Molecular Characterization and Diversity of Dicot-Infecting Mastreviruses Occurring in Pakistan

Huma Mumtaz

2018

Department of Biotechnology Pakistan Institute of Engineering and Applied Sciences Nilore, Islamabad, Pakistan

This page intentionally left blank.

Molecular Characterization and Diversity of Dicot-Infecting Mastreviruses Occurring in Pakistan

Huma Mumtaz

Submitted in partial fulfillment of the requirements for the degree of Ph.D.

2018

Department of Biotechnology Pakistan Institute of Engineering and Applied Sciences Nilore, Islamabad, Pakistan

Copyrights Statement

The entire contents of this thesis entitled Molecular Characterization and Diversity of Dicot-Infecting Mastreviruses Occurring in Pakistan by Huma Mumtaz are an intellectual property of Pakistan Institute of Engineering & Applied Sciences (PIEAS). No portion of the thesis should be reproduced without obtaining explicit permission from PIEAS.

iii

Dedications

“I humbly dedicate this kind effort to my whole family” “Especially to my late parents”

Acknowledgements

Read! In the Name of your Lord, who created (all that exists); created man from a clot. Read! And your Lord is the Most Generous” (Qur’an 96:1-3). Without the help of Allah Al-Mighty we can't move a step ahead, no matter how much we bow before Him, He gives more than we deserve. The Prophet (SAWW) was reported to have said, “Knowledge is worship” and when a Muslim has the proper intentions that is his deeds are only for sake of Allah (SWT), acquiring knowledge can be extremely beneficial in the purification of his heart.

Special thanks to former Chairman (PAEC), Mr. Anwar Ali, and former directors; Dr. Zafar Mehmood Khalid, Dr. Sohail Hameed, Dr. Shahid Mansoor (SI) for giving me a chance to do a Ph. D at NIBGE, the prestigious Biotechnology Institute of Pakistan. I express my utmost appreciation to Dr. Zahid Mukhtar (DCS), Head of Agricultural Biotechnology Division (ABD), NIBGE, for facilitating a pleasant and working environment.

It’s praiseworthy to mention the members of the “Higher Education Commission”, Islamabad, for sponsoring my Ph.D studies awarding me an indigenous scholarship as well as giving me the chance of a foreign training at the University of Cape Town, South Africa under the IRSIP scheme.

I am speechless for the motivating steps my Supervisor, Prof. Dr. Robert William Briddon (FFP) took during my Ph.D. He arranged my first foreign tour to Germany, the “RCA Summer School” at the University of Stuttgart in 2009. He supported and nurtured me like a father. He is a thorough scientist with perfection like attitude, the key towards success. I am indebted to Dr. Robert in all ways and I feel honored to have experienced scientific collaborations with some of the great virologists known to him such as Dr. Holger Jeske (University of Stuttgart), Dr. Edward Rybicki, Dr. Darren Martin (IRSIP Supervisor), Dr. Dionne Shepherd (University of Cape Town) and Dr. Safaa Kumari.

A special thanks to Dr. Arvind Varsani and Dr. Simona Kraberger for

contributing to part of my 3rd chapter which led to a novel and thoughtful finding in my Ph.D research.

I am deeply grateful to my co-supervisor Prof. Dr. Shahid Mansoor (SI) (Director, NIBGE) who is an exceptional teacher with an accommodative personality to all. I am highly indebted to you for having sheltered me under the umbrella of science. I worked in a serene environment one could ask for and your trust in me was the best part of you that i can’t thank you enough. Dr. Imran Amin (PS) was very helpful and kind to me and always extended his generous support, his words of thought always encouraged me whenever I got lost and I wish him the best in life.

I also pay a bundle of thanks to the very experienced scientists like Dr. Muhammad Ilyas, Dr. Muhammad Mubin, Dr. Muhammad Shahid Shafiq, Dr. Luqman and Dr. Khadim Hussain for guiding and encouraging me in initial days of work. My sincere gratitude goes to my lab fellows who cracked funny jokes and made me comfortable during work. The lab assistants get a thumbs up for being so accommodative to me whenever I needed them.

My Family (Parents, brothers and sisters), especially Hassan Mumtaz worked so hard to make me what I am today, I can't pay them back for all that, but pray that May Allah bless them always, aameen. I am entirely thankful to my very close friends who were by my side in good as well as bad times to mention a few as Dr. Shaista Javaid, Dr. Aysha Azhar, Dr. Mariam Zain, Dr. Alvina Gul, Zunaira Rizwan and Naadia van der Bergh. I can’t forget to mention Dr. Rizwan Ali Syed, a kind brother and fellow lab colleague at University of Cape Town, he supported me throughout my whole stay, and I pray for his success.

I finally thank my Husband Dr. Saif-ur-Rehman for his encouraging attitude towards my work, his suggestions and advice kept moving me forward. My adorable sons, Muhammad Rayyan Saif and Muhammad Affan Saif always relaxed me with their playful acts and million-dollar smiles. I pray to Allah to bestow upon us his countless blessings and accept my contribution towards plant virology, aameen.

Huma Mumtaz

Table of Contents

Title Page ...... i Declaration of Originality ...... Error! Bookmark not defined. Copyrights Statement ...... ii Dedication ...... iv Acknowledgement ...... v Table of Contents ...... vi List of Figures ...... xi List of Tables ...... xiii Abstract ...... xiv List of Publications ...... xvi List of Abbreviations and Symbols...... xvii Viruses and Satellites ...... xx 1. Introduction ...... 1 1.1 Viruses ...... 1 1.2 Plant Virus-Host Interactions ...... 2 1.3 Geminiviruses...... 2 1.4 Geminiviruses: Classification and Taxonomy ...... 3 1.4.1 Begomovirus ...... 4 1.4.2 Satellites ...... 5 1.4.3 Alphasatellites ...... 6 1.4.4 Betasatellites ...... 7 1.4.5 Deltasatellites ...... 8 1.4.6 Curtovirus ...... 9 1.4.7 Topocuvirus ...... 10 1.4.8 Becurtovirus ...... 11 1.4.9 Eragrovirus ...... 12 1.4.10 Turncurtovirus...... 12 1.4.11 Capulavirus ...... 13 1.4.12 Grablovirus ...... 14 1.4.13 Mastrevirus ...... 15 1.5 Long and Short Intergenic Regions ...... 16

vii

1.6 Mastrevirus Genes - Complementary Sense Genes ...... 17 1.6.1 Replication Associated Protein (Rep) ...... 17 1.6.2 Replication Associated Protein A (RepA) ...... 18 1.6.3 The Virion Sense Genes - Movement Protein (MP) ...... 19 1.6.4 Coat Protein (CP) ...... 20 1.7 Evolution of Mastreviruses ...... 21 1.7.1 High Mutation Rates ...... 21 1.7.2 Recombination ...... 22 1.8 Geminiviruses: Replication cycle...... 24 1.8.1 Rolling Circle Replication (RCR) and Recombination-Dependent Replication (RDR)…………… ...... 24 1.9 Gene Expression and RNA Silencing (RNAi) ...... 27 1.10 Objectives of the study ...... 28 2. Materials and Methods ...... 29 2.1 Sample Collection and Storage ...... 29 2.2 Extraction of DNA from Plant Tissue ...... 29 2.3 DNA Quantification ...... 29 2.4 DNA Amplification ...... 30 2.4.1 Polymerase Chain Reaction (PCR) ...... 30 2.4.2 Rolling Circle Amplification (RCA) ...... 30 2.5 Cloning of PCR and RCA Amplified Products ...... 31 2.5.1 Cloning of PCR Products ...... 31 2.5.2 Cloning of RCA Products ...... 31 2.6 Purification of DNA ...... 31 2.6.1 Gel Extraction and PCR Product Purification ...... 31 2.6.2 Phenol-Chloroform Purification of DNA ...... 32 2.7 Preparation and transformation of Heat Shock Competent Escherchia coli Cells ...... 32 2.7.1 Preparation of Heat Shock Competent E. coli cells ...... 32 2.7.2 Transformation of Heat-Shock Competent E. coli Cells ...... 33 2.8 Preparation and transformation of electro-competent Agrobacterium tumefaciens Cells...... 33 2.8.1 Preparation of Electro-competent Agrobacterium tumefaciens Cells ...... 33 2.8.2 Transformation of Competent Agrobacterium tumefaciens Cells ...... 34 2.8.3 Agrobacterium-Mediated Inoculation ...... 34 2.9 Isolation of Plasmid DNA ...... 35 2.10 Restriction Digestion of DNA ...... 35 2.11 Agarose Gel Electrophoresis ...... 35

viii

2.12 DNA Sequencing...... 36 2.13 Sequencing and Sequence Analysis ...... 36 2.14 Preparation of Glycerol Stocks ...... 37 2.15 Plant Material and Growth Conditions ...... 37 2.16 Photography and Computer Graphics ...... 37 2.17 Southern Blot Analysis ...... 37 2.17.1 Synthesis of DIG-labelled Probes ...... 39 3. Diversity of Dicot-infecting Mastreviruses in Pakistan ...... 40 3.1 Introduction ...... 40 3.1.1 Monocot-infecting Mastreviruses ...... 40 3.1.2 Dicot-infecting Mastreviruses ...... 41 3.2 Materials and Methods ...... 44 3.2.1 Field Survey and Sample Collection...... 44 3.2.2 DNA Extraction and Viral DNA Amplification ...... 44 3.2.3 Next Generation Sequencing ...... 45 3.2.4 Sequence Assembly and Analysis ...... 45 3.2.5 Agrobacterium-Mediated Inoculation ...... 46 3.3 Results ...... 46 3.3.1 Screening of Dicot-Infecting Mastreviruses ...... 46 3.3.2 PCR and RFLP ...... 50 3.3.3 Southern Hybridization of Infected Lentils ...... 52 3.3.4 Illumina High-Throughput/Next Generation Sequencing (NGS) ...... 53 3.3.5 Classification and Distribution of Dicot-Infecting Mastrevirus Species/Strains in Pakistan………………………………………………………53 3.3.6 Identification of an Australian Dicot-Infecting Mastrevirus-like Virus in Pakistan………………………………………………………………………..…55 3.3.7 Phylogenetic Analysis of Predicted Amino Acid Sequences for MP, CP and Rep Proteins ...... 60 3.3.8 Genome Features of Dicot-Infecting Mastreviruses ...... 65 Long Intergenic Region (iterons) and Rep motifs (iteron-related domain) ...... 65 3.4 Discussion ...... 70 4. Identification of Tomato leaf curl New Delhi virus Infecting Lentil (Lens culinaris) in Pakistan ...... 74 4.1 Introduction ...... 74 4.2 Materials and Methods ...... 75 4.2.1 Plant Survey, DNA Extraction ...... 75 4.1.2 RCA Amplification and Sequencing ...... 75 4.1.3 Sequence Assembly and Phylogenetic Analysis...... 75

4.1.4 PCR-Mediated Diagnosis of ToLCNDV ...... 75 4.1.5 Quantitative Real-Time PCR ...... 76 4.2 Results ...... 77 4.2.1 Identification of ToLCNDV in Lentil ...... 77 4.2.2 PCR Confirmation of ToLCNDV Infection of Lentil...... 78 4.2.3 Quantification of ToLCNDV DNA-A, DNA-B and CpCDV DNA Levels in Plants……………...... 79 4.2.4 Analysis of the ToLCNDV Isolate Identified in Lentil ...... 80 4.3 Discussion ...... 85 5. PVX-mediated Expression of Mastrevirus Genes ...... 87 5.1 Introduction ...... 87 5.2 Materials and Methods ...... 88 5.2.1 Production of Expression Constructs ...... 88 5.2.2 Agrobacterium-mediated Inoculation ...... 88 5.2.3 Trypan Blue Assay ...... 88 5.3 Results ...... 89 5.3.1 Effects of the PVX-mediated Expression of Mastrevirus Movement Protein in N. benthamiana ...... 89 5.3.2 Effects of the PVX-mediated Expression of Mastrevirus Coat Protein in N. benthamiana ...... 90 5.3.3 Effects of the PVX-mediated Expression of Mastrevirus RepA Protein in N. benthamiana ...... 90 5.4 Discussion ...... 95 6. General Discussion ...... 98 7. References ...... 100

List of Figures

Figure 1.1: General organization of begomovirus genomes along with begomovirus-associated satellites and causative agent of begomovirus B.tabaci...... 8 Figure 1.2: Schematic representation of deltasatellites...... 9 Figure 1.3: The arrangement of genes of curtovirus genome (left) and vector Circulifer tenellus (right)...... 10

Figure 1.4: Genome organization of Tomato pseudo-curly top virus (TPCTV) (left) and its vector, the treehopper - (Micrutalis malleifera) (right)...... 11

Figure 1.5: Genome organizations of becurtoviruses, turncurtoviruses and eragroviruses...... 13

Figure 1.6: Genome organization of capulavirus (left) and the vector Aphis craccivora (right)...... 14

Figure 1.7: Genomic organization of grablovirus (left) and the treehopper Spissistilus festinus (right)...... 15

Figure 1.8: Genome organization of mastreviruses (left) and the leafhopper vector of Chickpea chlorotic dwarf virus, Orosius orientalis (right) ...... 16 Figure 1.9: Organization of RepA and Rep proteins...... 19

Figure 1.10: 3D structures of Coat Protein...... 21

Figure 1.11: Rolling circle replication (RCR) mechanism of geminiviruses...... 26

Figure 1.12: Recombination - dependent replication (RDR) mechanism of geminiviruses...... 26

Figure 2.1: Southern blot apparatus for the transfer of DNA from an agarose gel to a nylon membrane...... 39 Figure 3.1: Map of Pakistan showing areas of virus infected samples surveyed...47 Figure 3.2: Symptoms exhibited by plants collected from various fields...... 48

Figure 3.3: PCR-RFLP analysis of CpCDV isolates from chickpea...... 51

Figure 3.4: New restriction patterns identified by in silico digestswith four enzymes Sau 3AI, RsaI, HaeIII and AluI (left-right)...... 52

Figure 3.5: Southern blot analysis of genomic DNA isolated from plant samples probed for the presence of CpCDV...... 53

Figure 3.6: Maximum-likelihood phylogenetic tree...... 56

Figure 3.7: Two-dimensional matrix of pairwise identities...... 57

Figure 3.8: Geographic distribution of known CpCDV species/strains in Pakistan...... 58 Figure 3.9: Phylogenetic trees and two dimensional pairwise identity plots...... 64 Figure 3.10: Multiple sequence alignment of the long intergenic region (LIR)...... 66

Figure 3.11: Multiple sequence alignment of the predicted amino acid sequences of the Rep proteins of the dicot-infecting mastrevirus isolates...... 67

Figure 3.12: Symptoms induced following Agrobacterium-mediated inoculation of Nicotiana benthamiana with a partial direct repeat construct of SYR-2...... 68

Figure 3.13: Southern blot probed with the full-length SYR-2 clone...... 69

Figure 4.1: Typical symptoms of chickpea stunt disease of lentil in the field...... 78

Figure 4.2: Coverage of NGS reads for ToLCNDV DNAA de novo assembly (A) and ToLCNDV DNA-B reference-based assembly (B) for lentil sample (LE-8) ...... …...79

Figure 4.3: Quantitative, real-time PCR estimation of the titres of the DNA-A (A) and DNA-B (B) components of ToLCNDV and CpCDV (C) in field collected lentil samples...... 80

Figure 5.1: Response of N. benthamiana plants to the PVX-mediated expression of genes encoded by CpCDV...... 91

Figure 5.2: Response of N. benthamiana plants to the PVX-mediated expression of genes encoded by MSV...... 92

Figure 5.3: Trypan blue staining to detect for cell death in CpCDV-RepA and MatA-RepA inoculated N. benthamiana plants...... 94

xii

List of Tables

Table 3.1: Sequences and features of dicot-infecting mastrevirus obtained in the study...... 49

Table 3.2: CpCDV isolates in chickpea used for PCR/RFLP analysis...... 51

Table 3.3: Dicot-infecting mastreviruses originating from Pakistan...... 59 Table 4.1: Oligonucleotides used in the study...... 77 Table 4.2: Lentil (LE-8) showing begomovirus related features of both ToLCNDV DNA-A and ToLCNDV DNA-B...... 79

Table 5.1: Oligonucleotide primers used in PVX studies...... 89

Table 5.2: Summary of the symptoms induced by the expression of MSV and CpCDV genes from a PVX vector in N. benthamiana...... 93

xiii

Abstract

Viruses of the genus Mastrevirus (family Geminiviridae) are transmitted by leafhoppers to either monocotyledonous or dicotyledonous plants. They are native to the Old World and have been identified across Australia, Asia, Europe and Africa. Although a lot is known about the diversity of monocot-infecting mastreviruses, until recently little was known about the diversity of dicot-infecting mastreviruses. At the time of starting the studies described here a single dicot-infecting mastrevirus was known in Australia and a single mastrevirus had been identified in Pakistan and South Africa (although at the time the viruses in Pakistan and South Africa were considered separate species). During the time the study here was conducted our understanding of the diversity of dicot-infecting mastreviruses has increased exponentially, assisted in part by the study described here.

The diversity of dicot-infecting mastreviruses in Pakistan was assessed by cloning and sequencing single-stranded DNA viruses occurring in chickpea and some other legumes which were collected from farms across the chickpea growing areas of Punjab province. A total of 20 full-length sequences were produced from either cloned virus genomes or reconstructed from next generation sequencing (NGS) reads. The majority of sequences were shown to be isolates of the species Chickpea chlorotic dwarf virus (CpCDV). Sequences produced as part of the study here contributed to the identification of three new strains of the virus - strains C, D and H. Additionally a chickpea sample from Syria was analyzed and the virus was cloned and sequenced. This sequence was shown to be an isolate of CpCDV strain A, which occurs across Iran and Turkey but not Pakistan. The clone of this virus was introduced back into plant by Agrobacterium-mediated inoculation to satisfy Koch’s postulates. Finally, in collaboration with researchers in New Zealand, a second species of dicot-infecting mastrevirus, for which the name Chickpea yellow dwarf virus has been proposed, was identified in Pakistan by NGS. Unusually this virus was shown to be more similar to dicot-mastreviruses from Australia than to CpCDV. This suggests that the diversity and host range of dicot-infecting mastreviruses may be greater than so far identified.

xiv

Although previously reported to be a host of CpCDV, until the study presented here no conclusive proof that CpCDV infects lentil (Lens culinaris) was presented. Here the sequences of a total of 10 CpCDV isolates originating from lentil have been produced. However, NGS of samples from lentil identified plants containing a second geminivirus. Reconstruction of NGS reads showed the presence of the bipartite begomovirus Tomato leaf curl New Delhi virus (ToLCNDV). This was confirmed by PCR and by quantitative analysis of the titres of ToLCNDV and CpCDV in co- infected plants. This is the first identification of a begomovirus infecting lentil. However, the results suggest that ToLCNDV requires CpCDV to infect lentil - no lentil plants singly infected with ToLCNDV were identified. This also raises interesting questions about the transmission of CpCDV in co-infected plants.

Three genes (replication associated protein A [Rep A], movement protein and coat protein) encoded by a dicot-infecting mastrevirus (CpCDV) and a monocot- infecting mastrevirus (Maize streak virus) were expressed from a Potato virus X vector in Nicotiana benthamiana. Overall the genes from CpCDV induced more severe symptoms than those of MSV, possibly due to this virus being adapted to dicotyledonous hosts. The Rep A proteins of both viruses were shown to induce necrosis, suggesting that they elicit a hypersensitive response due to interfering with the cell cycle. The significance of the results is discussed.

List of Publications

Journal Publications

• H. Mumtaz, S. G. Kumari, S. Mansoor, D. P. Martin, and R. W. Briddon, "Analysis of the sequence of a dicot-infecting mastrevirus (family Geminiviridae) originating from Syria," Virus Genes, vol. 42, pp. 422-428, 2011.

• S. Kraberger, H. Mumtaz, S. Claverie, D. P. Martin, R. W. Briddon, and A. Varsani, "Identification of an Australian-like dicot-infecting mastrevirus in Pakistan," Archives of Virology,vol. 160, pp. 825-830, 2015.

xvi

List of Abbreviations and Symbols

µg micrograms µL microlitre µM micromolar BLAST Basic Local Alignment Search Tool bp base pair BSA bovine serum albumin

CaCl2 calcium chloride cDNA complementary-strand DNA CIAP calf intestine alkaline phosphatase CP coat protein CR common region CTAB cetyltriethyl ammonium bromide DAS-ELISA double-antibody sandwich ELISA DEAE diethyl amino ethyl cellulose DEPC diethyl pyrocarbonate DNA deoxyribonucleic acid dNTP deoxyribonucleotide triphosphate dpi days post inoculation dsDNA double-stranded DNA dsRNA double-stranded RNA DTT dithiothreitol EDTA ethylene diaminetetraacetic acid FAO Food and Agriculture Organization

FeSO4.7H2O ferrous sulphate hepta hydrate GFP green fluorescence protein HCl hydrochloric acid HR hypersensitive response HV helper virus ICTV International Committee on Taxonomy of Viruses

xvii

IPTG isopropyl-beta-D-1-thiogalactopyranoside IR intergenic region

K2HPO4 dipotassium phosphate KCl potassium chloride kDa kilo Dalton °C degree celsius % percent GPS global positioning system GRAB geminivirus RepA binding LB Luria-Bertani LIR large intergenic region M molar mg milligram

MgCl2 magnesium chloride

MgSO4 magnesium sulphate

MgSO4.7H2O magnesium sulphate heptahydrate min minute miRNA microRNA mL milliliter mM millimolar MP movement protein mRNA messenger RNA NaCl sodium chloride NaOH sodium hydroxide

NaH2PO4 sodium phosphate

NH4Cl ammonium chloride NCBI National Center for Biotechnology Information ng nanogram NGS next generation sequencing NSP nuclear shuttle protein nt. nucleotide NW New World OD optical density ORF open reading frame

xviii

OW Old World PCR polymerase chain reaction pH potential of hydrogen RBR retinoblastoma-related proteins RCA rolling circle amplification RCR rolling circle replication RDP recombination detection programme RdRP RNA-dependent RNA polymerase REn replication enhancer protein Rep replication associated protein RISC RNA-induced silencing complex RFLP restriction fragment length polymorphism RNA ribonucleic acid RNAi RNA interference rpm revolutions per minute satRNAs satellite RNAs SCR satellite conserved region sg DNAs sub-genomic DNAs SIR small intergenic region siRNAs short interfering RNAs SDS sodium dodecyl sulphate SDW sterile distilled water ssDNA single-stranded DNA SSC standard saline citrate SSPE saline-sodium phosphate-EDTA TAE tris-acetate EDTA TBE tris-borate EDTA Taq Thermus aquaticus TGS transcriptional gene silencing TBIA tissue-blot immunoassay TrAP transcriptional activator protein UV ultra violet X-Gal 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside

xix

Viruses and Satellites

ACMV African cassava mosaic virus AYLCB Ageratum yellow leaf curl betasatellite AYVV Ageratum yellow vein virus BGYMV Bean golden yellowmosaic virus BLRV Bean leaf roll virus BCTV Beet curly top virus BCTIV Beet curly top Iran virus BWYV Beet western yellows virus BCSMV Bromus catharticus striate mosaic virus CpCDV Chickpea chlorotic dwarf virus CpYDV Chickpea yellow dwarf virus CpRLV Chickpea redleaf virus CpYV Chickpea yellows virus CpCV Chickpea chlorosis virus CpCAV Chickpea chlorosis Australia virus CSMV Chloris striate mosaic virus CLCuKoV Cotton leaf curl Kokhran virus CLCuMuA Cotton leaf curl Multan alphasatellite CLCuMuB Cotton leaf curl Multan betasatellite CLCuMuV Cotton leaf curl Multan virus CMV Cucumber mosaic virus EACMV East African cassava mosaic virus EACMKV East African cassava mosaic Kenya virus ECSV Eragrostis curvula streak virus FBNYV Faba bean necrotic yellows virus HrCTV Horseradish curly top virus MSV Maize streak virus PSV Panicum streak virus PSbMV Pea seed-borne mosaic virus

PVX Potato virus X SCTAV Spinach curly top Arizona virus SSCTV Spinach severe curly top virus TRV Tobacco rattle virus TMV Tobacco mosaic virus TNV Tobacco necrosis virus TYDV Tobacco yellow dwarf virus TGMV Tomato golden mosaic virus ToLCNDV Tomato leaf curl New Delhi virus ToLCV Tomato leaf curl virus ToMoV Tomato mottle virus TPCTV Tomato pseudo-curly top virus TYLCCV Tomato yellow leaf curl China virus TYLCV Tomato yellow leaf curl virus TCTV Turnip curly top virus WDV Wheat dwarf virus WDIV Wheat dwarf India virus

xxi

1: Introduction

1. Introduction

1.1 Viruses The origin of life, in a famous essay by Haldane about the central role of viruses in which he not only considers viruses as living entities, but that “life was in the virus stage for many years till an assemblage of elementary units were combined together in the first cell” [1]. Discovered in 1886-1903, virus is a Latin word, meaning “poison”. These extreme micro intracellular pathogens cause infection and have evolved so rapidly, having devastating effects on economy [2]. They form a major class of biological entities with both living and non-living properties. Viruses are unable to replicate on their own and as obligate parasites they replicate after they have invaded and parasitized a host cell. Viruses contain nucleic acid in the form of RNA or DNA genome enclosed and are protected by virus-encoded protein coat. To perform effectively, viruses deliver the genome (DNA or RNA) into the host cell and allow its expression through transcription and translation [3].

Being smallest replicating entities, viruses have high mutation and replication rates and thus have key role in evolutionary studies [4]. Deep sequencing has shown that viruses can form 106-109 particles per millilitre of seawater [5] and are known to encompass a diverse environment ranging from plants, human, soil, animals to algae in marine ecosystems.

In 1971, David Baltimore, proposed the classification of viruses on the basis of their packaged genomes as double-stranded DNA (dsDNA) viruses, single-stranded DNA (ssDNA) viruses, double-stranded RNA (dsRNA) viruses, reverse-transcribing viruses (RT), negative sense single-stranded RNA (ssRNA-) viruses and positive sense single-stranded RNA (ssRNA+) viruses [6]. The Geminiviridae and Nanoviridae constitute the group of ssDNA viruses [7, 8], which are a divergent group of viruses at the sequence level and could represent new families as pathogens of the phytoplankton and microzooplankton [9].

1: Introduction

1.2 Plant Virus-Host Interactions Plant DNA and RNA viruses have a limited coding capacity due to their small genome size, therefore are dependent on host cellular processes to complete their viral life cycle. The interaction of plant viruses with the host cells influences the host cell pathways, to trigger an antiviral response [10]. Plant viruses not only cause various diseases in crops, but most of the disease-causing plant viruses confer drought and cold tolerance to their hosts as well as show mutualism [11]. Plants counteract the viral effects by using a constitutive defense mechanism.

In addition, the host-virus interactions are affected by various host factors thus determining the host ranges of various viruses [10]. The effects of virus infection in plants is diverse as viruses spread systemically in some hosts but can be limited to localized necrotic lesions in others. Novel virus-host interactions are a result of vector, pathogen and non-native plant migration introduced by humans as well as environmental changes [12]. Single mutations in viruses may lead to severe diseases and these changes observed in host range are due to spontaneous mutations, caused by altering amino acid sequences in host-binding proteins [13, 14]. Abiotic and biotic stresses have an influence on the phenotypic effect of a host plant influenced by host- derived factors used to mediate virus-vector interactions [15].

Additionally, plants trigger an active defence towards viruses and pathogenic organisms, in the form of a hypersensitive response (HR) [16]. Plants have developed resistance strategies such as RNA or DNA interference, virus-induced gene silencing (VIGS), anti-sense RNA and others to protect from RNA and DNA virus infections [17]. As for the modern technologies qRT-PCR and microarrays, have facilitated plant-virus interaction studies through expression profiling [18].

1.3 Geminiviruses The family Geminiviridae is one of the largest and genetically diverse families of plant-infecting viruses which have single-stranded (ss) DNA genomes of approx. 2.5- 5.6 kb in length [19]. The name “gemini” is a Latin word which means “the twins” and is represented by a distinctive, paired-icosahedral capsid. Hatta and Francki in 1979 studied the virus particle structure of a geminivirus, chloris striate mosaic virus (CSMV) which contains a distinctive twinned geminate structure with an estimated

1: Introduction particles size of 18 x 30 nm [20]. Geminiviruses have caused enormous losses worldwide to agro-economical crops (staple and fiber), in tropical and subtropical regions [22, 23]. They are spread in a non-propagative, circulative, persistent manner including various species of leafhopper (Cicadellidae sp.), treehopper, whitefly (Bemisia tabaci) and aphid [41].

Viruses of the family Geminiviridae display significant diversity in their genome structure and nucleotide sequences [21]. Geminivirus genomes contain an intergenic region (IR) where viral genes are encoded in both the virion (V) and complementary (C) sense orientation. Genes (four to eight) are expressed on both strands of dsDNA replicative intermediate and transcription of these genes takes place under control of two bidirectional promoters and a mono-directional promoter. The Rep and coat protein (CP) genes [24] are shared by all geminiviruses. Molecular diversification has a significant role in geminiviruses via mutation and genetic recombination [25, 26] with new species and viruses adapting to natural environments.

1.4 Geminiviruses: Classification and Taxonomy “The beginning of wisdom is calling things by their right names.” Due to the new approaches such as viral metagenomics using powerful high- throughput sequencing methods, many viruses have been characterized with more than 6000 species available at the GenBank database [27]. The International Committee on the Taxonomy of viruses (ICTV), revised the taxonomy with newly defined genera and families with known viruses which reflect their evolutionary relationships [28].

Recently an additional five genera have been approved within the Geminiviridae, in addition to the four that were described in the 1990s, resulting in the nine genera now described - Begomovirus, Curtovirus, Topocuvirus, Mastrevirus, Becurtovirus, Turncurtovirus, Eragrovirus,Capulavirus and Grablovirus [28]. Demarcation criteria have been formulated on the basis of genome arrangement, host range, insect vector and sequence similarity to identify virus strains and species within genera [29]. In case of the mastreviruses the distribution of pair wise identity where demarcation thresholds are >94 % identity, the isolates are considered to be

1: Introduction members or variants of a specific strain and if the sequence has <78 % identity to the known mastreviruses, it is assigned as a new species [30]. Mastreviruses also include a ‘‘subtype’’ classification system used to categorize the members of some strains such as the MSV-A strains known as (MSVA1 to A6) [30] and in the case of dicot- infecting mastreviruses seven species are available among which CpCDV has currently eighteen identified strains.

The identification of new species for full-length nucleotide sequences of Begomovirus is 91% nucleotide (nt) identity for species and 94% for strains whereas for Curtovirus it is 77% and 94%, respectively. For the more recently established genera the thresholds are 80% and 94%, respectively, genome-wide pairwise identity for Becurtovirus and, with only a single species each identified for both Eragrovirus and Turncurtovirus so far, strain demarcation thresholds of 94% and 95%, respectively, have been proposed with, at least temporarily, viruses with <94% or <95%, respectively, identity being considered new species [31]. For Capulavirus the species threshold has been set at 78% and tentatively at 80% for Grablovirus [28]. So far no strain demarcation criteria have been proposed for these two genera. It is likely that, in the near future, new genera will be required to accommodate the unusual geminiviruses Citrus chlorotic dwarf associated virus and Mulberry mosaic dwarf associated virus as well as apple geminivirus and grapevine geminivirus A [28].

1.4.1 Begomovirus Begomovirus with type member Bean golden yellow mosaic virus (BGYMV), is the largest genus in the family Geminiviridae and constitutes the largest group of plant- infecting DNA viruses with more than 322 accepted species [32]. Begomoviruses cause significant diseases of dicotyledonous crops that are a serious constraint to agricultural productivity across the world, but particularly in the tropics and subtropics [33-35]. These viruses are transmitted through a highly specific vector, the whitefly (Bemisia tabaci) (family; Aleyrodidae) in a circulative, non-propagative manner [36].

Begomoviruses have genomes that are either monopartite or bipartite. The bipartite viruses have a genome comprising of two circular ssDNA molecules (known as DNA-A and DNA-B) which are required for infectivity, although it is reported that DNA-As are independently capable of establishing systemic infections in some cases

1: Introduction

[38, 39]. In most cases such DNA A infections are non-symptomatic. The monopartite begomoviruses have genomes consisting of one circular ssDNA molecule which is a homolog of the DNA A of the bipartite viruses. Most monopartite begomoviruses associate with two classes of ssDNA satellites known as alphasatellites and betasatellites [37].

The genome organization of monopartite begomoviruses and the DNA-A components of bipartite begomoviruses are the same. Both encode genes that include the C1(AC1), C2(AC2), C3(AC3) and C4(AC4) and V1(AV1) which encode the capsid protein (CP), replication-associated protein (Rep), transcriptional-activator protein (TrAP), replication-enhancer protein (REn) and C4/AC4 protein, respectively [40,41]. The virion-sense gene (A)V2 encodes the pre-coat protein, is present in most Old world (OW) begomoviruses but absent in the New world (NW) begomoviruses [42].

In monopartite OW viruses, V2 is the key movement protein but two proteins NSP and MP encoded by DNA-B are required for systemic infection in plants [43]. The DNA A and DNA B components of bipartite begomoviruses share part of high sequence identity, the common region (CR) present within the intergenic region and encompasses the hairpin structure which contains the nonanucleotide sequence (TAA/GTATTAC) as part of the loop.

1.4.2 Satellites Begomoviruses are associated with two main types of DNA satellite molecules namely, betasatellites and alphasatellites which are approximately 1.3 kb in size and share sequence similarity with the exception of an adenine-rich region. Satellite molecules are defined as subviral agents that are not independent entities and depend on a helper virus for their replication, spread and encapsidation. “Satellite virus” was a term introduced by Kassanis in 1962 who described a small virus dependent on Tobacco necrosis virus (TNV) for its multiplication in plants. The begomovirus satellites have a widespread distribution with serious threat to tropical and subtropical regions worldwide [44, 45].

Satellite molecules present in plant viruses are capable of replication and may have role in symptom expression diseases caused by helper virus and were initially

1: Introduction identified and well characterized in RNA viruses [46]. The ICTV, has grouped plant virus-associated satellites under subviral agents as satellite viruses that (encode coat protein) and satellite nucleic acids (DNA or RNA) [47]. To date, more than 500 satellite sequences have been isolated from cultivated crops and weeds [48, 49] that are associated with begomoviruses. Satellites produce intense symptoms that are induced by their helper viruses and cause severe aggravation of symptoms which vary among helper viruses and host plants [50, 46]. Satellite RNAs are linear RNA molecules related to RNA-containing viruses that are 200 to 1,500 nucleotides in size. Larger satellites encode functional open reading frames (ORFs) while smaller satellites are more structured. Satellite RNAs contain non-coding RNA molecules, known as satellite RNAs (satRNAs).

1.4.3 Alphasatellites Alphasatellites (previously known as DNA-1) are approx. half the size of begomovirus genomic components (~1375 nt) with circular ssDNA self-replicating molecules and are associated with most of begomovirus DNA-β disease complexes [51]. Alphasatellites were first identified in the Old World associated with monopartite begomoviruses that were associated with betasatellites. More recently unusual alphasatellites have been identified in the New World associated with bipartite begomoviruses in the absence of betasatellites [52, 53].

Alphasatellites contain conserved genome features including a single gene encoding protein of ∼37 kDa which is a replication-associated protein that initiates rolling-circle replication of the alphasatellite independent of the helper virus and is similar to the master Rep protein that is encoded by the genomic component DNA-R of nanoviruses, a region of sequence rich in adenine which may function to increase the size of alphasatellites to half the size of the begomovirus components and a hairpin structure containing the nonanucleotide “TAGTATTAC” required for Rep initiation of rolling-circle replication and is typical of that encoded by nanoviruses. Ageratum yellow vein disease (AYVD) and cotton leaf curl disease (CLCuD) were the first for which alphasatellite components were reported [51, 56, 57]. Alphasatellites play no role in disease maintenance but can reduce helper virus DNA levels [58] and in some cases suppress virus induced symptoms [59].

1: Introduction

1.4.4 Betasatellites Betasatellites (previously known as DNA-β), are large group of highly diverse ssDNA satellites. Betasatellites were isolated from tomatoes infected with ToLCV (a monopartite begomovirus) and was named as ToLCV-sat.This small, defective betasatellite molecule was 682 nts long [66]. Lateron, in 1999, the first full length betasatellite was identified in an infected Ageratum conyzoides with Ageratum yellow vein virus (AYVV). Till date, more than 400 full-length betasatellite sequences have been deposited in databases. The genomes of betasatellites are ∼1,350 nt in length, which is approx. half the size of begomovirus genomic components and are most commonly associated with monopartite begomoviruses [48, 49].

Betasatellites have no sequence homology with their helper viruses apart from a potential stem-loop structure that has the ubiquitous nonanucleotide sequence “TAATATTAC” [49]. Betasatellites contain a conserved regionknown as the satellite conserved region (SCR) that is ~120- nts long, and is well conserved among all betasatellites and an adenine rich sequence of 160-to 280-nts long, with an A content of ~57%to 65% [269]. The A-rich region is involved in the replication of complementary-sense strand DNA molecules [69]. Betasatellites depend upon the helper virus for replication and vector transmission. They contain a single coding sequence known as βC1. The βC1 protein is a dominant pathogenicity/symptom determinant, suppression of RNA-mediated host gene silencing [60, 59] and raises helper virus DNA levels [51].

Betasatellites are widespread in the Old World but are not found in the New World although an experiment on transreplication of betasatellites by New World begomoviruses is reported [44]. Betasatellite are also associated with some bipartite begomoviruses [61]. Betasatellites can be transreplicated by more than one begomoviruses. For example, cotton leaf curl disease (CLCuD) in Asia is caused by the association of Cotton leaf curl Multan betasatellite (CLCuMuB) with about six distinct monopartite begomovirus species [62]. Also, monopartite and bipartite begomoviruses have been found to be associated with betasatellite molecules reported on chillies [364].

1: Introduction

Figure 1.1: General organization of begomovirus genomes along with begomovirus-associated satellites and causative agent of begomovirus B. tabaci. The open reading frames diverge in the virion (V) and complementary (C) senses from an intergenic region (IR). Both DNA A and DNA B components are present with bipartite (or genomes of monopartite) begomoviruses encoded in the complementary- sense. The DNA A component includes V1(AV1), C1(AC1), C2(AC2), C3(AC3) and C4(AC4) genes, which encode the capsid protein (CP), replication-associated protein (Rep), transactivator protein (TrAP), replication enhancer protein (REn), and C4/AC4 proteins, respectively. The DNA-B components includes two genes, BV1 (nuclear shuttle protein [NSP]) and BC1 (movement protein [MP]). Alphasatellites encode a single ORF encoded protein (alpha-Rep) that replicates independently and betasatellites contains a satellite conserved region (SCR), an adenine rich region and a single protein known as βC1. The image of Bemisia tabaci was taken from https://upload.wikimedia.org/wikipedia/commons/a/a7/Silverleaf_whitefly.jpg. 1.4.5 Deltasatellites Deltasatellites are a novel class of subviral agents that are non-coding [63]. They are one quarter the size of begomovirus DNA components and half the size of betasatellites and alphasatellites ranging from 633 to 750 bp. These non-coding DNA satellites are associated with a group of divergent begomovirus known as sweepoviruses [64]. Some of the deltasatellites are known to be transmitted by B. tabaci. New world deltasatellites have been identified so far in two wild malvaceous plant species, Malvastrum coromandelianum and Sidastrum micranthum [63], and a NW deltasatellite associated with bipartite begomoviruses in the Caribbean ToLCV-

1: Introduction sat [63]. ToLCV-sat was identified in the 1990s in Australia [66], but the benefit to the helper virus of the maintenance of deltasatellites remains unclear. ToLCV-sat is approx. 682 nt, which is about a quarter the size of ToLCV, and was thought to have evolved as a defective betasatellite [67].

Deltasatellites are phylogenetically distinct from betasatellites and the difference in the nonanucleotide-containing hairpin structures shows a convergent evolution [68]. Deltasatellites are thought to have evolved from the betasatellites by loss of the βC1 coding sequence [69, 70]. Also, deltasatellites could be a useful candidate towards geminivirus resistance, by the “DNA interference” mechanism, as they are non-coding and not virus-derived, yet interact with virus-encoded Rep to achieve replication [71].

Figure 1.2: Schematic representation of deltasatellites. Deltasatellites include those associated with the New World bipartite begomoviruses, sweepoviruses, and Tomato leaf curl virus originating from Australia. The main features include a sequence rich in adenine (highlighted in green), a predicted secondary stem-loop structure (highlighted in blue), a sequence related to the satellite conserved regionof betasatellites (highlighted in red) and a conserved, predicted stem- loop structure with a nonanucleotide sequence forming part of the loop (highlighted in yellow).

1.4.6 Curtovirus The type member of the genus Curtovirus, Beet curly top virus (BCTV [248]) causes curly top disease. The virus has a very wide host range, infecting over 300 dicotyledonous species in 44 families [72]. Curtoviruses have monopartite genomes of ~ 2.9-3.0 kb. They encode seven proteins, though some isolates have only five or

1: Introduction six genes. A positive (virion) sense strand contains three proteins V1 (CP), V2 the ss/ds DNA regulator and V3 (MP) whereas the negative (complementary) sense strand contains four proteins as C1 (Rep-replication protein), C2 yet with unknown function and acts as a pathogenicity factor, C3 (REn- putative replication enhancer protein) and C4 is known to initiate cell division as well as act as a symptom determinant [73].

The Beet leafhopper Circulifer tenellus, is known to transmit the curtoviruses in New World members throughout arid and semi-arid locations [73]. The curtoviruses are re-classified into three curtovirus species namely, Beet curly top virus (BCTV), Spinach severe curly top virus (SpSCTV), and Horseradish curly top virus (HrCTV) [75]. A recombination between a leafhopper-transmitted geminivirus, coat protein gene and a whitefly-transmitted geminivirus, replication gene most likely explains how curtoviruses evolved [76, 248].

Figure 1.3: The arrangement of genes of curtovirus genome (left) and vector Circulifer tenellus (right). The hairpin structure contains the nonanucleotide sequence (TAATATTAC) shown at position zero in the non-coding, intergenic region. The virion-sense strand contains the coat protein (CP) (V1), a ss/dsDNA regulator (V2) and a putative movement protein (V3). The complementary-sense strand contains the replication-associated protein (Rep) (C1), C2, an enhancer of replication (REn) and a product involved in symptom development (C4). The image of insect was taken from (http://www.biolib.cz/en/image/id41127/). 1.4.7 Topocuvirus Topocuviruses with type member Tomato pseudo-curly top virus (TPCTV), [77] are one of the smallest groups of geminiviruses with a single species. They possess a single monopartite genome of 2.8- 3.0 kb in size and encode six proteins similar to that of the curtoviruses. Topocuviruses are transmitted by treehopper Micrutalis

1: Introduction malleifera and infect dicotyledonous plants [29]. Topocuviruses are found in the New World and might be a result of recombination among mastreviruses and begomoviruses [78].

The TPCTV genome has a similar arrangement as the curtoviruses [79]. The complementary sense strand has four ORFs (C1-C4), but only the function of C1 gene, Rep is known. C3 gene is known to encode a protein which has sequence homology to the begomovirus and curtovirus REn, but its function has not been determined in topocuviruses. The virion strand encodes two proteins, V1 (CP) and V2.

Figure 1.4: Genome organization of Tomato pseudo-curly top virus (TPCTV) (left) and its vector, the treehopper-(Micrutalis malleifera) (right). The genome of TPCTV encodes six genes. The positions and orientations of genes are shown by arrows.The coat protein (CP) and V2 protein are present in the virion-sense andreplication associated protein (Rep), C2 protein, replication enhancer protein (REn) and C4 protein are in the complementary-sense orientation. The hairpin structure contains a nonanucleotide sequence (TAATATTAC) that is part of the loop. Thephoto ofMicrutalis malleifera was taken from (http://www.dpvweb.net). 1.4.8 Becurtovirus Becurtovirus is a divergent geminivirus and contains two known species as Beet curly top Iran virus (BCTIV), its type member and Spinach curly top Arizona virus (SCTAV). BCTIV isolates are further subdivided into four strains (A, B, C and D). The viruliferous leafhopper Circulifer haematoceps, transmits the virus resulting in curly top symptoms as observed in sugar beet [80]. Becurtoviruses have an unusual nonanucleotide sequence (‘‘TAAGATTCC’’ instead of the more

1: Introduction common‘‘TAATATTAC’’) located at origin of virion-strand replication. There are three open reading frames in the virion sense as V1, V2, and V3 and two in the complementary sense as C1 and C2 respectively. Species demarcation is set at 80 % due to limited information among BCTIV and SCTAV isolates.

Becurtoviruses share common features, in case of mastreviruses express a closely related replication-associated protein (Rep) and in case of curtoviruses with a similar capsid protein. Beet curly top Iran virus (BCTIV) contains a chimeric genome that is supposed to be obtained by recombination of mastrevirus and curtovirus like ancestors [81], and is classified under genus becurtovirus, within Geminiviridae family [82].

1.4.9 Eragrovirus Eragrovirus is a new highly divergent geminivirus genus with type member Eragrostis curvula streak virus (ECSV).It contains amonopartite, closed circular, ss DNA, about 2750 nucleotides long. Species type member (ECSV), infects a South African wild grass and has only one recognised species, Eragrostis curvula streak virus [83]. ECSV has two strains, ECSV-A and ECSV-B that cause similar mild streak symptoms as seen in maize infected with maize streak virus (MSV).

ECSV genome encodes four ORFs, the virion sense ORFS correspond to positions of coat protein (CP) and movement protein (MP). The two complementary sense ORFs (C1, C2) also in the similar positions as Rep and TrAP/TrAP-like genes that are present in curtoviruses, topocuviruses and begomoviruses. The MP and TrAP share no homology to gemiviruses while CP and Rep share similarity to geminiviruses [84, 83]. ECSV like BCTIV has a typical nonanucleotide “TAAGATTCC” sequence rather than “TAATATTAC” sequence that is present in all other geminiviruses [76].

1.4.10 Turncurtovirus

Turncurtovirus, another genus has the only recognized species Turnip curly top virus (TCTV) [81,86] which is found in Iran. Turncurtovirus contains a monopartite, ssDNA circular genome with approx. size of 2.9 kb. The virus is transmitted by the vector Circulifer haematoceps [86]. Most of the isolates from Turnip curly top virus are known to infect turnip (Brassica rapa or Raphanus sativus) with symtoms as vein swelling and leaf cupping [81]. Other host ranges identified include Hibiscus trionum,

1: Introduction

Solanum americanum, Anchusa sp., Descurainia sophia [87].

Turncurtoviruses are phylogenetically distinct as the genome encodes 6 proteins and has four strains (A, -B, -C and -D). There are two open reading frames (ORFs) in the virion sense as V1- coat protein and V2 - movement protein and four in the complementary sense as C1-Replication initiator protein, C2 - Transciption activator protein (TrAP), C3- Replication enhancer protein and C4 - symptom determinant. The genome organization of TCTV is more similar to topocuviruses, but, the biological properties are similar to curtoviruses.

Figure 1.5: Genome organizations of becurtoviruses, turncurtoviruses and eragroviruses. The complementary-sense genes are shown as Rep, C2, C4 and the replication enhancer protein (Ren). The virion-sense genes are shown as - coat protein (CP), V2 and V3. The long and small intergenic region (SIR) for becurtoviruses and IR-1 and IR-2 for eragroviruses. A putative hairpin structure is present in the intergenic region with nonanucleotide sequence“TAATATTAC” for eragrovirus and turncurtovirus and “TAAGATTCC” for becurtoviruses. The orientation of genes is shown by arrows. 1.4.11 Capulavirus A newly proposed genus capulavirus is the eighth in the Geminiviridae family and contains highly divergent viruses [28]. The distinct species identified along with hosts include Alfalfa leaf curl virus (Medicago sativa (alfalfa), Euphorbia caput-medusae latent virus (Euphorbia caput-medusae), its type member are French bean severe leaf curl virus (bean; Phaseolus vulgaris) and Plantago lanceolata latent virus (Plantago lanceolata) [88-90]. Only Alfalfa leaf curl virus is transmitted by the aphid Aphis craccivora [90] while other identified species have no vectors reported. The genome organization in capulaviruses has two intergenic regions similar to mastreviruses and becurtoviruses [28]. Rep is expressed from a spliced

1: Introduction complementary strand transcript (C1 and C2), while RepA protein is expressed from an unspliced transcript. The C3 ORF as seen in curtoviruses and begomoviruses is completely embedded within the C1 ORF. The virion sense strand has four ORFs (V1, V2, V3 and V4), the V1 ORF possibly encodes the coat protein, and the V2 ORF is not fully functional while the V3 and V4 ORFs contain transmembrane domains that may encode MPs [91].

Aphis Craccivora

Figure 1.6: Genome organization of capulavirus (left) andAlfalfa leaf curl virus vector (Aphis Craccivora) (right). The genome of capulavirus indicating the complementary sense strand ORFs replication association protein A (C1) and replication associated protein (C1:C2). The virion sense strands ORFs movement protein and coat protein (V1) positioned with arrows. The nonanucleotide motif ‘‘TAATATTAC’’ is positioned in the origin of virion strand replication, the long intergenic region (LIR). Introns are located at overlap regions of C1 and C2 ORFs on complementary strand and V2 and V4 ORFs overlap on virion strand. The short intergenic region (SIR) is also shown. The photo ofAphis Craccivorawastaken from https://bugguide.net/node/view/637420. 1.4.12 Grablovirus Grablovirus is the ninth newly recognized genus withonly a single species Grapevine red blotch virus, known to infect Vitis vinifera (grapevine). The virus is transmitted by the three-cornered alfalfa treehopper, Spissistilus festinus (Hemiptera: Membracidae), [92]. Grablovirus has a monopartite genome of 3.2 kb larger than genome of other geminiviruses.

The genome of Grapevine red blotch virus contains three ORFs (C1, C2, and

1: Introduction

C3) in the complementary sense orientation. The C1 and C2 ORFs are similar to mastreviruses and likely encode the replication-associated protein (Rep) from a spliced transcript. RepA is encoded from the unspliced C1 transcript [93] whileC3 is entirely embedded in the C1 ORF. The virion sense strand contains three ORFs (V1, V2, and V3), the V1 ORF is predicted to encode the grablovirus coat protein and the V2 and V3 ORFs may encode movement proteins [94]. Grabloviruses have the virion strand origin of replication, the nonanucleotide motif “TAATATTAC”.

Spissistilus festinus

Figure 1.7: Genomic organization of grablovirus (left) and three-cornered alfalfa treehopper, (Spissistilus festinus) (right). The complementary sense strand and the virion-sense (V) strand ORFs are indicated with arrows. The stem-loop containing the conserved “TAATATTAC” sequence located in the large intergenic region (LIR) is shown. An intron occurs at the overlap between ORFs C1 and C2. CP, coat protein; MP, movement protein; Rep, replication- associated protein; SIR, short intergenic region. The photo of Spissistilus festinuswas taken from http://www.dpr.ncparks.gov/bugs/view_1.php?id=14370. 1.4.13 Mastrevirus The Mastrevirus genus with type member Maize streak virus (MSV); contains a monopartite (single component) genome with circular (ssDNA) of 2.6-2.8 kb [95-98]. The virus is transmitted through the leafhopper species (Cicadulina) in a circulative, persistent and non-propagative manner. Mastreviruses infect mostly monocotyledoneous plants of the family Gramineae, but a few reported members have dicotyledoneous hosts [99-101], which infect certain species in the Solanaceae and Fabaceae families. The mastrevirus species are found in Australia, Africa, the Middle East and Indian subcontinent [102].

1: Introduction

Mastrevirus genomes comprise four functional ORFs necessary for systemic infection [103]. The virion sense strand genes- V1 (Coat protein) and V2 (Movement protein) are involved in movement and structure. The complementary strand encodes ORFS C1 (Replication Association protein A) and C2 (Replication Association protein) that are involved in replication and transcription. The Replication associated protein B results from the splicing feature of an intronic region present between two Rep proteins [104, 105]. Mastreviruses also have the nonanucleotide motif sequence “TAAT (A/G) TTAC”. The mastreviral genome consists of long and short intergenic regions which contain transcriptional promoter and termination signals, respectively [106].

n o tr in

Figure 1.8: Genome organization of mastreviruses (left) and the leafhopper vector of Chickpea chlorotic dwarf virus, Orosius orientalis (right). The position and orientation of genes are indicated by arrows. The movement protein (MP) and coat protein (CP) genes are encoded on the virion-sense strand while the replication associated protein (Rep; a translation product of the spliced mRNA of the Rep A and Rep B genes) and the RepA protein are encoded by complementary-sense strand. The position of the intron which is removed by the splicing event leading to the mRNA where Rep is translated is indicated. The Rep A protein is the translation product of the unspliced mRNA. The large (LIR) and small intergenic regions (SIR) are indicated. Within the LIR there is a predicted hairpin-loop structure which contains the nonanucleotide sequence (TAATATTAC) as the loop portion. The photo of orosius orientalis was taken from https://upload.wikimedia.org/wikipedia/common s/thumb/8/87/Orosius_orientalis.jpg/240px-Orosius_orientalis.jpg. 1.5 Long and Short Intergenic Regions The mastrevirus genome consists of two non-coding intergenic regions, long intergenic region (LIR) which is ~ 300 nt long, and short intergenic region (SIR) is ~ 150 nt long. Both these regions have sequences that are essential for viral replication

1: Introduction as well as regulation of gene expression [105, 107]. The LIR intergenic region contains a conserved region TAATATTAC where a nick is introduced for replication while in the SIR a sequence is present which is used as a primer for viral replication [22]. In mastreviruses both the SIR and LIR are required for efficient genome amplification while in the other geminiviruses the IR contains the cis-acting signals needed for both negative and positive strand replication initiation [108].

The SIR of mastreviruses, contains a ca 80 nt long primer annealed to viral particle but is absent in other geminivirus genera. The ends of the LIR contain promoters along with TATA-boxes [109] are involved in the expression of the V- and C-sense genes in a bidirectional manner [110, 111]. The genome of WDV has a defined Rep-LIR and core LIR sequences needed for replication [112-115]. A 67 nt sequence region in the LIR has been identified which acts as a replication specificity determinant (RSD) for MSV [116]. Recombination hotspots have also been reported in virion strand origin of replication in the LIR of MSV [117].

1.6 Mastrevirus Genes - Complementary Sense Genes Mastreviruses contain two co-originating complementary-sense transcripts of 1.5 kb and 1.2 kb respectively and are both required for replication [118, 119]. Rep and RepA share 5’-terminal ends but have unique 3’-ends. The spliced version of the mRNA gives rise to Rep, while the unspliced mRNA which accounts for most of all c- sense transcripts, is translated to RepA [120]. Both Rep and RepA happen to be required in the activation of promoters of the V-sense genes [121].

1.6.1 Replication Associated Protein (Rep) Rep or replication-associated protein is the only indispensable single viral protein also known as “AL1” or “C1” in begomoviruses, L1 or C1 in curtoviruses and C1:C2 in mastreviruses. Rep is necessary to initiate nicking of viral origin of replication upon interaction with DNA sequences of the viral DNA in intergenic region. Rep proteins are involved in the gene regulation of most geminiviruses and act as transcriptional activator of late viral genes. Mastrevirus Rep protein (~40 kDa) contains approximately 360 amino acids in length and comprises of the N- and C-terminal portions encoded by the C1 and C2 ORFs, respectively [122].

Rep controls viral DNA replication, sequence-specific DNA binding ability

1: Introduction

[123-125] and site-specific endonucleolytic activity [126-128]. The viral protein REn (also named AL3 in Begomovirus [129], interacts with Rep while mastrevirus Rep interacts with RepA [130]. Rep C2 region has revealed activation of reporter gene transcription in yeast while in the absence of RepA [131], and found that a deletion of the Rep C terminal containing 89 amino acids was necessary for the transcription activation function [130]. Rep contains additional motifs in the C-terminal region such as helicase-like domains, myb-like transcription factors and dNTP binding motifs. The iteron elements recognized by Rep during the analysis of TYDV and BeYDV showed a begomovirus-like arrangement, thus creating a common evolutionary pathway of the dicot-infecting geminiviruses to recognize motifs.The inability of BeYDV-based chimaeric genomes containing MSV LIR or C-sense genes to replicate in tobacco protoplasts is due to lack of the recognition of the Rep-iteron [132]. The Rep protein is also involved in enhancement of WDV and Chloris striate mosaic virus (CSMV) V-sense expression [133].

1.6.2 Replication Associated Protein A (RepA) RepA is a shorter protein around 150 amino acids long and is ~ 31 kDa. RepA is a multifunctional protein and is involved in transactivation of virus-sense ORFs as seen in MSV and WDV [134, 135]. It is thought that RepA performs additional functions during the mastrevirus life cycle [22, 105]. Deletion mutants of the WDV and BeYDV C-sense intron sequences showed that RepA has no direct role in replication but the mutants were found to replicate more efficiently than wild-type genomes, which showed that RepA can control viral replication [136, 137].

RepA binds to a site in the LIR of BeYDV and inhibits its own expression as well as the expression of Rep [134]. In wheat dwarf virus (WDV), Rep A binds to the LIR along with Rep and regulates expression in virion and complementary sense regions [138, 139]. RepA controls cell cycle regulation and developmental pathways and also facilitates interactions with host factors like “geminivirus RepA binding” (GRAB) proteins, and host retinoblastoma-related proteins (pRBR) through an LxCxE motif [140-142]. RepARb−, a pRBR-interaction motif was found to inhibit the virus replication as seen in Bean yellow dwarf virus that pRBR-interaction motif was not vital for inhibition of MSV RepA-mediated replication [143].

1: Introduction

RepA of WDV also forms nucleoprotein complexes with the LIR located close to TATA-boxes that are linked to the V and C- sense promoters [115]. RepA is found to be associated to DNA sequence specific binding functions through the electron microscopy studies [114, 115]. RepA protein of MSV is also involved in the activated transcription of both the HIS3 and lacZ reporter genes in yeast [130].

Figure 1.9: Organization of RepA and Rep proteins. Domains such as RBR protein-interaction domain and GRAB-binding domain are shown here in analogous positions to the Rep DNA binding domain in begomoviruses and curtoviruses. RCR (I, -II and –III) are amino acid motifs conserved in proteins. This figure was reproduced from Gutierrez [22]. 1.6.3 The Virion Sense Genes - Movement Protein (MP) The MP (V1 ORF) of mastreviruses is the smallest of all genes and is necessary for cell movement [146] and is observed to limit systemic spread. The movement of viruses is aided by virus encoded MPs as plant virus-encoded factors. Interactions exist between virus encoded MPs and host proteins which are essential for viable systemic infection [145]. MP has a 10.9 KDa protein that is about 110 amino acids long [147]. In vitro studies confirmed that MP specifically binds to CP and facilitates the movement of an undefined CP-DNA nucleoprotein virus complex out of the nucleus [148, 105]. The MP of MSV is also known to be associated with symptom severity in their hosts [195].

1: Introduction

Structural analysis of the MSV and TYDV MPs showed a highly conserved secondary structure that is a hydrophobic transmembrane region containing a stretch of amino acids [105]. Also, the lack of MSV MP in single cells expression couldn’t reduce viral replication or interfere with virus particles [146]. The accumulation of nuclear ssDNA and dsDNA was inhibited through a microinjection experiment in which MSV DNA and a CP-GFP fusion, along with MP was injected into cells [148]. MSV MP and green fluorescent protein (GFP) fusions showed movements between cells more efficiently than in GFP alone [149].

1.6.4 Coat Protein (CP) Coat protein of geminiviruses is the second largest gene usually encoded as V1, V2, or AV1 on virion strand and considered the only structural protein that has been found as a purified virus preparation. CP is a 28 KDa protein with approximately 250 amino acids long chain. Structure of MSV particles has two incomplete icosohedra containing 110 copies of CP [150]. The cryo-electron microscopy and protein modelling of MSV CP showed that this geminate particle has dimensions of 220 x 380 Å and is made up of 22 capsomers [150].

CPs, have multifunctional roles in early and late function in disassembly and assembly of parental and progeny viruses. The viral DNA present in the infected tissues is determined by CPs through packaging the viral DNA as well as interfering with viral replicative mechanism; however CP is not required for viral replication [146]. An interaction between MP and CP has shown to facilitate both movement and localization of cells [149] a similar behavior was observed in begomovirus proteins. CPs function to encapsidate ssDNA and form a virus particle to protect the viral DNA during insect vector transmission [151] and act as determinant of insect vector specificity [152, 153]. Inoneexperiment in which antiserum was raised against WDV, CP showed a reduction in accumulation of WDV [154]. Monopartite geminiviruses show that CPs are absolutely essential for viral movement [147] and transport function [155]. MSV CP binds non-specifically to ssDNA and dsDNA [156] and facilitates nuclear import of virus DNA both in host and non-host cells as shown in tobacco and maize [141]. CP also contains highly conserved amino acid sequences which are present in various strains of MSV [157- 159] and diverge not more than 2% from among the MSV isolates.

1: Introduction

Figure 1.10: 3D structures of Coat Protein. (A) Capsomere showing individual CP subunits. (B) MSV-A (NG) capsid full structure. These images were reproduced from Zhang [20]. 1.7 Evolution of Mastreviruses The key reason for geminiviruses to evolve is high mutation rates and recombination. Mastreviruses are capable of rapid evolution into new host species while their recombinogenic nature and high mutation rates have shown evidence of virus emergence and adaptation. Two hypothetical theories of mastrevirus evolution exist in which one theory proposed, that codivergance is the primary model of mastrevirus evolution. The second theory suggested that neutral selection is the main model of mastrevirus evolution which best fits in mastreviruses due to their high basal mutation rate [178-180].

1.7.1 High Mutation Rates Mutation rates are defined as probability of a nucleotide substitution per nucleotide. Generally, RNA viruses have high mutation rates than DNA viruses [181, 182] but since ssDNA viruses have been seen to evolve rapidly, therefore their mutation rates are comparable to those of RNA viruses [183]. High rates of mutations have been observed in RNA viruses based on error-prone RNA polymerases [184, 185] while all identified ssDNA viruses replicate using probably high-fidelity host DNA polymerases with higher basal mutation rates higher than their hosts [183]. In mastreviruses, the basal rate of mutation is as high as 2x10-3 mutations per site per year [186].

MSVs as ssDNA viruses have a low degree of mutation [187, 188] due to their

1: Introduction simple structure and complex genome, but the arising mutations can be slightly deleterious. Some experiments under controlled conditions have revealed high rates of evolution in MSV [189] and have shown strand specific G  T mutations that can cause oxidative damage to guanines [186]. Different experiments to measure mutation frequencies were done with an evolution rate of 10-3 and 10-4 subs/site/year. One of the experiments was a MSV population of maize and coix with a genome-wide evolution rate between 2.6 x 10-4 and 5.5 x 10-4 subs/site/year [190] that was maintained within the infected plants.Infectious clones ofTomato yellow leaf curl China virus (TYLCCV) isolate maintained in Nicotiana benthamiana and tomato plants are estimated to have evolution rates of 1.4 x 10-3 and 2.2 x 10-3 subs/site/year which contain the rep gene and the intergenic regions [189].

The high mutation rate of MSV could be due to oxidative deamination reactions that occur on the virion strand of the virus present in a single-stranded state [191]. In various begomovirus species [192] and Rep genes of MSV [193, 194] a high-frequency reversions of non-lethal mutations have been reported and this reversion frequency suggests the presence of a cryptic genome portion that can facilitate repair of such mutations.

1.7.2 Recombination Viruses are capable of evolutionary adaptation due to high basal mutation rates as well as high rates of homologous recombination and reassortment of genome components [242-245]. Recombination has contributed to diversification and evolution of geminiviruses with emergence of new crop diseases [246, 247]. Recombination occurs in geminivirus DNA-B components, geminivirus and satellite molecules as well as in other genera [211, 158]. Due to recombination, viruses have evolved thus providing access of sequence spaces so that accumulation of harmful mutations is prevented. Recombination amongst geminiviruses is associated with alteration of host ranges and pathogenicity.

Recombination events among members of genus, other genera and intergenic recombination events possibly generated new genera [248, 249]. The genomic sequence analyses have evidence for a widespread recombination amongst geminiviruses [250-253]. In geminiviruses, high recombination rates resulted through

1: Introduction replication with combination of rolling circle and recombination dependent mechanisms [243]. Recombination incase of two geminiviruses enter into the same nucleus resulted in a variety of chimeric genomes [217]. Begomoviruses have shown potential recombination hot and cold-spots in insect-transmitted plant viruses. Interspecific homologous recombination has led to the genomic diversification and evolution of begomoviruses [41]. Recombination in mastreviruses such as MSV is an efficient way of generating progeny genomes with better fitness [197]. Mastreviruses with respect to monocot- and dicot-infecting mastreviruses have shown an extensive role in recombination, which is apparently a major feature of mastrevirus evolution.

At present, with a sufficient number of mastrevirus full genome sequences available at the database, several recombination studies have been carried out using designated softwares like RDP3 and RDP4 [198]. Earlier recombination was considered rare in mastreviruses as compared to other genera [199] but evidence of recombination amongst MSV isolates with the most prevalent MSV-A variant in southern Africa (MSV-A4), a recombinant of MSV F / G and MSV B [117] both involved in MSV-A evolution. MSV strains recombine more frequently which result in virulent strains of the viruses such as MSV-A in maize [197]. Mastreviruses have two recombination hotspots and one coldspot. The hotspots are present in the V-origin of replication and near interface of CP and SIR [117] and could specify conflicts between replicative and transcription mechanisms [200].

Begomoviruses have shown conserved patterns of recombination in inter- species geminiviruses that include hot-and cold-spots [200-202] while intra-strain recombination similarities are shown for MSV-A and variants of the begomovirus species, East African cassava mosaic Kenya virus (EACMKV) and East African cassava mosaic virus (EACMV) [203]. In monocot-infecting mastreviruses like MSV, Panicum streak virus and WDV interspecies recombination events frequently occur near the SIR [117].Both inter-species and [205] and inter-strain recombination events involving CpCDV have been recognized [205, 206].

Recombination studies involving (inter-species and intra-species) levels have been extensively studied in dicot-infecting mastreviruses. A number of recombination events have been reported with a total of 16 intra-species and 10 inter-species [207, 176]. In intra-species recombination events, involvement of larger genome fragments

1: Introduction transfers has been detected than in the case of inter-species recombination events [161, 117]. Four new CpCDV strains in Sudan have been identified with complex patterns of recombination in which CpCDV-H is considered the most predominant strain found in Sudan, found to be recombining with several other CpCDV strains present in the country with high frequencies of inter-strain recombination resulting in infections with multiple CpCDV strains [173].

Recombination breakpoint hotspots are present within the LIR and SIR genome regions and more number of recombination breakpoints is seen to occur in the complementary sense genes than in the virion sense genes [206, 203]. In dicot- infecting mastreviruses, three novel strains of CpCDV, (N, O and P) emerged as a result of recombination from about nine parental sequences belonging to other CpCDV strains [173]. Although CpCDV-L has so far only been found in Pakistan, it is likely that the CpCDV-L-like parent of the ancestral recombinant that resulted in the O and N strains could have existed in or out of geographical range of CpCDV.

1.8 Geminiviruses: Replication cycle

1.8.1 Rolling Circle Replication (RCR) and Recombination- Dependent Replication (RDR) In geminiviruses, highly important conserved proteins are essential for viral replication such as Rep also called as AL1, L1 or C1 in the case of bipartite geminiviruses [211], REn called C3 or L3 enhances viral DNA accumulation and is important for high level replication [212] and RepA. Rep functions to catalyse the initiation and termination of the rolling-circle replication by cleaving and ligating viral DNA within the viral genome [213]. Rolling circle replication, RCR [214] and recombination dependent replication, RDR [215] are the two replication strategies used by geminiviruses while RCR is aided by ssDNA containing coliphages like ΦX174 and M13 [216].

Geminivirus replication cycle takes place in nucleus of infected cells through double-stranded (ds) DNA intermediates to form viral minichromosomes [210]. During DNA replication, viral circular ssDNA is released from virion into the nucleus and is converted into circular covalently-closed dsDNA by the host DNA polymerases. The complementary strand is synthesized and viral dsDNA is amplified

1: Introduction and serves as a template for bidirectional transcription. Later on, during the process of RCR, the production of ssDNA takes place that is encapsidated in the viral particles and is involved in CP accumulation and movement.

In addition to RCR, replication by RDR has been less studied but best described in mastreviruses, begomoviruses and curtoviruses [125, 155, 218-222]. In RDR, ssDNAs which are replicated partially or digested by nucleases are repaired via recombination-dependent replication (RDR). The newly synthesized ssDNA acts as a template for replication via complementary strand replication CSR, producing dsDNA products [155, 218]. During the process of replication, the ccc dsDNA is attacked by a short DNA primer extended by host DNA polymerase. During replication newly- synthesized linear ssDNA gets converted partially to linear dsDNA by DNA polymerase complex. A heterogeneous population of linear dsDNAs is generated that accumulate during viral infection in high amounts and get involved for cytosine methylation [52]. Rep initiates the replication of linear dsDNA and ssDNA which are released from the multimeric linear dsDNA and generate circular ssDNA [217].

Both RCR and RDR mechanisms are used in the amplification of DNA genomes of geminiviruses [119, 218]. Viral transcription and DNA replication processes involve cis-acting signals present in a DNA region of divergent promoters. In mastreviruses, primer for complementary-strand DNA synthesis is enclosed in virions and it was observed in wheat dwarf virus [131] and maize streak virus [223] that stem-loop is part of (+) strand origin where deletion analyses showed that mastreviruses require at least 300 bp cis-acting element for the efficient viral DNA replication in cultured cells [125].

1: Introduction

Figure 1.11: Rolling circle replication (RCR) mechanism of geminiviruses. A three step process involved with initiation of complementary strand synthesis of ssDNA into dsDNA which is bidirectionally transcribed and later RCR involved in elongation and termination process of ssDNA products packaged into virus particles for transmission. This figure was reproduced from Pooggin [217].

Figure 1.12: Recombination - dependent replication (RDR) mechanism of geminiviruses. The RDR process does not require an origin of replication and is initiated by 3’ end of ssDNA which are present as overhangs in dsDNA. This figure was reproduced from Pooggin [217].

1: Introduction

1.9 Gene Expression and RNA Silencing (RNAi) Geminivirus gene expression is a complex process which is timely-ordered and involves viral DNA replication as well as host cell modification. A large number of genes are expressed as “early genes” that are involved in viral DNA replication and “late genes” specifically involved in virion structural proteins and lysis processes. Geminiviruses are excellent vectors for foreign gene expression due to their small single-stranded DNA genome. Over expression and suppression of genes in plants was observed by using plant virus based vectors [224]. Geminiviruses are involved in the amplification of foreign genes as well as used to induce gene silencing by using dsRNA obtained from overlapping ORFs of the geminivirus genome [225].

Potato virus X (PVX), Tobacco mosaic virus (TMV), and Tobacco rattle virus (TRV), as reported in different studies [226-229] showed that these viruses are used for protein expression and gene silencing. A non-mobile Maize Streak Virus (MSV)- derived vector is found to produce protein in maize cell cultures [226]. In the cells, the RNA silencing process involves long dsRNAs and hairpin RNAs that are recognized by an endonuclease Dicer and are converted into ~ 22 small RNAs classified into miRNAs and short interfering RNAs (siRNAs). The siRNAs generated by Dicer are loaded into RNA-induced silencing complexes (RISCs) which then unwind the ds siRNA and use one of the RNA strand to target complementary RNA molecules for degradation [230-232].

RNA silencing acts as an antiviral defense mechanism to develop resistance by virus-induced gene silencing mechanism against diseases [233] and require proper anti-sense or hairpin RNAi constructs [234]. Induction of transgene-encoded RNAi in plants [235] has been successful to kill insects through genetic-engineering using dsRNAs target knocking insect-specific genes [236]. RNAi has also been used to inhibit expression of targeted genes and determine their loss-of-function [237]. Its therapeutic approach in humans and mammals has been exploited for disease treatments like viral infections, ocular diseases, neurological disorders, cancer [238- 240] and mouse models are used for effective inhibition of tumor growth [241].

1: Introduction

1.10 Objectives of the study The main objectives of the work reported here was to investigate the diversity of dicot-infecting mastreviruses and their geographic distribution in Pakistan. Additionally the work sought to produce constructs for the infectivity of selected dicot-infecting mastreviruses to satisfy Koch’s postulates. Finally the study aimed to produce constructs for the expression of selected mastrevirus genes in a PVX vector to investigate gene functions, for comparisons between dicot- and monocot-infecting mastreviruses and for comparison to earlier published studies of begomovirus genes that were conducted using a similar expression system.

2. Materials and Methods

2.1 Sample Collection and Storage Leaf samples from chickpea plants, lentils, weeds and other alternate hosts showing symptoms such as yellowing, reddening, dwarfing, chlorosis and stunting were sampled from different geographical regions of Pakistan from 2008 to 2014 and were used in several studies. Samples were photographed and co-ordinates were taken using a Global Positioning System (GPS) instrument (Garmin eTrex). The plant material was placed in nylon bags and stored in -70°C freezer.

2.2 Extraction of DNA from Plant Tissue Total cellular nucleic acids were extracted from plant tissue using the CTAB method modified by Doyle and Doyle [212]. Fresh leaf tissue (~1 g) was crushed into fine powder using liquid nitrogen with pestle and mortar. The crushed tissue was transferred to a 1.5mL microfuge tube and 800 μL of pre-heated CTAB buffer [100mM Tris-HCl (pH 8.0), 20mM EDTA, 1.4M NaCl, 2% (w/v) CTAB and 2 mM β- mercaptoethanol] was added and the tube placed at 65oC. The samples were centrifuged in a microfuge at 14000 rpm for 10 min. the supernatant was then collected. About 600 µL of chloroform-isoamyl alcohol (24:1) was added to the supernatant and the tube centrifuged at 14000 rpm for 10 mins. The clear top layer was transferred to a clean tube and 0.6 volumes of isopropanol was added and the tube was placed at -70oC for thirty minutes. The samples were centrifuged for 15 min. at 14000 rpm and the supernatant was discarded. The pellet was washed with chilled 70% (v/v) ethanol for 5 min, dried at room temperature (RT), resuspended in 50-100 µL of sterile distilled water (SDW) and stored at -20oC.

2.3 DNA Quantification DNA solutions were quantified using either a NanoDrop™ 1000 spectrophotometer

2: Materials and Methods

(Thermo Scientific, Wilmington, USA) or a SmartSpec Plus spectrophotometer (Bio- Rad, Hemel Hempstead, UK). Samples were diluted 50-fold in SDW and the absorbance was measured at 260nm (OD260 of 1 = 50 μg/mL). DNA concentrations were also assessed by comparison to standards of known concentration following agarose gel electrophoresis.

2.4 DNA Amplification 2.4.1 Polymerase Chain Reaction (PCR) PCR amplifications were carried out in a thermocycler (MyCycleTMBio-Rad or Mastercycler Gradient, Eppendorf) in 0.25mL thin-walled PCR tubes.Reaction mixtures of 25 µL were prepared which comprised of 10pg to1µg of template DNA,

2mM dNTPs, 5 µL of 10x PCR Buffer, 1.5mM MgCl2, 0.5µM of each primer and 1.25 units of Taq DNA polymerase (Thermo) and SDW. The PCR machine was programmed for an initial denaturation step of 94°C for 5 min, followed by 35-40 cycles of 94°C for 1 min, 46°C to 52°C for 1 min and 72°C for 1 min (dependent upon the size of the template used). The precise temperature of each step depended upon the primers used. The amplification products were checked on ethidium bromide-stained 1% agarose gels run in TAE buffer (section 2.11).

2.4.2 Rolling Circle Amplification (RCA) Rolling circle amplification (RCA) used an IllustraTempliPhi kit (GE Healthcare Life Sciences) as described previously [287]. In a total reaction mixture of 20 μL, 1 µL of DNA extract (containing about 100 to 200ng of genomic DNA) was used in 5 µL of the provided sample buffer containing 50μM random hexamer primers. This was denatured at 95°C for 3 min and slowly cooled toroom temperature. TempliPhi Reaction Buffer (5 μL) and TempliPhi Enzyme Mix (0.2 μL) was placed in a separate tube and 5 µL of the template DNA primer mix was added and incubated at 30°C for 4-18hr. The enzyme was denatured by heating the sample at 65°C for 10 mins. An aliquot of the reaction mix (1 µL) was checked on ethidium bromide stained 1% agarose gels run in TAE buffer. A successful RCA amplification produces high molecular weight, concatameric DNA.

30 2: Materials and Methods

2.5 Cloning of PCR and RCA Amplified Products 2.5.1 Cloning of PCR Products Amplified PCR products were cloned in the plasmid vector pTZ57R/T using an InsTAclone PCR Cloning Kit (Thermo). The reaction was setup with a total volume of 30 µL containing 3 µLvector (pTZ57R/T), 6 µL 5X ligation buffer, 5 units T4 DNA Ligase and SDW to a volume of 29 μL. Finally 1 µL of PCR product, containing 18 to 540ng of DNA (dependent upon the length of DNA fragment), was added and incubated either at 16°C for 1 hour or overnight at 4°C. Transformation of ligation product into E. coli was by the heat shock method (section 2.7.2).

2.5.2 Cloning of RCA Products The concatameric, RCA-amplified products were digested with selected restriction enzymes to release full length (unit length) products (2.8kb for virus genomes) and then ligated into the plasmid pTZ57R (Thermo) linearized using the same restriction enzyme. Ligation reactions were conducted in a reaction mixture containing 75-150ng vector and 200-500ng insert (1:3), 4 µL 5X ligation buffer and 1 µL T4 DNA ligase made up to 20 µL with SDW. The ligation was placed at 16°C overnight and then transformed into E. coli by the heat shock method (section 2.7.2).

2.6 Purification of DNA 2.6.1 Gel Extraction and PCR Product Purification The Wizard® SV Gel and PCR Clean-Up System from Promega was used for gel elution of desired products run on a 1% agarose gel and excised from the gel under UV illumination. The gel slice was then weighed and placed in a 1.5mL microcentrifuge tube, after which 10 µLof Membrane Binding Solution per 10mg of gel slice was added, vortexed and then incubated at 55-65°C to dissolve the gel slice. An equal volume of Membrane Binding Solution was added to a PCR reaction or the dissolved gel, transferred to a minicolumn assembly, incubated at RT for 1 minute and centrifuged at 4000 rpm in a microfuge. The flowthrough was discarded and the minicolumn was washed by adding 700 µLof Membrane Wash Solution and centrifuged at 4000 rpm for 1 minute. This step was repeated with 500 µL Membrane Wash Solution. The empty Minicolumn, with collection tube, was then centrifuged for 1 minute with the lid open so allow residual ethanol to evaporate. The Minicolumn

31 2: Materials and Methods was placed in new microcentrifuge tube, 50 µL SDW was added, incubated for 1 minute and centrifuged at 13000 rpm in a microfuge. The eluted DNA was stored at - 20°C.

2.6.2 Phenol-Chloroform Purification of DNA Phenol chloroform extraction was used to remove proteins from DNA. An equal volume of phenol: chloroform (1:1) was added to an aqueous DNA sample in a 1.5ml microfuge, vortexed and centrifuged for 5 mins at 13000 rpm in a microfuge. The upper aqueous phase was carefully removed to a new tube and one-tenth the volume of 3M potassium acetate or sodium acetate (pH 5.4) was added and mixed. Then 2.5 volumes of absolute ethanol was added, mixed well and kept at -20°C for one hour. The tube was centrifuged at 13000 rpm for 30 min. The supernatant was discarded and the pellet was washed with 70% (v/v) ethanol. The pellet was finally air-dried for 15 mins and then resuspended in a suitable volume of SDW.

2.7 Preparation and transformation of Heat Shock Competent Escherichia coli Cells 2.7.1 Preparation of Heat Shock Competent E. coli cells Escherichia coli (DH5α or Top10) cells were grown on solid Lauria Bertani (LB) medium (bacto-tryptone 1% [w/v], bacto-yeast extract 0.5% [w/v], NaCl 0.5% [w/v], 1.5% agar) in petri plateat 37°C overnight. A sterile wire loop was used to pick a single colony from a freshly streaked plate of E. coli and transferred to a 50mL flask containing 25mL of liquid LB medium (0.5% [w/v] yeast extract, 1%[w/v] tryptone and 0.5% [w/v] NaCl) and incubated at 37°C in an incubator (GLSC-OSI-HC-196-10, Pamico Technologies). An aliquot (2mL) of the pre-culture was added to 250mL liquid LB in a 1L flask and incubated at 37°C with vigorous shaking until an OD600 of 0.5-1 was obtained. The flask was chilled on ice for 30 minutes, and the cell culture transferred aseptically to sterile disposable 50mL tubes. The cell culture was centrifuged (Eppendorf, 5810R, Hamburg, Germany) at 4000 rpm for 10 minutes at 4°C. The supernatant was discarded and the cell pellet resuspended in 20mL of 0.1M

MgCl2 and centrifuged again as before. The cell pellet was again resuspended in

20mL of 0.1M CaCl2 and incubated for 30 minutes on ice, before pelleting the cells by centrifugation at 4000 rpm for 10 minutes. The supernatant was discarded and the pellet was finally resuspended in 5mL ice-cold 0.1M CaCl2 solution containing 15%

32 2: Materials and Methods

(v/v) glycerol. Aliquots (50 μL) ofthe cell suspension were pipetted into cold microfuge tubes and stored at -80°C in a freezer. 2.7.2 Transformation of Heat-Shock Competent E. coli Cells A tube of competent E. coli cells was thawed on ice and 5-10 µL of a ligation reaction mix was added, mixed and incubated on ice for 30 mins. The cells were given a heat shock at 42°C for about 2 mins and again placed on ice for 2 mins. LB medium (800 µL) was added and incubated for 1 hour at 37°C. The transformed cells were then spread on solid LB medium petri plates containing 100 μg/mL ampicillin, spread with 20 µL X-Gal (50mg/mL) and 100 µL IPTG (24mg/mL) and incubated at 37°C for 16 hours.

2.8 Preparation and transformation of electro- competentAgrobacterium tumefaciens Cells 2.8.1 Preparation of Electro-competent Agrobacterium tumefaciens Cells A single colony of Agrobacterium tumefaciens (EHA105 or GV3101) was streaked on an solid LB petri plate containing 25μg/mL rifampicin. After 48 hours growth at 28°C, a single colony was transferred into a flask containing 100mL liquid LB medium containing 25μg/mL rifampicin using a sterile wire loop. The flask was incubated at 28°C overnight with vigorous shaking (160 rpm). An aliquot (5mL) of the culture was inoculated into a 1L flask containing 250mL LB medium and 10 incubated at 28°C with vigorous shaking until an OD600 of 0.5-1.0 (equivalent to10 cells/mL) was achieved. The cells were aseptically transferred to cold 50mL polypropylene tubes and kept for on ice for 30 minutes. Then the tubes were centrifuged (Eppendorf, 5810R, Hamburg, Germany) at 4000 rpm for 10 minutes at 4°C. The supernatant was discarded and the cell pellet re-suspended in 50mL cold SDW. Again the cells were centrifuged at 4000 rpm at 4°C for 10 minutes and the pelleted cells resuspended in 25mL cold SDW. After washing again, the cells were resuspended in 10mL cold 10% (v/v) glycerol and centrifuged at 4000 rpm at 4°C for 10 minutes. Finally, the cells were resuspended in 2mL filter sterilized cold 10% glycerol and aliquoted 50 µL-100 µL of cells into 1.5mL microcentrifuge tubes and stored at -80°C.

33 2: Materials and Methods

2.8.2 Transformation of Competent Agrobacterium tumefaciens Cells Electro-competent Agrobacterium tumefaciens cells from a glycerol stock kept at - 80°C were thawed on ice. The Agrobacterium cells (50 µL) were gently transferred into a pre-chilled 0.2mm electroporation cuvette, making sure that the bacterial suspension made contact with both sides of the cuvette, and 25ng of DNA was added to cells and the cuvette tapped gently. An electroporator (BTX Harvards) was set at resistance 400 Ω, capacitance 25µF and volts 2.5kV. The cuvette was inserted into the electric shock chamber and the shock was given. Immediately 1mL of liquid LB medium was added and gently mixed by pipetting. The cell suspension was then transferred to a 1.5mL Eppendorf tube and placed in a shaking incubator at 200 rpm and 28°C for 3 hours. Then cells were spread on petri plates with AB minimal medium (K2HPO43g, NaH2PO41g, NH4Cl 1g, MgSO4.7H2O 0.3g, KCl 0.15g,

CaCl20.005g, FeSO4.7H2O 0.0025g, and glucose 20% [w/v] [pH 7.2] in a 1 L volume) with agar (14g) and appropriate antibiotics, wrapped with aluminium foil or sealed with parafilm and placed in a 28°C incubator for 48 hours in darkness. Visible colonies of transformed Agrobacterium were observed after 48 hours.

2.8.3 Agrobacterium-Mediated Inoculation Clones with either binary vectors pGreen0029 or PVX vector pGR107 were electroporated into Agrobacterium strain GV3101 and inoculum was prepared for transient analysis. A single colony was picked from a plate and transferred to 50mL LB medium containing rifampicin (25 µg/mL), kanamycin (50 µg/mL) and tetracycline (10 µg/mL) antibiotics in a 50mL flask. The flask was incubated at 28°C with shaking (160 rpm/min) for48 hrs until an OD600 of 0.6-1 was obtained. The culture was transferred to 50ml polypropylene tubes and centrifuged at 4000 rpm for 15 minutes to harvest the cells. The cell pellet was resuspended in AB minimal medium (pH 5.6) containing acetosyringone (final concentration 100μM) and the tube were placed at room temperature for 3-4 hours before inoculation. For inoculation in N. benthamiana and N. tabacum plants, it was ensured that plants were not watered 24 hours before inoculation. The inoculum was infiltrated in the underside of young healthy N. benthamiana and N. tabacum plants at the 4 to 5 leaf stage using 5mL needleless syringe.

34 2: Materials and Methods

2.9 Isolation of Plasmid DNA A single bacterial colony was picked using a sterile toothpick and inoculated into 5mL of liquid LB broth in a sterile 10mL culture tube containing the appropriate antibiotic (ampicillin [100mg/mL] in most cases). The tube was incubated overnight at 37°C with vigorous shaking. After this 1mL of bacterial culture was placed in a 1.5mL microfuge tube and centrifuged in a microfuge at 13000 rpm for 1 min to pellet the cells. The supernatant was discarded and the pellet resuspended in 100 µL resuspension solution (25mM Tris-HCl [pH 8.0], 100μg/mL RNase A, 50mM glucose and 10mM EDTA [pH 8.0]) by vortexing. Lysis solution (150μL; 0.2N NaOH and 1% [w/v] SDS) was added, mixed gently by inverting the tube and left to stand for 5 minutes at RT. Neutralization solution (200 μL; 3.0M potassium acetate [pH 5.5]) was added, mixed thoroughly and incubated for 5 minutes at RT before centrifuging at 13000 rpm for 10 minutes in a microcentrifuge. The supernatant was transferred to a clean microfuge tube and two volumes of ice-cold ethanol were added. The tube was kept at -20°C for 30 mins and then centrifuged at 13000 rpm in a microfuge for 10 mins. The supernatant was discarded and the pellet washed in 70% ethanol, dried and dissolved in a small volume of SDW.

2.10 Restriction Digestion of DNA A total reaction of 20 µL was setup which included substrate DNA ~1μg (1μL), restriction enzyme 5-10U (0.5-1μL), 2 µL of the 10X recommended buffer for restriction enzyme and 16 µL (nuclease-free water). The tube was briefly centrifuged to collect the contents at the bottom of the tube and placed in incubator at the required optimum temperature of the restriction enzyme (37°C for most enzymes) for 1 hour. After incubation, the DNA fragments sizes were estimated by running the digested PCR or plasmid DNA on an ethidium bromide stained agarose and comparing to a 1 kb DNA marker (Thermo).

2.11 Agarose Gel Electrophoresis DNA was electrophoresed in 1% [w/v] agarose gels containing ethidium bromide (0.5mg/mL). Gels were prepared in a minigel apparatus (12 x 9 cm) or midigel apparatus (18 x 15 cm) (BIORAD, CA, USA), containing either 1X TBE (89mM Tris, 89mM boric acid, 2mM EDTA) or 0.5X TAE (20mM Trisacetate and 0.5mM EDTA [pH 8.0]) buffer. TBE gels were electrophoresed at approximately 40 volts and TAE

35 2: Materials and Methods gels at 100 volts. The ethidium-stained DNA was viewed using a short wavelength ultraviolet (UV) transilluminator using Stratagene Eagle Eye II imaging system (Stratagene, CA, USA) and fragment length estimated by comparison with a co- electrophoresed 1kbp DNA ladder (Thermo).

2.12 DNA Sequencing Plasmids to be sent for DNA sequencing were isolated using various kits such as the GeneJET Plasmid Miniprep Kit (Thermo). Cultures of E. coli grown overnight were transferred to 1.5mLmicrocentrifuge tubes, centrifuged in a microfuge at 13,000 rpm for 2 minutes and the supernantant was discarded. Previous step was repeated 2-3 times to remove all the culture medium. The pellet was resuspended in 250 µL resuspension solution (with RNase A) which was kept at 4°C and vortexed. Lysis solution (250 μL) was added, the tube was inverted 4-6 times to mix the contentsand 350 µL neutralization solution was added, inverted 4-6 times and centrifuged at 13000 rpm for 5 min. Supernatant was then loaded on a GeneJET™ spin column to bind the DNA onto the matrix, centrifuged for one minute and theflow-through present in the collection tube was discarded. The column was then washed by adding 500 µL of wash solution then centrifuged for 30-60s. The flow-through was discarded and this washing step was repeated twice. Then the empty column was centrifuged for one minute to remove residual ethanol. The column was then inserted into a fresh microcentrifuge tube and 100 µL nuclease free water was added (for storage at - 20°C), or TE buffer (1M Tris-HCl (pH 8.0), 0.2 ml EDTA (0.5 M) (for storage at 4°C) by adding 11 µL of 10X TE buffer to the 100 µL of eluted DNA. After incubating for 2 minutes, the tube was centrifuged for 2 minutes and the resulting purified DNA was stored at -20 or 4°C.

2.13 Sequencing and Sequence Analysis Plasmid clones with inserts to be sequenced were purified using GeneJET Plasmid Kit (Thermo) and sequenced by Macrogen (South Korea or Europe) by the dideoxy chain- termination technique [313]. For sequencing, universal primers (M13F-20 and M13R- 20) were used initially. Sequences were extended by designing specific primers to the sequence obtained (primer walking). Sequence data was assembled and analyzed using the Lasergene package of sequence analysis software (DNA Star Inc., Madison, WI, USA). Sequence similarity searches were performed at NCBI site using

36 2: Materials and Methods

BLASTn (http://blast.ncbi.nlm.nih.gov).ORF Finder (http://www.ncbi.nlm.nih.gov/go rf/gorf.html) was used to identify open reading frames (ORFs; potential genes). Sequences of viruses identified were submitted to the EMBL nucleotide sequence database (http://www.ebi.ac.uk/ena). Sequence alignments and Phylogenetic trees were produced using the Lasergene package MegAlign program or MEGA6 [289].

2.14 Preparation of Glycerol Stocks Glycerol stocks were prepared for the preservation of bacterial cultures. In a 1.5mL microfuge tube 300 µL of sterilized glycerol and 700 µL of a fresh, overnight bacterial cell culture was added, mixed and stored at -80°C. The bacterial cultures were recovered from glycerol stocks by streaking a small amount of the culture on petri plates with solid LB containing a suitable antibiotic. Plates were then incubated overnight at either 37°C for E. coli cultures or 28°C for A. tumefaciens cultures.

2.15 Plant Material and Growth Conditions N. benthamiana plants were grown in a glass house at 25°C with 16 hour dark/8 hour light period and 65% humidity. Plants were grown in small plastic pots containing compost, clay and silt in equal amounts. Plants were watered twice daily and once a week with Hoagland solution (1.5mM Ca(NO3)2.4H2O, 0.75mM MgSO4.7H2O,

1.25mM KNO3, 0.5mM KH2PO4, micronutrients [15μM MnCl2.4H2O, 50μM H3BO3,

0.5μM Na2MoO4.2H2O, 2.0M ZnSO4.7H2O, 1.5μM CuSO4.5H2O] and Fe-EDTA

[30μM FeSO4.7H2O, 30μM EDTA.2Na, 1mM KOH].

2.16 Photography and Computer Graphics Photographs of plants were taken using a digital camera (DSC W50, Sony). Digital photographs were edited and manipulated using the programs Paint (Microsoft) and CorelDRAW Graphics Suite X5 (http://www.coreldraw.com). Virus genomes and plasmid diagrams were drawn using the BVTech plasmid program (http://www.biovisualtech.com).

2.17 Southern Blot Analysis After electrophoresis, the agarose gel was taken out of the chamber and was cut on a very clean glass plate with a fresh blade to the right size and upper right corner was marked. The gel was treated with at least two volumes of 0.25M HCl for 10 min with

37 2: Materials and Methods moderate agitation and then rinsed twice with SDW and equilibrated twice in 1x transfer buffer (600mM NaCl). The gel was then placed in the capillary transfer apparatus shown in Figure 2-1 and left overnight. The apparatus was then taken apart and the membrane equilibrated with ~200mL neutralization solution buffer (1.5M NaCl, 0.5M Tris [pH 7.5]) for at least 10 min. without agitation. The membrane was air dried and stored at RT.

For hybridization 50 µL of DIG labelling reaction (section 2.17.1) was diluted with 50 µL SDW in a microfuge tube. The probe was denaturated by heating the tube at 95°C for 10 min. The probe was snap cooled on ice for 10 min. and then added to 40mL DIG Easy Hyb (Sigma-Aldrich). In the meantime,30mL of DIG Easy Hyb without probe was added to the membrane in a hybridisation bottle and incubated for 3 hours or more with rolling in a hybridisation oven ((Hybaid, Midi-dual 14) at 42°C. The DIG Easy Hyb without probe was replaced with the DIG Easy Hyb with probe, after denaturing, and left overnight in the oven. The DIG Easy Hyb with probe was removed and retained for future use. The membrane was washed four times with 2x

SSPE (3M NaCl, 0.2M NaH2PO4, 20mMNa-EDTA, 20mM, 0.5M NaOH [pH 7.4]) with 0.3% [w/v] SDS at 42°C. For stringent detection the oven temperature was increased to 65°C for 5 mins. Then the membrane was washed two times with 0.2x SSPE without SDS at 65°C for 5 minutes.

For detection the membrane was washed for 5 min in approx. 100mL of DIG Buffer 1(100mM Maleic acid, 150mM NaCl, NaOH pH 7.5) at 30-42°C, then incubated in 30mL blocking solution (1% Blocking Reagent in buffer 1) for at least 2- 4 hours. The blocking solution was replaced by 20mL AK-Anti Digoxgenin solution (diluted 1:10 000 in blocking reagent) and rolled for 30 min at RT. After that the membrane was rinsed 1x with 300mL of wash buffer 2 (Buffer 1 with 0.3% [v/v] Tween-20), washed 4x at intervals of 10 mins with wash buffer 2 and equilibrated for 5 min in 200mL of substrate buffer (100mM Tris-HCl [pH 9.5], 100mM NaCl). Finally, 25mL of substrate solution (CDP*/CSPD 1/100 or 1/200 diluted in buffer 3), was added and incubated at room temperature for 5 to10 min. The membrane was carefully taken out of the glass tube with clean forceps and immediately wrapped in cling film and placed in an X-ray cassette and exposed to X- ray film (Super RX, Fuji film) for 15-30 minutes. The X-ray film was removed from the cassette in a dark room with red safelights and placed in a tray containing

38 2: Materials and Methods developer solution (Fuji; 150g of developer dissolved in 1L SDW) and agitated gently for some time (30 s to 2 min, depending on signal intensity). The film was then washed in water and transferred to a tray containing fixer solution (Fuji; 120g fixer dissolved in 1L SDW) for 10 min with gentle agitation, and then washed with water and air dried.

2.17.1 Synthesis of DIG-labelled Probes To label a DNA fragment with digoxigenin (DIG), a PCR DIG probe synthesis kit (Roche, Germany) was used. Reactions (50 µL) consisted of 5 µL of 10x PCR buffer with MgCl2, 5 µL PCR DIG Probe synthesis mix (200µM dATP, dCTP, dGTP, 130µM dTTP and 70µM DIG-dUTP), 1 µL (0.5µM) of each primer, 1 µL enzyme mix provided with the kit, 5 µL template DNA (1-50ng for genomic DNA and 10-100pg for plasmid DNA) and SDW to make up the volume. Reagents were mixed and centrifuged briefly. The reaction mixture was incubated in a thermocycler (Eppendorf master cycler) and the PCR profile was set according to the length of DNA fragment as described in section 2.4.1.

Weight

Glass plate

Paper Towels Whatman 3MM paper Hybond N Gel

Support Transfer Wick buffer

Figure 2.1: Southern blot apparatus for the transfer of DNA from an agarose gel to a nylon membrane.

39 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

3. Diversity of Dicot-infecting Mastreviruses in Pakistan

3.1 Introduction The distinct feature of viruses of the genus Mastrevirus is that they infect either monocotyledonous or dicotyledonous plants. Mastreviruses have long been known to be widespread in Sub-Saharan Africa, Australia, Europe and Asian regions. The monocot-infecting mastreviruses were, until recently, believed to be geographically distributed only in the Old World but some have been reported in the New World including a very distinct maize infecting mastrevirus which may be native to only Brazil [196, 371]. To understand the diversity of mastreviruses, sequencing of the whole genome is the norm and a number of monocot- and dicot-infecting species have been reported [158, 160, 161, 159]. Mastreviruses occurring across Africa among which the most common are the “African streak viruses” that infect annual and perennial grasses. Streak viruses are transmitted by Cicadulina species, the most common of which is Cicadulina mbila which has a high transmission rate of Maize streak virus [162]. During the early 1500s, Portuguese traders brought Maize into West Africa and it moved towards southern Africa in the mid-1600s [163]. Maize streak disease was reported in 1901 in South African by the entomologist Claude Fuller, who described the disease as a “mealie variegation”, where MSD affected maize was known since since the 1870s. The disease was later renamed by Storey as ‘maize streak virus disease’ in 1925 [96].

3.1.1 Monocot-infecting Mastreviruses The majority of mastreviruses infect members of the family Poaceae (also known as the Gramineae; monocotyledonous flowering plants known as grasses. To date twenty-five species of monocot-infecting mastreviruses have been documented, all identified in the Old World. Among them, twelve species have been identified in Africa and the south-west Indian Ocean islands, nine in Australia, three in Eurasia and one in Japan [30]. Maize streak virus (MSV) is the most important and well-studied virus due to its devastating impact on maize, a staple crop in Africa [275]. The

40 3: Diversity of Dicot-infecting Mastreviruses in Pakistan prominent symptoms include chlorosis in the form of striations or mosaic patterns that cause reduction of crop yield and stunting of plant. MSV has about 11 identified strains [117] , among which MSV-A is the only strain that results in serious disease in maize [158] whereas the other MSV strains from MSV-B to MSV-K infect wild grass species [117, 167].

The monocot-infecting mastreviruses can be divided into the African streak mastreviruses, Australian striate mosaic mastreviruses, Japan-Pacific mastreviruses and the Eurasian mastreviruses [154, 164, 165, 168-171, 205]. Among the African streak mastreviruses, Sugarcane white streak virus was isolated from sugarcane germplasm, originating from Sudan, grown in Barbados and is the third example of a mastrevirus identified in the New World [282]. Deep sequencing was used to identify a mastrevirus in switch grass with mosaic-like symptoms in North American [284] using Illumina HiSeq 2000 (San Diego, CA) thus showing the existence of another mastrevirus found in a grass. Also other studies using NGS lead to identification of novel geminiviral genomes using viral DNA or short interfering RNA (siRNA) analyses, such is a case in which small RNAs were used as template to identify mastrevirus-like sequences in sweet potato [279, 285, 286].

3.1.2 Dicot-infecting Mastreviruses Mastreviruses are recognized as potentially important threats to the production of crops such as chickpea (Cicer arietinum), lentil (Lens culinaris), bean (Phaseolus vulgaris), and tobacco (Nicotianatabacum) [204, 259, 333, 65]. These economically important crops contribute significantly to the diets of large numbers of people in Asia, Africa, and South America [254]. Lentil is an important winter season crop and is grown in most areas of Punjab, Pakistan, and a number of viral diseases have posed a significant loss to the production of lentils with at least 10 viruses known to naturally infect the crop [222, 223]. Some of the common viruses known to infect lentils in Pakistan include Pea seed-borne mosaic virus (PSbMV), cucumber mosaic virus (CMV) [224], Beet western yellows virus (BWYV), Faba bean necrotic yellows virus (FBNYV) [225], and Chickpea chlorotic dwarf virus (CpCDV) [102].

Chickpea (Cicer arietinum L.), an important annual grain legume is grown in western Asia, the Indian subcontinent, Australia, and the Mediterranean. India is one of the world’s largest producers of chickpea, with about 15 times more production

41 3: Diversity of Dicot-infecting Mastreviruses in Pakistan than Australia and Pakistan, while other key producers include Turkey, Burma, Ethiopia, and Iran (FAOSTAT, 2013) [255]. The productivity of chickpea has been affected by chickpea stunt disease (CSD) that was identified in early 1991 by Nene [372]. CSD is not only ascribed to luteoviruses and geminiviruses, but also caused Chickpea chlorotic dwarf virus (CpCDV) inducing characteristic symptoms such as stunting, internode shortening, phloem browning in the collar region, leaf reddening and leaf yellowing [373, 374]. CpCDV is known to be transmitted by the leafhopper species Orosius orientalis [100] and Orosius albicinctus [256, 257], these vectors are found across the Middle East and Australia [258].

So far, seven species of dicot-infecting mastreviruses have been identified, five of which have been documented in Australia: Chickpea redleaf virus (CpRLV), chickpea yellows virus (CpYV), Chickpea chlorosis virus (CpCV), Chickpea chlorosis Australia virus (CpCAV), and Tobacco yellow dwarf virus(TYDV) [99, 175- 177]. The sixth species, CpCDV has a wide geographical range identified in Africa, the Middle East and the Indian subcontinent while the seventh speciesChickpea yellow dwarf virus (CpYDV), has only been found in Pakistan [102]. To date, eighteen identified strains of CpCDV have been identified from Africa (Morocco, Sudan and South Africa, Eritrea), Syria, Turkey, Oman, Yemen, Iran, Asia (Pakistan and India), Australia and Burkina Faso [85]. However, the diversification of strains was more prevalent in Sudan with about 11 strains known (C, F, H, I, K, and M to P) [173].

A number of natural hosts have been identified in the field infected by dicot- mastreviruses which include chickpea, lentils, field pea, faba bean [268, 269], French bean, [270], Sesbania bispinosa (Jacq.; [268], sugar beet (Beta vulgaris L.; [271], pepper (Capsicum annum L.; [272], cotton (Gossypium sp.[273], squash (Cucurbita pepo L.; [65], papaya (Carica papaya; [85], watermelon (Citrullus lanatus) [172], cucumber [74], as well as alternate (weed) hosts such as common vetch (Vicia sativa ssp. Sativa).

Recombination has been a driving force in the evolution of dicot-infecting mastreviruses [276] and co-infections between a mastrevirus and begomoviruses have been reported [277]. The presence of CpCDV in cotton plants with cotton leaf curl disease symptoms was an important discovery and the notion that CpCDV could be

42 3: Diversity of Dicot-infecting Mastreviruses in Pakistan transmitted by Bemisia tabaci, the whitefly vector of begomoviruses, by trans- encpasidation of the CpCDV genome in the coat protein of a begomovirus needs to be investigated [273]. Also other earlier co-infection studies included the presence of CpCDV along with Cotton leaf curl Kokhran virus strain Burewala and the DNA A component of Tomato leaf curl virus (previously called Tomato leaf curl Gujarat virus) and satellites in the weed Xanthium strumarium [244].

A number of mastreviruses have emerged from different geographically distant locations including the New World. A partial mastrevirus genome identified in sweet potato reported from Peru is an indication that mastreviruses are naturally found, or haves been introduced by humans to the New World [279]. Dragonflies were targeted, to detect novel mastreviruses and an alphasatellite-like molecule was reported from the Caribbean islands [53, 280]. Also, the discovery of novel mastrevirus and alphasatellites in New World raises the possibility that mastreviruses and alphasatellites were introduced into the Americas [281].

In the earlier days, serological assays were a common diagnostic method for identifying mastrevirus in samples using monoclonal antibodies or polyclonal antiserum in serological tests such as dot-blot ELISA, direct antigen-coating ELISA and double antibody sandwich enzyme-linked immunosorbent assays (ELISA) [227- 229]. However, due to cross reactivity issues, it was not an appropriate method to identify different species of mastrevirus [230]. The discovery of novel geminiviruses has increased due to viral metagenomics, and approaches such as Next generation sequencing (NGS). The use of deep sequencing techniques has eased the identification of novel plant viruses and more sampling of unknown viruses associated with hosts [283]. Recently NGS analyses have shown that CpCDV is the causal agent of “Hard Fruit Syndrome” of watermelon in Tunisia [174].

The objective of this study was to investigate the diversity of dicot-infecting mastreviruses in Pakistan and characterize them at the molecular level. The diversity of dicot-infecting mastreviruses in Southern Asia needs to be further explored within the major pulse growing regions to provide useful information on the evolution and origins of dicot-infecting mastreviruses.

43 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

3.2 Materials and Methods

3.2.1 Field Survey and Sample Collection Plant samples were collected from Punjab and parts of Sindh province in Pakistan during the months of February and March (2008 to 2013). Leaf samples from plants with typical CSD symptoms (foliar yellowing, reddening and plant stunting; Figure 3.2) were sampled from chickpea, lentil and weeds such as Vicia sativa. The study comprised of approx. 382 samples collected in the vicinity of the cities of Bahawalnagar (n = 15), Rahim Yar Khan (n = 11), Bhakkar (n = 25), Chakwal (n = 6), Faisalabad (n = 100), Layyah (n = 23), Jhang (n = 30), Khushab (n = 25), Mianwali (n = 30), Muzaffargarh (n = 10) and Hyderabad (n = 25). Lentil (Lens culinaris; n= 75) and common vetch (Vicia sativa; n=7) plants with yellowing and stunting symptoms, similar to CSD symptoms, were collected from Faisalabad. The geographic coordinates of plant samples collected were obtained using a handheld Global Positioning System (GPS) device. A chickpea sample originating from Syria with CSD symptoms was kindly provided by Dr. S.G. Kumari. The sample from Syria, with field isolate code SC3-03 [266], originated from a chickpea field at the International Center for Agricultural Research in the Dry Area (ICARDA) farm, near Aleppo (36.01N, 36.56E).

3.2.2 DNA Extraction and Viral DNA Amplification Total DNA was extracted from apparently healthy and symptomatic leaf samples using the CTAB method [325]. Viral DNA in the nucleic acid samples was amplified by PCR using a pair of oligonucleotide primers (DMF-5ʹ GTCGACGATGATATTATAGGTGGCG, 3ʹ/ DMR5ʹGTCGACATCCCCTTCAAGTT CGTCC-3ʹ) designed to amplify dicot-infecting mastreviruses [268]. Circular DNA molecules in samples were amplified by means of rolling-circle amplification (RCA), using phi29 DNA polymerase (Thermo, Arlington, Canada) [287]. PCR products were cloned in the plasmid vector pTZ57R/T (Thermo). The concatameric, RCA-amplified products were digested with EcoRI or HindIII to yield ~2.6 kb unit-length genomes and ligated into EcoRI or HindIII linearised plasmid pTZ57R (Thermo). Plasmid DNAs were purified using a GeneJET Plasmid Miniprep Kit (Thermo) and sequenced commercially by Macrogen (Seoul, South Korea).

44 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

3.2.3 Next Generation Sequencing RCA amplified samples were used for high throughput sequencing. Library construction was carried out with the Illumina Nextera sample preparation kit, utilizing the first version of the 96-plex dual indexing adapter set, according to the manufacturer’s protocol (Product numbers FC-121-1031 and FC-121-1012, Illumina, Inc, San Diego CA, www.illumina.com). Samples were processed as 3 pools of 48 libraries, plus one pool of 12 libraries. Fragments with adapter molecules on both ends were amplified by 10-12 cycles of PCR and selected for size by AMPure XP magnetic beads (Product number A63881, Beckman Coulter, Brea CA, www.beckmangenomics.com) as directed by the Illumina Nextera sample prep protocol. Each library pool was assayed for size distribution on an Agilent 2200 TapeStation with a High Sensitivity D1000 ScreenTape (Product number 5067-5584, Agilent Technologies, Santa Clara, CA, www.genomics.agilent.com) and for concentration with an Illumina library quantification kit (Product number KK4854, Kapa Biosystems, Inc, Woburn MA, www.kapabiosystems.com) on a qPCR instrument (LightCycler 480, Roche Applied Science, Indianapolis IN, http://lifescience.roche.com). Paired-end 2 x 150 bp sequencing was carried out on an Illumina MiSeq instrument utilizing MiSeq version 3 (Illumina product number MS- 102-3003) flow cells and chemistry. Automated base calling, demultiplexing, and conversion to FASTQ format was performed by on-board MiSeq Reporter software. Resulting sequences were analyzed using CLC Genomics Workbench 7.0.

3.2.4 Sequence Assembly and Analysis Sequence information was assembled using the SeqMan program of the Lasergene sequence analysis package (DNAStar Inc., Madison, WI, USA). ORFs were predicted using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Multiple sequences were aligned using the algorithm MUSCLE [288] implemented in MEGA6 [289]. Phylogenetic trees were constructed using the Maximum Likelihood method based on the Jukes-Cantor model [290] and rooted with an out group. Percentage pairwise sequence similarities were determined using the sequence demarcation tool (SDT) v1.2 [30].

45 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

3.2.5 Agrobacterium-Mediated Inoculation A construct for the Agrobacterium-mediated inoculation of the virus clone described in section 3.3.9 was produced essentially as described previously [291]. The full- length clone was restricted with EcoRI and XhoI, releasing fragments of 2.8 kb, 2.2 kb and 334 bp, or with EcoRI and ClaI, releasing fragments sizes of 2.8 kb, 2.2 kb and 357 bp. The two 2.2 kb fragments were gel isolated and ligated, in a single step, into the binary vector pGreen0029 restricted with ClaI and XhoI to yield a partial, direct repeat of the monomeric clone. The pGreen construct was transformed into Agrobacterium tumefaciens strain GV3101 by electroporation and cultures were prepared and inoculated into Nicotiana benthamiana plants as described previously [292].

3.3 Results

3.3.1 Screening of Dicot-Infecting Mastreviruses To study the diversity among dicot-infecting mastreviruses from different areas of Pakistan, infected crops and weeds with CSD-like symptoms were surveyed (Figure 3.2), and a detailed screening was done using several methods including PCR, PCR- RFLP, RCA and Southern Hybridization. The samples collected included chickpeas, lentils, alternate weed hosts and other unknown infected plants for the identification of mastreviruses.

Among the several samples screened, only 20 full-length dicot-mastrevirus genomes were obtained by RCA with product sizes ranging from 2.5 to 2.7 kb. Of these 13 of the isolates (9 from chickpea and 4 from lentil) were sequenced using the Sanger sequencing method while 7 of the isolates (1 from chickpea and 6 from lentil) were sequenced by Illumina-Next Generation Sequencing (NGS), with detailed information provided in (Table 3.1). The greatest number of sequenced viruses and alternate hosts were obtained from Faisalabad as compared to other cities. The sequences were later on confirmed through BLASTn at NCBI database and closely related sequences were collected in FASTA format, aligned and analyzed using MEGA6 software [289].

46 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

Figure 3.1: Map of Pakistan showing areas from which virus infected samples were obtained.

47 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

Figure 3.2: Symptoms exhibited by plants collected from various fields. Chickpeaplants with foliar yellowing (A) or foliar reddening (B). Lentil plants with foliar yellowing (C, D) and common vetch (Vicia sativa) plants with foliar yellowing (E, F).

48 3: Diversity of Dicot-infecting Mastreviruses in Pakistan Table 3.1: Sequences and features of dicot-infecting mastrevirus obtained in the study. Accession no./ Location/Year/Coordinates Virus/Strain Host Clone name/ Size (nt.) V1/MP V2/CP C1/ REPA C2/REPB C1: C2/REP chickpea Bahawalnagar/ FR687960/ 133-414/ 427-1164/ 1535-2494/ 1323-1757/ 1323-1733/1823-2413/ CpCDV-D (Cicer arietinum) 2008/NA$ BGR-3/2587 93/10.62 245/26.99 319/36.67 144/16.59 333/39.19 CpCDV-A Syria/2008/ FR687959/ 131-409/ 422-1159/ 1529-2407/ 1320-1739/ 1320-1730/1817-2407 chickpea 36.01N, 36.56E SYR-2/2572 92/10.23 245/27.00 292/33.44 143/16.1 337/39.5 CpCDV-C Faisalabad/2010 HG934858/ 132-410/ 423-1160/ 2030-2500/ 1319-1753/ 1319-1732/2033-2500 chickpea "31.39801 N 073.03096 E" NIAB-C/2675 92/10.32 245/26.96 156/18.61 144/16.73 293/34.54 CpCDV-D lentil Faisalabad/2012 KM377671/ 142-420/ 433-1170/ 1541-2497/ 1329-1760/ 1329-1736/1826-2416/ (Lens culinaris) "31.39755 N 0.7303092 E" PK43/2592 92/10.27 245/27.00 318/36.59 143/16.41 332/39.00 CpCDV-D Faisalabad/2012 KM377672/ 133-411/ 424-1161/ 1532-2410/ 1320-1754/ 1320-1730/1820-2410/ chickpea "31.39688 N 073.03026 E" PK103A/2585 92/10.25 245/26.99 292/33.55 144/16.57 333/39.16 CpCDV-D Faisalabad/2012 KM377668/ 133-411/ 424-1161/ 1531-2490/ 1319-1753/ 1319-1729/1819-2409 chickpea "31.39676 N 073.03013 E" PK31/2584 92/10.31 245/26.93 319/36.78 144/16.53 333/39.01 CpCDV-D Faisalabad/2012 KM377670/ 132-410/ 423-1160/ 1531-2490/ 1319-1753/ 1319-1729/1819-2409 chickpea "31.39666 N 073.03003 E" PK37A/2584 92/10.25 245/27.00 319/36.74 144/16.60 333/39.19 CpCDV-H Faisalabad/2012 KM377669/ 131-409/ 422-1159/ 1529-2407/ 1317-1751/ 1317-1727/1817-2407 chickpea "31.39661 N 073.02993 E" PK32/2561 92/10.28 245/27.03 292/33.70 144/16.72 333/39.16 CpYDV Faisalabad/2012 KM377674/ 124-429/ 413-1177/ 1531-2418/ 1531-1859/ 1319-1719/1822-2418 chickpea "31.39549 N 073.02897 E" PK103B/2547 101/11.16 254/28.46 295/33.86 153/17.26 336/39.34 CpCDV-C Faisalabad/2012 KM377673/ 132-410/ 423-1160/ 1531-2409/ 1319-1753/ 1319-1732/1819-2409 lentil "31.39539 N 073.02883 E" LE-E/2584 92/10.32 245/26.96 292/33.48 144/16.73 334/39.38 Faisalabad/2012 KM377675/ 124-429/ 413-1177/ 1531-2418/ 1531-1862/ 1319-1732/1822-2418 CpYDV chickpea "31.39705 N 073.02899 E" PK37B/2547 102/11.13 254/28.46 295/33.91 153/17.24 336/39.34 *NGS-(213 Reads) CpCDV-C Faisalabad/2012/ 132-410/ 423-1160/ 1529-2407/ 1317-1751/ lentil Reference based 1317-1730/1817-2407/ "31.39681 N 073.02932 E" 92/10.32 245/ 26.96 292/33.61 144/16.72 LN865160/ LE-6/2474 334/39.44 *NGS-(217132 Reads) Faisalabad/2012/ 133-411/ 424-1161/ 1532-2491/ 1320-1754/ CpCDV-D lentil de novo based 1320-1730/1820-2410/ "31.39687 N 073.02929 E" 92/10.27 245/27.00 319/36.67 144/16.59 LN865161/LE-9/2585 333/39.18 *NGS-(11 976 Reads) CpCDV-C Faisalabad/2012/ 132-410/ 423-1160/ 1531-2409/ 1319-1753/ lentil Reference based 1319-1732/1819-2409/ "31.39694 N 073.02919 E" 92/10.32 245/26.96 292/33.62 144/16.73 LN865158/LE-1A/2584 334/39.46 *NGS- (1223 Reads) CpCDV-C Faisalabad/2012/ 132-410/ 423-1160/ 1531/2409/ 1319-1753/ lentil Reference based 1319-1732/1819-2409/ "31.39711 N 073.02897 E" 92/10.32 245/26.96 292/33.62 144/16.72 LN865159/LE-2A/2584 334/39.45 *NGS-(644 Reads) CpCDV-C Faisalabad/2012/ 132-410/ 423-1160/ 1531/2409/ chickpea Reference based 1319-1753/ 1319-1732/1819-2409/ "31.39801 N073.03196 E" 92/10.32 245/26.96 292/33.64 LN864701/NN-1/2584 144/16.63 334/39.44 CpCDV-D *NGS-(1670 Reads) Faisalabad/2012/ 133-411/ 424-1161/ 1532-2491/ 1320-1754/ lentil de novo based 1320-1730/1820-2410/ "31.39705 N 073.02899 E" 92/10.27 245/27.00 319/36.65 144/16.59 LN865162/LE-11/2585 333/39.17 *NGS-(1709 Reads) CpCDV-C Faisalabad/2012/ 132-410/ 423-1160/ 1530-2408/ 1318-1752/ lentil de novo based 1318-1731/1818-2408/ "31.39736 N 073.02925 E" 92/10.32 245/26.96 292/33.59 144/16.73 LN865163/LE-13/2583 334/39.44

CpCDV-C Faisalabad/ 2012/ LN864703/ 133-411/ 424-1161/ 1530-2408/ 1319 -1752/ lentil 1318-1731/1818-2408 "31.3974 N 73.0293 E" LE-49/2583 92/10.32 245/26.95 292/33.62 144/16.70 334/39.44 CpCDV-C Faisalabad/ 2012/ LN864702/ 133-411/ 424-1161/ 1532-2410/ 1320-1754/ 1320-1733/1820-2410/ lentil "31.3976 N 73.0291 E" LE-50/2587 92/10.32 245/27.02 292/33.65 144/16.75 334/39.47 * Sequences obtained by high throughput sequencing are either obtained by de novo assembly or reference based assembly.$ Sample provided by a farmer. No geographic coordinates available.

49 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

3.3.2 PCR and RFLP PCR amplification of all isolates was conducted using degenerate primers CpCDV F5ʹ TAAAAGGCGCACTAATGGGTAGACCGTAGA-3ʹ, and CpCDV R- 5ʹGAAGTACACTCGGAAATAACCATTTACATA3ʹ. Samples yielding amplification products in the range of 400 to ~1052 bp were further restricted with set of enzymes that included EcoR1, HindIII and Pst1 resulting in DNA fragment sizes in range of (391-1913bp). Eluted fragments were cloned in pGEM-3Zf (+) and sequenced to identify the partial fragments.

Restriction fragment length polymorphisms (RFLP) was used to show a sequence variation among the isolates infected with CpCDV. A PCR-generated restriction fragment length polymorphisms (RFLPs) was performed on 12 infected chickpea isolates from different locations of Jhang, Bhakkar, Layyah and Khushab districts to check the different restriction patterns using the four selective enzymes; Sau 3AI, RsaI, HaeIII and AluI. The detailed information of isolates used is presented in Table 3.2 and figures of gel pictures is shown in (Figure 3.3).

The banding pattern in in vitro RFLP (Figure 3.3) behaved slightly differently and apparently partial digests obtained made it difficult to distinguish. However, similar restriction patterns were seen in most isolates while the AluI enzyme gave same restriction pattern in all isolates. Similar banding patterns would indicate that the sequences of the viruses are similar [159]. To compare with the above restriction pattern in Figure 3.3, in silico digests of 8 CpCDV isolates were performed using the Benchling tool, which included two chickpea infected isolates from Sudan (Cp-SD32 and Cp-SD265) and six isolates from Pakistan, 4 chickpea and 2 lentils (Cp-NN-1, Cp-BGR-3, LE-6, LE-9, Cp-CCDV8 and Cp-CCDV14). Multiple and unique restriction patterns were achieved with at least one enzyme in each isolate (Figure 3.4). Mixed infections could be the cause of the differences in intensity of the different banding patterns [159]. Interestingly the banding pattern of CpCDV isolate Cp-BGR3 and LE-9 were similar, which could indicate that the isolates are related. The predicted restriction patterns of the clones differ from the in vitro RFLP results, possibly indicating a greater diversity of viruses among the isolates.

50 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

Table 3.2: CpCDV isolates in chickpea used for PCR/RFLP analysis.

Sample City/year Symptoms Coordinates identifiers reddening, N 31º34.763' Jhang/2011 JH-2, 17, 19 stunting E 071º45.510'

reddening, N 31º23.310' Bhakkar/2011 BH-3, 6, 11 yellowing E 071º13.778' reddening, N 31º21.729' KH-11, 15 yellowing, Khushab/2011 E 071º42.684' stunting N 30º51.942' Layyah/2011 LY-22, 29, 32, 36 yellowing E 071º43.228'

Figure 3.3: PCR-RFLP analysis of CpCDV isolates from chickpea. PCR amplification products were digested with restriction enzymes, Sau3A, RsaI, HaeIII and AluI (from left to right in each case). The samples from which the PCR products originated are indicated above the gel in each case and detailed in Table 3.2. Restriction products were run on ethidium bromide-stained 2.0% agarose gels and the sizes of band were estimated relative to a 50 bp DNA maker (Fermentas).The sizes of selected bands (in bp) is shown on the left of each gel.

51 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

Figure 3.4: New restriction patterns identified by in silico digests with four enzymes Sau 3AI, RsaI, HaeIII and AluI (left-right). The restriction pattern is shown for each enzyme. Molecular size markers (50 bp) are indicated in base pairs (left). The isolates used are Cp-NN-1, Cp-BGR-3, LE-6, LE-9, Cp-CCDV8 and Cp-CCDV14 from Pakistan as well as Cp-SD32 and Cp-SD265 from Sudan. The isolates are from either chickpea (Cp) or lentil (LE). 3.3.3 Southern Hybridization of Infected Lentils To confirm for CpCDV in lentils, infected lentils were sampled from the Nuclear Institute for Agriculture and Biology (NIAB) fields of Faisalabad, where seasonally lentils are grown next to the chickpea crops for several trials. A high incidence of chickpea stunt disease (CSD) with typical symptoms was observed among the lentils. PCR was able to amplify the CpCDV using specific primers and a southern blot detection method (Chapter 2, section 2.17) was performed on total genomic DNA extracted and probed with the CP gene of a chickpea infected CpCDV clone to confirm infectivity as seen in blot B (figure 3.5).

Different lentil samples were positively probed such as (LE-A, LE-C, LE-E, LE-G, LE-H, LE-I, LE-J, LE-K, and LE-L) which proved the fact that infectivity exists in the field and CpCDV is also transmitted in lentils. As seen in blot A, to compare and confirm for lentils, infected chickpea positive samples, 2 chickpea samples from Hyderabad (Sindh province), and Vicia sativa (a common vetch) and an alternate host, were positively probed for CpCDV.

52 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

Figure 3.5: Southern blot analysis of genomic DNA isolated from plant samples probed for the presence of CpCDV. The samples were extracted from a healthy chickpea (lane 1) symptomatic chickpea (lane 2), chickpea from Sindh (lanes 3-4), chickpea from Faisalabad (lanes 5-8), Vicia sativa (lanes 9-10), lentils (lanes 11-21). Viral DNA is indicated as open circular (oc), supercoiled (sc) and single-stranded (ss). 3.3.4 Illumina High-Throughput/Next Generation Sequencing (NGS) Genomic DNA extracted from infected chickpea and lentil samples were RCA amplified, and the RCA products were purified and sent for next generation sequencing. The samples were from 6 lentils (LE-6, LE-9, LE-11, LE-1A, LE-2A, and LE-13) along with 1 chickpea (NN-1; Table 3.1). The Illumina Nextera sequencing method (section 3.2.3) was used and positive samples were confirmed for CpCDV showing a high similarity to already available sequences in NCBI database.

A complete analysis was done using the CLC Genomic workbench software version 7.0, where total no. of reads, assembled using either reference-based or de- novo methods for each sample are shown in Table 3.1. The contigs were used to search the NCBI-GenBank database to identify the most closely related mastreviruses. The results showed that the contigs containing mastreviruses comprised the highest number of assembled reads, and with intact ORFs, indicating that the RCA proved successful. The isolates were assigned to strains C and D after SDT analysis was done using 150 dicot-infecting mastrevirus genomes obtained from the GenBank sequences.

3.3.5 Classification and Distribution of Dicot-Infecting Mastrevirus Species/Strains in Pakistan To understand the classification and distribution of the dicot-infecting

53 3: Diversity of Dicot-infecting Mastreviruses in Pakistan mastreviruses in Pakistan, a phylogenetic analysis was done based on the alignment of 84 nucleotide sequences selected among ~200 dicot-infecting mastreviruses available at the NCBI database and outgrouped with a Nigerian isolate of MSV (monocot- infecting mastrevirus; X01633) (Figure 3.6). Based on the guidelines proposed by Muhire et al. [30], and information obtained in the study (Table 3.3), 17 isolates were identified as CpCDV strains. Prior to my study strain C was identified in CpCDV isolates in chickpea [268], we were able to identify strain C (n=9), which included 7 CpCDV infected lentil and 2 chickpea isolates. The identification of D and H strains was the first finding in Pakistan with CpCDV D (n=7), that included 3 lentil and 4 chickpea samples while CpCDV H (n=1) was obtained from chickpea [269].

To determine the pairwise identities, the complete genomes of 84 dicot- infecting mastreviruses were run through SDT software. CpCDV isolates from Pakistan, India and Sudan that belong to strain C shared ~97-98% pairwise nucleotide sequence identity and those with strain D, which included an isolate from Morocco grouped, along with isolates from Sudan and India shared ~98% pairwise nucleotide sequence identity with the Pakistan isolates. The CpCDV isolates from Pakistan (KM377669), Eritrea (KC172676) and the Sudan isolates shared ~95% pairwise nucleotide sequence identity and belonged to strain H. The CpCDV strains discovered from different areas of Pakistan included CpCDV strains B, C, D, F, H and L obtained from a wide range of hosts including chickpea and lentil [268, 102], cotton [273] and Tomato. Chickpea chlorotic dwarf virus strain B (CpCDV-B) contained isolates from Pakistan and South Africa (AM849096 and Y11023) placed in same clade with 99.8% nucleotide sequence identity.

Among the other Pakistan isolates included a unique finding of CpCDV in cotton [273], these four isolates grouped totally in a separate clade between the isolates of strains C and D and were assigned a different strain, under the strain demarcation criteria [30] as strain-L. The cotton isolates shared ~99% pairwise nucleotide sequence identity among each other and ~85-89% nucleotide sequence identity to the isolates of CpCDV strains C and D, respectively. Two chickpea isolates from Pakistan (KM377674 and KM377675) showed segregation from all other Pakistan isolates and emerged as a divergent group within the Australian isolates. These chickpea isolates were finally recognized as a new species, named CpYDV, and shared ~99.3% genome-wide pairwise nucleotide sequence identity with each other.

54 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

3.3.6 Identification of an Australian Dicot-Infecting Mastrevirus-like Virus in Pakistan During the screening of chickpea samples, two distinct clones (PK37 and PK37B) were isolated from a single plant, sample PK37 originating from Faisalabad (Table 3.3) by cloning RCA product. Phylogenetic analysis showed PK37 to segregate with CpCDV isolates (Figure 3.6). Specifically the results showed this cloned to be an isolate of CpCDV strain D. In contrast, PK37B segregated with isolates of mastreviruses from Australia.

To confirm this apparent identification of an Australian-like dicot-infecting mastrevirus in Pakistan, and ensure that it was not a contamination, a pair of specific abutting primers were designed to the sequence of PK37B (PK37 mastreF 5ʹ-GGT TTCTGA AGT CAC CTC TGG TG-3ʹand (PK37 mastreR 5ʹ-ATC GAG TCA GCC CAA CCA AAT CTG-3́). PCR with these primers amplified an approx. 2500 nt product which was cloned (isolate PK103) and sequenced. The two isolates (PK103 and PK37B) share 99.3% genome-wide pairwise nucleotide sequence identity but showed only ~72% pairwise nucleotide sequence identity with TYDV strain A isolates, ~73% nucleotide sequence identity with other Australian isolates and less than 75% nucleotide sequence identity to other dicot-mastreviruses. Isolates PK37B and PK103 thus represent a new species, based on current species demarcation criteria for mastreviruses and this virus is presently the second dicot-infecting mastrevirus species identified outside of Australia given the name Chickpea yellow dwarf virus (CpYDV) [102]. Screening of all other chickpea samples for the presence of CpYDV did not identify the presence of the virus.

Alignment of the MP, CP and Rep amino acid sequences of the two divergent Australian-like isolates with other dicot-mastrevirus species showed them to be closely related to Australian dicot-infecting mastreviruses with ~83% Rep and ~69% CP amino acid pairwise sequence identity (Figure 3.9). The two divergent isolates (PK37 and PK103) clustered in a clade with the Australian isolates and shared ~99% MP, CP and Rep pairwise amino acid identity with each other while in comparison to the Australian isolates, PK37 and PK103 shared ~50-70% amino acid identity in case of MP and CP while the Rep shared ~70-82% amino acid sequence identity (Figure 3.9).

55 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

Figure 3.6: Maximum-likelihood phylogenetic tree. Maximum-likelihood phylogenetic tree based on the Jukes-Cantor model obtained by applying the Neighbor-Joining method to a matrix of pairwise distances that was estimated using the Maximum Composite Likelihood (MCL) approach and drawn to scale, with branch lengths measured in the number of substitutions per site. Bootstrap confidence values (1000 replicates) are shown next to the branches. The phylogenetic tree was arbitrarily rooted on an isolate of Maize streak virus (X01633) as outgroup. Sequences produced as part of the study reported here are highlighted in red (Sanger sequenced), blue (NGS) and green (CpCDV from Syria). The country of origin of isolates is indicated on the right hand side.

56 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

Figure 3.7: Two-dimensionalmatrix of pairwise identities. Two-dimensional matrix of pairwise percent nucleotide sequence identities values for dicot-infecting mastrevirus sequences. Sequences produced as part of the study reported here are highlighted in red (Sanger sequenced), blue (NGS) and green (CpCDV from Syria).

57 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

Figure 3.8: Geographic distribution of characterized dicot-infecting mastreviruses species/strains in Pakistan. Species and strains of dicot-infecting mastreviruses identified in Pakistan and their geographic origin are indicated by coloured dots. The species/strains identified as part of the study here are highlighted within a box.

58 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

Table 3.3 Dicot-mastreviruses originating from Pakistan.

Genbank # Species/Strain Host Sampling location Sampling year Isolate ID

AM849096 CpCDV-B Chickpea Faisalabad 2005 CCDV14 AM849097 CpCDV-C Chickpea Faisalabad 2005 CCDV6 AM850136 CpCDV-C Chickpea Layyah 2007 CCDV3 AM900416 CpCDV-C Chickpea Layyah 2007 CCDV8 HG934858 CpCDV-C Chickpea Faisalabad 2010 NIAB-C KP881605 CpCDV-C Tomato Vehari 2012 330V KM377673 CpCDV-C Lentil Faisalabad 2012 LE-E LN865160 CpCDV-C Lentil Faisalabad 2012 LE-6 LN865158 CpCDV-C Lentil Faisalabad 2012 LE-1A LN865159 CpCDV-C Lentil Faisalabad 2012 LE-2A LN864701 CpCDV-C Chickpea Faisalabad 2012 NN-1 LN865163 CpCDV-C Lentil Faisalabad 2012 LE-13 LN864703 CpCDV-C Lentil Faisalabad 2014 LE-49 LN864702 CpCDV-C Lentil Faisalabad 2014 LE-50 KM377668 CpCDV-D Chickpea Faisalabad 2012 PK31 FR687960 CpCDV-D Chickpea Bahawalnagar 2008 BGR-3 KM377671 CpCDV-D Lentil Faisalabad 2012 PK43 KM377672 CpCDV-D Chickpea Faisalabad 2012 PK103 KM377670 CpCDV-D Chickpea Faisalabad 2012 PK37 LN865161 CpCDV-D Lentil Faisalabad 2012 LE-9 LN865162 CpCDV-D Lentil Faisalabad 2012 LE-11 KC172666 CpCDV-F Lentil Faisalabad 1997 PL148-97 KM377669 CpCDV-H Chickpea Faisalabad 2012 PK32 HE864164 CpCDV-L Cotton Fort Abbas 2010 TM2 HE956705 CpCDV-L Cotton Fort Abbas 2010 TM4 HE956706 CpCDV-L Cotton Burewala 2010 TM5 HG313782 CpCDV-L Cotton Lodhran 2009 MV27B/09 KM377674 CpYDV Chickpea Faisalabad 2012 PK103B KM377675 CpYDV Chickpea Faisalabad 2012 PK37B

*Isolates highlighted in bold and underlined were produced as part of the study described here.

59 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

3.3.7 Phylogenetic Analysis of Predicted Amino Acid Sequences for MP, CP and Rep Proteins Phylogenetic trees based upon alignments of the predicted amino acid sequences and pairwise distances of MP, CP and Rep of the virus isolates determined along with other selected viruses is shown in (Figure 3.9). The amino acid sequences of MP and CP of Pakistan isolates classified in strain-C along with isolates from Sudan and India, grouped closely and shared (92.4-100%) and (97.6-100%) pairwise sequence identity respectively while in case of Rep, amino acid pairwise identity was (95.8- 100%). Likewise, amino acid sequences of MP and CP of isolates of strain D shared (94.6-100%) and (97.6-100%) amino acid pairwise identity respectively while in case of Rep, amino acid pairwise identity was (96.4-100%). The CpCDV strain B isolate originating from Pakistan (accession no. AM849096; previously known as BeYDV [268]) closely grouped with South African isolates sharing ~95.7-99.4% MP, CP and Rep amino acid pairwise identities (Figure 3.9).

The Syrian isolate (FR687959-CpCDV-A), grouped with isolates of Iran and Turkey sharing 97.8-100% amino acid pairwise identities. One of the Pakistan isolates (KM377669) was distinct from other Pakistan isolates and was classified with the new strain-H along with the isolates from Eritrea and Sudan sharing ~99.6% amino acid pairwise sequence identities.

60 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

61 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

62 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

63 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

Figure 3.9: Phylogenetic trees and two dimensional pairwise identity plots. Maximum-likelihood phylogenetic tree derived from alignments of the predicted amino acid sequences of gene products of virus isolates characterised in this study and other dicot-infecting mastreviruses. The trees are based on alignments of the amino acid sequences of (A) MP, (C) CP and (E) Rep proteins of dicot-infecting mastreviruses. The tree was obtained by applying the Neighbor-Joining method to a matrix of pairwise distances estimated using a JTT model [248]. Matrices of pairwise percent sequence identities values for the predicted amino acid sequences of (B) MP, (D) CP and (F) Rep proteins. Sequences produced as part of the study reported here are highlighted in red (Sanger sequenced), blue (Next Generation Sequenced) and green (CpCDV from Syrian).

64 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

3.3.8 Genome Features of Dicot-Infecting Mastreviruses Long Intergenic Region (iterons) and Rep motifs (iteron-related domain) The LIR contains TATA boxes, iterons and a CA motif which are linked to enhanced viral replication. In begomoviruses, the two key elements identified in the IR include the AG motif, that is between the G-box and TATA box and is essential for origin function [293], and the CA motif that is located immediately upstream of the Rep binding site, which can also be noted for the mastreviruses in (Figure 3.10). The mastrevirus Rep binding sites might reside next to the stem of the stem-loop and sequence analysis of the dicot-mastrevirus LIRs showed the GC-rich sequence in the stem was iterated elsewhere in the LIR (Figure 3.10). The iterons in the sequences of the Australian-like new species CpYDV, have an unusual position compared to the other sequences, but were nevertheless appropriately located.

Motif I (FLTYP) which can be seen in all the dicot-mastrevirus isolates compared (Figure 3.11) is a conserved element of a DNA-binding domain required for specific dsDNA binding also known as “iteron related domain”(IRD), with a strong consensus present in ~90 dicot-infecting geminiviruses [294] which is also part of the rolling-circle replication initiator proteins [295]. Motif III (YxxKD/E) is the catalytic site for DNA cleavage and facilitates re-ligation at the virion-sense origin of replication [296].

The nucleotide alignment sequences of the Reps for all the isolates showed the conserved motifs characteristic to other dicot-infecting mastreviruses (iteron-related domain; IRD which included the motifs I, II, II, RBR and the Walker A and Walker B motifs (Figure 3.11). The Rep region in case of some of the Pakistani isolates under my study showed an extended motif consensus region (A) that contained the corresponding ‘‘FRFQ’’ IRD instead of the commonly ‘‘FRLQ’’ IRD which is also shown in CpCV-B of an Australian isolate [175]. The Motif II (HLHxxxQ) is a metal- binding site involved in the coordination of a divalent cation (Mg2+ or Mn2+) through the invariant histidine residues [279] and has a likely role in protein conformation and DNA cleavage was presented with a slightly changed conserved pattern observed in selected codon sites of (PK-103 and PK-37), a novel Pakistan species that is Australian-like as well as in (NC003822-TYDV) which occur within the regions of rep that encode the RCR motif II with ‘HLHCLIQL’, while other

65 3: Diversity of Dicot-infecting Mastreviruses in Pakistan representative isolates had a conserved pattern ‘HYHALIQL’. Also a similar pattern was observed in CpCV-B and CpRLV both Australian dicot-mastrevirus isolates while RBR ‘LHCHE’ among the conserved ‘LRCHE’ and Walker-A motif ‘GPSRTGKT’ while other isolates showed ‘GPTRTGKT’ pattern (Figure 3.11). Mastrevirus Rep shares the LxCxE motif with RepA, although Rep does not interact with RBR [130] due to steric hindrance that is induced by the C-terminal domain of Rep [22].

Figure 3.10: Multiple sequence alignment of the long intergenic region (LIR) of 18 CpCDV and 2 CpYDV sequences obtained in this study. The LIR contains a conserved (between most geminiviruses) nonanucleotide sequence, iterons, a G box, a TATA box (part of the Rep gene promoter) and CA motifs upstream of the hairpin structure. .

66 3: Diversity of Dicot-infecting Mastreviruses in Pakistan

Figure 3.11: Multiple sequence alignment of the predicted amino acid sequences of the Rep proteins of the dicot-mastrevirus sequences obtained in this study. The Rep proteins of selected other dicot-mastrevirus isolates (reference sequences for the Rep proteins of TYDV [NC_003822] and CpCDV [NC_003493]) were used in comparison to determine conserved motifs. The alignment includes all CpCDV isolates produced as part of this project as well as the Rep sequences of CpYDV (PK- 1038 and PK-37B). Conserved motifs are highlighted with boxes. 3.3.9 Analysis of the Infectivity of a CpCDV Isolate from Syria The infectivity of the clone of CpCDV originating from Syria was assessed by Agrobacterium-mediated inoculation of a partial repeat construct (SYR-2) to N. benthamiana (section 3.2.5). The cloned virus was infectious to N. benthamiana, with all eight inoculated plants showing amplification by diagnostic PCR with specific primers (results not shown). No amplification was evident using DNA extracted from a healthy N. benthamiana plant. Symptoms typically appeared within 21 days of inoculation and consisted of yellowing, stunting and crumpling of newly emerged leaves (Figure 3.12). Plants ceased to grow and rapidly became necrotic. Interestingly, tissue at the site of inoculation also became necrotic. This may suggest that, as has

67 3: Diversity of Dicot-Infecting Mastreviruses in Pakistan

been shown for the begomoviruses Bean dwarf mosaic virus in bean [298] and Tomato leaf curl New Delhi virus in tomato [299], the virus from Syria encodes an avirulence determinant that induces programmed cell death in N. benthamiana.

Southern blot analysis of nucleic acids extracted from symptomatic N. benthamiana plants showed the presence of single- and double-stranded viral DNA forms typical of geminivirus replication (Figure 3.13). No hybridization was detected for nucleic acids extracted from a healthy, non-inoculated N. benthamiana plant [300].

Figure 3.12: Symptoms induced following Agrobacterium-mediated inoculation of Nicotiana benthamiana with a partial direct repeat construct of the clone of CpCDV originating from Syria (SYR-2). The photographs are of a healthy, non-inoculated N. benthamiana plant (A) and an N. benthamiana plant inoculated with SYR-2 (B). Note the crumpling of the newly emerged leaves and necrosis at the site of inoculation. The photographs were taken at approximately 24 dpi.

68 3: Diversity of Dicot-Infecting Mastreviruses in Pakistan

Figure 3.13: Southern blot probed with the full-length SYR-2 clone. Nucleic acids were extracted from a healthy, non-inoculated N. benthamiana plant (lane 1), the chickpea plant from which the SYR-2 clone was obtained (lane 2) and three symptomatic N. benthamiana plants inoculated with a partial direct repeat construct of SYR-2 (lanes 3-5). The arrows to the right of the blot show the positions of linear (lin), open-circular (oc), single-stranded (ss) and supercoiled (sc) forms of the viral DNA.

69 3: Diversity of Dicot-Infecting Mastreviruses in Pakistan

3.4 Discussion During the study of dicot-infecting mastreviruses, a number of findings were contributed to develop an understanding as to how the diversity of mastreviruses is geographically and globally important. Viruses are characterized by a number of methods such as PCR and RFLP but due to the limitations of this technique much of diversity could not be explored. Amplification of circular viral DNA by RCA and sequencing of cloned viruses by Sanger and NGS techniques facilitated the discovery of novel viruses from individual plants [287], with a large number of reads of sequences obtained in a short time and no prior knowledge of target DNA sequences was required [301].

CpCDV is known to infect a range of hosts apart from chickpea. Alternate hosts of CpCDV, including lentil and Vicia sativa were identified during the study described here. Lentils are reported to be infected by a number of viruses [260], however during this research it was confirmed that CpCDV infects lentil, as reported previously in India [102] and the NGS results confirmed this (Table 3.1). On the other hand, V. sativa, commonly used as a fodder crop, was found to be infected with CpCDV which was confirmed by PCR, and Southern hybridization. Through BLASTn, the partial sequencing results showed a high similarity to available sequences which is the first report so far of CpCDV infecting this species. However, V. sativa has previously been shown to be infected by a number of distinct viruses including Pea enation mosaic virus (PEMV; now classified as a symbiosis between the Enamovirus Pea enation mosaic virus-1 and the Umbravirus Pea enation mosaic virus-2) and Chickpea chlorotic stunt virus (CpCSV; genus Polerovirus, family Luteoviridae) [302, 303] indicating that Vicia forage species are susceptible to viral infections [304].

The application of RFLP to analyze samples that showed variability in restriction patterns (Figure 3.3) can be seen in analysis of the diversity of African streak mastreviruses with PCR-generated RFLPs studied in combination to their partial sequences [276]. It is generally seen that defective viral DNAs are less anticipated, as their RFLP patterns seem more diverse and their amounts vary with sequence deletions at many positions [277].

As the geographical origin of some of the dicot-infecting mastreviruses is

70 3: Diversity of Dicot-Infecting Mastreviruses in Pakistan difficult to determine, with the recent discovery of CpYDV in one of the chickpea isolates leaves us with a question as to where this virus could have originated and how it came to be present in Pakistan [102], or maybe some vector species is involved [152]. However, it is possible that the geographic host range of unsampled Australian CpYDV lineages or other Australian-clade dicot-infecting mastreviruses could be much broader than previously recognized. So far no studies have looked for dicot- infecting mastreviruses in Southeast Asia and as it presents the second such species after CpCDV so thoughts do arise as to whether or not Australia is the actual center of diversity for the dicot-infecting mastreviruses [102].

The CP is the sole determinant for insect vector specificity [152]. Alignments with the predicted CP amino acid sequences of the Australian dicot-infecting mastreviruses show CpYDV to group within the Australian dicot-infecting mastrevirus clade which contains TYDV. Since Orosius orientalis (syn. O. argentatus) is known to transmit TYDV [305], a possibility does exist that same vector could transmit CpYDV, as it was sampled in Pakistan where the vector is already known to transmit CpCDV. The origin of CpYDV in Pakistan and insect transmission by members of an Asian/Middle Eastern Orosius species that is not found in Australia would help argue the hypothesis that this novel virus did originate from outside Australia. At this stage it is not possible to conclude about the diversity of CpYDV and to determine where this virus originated. The possibility remains that the virus was introduced by some means into Pakistan.

A general perception about previous plant viruses that were introduced into Pakistan in the recent past, including the devastating Banana bunchy top virus [300], (family Nanoviridae) and the begomovirus Cotton leaf curl Gezira virus [306], is that could have entered by means of vegetatively propagated plant material, being a possible assumption for the entry route of CpYDV. The host range of this virus can also help determine the possible origins of CpYDV if it includes crops or ornamental plant species that are traded as vegetative material.

Co-infections of geminiviruses are common place. CpYDV was found co- infected with a CpCDV-Strain-D isolate, but assumptions still exist as to whether some recombination occurred or other factors are involved. Also mastreviruses in combination with begomoviruses have been reported in co-infection where

71 3: Diversity of Dicot-Infecting Mastreviruses in Pakistan intergeneric recombination does exist; in one case Mubin et al. [277] showed the presence of CpCDV together with CLCuKoV-Bu and the DNA A component of Tomato leaf curl virus, as well as satellites, in the weed Xanthium strumarium. The curtoviruses are believed to have resulted from a recombination between a whitefly- transmitted geminivirus and a leafhopper-transmitted geminivirus [307], indicating the importance and danger of recombination.

The CpCDV isolate from Syria (previously called Chickpea chlorotic dwarf Syrian virus) falls in the strain A. CpCDV strain A occurs in the area encompassing Iran, Syria and Turkey (Figure 3.6) but has not previously been identified in Pakistan. The occurrence of such geographically distinct strains of the virus suggests that speciation is occurring due to geographic separation. Whether other CpCDV strains occur in Pakistan will require further investigation. Although the infectivity of the CpCDV strain A clone in N. benthamiana obtained from Syria does not satisfy Koch’s postulates for the virus causing disease in chickpea, it does strongly suggest that this is the case, as well as proving the integrity of the clone obtained. Surprisingly the clone, upon Agrobacterium-mediated inoculation, induced necrosis in inoculated tissues. This was not the case with the CpCDV strain B clone (previously called Bean yellow dwarf virus [268]). This may suggest that, as has been shown for the begomoviruses Bean dwarf mosaic virus in bean [308] and Tomato leaf curl New Delhi virus in tomato [309], the virus from Syria encodes an avirulence determinant that induces programmed cell death in N. benthamiana.

The evidence obtained here; together with the results obtained by others indicate that CpCDV occurs across a wide geographical area that spans from North Africa to south Asia and South Africa in the south. This evidence has only recently been obtained and it is likely that further investigation will show the virus to be present even farther afield. The economic impact of this virus has so far only been poorly investigated, likely due to the earlier lack of understanding of the widespread nature of the virus. Certainly, the finding that it is an important virus in geographical terms and infects a number of important crop species, not just chickpea, indicates that it should be given greater attention. These measures will look to control inoculum sources (weed hosts) and the insect vector as well as identify resistance sources in germplasm and introgress the resistance into commercial varieties [375].

72 3: Diversity of Dicot-Infecting Mastreviruses in Pakistan

Genetic engineering is a useful approach that has been exploited in plants to achieve resistance against insects, pathogens, including viruses that cause economic losses [310]. The stable integration of a hairpin RNAi construct in N. benthamiana has been shown to impart resistance against CpCDV [311]. The data provided here on the diversity of dicot-infecting mastreviruses and, particularly, CpCDV in Pakistan will provide the information necessary to devise optimum constructs for obtaining resistance to the virus in chickpea and other hosts. Southern hybridization proved a useful technique to initially detect infected samples while RCA proved a much better choice due to circular amplification of unknown viruses using phi DNA polymerase for full-length genomes [312].

4: Identification of Tomato leaf curl New Delhi virus infecting Lentil (Lens culinaris) in Pakistan

4. Identification of Tomato leaf curl New Delhi virus Infecting Lentil (Lens culinaris) in Pakistan

4.1 Introduction Lentil (Lens culinaris Medik.), a legume in the family Fabaceae, is an important crop and the second most important winter season food legume after chickpea in Pakistan. It is also widely cultivated across Asia and North Africa. Viral diseases are a threat to lentil production world-wide [314]. A number of diseases affect lentils in Pakistan such as rust, root rot wilt complex, foliar blight and viruses [315]. Lentil is affected by more than 10 viruses [314, 316] including Pea seed-borne mosaic virus (genus Potyvirus, family Potyviridae) [317] Cucumber mosaic virus (genus Cucumovirus and family Bromoviridae) [318], Faba bean necrotic yellows virus (genus Nanovirus, family Nanoviridae) and Beet western yellows virus (genus Polerovirus, family Luteoviridae). Although shown to be infected with CpCDV by serological diagnostic techniques [100] the actual nature of the virus infecting lentil was shown by sequencing of the complete virus genome until the study reported here (see Chapter 3 section 3.3.2) [319]. Lentil was not reported to be a host of begomoviruses until quite recently [320].

Tomato leaf curl New Delhi virus (ToLCNDV) is one of only few bipartite begomoviruses occurring in the OW. The virus has a wide host range that was recently shown to include cotton [321] but is most commonly identified in plants of the families Solanaceae and Cucurbitaceae. ToLCNDV was first identified in tomato (Solanum lycopersicum L.) in India in 1995 [311]. The virus also has a wide geographical host range having recently been reported from as far afield as Tunisia [318], Spain [317], Italy [319] and Taiwan [322]. The major problems to agriculture from ToLCNDV, however, are reported from south Asia [323]. The recent advent of next generation sequencing (NGS) technologies has improved the discovery and characterization of unusual new viruses [324] as well as the identification of known viruses in new hosts. The study described here has identified the bipartite

74 4: Identification of Tomato leaf curl New Delhi virus infecting Lentil (Lens culinaris) in Pakistan begomovirus ToLCNDV infecting lentil in Pakistan using NGS - the first begomovirus identified in lentil.

4.2 Materials and Methods

4.2.1 Plant Survey, DNA Extraction A survey of lentil crops was carried out between 2012 in the fields of the Nuclear Institute of Agriculture and Biology (NIAB), Faisalabad. Greater than 35% of the lentil exhibited leaf curling, yellowing and stunting (Figure 4.1). Samples were collected in 2013 and DNA was extracted from leaf tissue using the CTAB method [325]. The field of lentil was adjacent to a field of tomato, many of which were showing leaf curl symptoms (Figure 4.1) typical a number of begomovirus species, including ToLCNDV.

4.1.2 RCA Amplification and Sequencing Circular DNA molecules were amplified from DNA samples by RCA using a TempliPhi™ DNA amplification kit (GE Healthcare) (Chapter 2, section 2.4.2). The RCA reaction was performed as per the manufacturer’s instruction. The high molecular weight concatameric DNA produced in the reaction was purified, quantified using a NanoDrop™ 1000 spectrophotometer (Chapter 2, section 2.3) and sent for Nextera sequencing, as described previously (Chapter 3, section 3.2.3).

4.1.3 Sequence Assembly and Phylogenetic Analysis The paired-end reads obtained from the Illumina MiSeq Sequencer pipeline were subjected to standard quality trimming and adapter removal which was performed by Trimmomatic-0.32 using a Linux platform. These short sequences were assembled using CLC Genomics Work Bench 7.0 [326, 327]. BLASTn (http://blast.ncbi.nlm.nih gov) was used to compare the assembled sequences to related sequences available in the GenBank database. ORFs (potential genes) were identified using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Multiple sequence alignments and phylogenetic analyses were conducted using MEGA7 [328].

4.1.4 PCR-Mediated Diagnosis of ToLCNDV PCR was used to amplify the DNA-A and DNA-B components of ToLCNDV from DNA extracted from plant samples using the primer pairs mentioned in (table 4.1).

75 4: Identification of Tomato leaf curl New Delhi virus infecting Lentil (Lens culinaris) in Pakistan

4.1.5 Quantitative Real-Time PCR For real-time PCR, a total volume of 25 µLper reaction contained 12.5 µLof SYBER Green Super Mix (Thermo scientific,Waltham, MA USA), 0.25 µLof each primer (0.01pM each), 2.5 µLof template DNA (~25ng) and 9.5 µLSDW. The thermocycling conditions were an initial 94°C for 10 min followed by 40 cycles of 30 seconds (s) at 94°C, 30 s at 57°C and 30 s at 72°C. The real time PCR was performed in 96 well microtitre plates on a Bio-Rad iQ5 thermal cycler (Bio-Rad, Hercules, CA USA). The 18S ribosomal RNA gene was used as an internal control gene to normalize DNA levels in samples (Table 4.1). All samples were run in triplicate. Finally, at the end of every run, in order to assess the specificity of the amplification product, a melt curve from 57 to 95°C, with an increment of 0.5°C every 10 s, was performed. To prepare the standard curves for absolute quantification of ToLCNDV DNA-A [U15015] and ToLCNDV DNA-B [U15017], tenfold serial dilutions initially from 20 ng/ µLof plasmids containing the cloned full-length ToLCNDV DNA-A, ToLCNDV DNA-B and CpCDV were produced and dissolved in 20 ng/ µLof genomic DNA extracted independently from healthy lentil plants, to obtain a range from 20 ng/ µLto 0.002 ng/ µLof each component. The specific primers used in the quantitative PCR analyses are mentioned in (Table 4.1).

The standard curves for ToLCNDV DNA-A, DNA-B and CpCDV showed a linear relationship during the analyses. The melt curve analyses showed a single peak, indicative of the amplification of a single product.

76 4: Identification of Tomato leaf curl New Delhi virus infecting Lentil (Lens culinaris) in Pakistan

Table 4.1: Oligonucleotides used in the study. Amplified Primer Primer sequence [5’→3’] product Size (bps) ND-A Probe F CCTTTAATCATGACTGGCTT ND-A Probe R CATTTCCATCCGAACATTC 249

ND-B Probe F GCCCATGATTCGTTCGGAC ND-B Probe R CACGTGGTACTGGAATATCGCA 475

18s F TCTGCCCTATCAACTTTCGATGGTA 18s R AATTTGCGCGCCTGCTGCCTTCCTT 137

CpCDV- Probe F ACGTGGTCAGTGGTGGTGGA CpCDV- Probe R ACTCCGTTGACACACCCAGCC 136 ToLCNDV-A1-F GATATCATCATTTCAACGCCCGCATCGAA ToLCNDV-A2-R GATATCTGCTGGTCGCTTCGCCATAGTTC 175 ToLCNDV-B1-F AAGCTTCTGCTCGAACATGGACGGAAATGAC ToLCNDV-B2-R AAGCTTAGCCAGTTGAGGAATAGATGCATG 180

4.2 Results

4.2.1 Identification of ToLCNDV in Lentil As part of the study of the diversity of dicot-infecting mastreviruses described in Chapter 3, RCA products resulting from 10 lentil leaf samples (LE-A, 2, 4, E, F, 8, 9, 10, 11 and 13) were sent for NGS. Of these, the NGS results indicated that 6 samples were infected with only CpCDV, as indicated in Chapter 3. However, for one sample (LE-8) the NGS analysis indicated not the presence of CpCDV but a begomovirus. De-novo assembly for LE-8 showed a mean read length of 93.17 nts with total read count of 4,685,594 reads. N50 in terms of minimum contig length was 10,404 nts with mean contig length of about 2,222 nts. Average Phred score was 38 for match reads distribution. One de-novo assembled contig, shown by a BLAST trawl of the sequence databases to be ToLCNDV DNA A, showed 246x coverage of the component with a total read length of all reads of 675,255 nts with a mean read length of 92.55 nts. None of the de novo assembled contigs showed sequence identity to

77 4: Identification of Tomato leaf curl New Delhi virus infecting Lentil (Lens culinaris) in Pakistan

ToLCNDV DNA B. However, a reference based assembly provides a complete contig of 2.6 kb with average coverage of 541 nts of reference DNA-B provided that average read length of 97.90 nts and length of all reads of 2,053,158 nts (Figure 4.2).

In addition to the lentil samples, the RCA products from 3 chickpea samples were examined by NGS (Chapter 3). Of these only one showed the presence of CpCDV whereas none showed evidence of the presence of ToLCNDV.

4.2.2 PCR Confirmation of ToLCNDV Infection of Lentil PCR-mediated diagnostics with ToLCNDV-specific primers was used to confirm the presence of the virus in lentil (table 4.1). The primers used to detect ToLCNDV DNA A, and ToLCNDV DNA B as mentioned in (table 4.1), amplified a product size of 175 bp. Analysis of 40 lentil samples showed the presence of ToLCNDV in only four plants. The four samples were carried forward to the qPCR analysis. Extensive PCR screening of the chickpea samples mentioned in Chapter 3 did not identify ToLCNDV (results not shown).

Figure 4.1: Typical symptoms of chickpea stunt disease of lentil in the field. (A) Compared with the leaf curl symptoms, presumed to be caused by ToLCNDV, in tomato in a field adjacent to the field in which the ToLCNDV infected lentil was collected (B).

78 4: Identification of Tomato leaf curl New Delhi virus infecting Lentil (Lens culinaris) in Pakistan

Figure 4.2: Coverage of NGS reads for ToLCNDV DNAA de novo assembly (A) and ToLCNDV DNA-B reference-based assembly (B) for lentil sample (LE-8).

Table 4.2: Lentil (LE-8) showing begomovirus related features of both ToLCNDV DNA-A and ToLCNDV DNA-B.

AC3 AC2 AC4 Isolate/ GenBank/ AV2 AV1 AC5 (replication (transcrip- AC1 (AC4 Host/ Assembly/ (precoat (coat (AC5 enhancer tion activator (replicase) protein) Virus/size Coordinates protein) protein) protein) protein) protein)

LE-8/ LN849710/ Lens culinaris/ De novo based/ 120..458 280..1050 310..795 1047..1457 1192..1596 1499..2584 2251..2427 (ToLCNDV-A) "31.39741N" 2738 bp 73.02935 E" BV1 BC1 (NSP) (MP)

LE-8/ LN849711/ Lens culinaris/ Reference based 486..1292 1350..2195 (ToLCNDV-B)/ "31.39741N" 2735 bp 73.02935 E"

4.2.3 Quantification of ToLCNDV DNA-A, DNA-B and CpCDV DNA Levels in Plants A quantitative real-time PCR analysis of the titres of ToLCNDV DNA A, DNA B and CpCDV DNA levels in four field-collected, symptomatic lentils is presented in (Figure 4.3). The analysis shows all four lentils to have been infected with CpCDV but to contain widely varying virus DNA titres (from 7.2 to 0.028 ng/µg). As expected, CpCDV was not detected in the N. benthamiana plant experimentally

79 4: Identification of Tomato leaf curl New Delhi virus infecting Lentil (Lens culinaris) in Pakistan infected with ToLCNDV or in the healthy lentil.

With the exception of lentil sample LE-E, ToLCNDV DNA A was detected in the lentil samples but at low titres (0.005 ng/µg or less). These levels are 20 fold less than the ToLCNDV DNA A titre detected in N. benthamiana. In contrast, the ToLCNDV DNA B component was detected in only lentil LE-F at a titre (1.6 ng/µg) significantly higher than that of the DNA A component (0.001 ng/µg), as well as higher than that detected in N. benthamiana (0.515 ng/µg).

The results show that plants LE-A, LE-4 and LE-F were co-infected with CpCDV and ToLCNDV, whereas plant LE-E was infected with only CpCDV.

Figure 4.3: Quantitative, real-time PCR estimation of the titresof the DNA-A (A) and DNA-B (B) components of ToLCNDV and CpCDV (C) in field collected lentil samples. Four symptomatic lentil samples (LE-A, E, F and 4) were analyzed. DNA extracted from a healthy lentil plant (NTC) was run as a negative control and DNA extracted from a Nicotiana benthamiana plant experimentally infected with ToLCNDV was used as a positive control (To-A+B). In each case the titre is given as ng of virus [or component] per µg of total DNA. The experiment was conducted in three technical repeats and the results shown are the means with standard deviation. 4.2.4 Analysis of the ToLCNDV Isolate Identified in Lentil A phylogenetic analysis, using the Maximum Composite Likelihood (MCL) approach

80 4: Identification of Tomato leaf curl New Delhi virus infecting Lentil (Lens culinaris) in Pakistan by applying the Neighbor-Joining method to a matrix of pairwise distances produced using the Kimura 2-parameter method [329] showed the ToLCNDV DNA A sequence from lentil (acc. no. LN849710) to have the closest relationships with two ToLCNDV DNA A sequences isolated from tomato originating from Rahim Yar Khan (Pakistan) in 1997 (DQ116883, DQ116885) and one isolated from tomato originating from India in 2008 (KP195265). This is also supported by the matrix of pairwise percentage identity scores which shows 94% identity between the isolate from lentil and DQ116883/DQ116885 and 93% to KP195265 (Figure 4.4).

The ToLCNDV DNA B sequence from lentil (LN849711) showed closest relationship and highest percent nucleotide sequence identity (~97%) with the DNA B sequences of a ToLCNDV isolate from Chenopodium album originating from India (KC969440) and two isolates from tomato (AM947507 and FN435311) originating from Faisalabad, Pakistan (Figure 4.4).

The isolate of ToLCNDV identified from lentil is in all respects typical of species. The DNA A component encodes the 6 genes typically encoded by bipartite begomoviruses originating from the Old World (Table 4.2). Additionally the sequence contains an AC5 ORF. This is not conserved between all begomoviruses and there is some debate as to whether the “gene” is expressed or not. The DNA B component of the isolate from lentil encodes the two genes typical of DNA B components encoding the movement protein and nuclear shuttle protein.

81 4: Identification of Tomato leaf curl New Delhi virus infecting Lentil (Lens culinaris) in Pakistan

82 4: Identification of Tomato leaf curl New Delhi virus infecting Lentil (Lens culinaris) in Pakistan

See following page for figure legend.

83 4: Identification of Tomato leaf curl New Delhi virus infecting Lentil (Lens culinaris) in Pakistan

Figure 4.4: Neighbor-Joining phylogenetic tree and colour matrix of percentage nucleotide sequence identity values based upon an alignment of the sequences of Tomato leaf curl New Delhi virus DNA A (panels A and B) and DNA B (panels C and D) sequences. The phylogenetic trees were arbitrarily rooted on the DNA A and DNA B sequences, respectively, of Tomato mottle virus (ToMoV). The plant species from which each isolate was obtained is shown on the right side of the phylogenetic trees. The numbers at nodes are percentage bootstrap confidence scores (1000 replicates). The components of the Tomato leaf curl New Delhi virus (ToLCNDV) isolate identified in lentil are highlighted in pink.

84 4: Identification of Tomato leaf curl New Delhi virus infecting Lentil (Lens culinaris) in Pakistan

4.3 Discussion The study described here was the first to identify ToLCNDV in lentil. Subsequent to this Naimuddin et al. (2016) also identified the virus in lentil in India. It is very unusual to find ToLCNDV in a legume, the virus usually infects plants of the family Solanaceae and Cucurbitaceae. The grain legumes, which include lentil and chickpea, are an unusual group of leguminous plants. Prior to this study no bipartite begomovirus had been identified in lentil and no bipartite begomoviruses have been reported to infect chickpea [320]. Rather chickpea and lentil are affected by the mastrevirus CpCDV (Chapter 3). In contrast many other grain legumes, including mungbean, Pigeon pea and soybean, are affected by the bipartite begomoviruses Mungbean yellow mosaic India virus and Mungbean yellow mosaic virus across southern Asia [331]. The reason for this apparent difference in susceptibility of grain legumes to geminiviruses, or difference in host ranges of geminiviruses, is unclear.

However, the results presented here and by Naimuddin et al. (2016) do not prove that ToLCNDV causes disease in lentil. The qPCR analysis shows that all the lentil plants harbouring ToLCNDV also harbour CpCDV. This raises the question as to whether infection of lentil by ToLCNDV requires CpCDV - a synergistic interaction with, possibly, CpCDV “knocking down” plant host defences allowing ToLCNDV to infect. Unfortunately, Naimuddin et al. (2016) do not mention looking for CpCDV in the plants in which they identified ToLCNDV. However, the relatively low titres of ToLCNDV DNA A in lentil, so low that, in most cases, the DNA B cannot be detected, might indicate that lentil is not a favourable host for the virus. This question cannot be answered at this time but the tools (infectious clones) are available for both CpCDV and ToLCNDV to experimentally investigate this possibility.

Most crops which have been investigated, including cotton and cucurbits, are co-infected by more than one geminivirus [332, 321]. This is of concern since such co-infections can lead to exchange of genetic material (recombination) leading to more destructive strains/species, as was shown for the “Uganda Variant” of East African cassava mosaicvirus (EACMV; now known as the Uganda strain of EACMV; [334]. Although recombination between geminiviruses is common place [335] recent recombination events, meaning events that did not lead to the establishment of new

85 4: Identification of Tomato leaf curl New Delhi virus infecting Lentil (Lens culinaris) in Pakistan genera [248, 336], between mastreviruses and begomoviruses have not been reported. However, possible co-infection between a begomovirus and CpCDV has been shown [277]. This lack of recombination between viruses of these two genera may suggest that there are limitations to viable recombinant viruses being produced. This may possibly be due to the great genetic distances between begomoviruses and mastreviruses.

Co-infection of plants can also lead to trans-encapsidation (encapsidation of the genome of one virus in the coat protein of another virus) leading to, in this case, either transmission of ToLCNDV by a leafhopper or, more likely, the transmission of CpCDV by the whitefly vector of begomoviruses Bemisia tabaci. Although it cannot absolutely be ruled out, it would seem unlikely that ToLCNDV could be transmitted by the leafhopper vector of CpCDV. The virus particles of geminiviruses have a finite encapsidation capacity and the genomic components of ToLCNDV (~2750 nt) are some what larger than those of CpCDV (~2570 nt). However, there has been no conclusive evidence of trans-encapsidation occurring, although the bipartite begomovirus African cassava mosaic virus (ACMV) was shown to be, at least partially, transmissible the leafhopper vector of the curtovirus Beet curly top virus (BCTV) when the CP gene of ACMV was replaced with that of BCTV [152].

Although possibly not a favourable host for ToLCNDV, the identification of the virus in lentil is unwelcome. The plant species could act as an alternate host for the virus which is a major problem for tomato and cucurbit production across South and Southeast Asia as well as, more recently, North Africa and southern Europe [323]. With only four lentil plants here shown to harbour ToLCNDV a wider study should be instigated to determine the precise incidence of the virus in this crop. Although not identified here, it is also worthwhile doing a more detailed study of the possible occurrence of ToLCNDV in chickpea.

5: PVX-Mediated Expression of Mastrevirus Genes

5. PVX-mediated Expression of Mastrevirus Genes

5.1 Introduction Plant-infecting viruses may induce disease symptoms that can include chlorosis and/or necrosis, leaf curling, stunting and altered morphology. These symptoms of infection are presumably caused by interference with plant developmental processes [337]. RNA viruses, such as tobacco mosaic virus (TMV) and potato virus X (PVX), allow rapid replication of genes and thus are the most effective expression systems [338].

The genomes of mastreviruses encode four genes. The two in the virion-sense encode the coat protein (CP), involved in virus movement within and between plants, and the movement protein (MP), which is involved in virus movement in plants [105]. The complementary-sense genes encode the replication associated protein (Rep; a rolling circle replication initiator protein that also interferes with host cell-cycle, the only virus encoded protein required for virus replication [137, 120] and the RepA protein from a spliced and un-spliced complementary-sense transcript, respectively [105]. The characterization of the functions and interactions of mastrevirus gene products lags well behind those of begomoviruses, particularly for dicot-infecting mastreviruses. This disparity is likely due to the relatively low number of researchers working on mastreviruses and that fact that, until recently, the dicot-infecting mastreviruses were not seen as a major problem. Until recently only two dicot infecting mastreviruses had been described, Tobacco yellow dwarf virus in Australia and Bean yellow dwarf virus (now classified as a strain of Chickpea chlorotic dwarf virus) [99, 101]. Only recently have we come to realize that the diversity of dicot- infecting mastreviruses is greater than previously believed and that particularly CpCDV is a significant problem to grain legume production across south Asia, the Middle East and North Africa [102, 339]. It seems likely that the geographical host range of CpCDV will be found to extend even beyond the boundaries so far identified.

The study presented in this chapter describes the transient expression of three essential genes (RepA, MP and CP) of two distinct mastreviruses, the dicot-infecting

87 5: PVX-Mediated Expression of Mastrevirus Genes mastrevirus CpCDV and the monocot-infecting MSV, using a PVX based vector. The aim of the study was to setup the groundwork for an analysis of the functions and interactions of the proteins encoded by CpCDV.

5.2 Materials and Methods

5.2.1 Production of Expression Constructs Clones of the monocot-infecting mastrevirus MSV-MatA (accession no. AF329881), [158] and dicot-infecting CpCDV (AM850136), [268] shown previously to be infectious to plants, were used as a source of genes for cloning.

DNA fragments encompassing the genes were PCR amplified using the plasmid clone as a template and specific primers with a ClaI restriction site incorporated in the forward primer and either Sma1 or Sal1 restriction sites in the reverse primers (Table 5.1).The amplified fragments were initially cloned into the plasmid vector pTZ57R/T, confirmed by restriction sites with ClaI and SalI or SmaI, then transferred into PVX vector pGR107 [340] at either ClaI-SmaI or ClaI-SalI. The resulting constructs were MatA-MP, MatA-CP and MatA-RepA for MSV and CpCDV-MP, CpCDV-CP and CpCDV-RepA for CpCDV.

5.2.2 Agrobacterium-mediated Inoculation pGR107 constructs were electroporated into Agrobacterium tumefaciens strain GV3101. Resulting cells were spread on solid LB medium containing 12.5μg/mL of rifampicin and 50μg/mL of kanamycin antibiotics and incubated at 28oC. A single colony was picked with wire loop, inoculated into 50mL LB medium with antibiotics and incubated in shaker at 28oC. After 48 hours the cells were pelleted and resuspended in 10mM MgCl2 containing acetosyringone to an OD600 of 1. Young healthy plants were used for infiltration containing the inoculum.

5.2.3 Trypan Blue Assay Whole leaves were taken at 28 dpi for trypan blue staining and were then boiled for 45 min in a stain solution consisting of 1:1:1:1:4 phenol:lactic acid:glycerol:water: 95% (v/v) ethanol with 0.4% (w/v) trypan blue. Leaves were then destained in 0.1% (w/v) chloral hydrate (Sigma) for approx. two days and then placed on a glass slide and mounted in 50% glycerol and observed under a light microscope. The images

88 5: PVX-Mediated Expression of Mastrevirus Genes were photographed using Zeiss-HAL 100-Axioskop 2 microscope fitted with an Olympus MC 80 DX digital camera.

Table 5.1: Oligonucleotide primers used in PVX studies.

Gene Restriction Primer sequence [5’→3’]* Sites ClaI ATCGATATGGAACGTATTCTGTATCAGG CpCDV-MP SmaI CCCGGGCTAAGGTTGAGGATGATCCTGG ClaI ATCGATATGTCAACTGTGACGTGGGG CpCDV-CP SmaI CCCGGGTTATTGATTGACCAACGGAC ClaI ATCGATATGCCTTCTGCAAACAAGAACTTC CpCDV-RepA SmaI CCCGGGTTAATTGCTTCCACAATGGGACG ClaI ATCGATATGGATCCACAGAACGCCCTG MSV-MP Sal I GTCGACTTATCCCGTGCCTGGAACAA ClaI ATCGATATGTCCACGTCCAAGAGGAAG MSV-CP SmaI CCCGGGTTACTGGTTGCCAACACTC ClaI ATCGATATGGCCTCCTCCTCATCCAAC MSV-RepA SmaI CCCGGGCTAGGCTTCTGGCCCAAGTAG

* In each case the forward primer has a ClaI restriction endonuclease recognition site and the reverse primer a SmaI site. The sequence of the restriction endonuclease recognition sequence is underlined.

5.3 Results 5.3.1 Effects of the PVX-mediated Expression of Mastrevirus Movement Protein in N. benthamiana Inoculation of N. benthamiana plants with the PVX vector (lacking an inserted gene) resulted in mild symptoms that included mild vein yellowing and a faint mosaic that appeared at approx. 7 dpi (Figure 5.1, panel B; Table 5.2). Additionally, at approx. 15 dpi, newly emerging leaves of N. benthamiana plants infected with PVX ceased to show symptoms, indicative of recovery.

N. benthamiana plants inoculated with MatA-MP began to show symptoms at

89 5: PVX-Mediated Expression of Mastrevirus Genes approx. 7 dpi. The symptoms remained mild, resembling those induced by PVX alone but with possibly some mild thickening of veins on the undersides of the leaves and mild downward leaf curling (Figure 5.2 panels C and D, Table 5.2). Symptoms recovered at approx. 25 dpi. In contrast, plants inoculated with CpCDV-MP showed relatively severe symptoms initiating at approx. 7 dpi. The symptoms consisted of vein yellowing, an irregular foliar mosaic, with the yellow areas having clearly defined edges, leaf crumpling and downward curling of leaves (Figure 5.1 panels C and D, Table 5.2). Plants again recovered from symptoms at 25 to 30 dpi.

5.3.2 Effects of the PVX-mediated Expression of Mastrevirus Coat Protein in N. benthamiana N. benthamiana plants inoculated with CpCDV-CP developed symptoms consisting of vein yellowing, a foliar mosaic, leaf crumpling and leaf curling as well as thickening of the veins on the undersides of leaves by 7 dpi (Figure 5.1, panels E and F; Table 5.2). At approx. 21 dpi new growth appeared non-symptomatic.

Plants inoculated with MatA-CP developed symptoms similar to those induced by CpCDV-CP but with a more severe yellow mosaic and leaf crumpling observed at approx. 10-12 dpi which gradually increased in intensity (Figure 5.2, panels E and F; Table 5.2). In contrast to CpCDV-CP inoculated plants, in which leaf size was reduced, MatA-CP infected plants leaves obtained a near normal size. Recovery initiated at approx. 25 to 30 dpi.

5.3.3 Effects of the PVX-mediated Expression of Mastrevirus RepA Protein in N. benthamiana Symptoms in N. benthamiana plants inoculated with CpCDV-RepA appeared approx. at 7 dpi and consisted of downward curling of leaves with severe crumpling with vein thickening and necrotic lesions (Figure 5.1, panels G and H, Table 5.2). By approx. 8 dpi, the emerging leaves were deformed and showed severe leaf curling, vein yellowing and infected plants ceased to grow. MatA-RepA, in contrast, induced relatively mild symptoms, initiating at approx. 7 dpi, consisting of a severe foliar yellow mosaic, downward curling of leaves, vein thickening, leaf curling, mild leaf crumpling and necrosis (Figure 5.2, panels G and H, Table 5.2). The symptoms for both CpCDV-RepA and MatA-RepA persisted with no evidence of recovery.

To confirm cell death for CpCDV-RepA and MatA-RepA inoculated plants, a

90 5: PVX-Mediated Expression of Mastrevirus Genes trypan blue-assay was carried out [341]. Treated leaves from a healthy plant showed no retention of the dye indicating that all cells were alive (Figure 5.3, panel B). In contrast, leaves from plants infected by inoculation with CpCDV-RepA and MatA- RepA showed areas in which cell retained the dye, indicative of dead cells (Figure 5.3, panels D and F).

Figure 5.1: Response of N. benthamiana plants to the PVX-mediated expression of genes encoded by CpCDV. The photographs show N. benthamiana plants that included; healthy non-inoculated plant (A) or infected with PVX (with no insert) (B), CpCDV-MP (C-D), CpCDVCP (E-F) and CpCDV-RepA (G-H). Photographs were taken at approximately 10 days after inoculation.

91 5: PVX-Mediated Expression of Mastrevirus Genes

Figure 5.2: Response of N. benthamiana plants to the PVX-mediated expression of genes encoded by MSV. The photographs show N. benthamiana plants that included; healthy non-inoculated plant (A) infected with PVX (B), MaTA-MP (C-D), MaTA-CP (E-F), and MaTA- RepA (G-H). Photographs were taken at approximately 10 days after inoculation.

92 5: PVX-Mediated Expression of Mastrevirus Genes

Table 5.2: Summary of the symptoms induced by the expression of MSV and CpCDV genes from a PVX vector in N. benthamiana.

No. of plants Latent Recovery/ Inoculum infected/no. period Symptoms* persistence of plants (dpi) @ inoculated£

PVX 5/6 7 mFM, mVY R-15 days

mFM, mVY, MatA-MP 18/20 7 R-25 days mLCu, VT

sFM, VT, LCu, R-25-30 MatA-CP 24/25 7 LCr days

N, sVT, mLCu, MatA-RepA 12/15 Persisted 7 mLCr, VY, FM

FM, mVY, R-25-30 CpCDV-MP 15/15 7 mLCu days

FM, VY, VT, CpCDV-CP 17/20 7 R-21 days LCr, LCu

N, sVT, sLCr, CpCDV-RepA 24/25 7 Persisted sST, VY, LCu

*Symptoms are denoted as foliar mosaic (FM), vein yellowing (VY), vein thickening (VT), stunting (ST), leaf crumpling (LCr), leaf curling (LCu) and necrosis (N). These may be indicated as either severe (s) or mild (m). @ Symptoms of PVX infection either persisted until senescence or recovered (R). For plants that recovered (new growth showing no symptoms) the days after inoculation at which new growth showed no symptoms is indicated. £ The results of three independent experiments.

93 5: PVX-Mediated Expression of Mastrevirus Genes

Figure 5.3: Trypan blue staining to detect for cell death in CpCDV-RepA and MatA-RepA inoculated N. benthamiana plants. Photograph of a leaf from a non-inoculated N. benthamiana plant (A) and the same leaf after processing for the detection of cell death by staining with trypan blue and photograph with transmitted light (B), Photographs of leaves before (C and E) and after staining (D and E) from a CpCDV-RepA infected plant (C and D) and a MatA- RepA infected plant (E and F). Photographs of leaf sections from a CpCDV-RepA infected plant showing retention of trypan blue in some cells indicative of cell death (G-H). Slides were viewed and photographed on a Zeiss -HAL 100-Axioskop 2 microscope fitted with an Olympus MC 80 DX digital camera.

94 5: PVX-Mediated Expression of Mastrevirus Genes

5.4 Discussion The study described here is the first to compare the phenotypes induced by genes encoded mastreviruses when expressed from a PVX vector in the absence of the other gene products and thus may provide an insight into virus-host interactions that may not be evident by, for example, mutation of the gene in the virus. It is important to note that the genes of MSV were expressed in a heterologous system - the genes of a monocot-infecting virus expressed in a dicot. Whether this will have any effect on the results is unclear.

PVX infection of N. benthamiana induces only very mild symptoms and any symptoms above and beyond these mild symptoms can thus be attributed to the gene being expressed from the vector. For all six genes expressed here, symptoms induced were distinct from those induced by PVX alone, indicating that all genes affect the development of N. benthamiana and, by extension, that all genes interact to some degree with host factors even for the genes of MSV being expressed in a dicot.

The CP of geminiviruses is involved in interaction with the insect vector for transmission [152], being the only viral protein involved in forming the typical geminate virions [150], as well as in virus movement in plants. The involvement of the CP in virus movement in plants has been shown directly for both MSV and CpCDV by mutation [147,103]. The symptoms induced in N. benthamiana by PVX expression of CP are significantly more severe for MSV and CpCDV than for the CPs of four begomoviruses investigated by Amin et al. [342]. The significance of this is unclear. On the whole begomoviruses, even monopartite begomoviruses, are less dependent on the CP for movement in plants than mastreviruses. Mutation of the CP gene of bipartite begomoviruses does not abolish infectivity or symptoms but merely retards the appearance of symptoms – slowing down the spread of the virus in planta [343-346]. In contrast, mutation of the CP gene of monopartite begomoviruses has drastic effects, significantly reducing infectivity, viral DNA levels and abolishing symptoms [347]. This difference between monopartite and bipartite begomoviruses is attributed to the genes (MP and NSP) encoded on the second genomic component of bipartite begomoviruses which can complement missing CP functions in virus movement. In contrast, mutation of the CP gene of mastreviruses abolishes infectivity [103, 147]. The more severe symptoms for PVX-mediated expression of the CP of

95 5: PVX-Mediated Expression of Mastrevirus Genes mastreviruses over begomoviruses may thus indicate that the mastrevirus CP interacts with a greater range or distinct host factors to mediate virus spread in plants. Further studies will be required to answer this question.

Mutation of the MP gene of mastreviruses abolishes infectivity, [147, 348, 349, 103]. Constitutive expression of the MP genes of MSV and CpCDV in transgenic N. tabacum and N. benthamiana plants results in plants with severe disease-like symptoms, pinpointing the MP as a major symptom determinant [350]. This is not borne out by the transient expression studies conducted here in which the MSV and CpCDV MP induce only relatively mild symptoms; the RepA protein inducing the most severe symptoms, at least for CpCDV. This discrepancy may be due to differences in the tissues in which the gene was expressed between the two experiments.

The RepA of CpCDV, and other mastreviruses, contains an RBR-binding domain (LXCXE) and binds to a plant homologue of the cell cycle regulator retinoblastoma protein [351]. This property allows RepA to reprogram the host and create a replication-competent environment [352, 353]. For the monocot-infecting mastrevirus Oat dwarf virus the RepA protein has been shown to be a suppressor of post-transcriptional gene silencing (a host defense mechanism against foreign nucleic acids; [354] and induces cell death [355]. Significantly both these studies were conducted in a dicot, N. benthamiana, indicating that at least some functions/interactions of monocot-infecting mastreviruses are retained in a dicotyledonous host. The results obtained here are thus entirely consistent with the earlier results that RepA induces cell death and show that this is also the case for a dicot-infecting mastrevirus. The cell death is reminiscent of a hypersensitive response (HR) that is a component of disease resistance. HR can be initiated by a pathogen- encoded avirulence (avr) gene, the direct or indirect product of which is recognized by a plant possessing the corresponding resistance (R) gene, and is often associated with the prevention of growth and spread of the pathogen [356]. The HR response is programmed and is associated with a transient burst of reactive oxygen species, fortification of cell walls, and accumulation of antimicrobial phytoalexins and initiation of systemic acquired resistance [357]. This response to pathogen attack, as well as the mechanisms that regulate it, are conserved among plants and animals. Pathogens are capable of manipulating cell death so as to promote their growth and

96 5: PVX-Mediated Expression of Mastrevirus Genes spread in susceptible hosts by encoding proteins that interfere with factors involved in the pathway [358, 356]. The fact that CpCDV (and MSV) do not induce cell death in their natural hosts suggests that they have mechanisms to overcome the response. For the monopartite begomovirus Cotton leaf curl Kokhran virus and the bipartite begomovirus Tomato leaf curl New Delhi virus, the HR induced by V2 protein and the nuclear shuttle protein, respectively, have been shown to be countered by the transcriptional activator protein [292, 278]. It will be interesting in the future to investigate whether CpCDV (and other mastrevirus), in common with begomoviruses, encode a protein with “suppressor of HR” activity. It is interesting to note that the TrAP of begomoviruses and the RepA protein of mastreviruses share some functions, including transactivation of the virion-sense genes [359-361] and possibly also transactivation of host encoded genes [362], the RepA has been shown to transactivate genes in yeast but has not yet been shown to directly transactivate host plant genes [130]. The question would thus arise which mastrevirus gene might have “suppressor of HR” activity since the prediction, based on begomoviruses, would have been the RepA protein. However, it is also possible that RepA expression is tightly regulated, either spatially or temporally, such that only small amounts of the protein are produced, avoiding the triggering of the HR response.

The study described in this chapter was intended as a first analysis of the functions of the genes of a dicot-infecting mastrevirus. Although the information gained is limited, it has raised some interesting issues with regards to induction of HR by RepA and the question as to whether, if at all, there is a virus-encoded protein that counters this. Future studies will need to investigate suppression of RNA silencing to see whether, as has been shown for a monocot-infecting virus [363, 354], suppression is for dicot-infecting mastreviruses such as CpCDV is mediated by Rep and RepA. These are issues that will be dealt with in future studies.

7: References

6. General Discussion

At the outset of the study conducted here there were only a few (n=5) sequences of dicot-infecting mastreviruses available in the databases. At this time greater than 234 complete genome sequences of dicot-infecting mastreviruses are available in the databases and some were produced as part of the study detailed here. As well as the identification of a greater diversity of dicot-infecting mastreviruses, it has become evident during the course of the study conducted here that dicot-infecting mastreviruses have a greater plant host range than previously known; this is particularly the case for CpCDV. CpCDV was known only to infect chickpea, lentil and bean at the outset of the project but has since been shown to infect a wide range of hosts including papaya [85], tomato [85], okra [55], cucumber [74], watermelon [172], squash [274], pepper [54, 272], and even cotton [273].

Of particular importance was the recent report showing, by next generation deep sequencing, that CpCDV causes “Hard Fruit Syndrome” of watermelon [174]; a disease for which the causal agent had remained elusive. Taken together, a wide host- range and a very wide geographical range, indicate that CpCDV is a far more important pathogen than was previously known, on a par with some of the more important begomoviruses. Since dicot-infecting mastreviruses have only recently come to the fore, it is likely that further viruses, further hosts and a wider geographic range will become evident in the near future. The wider host range of CpCDV means that this virus particularly is of concern for the potential to recombine with other viruses leading, potentially, to more virulent strains. One example of this is the identification of CpCDV in co-infection with a begomovirus [277], which is a prerequisite for recombination. Similarly the identification of ToLCNDV infecting lentil (Chapter 4); [320], a common host of CpCDV, provides the stage for recombination. Important also has been the recent identification of novel mastreviruses in quarantine sugarcane samples in France within sugarcane setts from the USA, Barbados, Sudan and Egypt with their origin apparently in Sudan [205]. This is a further example of the movement of viruses by mankind, which may

98 7: References introduce viruses into areas not previously affected. It is evident that CpCDV has the potential to become as much of a problem as the begomovirus Tomato yellow leaf curl virus which now has an almost global occurrence [365].

In light of the greater importance of CpCDV to agriculture it is evident that more needs to be done to counter losses caused by the virus. Investigations of the losses due to CpCDV have not been extensive and have centered on chickpea [366]. Control methods have included altering sowing dates and reducing the numbers of leguminous weeds in the vicinity of chickpea fields [367] as well as controlling insects using insecticides [368]. Most recently initial efforts have been made to select/identify resistant chickpea genotypes using molecular methods (specifically by agrobacterium-mediated inoculation with the virus [369]). However, it is evident that these efforts will now probably also need to consider other crops which have recently been identified as hosts and to suffer losses due to the virus. It is likely that transgenic methods, such as the RNA interference-mediated transgenic resistance (so called pathogen-derived resistance) investigated by Nahid et al. [311] will prove a useful additional tool in this respect.

The transient expression of individual genes using PVX as a tool [144, 166, 208], was well demonstrated in one of the studies conducted by Amin et al, 2011, who expressed the individual genes encoded by four distinct begomoviruses in Nicotiana benthamiana. The rationale here was to similarly use PVX to study the individual genes of mastreviruses (Chapter 5). The aim in the future will be to use this system to identify the gene products of dicot-infecting mastreviruses, particularly of CpCDV, with suppressor of transcriptional and post-transcriptional gene silencing activity. Suppressor are particularly important in viruses overcoming plant host defenses and thus are important gene products to study and pre-eminent targets in developing RNAi resistance. It will be interesting to see whether, as has been shown to be the case for the monocot-infecting mastrevirus Wheat dwarf virus [209], the Rep protein of CpCDV encodes suppressor of post-transcriptional gene silencing activity. It is also possible that the Rep protein may suppress transcriptional gene silencing, as has been shown for a begomovirus [370]. Overall, at the end of the study, it is evident that rather than being minor players in agriculture, dicot-infecting mastreviruses are important and require further study aimed at understanding their biology and reducing losses caused by them.

99 7: References

7. References

[1] J. B. S. Haldane, "The origin of life,"The Quest for Extraterrestrial Life, p. 28, 1980.

[2] S. Anurag, "Virus-induced symptoms in plants: A Review of Interactions between viral trafficking and RNA silencing," The Philippine Agricultural Scientist, vol. 96, 2013. [3] L.M. Iyer, L. Aravind, and E. V. Koonin, "Common origin of four diverse families of large eukaryotic DNA viruses," Journal of virology, vol. 75, pp. 11720-11734, 2001.

[4] E. V. Koonin, and V.V. Dolja, "A virocentric perspective on the evolution of life," Current Opinion in Virology, vol. 35, pp. 546-57, 2013. [5] C.M. Mizuno, F. Rodriguez-Valera, N.E. Kimes, and R. Ghai, "Expanding the marine virosphere using metagenomics," PLoS Genetics, vol.9, pp.e1003987, 2013. [6] D. Baltimore, "Expression of animal virus genomes, Bacteriology Reviews, vol. 35, pp. 235-41, 1971. [7] D.A. de Cárcer, A. López-Bueno, D.A. Pearce, and A. Alcamí, "Biodiversity and distribution of polar freshwater DNA viruses", Science Advances, vo1.1, p.e1400127, 2015

[8] R. Chasan, "Geminiviruses: A twin approach to replication," The Plant Cell, vol.7, pp. 659-661, 1995. [9] J. M. Labonté, and C. A. Suttle, "Previously unknown and highly divergent ssDNA viruses populate the oceans," The ISME journal, vol. 7, pp. 2169- 2177, 2013. [10] P. D. Nagy, "Yeast as a model host to explore plant virus-host interactions," Annual Review of Phytopathology, vol. 46, pp. 217-242, 2008. [11] P. Xu, F. Chen, J. P. Mannas, T. Feldman, L. W. Sumner, and M. J. Roossinck, "Virus infection improves drought tolerance," New Phytologist, vol. 180, pp. 911-921, 2008. [12] T. Canto, M. A. Aranda, and A. Fereres, "Climate change effects on physiology and population processes of hosts and vectors that influence the spread of hemipteran‐borne plant viruses," Global Change Biology, vol. 15, pp. 1884-1894, 2009. [13] F. Tetart, F. Repoila, C. Monod, and H.M. Krisch, "Bacteriophage T4 host

100 7: References

range is expanded by duplications of a small domain of the tail fiber adhesion, "Journal of Molecular Biology, vol. 258, pp. 726-731, 1996. [14] M.T. Ferris, P, Joyce, and C.L. Burch, "High frequency of mutations that expand the host range of an RNA virus," Genetics, vol.176, pp. 1013-1022, 2007. [15] J. K. Holopainen, and J. Gershenzon, "Multiple stress factors and the emission of plant VOCs," Trends in Plant Science, vol. 15, pp. 176-184, 2010. [16] L. A. Mur, P. Kenton, A. J. Lloyd, H. Ougham, and E. Prats, "The hypersensitive response; the centenary is upon us but how much do we know," Journal of Experimental Botany, vol. 59, pp. 501-520, 2008. [17] H. Vanderschuren, M. Stupak, J. Fütterer, W. Gruissem, and P. Zhang, "Engineering resistance to geminiviruses-review and perspectives," Plant Biotechnology Journal, vol. 5, pp. 207-220, 2007. [18] E. J. Pierce, and M.E.C. Rey, "Assessing global transcriptome changes in response to South African cassava mosaic virus [ZA-99] infection in susceptible Arabidopsis thaliana," PloS One, vol. 86, pp. e67534, 2013. [19] E. Rybicki, R. Briddon, J. Brown, C. Fauquet, D. Maxwell, B. Harrison, P. Markham, D. Bisaro, D. Robinson, and J. Stanley, "Family geminiviridae," Virus Taxonomy Seventh Report of the International Committee on Taxonomy of Viruses, pp. 285-297, 2000. [20] R. I. B. Francki, T. Hatta, G. Boccardo, and J. W. Randles, "The composition of chloris striate mosaic virus, a geminivirus," Virology, vol. 101, pp. 233- 241, 1980. [21] M. R. Rojas, C. Hagen, W. J. Lucas, and R. L. Gilbertson, "Exploiting chinks in the plant's armor: evolution and emergence of geminiviruses," Annual Review of Phytopatholgy, vol. 43, pp. 361-394, 2005. [22] C. Gutierrez, "Strategies for geminivirus DNA replication and cell cycle interference," Physiological and Molecular Plant Pathology, vol. 60, pp. 219- 230, 2002. [23] A. Rojas, "A complex of begomoviruses affecting tomato crops in Nicaragua, "Swedish University of Agricultural Sciences Uppsala, vol. 492, 2004. [24] E. Rybicki, "A phylogenetic and evolutionary justification for three genera of Geminiviridae," Archives of Virology, vol. 139, pp. 49-77, 1994. [25] M. Padidam, S. Sawyer, and C.M. Fauquet, "Possible emergence of new geminiviruses by frequent recombination," Virology, vol. 265, pp. 218-225, 1999. [26] D.P. Martin, C. Williamson, and D. Posada, " RDP2: Recombination detection and analysis from sequence alignments," Bioinformatics, vol. 21, pp. 260-262, 2005.

101 7: References

[27] P. Simmonds, M. J. Adams, M. Benkő, M. Breitbart, J. R. Brister, E. B. Carstens, A. J. Davison, E. Delwart, A. E. Gorbalenya, B. Harrach, and R. Hull, "Consensus statement: Virus taxonomy in the age of metagenomics," Nature Reviews Microbiology, vol.15, pp.161-168, 2017. [28] A. Varsani, P. Roumagnac, M. Fuchs, J. Navas-Castillo, E. Moriones, A. Idris, R.W. Briddon, R. Rivera-Bustamante, F.M. Zerbini, and D.P. Martin, Capulavirus and Grablovirus: two new genera in the family Geminiviridae," Archives of Virology, vol.162, pp.1819-1831, 2017. [29] C. M. Fauquet, and J. Stanley, "Geminivirus classification and nomenclature: progress and problems," Annals of Applied Biology, vol. 142, pp. 165-189, 2003. [30] B. Muhire, D. P. Martin, J. K. Brown, J. Navas-Castillo, E. Moriones, F. M. Zerbini, R. Rivera-Bustamante, V. Malathi, R. W. Briddon, and A. Varsani, "A genome-wide pairwise-identity-based proposal for the classification of viruses in the genus Mastrevirus (family Geminiviridae)," Archives of Virology, vol. 158, pp. 1411-1424, 2013. [31] A. Varsani, J. Navas-Castillo, E. Moriones, C. Hernández-Zepeda, A. Idris, J. K. Brown, F. M. Zerbini, and D. P. Martin, "Establishment of three new genera in the family Geminiviridae: Becurtovirus, Eragrovirus and Turncurtovirus," Archives of Virology, vol. 159, pp. 2193-2203, 2014. [32] J.K. Brown, F.M. Zerbini, J. Navas-Castillo, E. Moriones, R. Ramos- Sobrinho, J.C. Silva, E. Fiallo-Olivé, R.W. Briddon, C.H. Zepeda, A. Idris, and V.G. Malathi, "Revision of Begomovirus taxonomy based on pairwise sequence comparisons," Archives of Virology, vol. 160, pp.1593-1619, 2015. [33] F. J. Morales, "Distribution and dissemination of begomoviruses in Latin America and the Caribbean," in Bemisia: Bionomics and Management of a Global Pest, ed: Springer, pp. 283-318, 2009. [34] J. Navas-Castillo, E. Fiallo-Olivé, and S. Sánchez-Campos, "Emerging virus diseases transmitted by whiteflies," Annual Review of Phytopathology, vol. 49, pp. 219-48, 2011. [35] M. R. Rojas, and R. L. Gilbertson, "Emerging plant viruses: a diversity of mechanisms and opportunities," in Plant Virus Evolution, pp. 27-51, 2008. [36] W. M. Zhang, H. B. Fu, W. H. Wang, C. S. Piao, Y.L. Tao, D. Guo, and D. Chu, "Rapid Spread of a Recently Introduced Virus (Tomato Yellow Leaf Curl Virus) and its vector Bemisia tabaci (Hemiptera: Aleyrodidae) in Liaoning Province, China," Journal of Economic Entomology, vol. 107, pp. 98-104, 2014. [37] F.M. Zerbini, R.W. Briddon, A. Idris, D.P. Martin, E. Moriones, J. Navas- Castillo, R. Rivera-Bustamante, and A. Varsani, "ICTV Virus Taxonomy Profile, Geminiviridae," Joural of General Virology vol. 98, pp. 131-133, 2017. [38] K. Saunders, N. Salim, V. R. Mali, V. G. Malathi, R. Briddon, P. G. Markham,

102 7: References

and J. Stanley, "Characterisation of Sri Lankan cassava mosaic virus and Indian cassava mosaic virus: evidence for acquisition of a DNA B component by a monopartite begomovirus," Virology, vol. 293, pp. 63-74, 2002. [39] R. M. Galvao, A. C. Mariano, D. F. Luz, P. F. Alfenas, E. C. Andrade, F. M. Zerbini, M. R. Almeida, and E. P. Fontes, "A naturally occurring recombinant DNA-A of a typical bipartite begomovirus does not require the cognate DNA- B to infect Nicotiana benthamiana systemically," Journal of General Virology, vol. 84, pp. 715-726, 2003. [40] C. Gutierrez, "Geminivirus DNA replication," Cellular and Molecular Life Sciences, vol. 56, pp. 313-329, 1999. [41] B. Harrison, and D. Robinson, "Natural genomic and antigenic variation in whitefly-transmitted geminiviruses (Begomoviruses)," Annual Review of Phytopathology, vol. 37, pp. 369-398, 1999. [42] C. Ha, S. Coombs, P. Revill, R. Harding, M. Vu, and J. Dale, "Molecular characterization of begomoviruses and DNA satellites from Vietnam: additional evidence that the New World geminiviruses were present in the Old World prior to continental separation," Journal of General Virology, vol. 89, pp. 312-326, 2008. [43] M. Padidam, R. N. Beachy, and C. M. Fauquet, "Classification and identification of geminiviruses using sequence comparisons," Journal of General Virology, vol. 76, pp. 249-263, 1995. [44] M. S. Nawaz-ul-Rehman, and C. M. Fauquet, "Evolution of geminiviruses and their satellites," FEBS Letters,vol. 583, pp. 1825-1832, 2009. [45] C. W. Collmer, and S. H. Howell, "Role of satellite RNA in the expression of symptoms caused by plant viruses," Annual Review of Phytopathology, vol. 30, pp. 419-442, 1992. [46] A. E. Simon, M. J. Roossinck, and Z. Havelda, "Plant virus satellite and defective interfering RNAs: new paradigms for a new century," Annual Review of Phytopathology, vol. 42, pp. 415-437, 2004. [47] C. M. Fauquet, M. A. Mayo, J. Maniloff, U. Desselberger, and L. A. Ball, "Virus taxonomy: VIIIth report of the International Committee on Taxonomy of Viruses," Academic Press, 2005. [48] R. Briddon, and J. Stanley, "Subviral agents associated with plant single- stranded DNA viruses," Virology, vol. 344, pp. 198-210, 2006. [49] R. Briddon, J. Brown, E. Moriones, J. Stanley, M. Zerbini, X. Zhou, and C. Fauquet,"Recommendations for the classification and nomenclature of the DNA-β satellites of begomoviruses," Archives of Virology, vol. 153, pp. 763- 781, 2008. [50] S. Mansoor, R. W. Briddon, Y. Zafar, and J. Stanley, "Geminivirus disease complexes: an emerging threat," Trends in Plant Science,vol. 8, pp. 128-134, 2003.

103 7: References

[51] R. W. Briddon, S. E. Bull, I. Amin, S. Mansoor, I. D. Bedford, N. Rishi, S. S. Siwatch, Y. Zafar, A. M. Abdel-Salam, and P. G. Markham, "Diversity of DNA 1: a satellite-like molecule associated with monopartite begomovirus-DNA β complexes," Virology, vol. 324, pp. 462-474, 2004. [52] T. Paprotka, L. Boiteux, M. Fonseca, R. Resende, H. Jeske, J. Faria, and S. Ribeiro, "Genomic diversity of sweet potato geminiviruses in a Brazilian germplasm bank," Virus Research,vol. 149, pp. 224-233, 2010. [53] G. Romay, D. Chirinos, F. Geraud-Pouey, and C. Desbiez, "Association of an atypical alphasatellite with a bipartite New World begomovirus," Archives of Virology,vol. 155, pp. 1843-1847, 2010. [54] H. S. Byun, E.J. Kil, S. Kim, H. Hwang, J.H. Lee, Y.J. Chung, and S. Lee, "First report of Chickpea chlorotic dwarf virus infecting Hot Pepper in India," Plant Disease, vol. 98, pp. 1590-1590, 2014.

[55] M. Zia-Ur-Rehman, U. Hameed, C.A. Ali, M.S. Haider, and J.K. Brown, "First Report of Chickpea chlorotic dwarf virus Infecting Okra in Pakistan," Plant Disease, vol. 101, pp. 1336-1336, 2017.

[56] S. Mansoor, I. Amin, M. Hussain, Y. Zafar, S. Bull, R. Briddon, and P. Markham, "Association of a disease complex involving a begomovirus, DNA 1 and a distinct DNA beta with leaf curl disease of okra in Pakistan," Plant Disease,vol. 85, pp. 922-922, 2001. [57] K. Saunders, and J. Stanley, "A nanovirus-like DNA component associated with yellow vein disease of Ageratum conyzoides: evidence for interfamilial recombination between plant DNA viruses," Virology, vol. 264, pp. 142-152, 1999. [58] P. J. Wu, and X. P. Zhou, "Interaction between a nanovirus-like component and the Tobacco curly shoot virus/satellite complex," Acta Biochimica et Biophysica Sinica, vol. 37, pp. 25-31, 2005. [59] B. L. Patil, and C. M. Fauquet, "Differential interaction between cassava mosaic geminiviruses and geminivirus satellites," Journal of General Virology, vol. 91, pp. 1871-1882, 2010. [60] X. Cui, X. Tao, Y. Xie, C. M. Fauquet, and X. Zhou, "A DNAβ associated with Tomato yellow leaf curl China virus is required for symptom induction," Journal of Virology, vol. 78, pp. 13966-13974, 2004. [61] A. Rouhibakhsh, and V. Malathi, "Severe leaf curl disease of cowpea-a new disease of cowpea in northern India caused by Mungbean yellow mosaic India virus and a satellite DNA β," Plant Pathology, vol. 54, pp. 259-259, 2005. [62] M. S. Nawaz-ul-Rehman, R. W. Briddon, and C. M. Fauquet, "A melting pot of old world begomoviruses and their satellites infecting a collection of Gossypium species in Pakistan," PLoS One, vol. 7, p. e40050, 2012.

104 7: References

[63] E. Fiallo-Olivé, Y. Martínez-Zubiaur, E. Moriones, and J. Navas-Castillo, "A novel class of DNA satellites associated with New World begomoviruses"Virology, vol. 426, pp.1-6, 2012. [64] E. Fiallo Olivé, R. Tovar, and J. Navas Castillo, "Deciphering the biology of deltasatellites from the New World: maintenance by New World begomoviruses and whitefly transmission," New Phytologist, vol. 212, pp. 680-692, 2016.

[65] P. Trębicki, R. Harding, B. Rodoni, G. Baxter, and K. Powell, "Vectors and alternativehosts of Tobacco yellow dwarf virus in southeastern Australia,"Annals of Applied Biology, vol. 157, pp. 13-24, 2010.

[66] I. B. Dry, L. R. Krake, J. E. Rigden, and M. A. Rezaian, " A novel subviral agent associated with a geminivirus: the first report of a DNA satellite," Proceedings of the National Academy of Sciences, vol. 94, pp.7088- 7093, 1997. [67] K. Saunders, I. D., Bedford, R.W. Briddon, P.G. Markham, S.M. Wong, and J. Stanley, "A unique virus complex causes Ageratum yellow vein disease," Proceedings of the National Academy of Sciences, vol. 97, pp. 6890- 6895, 2000. [68] G. Lozano, H.P. Trenado, E. Fiallo-Olivé, D. Chirinos, F. Geraud-Pouey, R.W. Briddon, and J. Navas-Castillo, " Characterization of non-coding DNA satellites associated with sweepoviruses (genus Begomovirus, Geminiviridae) - definition of a distinct class of begomovirus-associated satellites," Frontiers in Microbiology, vol. 7, pp.162, 2016. [69] R.W. Briddon, S. E. Bull, I. Amin, A. M. Idris, S. Mansoor, I. D. Bedford, P. Dhawan, N. Rishi, S.S. Siwatch, A.M. Abdel-Salam, and J.K. Brown, "Diversity of DNA β, a satellite molecule associated with some monopartite begomoviruses," Virology, vol. 312, pp.106-121, 2003.

[70] S. Akhtar, M. N. Tahir, G.R. Baloch, S. Javaid, A.Q. Khan, I. Amin, R.W. Briddon, and S. Mansoor," Regional changes in the sequence of cotton leaf curl Multan betasatellite," Viruses, vol. 6, pp. 2186-2203, 2014. [71] I. Hassan, A. F. Orílio, E. Fiallo-Olivé, R.W. Briddon, and J. Navas-Castillo, “Infectivity, effects on helper viruses and whitefly transmission of the deltasatellites associated with sweepoviruses (genus Begomovirus, family Geminiviridae)," Scientific Reports, vol. 6, p.30204, 2016.

[72] C. A. Strausbaugh, W. M. Wintermantel, A. M. Gillen, and I. A. Eujayl, "Curly top survey in the western United States," Phytopathology, vol. 98, pp.1212-1217, 2008.

[73] M. J. Soto, L. F. Chen, Y. S. Seo, and R. L. Gilbertson, "Identification of regions of the Beet mild curly top virus (family, Geminiviridae) capsid protein involved in systemic infection, virion formation and leafhopper transmission,"Virology, vol. 341, pp. 257-270, 2005. [74] U. Hameed, M. Zia-Ur-Rehman, S.A. Ali, M.S. Haider, and J.K. Brown, "First

105 7: References

Report of Chickpea chlorotic dwarf virus Infecting Cucumber in Pakistan," Plant Disease, vol. 101, pp. 848-848, 2017. [75] A. Varsani, D. P. Martin, J. Navas-Castillo, E. Moriones, C. Hernández- Zepeda, A. Idris, F.M. Zerbini, and J.K. Brown, "Revisiting the classification of curtoviruses based on genome-wide pairwise identity," Archives of Virology, vol. 159, pp.1873-1882, 2014. [76] S. Baliji, M. C. Black, R. French, D. C. Stenger, and G. Sunter, "Spinach curly top virus: A newly described Curtovirus species from southwest Texas with incongruent gene phylogenies," Phytopathology, vol. 94, pp. 772-779, 2004. [77] N. Giddings, C. Bennett, and A. Harrison, "A tomato disease resembling curly top," Phytopathology, vol. 41, pp. 415-417, 1951. [78] M. R. Rojas, C. Hagen, W. J. Lucas, and R. L. Gilbertson, "Exploiting chinks in the plant's armor: evolution and emergence of geminiviruses," Annual Review of Phytopathology,vol. 43, pp. 361-394, 2005.

[79] R. W. Briddon, I. D. Bedford, J. H. Tsai, and P. G. Markham, "Analysis of the nucleotide sequence of the treehopper-transmitted geminivirus, tomato pseudo-curly top virus, suggests a recombinant origin," Virology, vol. 219, pp. 387-394, 1996. [80] E. Hosseini Abhari, J. Heydarnejad, H. Massumi, A. Hosseini Pour, and K. Izadpanah, "Natural hosts, vector and molecular detection of Beet curly top virus (BCTV) in Southeast of Iran," in The Second Asian Conference on Plant Pathology, Singapore, vol. 62, 2005. [81] R. W. Briddon, J. Heydarnejad, F. Khosrowfar, H. Massumi, D. P. Martin, and A. Varsani, "Turnip curly top virus, a highly divergent geminivirus infecting turnip in Iran," Virus Research, vol. 152, pp. 169-175, 2010. [82] J. Heydarnejad, N. Keyvani, S. Razavinejad, H. Massumi, and A. Varsani, "Fulfilling Koch’s postulates for beet curly top Iran virus and proposal for consideration of new genus in the family Geminiviridae," Archives of Virology, vol. 158, pp. 435-443, 2013. [83] A. Varsani, D. N. Shepherd, K. Dent, A. L. Monjane, E. P. Rybicki, and D. P. Martin, "A highly divergent South African geminivirus species illuminates the ancient evolutionary history of this family," Virology Journal, vol. 6, pp. 36, 2009b. [84] A. Varsani, J. Navas-Castillo, E. Moriones, C. Hernández-Zepeda, A. Idris, J. Brown, F.M. Zerbini, and D.P Martin, "Establishment of three new genera in the family Geminiviridae: Becurtovirus, Eragrovirus and Turncurtovirus,"Archives of Virology, vol.159, pp. 2193-2203, 2014b. [85] A. Ouattara, F. Tiendrébéogo, P. Lefeuvre, M. Hoareau, S. Claverie, E.V. Traoré, N. Barro, O. Traoré, A. Varsani, and J.M. Lett, "New strains of chickpea chlorotic dwarf virus discovered on diseased papaya and tomato plants in Burkina Faso, " Archives of Virology, vol. 162, pp.1791-1794, 2017.

106 7: References

[86] S. Razavinejad, and J. Heydarnejad, "Transmission and natural hosts of turnip curly top virus," Iranian Journal of Plant Pathology, vol. 49, pp. 27-28, 2013.

[87] S. Razavinejad, J. Heydarnejad, M. Kamali, H. Massumi, S. Kraberger, and A. Varsani, "Genetic diversity and host range studies of turnip curly top virus," Virus Genes, vol. 46, pp. 345-353, 2013. [88] P. Bernardo, M. Golden, M. Akram, N. N. Nadarajan, E. Fernandez, M. Granier, A.G. Rebelo, M. Peterschmitt, D.P. Martin, and P. Roumagnac, "Identification and characterisation of a highly divergent geminivirus: evolutionary and taxonomic implications," Virus Research, vol. 177, pp.35- 45, 2013. [89] P. Bernardo, B. Muhire, S. Francois, M. Deshoux, P. Hartnady, K. Farkas, S. Kraberger , D. Filloux , E. Fernandez, S. Galzi, R. Ferdinand, M. Granier, A. Marais, P. M. Blasco, T. Candresse, F. Escriu, A. Varsani, G.W. Harkins, D.P. Martin, and P. Roumagnac, "Molecular characterization and prevalence of two capulaviruses: Alfalfa leaf curl virus from France and Euphorbia caput- medusae latent virus from South Africa," Virology, vol. 493, pp.142-153, 2016. [90] P. Roumagnac, M. Granier, P. Bernardo, M. Deshoux, R. Ferdinand, S. Galzi, E.Fernandez, C. Julian, I. Abt, D. Filloux, F. Mesleard, A.Varsani, S. Blanc, D.P. Martin, and M. Peterschmitt, "Alfalfa leaf curl virus: an aphid-transmitted geminivirus,"Journal of Virology, vol. 89, pp. 9683-9688, 2015. [91] P. Bernardo, M. Golden, M. Akram, N. Nadarajan, E. Fernandez, M. Granier, A.G. Rebelo, M. Peterschmitt, D.P. Martin, and P. Roumagnac, "Identification and characterisation of a highly divergent geminivirus: evolutionary and taxonomic implications," Virus Research, vol. 177, pp. 35-45, 2013. [92] B.W. Bahder, F. G. Zalom, M. Jayanth, and M. R. Sudarshana, "Phylogeny of Geminivirus Coat Protein Sequences and Digital PCR Aid in Identifying Spissistilus festinus as a Vector of Grapevine red blotch-associated virus," Phytopathology, vol. 106, pp. 1223-1230, 2016. [93] B. Krenz, J.R. Thompson, M. Fuchs, and K.L. Perry, "Complete genome sequence of a new circular DNA virus from grapevine," Journal of Virology, vol. 86, pp. 7715-7715, 2012. [94] M. R. Sudarshana, K.L. Perry, and M.F. Fuchs, "Grapevine red blotch- associated virus, an emerging threat to the grapevine industry," Phytopathology, vol. 105, pp. 1026-1032, 2015. [95] C. Fuller, "First Report of the Government Entomologist, Natal, 1899-1900," Pl. V, pp. 20-22, 1901. [96] H. Storey, "The transmission of streak virus of maize by the leafhopper Balclutha imbila Naude," Annals of Applied Biology, vol. 112, pp. 422-439, 1925. [97] S. H. Howell, "Physical structure and genetic organisation of the genome of maize streak virus (Kenyan isolate)," Nucleic Acids Research, vol. 12, pp.

107 7: References

7359-7375, 1984. [98] D. Pande, S. Kraberger, P. Lefeuvre, J.M. Lett, D.N. Shepherd, A. Varsani, and D.P. Martin, "A novel maize-infecting mastrevirus from La Reunion Island," Archives of virology, vol. 157, pp.1617-1621, 2012. [99] B. A. Morris, K. A. Richardson, A. Haley, X. Zhan, and J. E. Thomas, "The nucleotide sequence of the infectious cloned DNA component of tobacco yellow dwarf virus reveals features of geminiviruses infecting monocotyledonous plants," Virology, vol. 187, pp. 633-642, 1992. [100] N. Horn, S. Reddy, I. Roberts, and D. Reddy, "Chickpea chlorotic dwarf virus, a new leafhopper‐transmitted geminivirus of chickpea in India," Annals of Applied Biology, vol. 122, pp. 467-479, 1993. [101] L. Liu, T. van Tonder, G. Pietersen, J. W. Davies, and J. Stanley, "Molecular characterization of a subgroup I geminivirus from a legume in South Africa," Journal of General Virology, vol. 78, pp. 2113-2117, 1997. [102] S. Kraberger, H. Mumtaz, S. Claverie, D. P. Martin, R. W. Briddon, and A. Varsani, "Identification of an Australian-like dicot-infecting mastrevirus in Pakistan," Archives of Virology, vol. 160, pp. 825-830, 2015. [103] L. Liu, J. W. Davies, and J. Stanley, "Mutational analysis of bean yellow dwarf virus, ageminivirus of the genus Mastrevirus that is adapted to dicotyledonous plants,"Journal of General Virology, vol. 79, pp. 2265-2274, 1998. [104] K. E. Palmer, and E. P. Rybicki, "The molecular biology of mastreviruses," Advances in Virus Research, vol. 50, pp. 183-235, 1998. [105] M. I. Boulton, "Functions and interactions of mastrevirus gene products," Physiological and Molecular Plant Pathology, vol. 60, pp. 243-255, 2002.

[106] G. L. Regnard, R. P. Halley‐Stott, F. L. Tanzer, I. I. Hitzeroth, and E. P. Rybicki, "High level protein expression in plants through the use of a novel autonomously replicating geminivirus shuttle vector," Plant Biotechnology Journal, vol. 8, pp. 38-46, 2010. [107] J. Stanley, D. M. Bisaro, R. W. Briddon, J. K. Brown, C. M. Fauquet, B. D. Harrison, E. P. Rybicki, and D. C. Stenger, "Geminiviridae," in Virus Taxonomy, VIIIth Report of the ICTV, C. M. Fauquet, M. A. Mayo, J. Maniloff, U. Desselberger, and L. A. Ball, Eds., ed London: Elsevier/Academic Press, pp. 301-326, 2005. [108] S. G. Lazarowitz, L. C. Wu, S. G. Rogers, and J. S. Elmer, "Sequence-specific interaction with the viral AL1 protein identifies a geminivirus DNA replication origin," The Plant Cell, vol. 4, pp. 799-809, 1992. [109] G. Argüello-Astorga, R. Guevara-Gonzalez, L. Herrera-Estrella, and R. Rivera-Bustamante, "Geminivirus replication origins have a group-specific organization of iterative elements: a model for replication, "Virology, vol. 203, pp. 90-100, 1994. [110] B. A. Morris-Krsinich, P. M. Mullineaux, J. Donson, M. I. Boulton, P. G.

108 7: References

Markham, M. N. Short, and J. W. Davies, "Bidirectional transcription of maize streak virus DNA and identification of the coat protein gene," Nucleic Acids Research, vol. 13, pp. 7237-7256, 1985. [111] E. L. Dekker, C. J. Woolston, Y. Xue, B. Cox, and P. M. Mullineaux, "Transcript mapping reveals different expression strategies for the bicistronic RNAs of the geminivirus wheat dwarf virus," Nucleic Acids Research, vol. 19, pp. 4075-4081, 1991.

[112] P. Suärez-López, E. Martıneź -Salas, P. Hernánde, and C. Gutiérrez, "Bent DNA in the large intergenic region of wheat dwarf geminivirus," Virology, vol. 208, pp. 303-311, 1995. [113] P. Suárez-López, and C. Gutiérrez, "DNA replication of wheat dwarf geminivirus vectors: effects of origin structure and size," Virology, vol. 227, pp. 389-399, 1997. [114] M. M. Castellano, A. P. Sanz-Burgos, and C. Gutiérrez, "Initiation of DNA replication in a eukaryotic rolling-circle replicon: identification of multiple DNA-protein complexes at the geminivirus origin," Journal of Molecular Biology, vol. 290, pp. 639-652, 1999. [115] R. Missich, E. Ramirez-Parra, and C. Gutierrez, "Relationship of oligomerization to DNA binding of wheat dwarf virus RepA and Rep proteins," Virology, vol. 273, pp. 178-188, 2000. [116] J. A. Willment, D. P. Martin, K. E. Palmer, W. H. Schnippenkoetter, D. N. Shepherd, and E. P. Rybicki, "Identification of long intergenic region sequences involved in maize streak virus replication," Journal of General Virology, vol. 88, pp. 1831-1841, 2007. [117] A. Varsani, D. N. Shepherd, A. L. Monjane, B. E. Owor, J. B. Erdmann, E. P. Rybicki, M. Peterschmitt, R. W. Briddon, P. G. Markham, and S. Oluwafemi, "Recombination, decreased host specificity and increased mobility may have driven the emergence of maize streak virus as an agricultural pathogen," Journal of General Virology, vol. 89, pp. 2063-2074, 2008. [118] P. M. Mullineaux, F. Guerineau, and G. P. Accotto, "Processing of complementary sense RNAs of Digitaria streak virus in its host and in transgenic tobacco," Nucleic Acids Research, vol. 18, pp. 7259-7265, 1990. [119] C. Gutierrez, "Geminiviruses and the plant cell cycle," in The Plant Cell Cycle, ed: Springer, pp. 219-228, 2000. [120] H. J. Schalk, V. Matzeit, B. Schiller, J. Schell, and B. Gronenborn, "Wheat dwarf virus, a geminivirus of graminaceous plants needs splicing for replication," The EMBO Journal, vol. 8, p. 359, 1989. [121] D. McGivern, "Functional analysis of the Maize streak virus replication- associated proteins," PhD thesis, University of East Anglia, Norwich, UK, 2002. [122] E. Wright, T. Heckel, J. Groenendijk, J. Davies, and M. Boulton, "Splicing

109 7: References

features in maize streak virus virion‐and complementary‐sense gene expression," The Plant Journal, vol. 12, pp. 1285-1297, 1997. [123] E. Fontes, V. A. Luckow, and L. Hanley-Bowdoin, "A geminivirus replication protein is a sequence-specific DNA binding protein," The Plant Cell, vol. 4, pp. 597-608, 1992. [124] S. G. Lazarowitz, and R. Shepherd, "Geminiviruses: genome structure and gene function," Critical Reviews in Plant Sciences, vol. 11, pp. 327-349, 1992. [125] A. P. Sanz-Burgos, and C. Gutiérrez, "Organization of the cis-Acting Element Required for Wheat Dwarf Geminivirus DNA Replication and Visualization of a Rep Protein–DNA Complex," Virology, vol. 243, pp. 119-129, 1998. [126] F. Heyraud-Nitschke, S. Schumacher, J. Laufs, S. Schaefer, J. Schell, and B. Gronenborn, "Determination of the origin cleavage and joining domain of geminivirus Rep proteins," Nucleic Acids Research, vol. 23, pp. 910-916, 1995. [127] J. Laufs, S. Schumacher, N. Geisler, I. Jupin, and B. Gronenborn, "Identification of the nicking tyrosine of geminivirus Rep protein," FEBS Letters, vol. 377, pp. 258-262, 1995. [128] R. A. Hoogstraten, S. F. Hanson, and D. P. Maxwell, "Mutational analysis of the putative nicking motif in the replication-associated protein (AC1) of bean golden mosaic geminivirus," Molecular Plant Microbe Interactions, vol. 9, pp. 594-599, 1996. [129] S. B. Settlage, A. B. Miller, and L. Hanley-Bowdoin, "Interactions between geminivirus replication proteins," Journal of Virology, vol. 70, pp. 6790-6795, 1996. [130] G. V. Horváth, A. Pettkó-Szandtner, K. Nikovics, M. Bilgin, M. Boulton, J. W. Davies, C. Gutiérrez, and D. Dudits, "Prediction of functional regions of the maize streak virus replication-associated proteins by protein-protein interaction analysis," Plant Molecular Biology, vol. 38, pp. 699-712, 1998. [131] J. Hofer, E. L. Dekker, H. V. Reynolds, C. J. Woolston, B. S. Cox, and P. M. Mullineaux, "Coordinate regulation of replication and virion sense gene expression in wheat dwarf virus," The Plant Cell, vol. 4, pp. 213-223, 1992. [132] L. Liu, M.S. Pinner, J.W. Davies, and J. Stanley, "Adaptation of the geminivirus bean yellow dwarf virus to dicotyledonous hosts involves both virion-sense and complementary-sense gene, "Journal of General Virology, vol. 80, pp. 501-506, 1999. [133] X.C. Zhan, K.A. Richardson, A. Haley, and B.A. Morris, “The activity of the coat protein promoter of chloris striate mosaic virus is enhanced by its own and C1-C2 gene products,” Virology, vol. 193, pp. 498-502, 1993.

[134] K. L. Hefferon, Y. S. Moon, and Y. Fan, "Multi‐tasking of nonstructural gene products is required for bean yellow dwarf geminivirus transcriptional regulation," FEBS Journal, vol. 273, pp. 4482-4494, 2006.

110 7: References

[135] A. Muñoz-Martín, S. Collin, E. Herreros, P. M. Mullineaux, M. Fernández- Lobato, and C. Fenoll, "Regulation of MSV and WDV virion-sense promoters by WDV nonstructural proteins: a role for their retinoblastoma protein-binding motifs," Virology, vol. 306, pp. 313-323, 2003. [136] S. Collin, M. Fernández-Lobato, P. S. Gooding, P. M. Mullineaux, and C. Fenoll, "The two nonstructural proteins from wheat dwarf virus involved in viral gene expression and replication are retinoblastoma-binding proteins," Virology, vol. 219, pp. 324-329, 1996. [137] L. Liu, J. W. Davies, and J. Stanley, "Mutational analysis of bean yellow dwarf virus, a geminivirus of the genus Mastrevirus that is adapted to dicotyledonous plants," Journal of General Virology, vol. 79, pp. 2265-2274, 1998. [138] P. A. Eagle, B. M. Orozco, and L. Hanley-Bowdoin, "A DNA sequence required for geminivirus replication also mediates transcriptional regulation," The Plant Cell, vol. 6, pp. 1157-1170, 1994. [139] G. Sunter, M. D. Hartitz, and D. M. Bisaro, "Tomato golden mosaic virus leftward gene expression: autoregulation of geminivirus replication protein," Virology, vol. 195, pp. 275-280, 1993. [140] C. Gutierrez, E. Ramirez-Parra, M. M. Castellano, A. P. Sanz-Burgos, A. Luque and R. Missich, "Geminivirus DNA replication and cell cycle interactions," Veterinary Microbiology, vol. 98, pp. 111-119, 2004. [141] H. Liu, M. Boulton, C. Thomas, D. Prior, K. Oparka, and J. Davies, "Maize streak virus coat protein is karyophyllic and facilitates nuclear transport of viral DNA," Molecular Plant-Microbe Interactions, vol. 12, pp. 894-900, 1999. [142] Q. Xie, A. P. Sanz-Burgos, H. Guo, J. A. García, and C. Gutiérrez, "GRAB proteins, novel members of the NAC domain family, isolated by their interaction with a geminivirus protein," Plant Molecular Biology, vol. 39, pp. 647-656, 1999. [143] K. L. Hefferon, and B. Dugdale, "Independent expression of Rep and RepA and their roles in regulating bean yellow dwarf virus replication," Journal of General Virology, vol. 84, pp. 3465-3472, 2003. [144] J. Du, H. Rietman, and V.G. Vleeshouwers, "Agroinfiltration and PVX agroinfection in potato and Nicotiana benthamiana, " Journal of visualized experiments: JoVE, vol. 83, 2014. [145] H. B. Scholthof, "Plant virus transport: motions of functional equivalence," Trends in Plant Science, vol. 10, pp. 376-382, 2005. [146] M. I. Boulton, C. K. Pallaghy, M. Chatani, S. MacFarlane, and J. W. Davies, "Replication of maize streak virus mutants in maize protoplasts: evidence for a movement protein," Virology, vol. 192, pp. 85-93, 1993. [147] M. I. Boulton, H. Steinkellner, J. Donson, P. G. Markham, D. I. King, and J. W. Davies, "Mutational analysis of the virion-sense genes of maize streak

111 7: References

virus," Journal of General Virology, vol. 70, pp. 2309-2323, 1989. [148] H. Liu, M. I. Boulton, K. J. Oparka, and J. W. Davies, "Interaction of the movement and coat proteins of Maize streak virus: implications for the transport of viral DNA," Journal of General Virology, vol. 82, pp. 35-44, 2001. [149] G. Kotlizky, M. I. Boulton, C. Pitaksutheepong, J. W. Davies, and B. L. Epel, "Intracellular and intercellular movement of maize streak geminivirus V1 and V2 proteins transiently expressed as green fluorescent protein fusions," Virology, vol. 274, pp. 32-38, 2000. [150] W. Zhang, N. H. Olson, T. S. Baker, L. Faulkner, M. Agbandje-McKenna, M. I. Boulton, J. W. Davies, and R. McKenna, "Structure of the maize streak virus geminate particle," Virology, vol. 279, pp. 471-477, 2001. [151] O. Azzam, J. Frazer, D. De La Rosa, J. S. Beaver, P. Ahlquist, and D. P. Maxwell, "Whitefly transmission and efficient ssDNA accumulation of bean golden mosaic geminivirus require functional coat protein," Virology, vol. 204, pp. 289-296, 1994. [152] R. Briddon, M. Pinner, J. Stanley, and P. Markham, "Geminivirus coat protein gene replacement alters insect specificity," Virology, vol. 177, pp. 85-94, 1990. [153] P. Höfer, I. D. Bedford, P. G. Markham, H. Jeske, and T. Frischmuth, "Coat protein gene replacement results in whitefly transmission of an insect non- transmissible geminivirus isolate," Virology, vol. 236, pp. 288-295, 1997. [154] Y. Wang, Q. Mao, W. Liu, T. T. Mar, T. Wei, Y. Liu, and X. Wang, “Localization and distribution of Wheat dwarf virus in its vector leafhopper, Psammotettix alienus,”Phytopathology, vol. 104, pp. 897-904, 2014b. [155] H. Jeske, "Geminiviruses," in TT Viruses, ed: Springer, 2009, pp. 185-226. [156] H. Liu, M. I. Boulton, and J. W. Davies, "Maize streak virus coat protein binds single-and double-stranded DNA in vitro," Journal of General Virology, vol. 78, pp. 1265-1270, 1997. [157] R. W. Briddon, P. Lunness, L. C. Chamberlin, and P. G. Markham, "Analysis of the genetic variability of maize streak virus," Virus Genes, vol. 9, pp. 93- 100, 1994. [158] D. Martin, J. Willment, R. Billharz, R. Velders, B. Odhiambo, J. Njuguna, D. James, and E. Rybicki, "Sequence diversity and virulence in Zea mays of Maize streak virus isolates," Virology, vol. 288, pp. 247-255, 2001. [159] J. Willment, D. Martin, and E. Rybicki, "Analysis of the diversity of African streak mastreviruses using PCR-generated RFLPs and partial sequence data," Journal of Virological Methods, vol. 93, pp. 75-87, 2001. [160] A. L. Monjane, G. W. Harkins, D. P. Martin, P. Lemey, P. Lefeuvre, D. N. Shepherd, S. Oluwafemi, M. Simuyandi, I. Zinga, and E. K. Komba, "Reconstructing the history of maize streak virus strain a dispersal to reveal diversification hot spots and its origin in southern Africa," Journal of Virology,

112 7: References

vol. 85, pp. 9623-9636, 2011. [161] A. Varsani, A. L. Monjane, L. Donaldson, S. Oluwafemi, I. Zinga, E. K. Komba, D. Plakoutene, N. Mandakombo, J. Mboukoulida, and S. Semballa, "Comparative analysis of Panicum streak virus and Maize streak virus diversity, recombination patterns and phylogeography," Virology Journal, vol. 6, p. 1, 2009. [162] D. Rose, "Epidemiology of maize streak disease," Annual Review of Entomology, vol. 23, pp. 259-282, 1978. [163] J. McCann, "Maize, and Grace: history, corn, and Africa's new landscapes," Society for Comparative Study of Society and Health, vol. 43, pp. 246-272, 1999.

[164] A. Ekzayez, S. Kumari, and I. Ismail, "First report of wheat dwarf virus and its vector (Psammotettix provincialis) affecting wheat and barley crops in Syria," Plant Disease, vol. 95, pp. 76-76, 2011.

[165] J. Schubert, A. Habekuß, K. Kazmaier, and H. Jeske, "Surveying cereal- infecting geminiviruses in Germany-Diagnostics and direct sequencing using rolling circle amplification," Virus Research, vol. 127, pp. 61-70, 2007. [166] Y. Wang, Q.Q. Cong, Y.F. Lan, C. Geng, X.D. Li, Y.C. Liang, Z. Y. Yang, X. P. Zhu, and X. D. Li, "Development of new potato virus X-based vectors for gene over-expression and gene silencing assay, "Virus Research, vol. 191, pp. 62-69, 2014. [167] E. P. Rybicki, S. Dennis, G. Napier, and F. L. Hughes, "Novel grass and wheat strains of maize streak virus detected by DNA amplification and sequencing," Molecular Plant Pathology, 1998. [168] S. Oluwafemi, A. Varsani, A. L. Monjane, D. N. Shepherd, B. E. Owor, E. P. Rybicki, and D. P. Martin, "A new African streak virus species from Nigeria," Archives of Virology, vol. 153, pp. 1407-1410, 2008.

[169] J. Kumar, J. Kumar, S. P. Singh, and R. Tuli, "Association of satellites with a mastrevirus in natural infection: complexity of Wheat dwarf India virus disease," Journal of Virology, vol. 88, pp. 7093-7104, 2014.

[170] J. Kumar, S. P. Singh, J. Kumar, and R. Tuli, "A novel mastrevirus infecting wheat inIndia," Archives of Virology, vol.157, pp. 2031-2034, 2012.

[171] J. Schubert, A. Habekuß, B. Wu, T. Thieme, and X. Wang, "Analysis of completegenomes of isolates of the Wheat dwarf virus from new geographical locations and descriptions of their defective forms," Virus Genes, vol. 48, pp. 133-139, 2013. [172] T. Zaagueri, M. Mnari-Hattab, S. Zammouri, M. R. Hajlaoui, G. P. Accotto, and A. M. Vaira, "First Report of Chickpea chlorotic dwarf virus in watermelon (Citrullus lanatus) in Tunisia," Plant Disease, vol. 101, p. 392, 2017.

113 7: References

[173] S. Kraberger, S. G. Kumari, A. A. Hamed, B. Gronenborn, J. E. Thomas, M. Sharman, G. W. Harkins, B. M. Muhire, D. P. Martin, and A. Varsani, "Molecular diversity of Chickpea chlorotic dwarf virus in Sudan: High rates of intra-species recombination – a driving force in the emergence of new strains," Infection, Genetics and Evolution, vol. 29, pp. 203-215, 2015. [174] T. Zaagueri, L. Miozzi, M. Mnari-Hattab, E. Noris, G. Accotto, and A. Vaira, "Deep Sequencing Data and Infectivity Assays Indicate that Chickpea Chlorotic Dwarf Virus is the Etiological Agent of the “Hard Fruit Syndrome” of Watermelon," Viruses, vol. 9, p. 311, 2017.

[175] J. Thomas, J. Parry, M. Schwinghamer, and E. Dann, "Two novel mastreviruses from chickpea (Cicer arietinum) in Australia," Archives of Virology, vol. 155, pp. 1777-1788, 2010. [176] J. Hadfield, J. E. Thomas, M. W. Schwinghamer, S. Kraberger, D. Stainton, A. Dayaram, J. N. Parry, D. Pande, D. P. Martin, and A. Varsani, "Molecular characterisation of dicot-infecting mastreviruses from Australia," Virus Research, vol. 166, pp. 13-22, 2012. [177] S. Kraberger, G. W. Harkins, S. G. Kumari, J. E. Thomas, M. W. Schwinghamer, M. Sharman, D. A. Collings, R. W. Briddon, D. P. Martin and A. Varsani, "Evidence that dicot-infecting mastreviruses are particularly prone to inter-species recombination and have likely been circulating in Australia for longer than in Africa and the Middle East," Virology, vol. 444, pp. 282-291, 2013. [178] B. Wu, U. Melcher, X. Guo, X. Wang, L. Fan, and G. Zhou, "Assessment of codivergence of Mastreviruses with their plant hosts," BMC Evolutionary Biology, vol. 8, p. 1, 2008. [179] G. W. Harkins, W. Delport, S. Duffy, N. Wood, A. L. Monjane, B. E. Owor, L. Donaldson, S. Saumtally, G. Triton, and R. W. Briddon, "Experimental evidence indicating that mastreviruses probably did not co-diverge with their hosts," Virology Journal, vol. 6, p. 1, 2009. [180] G. W. Harkins, D. P. Martin, S. Duffy, A. L. Monjane, D. N. Shepherd, O. P. Windram, B. E. Owor, L. Donaldson, T. Van Antwerpen, and R. A. Sayed, "Dating the origins of the maize-adapted strain of maize streak virus, MSV-A," Journal of General Virology, vol. 90, pp. 3066-3074, 2009. [181] J. W. Drake, B. Charlesworth, D. Charlesworth, and J. F. Crow, "Rates of spontaneous mutation," Genetics, vol. 148, pp. 1667-1686, 1998. [182] J. Holland, K. Spindler, F. Horodyski, E. Grabau, S. Nichol, and S. VandePol, "Rapid evolution of RNA genomes," Science, vol. 215, pp. 1577-1585, 1982. [183] S. Duffy, L. A. Shackelton, and E. C. Holmes, "Rates of evolutionary change in viruses: patterns and determinants," Nature Reviews Genetics, vol. 9, pp. 267-276, 2008. [184] M. J. Roossinck, "Mechanisms of plant virus evolution," Annual Review of Phytopathology, vol. 35, pp. 191-209, 1997.

114 7: References

[185] F. García-Arenal, A. Fraile, and J. M. Malpica, "Variability and genetic structure of plant virus populations," Annual Review of Phytopathology, vol. 39, pp. 157-186, 2001. [186] E. van der Walt, D. P. Martin, A. Varsani, J. E. Polston, and E. P. Rybicki, "Experimental observations of rapid Maize streak virus evolution reveal a strand-specific nucleotide substitution bias," Virology Journal, vol. 5, p. 104, 2008. [187] P. Domingo-Calap, J. M. Cuevas, and R. Sanjuán, "The fitness effects of random mutations in single-stranded DNA and RNA bacteriophages," PLoS Genetics, vol. 5, p. e1000742, 2009. [188] R. Sanjuan, M. R. Nebot, N. Chirico, L. M. Mansky, and R. Belshaw, "Viral mutation rates," Journal of Virology, vol. 84, pp. 9733-9748, 2010. [189] L. Ge, J. Zhang, X. Zhou, and H. Li, "Genetic structure and population variability of Tomato yellow leaf curl China virus," Journal of Virology, vol. 81, pp. 5902-5907, 2007. [190] M. Isnard, M. Granier, R. Frutos, B. Reynaud, and M. Peterschmitt, "Quasispecies nature of three maize streak virus isolates obtained through different modes of selection from a population used to assess response to infection of maize cultivars," Journal of General Virology, vol. 79, pp. 3091- 3099, 1998. [191] A. L. Monjane, D. Pande, F. Lakay, D. N. Shepherd, E. van der Walt, P. Lefeuvre, J.-M. Lett, A. Varsani, E. P. Rybicki, and D. P. Martin, "Adaptive evolution by recombination is not associated with increased mutation rates in Maize streak virus," BMC Evolutionary Biology, vol. 12, p. 1, 2012. [192] G. Arguello-Astorga, J. T. Ascencio-Ibáñez, M. B. Dallas, B. M. Orozco, and L. Hanley-Bowdoin, "High-frequency reversion of geminivirus replication protein mutants during infection," Journal of Virology, vol. 81, pp. 11005- 11015, 2007. [193] D. N. Shepherd, D. P. Martin, D. R. McGivern, M. I. Boulton, J. A. Thomson, and E. P. Rybicki, "A three-nucleotide mutation altering the Maize streak virus Rep pRBR-interaction motif reduces symptom severity in maize and partially reverts at high frequency without restoring pRBR–Rep binding," Journal of General Virology, vol. 86, pp. 803-813, 2005. [194] D. N. Shepherd, D. P. Martin, A. Varsani, J. A. Thomson, E. P. Rybicki, and H. H. Klump, "Restoration of native folding of single-stranded DNA sequences through reverse mutations: an indication of a new epigenetic mechanism," Archives of Biochemistry and Biophysics, vol. 453, pp. 108-122, 2006. [195] E. W. Van der, K. E. Palmer, D. P. Martin, and E. P. Rybicki,"Viable chimaericviruses confirm the biological importance of sequence specific maize streak virus movement protein and coat protein interactions, "Virology Journal, vol. 5, pp. 61, 2008b.

[196] K. Rosario, M. Padilla-Rodriguez, S. Kraberger, D. Stainton, D.P. Martin, M.

115 7: References

Breitbart, and A. Varsani, "Discovery of a novel mastrevirus and alphasatellite-like circular DNA in dragonflies (Epiprocta) from Puerto Rico, "Virus Research, vol. 171, pp. 231-237, 2013.

[197] E. van der Walt, E. P. Rybicki, A. Varsani, J. Polston, R. Billharz, L. Donaldson, A. L. Monjane, and D. P. Martin, "Rapid host adaptation by extensive recombination," Journal of General Virology, vol. 90, pp. 734-746, 2009. [198] D. P. Martin, P. Lemey, M. Lott, V. Moulton, D. Posada, and P. Lefeuvre, "RDP3: a flexible and fast computer program for analyzing recombination," Bioinformatics, vol. 26, pp. 2462-2463, 2010. [199] M. Padidam, S. Sawyer, and C. M. Fauquet, "Possible emergence of new geminiviruses by frequent recombination," Virology, vol. 265, pp. 218-225, 1999. [200] P. Lefeuvre, J.-M. Lett, B. Reynaud, and D. P. Martin, "Avoidance of protein fold disruption in natural virus recombinants," PLoS Pathogens, vol. 3, p. e181, 2007. [201] P. Lefeuvre, D. Martin, M. Hoareau, F. Naze, H. Delatte, M. Thierry, A. Varsani, N. Becker, B. Reynaud, and J.M. Lett, "Begomovirus ‘melting pot’in the south-west Indian Ocean islands: molecular diversity and evolution through recombination," Journal of General Virology, vol. 88, pp. 3458-3468, 2007. [202] H. Prasanna, and M. Rai, "Detection and frequency of recombination in tomato-infecting begomoviruses of South and Southeast Asia," Virology Journal, vol. 4, p. 1, 2007.

[203] B. E. Owor, D. P. Martin, D. N. Shepherd, R. Edema, A. L. Monjane, E. P. Rybicki, J. A. Thomson, and A. Varsani, "Genetic analysis of maize streak virus isolates from Uganda reveals widespread distribution of a recombinant variant," Journal of General Virology, vol. 88, pp. 3154-3165, 2007. [204] K. M. Makkouk, Y. Fazlali, S. G. Kumari, and S. Farzadfar, "First record of Beet western yellows virus, Chickpea chlorotic dwarf virus, Faba bean necrotic yellows virus and Soybean dwarf virus infecting chickpea and lentil crops in Iran," Plant Pathology, vol.5 1, pp. 387-387, 2002.

[205] T. Candresse, D. Filloux, B. Muhire, C. Julian, S. Galzi, G. Fort, P.Bernardo, J.H. Daugrois, E. Fernandez, D. P. Martin, A. Varsani, and P.Roumagnac, "Appearances Can Be Deceptive: Revealing a Hidden Viral Infection with Deep Sequencing in a Plant Quarantine Context," PLoS One 9, e102945, 2014. [206] D. P. Martin, R. W. Briddon, and A. Varsani, "Recombination patterns in dicot- infecting mastreviruses mirror those found in monocot-infecting mastreviruses," Archives of Virology, vol. 156, pp. 1463-1469, 2011. [207] D. P. Martin, P. Lefeuvre, A. Varsani, M. Hoareau, J.Y. Semegni, B. Dijoux, C. Vincent, B. Reynaud, and J. M. Lett, "Complex recombination patterns arising

116 7: References

during geminivirus coinfections preserve and demarcate biologically important intra-genome interaction networks," PLoS Pathogens, vol. 7, p. e1002203, 2011.

[208] L. A. Selth, J. W. Randles, and M. A. Rezaian, "Host responses to transient expression of individual genes encoded by Tomato leaf curl virus, "Molecular Plant-Microbe Interactions, vol. 17, pp. 27-33, 2004.

[209] Y. Wang, M. Dang, H. Hou, Y. Mei, Y. Qian, and X. Zhou, "Identification of an RNA silencing suppressor encoded by a mastrevirus,"Journal of GeneralVirology, vol. 95, pp. 2082-2088, 2014. [210] M. Pilartz, and H. Jeske, "Abutilon mosaic geminivirus double-stranded DNA is packed into minichromosomes," Virology, vol. 189, pp. 800-802, 1992. [211] J. S. Elmer, L. Brand, G. Sunter, W. E. Gardiner, D. M. Bisaro, and S. G. Rogers, "Genetic analysis of the tomato golden mosaic virus II. The product of the AL1 coding sequence is required for replication," Nucleic Acids Research, vol. 16, pp. 7043-7060, 1988. [212] G. Sunter, M. D. Hartitz, S. G. Hormuzdi, C. L. Brough, and D. M. Bisaro, "Genetic analysis of tomato golden mosaic virus: ORF AL2 is required for coat protein accumulation while ORF AL3 is necessary for efficient DNA replication," Virology, vol. 179, pp. 69-77, 1990. [213] J. Laufs, W. Traut, F. Heyraud, V. Matzeit, S. G. Rogers, J. Schell and B. Gronenborn, "In vitro cleavage and joining at the viral origin of replication by the replication initiator protein of tomato yellow leaf curl virus," Proceedings of the National Academy of Sciences, vol. 92, pp. 3879-3883, 1995. [214] K. Saunders, A. Lucy, and J. Stanley, "DNA forms of the geminivirus African cassava mosaic virus consistent with a rolling circle mechanism of replication," Nucleic Acids Research, vol. 19, pp. 2325-2330, 1991. [215] H. Jeske, M. Lütgemeier, and W. Preiß, "DNA forms indicate rolling circle and recombination‐dependent replication of Abutilon mosaic virus," The EMBO Journal, vol. 20, pp. 6158-6167, 2001. [216] A. Kornberg, and T. A. Baker, “DNA replication,” American Society of Microbiology, USA, Second Edition, 1992. [217] M. M. Pooggin, "How can plant DNA viruses evade siRNA-directed DNA methylation and silencing?," International Journal of Molecular Sciences, vol. 14, pp. 15233-15259, 2013. [218] W. Preiss, and H. Jeske, "Multitasking in replication is common among geminiviruses," Journal of Virology, vol. 77, pp. 2972-2980, 2003. [219] J. B. Erdmann, D. N. Shepherd, D. P. Martin, A. Varsani, E. P. Rybicki, and H. Jeske, "Replicative intermediates of maize streak virus found during leaf development," Journal of General Virology, vol. 91, pp. 1077-1081, 2010. [220] B. Alberter, M. A. Rezaian, and H. Jeske, "Replicative intermediates of Tomato leaf curl virus and its satellite DNAs," Virology, vol. 331, pp. 441-448,

117 7: References

2005. [221] G. Morilla, A. G. Castillo, W. Preiss, H. Jeske, and E. R. Bejarano, "A versatile transreplication-based system to identify cellular proteins involved in geminivirus replication," Journal of Virology, vol. 80, pp. 3624-3633, 2006. [222] J. Jovel, W. Preiß, and H. Jeske, "Characterization of DNA intermediates of an arising geminivirus," Virus Research, vol. 130, pp. 63-70, 2007. [223] M. Schneider, E. Jarchow, and B. Hohn, "Mutational analysis of the ‘conserved region’of maize streak virus suggests its involvement in replication," Plant Molecular Biology, vol. 19, pp. 601-610, 1992. [224] J. A. Lindbo, W. P. Fitzmaurice, and G. della-Cioppa, "Virus-mediated reprogramming of gene expression in plants," Current Opinion in Plant Biology, vol. 4, pp. 181-185, 2001. [225] D. M. Bisaro, "Silencing suppression by geminivirus proteins," Virology, vol. 344, pp. 158-168, 2006. [226] M. Kumagai, J. Donson, G. Della-Cioppa, D. Harvey, K. Hanley, and L. Grill, "Cytoplasmic inhibition of carotenoid biosynthesis with virus-derived RNA," Proceedings of the National Academy of Sciences, vol. 92, pp. 1679-1683, 1995.

[227] S. M. Angell, and D. C. Baulcombe, "Potato virus X amplicon‐mediated silencing of nuclear genes," The Plant Journal, vol. 20, pp. 357-362, 1999. [228] S. A. MacFarlane, and A. H. Popovich, "Efficient expression of foreign proteins in roots from tobravirus vectors," Virology, vol. 267, pp. 29-35, 2000. [229] A. C. Mallory, G. Parks, M. W. Endres, D. Baulcombe, L. H. Bowman, G. J. Pruss, and V. B. Vance, "The amplicon-plus system for high-level expression of transgenes in plants," Nature Biotechnology, vol. 20, pp. 622-625, 2002. [230] S. M. Elbashir, J. Martinez, A. Patkaniowska, W. Lendeckel, and T. Tuschl, "Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate," The EMBO Journal, vol. 20, pp. 6877-6888, 2001. [231] T. Tuschl, P. D. Zamore, R. Lehmann, D. P. Bartel, and P. A. Sharp, "Targeted mRNA degradation by double-stranded RNA in vitro," Genes and Development, vol. 13, pp. 3191-3197, 1999. [232] P. D. Zamore, T. Tuschl, P. A. Sharp, and D. P. Bartel, "RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals," Cell, vol. 101, pp. 25-33, 2000. [233] S.W. Ding, "RNA-based antiviral immunity," Nature Reviews Immunology, vol. 10, pp. 632-644, 2010. [234] M. R. Sudarshana, G. Roy, and B. W. Falk, "Methods for engineering resistance to plant viruses," Plant-Pathogen Interactions: Methods and Protocols, pp. 183-195, 2007.

118 7: References

[235] P. M. Waterhouse, M. W. Graham, and M.B. Wang, "Virus resistance and gene silencing in plants can be induced by simultaneous expression of sense and antisense RNA," Proceedings of the National Academy of Sciences, vol. 95, pp. 13959-13964, 1998. [236] W. Zha, X. Peng, R. Chen, B. Du, L. Zhu, and G. He, "Knockdown of midgut genes by dsRNA-transgenic plant-mediated RNA interference in the hemipteran insect Nilaparvata lugens," Plos One, vol. 6, e20504, 2011. [237] M. Tierney, and K. Lamour, "An introduction to reverse genetic tools for investigating gene function". The Plant Health Instructor, 2005. [238] D. Dykxhoorn, D. Palliser, and J. Lieberman, "The silent treatment: siRNAs as small molecule drugs," Gene Therapy, vol. 13, pp. 541-552, 2006. [239] D. H. Kim, and J. J. Rossi, "Strategies for silencing human disease using RNA interference," Nature Reviews Genetics, vol. 8, pp. 173-184, 2007. [240] A. de Fougerolles, H. P. Vornlocher, J. Maraganore, and J. Lieberman, "Interfering with disease: a progress report on siRNA-based therapeutics," Nature Reviews Drug Discovery, vol. 6, pp. 443-453, 2007. [241] F. Takeshita, and T. Ochiya, "Therapeutic potential of RNA interference against cancer," Cancer Science, vol. 97, pp. 689-696, 2006. [242] A. Idris, K. Mills-Lujan, K. Martin, and J. Brown, "Melon chlorotic leaf curl virus: characterization and differential reassortment with closest relatives reveal adaptive virulence in the squash leaf curl virus clade and host shifting by the host-restricted bean calico mosaic virus," Journal of Virology, vol. 82, pp. 1959-1967, 2008. [243] H. Jeske, "Geminiviruses,. In zur Hausen H, de Villiers EM (ed), Torque Teno virus: the still elusive human pathogens," ed: Springer, Berlin, Germany, pp. 185-226, 2009. [244] E. Domingo, "Mechanisms of viral emergence," Veterinary Research, vol. 41, p. 38, 2010. [245] M. C. Christman, A. Kedwaii, J. Xu, R. O. Donis, and G. Lu, "Pandemic (H1N1) 2009 virus revisited: an evolutionary retrospective," Infection, Genetics and Evolution, vol. 11, pp. 803-811, 2011. [246] V. Fondong, J. Pita, M. Rey, A. De Kochko, R. Beachy, and C. Fauquet, "Evidence of synergism between African cassava mosaic virus and a new double-recombinant geminivirus infecting cassava in Cameroon," Journal of General Virology, vol. 81, pp. 287-297, 2000. [247] J. Pita, V. Fondong, A. Sangare, G. Otim-Nape, S. Ogwal, and C. Fauquet, "Recombination, pseudorecombination and synergism of geminiviruses are determinant keys to the epidemic of severe cassava mosaic disease in Uganda," Journal of General Virology, vol. 82, pp. 655-665, 2001. [248] J. Stanley, P. Markham, R. Callis, and M. Pinner, "The nucleotide sequence of an infectious clone of the geminivirus beet curly top virus," The EMBO

119 7: References

Journal, vol. 5, p. 1761, 1986. [249] R. W. Briddon, I. D. Bedford, J. H. Tsai, and P. G. Markham, "Analysis of the nucleotide sequence of the treehopper-transmitted geminivirus, tomato pseudo-curly top virus, suggests a recombinant origin," Virology, vol. 219, pp. 387-394, 1996. [250] L. Berrie, E. Rybicki and M. Rey, "Complete nucleotide sequence and host range of South African cassava mosaic virus: further evidence for recombination amongst begomoviruses," Journal of General Virology, vol. 82, pp. 53-58, 2001.

[251] A. I. Sanz, A. Fraile, F. Garcıá -Arenal, X. Zhou, D. J. Robinson, S. Khalid, T. Butt, and B. D. Harrison, "Multiple infection, recombination and genome relationships among begomovirus isolates found in cotton and other plants in Pakistan," Journal of General Virology, vol. 81, pp. 1839-1849, 2000. [252] X. Zhou, Y. Liu, L. Calvert, C. Munoz, G. W. Otim-Nape, D. J. Robinson, and B. D. Harrison, "Evidence that DNA-A of a geminivirus associated with severe cassava mosaic disease in Uganda has arisen by interspecific recombination," Journal of General Virology, vol. 78, pp. 2101-2111, 1997. [253] X. Zhou, Y. Liu, D. J. Robinson and B. D. Harrison, "Four DNA-A variants among Pakistani isolates of cotton leaf curl virus and their affinities to DNA-A of geminivirus isolates from okra," Journal of General Virology, vol. 79, pp. 915-923, 1998. [254] R. K. Varshney, D. A. Hoisington, H. D. Upadhyaya, P. M. Gaur, S. N. Nigam, K. Saxena, V. Vadez, N. K. Sethy, S. Bhatia, R. Aruna, M. V. Channabyre Gowda, and N. K. Singh, "Molecular Genetics and Breeding of Grain Legume Crops for the Semi-Arid Tropics," in Genomics-Assisted Crop Improvement, pp. 207-241, 2007. [255] FAOSTAT, Data. "Food and agriculture organization of the United Nations. Statistical database." 2013. [256] K. P. Akhtar, M. Ahmad, T. M. Shah, and B. M. Atta, "Transmission of Chickpea chlorotic dwarf virus in Chickpea by the leafhopper Orosius albicinctus (Distant) in Pakistan - Short communication," Plant Protection Science, vol. 47, pp. 1-4, 2011. [257] S. G. Kumari, K. M. Makkouk, N. Attar, W. Ghulam, and D. E. Lesemann, "First report of chickpea chlorotic dwarf virus infecting spring chickpea in Syria," Plant Disease, vol. 88, p. 424, 2004. [258] M. J. Fletcher, "Identification keys and checklists for the leafhoppers, planthoppers and their relatives occurring in Australia and neighbouring areas (Hemiptera: Auchenorrhyncha)," 2009. [259] E. J. Knights, N. Açikgöz, T. Warkentin, G. Bejiga, S. S. Yadav, and J. S. Sandhu, "Area, production, and distribution," Chickpea Breeding and Management, pp. 167-178, 2007.

120 7: References

[260] L. Bos, R. Hampton, and K. Makkouk, "Viruses and virus diseases of pea, lentil, faba bean and chickpea," In World Crops: Cool Season Food Legumes, ed: Springer, pp. 591-615, 1988. [261] J. K. Brown, J. Bird, and D. C. Fletcher, "First report of passiflora leaf mottle disease caused by a whitefly-transmitted geminivirus in Puerto Rico," Plant Disease, vol. 77, p. 1264, 1993. [262] K. Makkouk, M. Bashir, R. Jones, and S. Kumari, "Survey for viruses in lentil and chickpea crops in Pakistan," Zeitschrift für Pflanzenkrankheiten und Pflanzenschutz, vol. 108, pp. 258-268, 2001. [263] K. M. Makkouk, "Virus diseases of legume crops transmitted persistently by sucking insects," Grain Legumes, vol. 21, pp. 9-10, 1998. [264] C. Cenchrus, and D. Coix, "Characterization of maize streak virus isolates using monoclonal and polyclonal antibodies and by transmission to a few hosts," Plant Disease, p. 27, 1991. [265] R. Greber, "Biological characteristics of grass geminiviruses from eastern Australia," Annals of Applied Biology, vol. 114, pp. 471-480, 1989. [266] S. G. Kumari, K. M. Makkouk, and N. Attar, "An improved antiserum for sensitive serologic detection of chickpea chlorotic dwarf virus," Journal of Phytopathology, vol. 154, pp. 129-133, 2006. [267] L. Liu, T. van Tonder, G. Pietersen, J. W. Davies, and J. Stanley, "Molecular characterization of a subgroup I geminivirus from a legume in South Africa," Journal of General Virology, vol. 78, pp. 2113-2117, 1997. [268] N. Nahid, I. Amin, S. Mansoor, E. P. Rybicki, E. van der Walt, and R. W. Briddon, "Two dicot-infecting mastreviruses (family Geminiviridae) occur in Pakistan," Archives of Virology, vol. 153, pp. 1441-1451, 2008. [269] X. P. Zhou, Y. Xie X. R. Tao K. Z. Zhang Z. H. Li, and C. M. Fauquet, "Characterization of DNAβ associated with begomoviruses in China and evidence for co-evolution with their cognate viral DNA-A," Journal of General Virology vol. 84, pp. 237-47.

[270] M. Ali, S. Kumari, K. Makkouk, and M. Hassan, "Chickpea chlorotic dwarf virus (CpCDV) naturally infects Phaseolus bean and other wild species in the Gezira region of Sudan," Arab Journal of Plant Protection, vol. 22, p. 96, 2004. [271] S. H. Farzadfar, R. Pourrahim, A. R. Golnaraghi, and A. Ahoonmanesh, "PCR detection and partial molecular characterization of Chickpea chlorotic dwarf virus in naturally infected sugar beet plants in Iran," Journal of Plant Pathology, vol. 90, pp. 247-251, 2008. [272] A. J. Khan, S. Akhtar, and R. W. Briddon, "A distinct strain of Chickpea chlorotic dwarf virus associated with pepper in Oman," Plant Disease, vol. 98, pp. 1287-1287, 2015.

121 7: References

[273] M. Manzoor, M. Ilyas, M. Shafiq, M. Haider, A. Shahid, and R. Briddon, "A distinct strain of chickpea chlorotic dwarf virus (genus Mastrevirus, family Geminiviridae) identified in cotton plants affected by leaf curl disease," Archives of Virology, vol. 159, pp. 1-5, 2013. [274] I. F. Fahmy, O. Taha, and A. N. El-Ashry, "First genome analysis and molecular characterization of Chickpea chlorotic dwarf virus Egyptian isolate infecting squash," Virus Disease, vol. 26, pp. 33-41, 2015. [275] H. Storey, "Transmission studies of maize streak disease1," Annals of Applied Biology, vol. 15, pp. 1-25, 1928. [276] D. P. Martin, P. Lefeuvre, A. Varsani, M. Hoareau, J. Y. Semegni, B. Dijoux, C. Vincent, B. Reynaud, and J. M. Lett, "Complex recombination patterns arising during geminivirus coinfections preserve and demarcate biologically important intra-genome interaction networks," PLoS Pathogens, vol. 7, p. e1002203, 2011.

[277] M. Mubin, S. Mansoor, and R. W. Briddon, "Mastrevirus sequences in a begomovirus-infected plant," Virus Genes, vol. 44, pp. 536-538, 2012. [278] M. Mubin, I. Amin, L. Amrao, R. W. Briddon, and S. Mansoor, "The hypersensitive response induced by the V2 protein of a monopartite begomovirus is countered by the C2 protein," Molecular Plant Pathology, vol. 11, pp. 245-254, 2010. [279] J. F. Kreuze, A. Perez, M. Untiveros, D. Quispe, S. Fuentes, I. Barker, and R. Simon, "Complete viral genome sequence and discovery of novel viruses by deep sequencing of small RNAs: a generic method for diagnosis, discovery and sequencing of viruses," Virology, vol. 388, pp. 1-7, 2009. [280] T. Paprotka, V. Metzler, and H. Jeske, "The first DNA 1-like α satellites in association with New World begomoviruses in natural infections," Virology, vol. 404, pp. 148-157, 2010. [281] K. Rosario, M. Padilla-Rodriguez, S. Kraberger, D. Stainton, D. P. Martin, M. Breitbart, and A. Varsani, "Discovery of a novel mastrevirus and alphasatellite-like circular DNA in dragonflies (Epiprocta) from Puerto Rico," Virus Research, vol. 171, pp. 231-237, 2013. [282] T. Candresse, D. Filloux, B. Muhire, C. Julian, S. Galzi, G. Fort, P. Bernardo, J.-H. Daugrois, E. Fernandez, D. P. Martin, A. Varsani, and P. Roumagnac, "Appearances Can Be Deceptive: Revealing a Hidden Viral Infection with Deep Sequencing in a Plant Quarantine Context," PLoS One, vol. 9, p. e102945, 2014. [283] M. J. Roossinck, "The big unknown: plant virus biodiversity," Current Opinion in Virology, vol. 1, pp. 63-67, 2011. [284] B. O. Agindotan, L. L. Domier, and C. A. Bradley, "Detection and characterization of the first North American mastrevirus in switch grass," Archives of Virology, vol. 160, pp. 1313-1317, 2015.

122 7: References

[285] S. Massart, A. Olmos, H. Jijakli, and T. Candresse, “Current impact and future directions of high throughput sequencing in plant virus diagnostics,” Virus Research, vol. 188, pp. 90-96, 2014. [286] J. Seguin, R. Rajeswaran, N. Malpica-Lopez, R. R. Martin, K. Kasschau, V. V. Dolja, P. Otten, L. Farinelli, and M.M. Pooggin, “De novo reconstruction of consensus master genomes of plant RNA and DNA viruses from siRNAs,” PloS One, vol. 9, p.e88513, 2014. [287] D. Haible, S. Kober, and H. Jeske, "Rolling circle amplification revolutionizes diagnosis and genomics of geminiviruses," Journal of Virological Methods, vol. 135, pp. 9-16, 2006. [288] R. Edgar, "MUSCLE: a multiple sequence alignment method with reduced time and space complexity," BMC Bioinformatics, vol. 5, p. 113, 2004. [289] K. Tamura, G. Stecher, D. Peterson, A. Filipski, and S. Kumar, "MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0," Molecular Biology and Evolution, vol. 30, pp. 2725-2729, 2013. [290] D. T. Jones, W. R. Taylor, and J. M. Thornton, "The rapid generation of mutation data matrices from protein sequences," Computer Applications in the Biosciences, vol. 8, pp. 275-282, 1992. [291] A. M. Idris, M. S. Shahid, R. W. Briddon, A. J. Khan, J.K. Zhu, and J. K. Brown, "An unusual alphasatellite associated with monopartite begomoviruses attenuates symptoms and reduces betasatellite accumulation," Journal of General Virology, vol. 92, pp. 706-717, 2011. [292] M. Hussain, S. Mansoor, S. Iram, Y. Zafar, and R. W. Briddon, "The hypersensitive response to tomato leaf curl New Delhi virus nuclear shuttle protein is inhibited by transcriptional activator protein," Molecular Plant- Microbe Interactions, vol. 20, pp. 1581-1588, 2007. [293] B. M. Orozco, H. J. Gladfelter, S. B. Settlage, P. A. Eagle, R. N. Gentry, and L. Hanley-Bowdoin, "Multiple cis elements contribute to geminivirus origin function," Virology, vol. 242, pp. 346-356, 1998. [294] G. R. Argüello-Astorga, and R. Ruiz-Medrano, "An iteron-related domain is associated to motif 1 in the replication proteins of geminiviruses: identification of potential interacting amino acid-base pairs by a comparative approach.," Archives of Virology, vol. 146, pp. 1465-1485, 2001. [295] J. M. I. Hofer, E. L. Dekker, H. V. Reynolds, C. J. Woolston, B. S. Cox, and P. M. Mullineaux, "Coordinate Regulation of Replication and Virion Sense Gene Expression in Wheat Dwarf Virus," Plant Cell, vol. 4, pp. 213-223, 1992. [296] J. Laufs, W. Traut, F. Heyraud, V. Matzeit, S. G. Rogers, J. Schell, and B. Gronenborn, "In vitro cleavage and joining at the viral origin of replication by the replication initiator protein of tomato yellow leaf curl virus," Proceedings of the National Academy of Sciences, vol. 92, pp. 3879-3883, 1995. [297] E. V. Koonin, and T. V. Ilyina, "Geminivirus replication proteins are related to

123 7: References

prokaryotic plasmid rolling circle DNA replication initiator proteins," Journal of General Virology, vol. 73, pp. 2763-2766, 1992. [298] E. R. Garrido-Ramirez, M. R. Sudarshana, W. J. Lucas, and R. L. Gilbertson, “Bean dwarf mosaic virus BV1 protein is a determinant of the hypersensitive response and avirulence in Phaseolus vulgaris,” Molecular Plant-Microbe Interactions, vol. 13, pp. 1184-1194, 2000. [299] M. Hussain, S. Mansoor, S. Iram, A. N. Fatima, and Y. Zafar, “The nuclear shuttle protein of Tomato leaf curl New Delhi virus is a pathogenicity determinant,” Journal of Virology, vol. 79, pp. 4434-4439, 2005. [300] H. Mumtaz, S. G. Kumari, S. Mansoor, D. P. Martin, and R. W. Briddon, "Analysis of the sequence of a dicot-infecting mastrevirus (family Geminiviridae) originating from Syria," Virus Genes, vol. 42, pp. 422-428, 2011. [301] M. L. Metzker, "Sequencing technologies-the next generation,” Nature Reviews Genetics, vol. 11, pp. 31-46, 2010. [302] H. Aydin, F.J. Muehlbauer, and W.J. Kaiser, “Pea enation mosaic virus resistance in lentil (Lens culinaris),” Plant Disease, vol. 71, pp. 635-638, 1987. [303] N. Y. Asaad, S. G. Kumari, A. A. Haj Kassem, A. B. A. Shalaby, S. Al-Shaabi, and R. S. Malhotra, “Detection and characterization of Chickpea chlorotic stunt virus in Syria,” Journal of Phytopathology, vol. 157, pp. 756-761, 2009. [304] A. Franz, K. M. Makkouk, L. Katul, and H. J. Vetten, “Monoclonal antibodies for the detection and differentiation of faba bean necrotic yellows virusisolates,” Annals of Applied Biology, vol. 128, pp. 255-268, 1996. [305] P. Trębicki, R. Harding, B. Rodoni, G. Baxter, and K. Powell, "Vectors and alternative hosts of Tobacco yellow dwarf virus in southeastern Australia," Annals of Applied Biology, vol. 157, pp. 13-24, 2010. [306] M. N. Tahir, I. Amin, R. W. Briddon, and S. Mansoor, "The merging of two dynasties - identification of an African cotton leaf curl disease-associated begomovirus with cotton in Pakistan," PLoS One, vol. 6, p. e20366, 2011. [307] J. Stanley, P. G. Markham, R. J. Callis, and M. S. Pinner, "The nucleotide sequence of an infectious clone of the geminivirus beet curly top virus," EMBO Journal, vol. 5, pp. 1761-1767, 1986. [308] E. R. Garrido-Ramirez, M. R. Sudarshana, W. J. Lucas, and R. L. Gilbertson, "Bean dwarf mosaic virus BV1 protein is a determinant of the hypersensitive response and avirulence in Phaseolus vulgaris," Molecular Plant-Microbe Interactions, vol. 13, pp. 1184-1194, 2000. [309] M. Hussain, S. Mansoor, S. Iram, A. N. Fatima, and Y. Zafar, "The nuclear shuttle protein of Tomato leaf curl New Delhi virus is a pathogenicity determinant," Journal of Virology, vol. 79, pp. 4434-4439, 2005. [310] D. N. Shepherd, T. Mangwende, D. P, Martin, M. Bezuidenhout, J. A.

124 7: References

Thomson, and E.P. Rybicki, “Inhibition of maize streak virus (MSV) replication by transient andtransgenic expression of MSV replication- associated protein mutants," Journal of General Virology, vol. 88, pp. 325- 336, 2007. [311] N. Nahid, I. Amin, R. W. Briddon, and S. Mansoor, "RNA interference based resistance against a legume mastrevirus.," Virology Journal, vol. 8, pp. 499, 2011. [312] J. Schubert, A. Habeku, K. Kazmaier, and H. Jeske, "Surveying cereal- infecting geminiviruses in Germany-diagnostics and direct sequencing using rolling circle amplification," Virus Research, vol. 127, pp. 61-70, 2007.

[313] F. Sanger, S. Nicklen, and A. R. Coulson, "DNA sequencing with chain- terminating inhibitors," Proceedings of the National Academy of Sciences, vol. 74, pp. 5463-5467, 1977. [314] J. Fletcher, "Surveys of virus diseases in pea, lentil, dwarf and broad bean crops in South Island, New Zealand," New Zealand Journal of Crop and Horticultural Science, vol. 21, pp. 45-52, 1993. [315] M. Bashir, and B. A. Malik, "Diseases of major pulse crops in Pakistan-a review," International Journal of Pest Management, vol. 34, pp. 309-314, 1988. [316] J. Kumar, S. Gunapati, S. Singh, A. Kumar, A. Lalit, N. Sharma, R. Puranik, and R. Tuli, "A new betasatellite associated with cotton leaf curl Burewala virus infecting tomato in India: influence on symptoms and viral accumulation," Archives of Virology, vol. 158, pp. 1349-1353, 2013. [317] M. Juárez, R. Tovar, E. Fiallo-Olivé, M. Aranda, B. Gosálvez, P. Castillo, E. Moriones, and J. Navas-Castillo, "First detection of tomato leaf curl New Delhi virus infecting zucchini in Spain," Annual Review of Virology Nov, vol. 2, pp. 67-93, 2015. [318] M. Mnari-Hattab, S. Zammouri, M. Belkadhi, D. B. Doña, E. Ben Nahia, and M. Hajlaoui, "First report of Tomato leaf curl New Delhi virus infecting cucurbits in Tunisia," New Disease Reports, vol. 31, p.21, 2015. [319] S. Panno, G. Iacono, M. Davino, S. Marchione, V. Zappardo, P. Bella, L. Tomassoli, G. Accotto, and S. Davino, "First report of Tomato leaf curl New Delhi virus affecting zucchini squash in an important horticultural area of southern Italy," New Disease Reports, vol. 33, p. 6, 2016.

[320] K. Naimuddin, M. Akram and A. K. Agnihotri," Molecular characterization of a first begomovirus associated with lentil (Lens culinaris) from India," Acta Virologica, vol. 60, pp. 217-223, 2016.

[321] S. S. E. A. Zaidi, M. Shafiq, I. Amin, B. E. Scheffler, J. A. Scheffler, R. W. Briddon, and S. Mansoor, “Frequent occurrence of Tomato leaf curl New Delhi virus in cotton leaf curl disease affected cotton in Pakistan,”PLoS One 11, 2016.

125 7: References

[322] H. H. Chang, H. M. Ku, W. S. Tsai, R. C. Chien, and F. J. Jan, “Identification and characterization of a mechanical transmissible begomovirus causing leaf curl on oriental melon," European Journal of Plant Pathology, vol. 127, pp. 219-228, 2010.

[323] S. S. E. A. Zaidi, D. P. Martin, I. Amin, M. Farooq, and S. Mansoor,“Tomato leaf curl New Delhi virus; a widespread bipartite begomovirus in the territory of monopartite begomoviruses," Molecular Plant Pathology, vol. 18, pp. 901- 911, 2017.

[324] L. Barzon, E. Lavezzo, V. Militello, S. Toppo, and G. Palù, “Applications of next-generation sequencing technologies to diagnostic virology,” International Journal of Molecular Sciences, vol. 1211, pp. 7861-7884, 2011. [325] J. J. Doyle, "Isolation of plant DNA from fresh tissue," Focus, vol. 12, pp. 13- 15, 1990. [326] D. R. Zerbino, and E. V. Birney, “Algorithms for de novo short read assembly using de Bruijn graphs,” Genome Research, vol. 18, pp. 821-9, 2008. [327] R. Li, H. Zhu, J. Ruan, W. Qian, X. Fang, Z. Shi, Y. Li, S. Li, G. Shan, K. Kristiansen, and S. Li, “De novo assembly of human genomes with massively parallel short read sequencing,” Genome Research, vol. 20, pp. 265-272, 2010. [328] S. Kumar, S. Glen, and K. Tamura, "MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets." Molecular biology and evolution : msw054, 2016 . [329] M. Kimura, “A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences,” Journal of Molecular Evolution, vol. 16, pp. 111-120, 1980. [330] J. K. Brown, F. M. Zerbini, J. Navas-Castillo, E. Moriones, R. Ramos- Sobrinho, J. F. Silva, E. Fiallo-Olivé, R. W. Briddon, C. Hernández-Zepeda, A. Idris, V. G. Malathi, D. P. Martin, R. Rivera-Bustamante, S. Ueda, and A. Varsani," Revision of Begomovirus taxonomy based on pairwise sequence comparisons," Archives of Virology, vol, 160, pp. 1593-1619, 2015.

[331] M. Ilyas, J. Qazi, S. Mansoor, and R. W. Briddon, "Genetic diversity and phylogeography of begomoviruses infecting legumes in Pakistan," Journal of General Virology, vol. 91, pp. 2091-2101, 2010. [332] G. Anfoka, F. H. Ahmad, M. Abhary, and A. Hussein, "Detection and molecular characterization of viruses associated with tomato yellow leaf curl disease in cucurbit crops in Jordan," Plant Pathology, vol. 58, pp. 754-762, 2009.

[333] R. P. Halley-Stott, F. Tanzer, D. P. Martin, and E. P. Rybicki, "The complete nucleotide sequence of a mild strain of Bean yellow dwarf virus,"Archives of Virology, vol. 152, pp. 1237-1240, 2007.

126 7: References

[334] X. Zhou, Y. Liu, L. Calvert, C. Munoz, G. W. Otim-Nape, D. J. Robinson, and B. D. Harrison, "Evidence that DNA A of a geminivirus associated with severe cassava mosaic disease in Uganda has arisen by interspecific recombination," Journal of General Virology, vol. 78, pp. 2101-2111, 1997.

[335] J. Navas-Castillo, S. Sanchez-Campos, E. Noris, D. Louro, G. P. Accotto, and E. Moriones, “Natural recombination between Tomato yellow leaf curl virus-Is and Tomato leaf curl virus,” Journal of General Virology, vol. 81, pp. 2797- 2801, 2000. [336] R. W. Briddon, I. D. Bedford, J. H. Tsai, and P. G. Markham, “Analysis of the nucleotide sequence of the treehopper-transmitted geminivirus, tomato pseudo-curly top virus, suggests a recombinant origin,” Virology, vol. 219, pp. 387-394, 1996. [337] M. Zaitlin, and R. Hull, "Plant Virus-Host Interaction," Annual Review of Plant Physiology, vol. 38, pp. 291-315, 1987.

[338] C. Lico, Q. Chen, and L. Santi, "Viral vectors for production of recombinant proteins in plants," Journal of Cell Physiology, vol. 216, pp. 366-77, 2008. [339] S. G. Kumari, A. Najar, S. Timoumi, M. F. Male, S. Kraberger, and A. Varsani, "First report of Chickpea chlorotic dwarf virus naturally infecting chickpea in Tunisia," New Disease Reports, vol. 32, p.16, 2015. [340] S. Chapman, T. Kavanagh, and D. Baulcombe, "Potato virus X as a vector for gene expression in plants," The Plant Journal, vol. 2, pp. 549-557, 1992. [341] C. Jordan, W. Shen, L. Hanley-Bowdoin, and D. Robertson, "Geminivirus- induced gene silencing of the tobacco retinoblastoma-related gene results in cell death and altered development," Plant Molecular Biology, vol. 65, pp. 163-175, 2007. [342] I. Amin, B. L. Patil, R.W. Briddon, S. Mansoor, and C.M. Fauquet, "Comparison of phenotypes produced in response to transient expression of genes encoded by four distinct begomoviruses in Nicotiana benthamiana and their correlation with the levels of developmental miRNAs" Virology Journal vol. 8, pp. 238, 2011. [343] W. E. Gardiner, G. Sunter, L. Brand, J. S. Elmer, S. G. Rogers, and D. M. Bisaro, "Genetic analysis of tomato golden mosaic virus: the coat protein is not required for systemic spread or symptom development," EMBO Journal vol. 7, pp. 899-904, 1988. [344] A. Klinkenberg, S. Ellwood, and J. Stanley, "Fate of African cassava mosaic virus coat protein deletion mutants after agroinoculation," Journal of General Virology, vol. 70, pp. 1837-1844, 1989. [345] R. W. Briddon, and P. G. Markham, "Complementation of bipartite begomovirus movement functions by topocuviruses and curtoviruses," Archives of Virology, vol. 146, pp. 1811-1819, 2001.

127 7: References

[346] Q. Haq, P. Jyothsna, A. Ali, and V. Malathi, "Coat protein deletion mutation of Mungbean yellow mosaic India virus (MYMIV)," Journal of Plant Biochemistry and Biotechnology, vol. 20, pp. 182-189, 2011. [347] Z. Iqbal, M.N. Sattar, A. Kvarnheden, S. Mansoor, and R.W. Briddon, "Effects of the mutation of selected genes of Cotton leaf curl Kokhran virus on infectivity, symptoms and the maintenance of Cotton leaf curl Multan betasatellite," Virus Research, vol. 169, pp. 107-116, 2012. [348] M. I. Boulton, C. K. Pallaghy, M. Chatan, S. Macfarlane, and J. W. Davies, "Replication of maize streak virus mutants in maize protoplasts: evidence for a movement protein," Virology, vol. 192, pp. 85-93, 1993. [349] P. M. Mullineaux, M. I. Boulton, P. Bowyer, R. van der Vlugt, M. Marks, J. Donson, and J. W. Davies, "Detection of a non-structural protein of Mr 11000 encoded by the virion DNA of maize streak virus," Plant Molecular Biology, vol. 11, pp. 57-66, 1988. [350] C. Pitaksutheepong, "Biological and functional aspects of the movement proteins of maize streak virus and bean yellow dwarf virus in transgenic plants. Ph.D. thesis, University of East Anglia, UK, 1999. [351] L. Liu, K. Saunders, C.L. Thomas, J.W. Davies, and J. Stanley, "Bean yellow dwarf virus RepA, but not Rep, binds to maize retinoblastoma protein, and the virus tolerates mutations in the consensus binding motif," Virology, vol. 256, pp. 270-279, 1999. [352] C. Gutierrez, "Geminiviruses and the plant cell cycle," Plant Molecular Biology, vol. 43, pp. 763-772, 2000a. [353] C. Gutierrez,"DNA replication and the cell cycle in plants: learning from geminiviruses," EMBO Journal, vol. 19, pp. 792-799, 2000b. [354] Y. Wang, M. Dang, H. Hou, Y. Mei, Y. Qian, and X. Zhou, "Identification of an RNA Silencing Suppressor encoded by a Mastrevirus,"Journal of General Virology, vol. 95, pp. 2082-2088, 2014. [355] Y. Qian, H. Hou, Q. Shen, X. Cai, G. Sunter, and X. Zhou, "RepA protein encoded by Oat dwarf virus elicits a temperature-sensitive hypersensitive response-type cell death that involves jasmonic acid–dependent signaling," Molecular Plant-Microbe Interaction, vol. 29, pp. 5-21, 2015. [356] J. B. Morel, and J. L. Dangl, "The hypersensitive response and the induction of cell death in plants," Cell Death Differentiation, vol. 4, pp. 671- 683, 1997. [357] J. L. Dangl, R. A. Dietrich, and M. H. Richberg, "Death don’t have no mercy: cell death programs in plant–microbe interactions," Plant Cell, vol. 8, 1793- 1807, 1996. [358] J. T. Greenberg, and N. Tao, "The role and regulation of programmed cell death in plant-pathogen interactions," Cellular Microbiology, vol. 6, pp. 201- 211, 2004.

128 7: References

[359] G. Sunter, and D. M. Bisaro, "Transactivation in a geminivirus: AL2 gene product is needed for coat protein expression," Virology, vol. 180, pp. 416- 419, 1991. [360] J. M. I. Hofer, E. L. Dekker, H. V. Reynolds, C. J. Woolston, B. S. Cox, and P. M. Mullineaux, "Coordinate Regulation of Replication and Virion Sense Gene Expression in Wheat Dwarf Virus," Plant Cell, vol. 4, pp. 213-223, 1992. [361] P.V. Shivaprasad, R. Akbergenov, D. Trinks, R. Rajeswaran, K. Veluthambi, T. Hohn, and M.M. Pooggin, "Promoters, transcripts, and regulatory proteins of Mungbean yellow mosaic geminivirus," Journal of Virology, vol.79, pp. 8149-8163, 2005. [362] D. Trinks, R. Rajeswaran, P. V. Shivaprasad, R. Akbergenov, E. J. Oakeley, K. Veluthambi, T. Hohn, and M. M. Pooggin, "Suppression of RNA silencing by a geminivirus nuclear protein, AC2, correlates with transactivation of host genes," Journal of Virology, vol. 79, pp. 2517-2527, 2005.

[363] Y. Liu, W. Jin, L. Wang, and X. Wang, "Replication-associated proteins encoded by Wheat dwarf virus act as RNA silencing suppressors, "Virus Resrearch, vol. 190, pp. 34-39, 2014. [364] A. Akhter, S. Akhtar, M. Saeed, and S. Mansoor, "Chili leaf curl betasatellite enhances symptoms induced by Tomato leaf curl New Delhi virus, a bipartite begomovirus," International Journal of Agriculture and Biology, vol. 16, pp. 1225-1228, 2014.

[365] B. Mabvakure, D. P. Martin, S. Kraberger, L. Cloete, S. van Brunschot, A.D.W. Geering, J.E. Thomas, K. Bananej, J.-M. Lett, P. Lefeuvre, A. Varsani, and G. W. Harkins, "Ongoing geographical spread of Tomato yellow leaf curl virus," Virology, vol. 498, pp. 257-264, 2016.

[366] N.M. Horn, S.V. Reddy, and D.V.R. Reddy, "Assessment of yield losses caused by chickpea chlorotic dwarf geminivirus in chickpea (Cicer arietinum) in India," European Journal of Plant Pathology, vol. 101, pp. 221-224, 1995.

[367] A. A. Hamed, and K. M. Makkouk, "Occurence and management of Chickpea chlorotic dwarf virus in chickpea fields in northern Sudan," Phytopathologia Mediterranea, vol. 41, pp. 193-198, 2002.

[368] H. C. Sharma, C. L. L. Gowda, P. C. Stevenson, T. J. Ridsdill-Smith, S. L. Clement, G.R. Rao, J. Romeis, M. Miles, and M. El Bouhssini, "25 Host Plant Resistance and Insect Pest Management in Chickpea," Chickpea breeding and management, p. 520, 2007.

[369] S. Kanakala, H.N. Verma, P. Vijay, D.R. Saxena, and V.G. Malathi, "Response of chickpea genotypes to Agrobacterium-mediated delivery of Chickpea chlorotic dwarf virus (CpCDV) genome and identification of resistance source,"Applied Microbiology Biotechnology, vol. 97, pp. 9491- 9501, 2013.

129 7: References

[370] E. Rodríguez-Negrete, R. Lozano-Durán, A. Piedra-Aguilera, L. Cruzado, E.R. Bejarano, and A.G. Castillo, "Geminivirus Rep protein interferes with the plant DNA methylation machinery and suppresses transcriptional gene silencing," New Phytologist, vol. 199, pp. 464-475, 2013.

[371] R.S. Fontenele, D.M. Alves-Freitas, P.I. Silva, J. Foresti, P.R. Silva, M.T. Godinho, A. Varsani, and S.G. Ribeiro, "Discovery of the first maize-infecting mastrevirus in the Americas using a vector-enabled metagenomics approach," Archives of Virology, vol.163, pp.1-5, 2017.

[372] Y. L. Nene, "Viral diseases of some warm weather pulse crops in India," Plant Disease Reporter, vol. 57, pp. 463-467, 1973.

[373] N. M. Horn, S.V. Reddy, and J. vandenheuvel, "3. Survey of chickpea (Cicer arietinum L.) for chickpea stunt disease and associated viruses in India and Pakistan," Viruses involved in chickpea stunt, p. 23, 1996.

[374] A. D. Abraham, W. Menzel, M. Varrelmann, and H.J. Vetten, "Molecular, serological and biological variation among chickpea chlorotic stunt virus isolates from five countries of North Africa and West Asia," Archives of virology, vol. 154, pp. 791-799, 2009.

[375] M. Hema, P. Sreenivasulu, B.L. Patil, P.L. Kumar, and D.V.R. Reddy, "Chapter Nine - Tropical Food Legumes: Virus Diseases of Economic Importance and Their Control, in: Gad, L., Nikolaos, K. (Eds.)," Advanced Virus Research Academic Press, vol. 90, pp. 431-505, 2014.

130