3 Facilitating the Synthesis of Hepoxilin a 2 Regulates Mucosal Inflammation by Multidrug Resistance-Associated Transporter

The Journal of Immunology

Multidrug Resistance-Associated Transporter 2 Regulates Mucosal Inﬂammation by Facilitating the Synthesis of 1 Hepoxilin A3

Michael Pazos,* Dario Siccardi,*† Karen L. Mumy,*† Jeffrey D. Bien,* Steve Louie,* Hai Ning Shi,* Karsten Gronert,‡ Randall J. Mrsny,§¶ and Beth A. McCormick2*†

Neutrophil transmigration across mucosal surfaces contributes to dysfunction of epithelial barrier properties, a characteristic underlying many mucosal inﬂammatory diseases. Thus, insight into the directional movement of neutrophils across epithelial barriers will provide important information relating to the mechanisms of such inﬂammatory disorders. The eicosanoid hepoxilin

A3, an endogenous product of 12-lipoxygenase activity, is secreted from the apical surface of the epithelial barrier and establishes a chemotactic gradient to guide neutrophils from the submucosa across epithelia to the luminal site of an inflammatory stimulus, the final step in neutrophil recruitment. Currently, little is known regarding how hepoxilin A3 is secreted from the intestinal epithelium during an inflammatory insult. In this study, we reveal that hepoxilin A3 is a substrate for the apical efflux ATP-binding protein transporter multidrug resistance-associated protein 2 (MRP2). Moreover, using multiple in vitro and in vivo models, we show that induction of intestinal inflammation profoundly up-regulates apical expression of MRP2, and that interfering with hepoxilin A3 synthesis and/or inhibition of MRP2 function results in a marked reduction in inflammation and severity of disease. Lastly, examination of inflamed intestinal epithelia in human biopsies revealed up-regulation of MRP2. Thus, blocking hepoxilin

A3 synthesis and/or inhibiting MRP2 may lead to the development of new therapeutic strategies for the treatment of epithelial- associated inﬂammatory conditions. The Journal of Immunology, 2008, 181: 8044–8052.

ransmigration of polymorphonuclear neutrophils (PMNs)3 of PMN infiltration (see Refs. 8 and 12). An emerging concept across epithelial surfaces represents a shared phenom- over the past decade suggests an orchestrated movement of PMNs T enon among a diverse array of inflammatory mucosal from the bloodstream to luminal sites of inflammatory stimuli. For conditions. For example, salmonellosis, shigellosis, and pneu- example, in response to inflammatory stimuli within the intestinal monia, as well as autoimmune/idiopathic states such as Crohn’s lumen, IL-8, as well as other CXC chemokines, are secreted from disease, ulcerative colitis, bronchitis, chronic obstructive pul- the basolateral surface of enterocytes prompting PMN escape from monary disease, and oral diseases such as periodontitis all cul- the bloodstream and eventual accumulation within the submucosal minate in the destructive breach of the protective outer epithe- space (1). In concert, the potent PMN chemoattractant hepoxilin lium by activated PMNs. Furthermore, the severity and clinical A3 (HXA3) is secreted from the apical surface of the epithelial outcome of these inflammatory diseases correlate with the extent barrier where it establishes a chemotactic gradient to guide PMNs from the submucosa across the epithelium, a process constituting

the final step in PMN recruitment to the mucosal lumen (2). HXA3 *Department of Pediatric Gastroenterology and Nutrition, Massachusetts General is a hydroxyepoxide metabolite formed from the intermediate 12S- Hospital, Boston, MA 02129; †Department of Microbiology & Molecular Genetics, Harvard Medical School, Boston, MA 02115; ‡University of California, Berkeley, hydroperoxyeicosa-5Z,8Z,10E,14Z-tetraenoic acid (12S-HpETE), Center for Eye Disease and Development, School of Optometry, Berkeley, CA 94720; the main product of 12S-lipoxygenase (LOX) activity (3–5). He- §Department of Pharmacy & Pharmacology, University of Bath, Bath, United King- dom; and ¶Unity Pharmaceuticals, Menlo Park, CA 94025 poxilin synthase activity, responsible for the conversion of 12S- hydroxy-5Z, 8Z, 10Z, 14Z-eicosatetraenoic acid to HXA has been Received for publication August 14, 2008. Accepted for publication September 3 22, 2008. confirmed for human platelet 12-LOX, human epidermal LOX The costs of publication of this article were defrayed in part by the payment of page type 3, and murine and porcine 12/15-LOX (5, 6). Recently, a charges. This article must therefore be hereby marked advertisement in accordance critical role for HXA3 in PMN-mediated events in both intestinal with 18 U.S.C. Section 1734 solely to indicate this fact. and pulmonary inflammation has been demonstrated (2, 7–9). 1 This research was supported by National Institutes of Health Grants DK 56754 and DK 33506 (to B.A.M.), National Eye Institute Grant EY01613604 (to K.G.), and a To perform its specific function of drawing PMNs into a mu- T32 Training Grant sponsored by Harvard Medical School and the Department of cosal lumen, HXA3 must be secreted from the apical surface of Surgery at Massachusetts General Hospital (to K.L.M.). M.P. was supported by a epithelial cells, thereby establishing a concentration gradient National Institutes of Health Minority Supplement Award. across epithelial tight junctions to incite paracellular PMN move- 2 Address correspondence and reprint requests to Dr. Beth A. McCormick, Massa- chusetts General Hospital, CNY 114 16th Street (3503), Charlestown, MA 02129. ment. HXA3 performs this function as a pure chemoattractant that E-mail address: [email protected] does not induce neutrophil activation (10), leaving that event to 3 Abbreviations used in this paper: PMN, polymorphonuclear neutrophil; HXA3, he- occur in the presence of pathogens and other stimuli following poxilin; LOX, lipoxygenase; ABC, ATP-binding cassette; MRP, multidrug resistance- arrival at the epithelial luminal surface (2). Despite the critical associated protein; MDR, multidrug resistance; IBD, inflammatory bowel disease; siRNA, small interfering RNA; 12S-HpETE, hydroperoxyeicosa-5Z,8Z,10E,14Z-tetrae- nature of PMN transmigration in pathogen elimination and disease noic acid; 12-HETE, 12-Hydroxyeicosatetraenoic acid; LC/MS/MS, liquid chromatogra- pathophysiology, many of the details regarding the regulation of phy/mass spectrometry/mass spectrometry. PMN migration across mucosal surfaces remain undefined. Herein,

Copyright © 2008 by The American Association of Immunologists, Inc. 0022-1767/08/$2.00 we describe a mechanism for the vectored secretion of HXA3 from www.jimmunol.org The Journal of Immunology 8045 the apical surface of epithelial cells involving the ATP-binding MS)-based lipidomic analyses (9, 15). Extracted samples suspended in cassette (ABC) transporter multidrug resistance-associated protein methanol were analyzed by a triple quadruple linear ion trap LC/MS/MS 2 (MRP2). In general, the physiological role of ABC transporters system (MDS SCIEX 3200 QTRAP; Applied Biosystems) equipped with a LUNA C18–2 minibore column (Phenomenex) using a mobile phase covers a wide spectrum of functions varying from the transport of (methanol:water:acetate, 65:35:0.03, v/v/v) with a 0.35 ml/flow rate. excretory compounds and toxins to the elimination of xenobiotics MS/MS analyses were conducted in negative ion mode and fatty acids were (11). Our findings reveal a previously unappreciated role of MRP2 identified and quantified by the multiple reaction monitoring mode using 3 3 in meditating the inflammatory response as we demonstrate that specific transitions for HXA3 (335 27 m/z) and 12-HETE (319 179 m/z). Specific retention time for HXA3 and 12-HETE was established with inflammatory signals up-regulated MRP2 expression in association a synthetic standard (BIOMOL) and transition ions established by MS/MS with 12-LOX activity, a critical element in the synthesis of HXA3. analyses using enhanced product ion mode with appropriate selection of

Furthermore, our studies not only provide vital insight into the the parent ion in quadruple 1. Calibration curves (1–1000 pg) for HXA3, contribution of ABC transporters in the pathogenesis of inflam- 12-HETE, and PGB2 were established with synthetic standards. matory disorders of the gastrointestinal tract with respect to mech- Immunoprecipitation studies anisms underlying PMN recruitment but also identify novel targets for the treatment of epithelial-associated inflammatory conditions T84- or HCT-8-polarized monolayers were apically infected with either wild-type S. typhimurium (SL1344), EE633, or the bacterial negative con- such as inflammatory bowel disease (IBD). trol commensal isolate E. coli F-18 (12). Immunoprecipitation was performed using the Seize X Mammalian Immunoprecipitation Kit (Pierce) Materials and Methods according to the manufacturer’s instructions. The bead column was cross- Cell culture linked with 70 ␮g of goat anti-MRP2 polyclonal or goat anti-multidrug resistance (MDR) polyclonal Abs (Santa Cruz Biotechnology). Whole cell T84 intestinal epithelial cells (passages 40–58) were grown as previously de- lysates added to each column were normalized to 0.5 mg/column. Eluted scribed (12). For transport experiments, T84 cells were seeded at 250,000/cm2 protein was electrophoresed on a nondenaturing gradient SDS-PAGE gel on inverted polycarbonate membrane Transwell inserts (4.5-mm diameter) and (8–16% Tris-glycine; Cambrex Biosciences). Proteins were transferred us- cultured at 37°C, 90% relative humidity, and 5% CO2. HCT-8 (at passages ing a standard semidry transfer method onto nitrocellulose and probed with 30–40) were seeded on inverted Transwell inserts at a density of 40,000/cm2 MRP2 or MDR polyclonal Abs (1/500) overnight at 4°C followed by and cultured to days 7–10 postseeding for efflux experiments. The formation of washes and incubation with HRP-labeled donkey anti-goat Abs (1/1000; restrictive monolayers (at least 800 ohm ⅐ cm2) was monitored for all cell types Santa Cruz Biotechnology) for 1 h. Bands were detected using SuperSignal by measurement of transepithelial electrical resistance using an EVOM Vol- West Pico Chemiluminescent Substrate (Pierce). tometer (World Precision Instruments). Streptomycin model of acute inflammation Growth of bacteria for assays using cell culture inserts Based on a modification of Barthel et al. (16), female C57BL/6 mice, 6–8 Nonagitated microaerophilic bacterial cultures were prepared as previously wk old (The Jackson Laboratory) were orally treated with 75 ␮l of strep- described (12). Salmonella enterica serotype Typhimurium (S. typhi- tomycin sulfate (stock 50 mg/ml; Sigma-Aldrich) in sterile distilled water murium) SL1344 (wild type), EE633 (sipAϪ), AvrAϪ, VV341 (hilAϪ)as following a 4-h starvation period of both food and water. After 24 h, the well as Escherichia coli F-18 were used in this study and have previously mice were starved for 4 h and orally gavaged with 5 ϫ 108 CFU of the been described (12, 13). appropriate bacterial strain in 500 ␮l of sterile HBSS, monitored for 48 h, and sacrificed. PMN transepithelial migration Human intestinal biopsy material The PMN transmigration assay using inverted cell culture monolayers of polarized cells has been described previously (12). The diagnosis of IBD was based on clinical, endoscopic, and histological criteria, and infectious colitis was ruled out by stool cultures. The collec- ABC transport inhibitors tion of samples was approved by the Institutional Review Board at the University of Chicago. Intestinal biopsy specimens were obtained from For experiments involving ABC transport inhibitors, epithelial cells were four ulcerative colitis and four Crohn’s disease patients during routine pretreated for 1 h with either cyclosporin A (10–1000 nM), verapamil endoscopy upon informed consent. Control colonic biopsy specimens were (0.1–10000 nM), probenecid (10–100 ␮M), or MK571 (50–100 ␮M). Fol- ϩ obtained from age- and sex-matched individuals undergoing surgery for lowing pretreatment, the drug was removed by washing with HBSS con- ϩ ϩ cancer resection. taining Mg2 ,Ca2 , and 10 mM HEPES (HBSS; pH 7.4) before infecting polarized T84 monolayers at the apical surface with wild-type S. typhi- Slide preparation and hematoxylin staining murium SL1344. Murine intestinal sections were harvested from the proximal colon of mice at Collection and identification of HXA3 and necropsy. Human tissue was obtained from inflamed or noninflamed biopsy 12-Hydroxyeicosatetraenoic acid (12-HETE) samples of matched patient samples acquired through the Department of Pa- thology at the University of Chicago as a generous gift from Dr. J. R. Turner. Method 1. The apical surface of polarized T84 cell monolayers was infected All tissues were imbedded in Tissue-Tek OCT compound (Sakura Finetek with S. typhimurium SL1344 or EE633 as previously described (2, 10). Sub- USA), flash frozen in liquid nitrogen, and sectioned (5-␮m thickness) on a sequent HXA3 identification was conducted according to the protocol de- 2800 Frigocut cryostat (Reichert-Jung). Hematoxylin and Eosin Y staining and scribed by Mrsny et al. (2). This method was used to obtain the data (see Fig. scoring were performed as previously documented (17). 3C). Method 2. T84 or HCT-8 monolayers grown on 4.5-cm2 Transwells were Immunohistochemistry drained of medium and washed with warm HBSSϩ before infection with S. Murine and human colon sections were fixed in cold acetone (Ϫ20°C) for typhimurium (multiplicity of infection, 100:1) for1hat37°C. The bacteria ϩ ϩ 10 min and air dried for 5 min. Blocked sections were incubated at 4°C were washed away with warm HBSS and 750 ␮l of HBSS was added ϩ overnight in goat anti-MRP2 polyclonal Ab (Santa Cruz Biotechnology) to the apical surface, with 2 ml of HBSS in the basolateral chamber. The diluted 1/750 or 1/250 in TBS for mouse and human tissue, respectively. Transwells were incubated at 37°C and the buffer in the apical compart- Sections were washed in TBS, followed by a 1-h incubation with FITC- ment was collected every 2 h and replenished with the same volume of ϩ conjugated donkey anti-goat Ab (Santa Cruz Biotechnology) diluted fresh HBSS . Collected buffer was pooled and stored on ice in the dark. 1/1000 and 1/250 in TBS for mouse and human sections, respectively. After 6 h (three collections), all pooled samples received 0.5 ng of PGB 2 Sections were mounted with1 M Tris-HCl (pH 8.0)/Vectashield (Vector (Cayman Chemical) as an internal standard and was brought to a pH of 3–4 Laboratories) mixture (1:1) and analyzed by immunofluorescent micros- with HCl before extraction. Samples were extracted by solid phase as pre- copy at ϫ20 oil magnification (Nikon Eclipse TE-2000S). viously described (14). Samples were eluted in 5 ml of methanol, concen- trated under nitrogen and resuspended in 100 ␮l of methanol. Samples Determination of MRP2 activity in Sf9 cells were stored at Ϫ80°C until analyzed.

HXA3 (8-hydroxy-11,12-epoxy-eicosatetraenoic acid) was identiﬁed by This assay was performed according to the manufacturer’s instructions liquid chromatography/mass spectrometry/mass spectrometry (LC/MS/ using membrane product SB-MRP2-SF9-ATPase (Solvo Biotechnology). 8046 MRP2 AND MUCOSAL INFLAMMATION

o ATPase activity of the substrates probenecid (1 mM; BIOMOL) and HXA3 48hat37C. Subsequently, S. typhimurium SL1344 was added to the (1, 10, 100 ␮M; BIOMOL) was measured with respect to baseline activity. apical surface of the T84 monolayers for1hat37oC and the cells were then washed free of nonadherent bacteria and processed for the PMN transmi- MRP2 functional studies gration assay. For 5-LOX inhibition, the T84 cells were incubated for 24 h in the presence of caffeic acid (stock concentration at 22 mM in DMSO). Cells were treated with 10 ␮M 5-chloromethylfluorescein diacetate Both inhibitors were purchased form BIOMOL. (CMFDA; Molecular Probes) for1htoallow uptake and intracellular conversion to the fluorescent MRP substrate 5-chloromethylfluorescein (CMF) Statistical analysis (18). CMF, actively transported by MRPs as the glutathione conjugate glutathione-methylfluorescein (GS-MF), was detected by measuring the PMN isolation was limited to repetitive donations by 10 different donors appearance of fluorescence in the bathing solutions (excitation 495 nm and over the course of these experiments. Due to variation in both PMNs and emission 535 nm; LS-5 spectrofluorometer; PerkinElmer Life and Analyt- transepithelial resistance between monolayers (baseline resistance of ical Sciences). ϳ1500 ohm ⅐ cm2), data were analyzed within an individual experiment Permeability studies were conducted with T84 monolayers incubated in and not between experiments. All results are expressed as the mean Ϯ SD HBSS and used [3H]mannitol (0.088 ␮M, 0.147 MBq) as a control probe of an individual experiment performed in triplicate. Values of p values for low permeability paracellular transport. Radioactivity was determined were calculated according to Student’s t test and values Ͻ0.05 were con- by liquid scintillation counting, and coefficients of permeability for probe sidered statistically significant. molecules were similar to those found in the literature for viable monolayers (19). Transport experiments in the apical to basal (A3B) direction Results were initiated by adding 200 ␮l of the drug solution (CMFDA) to the donor chamber. Transport experiments in the basal to apical (B3A) direction Blockade of MRP2 function inhibits PMN transepithelial were initiated by adding 1 ml of CMFDA to the basal chamber. At pre- migration determined times over the course of the experiment, 100-␮l samples were taken from the respective chamber and replaced with fresh HBSS. Trans- Elucidation of mechanisms governing HXA3 synthesis and apical port studies conducted in the presence of the MRP inhibitor MK571 (100 secretion could provide novel therapeutic strategies to impede ␮M with 0.2% DMSO) were conducted as above. The cumulative mass and/or limit neutrophil involvement in deleterious events at epi- of the drug transported from donor to receiver chambers was assessed over thelia associated with a number of chronic inflammatory condi- the time course of the experiment (dM/dt) using linear regression analysis. ϭ ⅐ ⅐ tions. HXA3 must be secreted from the apical surface of epithelial The following equation was used to fit the data: dM/dt p A C0, where p is the permeability coefficient (cm/s), A is the surface area of the Transwell cells to establish a chemotactic gradient across tight junction com- 2 membrane (0.333 cm ), and C0 the initial drug concentration in the donor plexes to incite the paracellular movement of PMNs (2). Given the 3 chamber (nmol/cm ). In all experiments, the amount of drug transported structural characteristics of HXA3 and its strict apical secretion from donor to receiver was Յ5% of the donor drug mass, ensuring the requirement, we considered the involvement of ABC transporters validity of C0 as a constant in the equation. as potential substrates for HXA3. P-gp and MRP2 were promising Generation of small interfering RNA (siRNA) for suppression candidates due to their localization on apical membranes of en- of MRP2 and P-gp expression terocytes (25–27). In vitro treatment of polarized human intestinal Plasmids used to generate siRNAs were constructed with the pSUPER vector epithelial cell monolayers (T84) with inhibitors of either P-gp (cy- (Oligoengine) using the method described by Brummelkamp et al. (20). closporin A and verapamil) or MRP2 (probenecid and MK571) Briefly, two oligonucleotides were designed incorporating a 19-nt sequence demonstrated a progressive, dose-dependent decrease in the ability from each target transcript (shown in italics) or its reverse compliment sepa- of pathogenic S. enterica Typhimurium (S. typhimurium) to induce rated by a short spacer region and a portion of the BglII or HindIII restriction HXA -mediated PMN transepithelial migration (Fig. 1). More- sites. Oligonucleotides specific for the human gene MDR1 encoding P-gp and 3 a random control sequence were described previously (21). Oligonucleotides over, at the maximal doses tested, none of these drugs had an effect for the human gene encoding MRP2 (GenBank accession no. NM_000392) on PMN migration induced by imposed gradients of fMLP nor did were: 5Ј-GATCCCCGTATCAGGTTTGCCAGTTATTCAAGAGATAACTG they affect S. typhimurium internalization by T84 cell monolayers GCAAACCTGATACTTTTTGGAAA-3Ј and 5Ј-AGCTTTTCCAAAAAGTA (data not shown). These results suggest that inhibitors of ABC TCAGGTTTGCCAGTTATCTCTTGAATAACTGGCAAACCTGATACGG G-3Ј. After annealing, dsDNAs had overhanging restriction sites and were transporters known to localize to the apical surface of intestinal ligated into digested pSUPER and transformed into competent E. coli DH5␣ epithelial cells block the recruitment of PMNs across epithelial cell by standard methods and plated on Luria-Bertani with ampicillin (50 ␮g/ml). monolayers induced by an inflammatory stimulus driven by Plasmids were extracted, purified (QIAprep Spin Miniprep Kit; Qiagen) and HXA3; in this case, apical infection with the enteric pathogenic S. sequenced for confirmation. Once confirmed, bulk plasmid was prepared for typhimurium. transfection using a Qiagen Plasmid Midi Kit. Plasmids were transfected into HCT-8 intestinal epithelial cells using Lipofectamine 2000 (Invitrogen) as de- ABC transporter inhibitors are known to be poorly selective scribed previously (21). (28). To better define the relative roles played by P-gp and MRP2 in PMN transmigration, polarized epithelial cell monolayers were Cd45 CD45RB high IBD model transfected with plasmids generating siRNA for one of each of BALB/c mice and C.B-17scid/scid (SCID) mice (6–8 wk old) were pur- these two transporters. Decreased expression of MRP2 signifi- chased from The Jackson Laboratory (BALB/c) and Massachusetts Gen- cantly attenuated (Ͼ80% inhibition) S. typhimurium-induced eral Hospital (SCID). Colitis was induced in SCID mice by adoptive transfer of CD4ϩCD45RBhigh T cells isolated from splenic cells of BALB/c transepithelial PMN migration while monolayers generating mice as described previously (22–24). Briefly, CD4ϩ T cells were enriched siRNA specific for MDR1 (encoding P-gp) showed PMN transmi- from the spleens of BALB/c mice using anti-CD4 (L3T4) a MACS mag- gration in response to S. typhimurium infection equivalent to con- netic separation system (Miltenyi Biotec) according to the manufacturer’s ϩ trol monolayers (Fig. 2a). Importantly, neither siRNA indirectly instruction. Enriched CD4 T cells were then labeled with CyChrome- affected the ability of PMN to transmigrate as PMN migration in conjugated anti-mouse CD4 mAb (BD Pharmingen) and PE-conjugated anti-CD45RB mAb (BD Pharmingen) and then sorted into a CD45RBhigh response to an imposed fMLP gradient was similar under all con- (highest staining 30%) fraction; sorting was performed with Mo-Flo (Dako- ditions (Fig. 2a). Modulation of MRP2 and P-gp expression by Cytomation). Each SCID mouse was injected i.v. with 200 ␮lofPBS siRNA was verified by immunoblot analysis (Fig. 2b). Densito- 5 ϩ high containing 5 ϫ 10 CD4 CD45RB T cells. Mice were weighed and metric analysis showed a 75% decrease in MRP2 with siRNA in S. monitored for appearance and signs of soft stool and diarrhea daily during the experimental period. typhimurium-infected cells and a complete loss for P-gp (data not shown). Inhibition of transepithelial PMN migration induced by S. LOX inhibitors typhimurium was consistent with the extent of protein reduction For 12/15-LOX inhibition, T84 cell monolayers were incubated in the pres- for MRP2 but not for P-gp (Fig. 2, a and b), suggesting that MRP2, ence of baicalein (stock concentration at 1 mM in DMSO) in medium for and not P-gp, is involved in PMN transepithelial migration. The Journal of Immunology 8047

FIGURE 1. The effect of P-gp (MDR1) and MRP2 inhibitors on the ability of S. typhimurium to induce PMN transepithelial migration. T84 cell monolayers were treated for 1 h with the P-gp inhibitors (cyclosporin A (10–1000 nM); a) or verapamil (0.1–10000 nM; b) or the MRP2 inhibitors (probenecid (10–100 ␮M); c) or MK571 (50–100 ␮M; d). The pretreated monolayers were then infected at the apical surface with wild-type S. typhimurium SL1344 and judged for their ability to induce PMN transepithelial migration (see Materials and Methods). f, S. typhimurium-induced PMN transepithelial migration; Ⅺ, PMN migration to imposed gradients of fMLP. Data are expressed as the mean and SD of triplicate samples. This experiment is p Ͻ ,ء .representative of more than three performed 0.01.

During inflammatory events MRP2 is functionally active and is rectional efflux of the MRP substrate CMFDA from polarized ep- a substrate for HXA3 ithelial cell monolayers was studied (Fig. 2c). CMFDA passively In polarized epithelial cells, the majority of MRP transporters lo- diffuses into cells where upon hydrolysis of the acetate moieties by calize to the basolateral membrane (18, 27). To examine functional cytosolic esterases it becomes the fluorescent MRP substrate CMF; MRP2 transporter expression related to inflammatory events, di- CMF is actively transported by MRPs as the glutathione conjugate

FIGURE 2. Demonstration of the functional importance of the apical ABC transporter MRP2 during PMN transepithelial migration and as a substrate for HXA3. a, Polarized intestinal cell monolayers silenced for the expression of MRP2 or P-gp (MDR1) were assessed for the ability to promote S. typhimurium-induced PMN transepithelial migration. Data are represented as mean Ϯ SD of triplicate samples and are representative of three experiments; p Ͻ 0.01. b, Immunoblot analysis of the modulation in protein expression of MRP2 and P-gp (MDR1) based on siRNA as described in Materials and ,ء Method. Results are representative of three independent experiments. c, MRP2 functional activity was assessed by measuring GS-MF efﬂux from polarized monolayers of T84 infected in the absence and presence of S. typhimurium. T84 cell monolayers were infected apically for 1 h with either SL1344 (wild-type S. typhimurium) or VV341 (an isogenic derivative of SL1344 which lacks the hilA gene and is invasion deﬁcient). Control represents baseline transport in the presence of physiological buffer (HBSS). A3B represents transport in the apical to basolateral direction; B3A represents transport in the basolateral to apical direction; MK571 is an MRP2 inhibitor (100 ␮M containing 2% DMSO). Data are expressed as mean Ϯ SD of triplicate samples and are Ͻ ء representative of at least three independent experiments; , p 0.01. d, Inorganic phosphate yielded by hydrolysis of ATP used by the substrate HXA3 is represented as percentage of the baseline response. Inorganic phosphate was measured as (nmol/mg/protein per min) and baseline values were determined .p Ͻ 0.05 ,ء ;to be 1.6 Ϯ 0.15. Bars represent the mean Ϯ SD of triplicate determinations representative of at least three independent experiments 8048 MRP2 AND MUCOSAL INFLAMMATION

FIGURE 3. MRP2 is up-regulated by an inflammatory pathway activated by S. typhimurium that involves a SipA-dependent-mechanism. a, T84 cells were infected apically with SL1344 for 1 h, then lysed, and enriched for the Triton X-100-insoluble membrane fraction as described in Materials and Methods. Incubation with the physiological buffer HBSS served as the baseline control for MRP2 expression. Twenty-five micrograms of protein was separated on a 10% PAGE gel and immunoblotted for MRP2. b, To determine specificity of the response (i) T84 cell monolayers were apically infected with SL1344, the isogenic SipA mutant strain (EE633), and a normal intestinal human flora E. coli isolate, E. coli F-18, or left uninfected in the presence of HBSS (Ϫ) control). (ii) T84 cells were infected apically for1hinthepresence of either SL1344 or its isogenic AvrA (S. typhimurium effector protein) mutant strain. Ϫ, The baseline buffer control. (iii) T84 cell monolayers were apically infected for1hinthepresence of SL1344, EE633, or the sipA-complemented strain AJK63. This strain is derived from EE633 containing the pAK68C plasmid that encodes sipA. Ϫ, The baseline buffer control. For each immunoblot, after bacterial infection the cells were lysed and then enriched for the Triton X-100-insoluble membrane fraction. Twenty-five micrograms of protein was separated on 10% PAGE gels and immunoblotted for MRP2. The data represent a single experiment and are repetitive of at least three experiments performed. c, SipA affects the release of HXA3 from model intestinal epithelia. Monolayers of T84 epithelial cells were infected for 1 h with the SL1344 or EE633 S. typhimurium strain. PMN transepithelial cell migration (left) and HXA3 secretion (right) were measured. HXA3 was identified according to Method 1 as described in Methods and Materials. Data are presented as the mean Ϯ SD of assays performed in triplicate and are .p Ͻ 0.01 ,ء ;representative of three independent experiments

GS-MF. In the baseline state, T84 cell monolayers have an ϳ25- Expression of MRP2 is up-regulated in acute and chronic fold higher permeability coefficient in the apical to basolateral models of intestinal inflammation 3 3 Ϯ (A B) direction relative to the B A direction (20.3 1.04, and Previous studies have shown that the S. typhimurium effector pro- Ϯ ϫ Ϫ6 0.8 0.03 10 cm/s, respectively). This relationship favors an tein SipA is required for the ability of S. typhimurium to induce 3 overall basolateral secretion, or A B transport, of GS-MF. Inter- PMN transepithelial migration (13, 16, 33). We examined the role estingly, T84 monolayers infected at their apical surface with wild- of virulence factors, such as SipA, to incite functional expression 3 3 type S. typhimurium decreased the A B:B A permeability co- of MRP2 by comparing MRP2 expression levels following infec- efficient ratio to 1.8, with an 89% reduction of probe movement in tion with either wild-type S. typhimurium (SL1344) or the isogenic 3 the A B direction, suggesting activation of an apical efflux path- SipA mutant strain (EE633). Our results show that S. typhimurium way. Addition of the MRP2 inhibitor MK571 to T84 monolayers stimulated MRP2 expression in a SipA-dependent manner (Fig. 3, 3 infected with wild-type S. typhimurium restored the A B trans- a and b); P-gp levels were not affected by S. typhimurium infection port of GS-MF to 43% compared with controls with no effect on during a 1-h infection (Fig. 3a). To control for specificity of SipA, transport in the opposite direction. As a negative control, non- we performed this assay using a commensal E. coli strain lacking pathogenic S. typhimurium (VV341) only modestly reduced SipA (F-18) as well as an isogenic strain of S. typhimurium mu- GS-MF transport (15%; p Ͻ 0.05). In contrast, P-gp functional tated for an alternative effector protein, AvrA, that retains SipA activity was not increased during S. typhimurium infection (21). expression. As anticipated, the AvrA mutant induces MRP2 ex- The above results indicate that inflammatory events can enhance pression (Fig. 3b), whereas E. coli F-18 fails to do so. Moreover, apical MRP2-specific efflux activity. We next sought to determine complementing with a sipA-expressing plasmid (AJK63) restores whether HXA3 serves as a substrate for MRP2. Interestingly, the ability of the SipA mutant (EE633) to induce MRP2 protein MRP2 exhibits preference for negatively charged, hydrophobic expression (Fig. 3b). Thus, under these conditions S. typhimurium molecules such as the eicosanoid cysteinyl leukotriene (29–32). infection of T84 cell monolayers modulates MRP2 expression with HXA3 shares these characteristics at neutral pH, suggesting it fits no effect on P-gp expression. the profile of an MRP2 substrate. Since ABC transporters hydro- Using SipA as a prototypical virulence element, we could also lyze ATP during active substrate transport, the ATPase activity of show its involvement in the release of HXA3 since wild-type S. purified inside-out membrane vesicles isolated from Spodoptera typhimurium elicited significantly more HXA3 release from T84 frugiperda (Sf9) cells expressing the MRP2 transporter were ex- cell monolayers compared with the SipA mutant (EE633), and this amined following HXA3 addition. MRP2-containing membrane was correlated, respectively, with the ability to facilitate PMN mi- vesicles exhibited a dose-dependent increase in ATPase activity in gration (Materials and Methods: Method 1) (Fig. 3c). These results the presence of HXA3 (Fig. 2d). Addition of the MRP2 substrate suggest that induction of intestinal inflammatory events, in this inhibitor probenecid was used as a positive control to depict max- case SipA-mediated induction of HXA3 release, stimulates MRP2 imal ATPase activity. Such data provide direct evidence that expression to provide a potential apical secretion mechanism for

HXA3 can be a substrate for MRP2. HXA3. Furthermore, since 12-HETE is a biomarker for the HXA3 The Journal of Immunology 8049

FIGURE 4. MRP2 expression is modulated during active states of intestinal inflammation. a–c, Histopathology of the proximal large colon of mice following a 48-h infection with physiological buffer (HBSS; a), SL1344 (b), and EE633 (c). Sections are stained with H&E and represent a magnification of ϫ20. d–f, Immunohistochemistry of the expression pattern of MRP2 in the proximal large colon performed on the same set of mice described for a–c. d–f, Represent buffer control, SL1344-, and EE633-infected mice, respectively; original magnification, ϫ10. The enhanced boxed image in e illustrates the apical expression of MRP2 as denoted by the green arrows. g and h, Gross examination of the anal region in mice induced to exhibit characteristics of IBD using the CD4ϩCD45RBhigh T cell adoptive transfer model. Following induction of disease. the mice generally exhibit significant rectal prolapse. i, Gross examination of the diseased mice (CD4ϩCD45RBhigh T cell adoptive transfer model) following a therapeutic intervention strategy using the 12/15-LOX inhibitor baicalein. j–l. H&E- stained proximal colonic sections of mice not induced for IBD (j), mice induced for IBD (k), and mice induced for disease and then therapeutically treated with baicalein (l); original magnification, ϫ20. m, PMN infiltration into the proximal colon quantified by tissue myelo- peroxidase (MPO). Data are expressed as the mean Ϯ SD and represent groups of five mice per data set and the experiment was performed three times with similar results.

biosynthetic pathway and is easily detected by LC/MS/MS, we mouse leukocyte-type 12/15- LOX Ab, an earlier study by Shan- next measured the amount of 12-HETE released from intestinal non et al. (34) recognized a fundamental change in the pattern of epithelial cells displaying reduced levels of MRP2 (via siRNA) 12/15-LOX expression in colonic tissue during the onset of IBD; during an infection with S. typhimurium. We found that the inhi- inﬂamed colonic tissue expressed increased levels of 12-LOX with bition of 12-HETE from infected epithelial cells with reduced lev- a corresponding increase in 12-LOX activity relative to healthy els of MRP2 was at least 20% (n ϭ 2) compared with infected colonic tissue. However, there are four enzymes known to possess siRNA vector control monolayers. Similarly, 12-HETE release by signiﬁcant 12-LOX activity in humans: platelet-type 12-LOX S. typhimurium-infected was also profoundly inhibited by pharma- (ALOX12), 12(R)-LOX (ALOX12B), epidermis-type LOX cological treatment with a MRP2 inhibitor (MK571 100 ␮M; data (ALOXE3), and 15-LOX type 1 (ALOX15) (35–38). 15-LOX type not shown). To further substantiate a link between MRP2 and the 1 is the human homolog of murine leukocyte-type 12/15-LOX

hepoxilin biosynthetic pathway, we found that HXA3 release (39), and we have previously shown that PMN transepithelial mi- (measured by Method 2 in Methods and Materials) by infected gration in response to infection with S. typhimurium is dependent T84 cells or HCT-8 cells was inhibited 55–90% (n ϭ 2) by the on 12/15-LOX activity (2, 9). Formation of 12-HpETE by these ␮ MRP2 inhibitor probenecid (100 M). LOXs is the first step for the formation of HXA3 (40). We next determined whether MRP2 expression is modulated To delineate the in vivo relevance of the above findings during during an infection with S. typhimurium in vivo (16). Mice in- chronic states of inflammation, we sought to determine whether fected with wild-type S. typhimurium exhibited severe intestinal 12-LOX inhibition blocks inflammatory outcomes associated with pathology characterized by a predominant PMN cellular infiltrate an IBD model induced by transfer of CD4ϩCD45RBhigh T cells and extensive tissue damage, whereas mice infected with the SipA (41, 42). The CD4ϩCD45RBhigh T cell transfer model of IBD is mutant demonstrated only a slight level of intestinal inflammation well characterized, has a requirement for intestinal microorgan- (Fig. 4, a–c). Apical localization of the ABC transporter MRP2 isms, and involves the full spectrum of the immunoinflammatory was uniformly increased at the villus tips during the acute phase of cascade, including the infiltration of PMN to the intestinal mucosa. intestinal inflammation (Fig. 4, d–f), confirming MRP2 up-regula- Following disease induction, inhibition of the 12/15-LOX activity tion by pathogenic S. typhimurium. In contrast, P-gp was not up- (baicalein administration by i.p. injection every other day for 17 regulated (data not shown and Ref. 21). Collectively, these data are days) resulted in complete resolution of gross morphological consistent with our in vitro findings suggesting MRP2 may play a changes, including rectal prolapse (Fig. 4, g–i). This improvement role in acute salmonellosis. was consistent with histopathology results (Fig. 4, j–l). As shown Although chronic inflammatory diseases have been correlated in Table I, quantification of these findings revealed that colons with excessive PMN recruitment and destruction of protective ep- from PBS-treated (control) mice exhibited mucosal erosion, ithelial barriers, many aspects of events that initiate and perpetuate mucosal wall thickening, and moderate crypt abcessation with an PMN transmigration are poorly understood. However, using a accompanying inflammatory infiltrate. In contrast, the degree of 8050 MRP2 AND MUCOSAL INFLAMMATION

Table I. Quantification of intestinal inflammation We next posed the question of whether the 12/15-LOX activity and MRP2 expression might be coordinated as a regulated element Cellular Tissue Total Inflammation of response to an inflammatory signal. In the presence of the 12/ a a b Infiltration Damage Score 15-LOX inhibitor baicalein, S. typhimurium-infected monolayers Normal control 0.25 Ϯ 0.11 0.18 Ϯ 0.05 0.43 Ϯ 0.17 in vitro showed significantly lower levels of MRP2 than those Untreated 3 Ϯ 0.81 2.75 Ϯ 0.85 5.75 Ϯ 1.50 induced by this pathogen in the absence of the inhibitor (Fig. 5a). 12-LOX inhibitor 1 Ϯ 0.10 1.5 Ϯ 0.70 2.5 Ϯ 0.70 Similar treatment with caffeic acid, a 5-LOX inhibitor, failed to Quantification of the severity of intestinal inflammation in mice treated in the affect enhanced MRP2 expression induced by S. typhimurium in- absence and presence of the 12/15-LOX inhibitor baicalein. fection (data not shown). Examination of intestinal tissues from a Disease scores of colonic inflammation are assessed by determination of infil- high tration of inflammatory cells (range, 0–4) along with the evaluation of colonic dam- CD45RB T cell transfer mice revealed that therapeutic inter- age, including edema (range, 0–4). vention with baicalein reduced apical membrane MRP2 expression b The combined score represents the total inflammatory score (maximum ϭ 8). (Fig. 5b), suggesting a link between the regulation of 12/15-LOX Five animals were used per experimental treatment condition and the experiment was performed three times. activity and MRP2 expression during both acute and chronic inflammatory events. Taken together, these results imply that the 12/15-LOX pathway is required for maximal induction of MRP2 colonic inflammation in the baicalein-treated cohort was signifi- expression associated with epithelial inflammation. cantly decreased and the neutrophilic infiltrate returned to control To determine the in vivo relevancy of the above findings with levels following baicalein treatment (Fig. 4m). These results dem- respect to nonpathogen-induced human disease, we assessed onstrate that the severity of mucosal inflammation induced in the whether MRP2 is up-regulated in patients with IBD. Indeed, as CD4ϩCD45RBhigh T cell transfer model of IBD was significantly shown in Fig. 5c, we provide direct evidence demonstrating that attenuated by the 12/15-LOX inhibitor baicalein, which acts to intestinal biopsy specimens obtained from IBD patients with either active Crohn’s disease or ulcerative colitis exhibit marked MRP2 prevent the synthesis of HXA3. We were not able to perform similar experiments using either one of the MRP2-selective inhibitors up-regulation at the intestinal epithelial apical surface compared since injection or oral delivery did not result in topical delivery to with healthy intestinal segments. One hundred percent of the ul- the colon, the required site of action. cerative colitis patients (four of four) and 50% of the Crohn’s disease patients (two of four) examined in this study demonstrated an up-regulation of MRP2. None of the age- and sex-matched control biopsies showed any increase above baseline levels (Fig. 5c).

Discussion Given that migration of PMNs across mucosal surfaces contributes to epithelial cell dysfunction in a host of mucosal diseases (2, 7, 8, 12), the data provided here not only identify a new mechanism

underlying the vectored release of HXA3 but also reveal interfer-

ence with HXA3 synthesis or apical secretion from epithelial cells as novel therapeutic strategies for the treatment of mucosal inflammatory disorders such as IBD. We used S. typhimurium as a tool to induce an acute intestinal inflammatory response and found that during active states of intestinal inflammation apical expression of the efflux transporter MRP2 is profoundly up-regulated, function-

ally active, and capable of using HXA3 as a substrate. The molecular basis of this observation is consistent with the role of the S. typhimurium type III-secreted product SipA, as this effector protein has been found to be both necessary and sufficient for induction of PMN transepithelial migration across model intestinal ep- FIGURE 5. 12/15-LOX activity and the expression of MRP2 are linked ithelia (13). In keeping with its role as a virulence factor, our data events in response to active states of intestinal inflammation. a, Immuno- now reveal that SipA mediates PMN transepithelial migration by blot analysis of MRP2 expression during apical infection of SL1344 in the directly affecting the release of HXA via modulation of MRP2 absence and presence of the 12-LOX inhibitor baicalein, as described in 3 Materials and Methods. For each sample, 25 ␮g of protein was isolated expression. Thus, identification of the molecular mechanism by from the membrane fraction and run on a 10% PAGE gel and immuno- which SipA activates PMN transepithelial migration through blotted for MRP2. The data represent a single experiment and are repetitive MRP2 defines a novel proinflammatory signaling cascade essential of at least three experiments performed. b, Immunohistochemistry depict- for the pathogenesis of S. typhimurium that likely represents a ing the localization of MRP2 to the apical epithelial surface of the proximal paradigm of mucosal pathogen-elicited events. colon in mice treated in the absence and presence of 12/15-LOX inhibition Insights into pathogen-elicited active inflammation of the intes- ϩ using the CD4 CD45RBhigh T cell adoptive transfer model of IBD: i rep- tine may provide important information relating to mechanisms of resents the healthy control that did not undergo the adoptive transfer of the disorders underlying IBD, which appear to be unrelated to patho- ϩ high CD4 CD45RB T cells; ii represents mice induced for IBD; and iii gen colonization (43). Therefore, we hypothesize that although represents mice induced for IBD and then therapeutically treated with ba- evolution of such responses most likely targeted pathogens such as icalein; original magnification, ϫ10. c, Human intestinal biopsy specimens stained for MRP2: i, healthy colonic section; ii, colonic section from a S. typhimurium, aberrant activation of such pathways may lead to patient with active Crohn’s disease; and iii, colonic section from a patient induction of mucosal inflammation associated with some chronic with active ulcerative colitis; original magnification, ϫ20. Data represent a diseases of the intestine and airway. Consistent with this notion, single experiment that is representative of eight patient colonic biopsy we found a profound up-regulation of MRP2 at the apical surface specimens examined (four each for Crohn’s and ulcerative colitis patients). of the colonic epithelium in murine models of chronic intestinal The Journal of Immunology 8051 inflammation as well as in intestinal biopsies from patients pre- nism than MRP2. Consistent with this observation, we have re- senting with active Crohn’s disease and ulcerative colitis. Under cently determined that prolonged apical colonization of intestinal normal healthy conditions, the most abundant constitutive expres- epithelial cells by wild-type S. typhimurium (ϳ4 h) leads not only sion of human and rat MRP2/MRP2 mRNA is found in the renal to a profound functional decrease in P-gp but that the presence of proximal tubule brush border membrane and the hepatocyte can- P-gp adversely influences the ability of S. typhimurium to invade alicular membrane (44). Significantly lower levels of MRP2 have host cells (21). These results demonstrate that MRP2 and P-gp can been found in the small intestine, with exclusive localization at the be differentially regulated within the same tissue during a disease apical brush border membrane of villi (44). Furthermore, MRP2 process. This observation supports the finding that during the pro- expression decreases in intensity from the villus tip to the crypts, gression of chronic renal failure MRP2 is up-regulated in both the where no expression has been observed (44). At this location, kidney and liver, whereas P-gp remains unaffected (49). MRP2 is thought to play an important role in drug disposition. We In summary, we are beginning to understand how the PMN che- now describe an unanticipated function of MRP2 as it is uniformly moattractant HXA3 is secreted in a vectoral fashion through a up-regulated at the villus tips of the apical surface of epithelial unique efflux transport system located at the apical surface of the cells during active states of inflammation and plays a pivotal role intestinal epithelium that involves the ABC transporter MRP2. in the inflammatory response. This study demonstrates a critical link between apically expressed

Secreted HXA3 then establishes a gradient through the tight MRP2 and the HXA3 biosynthetic pathway. Surprisingly, inhibi- junction complex to provide a chemotactic gradient used by PMNs tion of an enzyme critical for the synthesis of HXA3, 12/15-LOX, to target the lumen of mucosal tissues at sites of inﬂammation (2). was found to also suppress the apical expression of MRP2 induced

The observation that HXA3 can serve as a substrate for the apical by inflammatory signals. This unanticipated coupling of 12/15- efflux transporter MRP2 fits well with the appreciation that other LOX and MRP2 identified in an in vitro acute inflammatory model eicosanoids such as the cysteinyl leukotriene C4, a metabolite of initiated by a pathogen was recapitulated in an in vivo mouse the 5-LOX pathway, is one of the highest affinity MRP2 substrates model of IBD and was consistent with observations made in bi- characterized to date (29–32). Detailed studies, however, are re- opsy samples obtained from IBD patients. Since HXA3 has also quired to fully characterize and provide direct evidence for MRP2 been shown to be involved in pathogen-induced inflammation of transport of hepoxilin. both intestinal (2, 9) and pulmonary (7) epithelial cells, it is likely There are four enzymes that possess 12-LOX activity in humans that our results describe a generalized mechanism governing and the most abundant LOX expressed in epithelial cells is 12/15- HXA3 synthesis and its subsequent apical release that could pro- LOX. In humans, unlike mice, 12HpETE is not the major product vide novel therapeutic strategies to impede and/or limit PMN in- of 12/15-LOX (ALOX15, 4:1 ratio of 15-HpETE:12-HpETE) (45, volvement in deleterious events associated with a number of acute 46). However, 12/15-LOX is highly expressed in epithelial cells, and chronic inflammatory conditions. including intestinal epithelial cells (45, 46), and the synthesis of 12-HpETE through this pathway is likely significant. At present it Acknowledgments is unclear which 12-LOX enzymes specifically contribute to HXA3 We thank Dr. Bryan Hurley for critical reading of this manuscript. We also production in the human mucosa and thus the potential contribu- thank Dr. Jerrold R. Turner at the University of Chicago for supplying the tion of ALOX12, ALOX12B, or ALOXE3 cannot be excluded. IBD specimens. Our studies, however, determined that pharmacological inhibition of 12/15-LOX activity (both in vitro and in vivo) was found to not Disclosures only block HXA3 synthesis but also the enhanced apical expres- One of the authors (R.J.M.) is affiliated with a company focusing on the sion of MRP2 typically observed as part of the inflammatory commercial development of therapeutics derived from this research. process. Our observation that 12/15-LOX activity is coupled to MRP2 References up-regulation and apical localization implies that either a metab- 1. McCormick, B. A., P. M. Hofman, J. Kim, D. K. Carnes, S. I. Miller, and olite of the 12/15-LOX pathway or an active form of the enzyme J. L. Madara. 1995. Surface attachment of Salmonella typhimurium to intestinal epithelia imprints the subepithelial matrix with gradients chemotactic for neutro- itself participates in MRP2-related cellular changes associated phils. J. Cell Biol. 131: 1599–1608. with inflammation. However, it is unclear at this point in our in- 2. Mrsny, R. J., A. T. Gewirtz, D. Siccardi, T. Savidge, B. P. Hurley, J. L. Madara, vestigation at what level or through what mechanism this associ- and B. A. McCormick. 2004. Identification of hepoxilin A3 in inflammatory events: a required role in neutrophil migration across intestinal epithelia. Proc. ation is achieved. Nevertheless, previous studies have demon- Natl. Acad. Sci. USA 101: 7421–7426. strated that cyclooxygenase 2 expression enhances the functional 3. Pace-Asciak, C. R., D. Reynaud, P. Demin, and S. Nigam. 1999. The hepoxilins: activity of P-gp, providing a precedent of a causal link between a review. Adv. Exp. Med. Biol. 447: 123–132. 4. Nigam, S., M. P. Zafiriou, R. Deva, R. Ciccoli, and R. Roux-Van der Merwe. arachidonic acid metabolism and expression of an ABC transporter 2007. Structure, biochemistry and biology of hepoxilins: an update. FEBS J. 274: (47). Furthermore, given that epithelial cells appear to regulate 3503–3512. 5. Nigam, S., S. Patabhiraman, R. Ciccoli, G. Ishdorj, K. Schwarz, B. Petrucev, 12/15-LOX and MRP2 expression in a coupled fashion, several H. Kuhn, and J. Z. Haeggstrom. 2004. The rat leukocyte-type 12-lipoxygenase novel therapeutic strategies are potentially available to treat in- exhibits an intrinsic hepoxilin A3 synthase activity. J. Biol. Chem. 279: flammatory conditions, such as IBD, based upon regulation of 12/ 29023–29030. 6. Yu, Z., C. Schneider, W. E. Boeglin, L. J. Marnett, and A. R. Brash. 2003. The 15-LOX and MRP2. Underscoring such important clinical impli- lipoxygenase gene ALOXE3 implicated in skin differentiation encodes a hy- cations, we show that treatment with baicalein, a 12-LOX droperoxide isomerase. Proc. Natl. Acad. Sci. USA 100: 9162–9167. inhibitor, which inhibits HXA synthesis as well as the enhanced 7. Hurley, B. P., D. Siccardi, R. J. Mrsny, and B. A. McCormick. 2004. Polymor- 3 phonuclear cell transmigration induced by Pseudomonas aeruginosa requires the apical expression of MRP2, resolved PMN transmigration/intesti- eicosanoid hepoxilin A3. J. Immunol. 173: 5712–5720. nal inflammation in a murine model of IBD. 8. Hurley, B. P., A. Sin, and B. A. McCormick. 2008. Adhesion molecules involved in hepoxilin A3-mediated neutrophil transepithelial migration. Clin. Exp. Immu- Although our studies provide the first description that MRP2 is nol. 151: 297–305. involved in the mechanisms that promote active states of intestinal 9. Mumy, K. L., J. D. Bien, M. A. Pazos, K. Gronert, B. P. Hurley, and inflammation (i.e., PMN recruitment), other ABC transporters, B. A. McCormick. 2008. Distinct Isoforms of phospholipase A2 mediate the ability of Salmonella enterica serotype Typhimurium and Shigella flexneri to namely, P-gp (MDR1), have been found to play a role in the de- induce the transepithelial migration of neutrophils. Infect. Immun. 76: velopment of colitis (48), albeit by a completely different mecha- 3614–3627. 8052 MRP2 AND MUCOSAL INFLAMMATION

10. McCormick, B. A., C. A. Parkos, S. P. Colgan, D. K. Carnes, and J. L. Madara. 29. Shen, H., S. Paul, L. M. Breuninger, P. J. Ciaccio, N. M. Laing, M. Helt, 1998. Apical secretion of a pathogen-elicited epithelial chemoattractant activity K. D. Tew, and G. D. Kruh. 1996. Cellular and in vitro transport of glutathione in response to surface colonization of intestinal epithelia by Salmonella typhi- conjugates by MRP. Biochemistry 35: 5719–5725. murium. J. Immunol. 160: 455–466. 30. Leier, I., G. Jedlitschky, U. Buchholz, M. Center, S. P. Cole, R. G. Deeley, and 11. Wakabayashi, K., A. Tamura, H. Saito, Y. Onishi, and T. Ishikawa. 2006. Human D. Keppler. 1996. ATP-dependent glutathione disulphide transport mediated by ABC transporter ABCG2 in xenobiotic protection and redox biology. Drug the MRP gene-encoded conjugate export pump. Biochem. J. 314: 433–437. Metab. Rev. 38: 371–391. 31. Muller, M., C. Meijer, G. J. Zaman, P. Borst, R. J. Scheper, N. H. Mulder, 12. McCormick, B. A., S. P. Colgan, C. Delp-Archer, S. I. Miller, and J. L. Madara. E. G. de Vries, and P. L. Jansen. 1994. Overexpression of the gene encoding the 1993. Salmonella typhimurium attachment to human intestinal epithelial mono- multidrug resistance-associated protein results in increased ATP-dependent glu- layers: transcellular signalling to subepithelial neutrophils. J. Cell Biol. 123: tathione S-conjugate transport. Proc. Natl. Acad. Sci. USA 91: 13033–13037. 895–907. 32. Loe, D. W., K. C. Almquist, R. G. Deeley, and S. P. Cole. 1996. Multidrug 13. Lee, C. A., M. Silva, A. M. Siber, A. J. Kelly, E. Galyov, and B. A. McCormick. resistance protein (MRP)-mediated transport of leukotriene C4 and chemothera- 2000. A secreted Salmonella protein induces a proinflammatory response in ep- peutic agents in membrane vesicles: demonstration of glutathione-dependent vin- ithelial cells, which promotes neutrophil migration. Proc. Natl. Acad. Sci. USA cristine transport. J. Biol. Chem. 271: 9675–9682. 97: 12283–12288. 33. Zhang, S., R. L. Santos, R. M. Tsolis, S. Stender, W. D. Hardt, A. J. Baumler, and 14. Gronert, K., C. B. Clish, M. Romano, and C. N. Serhan. 1999. Transcellular L. G. Adams. 2002. The Salmonella enterica serotype typhimurium effector pro- regulation of eicosanoid biosynthesis. Methods Mol. Biol. 120: 119–144. teins SipA, SopA, SopB, SopD, and SopE2 act in concert to induce diarrhea in 15. Murphy, R. C., R. M. Barkley, K. Zemski Berry, J. Hankin, K. Harrison, calves. Infect. Immun. 70: 3843–3855. C. Johnson, J. Krank, A. McAnoy, C. Uhlson, and S. Zarini. 2005. Electrospray 34. Shannon, V. R., W. F. Stenson, and M. J. Holtzman. 1993. Induction of epithelial ionization and tandem mass spectrometry of eicosanoids. Anal. Biochem. 346: arachidonate 12-lipoxygenase at active sites of inflammatory bowel disease. 1–42. Am. J. Physiol. 264: G104–G111. 16. Barthel, M., S. Hapfelmeier, L. Quintanilla-Martinez, M. Kremer, M. Rohde, 35. Yamamoto, S., K. Kishimoto, T. Arakawa, H. Suzuki, M. Nakamura, M. Hogardt, K. Pfeffer, H. Russmann, and W. D. Hardt. 2003. Pretreatment of T. Yoshimoto, T. Takao, Y. Shimonishi, and T. Tanabe. 1997. Arachidonate mice with streptomycin provides a Salmonella enterica serovar Typhimurium 12-lipoxygenases: catalytic properties and regulation of the enzyme gene. Adv. colitis model that allows analysis of both pathogen and host. Infect. Immun. 71: Exp. Med. Biol. 407: 191–196. 2839–2858. 36. Yoshimoto, T., and S. Yamamoto. 1995. Arachidonate 12-lipoxygenase. 17. Chen, C. C., S. Louie, B. McCormick, W. A. Walker, and H. N. Shi. 2005. J. Lipid Mediat. Cell Signal 12: 195–212. Concurrent infection with an intestinal helminth parasite impairs host resistance 37. Yamamoto, S., H. Suzuki, M. Nakamura, and K. Ishimura. 1999. Arachidonate to enteric Citrobacter rodentium and enhances Citrobacter-induced colitis in 12-lipoxygenase isozymes. Adv. Exp. Med. Biol. 447: 37–44. mice. Infect. Immun. 73: 5468–5481. 38. Funk, C. D., X. S. Chen, E. N. Johnson, and L. Zhao. 2002. Lipoxygenase genes 18. Lindenmaier, H., M. Becker, W. E. Haefeli, and J. Weiss. 2005. Interaction of and their targeted disruption. Prostaglandins Other Lipid Mediat. 68–69: progestins with the human multidrug resistance-associated protein 2 (MRP2). 303–312. Drug Metab. Dispos. 33: 1576–1579. 39. Collins, J. F., Z. Hu, P. N. Ranganathan, D. Feng, L. M. Garrick, M. D. Garrick, 19. Siccardi, D., L. E. Kandalaft, M. Gumbleton, and C. McGuigan. 2003. Stereo- and R. W. Browne. 2008. Induction of arachidonate 12-lipoxygenase (Alox15) in selective and concentration-dependent polarized epithelial permeability of a se- intestine of iron-deficient rats correlates with the production of biologically active ries of phosphoramidate triester prodrugs of d4T: an in vitro study in Caco-2 and lipid mediators. Am. J. Physiol. 294: G948–G962. Madin-Darby canine kidney cell monolayers. J. Pharmacol. Exp. Ther. 307: 40. Pace-Asciak, C. R., and S. Asotra. 1989. Biosynthesis, catabolism, and biological 1112–1119. properties of HPETEs, hydroperoxide derivatives of arachidonic acid. Free Rad- 20. Brummelkamp, T. R., R. Bernards, and R. Agami. 2002. A system for stable ical Biol. Med. 7: 409–433. expression of short interfering RNAs in mammalian cells. Science 296: 550–553. 21. Siccardi, D., K. L. Mumy, D. M. Wall, J. D. Bien, and B. A. McCormick. 2008. 41. Mackay, F., J. L. Browning, P. Lawton, S. A. Shah, M. Comiskey, A. K. Bhan, Salmonella enterica serovar Typhimurium modulates P-glycoprotein in the in- E. Mizoguchi, C. Terhorst, and S. J. Simpson. 1998. Both the lymphotoxin and testinal epithelium. Am. J. Physiol. 294: G1392–G1400. tumor necrosis factor pathways are involved in experimental murine models of 22. Powrie, F., M. W. Leach, S. Mauze, L. B. Caddle, and R. L. Coffman. 1993. colitis. Gastroenterology 115: 1464–1475. Phenotypically distinct subsets of CD4ϩ T cells induce or protect from chronic 42. Philippe, D., L. Dubuquoy, H. Groux, V. Brun, M. T. Chuoi-Mariot, intestinal inflammation in C. B-17 scid mice. Int. Immunol. 5: 1461–1471. C. Gaveriaux-Ruff, J. F. Colombel, B. L. Kieffer, and P. Desreumaux. 2003. ␮ 23. Morrissey, P. J., K. Charrier, S. Braddy, D. Liggitt, and J. D. Watson. 1993. Anti-inflammatory properties of the opioid receptor support its use in the treat- CD4ϩ T cells that express high levels of CD45RB induce wasting disease when ment of colon inflammation. J. Clin. Invest. 111: 1329–1338. transferred into congenic severe combined immunodeficient mice: disease devel- 43. McCormick, B. A., S. I. Miller, D. Carnes, and J. L. Madara. 1995. Transepi- opment is prevented by cotransfer of purified CD4ϩ T cells. J. Exp. Med. 178: thelial signaling to neutrophils by salmonellae: a novel virulence mechanism for 237–244. gastroenteritis. Infect. Immun. 63: 2302–2309. 24. Totsuka, T., T. Kanai, K. Uraushihara, R. Iiyama, M. Yamazaki, H. Akiba, 44. Van Aubel, R. A., A. Hartog, R. J. Bindels, C. H. Van Os, and F. G. Russel. 2000. H. Yagita, K. Okumura, and M. Watanabe. 2003. Therapeutic effect of anti- Expression and immunolocalization of multidrug resistance protein 2 in rabbit OX40L and anti-TNF-␣ MAbs in a murine model of chronic colitis. small intestine. Eur. J. Pharmacol. 400: 195–198. Am. J. Physiol. 284: G595–G603. 45. Kuhn, H., M. Walther, and R. J. Kuban. 2002. Mammalian arachidonate 15- 25. Chan, L. M., S. Lowes, and B. H. Hirst. 2004. The ABCs of drug transport in lipoxygenases structure, function, and biological implications. Prostaglandins intestine and liver: efflux proteins limiting drug absorption and bioavailability. Other Lipid Mediat. 68–69: 263–290. Eur. J. Pharm .Sci. 21: 25–51. 46. Kuhn, H., and V. B. O’Donnell. 2006. Inflammation and immune regulation by 26. Kullak-Ublick, G. A., and M. B. Becker. 2003. Regulation of drug and bile salt 12/15-lipoxygenases. Prog. Lipid Res. 45: 334–356. transporters in liver and intestine. Drug Metab. Rev. 35: 305–317. 47. Sorokin, A. 2004. Cyclooxygenase-2: potential role in regulation of drug efflux 27. Prime-Chapman, H. M., R. A. Fearn, A. E. Cooper, V. Moore, and B. H. Hirst. and multidrug resistance phenotype. Curr. Pharm. Des. 10: 647–657. 2004. Differential multidrug resistance-associated protein 1 through 6 isoform 48. Panwala, C. M., J. C. Jones, and J. L. Viney. 1998. A novel model of inflam- expression and function in human intestinal epithelial Caco-2 cells. J. Pharmacol. matory bowel disease: mice deficient for the multiple drug resistance gene, Exp. Ther. 311: 476–484. mdr1a, spontaneously develop colitis. J. Immunol. 161: 5733–5744. 28. Kruijtzer, C. M., J. H. Beijnen, and J. H. Schellens. 2002. Improvement of oral 49. Laouari, D., R. Yang, C. Veau, I. Blanke, and G. Friedlander. 2001. Two apical drug treatment by temporary inhibition of drug transporters and/or cytochrome multidrug transporters, P-gp and MRP2, are differently altered in chronic renal P450 in the gastrointestinal tract and liver: an overview. Oncologist 7: 516–530. failure. Am. J. Physiol. 280: F636–F645.