DOCSLIB.ORG

A New Variety of Potamogeton × Leptocephalus Koidz., Var. Fujiensis, Endemic to the Fuji Five Lakes and Lake Ashi, Central Japan

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A New Variety of Potamogeton × Leptocephalus Koidz., Var. Fujiensis, Endemic to the Fuji Five Lakes and Lake Ashi, Central Japan ISSN 1346-7565 Acta Phytotax. Geobot. 70 (3): 173–182 (2019) doi: 10.18942/apg.201825 A New Variety of Potamogeton × leptocephalus Koidz., var. fujiensis, Endemic to the Fuji Five Lakes and Lake Ashi, Central Japan * Yasuro Kadono and satoKo IIda Department of Biology, Graduate School of Science, Kobe University, Nada, Kobe, Hyogo 657-8501, Japan. *[email protected] (author for correspondence) DNA analysis and morphological observation were conducted for a putative Potamogeton hybrid endemic to the Fuji Five Lakes and Lake Ashi and Potamogeton × leptocephalus from Lake Biwa, Japan. Both proved to be hybrids between P. maackianus and P. perfoliatus. However, the hybrid from the Fuji Five Lakes and Lake Ashi was distinct from P. × leptocephalus in certain morphological characteristics. It is described as a new variety P. × leptocephalus var. fujiensis. Key words: hybrid origin, Potamogeton, Potamogeton maackianus, Potamogeton perfoliatus, variety The Fuji Five Lakes (Fuji-Go-ko) are located (Ashi-no-ko), Hakone, Kanagawa Prefecture, as at the northern foot of Mt. Fuji in Yamanashi “Potamogeton crispus L. × P. maackianus A. Prefecture and consist of Lake Yamanaka, Lake Benn. (?)”, with a brief description. This identifi- Kawaguchi, Lake Sai, Lake Shoji and Lake cation was accepted by those of Matsuyama-Ser- Motosu. The first comprehensive study of the izawa et al. (2009) and Serizawa et al. (2013, macrophytic flora of these lakes was conducted 2014). Occurrences of the putative hybrid were by Nobuhara et al. (1971), who enumerated eight reported in Lake Shoji and Lake Sai (Serizawa et species of Potamogeton (Potamogetonaceae) from al. 2015), as well as in Lake Yamanaka. the five lakes, namely P. perfoliatus L., P. malaia- Specimens that may also be the putative hy- nus Miq. (=P. wrightii Morong), P. maackianus brid were first collected from Lake Shoji by Bun- A. Benn., P. crispus L., P. compressus L., P. oxy- zo Hayata in 1924 and deposited in TI (identified phyllus Miq., P. distinctus A. Benn. and P. pecti- as “Potamogeton crispus L.”). Other specimens natus L.[=Stuckenia pectinata (L.) Börner]. were collected from Lake Kawaguchi in 1961 and Hayakawa (1986) reported the occurrence of deposited in MAK. Of the nine sheets in MAK, two additional taxa of Potamogeton, a hybrid seven were identified as P.“ maackianus × P. oxy- named P. anguillanus Koidz. and “P. crispus × phyllus” by Masami Mizushima; the remaining P. maackainus” from Lake Yamanaka. The iden- two were identified by Nobushige Kato as Pota“ - tification of the latter hybrid was made provision- mogeton × leptocephalus Koidzumi”. ally by Y. Kadono based on the morphology and Potamogeton × leptocephalus Koidz. was de- sterility of the specimen sent to him. The sheath- scribed as a species based on specimens collected ing leaf base indicated P. maackianus as one of from Lake Unagi, Kagoshima Pref., Kyushu. The the putative parents and three, conspicuous, red- putative hybrid from Lake Kawaguchi and P. × dish nerves reminded him of P. crispus as a can- leptocephalus share some morphological charac- didate for the other putative parent. Kadono teristics, as described later, which must have led (1988) recorded this hybrid from Lake Ashi to Kato’s identification. Miki (1937) hypothe- 174 Acta Phytotax. Geobot. Vol. 70 table 1. Locality of Potamogeton × leptocephalus and the putative hybrid examined in the DNA analysis. Species Locality Voucher specimen Potamogeton × leptocephalus Koidz. Japan: Pref. Shiga, Lake Biwa, Sugaura, Nagahama City Y. Kadono 17098(OSA) The putative hybrid Japan: Pref. Yamanashi, Lake Sai, Kawaguchiko-machi Y. Kadono 16103 (OSA) The putative hybrid Japan: Pref. Yamanashi, Lake Yamanaka, Yamanakako-mura Y. Kadono 16098 (OSA) The putative hybrid Japan: Pref. Kanagawa, Lake Ashi, Hakone-machi H. Sakayama & S. Kato s.n. (OSA) sized Potamogeton × leptocephalus to be a hy- mine the taxonomic identity of the hybrids. Both brid between P. maackianus and P. perfoliatus DNA regions were chosen based on our GenBank without in-depth discussion. His hypothesis of searches that found species-specific nucleotide the parental combination of P. × leptocephalus substitutions among four candidate species (Pota- has not been confirmed. Since then, P. × lepto- mogeton maackianus, P. perfoliatus, P. crispus, cephalus has also been recorded from Lake Biwa, and P. oxyphyllus) (Appendices 1 & 2). Shiga Pref., Honshu (Hamabata & Kira 1987, Ka- Total DNA was extracted from dried leaves of dono 1991). the putative hybrids from the Fuji Five Lakes (n = To determine the origin of hybrids in Potamo- 1 from each lake) and Lake Ashi (n = 1) and Pota- geton, molecular techniques such as allozyme mogeton × leptocephalus (n = 1), P. maackianus electrophoresis and DNA-based methods are use- (n = 1) and P. perfoliatus (n = 1) from Lake Biwa ful tools (e.g., Kaplan & Fehrer 2007, Kaplan et using NucleoSpinPlant II (Macherey-Nagel al. 2018, Zalewska-Gałosz & Ronikier 2012, Iida GmbH & Co. KG, Germany) according to the et al. 2018). In this study, we aimed to reveal the manufacturer’s protocol. Both ITS and rbcL were origin and taxonomic status of P. × leptocephalus amplified using γ-Taq polymerase (Toyobo, Japan). as well as the putative hybrid from the Fuji Five For ITS, 35 PCR cycles were performed at 94 °C Lakes and Lake Ashi by DNA and morphological for 30 s, 60 °C for 40 s, and at 72 °C for 30 s, using analyses, with special reference to the four candi- the primers F18S (5’- CCTTATCATTTAGAG- date parental species, P. maackianus, P. perfolia- GAAGGAG -3’) and R26S (5’- CTCCGCTTATT- tus, P. crispus and P. oxyphyllus, hypothesized by GATATGCTTAAAC -3’). The amplified prod- Miki (1937) or suggested by Kadono (1988) and ucts were sequenced directly using amplification Mizushima as mentioned above. primers and the internal sequence primer F5.8S (5’- TGACTCTCGGCAACGGATATC -3’) (Iida et al. 2018). Due to a length mutation in the paren- Materials and Methods tal ITS sequences, a sequence of positions 1–305 was determined by an F18S rRNA primer and a Samples sequence of positions 306–625 was determined Putative hybrid plants of Potamogeton were by an F5.8S rRNA primer. The amplification of collected from Lake Yamanaka, Lake Shoji, and rbcL was performed using primers rbcL26F Lake Ashi, while Potamogeton × leptocephalus (5’- TGTC ACCACAAACAGAGACTAAAGC was obtained from Lake Biwa (Table 1). Voucher -3’) and rbcL1375R (5’- ATACGATCTCTTTC specimens were deposited at OSA (transferred CATACTTCAC -3’) and sequenced using rb- from the herbarium of Kobe University). The cL1375R (Iida et al. 2007). ABI 3130 Genetic An- samples of P. maackianus and P. perfoliatus were alyzer (Applied Biosystems, USA) was used for collected from Lake Biwa. sequencing with a BigDye Terminator v.3.1 Cycle Sequencing Kit (ThermoFisher Scientific, USA) DNA analysis at Kobe University Biosignal Research Center. The nuclear-encoded internal transcribed Determined sequences of the putative hybrid and spacer (ITS) and the maternally inherited chloro- Potamogeton × leptocephalus were searched for plast-encoded gene rbcL were analyzed to deter- species-specific nucleotide substitutions or indels October 2019 Kadono & IIda– A New Variety of Potamogeton × leptocephalus 175 table 2. Diagnostic ITS sequences of Potamogeton × leptocephalus, the putative hybrid and their parental candidates. Data after position 533 were not listed (see Fig. 2). Positions in the alignment Species 1 1 1 2 2 2 2 3 4 2 2 3 4 4 5 6 7 8 9 1 6 8 1 1 1 1 6 1 0 3 5 6 9 2 0 8 5 5 4 7 7 2 4 5 6 8 3 P. × leptocephalus T C/T A A/T G/C T G/T A/T C/T C/T C/T G/T G G A C T C/T G/T Putative hybrids L. Sai . L. Yamanaka . L. Ashi . Parental candidates P. maackianus . C . A G . G A C T T* G . T G* P. perfoliatus . T* . T* C* . T* T* T* C C T* . C T* P. crispus C* C T* A G . G A C T C A* C* T* T* T* A* T A* P. oxyphyllus . C . A G A* G A C C C G . C C* Positions in the alignment Species 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 5 1 2 2 2 2 3 4 4 6 7 7 8 8 9 9 9 9 3 8 3 4 6 9 0 2 4 0 8 9 5 8 3 6 8 9 2 P. × leptocephalus C A/T C A C/T C A/G C/T C/T C C C/T - C G/C A/G A/G T Putative hybrids L. Sai . - . L. Yamanaka . - . L. Ashi . - . Parental candidates P. maackianus . T . C . A C C* . C* - . G G* A . P. perfoliatus . A* . T . G T* T . T - . C A G* . P. crispus T* T T* T* C T* A C T T* T* T T* T* G A A -* P. oxyphyllus . T . T . G C T . T - m C A A . .: the same as P. × leptocephalus, -: deletion, *: The species-specific nucleotide substitutions or indels. among four candidate species. in P. oxyphyllus). The obtained ITS sequences were 500 bp long Morphological comparison in the putative hybrid from the Fuji Five Lakes The morphology of the putative hybrid and and Lake Ashi and in Potamogeton × leptocepha- Potamogeton × leptocephalus was analyzed on lus (excluding an undetermined 88 bp sequence herbarium specimens at TI, MAK, and OSA, as around the 5.8S rRNA primer region). Although well as on living materials collected from the similar electropherograms were obtained from abovementioned lakes. Comparison was made on both the putative hybrid and P. × leptocephalus plants growing in an aquarium. before aligning position 532 (Fig. 1), the electro- pherograms of the hybrid showed complex pat- terns after aligning position 532 (Fig.
Load more

Recommended publications
  • An Updated Checklist of Aquatic Plants of Myanmar and Thailand
    Biodiversity Data Journal 2: e1019 doi: 10.3897/BDJ.2.e1019 Taxonomic paper An updated checklist of aquatic plants of Myanmar and Thailand Yu Ito†, Anders S. Barfod‡ † University of Canterbury, Christchurch, New Zealand ‡ Aarhus University, Aarhus, Denmark Corresponding author: Yu Ito ([email protected]) Academic editor: Quentin Groom Received: 04 Nov 2013 | Accepted: 29 Dec 2013 | Published: 06 Jan 2014 Citation: Ito Y, Barfod A (2014) An updated checklist of aquatic plants of Myanmar and Thailand. Biodiversity Data Journal 2: e1019. doi: 10.3897/BDJ.2.e1019 Abstract The flora of Tropical Asia is among the richest in the world, yet the actual diversity is estimated to be much higher than previously reported. Myanmar and Thailand are adjacent countries that together occupy more than the half the area of continental Tropical Asia. This geographic area is diverse ecologically, ranging from cool-temperate to tropical climates, and includes from coast, rainforests and high mountain elevations. An updated checklist of aquatic plants, which includes 78 species in 44 genera from 24 families, are presented based on floristic works. This number includes seven species, that have never been listed in the previous floras and checklists. The species (excluding non-indigenous taxa) were categorized by five geographic groups with the exception of to reflect the rich diversity of the countries' floras. Keywords Aquatic plants, flora, Myanmar, Thailand © Ito Y, Barfod A. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
    [Show full text]
  • A Satellite-Based Assessment of the Distribution and Biomass of Submerged Aquatic Vegetation in the Optically Shallow Basin of Lake Biwa
    Article A Satellite-Based Assessment of the Distribution and Biomass of Submerged Aquatic Vegetation in the Optically Shallow Basin of Lake Biwa Shweta Yadav 1, Minoru Yoneda 1, Junichi Susaki 2, Masayuki Tamura 2, Kanako Ishikawa 3 and Yosuke Yamashiki 4,* 1 Department of Environmental Engineering, Graduate School of Engineering, Kyoto University, Kyoto 615- 8540, Japan; [email protected] (S.Y.); [email protected] (M.Y.) 2 Department of Civil and Earth Resources Engineering, Graduate School of Engineering, Kyoto University, Kyoto 615-8540, Japan; [email protected] (J.S.); [email protected] (M.T.) 3 Lake Biwa Environmental Research Institute (LBERI), Otsu 520-0022, Japan; [email protected] 4 Graduate School of Advanced Integrated Studies in Human Survivability, Kyoto University, Kyoto 606-8501, Japan * Correspondence: [email protected]; Tel.: +81-75-762-2080 Received: 15 July 2017; Accepted: 12 September 2017; Published: 18 September 2017 Abstract: Assessing the abundance of submerged aquatic vegetation (SAV), particularly in shallow lakes, is essential for effective lake management activities. In the present study we applied satellite remote sensing (a Landsat-8 image) in order to evaluate the SAV coverage area and its biomass for the peak growth period, which is mainly in September or October (2013 to 2016), in the eutrophic and shallow south basin of Lake Biwa. We developed and validated a satellite-based water transparency retrieval algorithm based on the linear regression approach (R2 = 0.77) to determine the water clarity (2013–2016), which was later used for SAV classification and biomass estimation.
    [Show full text]
  • Differences in Phytoaccumulation of Organic Pollutants in Freshwater Submerged and Emergent Plants
    Environmental Pollution 241 (2018) 247e253 Contents lists available at ScienceDirect Environmental Pollution journal homepage: www.elsevier.com/locate/envpol Differences in phytoaccumulation of organic pollutants in freshwater submerged and emergent plants Senrong Fan a, Hang Liu a, Guomao Zheng a, Yilin Wang b, Shuran Wang c, Yong Liu b, * Xueqin Liu c,YiWana, a Laboratory for Earth Surface Processes, College of Urban and Environmental Sciences, Peking University, Beijing 100871, China b Key Laboratory of Water and Sediment Sciences Ministry of Education, College of Environmental Science and Engineering, Peking University, Beijing 100871, China c State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, 430072, China article info abstract Article history: Plants play an important role as sinks for or indicators of semivolatile organic pollutants, however most Received 7 December 2017 studies have focused on terrestrial plants and insufficient information has been obtained on aquatic Received in revised form plants to clarify the accumulation of organic pollutants via air-to-leaf vs. water-to-leaf pathways. The 16 May 2018 presence of p, pʹ-dichlorodiphenyldichloroethylene (p, pʹ-DDE), hexachlorobenzene (HCB), 15 polycyclic Accepted 21 May 2018 aromatic hydrocarbons (PAHs), and 9 substituted PAHs (s-PAHs), including oxy-PAHs and sulfur-PAHs, in Available online 26 May 2018 10 submerged and emergent plants collected from Lake Dianchi was analyzed in this study. Relatively low concentrations of p, pʹ-DDE (ND to 2.22 ng/g wet weight [ww]) and HCB (0.24e0.84 ng/g ww) and Keywords: e e Aquatic plants high levels of PAHs (46 244 ng/g ww) and s-PAHs (6.0 46.8 ng/g ww) were observed in the aquatic fi Mesophyll morphology plants.
    [Show full text]
  • The Effects of Water Pollution on the Phylogenetic Community Structure of Aquatic Plants in the East Tiaoxi River, China
    Received: 4 November 2018 | Revised: 8 October 2019 | Accepted: 6 November 2019 DOI: 10.1111/fwb.13451 ORIGINAL ARTICLE The effects of water pollution on the phylogenetic community structure of aquatic plants in the East Tiaoxi River, China Hironori Toyama1,2 | Kazuhiro Bessho3 | Liangliang Huang4 | Shun K. Hirota5,6 | Yuichi Kano6 | Keiko Mase2 | Tatsuro Sato6 | Akiyo Naiki7 | Jianhua Li8 | Yukihiro Shimatani9 | Tetsukazu Yahara2,6 1Center for Environmental Biology and Ecosystem Studies, National Institute for Environmental Studies, Tsukuba, Ibaraki, Japan 2Center for Asian Conservation Ecology, Kyushu University, Motooka, Fukuoka, Japan 3Department of Evolutionary Studies of Biosystems, School of Advanced Sciences, SOKENDAI (The Graduate University for Advanced Studies), Hayama, Kanagawa, Japan 4Guangxi Key Laboratory of Environmental Pollution Control and Technology, Guilin University of Technology, Guilin, Guangxi, China 5Field Science Center, Graduate School of Agricultural Science, Tohoku University, Osaki City, Miyagi, Japan 6Institute of Decision Science for a Sustainable Society, Kyushu University, Motooka, Fukuoka, Japan 7Tropical Biosphere Research Center, University of the Ryukyus, Yaeyama-gun, Okinawa, Japan 8Key Laboratory of Water Environment in the Yangtze River, Ministry of Education, College of Environmental Science and Engineering, Tongji University, Shanghai, China 9Faculty of Engineering, Kyushu University, Nishi-ku, Fukuoka, Japan Correspondence Hironori Toyama, Center for Environmental Abstract Biology and Ecosystem Studies, National 1. Water pollution is one of the most serious aquatic environmental problems world- Institute for Environmental Studies, Tsukuba, Ibaraki, 305-8506, Japan. wide. In China, recent agricultural and industrial development has resulted in rapid Email: [email protected] changes in aquatic ecosystems. Here, we reveal the effects of water pollution on Funding information the phylogenetic community structure of aquatic macrophytes in the Tiaoxi River, JSPS grant for Global Center of Excellence China.
    [Show full text]
  • Anaerobic Digestion of Submerged Macrophytes
    DISSERTATION ANAEROBIC DIGESTION OF SUBMERGED MACROPHYTES —BIOCHEMICAL APPROACH FOR ENHANCING THE METHANE PRODUCTION— 2016 SOKA UNIVERSITY GRADUATE SCHOOL OF ENGINEERING MITSUHIKO KOYAMA ANAEROBIC DIGESTION OF SUBMERGED MACROPHYTES —BIOCHEMICAL APPROACH FOR ENHANCING THE METHANE PRODUCTION— March 2016 MITSUHIKO KOYAMA SOKA UNIVERSITY Author: Mitsuhiko Koyama Title: Anaerobic digestion of submerged macrophytes —Biochemical approach for enhancing the methane production— Department: Environmental Engineering for Symbiosis Faculty: Engineering Degree: Ph.D. Convocation: March 2016 Permission is herewith granted to Soka University to circulate and copy for non- commercial purposes, at its discretion, the above title request of individual or institutions. We certify that we have read this dissertation and that, in our opinion, it is satisfactory in scope and quality as a dissertation for the degree of Doctor of Philosophy in Engineering March 2016 DISSERTATION COMMITTEE Prof. Dr. Tatsuki Toda Prof. Dr. Shuichi Yamamoto Prof. Dr. Kiyohiko Nakasaki Contents page ACKNOWLEDGMENTS i ABSTRACT iii Chapter I GENERAL INTRODUCTION 1.1. Emerging issues of aquatic macrophytes 1 1.2. Harvesting of submerged macrophytes and treatment of the harvested phytomass 2 1.3. Anaerobic digestion of lignocellulosic biomass and enhancement of CH4 recovery 5 1.4. Objectives 7 Tables 9 Figures 10 ChapterⅡ CHEMICAL COMPOSITION AND ANAEROBIC DIGESTIBILITY OF FIVE SUBMERGED MACROPHYTE SPECIES DOMINANT IN LAKE BIWA 2.1. Introduction 16 2.2. Materials and methods 17 2.2.1. Substrates and inoculum 17 2.2.2. Batch anaerobic digestion of submerged macrophytes 18 2.2.3. Analytical parameters 19 2.2.4. Calculation 20 2.3. Results and discussion 21 2.3.1. Chemical composition of submerged macrophytes 21 2.3.2.
    [Show full text]
  • Potamogetonaceae (PDF)
    POTAMOGETONACEAE 眼子菜科 yan zi cai ke Guo Youhao (郭友好)1; Robert R. Haynes2, C. Barre Hellquist3, Zdenek Kaplan4 Herbs, perennial or annual, in fresh to brackish water, totally submerged or with floating leaves. Rhizomes present or absent. Stems elongated or shortened, terete to compressed, rarely strongly compressed. Leaves alternate or basal, occasionally opposite or subopposite; stipules free from leaves or adnate to leaf base and sheathing stems. Inflorescence a capitate spike, terminal or axillary. Plants monoecious; flowers small, bisexual. Perianth bractlike, free, present or absent. Stamens (1–)4; anthers sessile, (1 or)2-celled, extrorse, longitudinally dehiscent. Carpels (1–)4, free; ovule solitary. Fruit drupaceous. Embryo curved; endosperm absent. Three genera and ca. 85 species: cosmopolitan; two genera and 24 species in China. Guo Youhao & Li Qingyi. 1992. Potamogetonaceae (excluding Halodule, Phyllospadix, Posidonia, Ruppia, Syringodium, Triglochin, and Zostera). In: Sun Xiangzhong, ed., Fl. Reipubl. Popularis Sin. 8: 40–83. 1a. Submersed leaves with stipules free from leaf base, or if adnate then adnate portion less than 1/2 length of stipule; leaves submersed and floating or all submersed; submersed leaf blades translucent, not channeled, flattened; peduncle stiff, submersed or projecting above water surface ..................................................................... 1. Potamogeton 1b. Submersed leaves with stipules adnate to leaf blade for 2/3 or more length of stipule; leaves all submersed, blades opaque, channeled; peduncle lax, not projecting inflorescence above water surface ........................................... 2. Stuckenia 1. POTAMOGETON Linnaeus, Sp. Pl. 1: 126. 1753. 眼子菜属 yan zi cai shu Herbs, perennial or annual, in fresh or brackish water, totally submerged or with floating leaves. Stems terete to compressed, rarely strongly compressed.
    [Show full text]
  • Characterization of Lake Biwa Macrophytes in Their Chemical Composition
    Journal of the Japan Institute of Energy, 91,J. 621-628 Jpn. Inst. (2012) Energy, Vol. 91, No. 7, 2012 621 Original Paper Characterization of Lake Biwa Macrophytes in their Chemical Composition Harifara RABEMANOLONTSOA, and Shiro SAKA （Received December 2, 2011） Macrophytes growing in Lake Biwa such as ofusa-mo (Myriophyllum aquaticum), sennin-mo (Potamogeton maackianus), okanada-mo (Egeria densa), kuro-mo (Hydrilla verticillata) and kokanada-mo (Elodea nuttallii) were characterized in their chemical composition in order to evaluate their potential as biorefinery feedstocks. As a result, cellulose and hemicellulose contents were found to be in a range, respectively, between 227 - 436 g/ kg and 88 - 194 g/kg, while lignin content was from 71 to 175 g/kg. In more detail, hemicelluloses were mostly composed of xylose, galactose, mannose and arabinose in relatively equal amounts, whereas lignin was composed of guaiacylpropane, syringylpropane and p-hydroxylphenylpropane moieties, while ash and protein were remarkably high to be 105-223 g/kg and 137-229 g/kg, respectively. Although inorganics as shown by ash might be a limitation in the utilization of the macrophytes as biorefinery feedstocks, cellulose, hemicellulose, lignin and protein are available as raw materials for the production of a wide range of value- added biobased products. Key Words Myriophyllum aquaticum, Potamogeton maackianus, Egeria densa, Hydrilla verticillata, Elodea nuttallii, Lake Biwa, Chemical composition 1. Introduction verticillata) as well as okanada-mo (Egeria densa) were also Biorefinery from terrestrial biomass feedstocks en- abundant in the basin 5). The large quantity of macrophytes countered problems related to food price and land use.
    [Show full text]
  • Exposure to Water Increased Pollen Longevity of Pondweed
    Evol Ecol (2010) 24:939–953 DOI 10.1007/s10682-010-9351-z ORIGINAL PAPER Exposure to water increased pollen longevity of pondweed (Potamogeton spp.) indicates different mechanisms ensuring pollination success of angiosperms in aquatic habitat Xiao-lin Zhang • Robert W. Gituru • Chun-feng Yang • You-hao Guo Received: 8 December 2008 / Accepted: 4 January 2010 / Published online: 22 January 2010 Ó Springer Science+Business Media B.V. 2010 Abstract Pollen longevity in seven Potamogeton species representing different polli- nation systems (anemophily, epihydrophily and hydroautogamy) was assessed both under aerial condition and in contact with water to investigate how water impacts the sexual reproduction in these aquatic taxa. Stainability of pollen with MTT was considered as an indicator of pollen viability. The half-life of pollen longevity was calculated using expo- nential decay regression. Overall, pollen viability decreased relatively rapidly with time. Pollen grains of obligate anemophilic species had lower initial viability and shorter half- lives than those of facultative anemophilic species. Pollen in these latter species may take more time to reach the stigma. The pollen of Potamogeton may be categorized as partially hydrated pollen owing to its generally spherical shape and lack of furrows, rapid loss of viability, and fast pollen tube initiation. The half-life is positively correlated with pollen size. Smaller-sized grains are at greater risk of desiccation than larger grains. In contrast with the situation observed in most terrestrial angiosperms, contact with water increases pollen longevity in Potamogeton species. In our present study the half-lives of pollen longevity of Potamogeton species in which the pollen had come into contact with water (mean of 10.65 h) were markedly higher than those under aerial conditions (mean of 5.79 h, t = 2.622, P = 0.039).
    [Show full text]
  • Potamogetonaceae, Zosteraceae
    Flora Malesiana, Series I, Volume 16 (2002) 167-216 Potamogetonaceae, Zosteraceae, and Cymodoceaceae 1 C. den Hartog Nijmegen, The Netherlands & G. Wiegleb Cottbus, Germany) Introductionto thesea-grasses (C. den Hartog) In earlier papers the sea-grasses were classifiedwithin two families, the Potamogetona- and the As result of research of all of the ceae Hydrocharitaceae. a thorough genera order Helobiae (Alismatidae) by Tomlinson (1982), it has become evident that the very heterogeneous family Potamogetonaceae had to be split into a number of independent families. The sea-grasses which already had subfamily status, became families in their own right, the Cymodoceaceae the Zosteraceae and the Posidoniaceae (not in Malesia). , , The independence of these families is not contradicted by molecular genetical evidence (Les et al. 1997). According to the new vision the Potamogetonaceae are restricted to the genera Potamogeton, Groenlandia (not in Malesia), and Ruppia; however, there are of its molecular genetic indications that the latter genus may present a family own (Les et al. 1997). Therefore, and because of the comparable role in the vegetation of the dif- ferent introduction to in is here, with to the genera, an sea-grasses general given a Key different families and genera of sea-grasses. The phytochemistry of all these groups is given by R. Hegnauer. The few angiosperms that have penetrated into the marine environment, and are able to fulfiltheir vegetative and generative cycle when completely submerged, are generally known as sea-grasses. The name refers to the superficial resemblance to grasses, be- cause ofthe linear leaves of most of the species. In spite of the fact that the numberof sea-grass species is very small (only 60 to 65), they are of paramount importance in the coastal environment, where, when they occur, they generally form extensive beds.
    [Show full text]
  • A Study of Comparative Purification Efficiency of Two Species of Potamogeton (Submerged Macrophyte) in Wastewater Treatment
    International Journal of Scientific and Research Publications, Volume 3, Issue 1, January 2013 1 ISSN 2250-3153 A Study of Comparative Purification Efficiency of Two Species of Potamogeton (Submerged Macrophyte) In Wastewater Treatment Parvaiz Ahmad Lone*, Ajay Kumar Bhardwaj **, Fayaz Ahmad Bahar*** * Department of Environmental Sciences and Limnology, Barkatullah University, Bhopal, Madhya Pradesh, India. ** Department of Botany, Government Narmada Post Graduate College Hoshanagbad, Madhya Pradesh, India. *** Faculty of Agriculture (FOA) Wadura Sopore, SKUAST-Kashmir, India. Abstract- In the balancing of lake ecosystem macrophytes play a organic matter in the lake from the catchment area. Macrophytic very important role. They have capacity to improve the water vegetation plays an important role in maintaining the ecosystem quality by absorbing nutrients with their effective root system of a lake. Various types of macrophytes viz. emergent, free and hence as Biofilters. Attempt was made in which samples of floating, submerged are generally observed in an aquatic two Potamogeton species viz. Potamogeton crispus and ecosystem where they play a very important role in improving Potamogeton pectinatus were collected during December 2008 to the quality of water since later is a prime natural resource, a basic April 2009 from three different sites of Upper Lake of Bhopal. human need and a precious natural asset. The nutrients including the phosphorus, potassium and sodium in Among the principal characteristics of macrophytes is their the plants were analysed and found to be high. Significant ability to accumulate nutrients and accelerate nutrient loading in correlations in phosphorus, potassium and sodium levels were the environment. Many aquatic plants utilize these nutrients and apparent between the tissues of two Potamogeton species which produce large amount of biomass which can be used for some were related to their life forms and to the limnological beneficial purposes.
    [Show full text]
  • An Account of the Species of Potamogeton L. (Potamogetonaceae)
    Folia Geobotanica 33: 241-316, 1998 AN ACCOUNTOF THE SPECIES OF POTAMOGETONL. (POTAMOGETONACEAE) Gerhard Wiegleb1) & Zdenek Kaplan2) 1) Department of General Ecology, BTU Cottbus, POB 10 13 44, D-03013 Cottbus, Germany; tel. +49 355 692291, fax +49 355 692291, E-mail [email protected] 2) Institute of Botany, Academy of Sciences of the Czech Republic, CZ-25243 Pruhonice, Czech Republic; fax +420 2 67750031, E-mail [email protected] Keywords:Descriptions, Hybrids, Key to species, Species list, Synonyms,Taxonomic problems Abstract:An accountof thetaxonomy of thegenus Potamogeton L. withspecial reference to speciesdescription and delimitationis presented.A key to the species is given, basedas far as possibleon vegetativecharacters. Detaileddescriptions are providedfor a total of 69 species which are regardedas sufficientlywell known. Specialemphasis is laid both on a completelist of relevantcharacters as well as on the judgementof their respectivediagnostic values. All importantsynonyms are listed allowingdirect access to most of the relevant taxonomicand floristicPotamogeton literature. 50 confirmedhybrids are listed andassigned to theirputative parentspecies. Questions with respectto the taxalisted are formulated in notes on each of the species.A more generalview and questionson futurePotamogeton research are summarizedin the conclusions. "It is to be regretted that we never arrive to the truth but through some mistake or another" (J.O. Hagstrom 1916) INTRODUCTION Since the days of GRAEBNER(1907) and HAGSTROM(1916) no comprehensivetaxonomic treatmentof the genus Potamogeton L. claiming worldwide validity has been carried out. The work of GRAEBNER(1907) was an attempt to compile all the known taxonomic and phytogeographicinformation about the genus, althoughP. Graebnerhimself never carriedout importanttaxonomic work on the genus Potamogeton.In contrast,J.O.
    [Show full text]
  • Title SATELLITE-BASED APPROACH for MONITORING and MAPPING
    SATELLITE-BASED APPROACH FOR MONITORING AND MAPPING THE SUBMERGED AQUATIC Title VEGETATION IN THE EUTROPHIC SHALLOW BASIN OF LAKE BIWA, JAPAN( Dissertation_全文 ) Author(s) Yadav, Shweta Citation 京都大学 Issue Date 2017-09-25 URL https://doi.org/10.14989/doctor.k20694 Right 許諾条件により本文は2018-09-24に公開 Type Thesis or Dissertation Textversion ETD Kyoto University SATELLITE-BASED APPROACH FOR MONITORING AND MAPPING THE SUBMERGED AQUATIC VEGETATION IN THE EUTROPHIC SHALLOW BASIN OF LAKE BIWA, JAPAN SHWETA YADAV 2017 1 ACKNOWLEDGEMENTS I would like to express my deep gratitude to my supervisor Professor Minoru Yoneda and also to Professor Yosuke Alexandre Yamashiki for their constant guidance and supervision throughout my doctoral research, which helped me to accomplish the task of my Ph.D. thesis. I would also like to extend my sincere thanks to Professor Tamura Masayuki, and Associate Professor Junichi Susaki for their immense support and valuable suggestions, which helped me to enhance my knowledge and understanding during my research. My gratitude extends to Professor Yoshihisa Shimizu for the constructive comments during my defense. Also thankful to Associate Professor Yoko Shimada for giving the much-needed suggestions during my research period. I owe my thanks to Dr. Kanako Ishikawa and other staff members from Lake Biwa Environmental Research Institute (LBERI) for conducting the lake surveys with us and for sharing the information. Also grateful to Japan Water Agency (JWA) for providing the required data for research. I am thankful to the Ministry of Education, Culture, Sports, Science, and Technology (MEXT) of Japan, for the financial support during my stay at Kyoto University.
    [Show full text]