether or how the tests used here affected biomarkers will require additional experiments. Nevertheless, all rats had the same tests and therefore were matched, and our focus was on relative differences rather than absolute differences. Overall, the results indicate that developmental DLM causes long-term changes in behavior, cognition, LTP, some dopaminergic markers, and glutamatergic function. Further research to identify site(s) of CNS injury from this exposure are still needed. Disruption of dopaminergic pathways is one emerging aspect of the developmental effects of DLM, but there are likely to be others uncovered in future studies.
104 ACKNOWLEDGMENT
This research was supported by NIH T32 ES007051 (E.M.P.) and funds from the
Division of Neurology, Cincinnati Children’s Research Foundation. Behavioral testing was conducted through the Animal Behavior Core of Cincinnati Children’s Research
Foundation.
105 References
Abraham WC, Mason SE (1988) Effects of the NMDA receptor/channel antagonists
CPP and MK801 on hippocampal field potentials and long-term potentiation in
anesthetized rats. Brain research 462:40-46.
Amos-Kroohs RM, Davenport LL, Atanasova N, Abdulla ZI, Skelton MR, Vorhees CV,
Williams MT (2017) Developmental manganese neurotoxicity in rats: Cognitive
deficits in allocentric and egocentric learning and memory. Neurotoxicol Teratol
59:16-26.
Aziz MH, Agrawal AK, Adhami VM, Shukla Y, Seth PK (2001) Neurodevelopmental
consequences of gestational exposure (GD14-GD20) to low dose deltamethrin in
rats. Neuroscience letters 300:161-165.
Baloch S, Verma R, Huang H, Khurd P, Clark S, Yarowsky P, Abel T, Mori S,
Davatzikos C (2009) Quantification of brain maturation and growth patterns in
C57BL/6J mice via computational neuroanatomy of diffusion tensor images.
Cerebral cortex (New York, NY : 1991) 19:675-687.
Bannerman DM, Good MA, Butcher SP, Ramsay M, Morris RG (1995) Distinct
components of spatial learning revealed by prior training and NMDA receptor
blockade. Nature 378:182-186.
Bliss TVP, Collingridge GL (1993) A synaptic model of memory: long-term potentiation
in the hippocampus. Nature 361:31.
Bockhorst KH, Narayana PA, Liu R, Ahobila-Vijjula P, Ramu J, Kamel M, Wosik J,
Bockhorst T, Hahn K, Hasan KM, Perez-Polo JR (2008) Early postnatal
106 development of rat brain: in vivo diffusion tensor imaging. Journal of
neuroscience research 86:1520-1528.
Bradberry SM, Thanacoody HK, Watt BE, Thomas SH, Vale JA (2005) Management of
the cardiovascular complications of tricyclic antidepressant poisoning : role of
sodium bicarbonate. Toxicological reviews 24:195-204.
Braun AA, Amos-Kroohs RM, Gutierrez A, Lundgren KH, Seroogy KB, Vorhees CV,
Williams MT (2016) 6-Hydroxydopamine-Induced Dopamine Reductions in the
Nucleus Accumbens, but not the Medial Prefrontal Cortex, Impair Cincinnati
Water Maze Egocentric and Morris Water Maze Allocentric Navigation in Male
Sprague-Dawley Rats. Neurotox Res 30:199-212.
Braun AA, Amos-Kroohs RM, Gutierrez A, Lundgren KH, Seroogy KB, Skelton MR,
Vorhees CV, Williams MT (2015) Dopamine depletion in either the dorsomedial
or dorsolateral striatum impairs egocentric Cincinnati water maze performance
while sparing allocentric Morris water maze learning. Neurobiology of learning
and memory 118:55-63.
Catalani A, Sabbatini M, Consoli C, Cinque C, Tomassoni D, Azmitia E, Angelucci L,
Amenta F (2002) Glial fibrillary acidic protein immunoreactive astrocytes in
developing rat hippocampus. Mechanisms of ageing and development 123:481-
490.
Coan EJ, Saywood W, Collingridge GL (1987) MK-801 blocks NMDA receptor-mediated
synaptic transmission and long term potentiation in rat hippocampal slices.
Neuroscience letters 80:111-114.
107 Costa LG (2013) Toxic effects of pesticides. In: Cassarett & Doull's Toxicology: The
Basic Science of Poisons, Eighth Edition (Amdur MO, Doull, J., Klaassen, C.D.,
ed), pp 933-980. New York: McGraw-Hill.
Cowan WM (1979) The development of the brain. Scientific American 241:113-133.
Crow JA, Borazjani A, Potter PM, Ross MK (2007) Hydrolysis of pyrethroids by human
and rat tissues: examination of intestinal, liver and serum carboxylesterases.
Toxicology and applied pharmacology 221:1-12.
Curzon P, Rustay NR, Browman KE (2009) Cued and Contextual Fear Conditioning for
Rodents. In: Methods of Behavior Analysis in Neuroscience, 2nd Edition (J.J. B,
ed). Boca Raton, FL: CRC Press/Taylor & Francis.
Dobbing J, Sands J (1979) Comparative aspects of the brain growth spurt. Early human
development 3:79-83.
Eriksson P, Nordberg A (1990) Effects of two pyrethroids, bioallethrin and deltamethrin,
on subpopulations of muscarinic and nicotinic receptors in the neonatal mouse
brain. Toxicol Appl Pharmacol 102:456-463.
Eriksson P, Fredriksson A (1991) Neurotoxic effects of two different pyrethroids,
bioallethrin and deltamethrin, on immature and adult mice: changes in behavioral
and muscarinic receptor variables. Toxicol Appl Pharmacol 108:78-85.
FQPA FQPAo (1996) In: Public Law 104-170.
Gilbert ME, Mack CM (1990) The NMDA antagonist, MK-801, suppresses long-term
potentiation, kindling, and kindling-induced potentiation in the perforant path of
the unanesthetized rat. Brain research 519:89-96.
Goodis ML (2017) Deltamethrin; Pesticide Tolerances. In, pp 18574-18580.
108 Gottlieb A, Keydar I, Epstein HT (1977) Rodent brain growth stages: an analytical
review. Biology of the neonate 32:166-176.
Gu Y, McIlwain KL, Weeber EJ, Yamagata T, Xu B, Antalffy BA, Reyes C, Yuva-Paylor
L, Armstrong D, Zoghbi H, Sweatt JD, Paylor R, Nelson DL (2002) Impaired
conditioned fear and enhanced long-term potentiation in Fmr2 knock-out mice.
The Journal of neuroscience : the official journal of the Society for Neuroscience
22:2753-2763.
Hedner J, Lundell KH, Breese GR, Mueller RA, Hedner T (1986) Developmental
variations in CSF monoamine metabolites during childhood. Biology of the
neonate 49:190-197.
Herring BE, Nicoll RA (2016) Long-Term Potentiation: From CaMKII to AMPA Receptor
Trafficking. Annu Rev Physiol 78:351-365.
Herschkowitz N, Kagan J, Zilles K (1997) Neurobiological bases of behavioral
development in the first year. Neuropediatrics 28:296-306.
Hossain MM, DiCicco-Bloom E, Richardson JR (2015) Hippocampal ER stress and
learning deficits following repeated pyrethroid exposure. Toxicological sciences :
an official journal of the Society of Toxicology 143:220-228.
Hossain MM, Suzuki T, Richardson JR, Kobayashi H (2013) Acute effects of pyrethroids
on serotonin release in the striatum of awake rats: an in vivo microdialysis study.
Journal of biochemical and molecular toxicology 27:150-156.
Hossain MM, Suzuki T, Sato N, Sato I, Takewaki T, Suzuki K, Tachikawa E, Kobayashi
H (2006) Differential effects of pyrethroid insecticides on extracellular dopamine
109 in the striatum of freely moving rats. Toxicology and applied pharmacology
217:25-34.
Jia Z, Agopyan N, Miu P, Xiong Z, Henderson J, Gerlai R, Taverna FA, Velumian A,
MacDonald J, Carlen P, Abramow-Newerly W, Roder J (1996) Enhanced LTP in
mice deficient in the AMPA receptor GluR2. Neuron 17:945-956.
Johri A, Yadav S, Singh RL, Dhawan A, Ali M, Parmar D (2006) Long lasting effects of
prenatal exposure to deltamethrin on cerebral and hepatic cytochrome P450s
and behavioral activity in rat offspring. European journal of pharmacology
544:58-68.
Khazipov R, Esclapez M, Caillard O, Bernard C, Khalilov I, Tyzio R, Hirsch J, Dzhala V,
Berger B, Ben-Ari Y (2001) Early development of neuronal activity in the primate
hippocampus in utero. The Journal of neuroscience : the official journal of the
Society for Neuroscience 21:9770-9781.
Kim KB, Anand SS, Kim HJ, White CA, Fisher JW, Tornero-Velez R, Bruckner JV
(2010) Age, dose, and time-dependency of plasma and tissue distribution of
deltamethrin in immature rats. Toxicol Sci 115:354-368.
Kretschmann HJ, Kammradt G, Krauthausen I, Sauer B, Wingert F (1986) Growth of the
hippocampal formation in man. Bibliotheca anatomica:27-52.
Kriegstein A, Alvarez-Buylla A (2009) The glial nature of embryonic and adult neural
stem cells. Annual review of neuroscience 32:149-184.
Landrigan PJM, D.R.; Babich, H.J.; Boardman, B.; Bruckner, J.V.; Gallo, M.A.;
Hutchings, D.E.; Jackson, R.J.; Karol, M.H.; Krewski, D.; Purvis, G.A.; Rizek,
R.L.; Seiber, J.N.; Weil,W.B. (1993) Pesticides in the Diets of Infants and
110 Children. In: (Council NR, ed), p 408. Washington, DC: The National Academies
Press.
Lazarini CA, Florio JC, Lemonica IP, Bernardi MM (2001) Effects of prenatal exposure
to deltamethrin on forced swimming behavior, motor activity, and striatal
dopamine levels in male and female rats. Neurotoxicol Teratol 23:665-673.
Levitt P (2003) Structural and functional maturation of the developing primate brain. The
Journal of pediatrics 143:S35-45.
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego,
Calif) 25:402-408.
Magby JP, Richardson JR (2017) Developmental pyrethroid exposure causes long-term
decreases of neuronal sodium channel expression. Neurotoxicology 60:274-279.
Migaud M, Charlesworth P, Dempster M, Webster LC, Watabe AM, Makhinson M, He Y,
Ramsay MF, Morris RG, Morrison JH, O'Dell TJ, Grant SG (1998) Enhanced
long-term potentiation and impaired learning in mice with mutant postsynaptic
density-95 protein. Nature 396:433-439.
Morris RG, Garrud P, Rawlins JN, O'Keefe J (1982) Place navigation impaired in rats
with hippocampal lesions. Nature 297:681-683.
Morris RG, Anderson E, Lynch GS, Baudry M (1986) Selective impairment of learning
and blockade of long-term potentiation by an N-methyl-D-aspartate receptor
antagonist, AP5. Nature 319:774-776.
Moser EI, Krobert KA, Moser MB, Morris RG (1998) Impaired spatial learning after
saturation of long-term potentiation. Science (New York, NY) 281:2038-2042.
111 Nair SG, Gudelsky GA (2004) Protein kinase C inhibition differentially affects 3,4-
methylenedioxymethamphetamine-induced dopamine release in the striatum and
prefrontal cortex of the rat. Brain Res 1013:168-173.
Nicoll RA (2017) A Brief History of Long-Term Potentiation. Neuron 93:281-290.
Oulhote Y, Bouchard MF (2013) Urinary metabolites of organophosphate and pyrethroid
pesticides and behavioral problems in Canadian children. Environmental health
perspectives 121:1378-1384.
Paxinos G, Watson C, Pennisi M, Topple A (1985) Bregma, lambda and the interaural
midpoint in stereotaxic surgery with rats of different sex, strain and weight.
Journal of neuroscience methods 13:139-143.
Power LE, Sudakin DL (2007) Pyrethrin and pyrethroid exposures in the United States:
a longitudinal analysis of incidents reported to poison centers. Journal of medical
toxicology : official journal of the American College of Medical Toxicology 3:94-
99.
Rabelo PC, Almeida TF, Guimaraes JB, Barcellos LA, Cordeiro LM, Moraes MM,
Coimbra CC, Szawka RE, Soares DD (2015) Intrinsic exercise capacity is related
to differential monoaminergic activity in the rat forebrain. Brain research bulletin
112:7-13.
Richardson JR, Taylor MM, Shalat SL, Guillot TS, 3rd, Caudle WM, Hossain MM,
Mathews TA, Jones SR, Cory-Slechta DA, Miller GW (2015) Developmental
pesticide exposure reproduces features of attention deficit hyperactivity disorder.
FASEB journal : official publication of the Federation of American Societies for
Experimental Biology 29:1960-1972.
112 Romijn HJ, Hofman MA, Gramsbergen A (1991) At what age is the developing cerebral
cortex of the rat comparable to that of the full-term newborn human baby? Early
human development 26:61-67.
Rutten K, Misner DL, Works M, Blokland A, Novak TJ, Santarelli L, Wallace TL (2008)
Enhanced long-term potentiation and impaired learning in phosphodiesterase
4D-knockout (PDE4D) mice. The European journal of neuroscience 28:625-632.
Semple BD, Blomgren K, Gimlin K, Ferriero DM, Noble-Haeusslein LJ (2013) Brain
development in rodents and humans: Identifying benchmarks of maturation and
vulnerability to injury across species. Progress in neurobiology 106-107:1-16.
Sheets LP, Doherty JD, Law MW, Reiter LW, Crofton KM (1994) Age-dependent
differences in the susceptibility of rats to deltamethrin. Toxicology and applied
pharmacology 126:186-190.
Shelton JF, Geraghty EM, Tancredi DJ, Delwiche LD, Schmidt RJ, Ritz B, Hansen RL,
Hertz-Picciotto I (2014) Neurodevelopmental disorders and prenatal residential
proximity to agricultural pesticides: the CHARGE study. Environmental health
perspectives 122:1103-1109.
Shimono K, Baudry M, Ho L, Taketani M, Lynch G (2002) Long-term recording of LTP in
cultured hippocampal slices. Neural plasticity 9:249-254.
Soderlund DM (2012) Molecular mechanisms of pyrethroid insecticide neurotoxicity:
recent advances. Archives of toxicology 86:165-181.
Vorhees CV (1987) Maze learning in rats: a comparison of performance in two water
mazes in progeny prenatally exposed to different doses of phenytoin.
Neurotoxicology and teratology 9:235-241.
113 Vorhees CV, Williams MT (2006) Morris water maze: procedures for assessing spatial
and related forms of learning and memory. Nature protocols 1:848-858.
Vorhees CV, Williams MT (2014) Assessing spatial learning and memory in rodents.
ILAR journal 55:310-332.
Vorhees CV, Williams MT (2016) Cincinnati water maze: A review of the development,
methods, and evidence as a test of egocentric learning and memory.
Neurotoxicol Teratol 57:1-19.
Vorhees CV, Herring NR, Schaefer TL, Grace CE, Skelton MR, Johnson HL, Williams
MT (2008) Effects of neonatal (+)-methamphetamine on path integration and
spatial learning in rats: effects of dose and rearing conditions. International
journal of developmental neuroscience : the official journal of the International
Society for Developmental Neuroscience 26:599-610.
Wagner-Schuman M, Richardson JR, Auinger P, Braun JM, Lanphear BP, Epstein JN,
Yolton K, Froehlich TE (2015) Association of pyrethroid pesticide exposure with
attention-deficit/hyperactivity disorder in a nationally representative sample of
U.S. children. Environmental health : a global access science source 14:44.
Wang J, Chen X, Zhang N, Ma Q (2013) Effects of exercise on stress-induced changes
of norepinephrine and serotonin in rat hippocampus. The Chinese journal of
physiology 56:245-252.
Williams MK, Rundle A, Holmes D, Reyes M, Hoepner LA, Barr DB, Camann DE,
Perera FP, Whyatt RM (2008) Changes in pest infestation levels, self-reported
pesticide use, and permethrin exposure during pregnancy after the 2000-2001
114 U.S. Environmental Protection Agency restriction of organophosphates.
Environmental health perspectives 116:1681-1688.
Williams MT, Gutierrez A, Vorhees CV (2018) Effects of acute deltamethrin exposure in
adult and developing Sprague-Dawley rats on acoustic startle response in
relation to deltamethrin brain and plasma concentrations. Toxicol Sci.
Williams MT, Herring NR, Schaefer TL, Skelton MR, Campbell NG, Lipton JW, McCrea
AE, Vorhees CV (2007) Alterations in body temperature, corticosterone, and
behavior following the administration of 5-methoxy-diisopropyltryptamine ('foxy')
to adult rats: a new drug of abuse. Neuropsychopharmacology : official
publication of the American College of Neuropsychopharmacology 32:1404-
1420.
Xue Z, Li X, Su Q, Xu L, Zhang P, Kong Z, Xu J, Teng J (2013) Effect of synthetic
pyrethroid pesticide exposure during pregnancy on the growth and development
of infants. Asia-Pacific journal of public health 25:72s-79s.
Zagon IS, McLaughlin PJ (1977) Effect of chronic maternal methadone exposure on
perinatal development. Biology of the neonate 31:271-282.
115 Figure Legends
116 Figure 1. Body weight. A, Average daily body weight during dosing from P3–20
(corn oil, CO: n=60 total, 29 males, 31 females; 0.25 mg/kg DLM: n=53 total, 27 males, 26 females; 0.5 mg/kg DLM: n=54 total, 25 males, 29 females; 1.0 mg/kg
DLM: n=51 total, 24 males, 27 females). B, Average weekly body weight following dosing from P21–119 (corn oil, CO: n=57 total, 28 males, 29 females; 0.25 mg/ kg DLM: n=53 total, 27 males, 26 females; 0.5 mg/kg DLM: n=50 total, 23 males,
27 females; 1.0 mg/kg DLM: n=45 total, 20 males, 25 females). ****p<.0001 compared with its respective control group. DLM, deltamethrin.
117
Figure 2. Open-field (OF) locomotor activity and elevated zero maze (EZM). A, Average activity for 60min OF test (corn oil, CO: n=55 total, 25 males, 30 females;
0.25 mg/kg DLM: n=51 total, 26 males, 25 females; 0.5 mg/kg DLM: n=52 total, 24 males, 28 females; 1.0 mg/kg DLM: n=45 total, 20 males, 25 females). B, Percent of time spent in the open arm of EZM (corn oil, CO: n=55 total, 25 males, 30 females; 0.25 mg/kg DLM: n=51 total, 26 males, 25 females; 0.5 mg/kg DLM: n=52 total, 24 males, 28 females; 1.0 mg/kg DLM: n¼45 total, 20 males, 25 females). *p<.05; **p<.01 compared with CO. DLM, deltamethrin.
118
Figure 3. Morris water maze (MWM). A, Acquisition latency across 6 days of testing (4 trials/day). B, Acquisition swim speed average for each treatment tested. C, Cued testing average latency. D–F, Acquisition, reversal, and shift average path efficiency for each treatment. (Corn oil, CO: n=55 total, 25 males, 30 females; 0.25mg/kg DLM: n=51 total, 26 males, 25 females; 0.5mg/kg DLM: n=52 total, 24 males, 28 females; 1.0mg/kg
DLM: n=45 total, 20 males, 25 females.) *p<.05; compared with CO. DLM, deltamethrin.
119
Figure 4. Cincinnati water maze (CWM). A, Average errors made by each treatment across 18 days of testing (2 trials/day), males and females combined. B, Latency to find platform by each treatment across 18 days of testing (2 trials/day), males and females combined. C, Average errors made by treatment for males, D, for females. E,
120 Average latency to find the platform for each treatment for males, F, for females. (Corn oil, CO: n=55 total, 25 males, 30 females; 0.25 mg/kg DLM: n=49 total, 24 males,
25 females; 0.5 mg/kg DLM: n=49 total, 22 males, 27 females; 1.0 mg/kg DLM: n=44 total, 20 males, 24 females.) *p<.05; **p<.01 compared with CO. DLM, deltamethrin.
121
Figure 5. Acoustic and tactile startle response (ASR/TSR). A, Average startle response
(both acoustic and tactile) made by each treatment for both males and females (corn oil, CO: n=55 total, 25 males, 30 females; 0.25 mg/kg DLM: n=51 total, 26 males, 25 females; 0.5 mg/kg DLM: n=52 total, 24 males, 28 females;
1.0 mg/kg DLM: n=45 total, 20 males, 25 females). *p<.05; ***p<.01; compared with CO. DLM, deltamethrin.
122
Figure 6. Conditioned freezing. A, Day 1, male average freezing behavior for both pre- and post-conditioned stimulus freezing. B, Day 1, female average freezing behavior for both pre- and post-conditioned stimulus freezing. C, Day 2, male and female rats were returned to the same test chamber to assess contextual freezing. D, Day
3, male and female rats were placed in a new chamber for 3 min with no stimulus (Pre) and remained in the chamber for 3 more minutes in presence of the tone (Post) to assess cued freezing. Note: scale of day 3 is different because the test chamber was half the size as that used on days 1 and 2 (corn oil, CO: n=51 total, 23 males, 28 females; 0.25 mg/kg DLM: n=47 total, 24 males, 23 females; 0.5 mg/kg DLM: n=48 total, 22 males, 26 females; 1.0 mg/kg DLM: n=43 total, 20 males, 23 females). *p<.05 compared with vehicle. DLM, deltamethrin.
123
124 Figure 7. Drug challenges. A, Amphetamine (AMPH) challenge, rats were placed into locomotor chamber for a total of 3h and examined for activity. Saline and
AMPH (1.0 mg/kg in 3 ml/kg, s.c.) administration are noted by arrows for time of injection (corn oil, CO: n=50 total, 22 males, 28 females; 0.25 mg/kg DLM: n=46 total, 24 males, 22 females; 0.5 mg/kg DLM: n=50 total, 23 males, 27 females;
1.0 mg/kg DLM: n=42 total, 18 males, 24 females). B, MK-801 challenge, using a similar protocol to the AMPH challenge, rats were placed into locomotor chambers for a total of 3h and examined for activity. Saline and MK-801 (0.2 mg/kg in
3 ml/kg, s.c.) administration are noted by arrows for time of injection (corn oil,
CO: n=55 total, 25 males, 30 females; 0.25 mg/kg DLM: n=51 total, 26 males, 25 females; 0.5 mg/kg DLM: n=51 total, 24 males, 27 females; 1.0 mg/kg DLM: n=45 total, 20 males, 25 females. Activity is measured in beam breaks. *p<.05 compared with CO. DLM, deltamethrin.
125
Figure 8. mRNA expression, monoamines, LTP and microdialysis: Norepinephrine concentrations in the hippocampus (A) measured by HPLC-ECD. (Corn oil, CO: n=17 total, 8 males, 9 females; 0.25 mg/kg DLM: n=17 total, 8 males, 9 females; 0.5 mg/kg
DLM: n=17 total, 8 males, 9 females; 1.0 mg/kg DLM: n=14 total, 7males, 7 females.)
Only males treated with the highest dose of DLM or corn oil were assessed for mRNA expression (B), microdialysis (C), and males and females for LTP (D). Drd1 mRNA expression in the neostriatum of male rats treated with 1 mg/kg DLM or corn oil (B).
(Corn oil, CO: n=10 males; 1.0 mg/kg DLM: n=9 males.) Amphetamine (AMPH;
2 mg/kg, i.p.) stimulated DA release in the N. accumbens in control and 1 mg/kg DLM- treated male rats (C). (Corn oil, CO: n=7 males; 1.0 mg/kg DLM: n=8 males.) LTP
126 results for 1 mg/kg DLM-treated rats and corn oil treated rats over time (D). EPSP recordings presented as a percentage of the baseline. The tetanizing stimulus (arrow; tetanus=100Hz in 10 bursts [4 pulses/burst] delivered at a frequency of 5Hz for 2 s) was delivered after 10 min of stable baseline, and then recorded for 90min following stimulation. (Corn oil, CO: n=16 total, 8 males, 8 females; 1.0 mg/kg DLM: n=16 total, 8 males, 8 females.) *p<.05; **p<.01; ***p<.01; ****p<.0001 compared with vehicle.
Abbreviations: DA, dopamine; DLM, deltamethrin; ECD, electrochemical detector;
EPSP, excitatory postsynaptic potential; HPLC, high performance liquid chromatograph; LTP, long-term potentiation; N. accumbens, nucleus accumbens.
127 Table 1 Sample size: rats/treatment/sex Treatment (mg/kg Males Females DLM) CO 25 30 0.25 26 25 0.5 24 28 1.0 20 25
Table 1: Sample size of each sex for each treatment group. Treatment presented as corn oil (CO), or 0.25, 0.5, or 1.0 mg/kg DLM.
128 Table 2 Primer sequence for each gene Product Primer Name Sequence NM Size
5HT1A (Htr1a) F GGTACTGGGCTATCACCGAC NM_012585.1 221
5HT1A (Htr1a) R CGGGATATAGAAAGCGCCGA NM_012585.1 221
5HT2A (Htr2a) F GCTGGGTTTCCTTGTCATGC NM_017254.1 265 GATTGGCATGGATATACCTACAG 5HT2A (Htr2a) R
A NM_017254.1 265
5HT2C (Htr2c) F GACGCTAGCGGGTTGTCA NM_012765.3 280
5HT2C (Htr2c) R GAAACAAGCGTCCACCATCG NM_012765.3 280 TGATGCTAATGTGAGTTCCAACG
5HT4 (Htr4) F AG NM_012853.1 231
5HT4 (Htr4) R AACTCAATGGCACCGAAGGCA NM_012853.1 231
5HT5A (Htr5a) F CCAGGAAGACCAACAGCGTC NM_013148.1 196
5HT5A (Htr5a) R CAGCAGAGGACAAACACCCC NM_013148.1 196
5HT6 (Htr6) F GGTGCCATCTGCTTCACCTA NM_024365.2 277
5HT6 (Htr6) R ACACGGCCTGAGCTATGTTG NM_024365.2 277
5HT7 (Htr7) F CAACTGCCTGGTGGTGATCT NM_022938.2 256
5HT7 (Htr7) R CCCAAGGTACCTGTCGATGC NM_022938.2 256
Actin F AGATCAAGATCATTGCTCCTCCT NM_031144.3 415
Actin R ACGCAGCTCAGTAACAGTCC NM_031144.3 415
B2m F CGAGACCGATGTATATGCTTGC NM_012512.2 445
B2m R GTCCAGATGATTCAGAGCTCCA NM_012512.2 445 NM_001270630 Bdnf F TGATGCTCAGCAGTCAA 160
.1 NM_001270630 Bdnf R CACTCGCTAATACTGTCAC 160
.1
DAT F GCTATGCTGGAAGCTGGTCA NM_012694.2 222
DAT R ATGGCATAGGCCAGTTTCTCC NM_012694.2 222
Drd1 F GTCCACTCTCCTGGGCAATAC NM_012546.2 196
Drd1 R TACCCAGATGTTACAAAAGGGAC NM_012546.2 196
Drd2 F GAAGACACCACTCAAGGGCA NM_012547.1 220
Drd2 R ATCAGGGAGAGTGAGCTGGT NM_012547.1 220
Drd5 F CCACATGATACCGAATGCAG NM_012768.1 146
Drd5 R CACAGTCAAGCTCCCAGACA NM_012768.1 146 Nav 1.1 (Scn1a) ATCTTTACCAACTGACATTGCGTG
F C NM_030875.1 237 Nav 1.1 (Scn1a)
R TTGCTGCCGCCGCCT NM_030875.1 237 Nav 1.2 (Scn2a)
F AGTGGAGAGATGGACGCTCT NM_012647.1 237 Nav 1.2 (Scn2a)
R TTCTTTGATGGGCGTTCCCT NM_012647.1 237
129 Nav 1.3 (Scn3a)
F ACAAGAAGCTGTGCTCTCCC NM_013119.1 236 Nav 1.3 (Scn3a)
R GGTGGTACCGTTACTGTTGC NM_013119.1 236 Nav 1.6 (Scn8a)
F GGCCGTAGGAAATCTGGTGT NM_019266.2 240 Nav 1.6 (Scn8a)
R ATCAGCATGTTCAGGGTGGG NM_019266.2 240 Nav β1 (Scn1b) NM_001271045
F TGTCACGTCTACCGTCTCCT .1 245 Nav β1 (Scn1b) NM_001271045
R GCCAGGTATTCCGAGGCATT .1 245 Nav β2 (Scn2b)
F CACAGCCCACCCGCCTAA NM_012877.1 280 Nav β2 (Scn2b)
R TGGAGGAACATCTCCTCTGAGC NM_012877.1 280 Nav β3 (Scn3b)
F CCTCCGTGGTCTCGGAAATC NM_139097.3 221 Nav β3 (Scn3b)
R CTCAGCACTCAGATCACCTCAA NM_139097.3 221 Nav β4 (Scn4b) NM_001008880
F CTTGCTTCGTGAGGAACCCC .1 219 Nav β4 (Scn4b) NM_001008880
R CGAGACACTCCTTCTTCTTCTCTC .1 219 NM_001270602
NR1 (Grin1) F TCTGACAAGAGTATCCACCTGAG .1 245 NM_001270602
NR1 (Grin1) R GGTCCGCGCTTGTTGTCATA .1 245
SERT F AGCAGTCTGAAGAACAGACCA NM_013031.1 269
SERT R ACCCCTTGTCGGCTTTAGTG NM_013031.1 269
TPH F CTAGAGGATGTGCCGTGGTT NM_173839.2 182
TPH R GGAATGGGCTGGCCATATTT NM_173839.2 182 NM: identification number and product size for each gene.
Table 2: Primer sequence of each analyzed gene for RT-PCR. Primer name, sequence,
NM and product size are given for each gene examined.
130
CHAPTER 3
Long-term effects of developmental deltamethrin exposure: Cellular effects on
the hippocampus in Sprague-Dawley rats
Emily M. Pitzer*, Chiho Sugimoto*, Gary A. Gudelsky†, Michael T. Williams*, and
Charles V. Vorhees*,‡
*Dept. of Pediatrics, University of Cincinnati College of Medicine, and Division of
Neurology, Cincinnati Children’s Hospital Medical Center, Cincinnati, OH, 45229 USA
†College of Pharmacy, University of Cincinnati, Cincinnati, OH 45267 USA
Keywords: Deltamethrin, Glutamate, Dopamine, Long-term potentiation, Pyrethroids,
Rats, Caspase-3, Apoptosis
131 ABSTRACT
Pyrethroid pesticides are widely used and can cause long-term effects after developmental exposure. Epidemiological studies reveal associations between increased pyrethroid metabolite levels and neurological disorders in children. Animal studies find impairments in behavior following developmental pyrethroid exposure.
Among the effects are impairments in learning and memory in rats after exposure to the type II pyrethroid deltamethrin (DLM) when administered prior to weaning. However, little is known about the cellular effects of such exposure. Sprague-Dawley rats were gavaged with 0 or 1.0 mg/kg DLM in corn oil (5 mL/kg/d) from postnatal day P3-20 and assessed in adulthood. No treatment-related effects were found on several dopaminergic markers (dopamine (DA) including the DA transporter (DAT), DA D1 receptor (DRD1), or DA D2 receptor (DRD2)) in neostriatum, n. accumbens, or hippocampus, nor were there changes in α-amino-3-hydroxy-5-methyl-4- isoxazolepropionic acid (AMPA) receptor subunits (GluR1, GluR2) or the N-methyl-D- aspartate (NMDA)-NR1 subunit. However, NMDA-NR2 subunit levels were affected:
DLM increased NMDA-NR2A (p<0.01) and decreased NMDA-NR2B (p<0.01) in the hippocampus in males but not females. Hippocampal CA1 long-term potentiation (LTP) was increased in DLM-treated male adult rats (p<0.0001) but not females, however, potassium stimulated extracellular glutamate release was not affected. In a separate group assessed at the end of treatment on P21, terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) for apoptotic cells was increased in the dentate gyrus of male rats (p<0.01), in the absence of changes in cleaved caspase-3. An analysis of nine proinflammatory cytokines showed a trend for decreased interleukin 1 beta (IL-1β)
132 in male DLM-treated rats on P20. The data provide leads for determining how neonatal
DLM exposure causes neurochemical and cellular changes that may contribute to the neurobehavioral deficits.
133 INTRODUCTION
Deltamethrin (DLM) is a type II pyrethroid pesticide used to kill ectoparasites on animals, insects on agricultural crops, and in public health programs to kill mosquitos for the control of malaria and other disease carrying insects. Pyrethroid use is increasing because of the phase-out of older more toxic pesticides (Barr et al., 2010; Saillenfait et al., 2015). Pyrethroids are also used to control insects on lawns, playgrounds, and parks, and in houses, apartments, and businesses. They are used directly on pets for ticks and fleas and on children for lice.
Adults metabolize pyrethroids efficiently with plasma half-lives of ~11.5 h
(Chrustek et al., 2018). However, children metabolize these compounds slower due to lower metabolic capacity. Children also intake more DLM from exposed surfaces than adults, have immature blood brain barriers (BBB) and lower levels of some metabolic enzymes (Lu et al., 2006; Lu et al., 2010; Morgan, 2012). From epidemiological studies, children show associations between an increase in the common pyrethroid urinary metabolite 3-phenoxybenzoic acid (3-PBA) and neurobehavioral disorders such as autism spectrum disorder (ASD), attention deficit hyperactivity disorder (ADHD), and developmental delay (Oulhote and Bouchard, 2013; Xue et al., 2013; Shelton et al.,
2014; Richardson et al., 2015; Viel et al., 2015; Wagner-Schuman et al., 2015).
Although these associations are not strong (Burns and Pastoor, 2018), they raise concerns about the safety of these compounds for children.
In regard to the safety issues during development, immature rats are more susceptible to acute pyrethroid exposure compared with adults (Cantalamessa, 1993;
Sheets et al., 1994; Williams et al., 2019). Physiological-based pharmacokinetic
134 (PBPK) models show that plasma and brain DLM levels are inversely related to age, with weanling and pre-weanling rats displaying higher concentrations in brain and plasma for longer intervals than adults treated with the same dose (Kim et al., 2010).
This occurs because immature rats have less DLM metabolic capacity (Anand et al.,
2006), as well as increased BBB permeability (Amaraneni et al., 2017).
We previously reported deficits in learning and memory following postnatal day
(P) 3-20 DLM exposure in Sprague-Dawley rats (Pitzer et al., 2019). Locomotor activity in the adult offspring was decreased, acoustic startle reactivity and long-term potentiation (LTP) were increased, and there were cognitive deficits (impaired egocentric learning, allocentric reversal learning, and contextual freezing), and reduced
MK-801 induced hyperactivity. Moreover, most of the effects were limited to males.
Others have found related effects in mice or rats, including impulsivity and attention deficits after developmental DLM exposure (Aziz et al., 2001; Johri et al., 2006;
Richardson et al., 2015).
The poisoning mechanism of pyrethroids is a function of binding of the insecticide to voltage-gated sodium channels (VGSC). When bound, pyrethroids attach to sites that allow channels to open and delay closing resulting in extended depolarization. At high doses, Type II pyrethroids can inhibit channel closing so long they induce depolarization block (Soderlund, 2012). The effects of disrupting VGSC function during development has been investigated. For example, the VGSC α-subunit Nav1.2 knockout mouse has reduced neuronal excitability, high levels of cell death in the brainstem and cortex, and dies shortly after birth (1-2 days) from hypoxia (Planells-
Cases et al., 2000). When the gene encoding Nav1.6 is mutated, mice exhibited hind-
135 limb paralysis, muscle atrophy (P10), and death by P20 (Porter et al., 1996). However,
Nav1.8 knockout mice survive and have few behavioral alterations (Akopian et al., 1999;
Laird et al., 2002), but the Nav1.8 subunit is located in sensory neurons of the dorsal root ganglia and not in the CNS (Hameed, 2019). Mutations in VGSC subunits result in hyper-excitability and altered channel gating (Meisler et al., 2001), as well as being linked to epilepsy in humans (Claes et al., 2001; Escayg et al., 2001; Wallace et al.,
2001; Meisler et al., 2002; Noebels, 2002). More recently, mice exposed to DLM (3 mg/kg every 3 days, fed in peanut butter) from embryonic day (E)6 to P25 show changes in VGSC subunit mRNA expression (Magby and Richardson, 2017) and have increased activity and deficits in operant learning and memory following E0 to P21 DLM exposure (3 mg/kg every 3 days, fed in peanut butter) (Richardson et al., 2015).
However, in rats with DLM exposure from P3-20 there was no effect on VGSC mRNA expression, but behavior was altered (Pitzer et al., 2019).
Several studies implicate dopamine (DA) in the developmental effects of DLM
(Lazarini et al., 2001; Richardson et al., 2015; Pitzer et al., 2019). We found that DLM
(1 mg/kg P3-20) treated male rats have decreased DA D1 receptor (DRD1) mRNA in the neostriatum and decreased extracellular DA release in the n. accumbens compared with controls (Pitzer et al., 2019). DLM treated mice (3 mg/kg every 3 days, E0-P21, fed in peanut butter) had decreased extracellular DA release in the n. accumbens, as well as increased DA transporter (DAT) and DRD1 levels (Richardson et al., 2015). Lazarini et al. (2001) found that gestational DLM exposure (E6-15; 0.08 mg/kg, gavage) resulted in higher 3,4-dihydroxyphenylacetic acid (DOPAC) and DOPAC/DA ratios (Lazarini et al., 2001). The extremely low doses used in this study are difficult to reconcile with the
136 rest of the literature, but these authors report using a proprietary vehicle of undisclosed composition. How this affected efficacy is impossible to determine.
Based on studies in adult rodents, other targets of DLM-induced neurotoxicity have been identified. For example, DLM causes ER stress and cell death in vitro in SK-
N-AS cells (Hossain and Richardson, 2011) and in vivo in rats (Hossain et al., 2015). In addition, DLM leads to activation of inflammatory and immune pathways that in turn lead to cell death (Hossain et al., 2016). Microglia are activated by DLM and this leads to neuroinflammation of cells that have sodium channels (Black et al., 2009; Stevens et al., 2013; Hossain et al., 2016; Pappalardo et al., 2016). Pyrethroid interactions with sodium channels on microglia participate in activation and cytokine secretion, since sodium channels are expressed in both astrocytes and microglia and are linked to roles in phagocytosis, proliferation, and the regulation of cytokines (Black et al., 2009; Morsali et al., 2013; Stevens et al., 2013; Pappalardo et al., 2016). Induced (lipopolysaccharide
(LPS) -treated) rat cultured microglia treated with tetrodotoxin (TTX) have impaired phagocytosis (Craner et al., 2005); and reduced microglia phagocytosis occurs in mice without functional Nav1.6 compared with wild-type mice (Kohrman et al., 1996). This indicates a role of VGSCs in the immune response of microglia. Cultured activated microglia, activated with phorbol-12-myristate-13-acetate (PMA) or LPS, have attenuated release of several cytokines (interleukin 1 alpha (IL-1α), interleukin 1 beta
(IL-1β), and tumor necrosis factor alpha (TNF-α)) when treated with TTX or phenytoin
(Morsali et al., 2013). Also, sodium influx through VGSCs can activate microglia and inflammatory pathways (Hossain et al., 2013; Jung et al., 2013). DLM (0-5 μM) treated
137 microglia in culture had increased intracellular sodium and the pro-inflammatory cytokine TNF- α; an effect inhibited by pre-treatment with TTX (Hossain et al., 2016).
Based on our previous data, the present study examined cellular effects after P3-
20 DLM exposure. Specifically, we tested whether the increased LTP seen at P25-35 persists into adulthood. We also tested DA markers in brain regions associated with egocentric learning (neostriatum and n. accumbens) and markers associated with allocentric learning (hippocampus). Hippocampal glutamate release and markers of apoptosis were examined in the neostriatum and hippocampus given the data of
Hossain et al. (2015) showing caspase changes. Finally, we assessed whether proinflammatory cytokines were altered in the brain after developmental DLM exposure.
MATERIALS AND METHODS
Animals and Treatment groups
The experiments were approved by the Institutional Animal Care and Use
Committee of Cincinnati Children’s Research Foundation and adhered to guidelines on the care and use of animals in research by the U.S. National Institutes of Health. Male and nulliparous female Sprague-Dawley rats (175–200 g upon arrival, CD IGS; strain
No. 001, Charles River, Raleigh, North Carolina) were maintained on ad libitum NIH-07 diet (LabDiet, Richmond, Indiana) and reverse osmosis filtered/ UV sterilized water.
Rats were acclimated to the AAALAC International accredited vivarium for 1–3 weeks before breeding. The vivarium was maintained on a 14–10 h light-dark cycle (lights on at 600 h) with controlled temperature (20 ±1 oC) and humidity (50% ± 10%). Females were paired with males in cages with standard bedding and stainless steel enclosures
138 for enrichment until females were determined to be pregnant, at which time females were separately rehoused (Vorhees et al., 2008). Day of birth was designated P0. On
P3 pups were randomly assigned a number identified using a localized subcutaneous injection of India ink. On P7 pups were ear punched as permanent identification.
Group assignments were made using a random number table to one of two groups: 0 mg/kg (corn oil; CO) or 1.0 mg/kg DLM (Bayer Crop Sciences, Frankfurt Germany,
>99% pure). DLM was dissolved in corn oil (Arcos Organics, Geel, Belgium) in a dosing volume of 5 mL/kg and administered once per day by gavage from P3-20 (Pitzer et al.,
2019). Litters were culled to 8 on P3 balancing for sex. Experimenters were blinded to treatment group during testing. Litters not used for early tissue collection were weaned at P28 and housed 2/cage of the same sex for assessment as adults. Dams and offspring were weighed on P3 and weekly from P7 to the end of the experiment.
Long-term potentiation
12 litters with 4 males and 4 females (2/sex/treatment/litter) were used for LTP, with only 1 rat/treatment/sex/litter tested. At P60 or later, rats were decapitated and brains were dissected, sliced, and placed on MED64 multielectrode arrays (Alpha Med
Sciences, Kadoma, Japan) with an 8x8 array of contact electrodes (50x50 mm and spaced 150 mm apart) (Shimono et al., 2002). LTP was assessed in parasagittal sections (350 mm) in the CA1 region of the hippocampus (Pitzer et al., 2019). Slices
o were maintained in aCSF (saturated with 95% O2/ 5% CO2, at 32 C). LTP was measured in the CA1 region until a stable baseline of field excitatory postsynaptic potentials (fEPSPs) was obtained (10 min), then a theta burst [tetanus = 100 Hz in 10 bursts (4 pulses/burst) delivered at a frequency of 5 Hz for 2 s] was applied and fEPSPs
139 were recorded for an additional 90 min (Amos-Kroohs et al., 2017; Pitzer et al., 2019).
Data are reported as percent change from baseline.
Western analyses
The second pair from each litter were used for protein analyses by western blot.
Western blots were performed in hippocampus, neostriatum, and n. accumbens for
DAT, DRD1, and DA D2 receptor (DRD2); N-methyl-D-aspartate (NMDA) subunits -
NR1, -NR2A, and –NR2B; and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid
(AMPA) receptor subunits GluR1 and GluR2. Actin was the reference protein. Tissue was dissected, placed on dry ice, and stored in -80 ºC until assayed. Frozen tissue was homogenized in immuno-precipitation assay buffer (25 mM Tris, 150 mM NaCl, 0.5% sodium deoxychlorate, and 1% Triton X-100 adjusted to 7.2 pH) with protease inhibitor
(Pierce Biotechnology, Rockford, IL). Protein was quantified using the BCATM Protein
Assay Kit (Pierce Biotechnology, Rockford, IL) and samples were diluted to 3 µg/µL.
Western blots were performed using LI-COR Odyssey® (LI-COR Biosciences, Lincoln,
NE) analyzer. Briefly, 25 µL of sample was mixed with Laemmli buffer (Sigma, St.
Louis, MO) and loaded on 12% gel (Bio-Rad Laboratories, Hercules, CA) and run at 200
V for 35 min in running buffer (25 mM Tris, 192 mM glycine, 0.1% SDS). The gel was transferred to Immobilon-FL transfer membrane (Millipore, Burlington, MA) in 1X rapid transfer buffer (AMRESCO, Solon, OH) at 40 V for 1.5 h. Membranes were soaked in
Odyssey phosphate buffered saline blocking buffer (LI-COR Biosciences, Lincoln, NE) for 1 h and incubated overnight at 4 ºC with primary antibody in blocking buffer with
0.2% Tween 20. Membranes were incubated with secondary antibody in blocking buffer with 0.2% Tween 20 and 0.01% SDS for 1 h at room temperature. Antibodies were
140 rabbit anti-NMDA-NR1 (Ab109182, AbCam, Cambridge, MA) at 1:4,000 with Odyssey
IRDye 800 secondary antibody at 1:3,000 dilution; rabbit anti-NMDA-NR2A (Ab124913,
AbCam, Cambridge, MA) at 1:9,000 with Odyssey IRDye 800 secondary antibody at
1:20,000 dilution; rabbit anti-NMDA-NR2B (Ab81271, AbCam, Cambridge, MA) at
1:5,000 with Odyssey IRDye 800 secondary antibody at 1:20,000 dilution; rabbit anti- ionotropic glutamate receptor 1 (AMPA subtype GluR1) (Ab109450, AbCam,
Cambridge, MA) at 1:9,000 with Odyssey IRDye 800 secondary antibody at 1:15,000 dilution; rabbit anti-ionotropic glutamate receptor 2 (AMPA subtype GluR2) (Ab133477,
AbCam, Cambridge, MA) at 1:7,000 with Odyssey IRDye 800 secondary antibody at
1:10,000 dilution; rabbit anti-DRD1 (Ab40653, AbCam, Cambridge, MA) at 1:1,000 with
Odyssey IRDye 800 secondary antibody at 1:3,000 dilution; rabbit anti-DRD2 (Ab85367,
AbCam, Cambridge, MA) at 1:500 with Odyssey IRDye 800 secondary antibody at
1:3,000 dilution; rabbit anti-DAT (Ab184451, AbCam, Cambridge, MA) at 1:2,000 with
Odyssey IRDye 800 secondary antibody at 1:20,000 dilution; mouse anti-β Actin (P/N:
926-42212, LI-COR Biosciences, Lincoln, NE) at 1:2,000 with Odyssey IRDye 680 secondary antibody at 1:15,000 dilution. Relative protein levels were quantified using the LI-COR Odyssey® scanner and Image Studio software for fluorescent intensity of each sample normalized to actin for each lane and the entire gel normalized to the highest actin sample.
Hippocampal glutamate release via microdialysis
Another 11 litters were used for microdialysis using the same litter design as before (2 rats/sex/treatment/litter) except only males were used. Rats were implanted with a stainless-steel guide cannula under isoflurane (2%–4%; IsoThesia; Butler Animal
141 Health Supply, Dublin, Ohio) anesthesia 72 h prior to the insertion of a dialysis probe.
On the morning of dialysis, a concentric dialysis probe was inserted through the guide cannula into the hippocampus such that the tip of the probe was located at the following coordinates: A/P, -3.6 mm relative to bregma; L, 2.0 mm; V, -3.8 mm (Paxinos et al.,
1985). The probes were connected to an infusion pump set to deliver Dulbecco’s phosphate buffered saline (2 mL/min) for 3 h of acclimation. A baseline sample was collected at 10, 20, 30, 60, 90, 120, and 150 min following administration of potassium
(80 mM, dissolved in dialysis buffer (Nair and Gudelsky, 2004)). Glutamate in dialysis samples was quantified by HPLC (Nair and Gudelsky, 2004). Placements of dialysis probes were verified post-mortem in coronal sections.
Apoptosis
Pro-Caspase-3: We assessed pro-caspase-3 expression in male and female rats after P3-20 DLM treatment. A total of 12 litters were used with 1 rat/sex/group/litter.
Hippocampal and striatal tissue on P21 were collected and protein supernatant processed as above. Western blots were run as above. Antibodies were mouse anti- caspase-3 (31A1067: sc-56053, Santa Cruz Biotechnology, INC, Cell Signaling
Technology, Dallas, TX) at 1:150 with Odyssey IRDye 680 secondary antibody at 1:500 dilution and rabbit anti-β Actin (P/N: 926-42210, LI-COR Biosciences, Lincoln, NE) at
1:2,000 with Odyssey IRDye 800 secondary antibody at 1:15,000 dilution. Relative protein levels were quantified using the LI-COR Odyssey® scanner and Image Studio software for fluorescent intensity of each sample normalized to actin/lane and the gel normalized to highest actin sample.
142 Cleaved Caspase-3: A separate group of 28 litters was used for western blot analysis of cleaved caspase-3 at different ages: P3, 9, 15, and 20. At each age hippocampus, neostriatum, and n. accumbens were dissected 4 h following DLM dosing since Cmax peaks 2-6 h after exposure in P10 rat brain after doses of 0.4-10 mg/kg (Kim et al., 2010). Tissue was collected and protein supernatant processed as above.
Western blots were performed using Cell Signaling Technology’s western procedure
(Cell Signaling Technology, Danvers, MA). Briefly, 25 µL of sample was mixed with
Laemmli buffer (Sigma, St. Louis, MO), loaded on a 12% gel (Bio-Rad Laboratories,
Hercules, CA), and then run at 200 V for 35 min in running buffer (25 mM Tris, 192 mM glycine, 0.1% SDS). The gel was transferred to nitrocellulose transfer membrane (0.2
µm pore; Bio-Rad Laboratories, Hercules, CA) in 1X rapid transfer buffer at 40 V for 1.5 h. Membranes were first washed in 1X TBS for 5 min, then blocking buffer (1X TBS/5% dry milk) for 3 h, then incubated overnight at 4 ºC with primary antibody in blocking buffer with 0.1% Tween 20 (Sigma, St. Louis, MO). The following day membranes were then washed in 1X TBST 3 times for 5 min each. Membranes were incubated with secondary antibody in blocking buffer 0.1% Tween 20 for 1 h at room temperature.
Antibodies were rabbit anti-cleaved caspase-3 (Asp175; #9661, Cell Signaling
Technology, Danvers, MA) at 1:200 with Odyssey IRDye 800 secondary antibody at
1:1,000 dilution and mouse anti-β actin (P/N: 926-42212, LI-COR Biosciences, Lincoln,
NE) at 1:2,000 with Odyssey IRDye 680 secondary antibody at 1:15,000 dilution.
Relative protein levels were quantified using the LI-COR Odyssey® scanner and Image
Studio software for fluorescent intensity of each sample normalized to actin. Inspection
143 of the data distribution revealed that the dataset was not normally distributed, therefore, the data were log transformed prior to statistical analysis.
Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL): From 11 litters above, pups were also used to test for DNA fragmentation via TUNEL staining on
P21 in males. Rats were administered 0.15-0.3 mL pentobarbital. A ventral incision was made, and a butterfly needle inserted into the left ventricle to perfuse with ice cold
1X PBS. Then, 30-60 mL of ice cold 4% PFA in 1X PBS (pH 7.4) was perfused, and brains were removed and stored in 4% PFA. The following day brains were transferred to 30% sucrose in 1X PBS solution. After brains sank, sagittal sections (40 μM) were cut on a cryostat and mounted on slides. Slices were allowed to dry at room temperature overnight and stored at -80 °C until stained. The TACS 2 Tdt-Blue Label In
Situ Apoptosis Detection Kit (Trevigen, Gaithersburg, MD) was used. Slides were equilibrated to room temperature for 2 h, rehydrated and washed in 1X PBS twice for 10 min each. Tissue sections were permeabilized with 50 μL of Cytonin Solution for 30 min at 37 oC in a humidity chamber. Slides were washed twice in Milli-Q water (2 min each), immersed in quenching solution (45 mL methanol and 5 mL fresh 30% hydrogen peroxide) for 5 min, washed in 1X PBS for 1 min and immersed in 1X Tdt labeling buffer for 5 min. Samples were removed from the buffer and covered in 50 μL of labeling reaction mix at 37 °C in a humidity chamber for 60 min then immersed in 1X of the Tdt stop buffer for 5 min. Slides were washed twice in 1X PBS for 5 min then covered with
50 μL of the Strep-HRP solution, placed in a humidity chamber and incubated at 37 °C for 10 min, and washed 2 times for 2 min each in 1X PBS. Slides were then covered with 50 μL of Blue label solution for 5 min and washed twice in Milli-Q water for 2 min
144 each. Samples were next counterstained. First, slides were placed in Milli-Q water then in Nuclear Fast Red solution for 2 min each. Samples were dehydrated and cleared with xylene before mounting with Krystalon (Millipore, Burlington, MA). After mounting medium had hardened, sections were imaged, using a Nikon NiE upright Widefield at
10X magnification under bright field illumination. Images were analyzed for TUNEL positive cells using RGB analysis on Nikon NIS-Elements AR analysis software (5.20.00
64-bit) in neostriatum, n. accumbens, and hippocampus. The dentate gyrus was further analyzed via stereological counting of TUNEL positive cells. As a positive control, a subset of samples were treated with TAC-nuclease (Trevigen, Gaithersburg, MD) to confirm adequate permeabilization of membranes and staining quality.
Cytokine assay
Six litters were used for assessment of cytokines at P20 in males (1 rat/group/litter). Cytokines were interferon gamma (IFN-γ), interleukin 10 (IL-10), interleukin 13 (IL-13), IL-1β, interleukin 4 (IL-4), interleukin 5 (IL-5), interleukin 6 (IL-6), keratinocyte chemoattractant/ human growth-regulated oncogene (KC/GRO), and TNF-
α. Hippocampus, n. accumbens, and neostriatum were dissected 4 h following the last dose on P20. Protein was analyzed as above. Cytokines were assayed using the
Meso Scale Discovery (MSD) proinflammatory panel 2 (rat) V-PLEX ® kit (MSD,
Rockville, MD). Blocker H (150 uL; MSD, Rockville, MD) was added to each MSD multi- spot 96 well 10 spot plate and incubated for 1 h on a shaker at room temperature. The plate was washed 3 times with 150 μL/well of wash buffer (1X PBS + 0.05% Tween 20), then samples and MSD calibrators were added to the plate, 50 μL/well. MSD calibrators are reconstituted by adding Diluent 42 to the highest calibrator, then serial
145 dilutions were performed to create a set of calibrators, with Diluent 42 being the zero- calibrator containing no protein. Sample protein supernatants were also prepared with
Diluent 42 (1:2 dilution). The plate was then loaded with prepared samples and calibrators, sealed, incubated, and placed on a shaker for 2 h. The plate was then washed 3 times with the wash buffer. 25 μL/well of 1X detection antibody solution was then added, the plate sealed, and incubated for 2 h on a plate shaker. Next the plate was washed 3 times with the wash buffer, followed by 150 μL/well of a 2X read buffer, and the plate analyzed on the MSD Meso Sector S600 plate reader. Calculated concentrations were determined using MSD Discovery Workbench software®. Cytokine concentrations were normalized to total protein concentrations of each sample determined using BCATM Protein Assay Kit (Pierce Biotechnology, Rockford, IL).
Data Analysis
Data were analyzed using mixed linear model ANOVAs (SAS v9.4, SAS Institute,
Cary, NC). Fixed factors were treatment and sex. Interval, time, or region was a repeated measure (RM) factor in RM-ANOVA models used for LTP, microdialysis, and western blots. For these data an autoregressive-1 covariance structure was used. RM-
ANOVA was also used for TUNEL data and a t-test for independent samples for dentate gyrus cell counts. To control for litter, only one rat per treatment per sex per litter was used for any given outcome and litter was a random factor in ANOVA models with first- order Kenward-Roger degrees of freedom estimated. Significant interactions were further analyzed using slice-effect ANOVAs. ANOVA by sex analyses were conducted for LTP and westerns, where applicable, based on previously observed sex specific
146 behavioral effects in adulthood following DLM exposure. Data are presented as least square (LS) mean ± SEM. Statistical significance was set at p 0.05.
RESULTS
Long-Term Potentiation
We previously found increased LTP in DLM treated offspring assessed at P25-35 in CA1 (Pitzer 2019). No treatment effects were observed for LTP in DLM-treated rats when analyzed with sex included as a factor, although there was an effect of interval
[F(89, 1939)=5.79, p<0.0001] and interval x sex interaction [F(89, 1939)=1.75, p<0.0001]. We found mostly male specific behavioral effects following DLM treatment
(Pitzer et al. 2019), so we analyzed the data for each sex separately. Male DLM-treated rats showed increased LTP after tetanizing stimulation compared with CO controls
(Figure 1A & 1B) [treatment: F(1, 7.17)=10.54, p<0.05]. Males also had a main effect of interval [F(89, 977)=4.2, p<0.0001]. No treatment effects were observed for females
(Figure 1C & 1D), however there was a main effect of interval [F(89, 977)=2.61, p<0.0001]. No group differences were found at baseline prior to delivering the tetanizing stimulus.
Dopamine and glutamate systems
No significant effects of DLM treatment were observed for DRD1, DRD2, or DAT protein in any of the three regions examined (Figure 2). There were no significant effects of developmental DLM exposure on GluR1 (Figure 3A), GluR2 (Figure 3B), or
NMDA-NR1 (Figure 4A). No treatment effects were observed for NR2A and NR2B in
DLM-treated rats when analyzed with sex as a factor, although there was an effect of sex for NMDA-NR2A [F(1, 85.1=16.39, p<0.0001] and NMDA-NR2B [F(1, 93.2)=55.24,
147 p<0.0001]. We then assessed both -NR2A and -NR2B data for each sex separately due to our previously observed male specific effects following DLM treatment. NR1,
GluR1, and GluR2 were all analyzed in this fashion as well, but when separated by sex still no treatment effects were observed. When analyzed with each sex separately, males for NMDA-NR2A showed an effect of region [F(2, 415)=146.97, p<0.0001], but the treatment main effect [F(1, 18.8)=2.97, p=0.101] and treatment x region interaction
[F(2, 34.7)=2.67, p=0.0833] fell short of significance. However, when assessing slice effects, DLM-treated males had increased NMDA-NR2A levels in the hippocampus
(Figure 4B; p<0.01) compared with controls. For male NMDA-NR2B, there was also an effect of region [F(2, 40.1)=56.3, p<0.0001] but the treatment x region effect was not significant [F(2, 40.1)=2.59, p<0.09]. When examining slice effects, DLM-treated males also had decreased levels of NMDA-NR2B in the hippocampus (Figure 4D; p<0.01) compared with controls. There were no treatment effects in females (Figure 4C & 4E).
Hippocampal Glutamate Release
There were no treatment effects found for potassium stimulated hippocampal glutamate release (Figure 5). There was a main effect of time [F(7, 62.9)=11.62, p<.0001], with glutamate release increasing for 10 min following stimulation and then decreasing to basal levels.
Caspase-3 and TUNEL
No effects of DLM were found for pro-caspase (Figure 6) or cleaved caspase-3
(Figure 7) expression in the brain regions examined. However, increased cell death was found using TUNEL labeling. There was an effect of treatment [F(1, 21.8)=4.28, p=0.05], with increased TUNEL positive cells in striatum and hippocampus (Figure 8A)
148 compared with controls. We also observed an effect of region [F(1, 20.9)=15.23, p<0.001], with higher counts for TUNEL positive cells within the striatum. In the dentate gyrus, DLM-treated rats showed increased numbers of TUNEL positive cells compared with controls [t(20) = -4.58, p<0.001] (Figure 8B).
Cytokines
Of the proinflammatory cytokines assayed, IL-1β was affected in DLM-treated rats (Figure 9). There was an effect of brain region [F(2, 18.8)=4.43, p<0.05], but the treatment main effect was not significant [F(1, 6.86)=4.98, p=0.0616]. For this outcome, only males were included.
DISCUSSION
There is growing evidence that DLM results in long-term CNS effects after preweaning exposure in rats and mice. We previously showed effects on learning, memory, activity and acoustic startle following developmental DLM exposure (Pitzer et al., 2019). We reported increases in CA1 LTP in DLM treated males and females shortly after the end of treatment, and herein we find that this change persists into adulthood in males, but not females. In addition, we found changes in NMDA-NR2A and NR2B subunits of the NMDA-NR1/NR2/3 heterodimer receptor complex in the hippocampus in DLM treated offspring.
Previously, we showed cognitive deficits in DLM-exposed rats on a test of egocentric navigation using the Cincinnati water maze (CWM) (Pitzer et al., 2019), a striatally mediated form of learning largely mediated by DA (Braun et al., 2015; Braun et al., 2016; Vorhees and Williams, 2016). Consistent with this, we found decreased
149 DRD1 mRNA in the neostriatum and decreased extracellular DA release in the n. accumbens in DLM-treated rats (Pitzer et al., 2019). However, for DRD1, DRD2, and
DAT there were no significant changes in DLM-treated rats. Although, the CWM involves striatal dopamine (DA) (Braun et al., 2015; Braun et al., 2016; Vorhees and
Williams, 2016), the influence of DA receptors in this task are not known. Results from this study suggest they are not likely involved since no changes in these proteins were found in DLM treated rats. How the decreased DRD1 mRNA expression and reduced stimulated DA release lead to impaired CWM learning in the absence of changes in
DRD1, DRD2, or DAT is unclear and requires further investigation.
However, we did find increased CA1 LTP in DLM exposed males as adults, consistent with what we found before in P25-35 rats (Pitzer et al., 2019). Typically, LTP reductions are associated with impaired learning and memory, whereas we found increased LTP. Moreover, the effect was sex-specific, affecting only males in adulthood. Consistent with this, we observed deficits in the MWM maze on shift trials only in males (Pitzer et al., 2019). LTP is a cellular correlate of spatial learning and memory including in the MWM (Morris et al., 1986; Bliss and Collingridge, 1993;
Bannerman et al., 1995; Moser et al., 1998; Herring and Nicoll, 2016; Nicoll, 2017) although there are exceptions (Meiri et al., 1998; Garcia-Alvarez et al., 2015; Aziz et al.,
2019). Impairments in MWM learning, while indicative of hippocampal dysfunction, are not always reflected by changes in LTP (Morris et al., 1982). We chose the CA1 region because it is critical for spatial learning and memory (Tsien et al., 1996; Oh et al., 2003;
Suthana et al., 2009; Bannerman et al., 2014), and we expected decreases in LTP but found the opposite. There are reports where increased LTP in genetic knockout models
150 is associated with impaired spatial learning and memory (Jia et al., 1996; Migaud et al.,
1998; Gu et al., 2002; Rutten et al., 2008), but how these may relate to our findings is unknown.
AMPA and NMDA receptors mediate LTP (Williams et al., 2007; Luscher and
Malenka, 2012; Nicoll, 2017). We observed no changes in AMPA receptor expression of GluR1 or GluR2 or for NMDA–NR1 expression but did find changes in NMDA–NR2 expression. NMDA-NR2A was increased and NMDA-NR2B was decreased in male
DLM treated rats. NMDARs are heteromers (dimers or trimers), composed of 2 NR1 subunits and 2 NR2 subunits (NR2A, NR2B, NR2C) or NR3 subunits (NR3A, NR3B)
(Low and Wee, 2010; Flores-Soto et al., 2012; Vyklicky et al., 2014). NMDA-NR2A and-
NR2B are present throughout the brain, including in areas involved in CWM and MWM learning. NR2A and NR2B undergo a developmental switch in expression (Wenzel et al., 1997). This occurs prior to weaning, during the same developmental period when we treat with DLM. It is possible that exposure to DLM during this switch could influence the composition of NMDAR dimers and trimers resulting in permanently altered function. NMDA-NR2A and -NR2B complexes are implicated in different aspects of neuroplasticity. Increased NMDA-NR2A subunit ratios are associated with long-term depression (LTD) whereas increased NMDA-NR2B subunit ratios are associated with LTP (Yashiro and Philpot, 2008). Given this, LTD activity in DLM- treated offspring should be determined. DLM treated rats did not show differences in baselines prior to LTP induction (which could lead to differences in postsynaptic potentials after a theta burst), it may be that DLM had effects on LTD, which is
151 associated with forgetting, however we did not assess LTD and this should be considered in future experiments.
If our NMDA-NR2A changes are associated with LTD it would implicate the accessibility of calcium/calmodulin-dependent protein kinase II (CaMKII) to the receptors because NMDA-NR2A has lower affinity for CaMKII than NMDA-NR2B
(Strack and Colbran, 1998; Leonard et al., 1999; Strack et al., 2000; Yashiro and
Philpot, 2008). When activated, CaMKII translocates to the synapse and binds NMDA receptors allowing synaptic potentiation (Lisman et al., 2012). NMDA-NR2A limits calcium entry into the cell due to channel kinetics that cause NR2A-containing NMDA receptors to open and close earlier than NR2B-containing NMDA receptors (Erreger et al., 2005). These studies suggest that NR2A-dominated synapses favor LTD. LTD is an activity-dependent reduction in synaptic strength that weakens synaptic firing
(Dharani, 2015). Conditions favoring LTD could be a mechanism by which developmental DLM impairs cognition since LTD is a mechanism involved in forgetting.
However, we observed increased LTP. Both NR2A and NR2B are capable of supporting bidirectional synaptic plasticity, and the processes of LTP and LTD are mechanisms that involve signaling molecules in several brain areas during development
(Dharani, 2015). Although channel kinetics and interactions with CaMKII suggest effects on LTD, it is possible that increased NMDA-NR2A expression in conjunction with decreased NMDA-NR2B expression in DLM treated rats is disruptive to learning because they are out of balance. Although NMDA-NR2A-containing receptors open more briefly than NMDA-NR2B receptors and have a faster deactivation time (Erreger et al., 2005), they also have higher opening probability and their opening is more reliable
152 following glutamate release compared with NMDA-NR2B-containing receptors (Erreger et al., 2005; Santucci and Raghavachari, 2008). This suggests that increased NMDA-
NR2A levels support increased LTP. However, in vivo microdialysis showed no increase in potassium-stimulated glutamate release in the hippocampus of DLM-treated males, suggesting that the mechanism underlying impaired learning could be postsynaptic rather than presynaptic. Therefore, examination of postsynaptic markers such as postsynaptic density protein 95 (PSD95) should be investigated.
We assessed caspase associated cell death. Caspase-3 is an executioner caspase in cell death pathways active only when cleaved by an initiator caspase, such as caspase-9 (Salvesen, 2002; Ghavami et al., 2009; Walters et al., 2009). Caspase cascades can be initiated by extrinsic mechanisms such as death-associated ligands, or by intrinsic mechanisms, such as that induced by mitochondrial dysfunction (Salvesen,
2002). It has been proposed that DLM triggers caspase cascades through intrinsic mechanisms, including ER stress that leads to unfolded protein protective mechanisms and apoptosis, such as that reported in cell culture and adult mice (Hossain and
Richardson, 2011; Hossain et al., 2015; Hossain et al., 2019). We examined cleaved caspase-3 expression on P3, P9, P15, and P20 and pro-caspase-3 on P21. We did not find any treatment related differences. This could be because of the low abundance of caspase at these ages (Mooney and Miller, 2000) or because western analyses are not sensitive enough to detect low level differences. In future experiments, it might be better to examine caspases immunohistochemically.
However, TUNEL staining did show that DLM increased cell death in the hippocampus and neostriatum compared with controls. Increases in TUNEL positive
153 cells, indicating increased apoptosis, have also been observed following a single dose of DLM (6 mg/kg; gavage) in adult male mice, mediated by caspase cascades, as seen by increased levels of caspase-12 and caspase-3 (Hossain et al., 2019). In addition this increase was be blocked by administration of salubrinal (1 mg/kg i.p.; 24 h and 30 min before DLM administration), a eukaryotic translation initiating factor 2 subunit 1 (eIf2α) inhibitor, thereby inhibiting ER stress (Hossain et al., 2019). Differences in dose, dosing period, and species may account for differences in cell death in these experiments compared with mine. This issue remains to be reconciled in future experiments. DLM may induce cell death through mechanisms other than caspase-3, therefore the caspase data are not inconsistent with the TUNEL data. For example, cell death may have occurred through p53 signaling or oxidative stress (Kumar et al., 2015). We examined apoptosis in greater detail in the dentate gyrus. The dentate is known to generate new granule cells during the preweaning period (Bayer and Altman, 1974).
When 5-bromo-2-deoxyuridine (BrdU) labeled cells were examined in adult mice exposed to DLM, it was shown that DLM reduced proliferation (Hossain et al., 2015).
DLM treated mice displayed fewer BrdU labeled cells in the dentate gyrus compared with control mice. Hence, these data are consistent with our TUNEL data and with impaired hippocampal function, as reflected by MWM deficits in adult mice (Hossain et al., 2015) and MWM reversal deficits in developmentally treated rats (Pitzer et al.,
2019).
Hossain et al. (2016) reported increased TNF-α in BV2 cells and in primary microglia culture following DLM treatment (Hossain et al., 2016). Here we observed that DLM-treated rats have altered IL-1β expression on P20 compared with controls,
154 although further investigation is necessary. We did not observe TNF-α changes as
Hossain et al. (2016) found, however, differences between models may account for this.
IL-1β is a proinflammatory cytokine that has modulatory effects beyond the immune system. IL-1β is expressed throughout the brain with higher levels during brain development that later decrease to stable levels in adulthood (Gadient and Otten, 1994;
Ma et al., 2014). IL-1 receptor (R; IL-1α and IL-1β are the ligands for this receptor) knockout mice have deficits in MWM and reduced contextual fear conditioning (Avital et al., 2003). Overexpression or administration of IL-1β also impairs hippocampal based learning and memory (Barrientos et al., 2002; Hein et al., 2007). The effects of IL-1β on memory are cell specific (Hewett et al., 2012) with potential mechanisms being the actions of IL-1β regulating voltage and ligand gated ion channels (Wang et al., 2000;
Viviani et al., 2003; Yang et al., 2005; Gardoni et al., 2011; Viviani and Boraso, 2011;
Zhou et al., 2011). This indicates that disrupted IL-1β signaling could impact cognition and may be involved in the DLM-induced learning and memory deficits.
IL-1β is also implicated in cell survival. IL-1-R knockout mice do not show microgliosis or astrogliosis in response to injury and show decreased neuronal sprouting, implicating IL-1 as a trophic factor (Parish et al., 2002). IL-1β stimulated astrocytes produce other neurotrophic factors that support neuronal survival (Albrecht et al., 2002; John et al., 2005; Saavedra et al., 2007; Hewett et al., 2012). Astrocytes protect neurons from oxidative stress (Tanaka et al., 1999; Shih et al., 2003; Gegg et al., 2005; Jakel et al., 2007) and circulation in a model of cerebral ischemia (Hewett et al., 2012; He et al., 2015). In the latter case, IL-1β was protective against oxidative stress by increasing glutathione synthesis (Hewett et al., 2012; He et al., 2015). Taken
155 together the potential decreased levels of IL-1β in male DLM treated rats could reflect compromised immune responses and result in increased oxidative stress that adversely affect cognition. This supposition requires further testing.
The present data add evidence that preweaning DLM exposure affects glutamatergic systems (NMDA-NR2A and –NR2B receptors) as well as CA1 LTP. We also observed increased apoptosis in DLM treated rats that could have effects on neurogenesis in the dentate gyrus, a region critical for spatial learning. Future studies are needed to narrow the search for long-term molecular changes caused by early DLM exposure. Further experiments on cell death pathways and inflammatory mediators would be informative since we found decreased IL-1β expression in the n. accumbens of male rats, indicating abnormal immune signaling. Overall, our data show widespread effects from developmental DLM exposure, effects beyond those on the DA system.
These additional changes may contribute to the learning and memory deficits. Studies are needed to understand the mechanisms of how DLM causes changes to NMDA receptor function and how those changes relate to changes in LTP. Finally, understanding how the changes in rat neurodevelopment from DLM exposure translate to children’s health requires further research, but the data thus far raise concerns over the safety of pyrethroids for children.
156 References
Akopian AN, Souslova V, England S, Okuse K, Ogata N, Ure J, Smith A, Kerr BJ,
McMahon SB, Boyce S, Hill R, Stanfa LC, Dickenson AH, Wood JN (1999) The
tetrodotoxin-resistant sodium channel SNS has a specialized function in pain
pathways. Nature neuroscience 2:541-548.
Albrecht PJ, Dahl JP, Stoltzfus OK, Levenson R, Levison SW (2002) Ciliary
neurotrophic factor activates spinal cord astrocytes, stimulating their production
and release of fibroblast growth factor-2, to increase motor neuron survival.
Experimental neurology 173:46-62.
Amaraneni M, Pang J, Mortuza TB, Muralidhara S, Cummings BS, White CA, Vorhees
CV, Zastre J, Bruckner JV (2017) Brain uptake of deltamethrin in rats as a
function of plasma protein binding and blood-brain barrier maturation.
Neurotoxicology 62:24-29.
Amos-Kroohs RM, Davenport LL, Atanasova N, Abdulla ZI, Skelton MR, Vorhees CV,
Williams MT (2017) Developmental manganese neurotoxicity in rats: Cognitive
deficits in allocentric and egocentric learning and memory. Neurotoxicology and
teratology 59:16-26.
Anand SS, Kim KB, Padilla S, Muralidhara S, Kim HJ, Fisher JW, Bruckner JV (2006)
Ontogeny of hepatic and plasma metabolism of deltamethrin in vitro: role in age-
dependent acute neurotoxicity. Drug metabolism and disposition: the biological
fate of chemicals 34:389-397.
157 Avital A, Goshen I, Kamsler A, Segal M, Iverfeldt K, Richter-Levin G, Yirmiya R (2003)
Impaired interleukin-1 signaling is associated with deficits in hippocampal
memory processes and neural plasticity. Hippocampus 13:826-834.
Aziz MH, Agrawal AK, Adhami VM, Shukla Y, Seth PK (2001) Neurodevelopmental
consequences of gestational exposure (GD14-GD20) to low dose deltamethrin in
rats. Neuroscience letters 300:161-165.
Aziz W, Kraev I, Mizuno K, Kirby A, Fang T, Rupawala H, Kasbi K, Rothe S, Jozsa F,
Rosenblum K, Stewart MG, Giese KP (2019) Multi-input Synapses, but Not LTP-
Strengthened Synapses, Correlate with Hippocampal Memory Storage in Aged
Mice. Current Biology 29:3600-3610.e3604.
Bannerman DM, Good MA, Butcher SP, Ramsay M, Morris RG (1995) Distinct
components of spatial learning revealed by prior training and NMDA receptor
blockade. Nature 378:182-186.
Bannerman DM, Sprengel R, Sanderson DJ, McHugh SB, Rawlins JN, Monyer H,
Seeburg PH (2014) Hippocampal synaptic plasticity, spatial memory and anxiety.
Nature reviews Neuroscience 15:181-192.
Barr DB, Olsson AO, Wong LY, Udunka S, Baker SE, Whitehead RD, Magsumbol MS,
Williams BL, Needham LL (2010) Urinary concentrations of metabolites of
pyrethroid insecticides in the general U.S. population: National Health and
Nutrition Examination Survey 1999-2002. Environmental health perspectives
118:742-748.
Barrientos RM, Higgins EA, Sprunger DB, Watkins LR, Rudy JW, Maier SF (2002)
Memory for context is impaired by a post context exposure injection of
158 interleukin-1 beta into dorsal hippocampus. Behavioural brain research 134:291-
298.
Bayer SA, Altman J (1974) Hippocampal development in the rat: cytogenesis and
morphogenesis examined with autoradiography and low-level X-irradiation. The
Journal of comparative neurology 158:55-79.
Black JA, Liu S, Waxman SG (2009) Sodium channel activity modulates multiple
functions in microglia. Glia 57:1072-1081.
Bliss TVP, Collingridge GL (1993) A synaptic model of memory: long-term potentiation
in the hippocampus. Nature 361:31.
Braun AA, Amos-Kroohs RM, Gutierrez A, Lundgren KH, Seroogy KB, Vorhees CV,
Williams MT (2016) 6-Hydroxydopamine-Induced Dopamine Reductions in the
Nucleus Accumbens, but not the Medial Prefrontal Cortex, Impair Cincinnati
Water Maze Egocentric and Morris Water Maze Allocentric Navigation in Male
Sprague-Dawley Rats. Neurotoxicity research 30:199-212.
Braun AA, Amos-Kroohs RM, Gutierrez A, Lundgren KH, Seroogy KB, Skelton MR,
Vorhees CV, Williams MT (2015) Dopamine depletion in either the dorsomedial
or dorsolateral striatum impairs egocentric Cincinnati water maze performance
while sparing allocentric Morris water maze learning. Neurobiology of learning
and memory 118:55-63.
Burns CJ, Pastoor TP (2018) Pyrethroid epidemiology: a quality-based review. Critical
reviews in toxicology 48:297-311.
Cantalamessa F (1993) Acute toxicity of two pyrethroids, permethrin, and cypermethrin
in neonatal and adult rats. Archives of toxicology 67:510-513.
159 Chrustek A, Holynska-Iwan I, Dziembowska I, Bogusiewicz J, Wroblewski M, Cwynar A,
Olszewska-Slonina D (2018) Current Research on the Safety of Pyrethroids
Used as Insecticides. Medicina (Kaunas, Lithuania) 54.
Claes L, Del-Favero J, Ceulemans B, Lagae L, Van Broeckhoven C, De Jonghe P
(2001) De novo mutations in the sodium-channel gene SCN1A cause severe
myoclonic epilepsy of infancy. Am J Hum Genet 68:1327-1332.
Craner MJ, Damarjian TG, Liu S, Hains BC, Lo AC, Black JA, Newcombe J, Cuzner ML,
Waxman SG (2005) Sodium channels contribute to microglia/macrophage
activation and function in EAE and MS. Glia 49:220-229.
Dharani K (2015) Chapter 3 - Memory. In: The Biology of Thought (Dharani K, ed), pp
53-74. San Diego: Academic Press.
Erreger K, Dravid SM, Banke TG, Wyllie DJ, Traynelis SF (2005) Subunit-specific gating
controls rat NR1/NR2A and NR1/NR2B NMDA channel kinetics and synaptic
signalling profiles. The Journal of physiology 563:345-358.
Escayg A, Heils A, MacDonald BT, Haug K, Sander T, Meisler MH (2001) A novel
SCN1A mutation associated with generalized epilepsy with febrile seizures plus--
and prevalence of variants in patients with epilepsy. Am J Hum Genet 68:866-
873.
Flores-Soto ME, Chaparro-Huerta V, Escoto-Delgadillo M, Vazquez-Valls E, Gonzalez-
Castaneda RE, Beas-Zarate C (2012) [Structure and function of NMDA-type
glutamate receptor subunits]. Neurologia (Barcelona, Spain) 27:301-310.
160 Gadient RA, Otten U (1994) Expression of interleukin-6 (IL-6) and interleukin-6 receptor
(IL-6R) mRNAs in rat brain during postnatal development. Brain research 637:10-
14.
Garcia-Alvarez G, Shetty MS, Lu B, Yap K, Oh-Hora M, Sajikumar S, Bichler Z, Fivaz M
(2015) Impaired spatial memory and enhanced long-term potentiation in mice
with forebrain-specific ablation of the Stim genes. Frontiers in behavioral
neuroscience 9:180.
Gardoni F, Boraso M, Zianni E, Corsini E, Galli CL, Cattabeni F, Marinovich M, Di Luca
M, Viviani B (2011) Distribution of interleukin-1 receptor complex at the synaptic
membrane driven by interleukin-1beta and NMDA stimulation. J
Neuroinflammation 8:14.
Gegg ME, Clark JB, Heales SJ (2005) Co-culture of neurones with glutathione deficient
astrocytes leads to increased neuronal susceptibility to nitric oxide and increased
glutamate-cysteine ligase activity. Brain research 1036:1-6.
Ghavami S, Hashemi M, Ande SR, Yeganeh B, Xiao W, Eshraghi M, Bus CJ, Kadkhoda
K, Wiechec E, Halayko AJ, Los M (2009) Apoptosis and cancer: mutations within
caspase genes. J Med Genet 46:497-510.
Gu Y, McIlwain KL, Weeber EJ, Yamagata T, Xu B, Antalffy BA, Reyes C, Yuva-Paylor
L, Armstrong D, Zoghbi H, Sweatt JD, Paylor R, Nelson DL (2002) Impaired
conditioned fear and enhanced long-term potentiation in Fmr2 knock-out mice.
The Journal of neuroscience : the official journal of the Society for Neuroscience
22:2753-2763.
161 Hameed S (2019) Na(v)1.7 and Na(v)1.8: Role in the pathophysiology of pain. Mol Pain
15:1744806919858801-1744806919858801.
He Y, Jackman NA, Thorn TL, Vought VE, Hewett SJ (2015) Interleukin-1beta protects
astrocytes against oxidant-induced injury via an NF-kappaB-dependent
upregulation of glutathione synthesis. Glia 63:1568-1580.
Hein AM, Stutzman DL, Bland ST, Barrientos RM, Watkins LR, Rudy JW, Maier SF
(2007) Prostaglandins are necessary and sufficient to induce contextual fear
learning impairments after interleukin-1 beta injections into the dorsal
hippocampus. Neuroscience 150:754-763.
Herring BE, Nicoll RA (2016) Long-Term Potentiation: From CaMKII to AMPA Receptor
Trafficking. Annual review of physiology 78:351-365.
Hewett SJ, Jackman NA, Claycomb RJ (2012) Interleukin-1β in Central Nervous System
Injury and Repair. Eur J Neurodegener Dis 1:195-211.
Hossain MM, Richardson JR (2011) Mechanism of pyrethroid pesticide-induced
apoptosis: role of calpain and the ER stress pathway. Toxicological sciences : an
official journal of the Society of Toxicology 122:512-525.
Hossain MM, Sonsalla PK, Richardson JR (2013) Coordinated role of voltage-gated
sodium channels and the Na+/H+ exchanger in sustaining microglial activation
during inflammation. Toxicology and applied pharmacology 273:355-364.
Hossain MM, DiCicco-Bloom E, Richardson JR (2015) Hippocampal ER stress and
learning deficits following repeated pyrethroid exposure. Toxicological sciences :
an official journal of the Society of Toxicology 143:220-228.
162 Hossain MM, Liu J, Richardson JR (2016) Pyrethroid Insecticides Directly Activate
Microglia Through Interaction With Voltage-Gated Sodium Channels.
Toxicological Sciences 155:112-123.
Hossain MM, Sivaram G, Richardson JR (2019) Regional Susceptibility to ER Stress
and Protection by Salubrinal Following a Single Exposure to Deltamethrin.
Toxicological sciences : an official journal of the Society of Toxicology 167:249-
257.
Jakel RJ, Townsend JA, Kraft AD, Johnson JA (2007) Nrf2-mediated protection against
6-hydroxydopamine. Brain research 1144:192-201.
Jia Z, Agopyan N, Miu P, Xiong Z, Henderson J, Gerlai R, Taverna FA, Velumian A,
MacDonald J, Carlen P, Abramow-Newerly W, Roder J (1996) Enhanced LTP in
mice deficient in the AMPA receptor GluR2. Neuron 17:945-956.
John GR, Lee SC, Song X, Rivieccio M, Brosnan CF (2005) IL-1-regulated responses in
astrocytes: relevance to injury and recovery. Glia 49:161-176.
Johri A, Yadav S, Singh RL, Dhawan A, Ali M, Parmar D (2006) Long lasting effects of
prenatal exposure to deltamethrin on cerebral and hepatic cytochrome P450s
and behavioral activity in rat offspring. European journal of pharmacology
544:58-68.
Jung GY, Lee JY, Rhim H, Oh TH, Yune TY (2013) An increase in voltage-gated
sodium channel current elicits microglial activation followed inflammatory
responses in vitro and in vivo after spinal cord injury. Glia 61:1807-1821.
Kim KB, Anand SS, Kim HJ, White CA, Fisher JW, Tornero-Velez R, Bruckner JV
(2010) Age, dose, and time-dependency of plasma and tissue distribution of
163 deltamethrin in immature rats. Toxicological sciences : an official journal of the
Society of Toxicology 115:354-368.
Kohrman DC, Smith MR, Goldin AL, Harris J, Meisler MH (1996) A missense mutation
in the sodium channel Scn8a is responsible for cerebellar ataxia in the mouse
mutant jolting. The Journal of neuroscience : the official journal of the Society for
Neuroscience 16:5993-5999.
Kumar A, Sasmal D, Sharma N (2015) An insight into deltamethrin induced apoptotic
calcium, p53 and oxidative stress signalling pathways. Toxicology and
Environmental Health Sciences 7:25-34.
Laird JM, Souslova V, Wood JN, Cervero F (2002) Deficits in visceral pain and referred
hyperalgesia in Nav1.8 (SNS/PN3)-null mice. The Journal of neuroscience : the
official journal of the Society for Neuroscience 22:8352-8356.
Lazarini CA, Florio JC, Lemonica IP, Bernardi MM (2001) Effects of prenatal exposure
to deltamethrin on forced swimming behavior, motor activity, and striatal
dopamine levels in male and female rats. Neurotoxicology and teratology 23:665-
673.
Leonard AS, Lim IA, Hemsworth DE, Horne MC, Hell JW (1999) Calcium/calmodulin-
dependent protein kinase II is associated with the N-methyl-D-aspartate receptor.
Proceedings of the National Academy of Sciences of the United States of
America 96:3239-3244.
Lisman J, Yasuda R, Raghavachari S (2012) Mechanisms of CaMKII action in long-term
potentiation. Nature reviews Neuroscience 13:169-182.
164 Low C-M, Wee K (2010) New Insights into the Not-So-New NR3 Subunits of N-Methyl-
D-aspartate Receptor: Localization, Structure, and Function. Molecular
pharmacology 78:1-11.
Lu C, Schenck FJ, Pearson MA, Wong JW (2010) Assessing children's dietary pesticide
exposure: direct measurement of pesticide residues in 24-hr duplicate food
samples. Environmental health perspectives 118:1625-1630.
Lu C, Barr DB, Pearson M, Bartell S, Bravo R (2006) A longitudinal approach to
assessing urban and suburban children's exposure to pyrethroid pesticides.
Environmental health perspectives 114:1419-1423.
Luscher C, Malenka RC (2012) NMDA receptor-dependent long-term potentiation and
long-term depression (LTP/LTD). Cold Spring Harbor perspectives in biology 4.
Ma L, Li X-w, Zhang S-j, Yang F, Zhu G-m, Yuan X-b, Jiang W (2014) Interleukin-1 beta
guides the migration of cortical neurons. Journal of Neuroinflammation 11:114.
Magby JP, Richardson JR (2017) Developmental pyrethroid exposure causes long-term
decreases of neuronal sodium channel expression. Neurotoxicology 60:274-279.
Meiri N, Sun M-K, Segal Z, Alkon DL (1998) Memory and long-term potentiation (LTP)
dissociated: Normal spatial memory despite CA1 LTP elimination with
<em>Kv1.4</em> antisense. Proceedings of the National Academy of
Sciences 95:15037.
Meisler MH, Kearney J, Ottman R, Escayg A (2001) Identification of epilepsy genes in
human and mouse. Annu Rev Genet 35:567-588.
165 Meisler MH, Kearney JA, Sprunger LK, MacDonald BT, Buchner DA, Escayg A (2002)
Mutations of voltage-gated sodium channels in movement disorders and
epilepsy. Novartis Foundation symposium 241:72-81; discussion 82-76, 226-232.
Migaud M, Charlesworth P, Dempster M, Webster LC, Watabe AM, Makhinson M, He Y,
Ramsay MF, Morris RG, Morrison JH, O'Dell TJ, Grant SG (1998) Enhanced
long-term potentiation and impaired learning in mice with mutant postsynaptic
density-95 protein. Nature 396:433-439.
Mooney SM, Miller MW (2000) Expression of bcl-2, bax, and caspase-3 in the brain of
the developing rat. Developmental Brain Research 123:103-117.
Morgan MK (2012) Children's exposures to pyrethroid insecticides at home: a review of
data collected in published exposure measurement studies conducted in the
United States. International journal of environmental research and public health
9:2964-2985.
Morris RG, Garrud P, Rawlins JN, O'Keefe J (1982) Place navigation impaired in rats
with hippocampal lesions. Nature 297:681-683.
Morris RG, Anderson E, Lynch GS, Baudry M (1986) Selective impairment of learning
and blockade of long-term potentiation by an N-methyl-D-aspartate receptor
antagonist, AP5. Nature 319:774-776.
Morsali D, Bechtold D, Lee W, Chauhdry S, Palchaudhuri U, Hassoon P, Snell DM,
Malpass K, Piers T, Pocock J, Roach A, Smith KJ (2013) Safinamide and
flecainide protect axons and reduce microglial activation in models of multiple
sclerosis. Brain : a journal of neurology 136:1067-1082.
166 Moser EI, Krobert KA, Moser MB, Morris RG (1998) Impaired spatial learning after
saturation of long-term potentiation. Science (New York, NY) 281:2038-2042.
Nair SG, Gudelsky GA (2004) Protein kinase C inhibition differentially affects 3,4-
methylenedioxymethamphetamine-induced dopamine release in the striatum and
prefrontal cortex of the rat. Brain research 1013:168-173.
Nicoll RA (2017) A Brief History of Long-Term Potentiation. Neuron 93:281-290.
Noebels JL (2002) Sodium channel gene expression and epilepsy. Novartis Foundation
symposium 241:109-120; discussion 120-103, 226-132.
Oh MM, Kuo AG, Wu WW, Sametsky EA, Disterhoft JF (2003) Watermaze learning
enhances excitability of CA1 pyramidal neurons. Journal of neurophysiology
90:2171-2179.
Oulhote Y, Bouchard MF (2013) Urinary metabolites of organophosphate and pyrethroid
pesticides and behavioral problems in Canadian children. Environmental health
perspectives 121:1378-1384.
Pappalardo LW, Black JA, Waxman SG (2016) Sodium channels in astroglia and
microglia. Glia 64:1628-1645.
Parish CL, Finkelstein DI, Tripanichkul W, Satoskar AR, Drago J, Horne MK (2002) The
role of interleukin-1, interleukin-6, and glia in inducing growth of neuronal
terminal arbors in mice. The Journal of neuroscience : the official journal of the
Society for Neuroscience 22:8034-8041.
Paxinos G, Watson C, Pennisi M, Topple A (1985) Bregma, lambda and the interaural
midpoint in stereotaxic surgery with rats of different sex, strain and weight.
Journal of neuroscience methods 13:139-143.
167 Pitzer EM, Sugimoto C, Gudelsky GA, Huff Adams CL, Williams MT, Vorhees CV
(2019) Deltamethrin Exposure Daily From Postnatal Day 3-20 in Sprague-Dawley
Rats Causes Long-term Cognitive and Behavioral Deficits. Toxicological
sciences : an official journal of the Society of Toxicology 169:511-523.
Planells-Cases R, Caprini M, Zhang J, Rockenstein EM, Rivera RR, Murre C, Masliah
E, Montal M (2000) Neuronal Death and Perinatal Lethality in Voltage-Gated
Sodium Channel αII-Deficient Mice. Biophysical journal 78:2878-2891.
Porter JD, Goldstein LA, Kasarskis EJ, Brueckner JK, Spear BT (1996) The Neuronal
Voltage-Gated Sodium Channel, Scn8a, Is Essential for Postnatal Maturation of
Spinal, but Not Oculomotor, Motor Units. Experimental neurology 139:328-334.
Richardson JR, Taylor MM, Shalat SL, Guillot TS, 3rd, Caudle WM, Hossain MM,
Mathews TA, Jones SR, Cory-Slechta DA, Miller GW (2015) Developmental
pesticide exposure reproduces features of attention deficit hyperactivity disorder.
FASEB journal : official publication of the Federation of American Societies for
Experimental Biology 29:1960-1972.
Rutten K, Misner DL, Works M, Blokland A, Novak TJ, Santarelli L, Wallace TL (2008)
Enhanced long-term potentiation and impaired learning in phosphodiesterase
4D-knockout (PDE4D) mice. The European journal of neuroscience 28:625-632.
Saavedra A, Baltazar G, Duarte EP (2007) Interleukin-1beta mediates GDNF up-
regulation upon dopaminergic injury in ventral midbrain cell cultures.
Neurobiology of disease 25:92-104.
168 Saillenfait AM, Ndiaye D, Sabate JP (2015) Pyrethroids: exposure and health effects--
an update. International journal of hygiene and environmental health 218:281-
292.
Salvesen GS (2002) Caspases: opening the boxes and interpreting the arrows. Cell
Death Differ 9:3-5.
Santucci DM, Raghavachari S (2008) The effects of NR2 subunit-dependent NMDA
receptor kinetics on synaptic transmission and CaMKII activation. PLoS
computational biology 4:e1000208.
Sheets LP, Doherty JD, Law MW, Reiter LW, Crofton KM (1994) Age-dependent
differences in the susceptibility of rats to deltamethrin. Toxicology and applied
pharmacology 126:186-190.
Shelton JF, Geraghty EM, Tancredi DJ, Delwiche LD, Schmidt RJ, Ritz B, Hansen RL,
Hertz-Picciotto I (2014) Neurodevelopmental disorders and prenatal residential
proximity to agricultural pesticides: the CHARGE study. Environmental health
perspectives 122:1103-1109.
Shih AY, Johnson DA, Wong G, Kraft AD, Jiang L, Erb H, Johnson JA, Murphy TH
(2003) Coordinate regulation of glutathione biosynthesis and release by Nrf2-
expressing glia potently protects neurons from oxidative stress. The Journal of
neuroscience : the official journal of the Society for Neuroscience 23:3394-3406.
Shimono K, Baudry M, Ho L, Taketani M, Lynch G (2002) Long-term recording of LTP in
cultured hippocampal slices. Neural plasticity 9:249-254.
Soderlund DM (2012) Molecular mechanisms of pyrethroid insecticide neurotoxicity:
recent advances. Archives of toxicology 86:165-181.
169 Stevens M, Timmermans S, Bottelbergs A, Hendriks JJ, Brone B, Baes M, Tytgat J
(2013) Block of a subset of sodium channels exacerbates experimental
autoimmune encephalomyelitis. Journal of neuroimmunology 261:21-28.
Strack S, Colbran RJ (1998) Autophosphorylation-dependent targeting of calcium/
calmodulin-dependent protein kinase II by the NR2B subunit of the N-methyl- D-
aspartate receptor. The Journal of biological chemistry 273:20689-20692.
Strack S, McNeill RB, Colbran RJ (2000) Mechanism and regulation of
calcium/calmodulin-dependent protein kinase II targeting to the NR2B subunit of
the N-methyl-D-aspartate receptor. The Journal of biological chemistry
275:23798-23806.
Suthana NA, Ekstrom AD, Moshirvaziri S, Knowlton B, Bookheimer SY (2009) Human
hippocampal CA1 involvement during allocentric encoding of spatial information.
The Journal of neuroscience : the official journal of the Society for Neuroscience
29:10512-10519.
Tanaka J, Toku K, Zhang B, Ishihara K, Sakanaka M, Maeda N (1999) Astrocytes
prevent neuronal death induced by reactive oxygen and nitrogen species. Glia
28:85-96.
Tsien JZ, Huerta PT, Tonegawa S (1996) The essential role of hippocampal CA1 NMDA
receptor-dependent synaptic plasticity in spatial memory. Cell 87:1327-1338.
Viel JF, Warembourg C, Le Maner-Idrissi G, Lacroix A, Limon G, Rouget F, Monfort C,
Durand G, Cordier S, Chevrier C (2015) Pyrethroid insecticide exposure and
cognitive developmental disabilities in children: The PELAGIE mother-child
cohort. Environment international 82:69-75.
170 Viviani B, Boraso M (2011) Cytokines and neuronal channels: a molecular basis for
age-related decline of neuronal function? Experimental gerontology 46:199-206.
Viviani B, Bartesaghi S, Gardoni F, Vezzani A, Behrens MM, Bartfai T, Binaglia M,
Corsini E, Di Luca M, Galli CL, Marinovich M (2003) Interleukin-1beta enhances
NMDA receptor-mediated intracellular calcium increase through activation of the
Src family of kinases. The Journal of neuroscience : the official journal of the
Society for Neuroscience 23:8692-8700.
Vorhees CV, Williams MT (2016) Cincinnati water maze: A review of the development,
methods, and evidence as a test of egocentric learning and memory.
Neurotoxicology and teratology 57:1-19.
Vorhees CV, Herring NR, Schaefer TL, Grace CE, Skelton MR, Johnson HL, Williams
MT (2008) Effects of neonatal (+)-methamphetamine on path integration and
spatial learning in rats: effects of dose and rearing conditions. International
journal of developmental neuroscience : the official journal of the International
Society for Developmental Neuroscience 26:599-610.
Vyklicky V, Korinek M, Smejkalova T, Balik A, Krausova B, Kaniakova M, Lichnerova K,
Černý J, Krusek J, Dittert I, Horak M, Vyklicky L (2014) Structure, Function, and
Pharmacology of NMDA Receptor Channels. Physiological research / Academia
Scientiarum Bohemoslovaca 63 Suppl 1:S191-203.
Wagner-Schuman M, Richardson JR, Auinger P, Braun JM, Lanphear BP, Epstein JN,
Yolton K, Froehlich TE (2015) Association of pyrethroid pesticide exposure with
attention-deficit/hyperactivity disorder in a nationally representative sample of
U.S. children. Environmental health : a global access science source 14:44.
171 Wallace RH, Scheffer IE, Barnett S, Richards M, Dibbens L, Desai RR, Lerman-Sagie
T, Lev D, Mazarib A, Brand N, Ben-Zeev B, Goikhman I, Singh R, Kremmidiotis
G, Gardner A, Sutherland GR, George AL, Jr., Mulley JC, Berkovic SF (2001)
Neuronal sodium-channel alpha1-subunit mutations in generalized epilepsy with
febrile seizures plus. Am J Hum Genet 68:859-865.
Walters J, Pop C, Scott FL, Drag M, Swartz P, Mattos C, Salvesen GS, Clark AC (2009)
A constitutively active and uninhibitable caspase-3 zymogen efficiently induces
apoptosis. The Biochemical journal 424:335-345.
Wang S, Cheng Q, Malik S, Yang J (2000) Interleukin-1beta inhibits gamma-
aminobutyric acid type A (GABA(A)) receptor current in cultured hippocampal
neurons. The Journal of pharmacology and experimental therapeutics 292:497-
504.
Wenzel A, Fritschy JM, Mohler H, Benke D (1997) NMDA receptor heterogeneity during
postnatal development of the rat brain: differential expression of the NR2A,
NR2B, and NR2C subunit proteins. Journal of neurochemistry 68:469-478.
Williams JM, Guevremont D, Mason-Parker SE, Luxmanan C, Tate WP, Abraham WC
(2007) Differential trafficking of AMPA and NMDA receptors during long-term
potentiation in awake adult animals. The Journal of neuroscience : the official
journal of the Society for Neuroscience 27:14171-14178.
Williams MT, Gutierrez A, Vorhees CV (2019) Effects of Acute Deltamethrin Exposure in
Adult and Developing Sprague Dawley Rats on Acoustic Startle Response in
Relation to Deltamethrin Brain and Plasma Concentrations. Toxicological
sciences : an official journal of the Society of Toxicology 168:61-69.
172 Xue Z, Li X, Su Q, Xu L, Zhang P, Kong Z, Xu J, Teng J (2013) Effect of synthetic
pyrethroid pesticide exposure during pregnancy on the growth and development
of infants. Asia-Pacific journal of public health 25:72s-79s.
Yang S, Liu ZW, Wen L, Qiao HF, Zhou WX, Zhang YX (2005) Interleukin-1beta
enhances NMDA receptor-mediated current but inhibits excitatory synaptic
transmission. Brain research 1034:172-179.
Yashiro K, Philpot BD (2008) Regulation of NMDA receptor subunit expression and its
implications for LTD, LTP, and metaplasticity. Neuropharmacology 55:1081-
1094.
Zhou C, Qi C, Zhao J, Wang F, Zhang W, Li C, Jing J, Kang X, Chai Z (2011)
Interleukin-1beta inhibits voltage-gated sodium currents in a time- and dose-
dependent manner in cortical neurons. Neurochemical research 36:1116-1123.
173 FIGURES AND LEGENDS
A B Tetanus 200 * 200
150 * e
e 150
n
i
n
l
i
l
e e
s 100 s
a 100
a
B
B
% CO - Males 50
% 50 DLM 1.0 - Males
0 0 0 25 50 75 100 CO DLM 1.0 Time (min) Treatment
C D Tetanus 200 200
150 e 150
e
n
i
n
l
i
l
e e
s 100
s 100
a
a
B
B
% CO - Females % 50 50 DLM 1.0 - Females 0 0 0 25 50 75 100 CO DLM 1.0 Time (min) Treatment
Figure 1. Adult CA1 Hippocampal LTP: LTP results for male DLM-treated rats and corn oil treated rats over time (A) and presented as overall average (B). LTP results for female DLM-treated rats and corn oil controls across intervals (C) and as overall average (D). EPSP recordings are shown as a percentage of baseline. The tetanizing stimulus (dotted line demarcating time of stimulus application; tetanus = 100 Hz in 10 bursts [4 pulses/burst] delivered at a frequency of 5 Hz for 2 s) was delivered after 10 min of stable baseline, and then recorded for 90 min following stimulation. Corn oil, CO: n = 17 total, 9 males, 8 females; 1.0 mg/kg DLM: n = 17 total, 9 males, 8 females. *p <
174 0.05 compared with vehicle. Abbreviations: CO, corn oil; DLM, deltamethrin; EPSP, excitatory postsynaptic potential; LTP, long-term potentiation.
175 CO DLM DLM CO A COCO DLMDLMDLM B DLMDLM COCO C CO DLM AA COCO DLMDLM BC DLM CO C CO DLM AA CO DLM C Drd1A – STR Drd2 – STR DAT – STR Drd1Drd1M ales ––STRSTR Drd2M ales– STR Drd1MMales ales– STR Males Males Males Drd1 ~49 kDa Drd2 ~49 kDa Drd2Actin ~49 ~42 kDa kDa Drd1Drd1Actin ~49 ~49 kDa~42 kDa kDa Drd2 ~49 kDa DAT ~70 kDa Drd1 ~49 kDa Drd2Actin ~49 ~42 kDa kDa Drd1ActinDrd1Actin ~49 ~49~42~49 kDa ~42kDakDa kDa DATActin ~70 ~42 kDa kDa Drd1Actin ~49 ~42 kDa kDa ActinActin ~42~42 kDakDa ActinActin ~42 ~42~42 kDa kDa Actin ~42 kDa
l Actin ~42 kDa l 0.6 l
a 2.0 a
l 0.8
a
l
l
l
n
l
l l
0.4 l a
0.6 n a
2.0 n a l 2.0 a Corn Oil Corn Oil
g 2.0 a
l 2.0 a 2.0
a 0.8
l
a
i n
0.4 g
n
a
g n
n 0.4
n
a i n Corn Oil
0.4 i
a n
Corn Oil n g S Corn Oil
n Corn Oil
g
g
g
g
n
i
g
n
S
i
S
i
g
i
i
i
g
g 1.0 DLM 1.0 DLM
i
i
g
g
d
i
S
S
S
i
S
i
S
S
d 1.5
1.0 DLM d 0.6
S
e
1.0 DLM S
S
S 1.0 DLM
S e
d 0.3
e
0.4 d
d 1.5 z
d 1.5
d 1.5
d 1.5
i d
z 1.5 d
z 0.6
e d
0.3 e
e
e l
d 0.3
e
i e
d 0.3
i
l
e
z
z
l z
0.4 e
z
e
e
a
z
z
i
i
i
e
i
i
z
i
a
l
l
z
l
z
z
a
l
l
i
l
z
i
i
i
l
i
m
l a
a
a
l
l
a
a
l a m
r 1.0
m 0.4
a
a
a
a
r
a
m r m 1.0 1.0
m 0.2
o
m m
m 1.0 1.0
r
r m
r 0.2
o
m o
r 1.0 m
0.2 m 0.4
r
r
r m
N 0.2
o
o
r
r
r
o
r
o 0.2
N
o
o
N
o
N
N
o
o
o
e
o
N
N
N
N
N
e
e
g
0.2
N
N e
e
N
N
0.5
e g
0.2
g
e
e a
e 0.5
e 0.5
g
g e
0.1 e
a
r e
g 0.1
g
a
e g
a 0.5
a 0.5
g g
0.1 r
0.5 r
g
r
g e
r 0.2
a a
0.1 g
g
a
a
a
r
e
r
e
a e
e
r
a
v
a
r
r
a
e
r
r
v
e
v
r
v
r
v
e
e
e
A
v
e e
0v .0
e
e
v
A
A
A
v A 0.0 v 00.0.0
v 0.0
A
v
v v
A 0.0
A A 0.00.0 HIPP NA STR A
A 0.0 0.0 A
A HIPP NA STR 0.00.0 0.0 HHIPPIPP NNAA SSTRTR A 0.0 HIPP NA STR HIPPHIPP NANA STRSTR HIPPHIPP NANA STRSTR HIPPHIPP NANA STRSTR HIPP NA STR ReRegiongion RRegionegion Region Region RegionRegionRegion RegionRegion Region
Figure 2. Dopamine receptor and transporter western blots: Data are for Drd1 (A) Drd2
(B) and DAT (C) protein expression in hippocampus, n. accumbens, and striatum of
DLM and CO treated male and female rats. Data are averaged signal normalized to actin. Representative blot images containing both CO and DLM bands alongside ladder are presented above as semiquantitative data. Drd1 (~49 kDa), Drd2 (~49 kDa), and
DAT (~70 kDa) are denoted with green bands, and actin. (~42 kDa) served as the housekeeping protein, is denoted with a red band on the western images.
Representative images are from blots examining the striatum. Sample size: n = 7-
10/treatment/sex/region/dopamine marker. Abbreviations: CO, corn oil; DLM, deltamethrin; DA, dopamine; DRD1, dopamine receptor subunit D1; DRD2, dopamine receptor subunit D2; DAT, dopamine transporter; HIPP, hippocampus; NA, nucleus accumbens; STR, striatum.
176 A GluR1 GluR1 – HIPP
l 0.3
a Corn Oil DLM CO
n g
i 1.0 DLM
S
d
e 0.2
z
i
l
a
m
r
o N
0.1
e g
a GluR1 ~102 kDa r
e Actin ~42 kDa v
A 0.0 HIPP NA STR Region
B GluR2 GluR2 – HIPP
l 0.25 a
n DLM CO
g i
S 0.20
d
e
z i
l 0.15
a
m r
o 0.10
N
e g
a 0.05 r
e GluR2 ~98 kDa v
A 0.00 Actin ~42 kDa HIPP NA STR Region
Figure 3. AMPA receptor subunit western blots: Western blot analysis of the AMPA receptor subunits GluR1 (A) and GluR2 (B) protein expression within the hippocampus, n. accumbens, and striatum of DLM and CO treated male and female rats. Data are
177 presented as averaged signal normalized to actin. Representative blot images containing both CO and DLM bands alongside ladder are presented above semiquantitative data. GluR1 (~102 kDa) and GluR2 (~98 kDa) are denoted with green bands, and actin (~42 kDa) our housekeeping protein is denoted with a red band on the representative western images. Representative images are all from blots examining the hippocampus region. Sample size: n = 7-10/treatment/sex/region/GluR marker.
Abbreviations: CO, corn oil; DLM, deltamethrin; GluR1, AMPA receptor subunit R1;
GluR2, AMPA receptor subunit R2; HIPP, hippocampus; NA, nucleus accumbens; STR, striatum.
178 A A COCODLD M L M NR1
l 0.4 a
n Corn Oil
g
i S
1.0 DLM
d 0.3
e
z
i
l a
m 0.2
r o
N NR1 – HIPP
e 0.1
g Males a
r NR1 ~130 kDa e
v Actin ~42 kDa
A 0.0 HIPP NA STR NR1 ~130 kDa Actin ~42 kDa Region
B CO D L M C CO D L M B CO D L M C CO D L M NR2A – HIPP NR2A – HIPP Males NR2A ~165 kDa Actin ~42 kDa Females NR2A – HIPP NR2A – HIPP Males NR2A ~165 kDa Actin ~42 kDa Females
NR2A - males NR2A - females *
l 1.0 l 0.6
a a
*
n n
NR2Ag - males NR2Ag - females
i i
S S
0.8
*
l l
1.0 d 0.6 d
a
a
*
e e n
n 0.4
z z
i i
g
g
l l i
0.6 i
a a
S
S
0.8
m m
d
d
r r
e e
o 0.4 o z
0.4 z
i
i
l l 0.6 N N
0.2
a
a
e e
m
m
g g
r r
a 0.2 a
r r o
0.4 o
e e
N
N
0.2
v v
e e
A 0.0 A 0.0
g
g a
0.2 a r
HIPP NA STR r HIPP NA STR
e
e
v
v A 0.0 Region A 0.0 Region HIPP NA STR HIPP NA STR CO DLM DRegion Region DLM CO CO DL M E DLM CO D NR2B – HIPP E NR2B – HIPP Males NR2B ~166 kDa Actin ~42 kDa Females NR2B ~166 kDa NR2A – STR N R 2 B – S T R Actin ~42 kDa Females M a l e s NR2B - males NR2B - females
l 1.5 l 0.4
a a
NR2Bn - males NR2Bn - females
g g
i i
S S
l l
1.5 0.4
a a
d d 0.3
n
n
e e
* g
1.0 g
z z
i
i
i i
*
l l
S
S
a a d d 0.3
m m 0.2
e
e
r r
1.0 *
z
z
i
i
o o
*
l
l
N N
a a
0.5
e e m
m 0.2 r
r 0.1
g g
o
o
a a
r r
N
N
0.5 e e
e e
v 0.1 v
g g
A 0.0 A 0.0
a
a r
HIPP NA STR r HIPP NA STR
e
e
v
v A 0.0 Region A 0.0 Region HIPP NA STR HIPP NA STR Region Region
179 Figure 4. NMDA receptor subunit western blots: NMDA receptor subunits NR1 (A) are shown for male and females combined within the hippocampus, n. accumbens, and striatum of DLM and CO treated rats. Western blot data for NR2 subunits are also analyzed by sex, based on sex x treatment interaction. NR2A male (B) and female (C) as well as NR2B male (D) and female (E) western results are displayed by region for
CO and DLM treated rats. Data are presented as averaged signal normalized to actin.
Representative images containing both CO and DLM bands alongside ladder are presented above semiquantitative data. NR1 (~130 kDa), NR2A (~165 kDa), and NR2B
(~166 kDa) are denoted with green bands, and actin (~42 kDa) our housekeeping protein is denoted with a red band on the representative western images.
Representative images are all from blots examining the hippocampus region. Sample size: n = 7-10/treatment/sex/region/NMDA receptor subunit marker. **p < 0.01 compared with vehicle control. Abbreviations: CO, corn oil; DLM, deltamethrin; NR1,
NMDA receptor subunit NR1; NR2A, NMDA receptor subunit NR2A; NR2B, NMDA receptor subunit NR2B; HIPP, hippocampus; NA, nucleus accumbens; STR, striatum.
180
) 400 l
a Corn Oil
s a
B DLM
300
f
o
% (
200
e
t
a m
a 100
t
u
l G 0 0 30 60 90 120 150 Time (min)
Figure 5. Extracellular Glutamate Release: Potassium (80 mM) stimulated glutamate release measured via microdialysis within the hippocampus of male DLM and CO treated rats. Results are percent of baseline (time point zero) across the 150 min of testing. Sample size: n = 6/treatment. Abbreviations: CO, corn oil; DLM, deltamethrin.
181
Figure 6. Po-Caspase-3 western blots: Western blot analysis of pro-caspase-3 protein expression for male and female rats treated with CO and DLM within the hippocampus and striatum following our dosing paradigm at P21. Data are averaged signal normalized to actin. Representative blots containing CO and DLM bands alongside ladder are presented semi-quantitatively. Pro-caspase-3 (~32 kDa) are denoted with red bands, and actin (~42 kDa) in green bands on representative western images. Image is from a blot examining the striatum of DLM and CO rats. Sample size: n = 7-
11/sex/treatment/region. Abbreviations: CO, corn oil; DLM, deltamethrin; HIPP, hippocampus; STR, striatum.
182
A Hippocampus B Nucleus Accumbens
)
) 0
2.0 0 2.0 1
Corn Oil 1
G
G
O
O
L
L
(
(
1.0 DLM
l l
a 1.5
a 1.5
n
n
g
g
i
i
S
S
d
d
e e
z 1.0
z 1.0
i
i
l
l
a
a
m
m
r
r
o
o
N
N
0.5 0.5
e
e
g
g
a
a
r
r
e
e
v
v A 0.0 A 0.0 3 9 15 20 3 9 15 20 Postnatal Day Postnatal Day
C Striatum )
0 2.0
1 G
O P3 P9 P15 P20 P21
L
(
l CO DLM CO DLM CO DLM CO DLM CO DLM
a 1.5
n
g
i
S
d e
z 1.0
i
l
a
m
r
o N
0.5
e
g
a
r
e v
A 0.0 Nucleus Accumbens 3 9 15 20 Postnatal Day Actin ~42 kDa Cleaved Caspase-3 ~19 kDa
Figure 7. Cleaved Caspase-3 western blots: Western analysis of cleaved caspase-3 protein expression for male rats treated with CO and DLM in the hippocampus (A), nucleus accumbens (B), and striatum (C) across the dosing period. Data are averaged signal normalized to actin and log transformed. Representative images containing both
CO and DLM bands for ages P3-20 alongside ladder are semiquantitative. Cleaved caspase-3 (~19/17 kDa) is denoted in green and actin (~42 kDa) in red. Image is from a blot examining the n. accumbens. Sample size: n = 7-11/treatment/region.
Abbreviations: CO, corn oil; DLM, deltamethrin; HIPP, hippocampus; NA, nucleus accumbens; STR, striatum; P, postnatal day.
183
184 Figure 8. TUNEL stained sections for apoptosis. Using spot detection in striatum and hippocampus of CO and DLM treated P21 male rats (A). Stereological count of TUNEL- positive cells in the dentate gyrus of DLM and CO treated P21 male rats (B). Images are of hippocampus (C) and striatum (D) for TAC nuclease treated (positive control), CO and DLM samples. Inset to each image is an enlarged region to show TUNEL labeled nuclei, denoted with dashed box. Scale bar = 100 mm. Black arrows are TUNEL positive cells. Sample size: n = 8-11/treatment/region. *p < 0.05; ****p < 0.0001 compared with vehicle control. Abbreviations: CO, corn oil; DLM, deltamethrin.
185
Figure 9. Cytokine analysis: Proinflammatory cytokines were assessed in CO and DLM treated male rats in P20 hippocampus (A), n. accumbens (B), neostriatum (C), and all regions included (D). Data are average normalized concentration (pg/mL). Sample size: n = 6/treatment/region. †p<0.1; *p < 0.05 compared with vehicle control. Abbreviations:
CO, corn oil; DLM, deltamethrin.
186 CHAPTER 4
General Discussion
187 Developmental DLM-induced behavioral and cognitive deficits
Pyrethroids are replacing organophosphate pesticides in agricultural, commercial, and household use. With this increase children, are being exposed to pyrethroids more often and are reported as showing adverse effects. However, epidemiological data from NHANES do not rule out the effect of mixed pesticide exposures. Exposure to multiple compounds, such as pyrethroids and organophosphates occur and may lead to adverse neurological outcomes in combination. Although organophosphates are decreasing in use, they remain legal for some applications, making separating the effects difficult. Studies in rodents examining mixed exposure could be undertaken in the future to test for interactions, but such an experiment was outside the scope of this project. Nevertheless, pesticides are implicated in adverse neurological outcomes following developmental exposure and understanding the mechanism of action of each one is a necessary building block for future interaction studies. For example, there are associations between elevated pyrethroid metabolites in urine and neurological disorders, such as autism spectrum disorder (ASD), attention deficit hyperactivity disorder (ADHD), and developmental delay (Oulhote and Bouchard, 2013; Xue et al., 2013; Shelton et al., 2014; Richardson et al., 2015; Wagner-Schuman et al., 2015). Nonetheless, these studies have limitations and do not provide clear evidence of harm (Burns and Pastoor, 2018). For cognitive outcomes, few data exist in children or animals after developmental pyrethroid exposure. Deltamethrin (DLM) is a Type II pyrethroid that has received attention in animal studies largely because it is widely used in commercial, agriculture and home settings. Animal models examining long-term neurobehavioral and neurochemical
188 effects are limited and outcomes vary (Eriksson and Fredriksson, 1991; Aziz et al.,
2001; Lazarini et al., 2001; Johri et al., 2006; Richardson et al., 2015). The models vary by dose, exposure period and length, route, vehicle, dose volume, age, tests, species, and strain. As a result, a clear picture of the neurodevelopmental effects of DLM has not yet emerged.
We developed a model to examine the long-term effects of DLM (0, 0.25, 0.5, and 1.0 mg/kg in 5 ml/kg in corn oil) administered by gavage from P3-20 in Sprague
Dawley rats (Chapter 2) (Pitzer et al., 2019). Rats were used because of their more advanced cognitive ability compared with mice. DLM or corn oil (CO) treated rats were assessed for allocentric hippocampal dependent learning and memory, egocentric striatal dependent learning and memory, conditioned freezing, acoustic and tactile startle, locomotor activity with and without drug challenge, and anxiety-like behavior.
Deficits in allocentric reversal learning and memory were observed in the Morris water maze (MWM) (Pitzer et al., 2019). We found that DLM treated rats learned the first phase of the test (acquisition) at the same rate as CO controls. However, on reversal and shift trials, the DLM rats had reduced path efficiency and increased average heading error, with males specifically being impaired during shift phases (Pitzer et al.,
2019). This suggests cognitive flexibility was impaired rather than spatial learning, since deficits in reversal learning are regarded as an impairment in remapping of a learned response (Vorhees and Williams, 2006). Shift trials are unique to this lab; however, there is no consensus on the interpretation of shift effects. It is likely that impairments in shift trials reflect an additional aspect of cognitive flexibility or retroactive interference during retrieval given that to perform this task the rat must extinguish two
189 past platform locations that compete with learning the new location. The hippocampus is critical for spatial learning and flexibility for stimulus-guided behavior (Eichenbaum and
Cohen, 2004). Our observation of altered reversal and shift learning in the absence of acquisition impairment differs from other studies that used the MWM following DLM exposure. Hossain et al. (2015) found deficits in learning and memory in the MWM in adult C57BL/6 mice treated with DLM (0 or 3 mg/kg dissolved in corn oil every 3 days for 60 days, gavage). The different outcomes probably are due to different doses, ages and species.
Hippocampus-dependent place learning, but not response learning, is required for spatial flexibility, as seen in a water-cross maze examining learning strategies
(Kleinknecht et al., 2012). In addition, an intact hippocampus is necessary for learning spatial relationships; mice with ibotenic acid hippocampal lesions could not learn the water-cross maze (Kleinknecht et al., 2012). The hippocampus is important in place- learning, as seen by fornix lesioned rats having impaired cognitive flexibility when cues or starting position are altered in the MWM, with acquisition spared (Eichenbaum et al.,
1990). Morris et al. (1990) has also shown that the hippocampus, subiculum, and combined hippocampus/subiculum lesions result in impairment of place navigation in the MWM, but with gradual catch up learning over time to controls in hippocampus and subiculum lesioned groups. However, the hippocampus/subiculum lesioned rats had more severe impairments, never acquiring place learning, which could not be overcome by extra training, unlike the hippocampus and subiculum only lesioned groups (Morris et al., 1990). Lesioned rats also had impaired matching to place (serial spatial learning) which involved the location of the escape platform changing each day (remains the
190 same for the trials within each day), which overtraining could not overcome (Morris et al., 1990). Subiculum lesioned rats had the least severe deficits in the matching to place task, with larger deficits observed in the hippocampus-only lesion and hippocampus/subiculum lesioned rats (Morris et al., 1990). Additionally, Morris et al.
(1990) examined overtraining in the MWM in control rats, which were then lesioned and retested. This involved rats that were previously included in the control group, undergoing a new surgery procedure to receive lesions. The previous control rats that were newly lesioned in the hippocampus or hippocampus/subliculum were retested and had impaired retention and impaired relearning (Morris et al., 1990). These data show the importance of the hippocampus in place learning and flexibility. The extent of injury caused by developmental DLM affected place learning flexibility, implicating the hippocampus and subiculum as areas that DLM may be damaging.
In addition to MWM reversal learning, our developmental DLM model showed alterations in conditioned freezing (Pitzer et al., 2019). Conditioned freezing assesses two mnemonic processes, one hippocampally dependent (contextual) and one amygdala dependent (cued) (Curzon et al., 2009). We found that DLM treated males had increased freezing behavior during conditioning with impaired contextual recall and no effects on cued freezing (Pitzer et al., 2019). Contextual freezing and MWM cognitive flexibility both depend on an intact hippocampus.
Involvement of place cells in CA1 of the hippocampus are implicated in spatial memory and cognitive flexibility (Ainge et al., 2007). Rats with hippocampal damage induced by ibotenic acid of the dentate gyrus and CA regions (Jarrard, 1989) were tested in a double-ended Y-maze, a hippocampal spatial learning and memory task of
191 left-right discrimination and alternation, Lesioned rats had increased errors when food reward locations were reversed, but not during initial learning (Ainge et al., 2007). In addition, Ainge et al. (2007) found that place fields within the hippocampus encoded both current location (generally starting location within the Y-maze stem) as well as projected locations (reward arms), and that this information is needed for flexibility.
Although this study uses a different behavioral test from ours, it also suggests the hippocampus is involved in cognitive flexibility. Hence, the deleterious effects of DLM on cognitive flexibility may be related to deficits in remapping spatial locations rather than a deficit in memory consolidation. The hippocampus is also necessary for contextual learning and is important for guiding behavior based on contextual information. However, if the hippocampus is disabled the animal must rely on habit based strategies, which may involve reversal learning (Hirsh, 1974).
In addition to place fields being implicated in reversal learning, both hippocampal stabilization of β-catenin and temporal dynamics of activity-regulated cytoskeleton- associated protein (Arc) are involved in reversal learning (Mills et al., 2014). Mice with increased β-catenin under conditional calcium-calmodulin dependent protein kinase II
(CaMKII) expression using a Cre-lox system, have deficits in spatial reversal learning in the MWM, with spared acquisition, and impaired cognitive flexibility in a delayed nonmatch to place T-maze task (Mills et al., 2014). In addition, Arc knock-in mice were found to have intact spatial learning but deficits in reversal learning in a modified Barnes maze task (Wall et al., 2018). This model modified the temporal expression of Arc which is a key mediator of synaptic plasticity and relies on proteasome-dependent degradation. The data imply that the hippocampus and its signaling pathways are
192 necessary for cognitive flexibility and regulating synaptic plasticity. To understand the extent of the effects of DLM on reversal learning, data on the signaling pathways involved would be helpful.
The hippocampus is a region that undergoes continuous neurogenesis.
Specifically, the dentate gyrus generates new granule cells at similar time periods of our
DLM dosing paradigm (Bayer and Altman, 1974). The dentate is known to be involved in spatial learning and memory (Okada et al., 2003). Potential disruption of neurogenesis in the hippocampus, due to developmental DLM exposure could result in impaired learning and memory. Exposures to toxins, such as lipopolysaccharide (LPS), lead, or vitamin A deficiency, during gestational or postnatal development reduces neurogenesis and results in impaired reference memory, impaired novel object recognition, and impaired contextual fear memory (Jaako-Movits et al., 2005; Bonnet et al., 2008; Graciarena et al., 2010; Abrous and Wojtowicz, 2015). In addition, stress during development reduces neurogenesis throughout life and results in impaired spatial memory (Y-maze and MWM) (Lemaire et al., 2000; Koo et al., 2003). Possible changes to neurogenesis still need to be investigated after developmental DLM.
We also observed deficits in egocentric learning and memory in the Cincinnati water maze (CWM) (Chapter 2). The CWM is a striatal dopamine (DA) dependent task
(Braun et al., 2015; Braun et al., 2016; Vorhees and Williams, 2016). DLM treated males had increased latency and errors in the CWM compared with controls, an effect not observed in females (Pitzer et al., 2019). This effect indicates impairments in the striatal DA system in males developmentally treated with DLM.
193 In addition, the sexually dimorphic effect observed in the CWM is consistent with male specific effects on adult behavior in mice treated developmentally with DLM from
E0-P21 (Richardson et al., 2015). Richardson et al. (2015) observed male specific hyperactivity in DLM treated mice in a dose-dependent manner in an open-field (OF)
(Richardson et al., 2015). The OF task examines motor activity in a novel environment, such that the environment motivates the locomotion. The DLM induced hyperactivity was attenuated with methylphenidate (1 mg/kg i.p.) a typical medication for ADHD, as well as by selective DA D1 receptor (DRD1) and DA D2 receptor (DRD2) antagonists
(SCH23390 (DRD1 antagonist), by eticlopride (DRD2 antagonist); or by quinpirole
(DRD2-autoreceptor antagonist)) (Richardson et al., 2015). In addition, the DA agonists
(apomorphine, a non-specific DA receptor agonist; and SKF82958 a DRD1 agonist) increased activity in DLM treated mice more than in controls (Richardson et al., 2015).
The male hyperactivity, which could be altered by DA specific pharmacological agents, observed by Richardson et al. (2015), corroborate our egocentric striatal DA dependent deficits in DLM treated males. However, the actions of the specific DA receptors have not been explored with regard to performance in the CWM. It is important to note that although DA is implicated in our study and Richardson et al.
(2015), the tasks that divulge this explore very different aspects of behavior, with the OF studying novelty induced locomotion and the CWM studying egocentric learning and memory. Additionally, Richardson et al.’s (2015) data and ours in DLM treated animals both showed sexually dimorphic effects on brain and behavior.
Richardson et al., (2015) observed hyperactivity following developmental DLM exposure, however we observed the opposite effect in the OF. In chapter 2 we found
194 that DLM treated rats had reduced activity in an OF test of spontaneous locomotor behavior (Pitzer et al., 2019). Increased locomotor activity was observed in adult male and female rats following P10-16 DLM exposure (Eriksson and Fredriksson, 1991).
Interestingly, E6-15 exposure resulted in decreased activity in DLM treated male rats compared with controls at P60 (Lazarini et al., 2001). Another study examining gestational exposure (E5-21) observed dose-dependent activity reductions in male DLM treated offspring (Johri et al., 2006). This effect was observed at 3, 6, and 9 weeks of age and diminished with age; females were not tested (Johri et al., 2006). These DLM induced changes in activity may be due to differences in species, doses, timing, and route of administration, but most find decreased activity as did we.
Locomotor activity was also examined following drug challenges. In Chapter 2 we tested activity following administration of amphetamine (AMPH) and MK-801 (Pitzer et al., 2019). AMPH is a classic sympathomimetic agonist used in the treatment of
ADHD (Bidwell et al., 2011; Miller, 2011). AMPH administration increased activity in all groups, with the DLM treated rats showing a greater increase than controls but the difference fell short of significance (Pitzer et al., 2019). MK-801 is an N-methyl-D- aspartate (NMDA) receptor non-competitive antagonist that causes hyperactivity. In our experiment, MK-801 increased activity in all groups, but the increase in the 1.0 and 0.5 mg/kg DLM treated rats was significantly lower than in CO controls (Pitzer et al., 2019).
This implies glutamatergic dysfunction in DLM treated rats and represents an alternative mechanism of DLM induced cognitive deficits. Specifically, NMDA dysfunction may be involved in the observed impairments in the spatial learning and memory MWM task.
NMDA receptor mechanisms are involved in spatial learning and memory, as seen by
195 chronic infusion of AP5, a selective NMDA receptor antagonist, that resulted in impaired
MWM learning (Morris et al., 2013).
We also found male changes in startle behavior (Pitzer et al., 2019). DLM increased startle responses for acoustic (ASR) and tactile startle responses (TSR) in males but not females with no change in pre-pulse inhibition (PPI) (Pitzer et al., 2019).
Adult rats administered the Type I pyrethroid, permethrin, show increased ASR, whereas Type II pyrethroids, like DLM, show decreased ASR (Crofton and Reiter, 1988;
Williams et al., 2018, 2019). Similar directional changes in startle were observed in P15 rats administered DLM or permethrin (Williams et al., 2018, 2019). This dichotomy is consistent across studies. However, early postnatal exposure had an opposite effect.
Additional studies are needed to determine discrepancies, although dosing length could contribute to the variable results.
Adult DLM treated rats show increased anxiety-like behavior (30-125 min following DLM) in the elevated plus maze as reflected by reduced center crossings, entries, and time in open arms (Ricci et al., 2013). Zebrafish larvae had increased thigmotaxis following DLM exposure; an effect that is indicative of anxiety-like behavior
(Li et al., 2019). We did not show similar effects using an elevated zero-maze (Pitzer et al. 2019), suggesting that DLM does not produce long-lasting anxiety-like behaviors when rats are exposed developmentally to low doses of DLM.
Hence, we found a number of effects in our developmental DLM model. These data add knowledge about the behavioral and cognitive effects of developmental DLM and first-steps in finding mechanisms for these effects. However additional work is needed to understand the full extent of DLM-induced behavioral and cognitive effects.
196 Effects of DLM on monoamines
DLM treated male rats have decreased AMPH-stimulated extracellular DA release in the n. accumbens (Pitzer et al., 2019). Mice exposed to DLM from E0-P21 had reduced DA release in the n. accumbens (Richardson et al., 2015). The reduced
DA release from the n. accumbens of DLM treated rats may contribute to the egocentric learning and memory CWM deficits. The CWM is impacted by neurotoxic drugs that alter DA neurotransmission (methamphetamine and AMPH) (Vorhees et al., 2011) at doses that produce neurotoxicity. In addition, when the n. accumbens, dorsal lateral striatum, and dorsal medial striatum are lesioned with 6-hydroxydopamine (6-OHDA) to deplete DA, deficits are observed in the CWM (Braun et al., 2012; Braun et al., 2015;
Braun et al., 2016),
To determine if the reduction in DA release was related to DA levels, we measured monoamines via HPLC-ECD. We found no changes in hippocampus or neostriatum in DA, serotonin (5-HT), or their major metabolites (3,4- dihydroxyphenylacetic acid (DOPAC), 5-hydroxyindoleacetic acid (5-HIAA), and homovanillic acid (HVA)) (Pitzer et al., 2019). In mice developmentally exposed to DLM there was also no change in DA, DOPAC or HVA (Richardson et al., 2015). We did find decreased NE in the hippocampus of DLM treated male and female rats compared with
CO controls (Pitzer et al., 2019). NE plays a role in synaptic plasticity, including in LTP
(Ikegaya et al., 1997), and in Arc expression associated with emotional memory
(McIntyre et al., 2005). Application of NMDA in rat hippocampal superfused mini-slices induces [3H]-NE in the CA1-CA3 and dentate gyrus, with this effect being higher in the dentate gyrus compared than in the CA1-CA3 area (Andres et al., 1993). NE
197 concentrations affect phosphorylation of α-amino-3-hydroxy-5-methyl-4- isoxazolepropionic acid (AMPA) receptor GluR1 subunits, facilitating the trafficking of
AMPA receptors to the synapse during LTP induction and facilitating memory formation
(Hu et al., 2007). Mice with GluR1 phosphorylation site mutations when given epinephrine to elevate NE had no effect on contextual fear or LTP, whereas increased
NE enhanced these effects in wild type mice (Hu et al., 2007). This may help explain
DLM induced alterations in contextual memory noted in Chapter 2.
We also examined DA receptors and the transporter (DAT) for DLM-induced alterations. In the striatum of male DLM treated rats, DRD1 mRNA was decreased compared with controls (Pitzer et al., 2019). The decreased mRNA expression could be altered due to the change in n. accumbens DA release, however the mRNA was not specifically examined in the n. accumbens. In chapter 3 we examined DA receptor and transporter protein levels. We found no significant effect of DLM treatment on DRD1,
DRD2, or DAT in males or females. This differs from what was observed in mice following DLM exposure from E0 to P21. Richardson et al. observed increased male and female DAT and male only DRD1 levels in the n. accumbens of DLM-treated mice
(Richardson et al., 2015). However, the observed differences in DLM-induced changes to the DA system could be due to differences in time of exposure between studies. With
Richardson et al. (2015) administering DLM for long and earlier in development (E0-
P21) compared to our dosing paradigm (P3-20) may be an important different. DA receptors, including DRD1, increase in expression during embryogenesis, generally reaching a peak postnatally (around adolescence) then declines to adult levels in rats
(Caille et al., 1995), mice (Araki et al., 2007) and humans (Brana et al., 1996).
198 Perturbations during the embryonic period, when expression is not at adult levels, may cause greater effects as in Richardson’s model by altering the fate of neurons expressing DRD1 compared with our postnatal exposure. This needs to be tested in further experiments.
Role of glutamatergic systems and LTP in DLM induced cognitive deficits
In chapter 2 we examined LTP in CA1 hippocampal slices at P25-35. DLM treated males and females had increased LTP compared with controls which maintained for 90 min (Pitzer et al., 2019). In Chapter 3, when LTP was examined after the same treatment conditions but in ≥ P60 male and female rats, only males showed an increase in LTP. Although, the LTP effect was not as large in adults as at P25-35, it remained, indicating that the effect is persistent. Decreased LTP is more commonly associated with deficits in learning and memory (Lynch, 2004), but like many homeostatic processes in biological systems, too much or too little are both detrimental and we assume this to be the case with LTP. Increased LTP could be detrimental in that connections are less easily changed when the rat is faced with an altered task which becomes evident during reversal and shift because it requires cognitive flexibility.
DLM-induced increased synaptic strength may upregulate proteins that are adequate for initial learning but consequently may over-strengthen these initial connections making remapping under different conditions more difficult for DLM-exposed rats. If the LTP mechanism is facilitated and unable to be reorganized, this may interfere with the demands during reversal and shift testing.
199 Mice lacking the AMPA receptor GluR2 subunit show an increase in CA1 hippocampal LTP and decreased exploration of a novel object compared with wild type mice (Jia et al., 1996). A similar outcome is observed in mice deficient in postsynaptic density protein 95 (PSD-95), which exhibit increased LTP and deficits in the MWM
(Migaud et al., 1998). We did not assess the converse of LTP, long-term depression
(LTD), a process associated with forgetting. Assessing LTD after developmental DLM might provide further insight.
To begin to get at a mechanism of altered LTP we examined stimulated hippocampal glutamate release. We found no change in glutamate release when stimulated with potassium in DLM treated rats compared with controls. DLM administered in adult rats increases extracellular glutamate and decreased GABA when measured by in vivo microdialysis (Hossain et al., 2008). However, the differences between the doses tested in our DLM model and those tested by Hossain et al. (2008), as well as the age of exposure, are likely responsible for the differences.
LTP has been studied in detail. Synaptic plasticity requires increased calcium levels within the postsynaptic neuron, which can occur through depolarized NMDA receptors, through voltage gated calcium channels, or release of intracellular stored calcium (Fino et al., 2010; Blackwell and Jedrzejewska-Szmek, 2013; Baudry et al.,
2015; Herring and Nicoll, 2016). Calmodulin is a calcium binding partner, which binds to CaMKII, leading to downstream events that result in synaptic facilitation (Faas et al.,
2011; Lisman et al., 2012a). Calcium can also activate calcineurin (also known as protein phosphatase 2B) resulting in LTD (Mulkey et al., 1994). The concentration of calcium influx determines which pathway is activated, with lower concentrations
200 activating calcineurin and higher concentrations activating CaMKII (Bliss and
Collingridge, 1993; Malenka and Bear, 2004; Blackwell and Jedrzejewska-Szmek,
2013). Activating CaMKII phosphorylates AMPA receptors (McGlade-McCulloh et al.,
1993; Tan et al., 1994; Roche et al., 1996), which increases synaptic strength. CaMKII can translocate to the synapse, bind NMDA receptors, and cause synaptic potentiation
(Lisman et al., 2012b). Additional mechanisms of LTP include activation of protein kinase A (PKA) and protein kinase C (PKC), both of which are activated by second messengers of G protein coupled receptors (GPCRs), cyclic adenosine monophosphate
(cAMP) and diacylglycerol (DAG), respectively (Blackwell and Jedrzejewska-Szmek,
2013). PKA phosphorylates several targets, including glutamate receptors, and regulates its own activity through the phosphorylation of phosphodiesterases to modulate synaptic plasticity. PKA can also activate nuclear targets such as cyclic AMP response element–binding protein (CREB), resulting in LTP (Sassone-Corsi, 1995;
Impey et al., 1996). PKC and PKA activate mitogen-activated protein kinase cascades as well (Sassone-Corsi, 1995; Deisseroth et al., 1996; Xing et al., 1996; Hirono et al.,
2001; Tanaka and Augustine, 2008), resulting in increased or decreased protein synthesis that alter synaptic efficiency. Hence, LTP is a complicated cellular mechanism with multiple signaling molecules involved and pathways that vary based on brain region and which signaling pathways are activated.
We also examined receptors involved in the process of LTP, both AMPA and
NMDA receptors, using western blot analysis. In chapter 3 we found no changes in the
AMPA receptor subunits GluR1 and GluR2, or NMDA receptor NR1 subunit expression following developmental DLM exposure. However, we observed changes in NMDA-
201 receptor NR2 expression. We found increased NR2A and decreased NR2B levels in the hippocampus of DLM treated males but not females. NMDA receptors contain up to
2 NR2 subunits (NR2A, NR2B, NR2C) (Flores-Soto et al., 2012; Vyklicky et al., 2014), and the composition of NR2 subunits influences neuroplasticity, with NR2A favoring
LTD and NR2B favoring LTP (Yashiro and Philpot, 2008). The expression of NR2A and
NR2B undergo changes during development. NR2A increases during postnatal development and maintains levels into adulthood, and NR2B is present embryonically and increases until P21 then decreases in adulthood (Wenzel et al., 1997). This developmental switch during the period of DLM dosing could change the NR2 subunit composition of NMDA-Rs thereby permanently changing their function. Examiniation of
NR2 subunit synapse insertion during development and in adulthood, in conjuction with examination of receptor function using NMDA-dependent LTP, would be benefical to understand the potential alterations induced by developmental DLM.
The effect on NMDA-NR2 could contribute to the altered LTP effects observed in
DLM treated rats. CA1 LTP is NMDA-receptor (R) dependent, as seen in mice with the
NMDAR1 gene knockout in the CA1 region, that have normal dentate gyrus LTP but lack LTP in the CA1 (Tsien et al., 1996). In addition, CA1 NMDA-R knockout mice show spatial memory deficits, but normal non-spatial learning (Tsien et al., 1996), emphasizing the importance of NMDA-Rs in LTP and spatial learning and memory.
Higher NMDA-NR2A is reported to favor LTD, which is unlike the effects elicited by our DLM model which caused increased LTP. Perhaps increases in LTD could lead to selective increases in LTP. We measured field excitatory postsynaptic potentials
(fEPSPs), which is the summation of groups of synapses (globally) and therefore cannot
202 segregate subgroups of neurons where effects may be different. Sharp electrode methods would be needed to sort out differences within CA1. In addition, western blots measure whole protein in regions with low spatial resolution compared with immunohistochemistry. There could be circuits favoring LTD (such as GABAergic synapses), leading to LTP in some subregions and not others (such as glutamatergic synapses). Further studies are be needed to differentiate among these and other possibilities.
Although NR2A and NR2B support LTP and LTD, channel kinetics of the NR2 subunits’ alters the favorability for one form of synaptic plasticity over the other. NR2A has a lower affinity for CaMKII, limiting synaptic plasticity, compared with NMDA-NR2B
(Strack and Colbran, 1998; Leonard et al., 1999; Strack et al., 2000; Yashiro and
Philpot, 2008). In addition, NR2A-containing NMDA-Rs limit the flow of calcium into the neuron (Erreger et al., 2005), which influences the induction of LTP vs LTD on a calcium concentration-dependent basis. It is possible, although not yet studied, that
LTD is a mechanism by which DLM is altering learning and memory, due to effects on
NR2A/NR2B ratios as well as the importance of LTD in cognitive flexibility and re- learning. However, the observed effects on LTP in DLM treated rats seem to suggest otherwise. Additional tests are needed to understand the impact of developmental DLM on LTD. NR2A subunits contribute to LTP, although the channel kinetics are not as favorable as they are for NR2B. NR2A channel kinetics, although open more briefly and deactivate faster than NR2B channels, have a higher probability of opening (Erreger et al., 2005; Santucci and Raghavachari, 2008). Under conditions where a reliable
203 stimulus is applied, such as during LTP, having more NR2A could increase LTP responses.
Overall, the observed effects on LTP and NMDA-NR2 subunit expression may contribute to the observed deficits in learning and memory. Specifically, the impaired cognitive flexibility observed in the MWM as well as contextual freezing deficits could be impaired by a change in the NMDA-NR2 ratio, favoring NR2A, which then alters synaptic plasticity thereby disrupting memory. Although there are connections between the observed molecular assays and behavior, more experiments are needed to elucidate the mechanism by which developmental DLM alters learning and memory.
Developmental effects of DLM on inflammatory cytokines and cell death
In Chapter 3 we examined proinflammatory cytokines using in situ terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) to detect cells undergoing apoptosis and found DLM treated males had increased cell death in the striatum and hippocampus. We then examined cell death in the dentate gyrus by cell counting, since this region is known to generate new granule cells during our dosing period (Bayer and Altman, 1974). We observed increased TUNEL positive cells in the dentate gyrus of DLM treated males compared with CO controls. The observed increase in apoptotic cells in DLM treated rats may contribute to the alterations in learning and memory since the dentate is known to be involved in spatial reference memory that was impaired in DLM treated rats.
Increased cell death was observed following both in vitro (Wu et al., 2003; Elwan et al., 2006; Hossain and Richardson, 2011) and in vivo (Wu and Liu, 2000a, b;
204 Hossain et al., 2019) DLM exposure. However, these studies used higher doses and adult animals. There are connections between DLM and caspase-mediated cell death pathways too. Caspase-3 was increased in DLM treated SK-N-AS cells (Hossain and
Richardson, 2011) and adult mice (Hossain et al., 2015; Hossain et al., 2019).
However, we did not see alterations in caspase-3 expression after developmental exposure. It is important to note that caspase-3 expression is low during early development, and this limits the detection sensitivity measure by western blot. It may be better to analyze caspase-3 expression in young rats via immunohistochemical methods that are more sensitive and also provide regional information.
To understand mechanisms that induce neurotoxicity in our developmental DLM model we also examined cytokine levels. Cytokines are secreted by immune cells to initate protective effects in response to injury, infection, or exposure to toxic compounds
(Zhang and An, 2007; Turner et al., 2014). Few studies have examined the effect of
DLM on cytokine expression. One study observed DLM increased TNF- levels in primary microglia following DLM treatment (Hossain et al., 2016). We assessed several proinflammatory cytokines, however we only observed decreased expression of IL-1β in
DLM treated male rats tested at P20 compared with controls, although this effect did not reach significance. Oxidative stress pathways are known to be affected by DLM (Kumar et al., 2015), and IL-1β plays a role in oxidative stress mechanisms (Hewett et al., 2012;
He et al., 2015). IL-1β is also important in neuronal survival (Albrecht et al., 2002; John et al., 2005; Saavedra et al., 2007; Hewett et al., 2012). The involvement of IL-1β in the prevention of oxidative stress and cell death indicate that a reduction in these factors following DLM treatment may be deleterious. Additional studies exploring the effect of
205 DLM on IL-1β and oxidative stress are needed to confirm this as a mechanism of DLM- induced cell death.
These experiments add to the evidence of developmental neurotoxicity induced by DLM. The observed cell death in the striatum and hippocampus of DLM exposed rats in conjunction with potentially altered cytokine expression adds data on how DLM may impact brain development. Studies are needed to further study if DLM impacts IL-
1β, elucidate the role of IL-1β in cell death mechanisms, as well as its potential role in learning and memory.
Developmental DLM-induced sex specific effects
Throughout Chapter 2 and 3 there were sex specific effects, with DLM-treated males exhibiting more effects than DLM-treated females. Although some tests showed impairments in both sexes, there were far more observed in DLM-treated males. This male effect was corroborated in several studies (Lazarini et al., 2001; Richardson et al.,
2015), as well as in epidemiological studies (Wagner-Schuman et al., 2015). We did not explore the mechanism by which DLM causes impairments in males only.
In future studies, the effects of DLM treatment on sex hormones or their targets should be assessed. Pyrethroids are suspected endocrine-disruptors. DLM in vitro as well as the metabolite 3-PBA exhibit antagonist effects to androgen receptors (Du et al.,
2010). DLM also has weak estrogenic effects, and 3-PBA has anti-estrogenic effects
(Du et al., 2010). DLM also has antagonistic effects to the thyroid hormone receptor
(Du et al., 2010). The data support the idea that DLM has antagonistic thyroid hormone and androgen receptor effects that may make males more vulnerable, especially during
206 development when these systems are emergent. Also, in vitro results by Du et al.
(2010) showed weak estrogenic effects, which could be protective in females, since estrogens are known to be protective to nervous system function (Wise et al., 2001;
Gillies and McArthur, 2010; Zárate et al., 2017). Additional studies are needed to understand the sex differences found here.
Conclusions
DLM has multiple effects, impacting egocentric-striatal and allocentric- hippocampal dependent forms of learning and memory, as well as other behaviors. The mechanism by which these behaviors are altered is not understood. The experiments presented here show how DLM disrupts neurotransmitter systems and cellular changes associated with these effects but not yet causally linked to them. Tantalizing findings that may lead to better mechanistic insight include reduced release of DA in the n. accumbens and reduced DRD1 mRNA expression in the striatum of male DLM treated rats. LTP was altered following developmental DLM administration as were NMDA-NR2 receptor subunits that are mediators of LTP. Many of the effects were male-specific but investigating this aspect of DLM’s developmental effects was beyond the scope of this work. But it is relevant that male specific effects from developmental DLM treatment were also found in mice by Richardson et al. (2015), lending credence to the important of this effect. We also observed male specific changes in NMDA-NR2A and NMDA-
NR2B subunit ratios in the hippocampus suggesting a dysregulation of synaptic plasticity. We found increased apoptosis and preliminary evidence of reductions in IL-
1β. While we do not yet understand the significance of the NMDA-subunit or cytokine
207 changes, these data warrant further investigation. DLM, like most such compounds, has effects on many systems and likely will not be resolved to a single or small number of mechanisms; more likely DLM will have complex effects that contribute to different degrees with the effects we found at the organismal/cognitive level. However, if pyrethroids adversely affect children’s brain development and cognitive function, finding out how this may happen is important/pertinent. These experiments are the beginning, not the end. Another step is to determine the relationship between the effects we see in rats and those reported by epidemiological studies, such as in homologous behaviors that can be compared across species. We have undoubtedly not observed the full range of neurological effects associated with developmental DLM exposure, let alone exposure to other pyrethroids. For example, we did not examine working memory, attention, or impulsivity, or social behavior that represent other CNS domains yet to be explored. Yet, this set of experiments add to the current knowledge and suggest several mechanisms that could contribute to the DLM-induced deficits that require further investigation.
Future directions
This research revealed alterations following developmental DLM exposure, however there are many areas requiring further investigation. Additional experiments examining the effects on LTP and receptors that could be altered following DLM exposure would be beneficial. Specifically, examining proteins that are involved in LTP mechanism, such as CaMKII, PKA and PKC may help determine the interconnections by which DLM causes altered LTP. Experiments examining NR2A and NR2B levels
208 and their insertion into the membrane may also aid in understanding their involvement in altering LTP. Based on the deficits in learning and memory, an understanding of the effects of DLM on LTD might be informative. Diminished LTD in addition to the observed increased LTP in male DLM rats would imply an impairment of cognitive flexibility and an inability to remap spatial relationships. It would also be valuable to investigate regional expression changes in IL-1β. Studies have examined the influence of cytokines on memory, with emphasis on hippocampal learning and memory, however, how these proinflammatory markers alter striatal learning and memory is not understood. Studies examining how IL-1β influences CWM learning in DLM rats would be useful, such as through inhibition or application of IL-1β and examination of CWM activity in DLM treated rats. Additionally, studies on oxidative stress pathways along with the involvement of cytokines in these mechanisms may shed further light on the effects of DLM. Experiments to determine if altered cytokine expression leads to increased oxidative stress and causes cell death might help explain DLM neurotoxicity.
In addition, many of the observed effects were male specific. Examination of these male specific deficits would be beneficial, perhaps by gonadectomy surgeries, or vaginal swabbing to track females cycles over the course of testing, to control for sex hormones that could be influencing or protective of the effects of DLM. Although, a studying this during dosing may be challenging since dosing in our model occurs before puberty but may still be worthwhile. Another approach might be to assess estrogens and androgens during DLM treatment to see the effect DLM has on these signals. Or use hormone agonists or antagonists during DLM treatment to determine if sex hormones interact with the effects of DLM. Examination of behavioral and
209 neurotransmitter effects following developmental DLM exposure, with co-exposure to sex hormone antagonists or agonists (via mini-pumps) may help elucidate why DLM preferentially affects males compared with females.
210 References
Abrous DN, Wojtowicz JM (2015) Interaction between Neurogenesis and Hippocampal
Memory System: New Vistas. Cold Spring Harbor perspectives in biology
7:a018952.
Ainge JA, Tamosiunaite M, Woergoetter F, Dudchenko PA (2007) Hippocampal CA1
place cells encode intended destination on a maze with multiple choice points.
The Journal of neuroscience : the official journal of the Society for Neuroscience
27:9769-9779.
Albrecht PJ, Dahl JP, Stoltzfus OK, Levenson R, Levison SW (2002) Ciliary
neurotrophic factor activates spinal cord astrocytes, stimulating their production
and release of fibroblast growth factor-2, to increase motor neuron survival.
Experimental neurology 173:46-62.
Andres ME, Bustos G, Gysling K (1993) Regulation of [3H]norepinephrine release by N-
methyl-D-aspartate receptors in minislices from the dentate gyrus and the CA1-
CA3 area of the rat hippocampus. Biochemical pharmacology 46:1983-1987.
Araki KY, Sims JR, Bhide PG (2007) Dopamine receptor mRNA and protein expression
in the mouse corpus striatum and cerebral cortex during pre- and postnatal
development. Brain research 1156:31-45.
Aziz MH, Agrawal AK, Adhami VM, Shukla Y, Seth PK (2001) Neurodevelopmental
consequences of gestational exposure (GD14-GD20) to low dose deltamethrin in
rats. Neuroscience letters 300:161-165.
211 Baudry M, Zhu G, Liu Y, Wang Y, Briz V, Bi X (2015) Multiple cellular cascades
participate in long-term potentiation and in hippocampus-dependent learning.
Brain research 1621:73-81.
Bayer SA, Altman J (1974) Hippocampal development in the rat: cytogenesis and
morphogenesis examined with autoradiography and low-level X-irradiation. The
Journal of comparative neurology 158:55-79.
Bidwell LC, McClernon FJ, Kollins SH (2011) Cognitive enhancers for the treatment of
ADHD. Pharmacology, biochemistry, and behavior 99:262-274.
Blackwell KT, Jedrzejewska-Szmek J (2013) Molecular mechanisms underlying
neuronal synaptic plasticity: systems biology meets computational neuroscience
in the wilds of synaptic plasticity. Wiley Interdiscip Rev Syst Biol Med 5:717-731.
Bliss TVP, Collingridge GL (1993) A synaptic model of memory: long-term potentiation
in the hippocampus. Nature 361:31.
Bonnet E, Touyarot K, Alfos S, Pallet V, Higueret P, Abrous DN (2008) Retinoic acid
restores adult hippocampal neurogenesis and reverses spatial memory deficit in
vitamin A deprived rats. PloS one 3:e3487.
Brana C, Caille I, Pellevoisin C, Charron G, Aubert I, Caron MG, Carles D, Vital C,
Bloch B (1996) Ontogeny of the striatal neurons expressing the D1 dopamine
receptor in humans. The Journal of comparative neurology 370:23-34.
Braun AA, Graham DL, Schaefer TL, Vorhees CV, Williams MT (2012) Dorsal striatal
dopamine depletion impairs both allocentric and egocentric navigation in rats.
Neurobiology of learning and memory 97:402-408.
212 Braun AA, Amos-Kroohs RM, Gutierrez A, Lundgren KH, Seroogy KB, Vorhees CV,
Williams MT (2016) 6-Hydroxydopamine-Induced Dopamine Reductions in the
Nucleus Accumbens, but not the Medial Prefrontal Cortex, Impair Cincinnati
Water Maze Egocentric and Morris Water Maze Allocentric Navigation in Male
Sprague-Dawley Rats. Neurotoxicity research 30:199-212.
Braun AA, Amos-Kroohs RM, Gutierrez A, Lundgren KH, Seroogy KB, Skelton MR,
Vorhees CV, Williams MT (2015) Dopamine depletion in either the dorsomedial
or dorsolateral striatum impairs egocentric Cincinnati water maze performance
while sparing allocentric Morris water maze learning. Neurobiology of learning
and memory 118:55-63.
Burns CJ, Pastoor TP (2018) Pyrethroid epidemiology: a quality-based review. Critical
reviews in toxicology 48:297-311.
Caille I, Dumartin B, Le Moine C, Begueret J, Bloch B (1995) Ontogeny of the D1
Dopamine Receptor in the Rat Striatonigral System: an lmmunohistochemical
Study. European Journal of Neuroscience 7:714-722.
Crofton KM, Reiter LW (1988) The effects of type I and II pyrethroids on motor activity
and the acoustic startle response in the rat. Fundamental and applied toxicology :
official journal of the Society of Toxicology 10:624-634.
Curzon P, Rustay NR, Browman KE (2009) Cued and Contextual Fear Conditioning for
Rodents. In: Methods of Behavior Analysis in Neuroscience, 2nd Edition (J.J. B,
ed). Boca Raton, FL: CRC Press/Taylor & Francis.
213 Deisseroth K, Bito H, Tsien RW (1996) Signaling from synapse to nucleus: postsynaptic
CREB phosphorylation during multiple forms of hippocampal synaptic plasticity.
Neuron 16:89-101.
Du G, Shen O, Sun H, Fei J, Lu C, Song L, Xia Y, Wang S, Wang X (2010) Assessing
hormone receptor activities of pyrethroid insecticides and their metabolites in
reporter gene assays. Toxicological sciences : an official journal of the Society of
Toxicology 116:58-66.
Eichenbaum H, Cohen NJ (2004) From Conditioning to Conscious Recollection:
Memory Systems of the Brain: Oxford University Press.
Eichenbaum H, Stewart C, Morris RG (1990) Hippocampal representation in place
learning. The Journal of neuroscience : the official journal of the Society for
Neuroscience 10:3531-3542.
Elwan MA, Richardson JR, Guillot TS, Caudle WM, Miller GW (2006) Pyrethroid
pesticide-induced alterations in dopamine transporter function. Toxicology and
applied pharmacology 211:188-197.
Eriksson P, Fredriksson A (1991) Neurotoxic effects of two different pyrethroids,
bioallethrin and deltamethrin, on immature and adult mice: changes in behavioral
and muscarinic receptor variables. Toxicology and applied pharmacology 108:78-
85.
Erreger K, Dravid SM, Banke TG, Wyllie DJ, Traynelis SF (2005) Subunit-specific gating
controls rat NR1/NR2A and NR1/NR2B NMDA channel kinetics and synaptic
signalling profiles. The Journal of physiology 563:345-358.
214 Faas GC, Raghavachari S, Lisman JE, Mody I (2011) Calmodulin as a direct detector of
Ca2+ signals. Nature neuroscience 14:301-304.
Fino E, Paille V, Cui Y, Morera-Herreras T, Deniau JM, Venance L (2010) Distinct
coincidence detectors govern the corticostriatal spike timing-dependent plasticity.
The Journal of physiology 588:3045-3062.
Flores-Soto ME, Chaparro-Huerta V, Escoto-Delgadillo M, Vazquez-Valls E, Gonzalez-
Castaneda RE, Beas-Zarate C (2012) [Structure and function of NMDA-type
glutamate receptor subunits]. Neurologia (Barcelona, Spain) 27:301-310.
Gillies GE, McArthur S (2010) Estrogen actions in the brain and the basis for differential
action in men and women: a case for sex-specific medicines. Pharmacological
reviews 62:155-198.
Graciarena M, Depino AM, Pitossi FJ (2010) Prenatal inflammation impairs adult
neurogenesis and memory related behavior through persistent hippocampal
TGFbeta1 downregulation. Brain, behavior, and immunity 24:1301-1309.
He Y, Jackman NA, Thorn TL, Vought VE, Hewett SJ (2015) Interleukin-1beta protects
astrocytes against oxidant-induced injury via an NF-kappaB-dependent
upregulation of glutathione synthesis. Glia 63:1568-1580.
Herring BE, Nicoll RA (2016) Long-Term Potentiation: From CaMKII to AMPA Receptor
Trafficking. Annual review of physiology 78:351-365.
Hewett SJ, Jackman NA, Claycomb RJ (2012) Interleukin-1β in Central Nervous System
Injury and Repair. Eur J Neurodegener Dis 1:195-211.
Hirono M, Sugiyama T, Kishimoto Y, Sakai I, Miyazawa T, Kishio M, Inoue H, Nakao K,
Ikeda M, Kawahara S, Kirino Y, Katsuki M, Horie H, Ishikawa Y, Yoshioka T
215 (2001) Phospholipase Cbeta4 and protein kinase Calpha and/or protein kinase
CbetaI are involved in the induction of long term depression in cerebellar Purkinje
cells. The Journal of biological chemistry 276:45236-45242.
Hirsh R (1974) The hippocampus and contextual retrieval of information from memory: a
theory. Behavioral biology 12:421-444.
Hossain MM, Richardson JR (2011) Mechanism of pyrethroid pesticide-induced
apoptosis: role of calpain and the ER stress pathway. Toxicological sciences : an
official journal of the Society of Toxicology 122:512-525.
Hossain MM, DiCicco-Bloom E, Richardson JR (2015) Hippocampal ER stress and
learning deficits following repeated pyrethroid exposure. Toxicological sciences :
an official journal of the Society of Toxicology 143:220-228.
Hossain MM, Liu J, Richardson JR (2016) Pyrethroid Insecticides Directly Activate
Microglia Through Interaction With Voltage-Gated Sodium Channels.
Toxicological Sciences 155:112-123.
Hossain MM, Sivaram G, Richardson JR (2019) Regional Susceptibility to ER Stress
and Protection by Salubrinal Following a Single Exposure to Deltamethrin.
Toxicological sciences : an official journal of the Society of Toxicology 167:249-
257.
Hossain MM, Suzuki T, Unno T, Komori S, Kobayashi H (2008) Differential presynaptic
actions of pyrethroid insecticides on glutamatergic and GABAergic neurons in the
hippocampus. Toxicology 243:155-163.
216 Hu H, Real E, Takamiya K, Kang MG, Ledoux J, Huganir RL, Malinow R (2007)
Emotion enhances learning via norepinephrine regulation of AMPA-receptor
trafficking. Cell 131:160-173.
Ikegaya Y, Nakanishi K, Saito H, Abe K (1997) Amygdala beta-noradrenergic influence
on hippocampal long-term potentiation in vivo. Neuroreport 8:3143-3146.
Impey S, Mark M, Villacres EC, Poser S, Chavkin C, Storm DR (1996) Induction of
CRE-mediated gene expression by stimuli that generate long-lasting LTP in area
CA1 of the hippocampus. Neuron 16:973-982.
Jaako-Movits K, Zharkovsky T, Romantchik O, Jurgenson M, Merisalu E, Heidmets LT,
Zharkovsky A (2005) Developmental lead exposure impairs contextual fear
conditioning and reduces adult hippocampal neurogenesis in the rat brain.
International journal of developmental neuroscience : the official journal of the
International Society for Developmental Neuroscience 23:627-635.
Jarrard LE (1989) On the use of ibotenic acid to lesion selectively different components
of the hippocampal formation. Journal of neuroscience methods 29:251-259.
Jia Z, Agopyan N, Miu P, Xiong Z, Henderson J, Gerlai R, Taverna FA, Velumian A,
MacDonald J, Carlen P, Abramow-Newerly W, Roder J (1996) Enhanced LTP in
mice deficient in the AMPA receptor GluR2. Neuron 17:945-956.
John GR, Lee SC, Song X, Rivieccio M, Brosnan CF (2005) IL-1-regulated responses in
astrocytes: relevance to injury and recovery. Glia 49:161-176.
Johri A, Yadav S, Singh RL, Dhawan A, Ali M, Parmar D (2006) Long lasting effects of
prenatal exposure to deltamethrin on cerebral and hepatic cytochrome P450s
217 and behavioral activity in rat offspring. European journal of pharmacology
544:58-68.
Kleinknecht K, Bedenk B, Kaltwasser S, Gruenecker B, Yen Y-C, Czisch M, Wotjak C
(2012) Hippocampus-dependent place learning enables spatial flexibility in
C57BL6/N mice. Frontiers in Behavioral Neuroscience 6.
Koo JW, Park CH, Choi SH, Kim NJ, Kim HS, Choe JC, Suh YH (2003) The postnatal
environment can counteract prenatal effects on cognitive ability, cell proliferation,
and synaptic protein expression. FASEB journal : official publication of the
Federation of American Societies for Experimental Biology 17:1556-1558.
Lazarini CA, Florio JC, Lemonica IP, Bernardi MM (2001) Effects of prenatal exposure
to deltamethrin on forced swimming behavior, motor activity, and striatal
dopamine levels in male and female rats. Neurotoxicology and teratology 23:665-
673.
Lemaire V, Koehl M, Le Moal M, Abrous DN (2000) Prenatal stress produces learning
deficits associated with an inhibition of neurogenesis in the hippocampus.
Proceedings of the National Academy of Sciences of the United States of
America 97:11032-11037.
Leonard AS, Lim IA, Hemsworth DE, Horne MC, Hell JW (1999) Calcium/calmodulin-
dependent protein kinase II is associated with the N-methyl-D-aspartate receptor.
Proceedings of the National Academy of Sciences of the United States of
America 96:3239-3244.
Li M, Liu X, Feng X (2019) Cardiovascular toxicity and anxiety-like behavior induced by
deltamethrin in zebrafish (Danio rerio) larvae. Chemosphere 219:155-164.
218 Lisman J, Yasuda R, Raghavachari S (2012a) Mechanisms of CaMKII action in long-
term potentiation. Nature reviews Neuroscience 13:169-182.
Lisman J, Yasuda R, Raghavachari S (2012b) Mechanisms of CaMKII action in long-
term potentiation. Nature reviews Neuroscience 13:169-182.
Lynch MA (2004) Long-Term Potentiation and Memory. Physiological reviews 84:87-
136.
Malenka RC, Bear MF (2004) LTP and LTD: an embarrassment of riches. Neuron 44:5-
21.
McGlade-McCulloh E, Yamamoto H, Tan SE, Brickey DA, Soderling TR (1993)
Phosphorylation and regulation of glutamate receptors by calcium/calmodulin-
dependent protein kinase II. Nature 362:640-642.
McIntyre CK, Miyashita T, Setlow B, Marjon KD, Steward O, Guzowski JF, McGaugh JL
(2005) Memory-influencing intra-basolateral amygdala drug infusions modulate
expression of Arc protein in the hippocampus. Proceedings of the National
Academy of Sciences of the United States of America 102:10718-10723.
Migaud M, Charlesworth P, Dempster M, Webster LC, Watabe AM, Makhinson M, He Y,
Ramsay MF, Morris RG, Morrison JH, O'Dell TJ, Grant SG (1998) Enhanced
long-term potentiation and impaired learning in mice with mutant postsynaptic
density-95 protein. Nature 396:433-439.
Miller GM (2011) The emerging role of trace amine-associated receptor 1 in the
functional regulation of monoamine transporters and dopaminergic activity.
Journal of neurochemistry 116:164-176.
219 Mills F, Bartlett TE, Dissing-Olesen L, Wisniewska MB, Kuznicki J, Macvicar BA, Wang
YT, Bamji SX (2014) Cognitive flexibility and long-term depression (LTD) are
impaired following β-catenin stabilization in vivo. Proceedings of the National
Academy of Sciences 111:8631-8636.
Morris RG, Schenk F, Tweedie F, Jarrard LE (1990) Ibotenate Lesions of Hippocampus
and/or Subiculum: Dissociating Components of Allocentric Spatial Learning. The
European journal of neuroscience 2:1016-1028.
Morris RG, Steele RJ, Bell JE, Martin SJ (2013) N-methyl-d-aspartate receptors,
learning and memory: chronic intraventricular infusion of the NMDA receptor
antagonist d-AP5 interacts directly with the neural mechanisms of spatial
learning. The European journal of neuroscience 37:700-717.
Mulkey RM, Endo S, Shenolikar S, Malenka RC (1994) Involvement of a
calcineurin/inhibitor-1 phosphatase cascade in hippocampal long-term
depression. Nature 369:486-488.
Okada T, Yamada N, Tsuzuki K, Horikawa HP, Tanaka K, Ozawa S (2003) Long-term
potentiation in the hippocampal CA1 area and dentate gyrus plays different roles
in spatial learning. The European journal of neuroscience 17:341-349.
Oulhote Y, Bouchard MF (2013) Urinary metabolites of organophosphate and pyrethroid
pesticides and behavioral problems in Canadian children. Environmental health
perspectives 121:1378-1384.
Pitzer EM, Sugimoto C, Gudelsky GA, Huff Adams CL, Williams MT, Vorhees CV
(2019) Deltamethrin Exposure Daily From Postnatal Day 3-20 in Sprague-Dawley
220 Rats Causes Long-term Cognitive and Behavioral Deficits. Toxicological
sciences : an official journal of the Society of Toxicology 169:511-523.
Ricci E, Jr V, Habr SF, Macrini D, Bernardi M, Spinosa H (2013) Behavioral and
neurochemical evidence of deltamethrin anxiogenic-like effects in rats. Brazilian
Journal of Veterinary Research and Animal Science 50:33-42.
Richardson JR, Taylor MM, Shalat SL, Guillot TS, 3rd, Caudle WM, Hossain MM,
Mathews TA, Jones SR, Cory-Slechta DA, Miller GW (2015) Developmental
pesticide exposure reproduces features of attention deficit hyperactivity disorder.
FASEB journal : official publication of the Federation of American Societies for
Experimental Biology 29:1960-1972.
Roche KW, O'Brien RJ, Mammen AL, Bernhardt J, Huganir RL (1996) Characterization
of multiple phosphorylation sites on the AMPA receptor GluR1 subunit. Neuron
16:1179-1188.
Saavedra A, Baltazar G, Duarte EP (2007) Interleukin-1beta mediates GDNF up-
regulation upon dopaminergic injury in ventral midbrain cell cultures.
Neurobiology of disease 25:92-104.
Santucci DM, Raghavachari S (2008) The effects of NR2 subunit-dependent NMDA
receptor kinetics on synaptic transmission and CaMKII activation. PLoS
computational biology 4:e1000208.
Sassone-Corsi P (1995) Transcription factors responsive to cAMP. Annual review of cell
and developmental biology 11:355-377.
Shelton JF, Geraghty EM, Tancredi DJ, Delwiche LD, Schmidt RJ, Ritz B, Hansen RL,
Hertz-Picciotto I (2014) Neurodevelopmental disorders and prenatal residential
221 proximity to agricultural pesticides: the CHARGE study. Environmental health
perspectives 122:1103-1109.
Strack S, Colbran RJ (1998) Autophosphorylation-dependent targeting of calcium/
calmodulin-dependent protein kinase II by the NR2B subunit of the N-methyl- D-
aspartate receptor. The Journal of biological chemistry 273:20689-20692.
Strack S, McNeill RB, Colbran RJ (2000) Mechanism and regulation of
calcium/calmodulin-dependent protein kinase II targeting to the NR2B subunit of
the N-methyl-D-aspartate receptor. The Journal of biological chemistry
275:23798-23806.
Tan SE, Wenthold RJ, Soderling TR (1994) Phosphorylation of AMPA-type glutamate
receptors by calcium/calmodulin-dependent protein kinase II and protein kinase
C in cultured hippocampal neurons. The Journal of neuroscience : the official
journal of the Society for Neuroscience 14:1123-1129.
Tanaka K, Augustine GJ (2008) A positive feedback signal transduction loop determines
timing of cerebellar long-term depression. Neuron 59:608-620.
Tsien JZ, Huerta PT, Tonegawa S (1996) The Essential Role of Hippocampal CA1
NMDA Receptor–Dependent Synaptic Plasticity in Spatial Memory. Cell 87:1327-
1338.
Turner MD, Nedjai B, Hurst T, Pennington DJ (2014) Cytokines and chemokines: At the
crossroads of cell signalling and inflammatory disease. Biochimica et Biophysica
Acta (BBA) - Molecular Cell Research 1843:2563-2582.
Vorhees CV, Williams MT (2006) Morris water maze: procedures for assessing spatial
and related forms of learning and memory. Nature protocols 1:848-858.
222 Vorhees CV, Williams MT (2016) Cincinnati water maze: A review of the development,
methods, and evidence as a test of egocentric learning and memory.
Neurotoxicology and teratology 57:1-19.
Vorhees CV, He E, Skelton MR, Graham DL, Schaefer TL, Grace CE, Braun AA, Amos-
Kroohs R, Williams MT (2011) Comparison of (+)-methamphetamine, +/--
methylenedioxymethamphetamine, (+)-amphetamine and +/--fenfluramine in rats
on egocentric learning in the Cincinnati water maze. Synapse (New York, NY)
65:368-378.
Vyklicky V, Korinek M, Smejkalova T, Balik A, Krausova B, Kaniakova M, Lichnerova K,
Černý J, Krusek J, Dittert I, Horak M, Vyklicky L (2014) Structure, Function, and
Pharmacology of NMDA Receptor Channels. Physiological research / Academia
Scientiarum Bohemoslovaca 63 Suppl 1:S191-203.
Wagner-Schuman M, Richardson JR, Auinger P, Braun JM, Lanphear BP, Epstein JN,
Yolton K, Froehlich TE (2015) Association of pyrethroid pesticide exposure with
attention-deficit/hyperactivity disorder in a nationally representative sample of
U.S. children. Environmental health : a global access science source 14:44.
Wall MJ, Collins DR, Chery SL, Allen ZD, Pastuzyn ED, George AJ, Nikolova VD, Moy
SS, Philpot BD, Shepherd JD, Müller J, Ehlers MD, Mabb AM, Corrêa SAL
(2018) The Temporal Dynamics of Arc Expression Regulate Cognitive Flexibility.
Neuron 98:1124-1132.e1127.
Wenzel A, Fritschy JM, Mohler H, Benke D (1997) NMDA receptor heterogeneity during
postnatal development of the rat brain: differential expression of the NR2A,
NR2B, and NR2C subunit proteins. Journal of neurochemistry 68:469-478.
223 Williams MT, Gutierrez A, Vorhees CV (2018) Effects of Acute Exposure of Permethrin
in Adult and Developing Sprague-Dawley Rats on Acoustic Startle Response and
Brain and Plasma Concentrations. Toxicological sciences : an official journal of
the Society of Toxicology 165:361-371.
Williams MT, Gutierrez A, Vorhees CV (2019) Effects of Acute Deltamethrin Exposure in
Adult and Developing Sprague Dawley Rats on Acoustic Startle Response in
Relation to Deltamethrin Brain and Plasma Concentrations. Toxicological
sciences : an official journal of the Society of Toxicology 168:61-69.
Wise PM, Dubal DB, Wilson ME, Rau SW, Böttner M (2001) Minireview:
Neuroprotective Effects of Estrogen—New Insights into Mechanisms of Action.
Endocrinology 142:969-973.
Wu A, Liu Y (2000a) Apoptotic cell death in rat brain following deltamethrin treatment.
Neuroscience letters 279:85-88.
Wu A, Liu Y (2000b) Deltamethrin induces delayed apoptosis and altered expression of
p53 and bax in rat brain. Environmental toxicology and pharmacology 8:183-189.
Wu A, Li L, Liu Y (2003) Deltamethrin induces apoptotic cell death in cultured cerebral
cortical neurons. Toxicology and applied pharmacology 187:50-57.
Xing J, Ginty DD, Greenberg ME (1996) Coupling of the RAS-MAPK pathway to gene
activation by RSK2, a growth factor-regulated CREB kinase. Science (New York,
NY) 273:959-963.
Xue Z, Li X, Su Q, Xu L, Zhang P, Kong Z, Xu J, Teng J (2013) Effect of synthetic
pyrethroid pesticide exposure during pregnancy on the growth and development
of infants. Asia-Pacific journal of public health 25:72s-79s.
224 Yashiro K, Philpot BD (2008) Regulation of NMDA receptor subunit expression and its
implications for LTD, LTP, and metaplasticity. Neuropharmacology 55:1081-
1094.
Zárate S, Stevnsner T, Gredilla R (2017) Role of Estrogen and Other Sex Hormones in
Brain Aging. Neuroprotection and DNA Repair. Front Aging Neurosci 9:430-430.
Zhang J-M, An J (2007) Cytokines, inflammation, and pain. Int Anesthesiol Clin 45:27-
37.
225