DOCSLIB.ORG

EGR1 and FOSB Gene Expressions in Cancer Stroma Are Independent Prognostic Indicators for Epithelial Ovarian Cancer Receiving Standard Therapy

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
EGR1 and FOSB Gene Expressions in Cancer Stroma Are Independent Prognostic Indicators for Epithelial Ovarian Cancer Receiving Standard Therapy GENES, CHROMOSOMES & CANCER 51:300–312 (2012) EGR1 and FOSB Gene Expressions in Cancer Stroma Are Independent Prognostic Indicators for Epithelial Ovarian Cancer Receiving Standard Therapy Fumio Kataoka,1 Hiroshi Tsuda,1* Tokuzo Arao,2 Sadako Nishimura,3 Hideo Tanaka,1 Hiroyuki Nomura,1 Tatsuyuki Chiyoda,1 Akira Hirasawa,1 Tomoko Akahane,1 Hiroshi Nishio,1 Kazuto Nishio,2 and Daisuke Aoki1 1Departmentof Obstetrics and Gynecology,School of Medicine,Keio University,Tokyo,Japan 2Departmentof Genome Biology,Kinki University School of Medicine,Osaka,Japan 3Departmentof Obstetrics and Gynecology,Osaka City General Hospital,Osaka,Japan Stromal components interact with cancer cells to promote growth and metastasis. The purpose of this study was to iden- tify genes expressed in stroma, which could provide prognostic information in epithelial ovarian cancer (EOC). Seventy- four patients were included. We performed gene expression profiling and confirmed array data using RT-PCR and immuno- histochemistry. By microarray analysis, 52 candidate genes associated with progression free survival (PFS) were identified (P < 0.005). Expression of the early growth response 1 (EGR1) and FBJ murine osteosarcoma viral oncogene homolog B (FOSB) genes was further analyzed. Array data were confirmed by RT-PCR and multivariate analysis demonstrated that both EGR1 and FOSB expression in cancer stroma, and EGR1 expression in cancer are independent prognostic factors in EOC. Immunohistochemically, EGR1 protein is localized in cancer cells and a-smooth muscle actin positive stromal fibro- blasts. The EGR1 and FOSB expression in stromal cells and EGR1 expression in cancer cells are prognostic indicators in EOC. VC 2011 Wiley Periodicals, Inc. INTRODUCTION ior, including invasion or metastasis and response Epithelial ovarian cancer (EOC) is a common to therapy (Bhowmick and Moses, 2005; Kim et al., cause of cancer death in women. Early diagnosis 2005; Tlsty and Coussens, 2006). However, the role of EOC is difficult because of a lack of specific of stromal cells in the development and progression symptoms so that 80% of patients are diagnosed of epithelial neoplasia has not been thoroughly at Stage III or IV. EOC is a relatively chemosen- investigated. Finak et al. used laser capture micro- sitive tumor, and 70% of advanced EOC (aEOC) dissection (LCM) to compare gene expression pro- patients treated by standard surgical procedures files of tumor stroma from 53 primary breast (bilateral adnexectomy þ hysterectomy þ greater cancers and established a new stroma-derived prog- omentectomy) with staging laparotomy and nostic predictor (SDPP) that stratifies disease out- debulking surgery, followed by postoperative come independently of standard clinical prognostic chemotherapy using a combination of platinum factors or published gene expression-based predic- and taxan, achieved a complete clinical response. tors (Finak et al., 2008). However, few studies have However, disease recurs in most patients within 2 examined the tumor–stroma interaction in clinical years after diagnosis and death is due to chemo- therapy-resistant tumor. If reliable predictive Additional Supporting Information may be found in the online markers could be established, patients who are version of this article. likely to relapse and die of disease are good can- Supported by: Grant-in-Aid for Scientific Research on Priority Areas from the Ministry of Education, Science and Culture, didates for clinical trials using new drugs. We Japan, Grant number: 20014024; A Grant-in Aid for scientific previously reported that the amplification of 8q24 Research (C) from the Ministry of Education, Science and Culture, Japan; Grant number: 19591940; Osaka City General and 20q11-13 or 17q21-q24 can predict progres- Hospital. sion-free survival (PFS) in EOC and may be new *Correspondence to: Hiroshi Tsuda, MD, PhD, Department of predictive biomarkers for aEOC (Hirasawa et al., Obstetrics and Gynecology, School of Medicine, Keio University, 35 Shinanomachi, Shinjyuku-ku, Tokyo, 160-8582, Japan. 2003; Tominaga et al., 2010). Cancer consists of Tel.: þ81-3-3353-1211 (Ext 61721). Fax: þ81-3-3353-0249. founder cancer cells and stroma, including blood E-mail: [email protected] and lymph endothelial cells, inflammatory cells, Received 20 June 2011; Accepted 27 October 2011 DOI 10.1002/gcc.21916 immunocytes, macrophages and fibroblasts. Published online 15 November 2011 in Stroma is thought to play a role in tumor behav- Wiley Online Library (wileyonlinelibrary.com). VC 2011 Wiley Periodicals, Inc. A STROMAL BIOMARKER IN OVARIAN CANCER 301 samples of EOC. Here, we microdissected cancer Study Design stroma from aEOC by LCM, performed expression Seventy-four aEOC samples were evaluated in profiling, and analyzed the relationship between this study. We performed microarray analysis on the expression profile pattern and prognosis. microdissected stroma from 24 aEOCs and genes of interest were evaluated in an independent set of 50 samples. PFS was predicted using the MATERIALS AND METHODS results of real-time PCR analysis. Patients and Samples Subjects eligible for this study were patients Microdissection, RNA Extraction, and with histologically confirmed Stage IIc–IV aEOC Amplification of RNA (excluding mucinous and clear cell types) receiv- Microdissection was performed as described ing standard therapy. Additional inclusion criteria (Tsuda et al., 2004, 2005). In brief, frozen sec- included an Eastern Cooperative Oncology Group tions (6 lm) prepared from tumor tissue speci- performance status of 0–2. Clinical stage and his- mens were affixed to glass slides and stained by tologic grade were determined in accordance with HistogeneTM LCM Frozen Section Staining Kit the International Federation of Gynecology and (Arcturus Engineering, Mountain View, CA). Obstetrics (FIGO) systems. Undifferentiated his- Stained sections were microdissected using a Pix- tology was treated as Grade 3. Exclusion criteria Cell IIe LCM system (Arcturus Engineering). included a history of prior chemotherapy or major Tumor cells and adjacent non-tumor stromal cells surgery. All patients received standard surgery were visualized under the microscope and selec- and chemotherapy using carboplatin and pacli- tively detached by activation of the laser. Stromal taxel. Standard surgery means bilateral adnexec- tissues within 200 cells from the margin of tomy, hysterectomy, and greater omentectomy tumors were dissected in each case. Total RNA with staging laparotomy and debulking surgery. extraction was performed using the PicoPureTM Samples used for microarray analysis were from RNA Isolation Kit according to the manufac- 24 aEOC patients with a median age of 61 years turer’s instructions (Arcturus Engineering). RNA (range 41–80), 4 were Stage II, 14 Stage III, and was amplified using a modified single round T7 6 Stage IV. Three tumors were endometrioid, 17 RNA amplification protocol. In brief, total RNA serous, and 4 of undifferentiated histologic type, (600 ng) was first incubated with 1 llofT7 while 1 was histologic Grade G1, 7 G2, and 16 primer (50-GCATTAGCGGCCGCGAAATTAAT G3. Ten patients were of optimal and 14 of sub- ACGACTCACTATAGGGAGATTTTTTTTT optimal operation status. The median follow-up TTTTTTTTTVN-30, 200 ng/ll) in a total vol- period was 1,006 days (range: 339–2,283 days) ume of 50 ll for 3 min at 70C. First strand and seven patients are alive without relapse. cDNA synthesis was then performed by incubat- Fifty independent aEOC samples used for valida- ing 5 ll of primer-annealed sample and 5 llof tion by reverse transcription polymerase chain reac- first strand master mix containing 2 llof5Â first tion (RT-PCR) assay were from patients with a strand buffer, 1 ll of 0.1 M Dithiothreitol (DTT), median age of 54 years (range 29–80), 7 patients 0.5 ll of Diethyl polycarbonate (DEPC) water, were Stage II, 33 Stage III, and 10 Stage IV. Eleven 0.5 ll 10 mM deoxyribonucleotide triphosphate tumors were endometrioid, 31 serous, and 8 of undif- (dNTP) mix, 0.5 ll RNase Inhibitor, and 0.5 llof ferentiated histologic type while 2 were histologic Moloney Murine Leukemia Virus Reverse Tran- Grade G1, 16 G2, and 32 G3. Twenty-seven patients scriptase (MMLV) (200 U/ll)for1hand15minat were of optimal and 23 of suboptimal operation sta- 37C. Subsequently, second strand cDNA synthesis tus. The median follow-up period was 836 days was performed by incubating the10 ll first strand (range: 191–2,885 days) and 20 patients are alive reaction with 65 ll of second master mix, which without relapse. All cases are shown in Table 1. contained 46 llDEPCwater,15ll5Â second PFS was followed after the patients had strand buffer, 1.5 llof10mMdNTPmix,0.5ll received primary surgery. This study was approved of E. coli DNA Ligase (10 U/ll), 1.5 ll E. coli by the Institutional Review Board of the Osaka DNA polymerase I (10 U/ll), and 0.5 ll E. coli City General Hospital and School of Medicine, RNase H (2 U/ll), for 2 h at 16C,andthenfor Keio University and written informed consent was 15 min at 70C.Theentire75llcDNAsample obtained from all patients. Specimens obtained at was loaded onto a ChromaSpin TE-200 spin operation were immediately stored at À80C. column (BD Biosciences, San Diego, CA), which Genes, Chromosomes & Cancer DOI 10.1002/gcc 302 KATAOKA ET AL. TABLE 1. Clinical Background and EGR1 and FOSB Expression in All Cases Debulking EGR1s EGR1c EGR1s EGR1c FOSBs FOSBc Clinical No. Age Stage Histology Grade status PCR PCR IHC IHC PCR PCR outcome 1 55 4 ECC 3 Optimal prog 2 52 3c SEC 3 Suboptimal
Load more

Recommended publications
  • Core Transcriptional Regulatory Circuitries in Cancer
    Oncogene (2020) 39:6633–6646 https://doi.org/10.1038/s41388-020-01459-w REVIEW ARTICLE Core transcriptional regulatory circuitries in cancer 1 1,2,3 1 2 1,4,5 Ye Chen ● Liang Xu ● Ruby Yu-Tong Lin ● Markus Müschen ● H. Phillip Koeffler Received: 14 June 2020 / Revised: 30 August 2020 / Accepted: 4 September 2020 / Published online: 17 September 2020 © The Author(s) 2020. This article is published with open access Abstract Transcription factors (TFs) coordinate the on-and-off states of gene expression typically in a combinatorial fashion. Studies from embryonic stem cells and other cell types have revealed that a clique of self-regulated core TFs control cell identity and cell state. These core TFs form interconnected feed-forward transcriptional loops to establish and reinforce the cell-type- specific gene-expression program; the ensemble of core TFs and their regulatory loops constitutes core transcriptional regulatory circuitry (CRC). Here, we summarize recent progress in computational reconstitution and biologic exploration of CRCs across various human malignancies, and consolidate the strategy and methodology for CRC discovery. We also discuss the genetic basis and therapeutic vulnerability of CRC, and highlight new frontiers and future efforts for the study of CRC in cancer. Knowledge of CRC in cancer is fundamental to understanding cancer-specific transcriptional addiction, and should provide important insight to both pathobiology and therapeutics. 1234567890();,: 1234567890();,: Introduction genes. Till now, one critical goal in biology remains to understand the composition and hierarchy of transcriptional Transcriptional regulation is one of the fundamental mole- regulatory network in each specified cell type/lineage.
    [Show full text]
  • RFX2 Antibody Cat
    RFX2 Antibody Cat. No.: 25-404 RFX2 Antibody Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human Antibody produced in rabbits immunized with a synthetic peptide corresponding a region IMMUNOGEN: of human RFX2. TESTED APPLICATIONS: ELISA, WB RFX2 antibody can be used for detection of RFX2 by ELISA at 1:1562500. RFX2 antibody APPLICATIONS: can be used for detection of RFX2 by western blot at 1 μg/mL, and HRP conjugated secondary antibody should be diluted 1:50,000 - 100,000. POSITIVE CONTROL: 1) 721_B Cell Lysate PREDICTED MOLECULAR 80 kDa WEIGHT: Properties PURIFICATION: Antibody is purified by peptide affinity chromatography method. CLONALITY: Polyclonal CONJUGATE: Unconjugated PHYSICAL STATE: Liquid September 30, 2021 1 https://www.prosci-inc.com/rfx2-antibody-25-404.html Purified antibody supplied in 1x PBS buffer with 0.09% (w/v) sodium azide and 2% BUFFER: sucrose. CONCENTRATION: batch dependent For short periods of storage (days) store at 4˚C. For longer periods of storage, store RFX2 STORAGE CONDITIONS: antibody at -20˚C. As with any antibody avoid repeat freeze-thaw cycles. Additional Info OFFICIAL SYMBOL: RFX2 ALTERNATE NAMES: RFX2, FLJ14226, ACCESSION NO.: NP_000626 PROTEIN GI NO.: 19743881 GENE ID: 5990 USER NOTE: Optimal dilutions for each application to be determined by the researcher. Background and References RFX2 is a member of transcription factors that contain a highly-conserved winged helix DNA binding domain. RFX2 is structurally related to regulatory factors X1, X3, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. This protein can bind to cis elements in the promoter of the IL-5 receptor alpha gene.This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA BACKGROUND: binding domain.
    [Show full text]
  • Dedifferentiation and Neuronal Repression Define Familial Alzheimer’S Disease Andrew B
    bioRxiv preprint doi: https://doi.org/10.1101/531202; this version posted November 18, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International licenseCaldwell. et al. BIORXIV/2019/531202 Dedifferentiation and neuronal repression define Familial Alzheimer’s Disease Andrew B. Caldwell1, Qing Liu2, Gary P. Schroth3, Douglas R. Galasko2, Shauna H. Yuan2,8, Steven L. Wagner2,4, & Shankar Subramaniam1,5,6,7* Affiliations 1Department of Bioengineering, University of California, San Diego, La Jolla, CA, USA. 2Department of Neurosciences, University of California, San Diego, La Jolla, CA, USA. 3Illumina, Inc., San Diego, CA, USA. 4VA San Diego Healthcare System, La Jolla, CA, USA. 5Department of Cellular and Molecular Medicine, University of California, San Diego, La Jolla, CA, USA. 6Department of Nanoengineering, University of California, San Diego, La Jolla, CA, USA. 7Department of Computer Science and Engineering, University of California, San Diego, La Jolla, CA, USA. 8Present Address: N. Bud Grossman Center for Memory Research and Care, Department of Neurology, University of Minnesota, Minneapolis, MN, USA; GRECC, Minneapolis VA Health Care System, Minneapolis, MN, USA. *Correspondence: Correspondence and requests for materials should be addressed to S.S. ([email protected]). Abstract Early-Onset Familial Alzheimer’s Disease (EOFAD) is a dominantly inherited neurodegenerative disorder elicited by over 300 mutations in the PSEN1, PSEN2, and APP genes1. Hallmark pathological changes and symptoms observed, namely the accumulation of misfolded Amyloid-β (Aβ) in plaques and Tau aggregates in neurofibrillary tangles associated with memory loss and cognitive decline, are understood to be temporally accelerated manifestations of the more common sporadic Late-Onset Alzheimer’s Disease.
    [Show full text]
  • (P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation
    Table S1: Significant differentially expressed genes (P -Value<0.05, Fold Change≥1.4), 4 vs. 0 Gy irradiation Genbank Fold Change P -Value Gene Symbol Description Accession Q9F8M7_CARHY (Q9F8M7) DTDP-glucose 4,6-dehydratase (Fragment), partial (9%) 6.70 0.017399678 THC2699065 [THC2719287] 5.53 0.003379195 BC013657 BC013657 Homo sapiens cDNA clone IMAGE:4152983, partial cds. [BC013657] 5.10 0.024641735 THC2750781 Ciliary dynein heavy chain 5 (Axonemal beta dynein heavy chain 5) (HL1). 4.07 0.04353262 DNAH5 [Source:Uniprot/SWISSPROT;Acc:Q8TE73] [ENST00000382416] 3.81 0.002855909 NM_145263 SPATA18 Homo sapiens spermatogenesis associated 18 homolog (rat) (SPATA18), mRNA [NM_145263] AA418814 zw01a02.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:767978 3', 3.69 0.03203913 AA418814 AA418814 mRNA sequence [AA418814] AL356953 leucine-rich repeat-containing G protein-coupled receptor 6 {Homo sapiens} (exp=0; 3.63 0.0277936 THC2705989 wgp=1; cg=0), partial (4%) [THC2752981] AA484677 ne64a07.s1 NCI_CGAP_Alv1 Homo sapiens cDNA clone IMAGE:909012, mRNA 3.63 0.027098073 AA484677 AA484677 sequence [AA484677] oe06h09.s1 NCI_CGAP_Ov2 Homo sapiens cDNA clone IMAGE:1385153, mRNA sequence 3.48 0.04468495 AA837799 AA837799 [AA837799] Homo sapiens hypothetical protein LOC340109, mRNA (cDNA clone IMAGE:5578073), partial 3.27 0.031178378 BC039509 LOC643401 cds. [BC039509] Homo sapiens Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 1, mRNA 3.24 0.022156298 NM_000043 FAS [NM_000043] 3.20 0.021043295 A_32_P125056 BF803942 CM2-CI0135-021100-477-g08 CI0135 Homo sapiens cDNA, mRNA sequence 3.04 0.043389246 BF803942 BF803942 [BF803942] 3.03 0.002430239 NM_015920 RPS27L Homo sapiens ribosomal protein S27-like (RPS27L), mRNA [NM_015920] Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an 2.98 0.021202829 NM_003841 TNFRSF10C intracellular domain (TNFRSF10C), mRNA [NM_003841] 2.97 0.03243901 AB002384 C6orf32 Homo sapiens mRNA for KIAA0386 gene, partial cds.
    [Show full text]
  • Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
    Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,
    [Show full text]
  • Transcriptomic Regulation of Alternative Phenotypic Trajectories in Embryos of the Annual Killifish Austrofundulus Limnaeus
    Portland State University PDXScholar Dissertations and Theses Dissertations and Theses Fall 11-30-2017 Transcriptomic Regulation of Alternative Phenotypic Trajectories in Embryos of the Annual Killifish Austrofundulus limnaeus Amie L. Romney Portland State University Follow this and additional works at: https://pdxscholar.library.pdx.edu/open_access_etds Part of the Biology Commons, and the Genetics and Genomics Commons Let us know how access to this document benefits ou.y Recommended Citation Romney, Amie L., "Transcriptomic Regulation of Alternative Phenotypic Trajectories in Embryos of the Annual Killifish Austrofundulus limnaeus" (2017). Dissertations and Theses. Paper 4033. https://doi.org/10.15760/etd.5917 This Dissertation is brought to you for free and open access. It has been accepted for inclusion in Dissertations and Theses by an authorized administrator of PDXScholar. Please contact us if we can make this document more accessible: [email protected]. Transcriptomic Regulation of Alternative Phenotypic Trajectories in embryos of the Annual Killifish Austrofundulus limnaeus by Amie Lynn Thomas Romney A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biology Dissertation Committee Jason Podrabsky, Chair Suzanne Estes Bradley Buckley Todd Rosenstiel Dirk Iwata-Reuyl Portland State University 2017 © 2017 Amie Lynn Thomas Romney ABSTRACT The Annual Killifish, Austrofundulus limnaeus, survives the seasonal drying of their pond habitat in the form of embryos entering diapause midway through development. The diapause trajectory is one of two developmental phenotypes. Alternatively, individuals can “escape” entry into diapause and develop continuously until hatching. The alternative phenotypes of A. limnaeus are a form of developmental plasticity that provides this species with a physiological adaption for surviving stressful environments.
    [Show full text]
  • Multi-Omics Analysis of Tumor Angiogenesis Characteristics And
    Zheng et al. Cell Commun Signal (2021) 19:39 https://doi.org/10.1186/s12964-021-00728-9 RESEARCH Open Access Multi-omics analysis of tumor angiogenesis characteristics and potential epigenetic regulation mechanisms in renal clear cell carcinoma Wenzhong Zheng1†, Shiqiang Zhang2† , Huan Guo3, Xiaobao Chen1, Zhangcheng Huang1, Shaoqin Jiang1 and Mengqiang Li1* Abstract Background: Tumor angiogenesis, an essential process for cancer proliferation and metastasis, has a critical role in prognostic of kidney renal clear cell carcinoma (KIRC), as well as a target in guiding treatment with antiangiogenic agents. However, tumor angiogenesis subtypes and potential epigenetic regulation mechanisms in KIRC patient remains poorly characterized. System evaluation of angiogenesis subtypes in KIRC patient might help to reveal the mechanisms of KIRC and develop more target treatments for patients. Method: Ten independent tumor angiogenesis signatures were obtained from molecular signatures database (MSigDB) and gene set variation analysis was performed to calculate the angiogenesis score in silico using the Cancer Genome Atlas (TCGA) KIRC dataset. Tumor angiogenesis subtypes in 539 TCGA-KIRC patients were identifed using consensus clustering analysis. The potential regulation mechanisms was studied using gene mutation, copy number variation, and diferential methylation analysis (DMA). The master transcription factors (MTF) that cause the diference in tumor angiogenesis signals were completed by transcription factor enrichment analysis. Results: The angiogenesis score of a prognosis related angiogenesis signature including 189 genes was signifcantly correlated with immune score, stroma score, hypoxia score, and vascular endothelial growth factor (VEGF) signal score in 539 TCGA KIRC patients. MMRN2, CLEC14A, ACVRL1, EFNB2, and TEK in candidate gene set showed highest correla- tion coefcient with angiogenesis score in TCGA-KIRC patients.
    [Show full text]
  • Downloadedfrommultiple from Poplar, and We Could Identify TF Clusters That Can Resources
    Nie et al. BMC Systems Biology 2011, 5:53 http://www.biomedcentral.com/1752-0509/5/53 METHODOLOGYARTICLE Open Access TF-Cluster: A pipeline for identifying functionally coordinated transcription factors via network decomposition of the shared coexpression connectivity matrix (SCCM) Jeff Nie1†, Ron Stewart1†, Hang Zhang6, James A Thomson1,2,3,9, Fang Ruan7, Xiaoqi Cui5 and Hairong Wei4,8* Abstract Background: Identifying the key transcription factors (TFs) controlling a biological process is the first step toward a better understanding of underpinning regulatory mechanisms. However, due to the involvement of a large number of genes and complex interactions in gene regulatory networks, identifying TFs involved in a biological process remains particularly difficult. The challenges include: (1) Most eukaryotic genomes encode thousands of TFs, which are organized in gene families of various sizes and in many cases with poor sequence conservation, making it difficult to recognize TFs for a biological process; (2) Transcription usually involves several hundred genes that generate a combination of intrinsic noise from upstream signaling networks and lead to fluctuations in transcription; (3) A TF can function in different cell types or developmental stages. Currently, the methods available for identifying TFs involved in biological processes are still very scarce, and the development of novel, more powerful methods is desperately needed. Results: We developed a computational pipeline called TF-Cluster for identifying functionally coordinated TFs
    [Show full text]
  • The Genetic Determinants of Cerebral Palsy
    The genetic determinants of cerebral palsy A thesis submitted for the degree of Doctor of Philosophy (PhD) to the University of Adelaide By Gai McMichael Supervisors: Professors Jozef Gecz and Eric Haan The University of Adelaide, Robinson Institute School of Medicine Faculty of Health Science May 2016 Statement of Declaration This work contains no material which has been accepted for the award of any other degree or diploma in any university or other tertiary institution and to the best of my knowledge and belief, contains no material previously published or written by another person, except where due reference has been made in the text. I give consent to this copy of my thesis, when deposited in the University Library, being available for loan and photocopying. Gai Lisette McMichael January 2016 i Table of contents Statement of declaration i Table of contents ii Acknowledgements ix Publications xi HUGO Gene Nomenclature gene symbol and gene name xiii Abbreviations xvi URLs xix Chapter 1 Introduction 1 1.1 Definition of cerebral palsy 2 1.2 Clinical classification of cerebral palsy 3 1.2.1 Gross motor function classification system 5 1.3 Neuroimaging 7 1.4 Incidence and economic cost of cerebral palsy 8 1.5 Known clinical risk factors for cerebral palsy 9 1.5.1 Preterm birth 9 1.5.2 Low birth weight 9 1.5.3 Multiple birth 10 1.5.4 Male gender 10 1.6 Other known clinical risk factors 11 1.6.1 Birth asphyxia 11 1.7 Other possible risk factors 12 1.8 Evidence for a genetic contribution to cerebral palsy causation 13 1.8.1 Sibling risks
    [Show full text]
  • Strong Binding Activity of Few Transcription Factors Is a Major Determinant of Open Chromatin
    bioRxiv preprint doi: https://doi.org/10.1101/204743; this version posted December 12, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Strong binding activity of few transcription factors is a major determinant of open chromatin Bei Wei1, Arttu Jolma1, Biswajyoti Sahu2, Lukas M. Orre3, Fan Zhong1, Fangjie Zhu1, Teemu Kivioja2, Inderpreet Kaur Sur1, Janne Lehtiö3, Minna Taipale1 and Jussi Taipale1,2,4* 1Division of Functional Genomics and Systems Biology, Department of Medical Biochemistry and Biophysics, and Department of Biosciences and Nutrition, Karolinska Institutet, SE 141 83, Stockholm, Sweden 2Genome-Scale Biology Program, P.O. Box 63, FI-00014 University of Helsinki, Finland 3Department of Oncology-Pathology, Science for Life Laboratory, Karolinska Institutet, SE 141 83, Stockholm, Sweden 4Department of Biochemistry, University of Cambridge, United Kingdom *To whom correspondence should be addressed. E-mail: [email protected] Abstract It is well established that transcription factors (TFs) play crucial roles in determining cell identity, and that a large fraction of all TFs are expressed in most cell types. In order to globally characterize activities of TFs in cells, we have developed a novel massively parallel protein activity assay, Active TF Identification (ATI) that measures DNA-binding activity of all TFs from any species or tissue type. In contrast to previous studies based on mRNA expression or protein abundance, we found that a set of TFs binding to only around ten distinct motifs display strong DNA-binding activity in any given cell or tissue type.
    [Show full text]
  • Dedifferentiation Orchestrated Through Remodeling of the Chromatin Landscape Defines PSEN1 Mutation-Induced Alzheimer’S Disease
    bioRxiv preprint doi: https://doi.org/10.1101/531202; this version posted January 29, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Dedifferentiation orchestrated through remodeling of the chromatin landscape defines PSEN1 mutation-induced Alzheimer’s Disease Andrew B. Caldwell1, Qing Liu2, Gary P. Schroth3, Rudolph E. Tanzi4, Douglas R. Galasko2, Shauna H. Yuan2, Steven L. Wagner2,5, & Shankar Subramaniam1,6,7,8* 1Department of Bioengineering, University of California, San Diego, La Jolla, California, USA. 2Department of Neurosciences, University of California, San Diego, La Jolla, California, USA. 3Illumina, Inc., San Diego, California, USA. 4Department of Neurology, Massachusetts General Hospital, Charlestown, Massachusetts, USA. 5VA San Diego Healthcare System, La Jolla, California, USA. 6Department of Cellular and Molecular Medicine, University of California, San Diego, La Jolla, California, USA. 7Department of Nanoengineering, University of California, San Diego, La Jolla, California, USA. 8Department of Computer Science and Engineering, University of California, San Diego, La Jolla, California, USA. Abstract Early-Onset Familial Alzheimer’s Disease (EOFAD) is a dominantly inherited neurodegenerative disorder elicited by mutations in the PSEN1, PSEN2, and APP genes1. Hallmark pathological changes and symptoms observed, namely the accumulation of misfolded Amyloid-β (Aβ) in plaques and Tau aggregates in neurofibrillary tangles associated with memory loss and cognitive decline, are understood to be temporally accelerated manifestations of the more common sporadic Late-Onset Alzheimer’s Disease. The complete penetrance of EOFAD-causing mutations has allowed for experimental models which have proven integral to the overall understanding of AD2.
    [Show full text]
  • Effect of Photoperiod on the Feline Adipose Transcriptome As Assessed by RNA Sequencing Akihiro Mori, Kelly L Kappen, Anna C Dilger and Kelly S Swanson*
    Mori et al. BMC Veterinary Research 2014, 10:146 http://www.biomedcentral.com/1746-6148/10/146 RESEARCH ARTICLE Open Access Effect of photoperiod on the feline adipose transcriptome as assessed by RNA sequencing Akihiro Mori, Kelly L Kappen, Anna C Dilger and Kelly S Swanson* Abstract Background: Photoperiod is known to cause physiological changes in seasonal mammals, including changes in body weight, physical activity, reproductive status, and adipose tissue gene expression in several species. The objective of this study was to determine the effects of day length on the adipose transcriptome of cats as assessed by RNA sequencing. Ten healthy adult neutered male domestic shorthair cats were used in a randomized crossover design study. During two 12-wk periods, cats were exposed to either short days (8 hr light:16 hr dark) or long days (16 hr light:8 hr dark). Cats were fed a commercial diet to maintain baseline body weight to avoid weight-related bias. Subcutaneous adipose biopsies were collected at wk 12 of each period for RNA isolation and sequencing. Results: A total of 578 million sequences (28.9 million/sample) were generated by Illumina sequencing. A total of 170 mRNA transcripts were differentially expressed between short day- and long day-housed cats. 89 annotated transcripts were up-regulated by short days, while 24 annotated transcripts were down-regulated by short days. Another 57 un-annotated transcripts were also different between groups. Adipose tissue of short day-housed cats had greater expression of genes involved with cell growth and differentiation (e.g., myostatin; frizzled-related protein), cell development and structure (e.g., cytokeratins), and protein processing and ubiquitination (e.g., kelch-like proteins).
    [Show full text]