Platelet Rich Plasma and Orthopedics: Why, When, and How

BioMed Research International

Guest Editors: Mikel Sánchez, Giuseppe Filardo, and Tomokazu Yoshioka Platelet Rich Plasma and Orthopedics: Why, When, and How BioMed Research International Platelet Rich Plasma and Orthopedics: Why, When, and How

This is a special issue published in “BioMed Research International.” All articles are open access articles distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Contents

Platelet Rich Plasma and Orthopedics: Why, When, and How,MikelSanchez,´ Giuseppe Filardo, and Tomokazu Yoshioka Volume 2015, Article ID 949720, 2 pages

New and Emerging Strategies in Platelet-Rich Plasma Application in Musculoskeletal Regenerative Procedures: General Overview on Still Open Questions and Outlook, Francesca Salamanna, Francesca Veronesi, Melania Maglio, Elena Della Bella, Maria Sartori, and Milena Fini Volume 2015, Article ID 846045, 24 pages

PRP Augmentation for ACL Reconstruction, Luca Andriolo, Berardo Di Matteo, Elizaveta Kon, Giuseppe Filardo, Giulia Venieri, and Maurilio Marcacci Volume 2015, Article ID 371746, 15 pages

PRP and Articular Cartilage: A Clinical Update, Antonio Marmotti, Roberto Rossi, Filippo Castoldi, Eliana Roveda, Gianni Michielon, and Giuseppe M. Peretti Volume 2015, Article ID 542502, 19 pages

Hyperuricemic PRP in Tendon Cells,I.Andia,E.Rubio-Azpeitia,andN.Maffulli Volume2014,ArticleID926481,8pages

Platelet Rich Plasma and Knee Surgery,MikelSanchez,´ Diego Delgado, Pello Sanchez,´ Nicolas´ Fiz, Juan Azofra, Gorka Orive, Eduardo Anitua, and Sabino Padilla Volume2014,ArticleID890630,10pages

Are Applied Growth Factors Able to Mimic the Positive Effects of Mesenchymal Stem Cells on the Regeneration of Meniscus in the Avascular Zone?, Johannes Zellner, Christian Dirk Taeger, Markus Schaffer, J. Camilo Roldan, Markus Loibl, Michael B. Mueller, Arne Berner, Werner Krutsch, Michaela K. I. Huber, Richard Kujat, Michael Nerlich, and Peter Angele Volume2014,ArticleID537686,10pages

Regenerative Medicine in Rotator Cuff Injuries, Pietro Randelli, Filippo Randelli, Vincenza Ragone, Alessandra Menon, Riccardo D’Ambrosi, Davide Cucchi, Paolo Cabitza, and Giuseppe Banfi Volume 2014, Article ID 129515, 9 pages

Platelet Concentration in Platelet-Rich Plasma Affects Tenocyte Behavior In Vitro,IlariaGiusti, Sandra D’Ascenzo, Annalisa Manco,` Gabriella Di Stefano, Marianna Di Francesco, Anna Rughetti, Antonella Dal Mas, Gianfranco Properzi, Vittorio Calvisi, and Vincenza Dolo Volume2014,ArticleID630870,12pages

Clinical Applications of Platelet-Rich Plasma in Patellar Tendinopathy,D.U.Jeong,C.-R.Lee,J.H.Lee, J. Pak, L.-W.Kang, B. C. Jeong, and S. H. Lee Volume2014,ArticleID249498,15pages

Does Platelet-Rich Plasma Freeze-Thawing Influence Growth Factor Release and Their Effects on Chondrocytes and Synoviocytes?, Alice Roffi, Giuseppe Filardo, Elisa Assirelli, Carola Cavallo, Annarita Cenacchi, Andrea Facchini, Brunella Grigolo, Elizaveta Kon, Erminia Mariani, Loredana Pratelli, Lia Pulsatelli, and Maurilio Marcacci Volume 2014, Article ID 692913, 10 pages Hindawi Publishing Corporation BioMed Research International Volume 2015, Article ID 949720, 2 pages http://dx.doi.org/10.1155/2015/949720

Editorial Platelet Rich Plasma and Orthopedics: Why, When, and How

Mikel Sánchez,1 Giuseppe Filardo,2 and Tomokazu Yoshioka3

1 Arthroscopic Surgery Unit, Hospital Vithas San Jose,´ 01008 Vitoria-Gasteiz, Spain 2Biomechanics Laboratory-II Clinic, Rizzoli Orthopaedic Institute, 40136 Bologna, Italy 3Division of Regenerative Medicine for Musculoskeletal System, Department of Orthopaedics Surgery, University of Tsukuba, Tsukuba, Ibaraki 305-8575, Japan

Correspondence should be addressed to Mikel Sanchez;´ [email protected]

Received 2 February 2015; Accepted 2 February 2015

Copyright © 2015 Mikel Sanchez´ et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

In present practice, orthopedic and sports medicine is mak- howtouseitaswell.Wehavetorememberthatthisisnot ing a great effort in promoting the use of minimally invasive a magical bullet. We should know the possible indications techniques aimed at arresting or slowing down the aging and foritsuseandthevolumetobeapplied,thefrequency degeneration of several tissues. The scientific community has of application, number of applications, and so forth. PRP been developing new areas of research that have fuelled the applicationforanacuteinjurylikeabonefractureisdifferent emergence of regenerative medicine and tissue engineering from treating a chronic injury such as a tendinopathy and bringing into the spotlight treatments such as those based on different again from approaching a degenerative problem stem cells and platelet rich plasma (PRP). Growing interest such as osteoarthritis. This lack of consensus is the reason for in PRP is evident. Since PRP therapies began to be used the title of this special issue. regularly in the musculoskeletal system at the onset of this Studies presented in this special issue cover topics ranging decade, this topic has now reached over 7000 publications from preclinical to clinical research of PRP technology in the scientific literature. When delving into the published in different tissues. I. Giusti and I. Andia conducted two research studies and reviews, two overwhelming facts stand in vitro studies about PRP and tendon cells. The former out over the rest: a maze of clinical indications based on evaluated the tenocyte cellular behavior with different platelet widely varied and even controversial results and a relative dif- concentrations; I. Andia et al. analyzed the effect of uric ficulty in establishing a mechanistic cause-effect relationship, acid in tendon cells response to PRP. Continuing the tendon facts that are fueling a rather misleading controversy. pathology, D. U. Jeong et al. reviewed the clinical effectiveness The root of PRP controversy lies in several inconsistencies of PRP in the patellar tendinopathy, and P. Randelli et al. including a lack of standardization in obtaining PRP as an addressed the treatment of rotator cuff injuries with PRP autologous product. PRP contains by definition a platelet as well as stem cells. A. Roffi and A. Marmotti focused on concentration superior to peripheral blood. In recent years, PRP application for cartilage and its pathologies. The former a plethora of platelet concentration systems has been com- studied the effect of PRP cryopreservation on its quality and mercialized, and these are marketed under different names its action over chondrocytes and synoviocytes. The latter andacronymsbuttheyareallsoldundertheumbrella updated the clinical knowledge of PRP in chondral surgery term “PRP.” The final biological products are very distinct in and in the treatment of cartilage degenerative processes. In terms of volume, color, platelet count, presence or absence of this special issue, there are also three articles related to knee leukocytes, and unknown protein content; and the activation pathology. J. Zellner et al. carried out both in vitro and in method, with either bovine thrombin or calcium chloride, vivo assays in order to study the effect of PRP and BMP7 adds more confusion to this biologic ceremony. The question in meniscal defects. L. Andriolo et al. presented a systematic we must ask is whether PRP is a homogeneous consistent review about biological effects of PRP in the reconstruction of biological product. Not only is it important to have a fully the anterior cruciate ligament. In addition, M. Sanchez et al. characterized and reproducible product, it is crucial to know showed a series of PRP application guidelines for several knee 2 BioMed Research International surgeries. Finally, F. Salamanna et al. conducted an extensive literature review of preclinical studies with PRP in different musculoskeletal tissues. AsBertoltBrechtwroteinLife of Galileo “The aim of the science is not to open the door to infinite wisdom but to set a limit to infinite error”, these works are only afew examples of the larger number of studies still needed to answer questions that give name to this special issue. We are at the nascent end of a new health technology and, as it happened in the era of antibiotics, we must lead to a future in which PRP should be characterized both for each patient and for each application protocol. And as it happened many times in the history of medicine, we are constantly passing through the three phases described by Schopenhauer: “All truth passes through three stages. First, it is ridiculed. Second, it is violently opposed. Third, it is accepted as being self- evident.”However, we realize that now we face the paradox of Socrates: we know that we know nothing. Therefore, further studies about PRP as presented here are necessary to keep shedding light on this topic. Mikel Sanchez´ Giuseppe Filardo Tomokazu Yoshioka Hindawi Publishing Corporation BioMed Research International Volume 2015, Article ID 846045, 24 pages http://dx.doi.org/10.1155/2015/846045

Review Article New and Emerging Strategies in Platelet-Rich Plasma Application in Musculoskeletal Regenerative Procedures: General Overview on Still Open Questions and Outlook

Francesca Salamanna,1 Francesca Veronesi,1 Melania Maglio,2 Elena Della Bella,2,3 Maria Sartori,1 and Milena Fini1,2

1 Laboratory of Biocompatibility, Innovative Technologies and Advanced Therapies, Department Rizzoli RIT, Rizzoli Orthopedic Institute, Via di Barbiano 1/10, 40136 Bologna, Italy 2Laboratory of Preclinical and Surgical Studies, Rizzoli Orthopedic Institute, Via di Barbiano 1/10, 40136 Bologna, Italy 3Department of Specialized, Experimental, and Diagnostic Medicine, University of Bologna, Via Massarenti 9, 40138 Bologna, Italy

Correspondence should be addressed to Francesca Salamanna; [email protected]

Received 17 August 2014; Revised 9 January 2015; Accepted 13 January 2015

Academic Editor: Tomokazu Yoshioka

Copyright © 2015 Francesca Salamanna et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Despite its pervasive use, the clinical efficacy of platelet-rich plasma (PRP) therapy and the different mechanisms of action have yet to be established. This overview of the literature is focused on the role of PRP in bone, tendon, cartilage, and ligament tissue regeneration considering basic science literature deriving from in vitro and in vivo studies. Although this work provides evidence that numerous preclinical studies published within the last 10 years showed promising results concerning the application of PRP, many key questions remain unanswered and controversial results have arisen. Additional preclinical studies are needed to define the dosing, timing, and frequency of PRP injections, different techniques for delivery and location of delivery, optimal physiologic conditions for injections, and the concomitant use of recombinant proteins, cytokines, additional growth factors, biological scaffolds, and stems cells to develop optimal treatment protocols that can effectively treat various musculoskeletal conditions.

1. Introduction requires surgery with several hardships for the patients. One of the most innovative methods used to biologically enhance The vulnerability of the musculoskeletal system to acute tissue healing and regeneration includes the use of autologous or chronic injuries is often dramatic and, according to the blood products and, in particular, platelet-rich plasma (PRP). WHO, they are the most common causes of severe long-term Blood is withdrawn from a patient’s peripheral vein and pain and physical disability affecting hundreds of millions of centrifuged to achieve a high concentration of platelets people worldwide [1]. Thus, bone, cartilage, tendon, and liga- (PLTs) within a small volume of plasma. It is reinjected at ment injuries have serious socioeconomic consequences; for asiteofinjuryorinsertedasagelorincombinationwith example, osteoarthritis affects nearly 27 million Americans or other biomaterials during surgery. At baseline levels, PLTs 12.1%oftheadultpopulationoftheUnitedStateswithatotal function as a natural reservoir for growth factors (GFs) and annual cost of about $89.1 billion [2]. Besides osteoarthritis, plays an important role in tissue healing and regeneration. also bone fracture care in osteoporotic patients has a high GFs secreted by PLTs include platelet-derived growth factor incidence with an annual cost of about $17 billion [3]. Sim- (PDGF), epidermal growth factor (EGF), insulin-like growth ilarly, ligamentous and tendinous injuries are very common factor (IGF-I), transforming growth factor 𝛽-I (TGF𝛽-I), vas- with an annual incidence estimated at about 1 per 1000 people cular endothelial growth factor (VEGF), hepatocyte growth [4, 5]. However, the bulk of these musculoskeletal injuries factor (HGF), and basic fibroblast growth factor (bFGF), does not heal with conservative managements and frequently which provide the potential to modulate the healing of many 2 BioMed Research International

Table 1: Main GFs release by 𝛼-granules.

GFs Mechanism of action (i) MSC proliferation and differentiation (ii) Cell mitogenesis TGF-𝛽 (iii) Collagen II, proteoglycan, and ECM synthesis (iv) Endothelial chemotaxis and angiogenesis (v) Macrophages and lymphocyte proliferation inhibition; chondrocyte differentiation (vi) TIMP upregulation PDGF-a and -b (i) OBs and MSCs mitogenesis (ii) Macrophages, neutrophil, and other cell chemotaxis; collagen I synthesis bFGF (i) Chondrocyte and OB differentiation (ii) MSCs, chondrocyte, and OB mitogenesis (i) Endothelial chemotaxis and angiogenesis EGF (ii) Collagen synthesis (iii) MSC and epithelial cell mitogenesis (i) Angiogenesis CTGF (ii) Cartilage regeneration (iii) Fibrosis (iv) Platelet adhesion VEGF (i) Angiogenesis (ii) Endothelial cell mitogenesis (i) Cell proliferation IGF (ii) Collagen synthesis (iii) Myoblast proliferation and differentiation

tissues through interaction with specific cells [6, 7](Table 1). of chronic jumper’s knee [146]. Finally, the quality of PRP This wide variety of GFs contributes to multifaceted roles of and resulting effects could also be influenced by patient’s PRP,including the enhancement of anabolism, bone and ves- age, gender, body mass index, comorbidities, ethnic origin, sel remodeling, cell proliferation, angiogenesis, inflammation healing capabilities, and different lifestyles (smoke, alcohol control, coagulation, and cell differentiation8 [ ]. abuse, obesity, etc...)[147, 148]. Despite the lack of high-quality clinical trial data, several The huge literature about this topic, from basic science studies confirmed PRP clinical efficacy in the treatment of reviews to in vitro and in vivo research,aswellasclinicalstud- different types of musculoskeletal injuries [132–139]. How- ies, highlighted the need of validated classification systems ever, many important questions remain unanswered. Toreach to compare the crucial differences between PRP preparation a consensus on PRP use, there is the need of explaining why protocols. Among those proposed, we considered the PAW the employment of PRP generates different clinical results. classification which assigns a code based on PLT concentra- The main drawback in evaluating the clinical effects ofPRP tion (PLTs/𝜇L), kind of activation (endogenous/exogenous), is the inconsistency in established preparation protocols. To andwhitebloodcellconcentration(totalWBCsandneu- date, more than 40 commercial systems exist which claim trophils) [149].Thispaperisplannedtogiveanoverviewof to concentrate whole blood into a PLT-rich substance but a thelastdecadeonthein vitro and in vivo studies on PRP standardized preparation system has yet to be implemented in musculoskeletal regeneration also evaluating the different in the common practice. Therefore, it is highly important for preparation protocols. Bone, cartilage, tendon, and ligament the clinician to be mindful of the different ways to obtain PRP regeneration was considered. and how the different methods affect the composition of PRP atthetimeoftreatment[140]. The most important differences 2. Search Strategies between the protocols and machines currently used are blood volume (from 9 to 120 mL), PRP volume (from 3 to 32 mL), To identify the studies to be considered in the current activators (CaCl2, thrombin, batroxobin, bovine thrombin, review, a PubMed database search was performed using the and thrombin added to CaCl2), number of spins during following MeSH: “platelet-rich plasma” and “regeneration”. centrifugation (1 or 2), and PLT concentration (from 1x to 18x) The searching limits were English language and papers [141, 142]. Additionally, the presence or absence of leukocytes, publishedfromJuly8,2004,toJuly8,2014.Threeauthors which contain considerable amounts of VEGF could further (Francesca Salamanna, Francesca Veronesi, and Melania affect the quality of PRP and consequently its effects [143– Maglio) evaluated all articles. Studies were included if they 145].Infact,arecentstudybyKauxetal.demonstratedthat were available online, in vitro or in vivo, and regarding bone, a local infiltration of PRP, without both erythrocytes and cartilage, tendons, and ligaments, while they were excluded leukocytes and obtained with the apheresis system, associated if title and abstract clearly refuted eligibility. Also reviews, with submaximal eccentric protocol can improve symptoms letters, or comments to the editor and clinical studies were BioMed Research International 3

PubMed database “Platelet-rich plasma” and “regeneration” Filters: publication date from July 8, 2004, to July 8, 2014 English language

291 not related to the 78 on bone musculoskeletal system (9 in vitro, 69 in vivo) 150 reviews, letters, or 619 articles 14 on cartilage comments to the editor (2 in vitro, 12 in vivo)

26 on tendons 1 on muscle (7 in vitro, 19 in vivo) (in vivo study) 7 on ligaments 33 clinical studies (3 in vitro, 4 in vivo) 20 not available

Figure 1: Schematic representation of the PubMed database searches.

excluded. All the selections were performed independently in duplicate. Disagreement was resolved by consensus. 70

3. Results 60

3.1. Search Strategies. The PubMed search produced 619 50 articles. Several studies (494) were excluded: 290 were not related to musculoskeletal system, 150 were reviews, letters, 40 or comments to the editor, 1 was on muscle regeneration, 33 were clinical studies on musculoskeletal system, and the other 30 20 were not available online to us. So a total of 125 articles were analyzed (Figure 1). In Figure 2,thenumberofpapers 20 for each tissue and year is reported (Figure 2). Regardingbonetissue,thereviewedin vitro studies were 10 carried out on osteoblasts (OBs) or mesenchymal stem cells (MSCs) with PRP combined or not with scaffolds. In vivo 0 studies were performed with PRP alone or with autologous Bone Tendon bone/scaffolds/cells or with a combination of scaffolds and Cartilage Ligaments cells. For tendon tissue regeneration, the examined in vitro studiesevaluatedtheeffectsofPRPaloneorwithMSCsand 2014 2009 scaffold on tenocytes or tendon tissue explants. In the in vivo 2013 2008 2012 2007 studies, PRP was employed alone or associated with scaffolds, 2011 2006 cells (mainly MSCs), or their combination. Concerning the 2010 in vitro studies on cartilage, PRP alone or with scaffold was evaluated on human chondrocytes, while, in in vivo ones, PRP Figure 2: An overview on the application of PRP in musculoskeletal wasusedinassociationwithscaffoldsorcells(chondrocytes regenerative procedures in the last decade. or MSCs), also in combination with microfractures. As for anterior cruciate ligament (ACL) reconstruction, the in vitro studies evaluated the ACL fibroblast behavior under the effect 3.2.1. Terminology and PLTs Products. Even though PRP is a of PRP with or without scaffolds while the in vivo evaluations were performed with PRP alone or in combination with generic term, many definitions and acronyms have appeared scaffolds. to differentiate PRP constituents and state of activation but The main variables found among studies under review maybealsoincreasingtheconfusion.Althoughmanyauthors are presented in Table 2, while all the basic science literature urge standardization, the variety of names unfortunately does derived from in vitro and in vivo studies were summarized in little to help standardize the product. PRP or PRF (platelet- Tables 3 and 4. richfibrin)isthemostusedacronymstoindicatePLTs concentrates. Their processing techniques allow discarding 3.2. PRP Biology: What Have We Learned? Before examining the nonclinical useful elements, such as most of red blood PRP effects in musculoskeletal regeneration, a brief overview cells, to concentrate the therapeutic effective ones, such as on its biology is provided below. PLTs, GFs, leukocytes, or fibrinogen/fibrin. Actually, PRP 4 BioMed Research International

Table 2: Main variables of the reviewed studies and factors implicated in PRP efficacy.

Blood volume PRP volume PLT count Leukocyte count Tissue type Study type Activators (mL) (mL) (×106/𝜇LPRP) (×104/𝜇L) Thrombin, CaCl , In vitro 51 ± 30 (n =4) 5.3± 6.6 (n = 2) 4.2 ± 6.6 (n =4) NS 2 Ca-gluconate (n =4) Thrombin, CaCl , Bone 2 CaCl2 + thromboplastin, In vivo 77 ± 135 (n =54) 2.6± 4.9 (n =34) 2.3± 2.3 (n =34) 1.4± 4.1/𝜇L(n =3) Ca-gluconate, and CaCl2 +thrombin(n =52)

Thrombin, CaCl2, In vitro 93 ± 167 (n = 8) 4.5 ± 3.8 (n =6) 1.9± 2.4 (n =10) 4± 4.1/𝜇L(n =2) Ca-gluconate + Tendon thrombin (n =5) Thrombin, CaCl (n = In vivo 17 ± 16 (n = 15) 2.4 ± 1.2 (n =9) 1.9± 1.6 (n =9) 2± 3/𝜇L(n =2) 2 6) ± ± ± In vitro 115 61 (n =3) 1.0 n/a (n = 1) 0.9 n/a (n = 1) NS Thrombin, CaCl2 Cartilage Thrombin, CaCl2,Ca, In vivo 25 ± 20 (n = 11) 3.1 ± 3.8 (n =8) 2.8± 3.9 (n =8) NS Fibrinogen Thrombin (n =4) Anterior cruciate In vitro 33 ± 38 (n = 2) NS 0.5 ± 0.2 (n =3) NS NS ligament Thrombin, CaCl (n = In vivo 33 ± 23 (n =3) 5.0± 5.7 (n =2) 1.6± 0.7 (n =5) NS 2 1) 𝑛: number of data available for the specific variable in the considered papers; NS: not specified. products are divided into 4 families, based on leukocytes and HGF, and bFGF (Table 1). However, other bioactive factors, fibrin content: pure platelet-rich plasma (P-PRP), leukocyte- which include adhesive proteins, clotting and fibrinolytic and platelet-rich plasma (L-PRP), pure platelet-rich fibrin (P- factors and their inhibitors, proteases and antiproteases, PRF), and leukocyte- and platelet-rich fibrin (L-PRF) [150]. antimicrobial proteins, and membrane glycoproteins, are The first, also known as plasma rich in growth factors (PRGF), getting increased attention in the last decade [153]. Another and the second are usually in the form of gel or liquid and aspect is that 𝛼-granules also contain monocytes mediators are characterized by a low-density fibrin network, without or and different interleukins (ILs) and chemokines, such as IL- with leukocytes, respectively. On the other hand, the third, 1 𝛽, IL-8, and MIP-1-2-3, regulated on activation, normal also named platelet-rich fibrin matrix (PRFM), and the fourth T cells expressed and secreted (CCL5), and more others, contain high-density fibrin network and exist only in the which are capable of mediating inflammation, stimulate cells gel form. P-PRF is without leukocytes, while L-PRF contains chemotaxis, proliferation, and maturation [153, 156, 157]. leukocytes. It is clear that these four variables alone allow Although PLTs have now been shown to store and release many possible variants of PRP to be produced; however, they such a wide range of biologically active proteins, different provide a simple baseline for comparison. enigmas, regarding their contents and possible activities on tissue healing, still remain to be solved. 3.2.2. PLTs Number and 𝛼-Granule Contents. In healthy humans, the average PLT concentration of whole blood is 𝜇 𝜇 3.2.3. Methods of PRP Activation. Different methods of acti- around 200,000/ L (normal range 150,000 to 350,000/ L) vating PRP influence the concentration of GFs. PRPs are [151]. PLTs are small anucleated cytoplasmic fragments of frequently activated by calcium chloride, thrombin, chitosan, megakaryocytes normally thought as the responsible agents and batroxobin. Calcium chloride and thrombin activation for hemostasis. Not only are the PLTs central to the clotting are the two most common methods; 5% calcium chloride cascade, but they are also fundamental to tissue healing. The first step of the healing process is clot formation and treatment for 19 min produces the most effective PRP, which PLTsactivation [151]. Then biologically active molecules, GFs, has properties for soft-tissue adhesion158 [ ]. Chitosan can be and differentiation factors, are released from the 𝛼-granules used instead of thrombin because it enhances aggregation, 𝛼 [152, 153].About70%oftheGFsaresecretedwithinthe adhesion, and expression of -granule membrane glycopro- first 10 minutes next to activation and, within the first hours, tein. Some data, however, suggest that exogenous thrombin almost 100% have been secreted [154]. According on where activation of PRP may actually diminish its ability to induce theyareincourseoftheirlife,severalPLTswilldiewithina bone formation compared with nonthrombin-activated PRP few days while some others may last up to 9 days ongoing [159]. to generate further GFs [155]. As previously mentioned, the degranulation of 𝛼-granules result in the release of a 3.2.4. Inter- and Intraspecies Variability. Preclinical models number of GFs, such as PDGF, EGF, IGF-I, TGF 𝛽-I, VEGF, offer fundamental basis for the development of clinical BioMed Research International 5 ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] 9 11 13 15 17 12 21 18 19 14 10 16 23 22 20 [ [ [ [ [ [ [ [ [ [ [ [ [ Reference x x P3 P1-x P1-x P1-x P2-x P2-x P4-x P2-A PAW P4-x P4-x P2-B P2-B P3-A P1-x-B classification Not applicable [ Not applicable [ × L × 𝜇 × / /uL /uL; ) 3 3 6.5 3 − /mL 10 +x 10 ± 10 NS NS NS NS NS NS NS NS 6 0.00 × (+/ × × 10 /uL; clPRP: PRP: 8 /uL; hcPRP: 6.4 (1.8–14.4) lrPRP: 1 3 PPCR and 3 28 Leukocytes 24 5.7 PRCR: 0.10 10 10 ± 2 2 2 2 2 2 2 ) − NS NS NS /thrombin (+/ CaCl CaCl CaCl 2 thrombin gluconate Activator 10% CaCl 10% CaCl 500 U bovine Thrombin/Ca- PRFMatrix and 2% alginate-6% PRFMembrane: CaCl Thrombin/CaCl Thrombin/CaCl Bovine thrombin thrombin in 1 mL calcium gluconate L 3 × 88 𝜇 L 10 /uL; 𝜇 /uL × ± L /uL; 5 L /L / L) 5 /uL; × 265 5 𝜇 6 /uL 𝜇 5 𝜇 12 10 / / 3 10 ± 10 /mL 3 3 10 3 491 10 29 10 6 × /mL 10 3 × × 10 /mL 10 6 × 10 ± × ± × 10 NS NS NS NS NS 6 10 × × 10 × × 37 (83–738) × Platelet 10 × ± 920 (555–1114) 14 912 194 (platelets/ PPCR: 6–11 1.005 1400 /mL; PRCR: 7–19 concentration 6 0.5–1.0 PRP: 6 clPRP: 6 lrPRP: 5 260 Medium: 1453 High: 4358 Low: 48 hcPRP: 12 10 2 NS NS NS NS 353000–837000/ NSNS NS NS NS NS NS 1mL 2mL (mL) 5mL 10 mL 0.6 mL hcPRP and 0.5 mL/cm PRP: 10 mL; lrPRP: 8 mL clPRP: 5 mL; PRP volume 1 2 2 2 2 2 2 2 2 2 4 1 NS (no centrifuge) Centrifugation Caption device (number of spins) NS NS NS NS NS NS NS 6mL (mL) 55 mL 30 mL 90 mL 40 mL 45 mL 18 mL; 150 mL 500 mL BC: 4 mL Blood volume hcPRP: 60 mL; PRFMembrane: PRP, plasma, and lrPRP and clPRP: PRFMatrix: 9 mL; studies on musculoskeletal tissue regeneration. The PAW classification has attributedbeen when possible. L-PRP PRP + P-PRP BMSCs CS-NHS or clPRP 10% PRP BC eluent In vitro PRFMatrix or L-M-H PRP + -microspheres or PRP-Ca-Thr Ciprofloxacin + 10%, 20% PRCR 5–10–15% PRP + cocultures + PRP dexamethasone + PRFMembrane or OBs and tenocytes 10%, 20% PPCR or PRP, hcPRP, lrPRP, PRP+OsteoMatrix NS 10% PPP or PRP-Ca, Table 3: -BC PRP PRP 60 mL PRP PRP PRP PRP PRP PRP PRP PRP PRP PRP PRP 80 mL PRP PRP 8.5 mL PRP -PRP -PPCR -clPRP -lrPRP -PRCR -hcPRP -PRFMatrix -PRFMembrane Purchased hOB-like cells Human tenocytes from hamstring Rabbits ADSCs Purchased porcine MSCs hBMSCs Purchased hOBs and tenocytes from semitendinosus and gracilis tendons Anterior abdominal wall hADSCs Human tenocytes from hamstring Jaw bone hOBs Rat BMSC Horse flexor digitorum superficialis tendon Canine patellar tendon Purchased hMSCs Cell typeAlveolar bone hOBs PRP formulation PRP combination Human tenocytes from the rotator cuff 6 BioMed Research International ] ] ] ] ] ] 25 27 28 24 29 26 [ [ [ [ [ Reference x P1 P2 P1 P1 P2 P1-x P4-x P3-x P2-x PAW classification Not applicable [ ) − + − + − NS NS (+/ Leukocytes 2 P activated with calcium and thrombin (PRP-Ca-Thr), 2 ) 2 2 , medium PRP (mPRP), high PRP (hPRP), growth factors − NS NS NS (+/ CaCl CaCl CaCl Bovine Activator thrombin/CaCl Bovine thrombin lot releasate (PPCR), high-concentration PRP (hcPRP), leukocyte- L 𝜇 = = 3 3 103/ = 6000 × 3 PLTs/mL PLTs/mL PLTs/mL mm mm PLTs/mL 6 6 6 × × 6 mm that of the 10 10 10 Platelet 194000 929000 10 × × × × × whole blood × PLT PLT concentration 3 Median number: 8 615 129 370 PLT Mean: 1316 NS NS NS NS NS NS NS NS NS NS 1mL 1mL (mL) PRP volume 1 1 Table 3: Continued. 2 2 2 1 2 2 2 2 2 1,250,000), x (exogenous activation), A (above baseline), and B (below baseline). > Centrifugation (number of spins) , mesenchymal stem cells (MSCs), PRP activated with calcium (PRP-Ca), PR l vascular fraction of AT (SVF AT), bone marrow cells (BMC), low PRP (lPRP) NS NS (mL) 55 mL 60 mL 45 mL 150 mL 150 mL Blood volume 750,000–1,250,000), P4 ( > PPP PPP matrix P-PRP L-PRP 5x PRP 1x PRP 3x PRP scaffold Patch + MSCs PRP + collagen PRP + collagen Collagen-platelet baseline-750,000), P3 ( > PPP PRP PRP PRP 6 mL PRP PRP PRP PPP P-PRP L-PRP baseline), P2 ( ), white blood cells (WBC), low PRP (P-PRP), high PRP (L-PRP), and platelet-poor plasma (PPP). ≤ 2 Porcine ACL fibroblasts Human ACL fibroblasts Immortalized human articular chondrocytes Porcine and ovine ACL fibroblasts Cell typeCanine flexor digitorum profundus tendon PRP formulation PRP combination Human chondrocytes from osteoarthritic cartilage PAW classification: P1 ( calcium chloride (CaCl (GF), CS-NHS (chondroitin sulfate succinimidylreduced succinate), PRP calcium (lrPRP), (Ca), concentrated-leukocytes osteoblast PRP (OB), (clPRP), blood platelet-rich clot clot releasate (BC) (PRCR), platelet-poor c Not specified (NS), mesenchymal stem cell (MSC), adipose tissue stroma (AT), BioMed Research International 7 ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] 31 13 12 41 33 32 35 37 39 38 30 36 34 42 40 [ [ [ [ Reference Not Not P1-x P3-x P3-x PAW P4-x P4-x P4-x P4-x applicable applicable classification ) − NS P4-x [ NS x [ NSNSNS x P3-x P4-x [ [ [ NSNS xNS P3-x [ [ NSNS x [ x [ NS x [ NS x [ (+/ Leukocytes 2 / / 2 2 2 2 2 2 2 2 2 ) 2 2 − /thrombin NS (+/ CaCl CaCl CaCl CaCl CaCl CaCl 2 CaCl CaCl thrombin thrombin Activator 10% CaCl Thrombin/ Thrombin/ Thrombin/ 500 U bovine CaCl 25% thromboplastin thrombin in 1 mL 10% × × × 3 × × 0.5 88 10 /mL; ± ± 0.4 L) L 9 0.16 × 265 L 𝜇 𝜇 ± 𝜇 10 ± ± L / 3 29 / 1084.85 1174.83 𝜇 6 /mL 3 × L 3 / 6 10 ± 3 ± 𝜇 ± 10 10 10 10 × 10 0.2 × Platelet × 1 /mL; M-PRP: ± 9 (platelets/ concentration /mL; PPP: 8 9 10 2977.66 Low: 48 Medium: 1453 High: 4358 H-PRP: 8.21 2.65 L-PRP: 0.85 1852.307 10 PRP total (mL) 0.9 mL NS CaCl ∼ volume 10–15% of studies on musculoskeletal tissue regeneration. spins) In vivo (number of Centrifugation Table 4: NS 3 NS (mL) Blood 30 mL 2 NS NS 130 mL 2 NS 900,000/ volume PPP PRP -PPP PRP -L-PRP; -H-PRP; -M-PRP; combination 5–10–15% PRP + ADSCs-microspheres PPP PRF PRF NS NS NS NS NS NS PRP PRP PRP + AB 120 mL 1 20 mL NS PRPPRPNS2NSNS PRP PRP + AB 10 mL 2 NS NS PRPPRP PRP 20 PRP mL 2 3.15 mLPRP 2PRP 0.35 mL PRP NS NS NS NS NS NS PRP PRP 3.15 mL 2 0.35 mL PRP PRP 10 mL 1 PRP PRP + AB 10 mL 1 0.5 mL NS CaCl PRP PRGF PRGF 40 mL 1 NS NS CaCl formulation Tissue type Mice dorsum PRP Mini. pig tibia Sheep sternum Rat femur Rabbit tibia Rat limb PRPRat tibia L-M-H PRP + BMSCs 40 mLRat calvaria 2 NS Rabbit calvaria Ovx. rat femur Ovx. mice femur Rat calvaria Mouse calvaria Rabbit calvaria Rabbit tibia 8 BioMed Research International ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] 51 53 52 55 57 58 59 43 45 47 56 50 54 49 48 60 46 44 [ [ [ Reference Not Not Not P4-x [ P2-A [ PAW applicable applicable applicable classification × /L 9 L ) 10 8.9 𝜇 − / × ± 3 NSNSNS P4-x x [ P4-xNS [ [ P4-xNSNS [ P4-xNS P4-x [ NS x [ P3-x [ NS [ x [ NS NSNS P1-xNS [ P3-x P3-x [ [ (+/ 10 24.8 Leukocytes 13.42 / / / / 2 2 2 2 2 2 2 2 2 2 ) 2 2 2 2 − NS NS P4 [ NS (+/ CaCl CaCl CaCl CaCl CaCl CaCl CaCl CaCl CaCl CaCl CaCl thrombin thrombin Activator Thrombin/ Thrombin/ bovine thrombin bovine thrombin L × 𝜇 × L / /L L 3 𝜇 L. 3 L 9 𝜇 L ± 𝜇 L 𝜇 / 10 9 /L 10 ± / 6 𝜇 3 6 ± 9 6 / L × 10 1547.862 6 × 6 359.65 10 10 10 × 10 603.07 𝜇 10 × ± / 10 10 ± × × × 3 × ± NS CaCl × 1,7 97.2 × 680,200/ × 10 Platelet 1,2 platelets/ ± 2611.80 ± 800 3 1,5 2,4 2,422 platelets/mL 6 1.621 concentration platelets/mm 2.564 313.34 10 800–1000 10 2,628.8 2,718.46 2.414.720 483.8 ∘ ∗ PRP (mL) 1mL 0.5 mL volume Table 4: Continued. ∘ ∗ 4NS 2 1 spins) (number of Centrifugation 3 (mL) 10 mL 10 mL 2 NS Blood 38 mL 1 5 mL 250 mL NS NS volume 3.15 mL 2 0.35 mL 3.15 mL 2 0.35 mL 250 cm L+ L+ 𝜇 𝜇 +AB +AB ∘ ∗ AB AB AB bed PRP Bioglass PRP PRP combination Phycogenic HA or PRP + particulated PRP + Bovine HA or PRP + AB + receptor PRP 50–100–150 PRP 50–100–150 PRP PRP PRP PRP + FFBA 3.15 mL 2 0.35 mL PRP PRP PRP + ABPRP 250 mL hPRP + HA NS 500 mL NS 1 NS PRP PRP + AB 40 mL 1PRP NSPRP PRP + AB NS hPRP 15 + mL AB 10 mL 2 CaCl 2 1 mL 1 mL PRP PRP PRP+AB+BioOss PRP PRP PRP + AB 15 mL 2 1 mL PRP PRP + CPC NS NS NS NS NS NS PRP PRP PRP + Bioss Collagen 4 mL NS NS NS NS NS PRP PRGF PRGF + DBBM 10 mL 1 1 mL NS CaCl formulation Tissue type Rat calvaria Rat calvaria Rat calvaria Goat’s frontal bone Rabbit radius Rabbit calvaria Rabbit calvaria Rabbit calvaria Rabbit calvaria Rabbit femur Goat’s frontal bone Mini. pig’s subcutis Rabbit calvaria Rabbit condyle Dog tibia PRP PRP + Bio-OssRabbit calvaria 20 mL 2 NS 1.380.000 Rabbit femur Rabbit calvaria BioMed Research International 9 ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] 71 61 73 75 74 72 76 63 65 62 70 67 69 68 66 64 [ Reference Not PAW applicable classification ) − NS x [ NS P3-xNS [ NS xNS x [ P4-x [ NS [ x [ NSNSNS x x P3-x [ [ [ NSNS x P2-x [ [ NS x [ (+/ Leukocytes / / / / / / 2 2 2 2 2 2 ) 2 2 2 2 2 2 − NSNS NS NS P4 P4 [ [ NS NS P3 [ (+/ CaCl CaCl CaCl CaCl CaCl CaCl CaCl CaCl CaCl CaCl thrombin thrombin thrombin thrombin thrombin thrombin Activator Thrombin/ Thrombin/ Thrombin/ L 4 𝜇 / 10 3 × L /L /L × 3 10 9 9 𝜇 12 × × 10 10 10 1.62 × × 98.7 × /mm ± 600 1.0– 4 332 ± ∼ Platelet 1.5 10 platelets/mL ± 3 platelets/ 78.1 2422 2422 concentration 10 thrombocytes/L 152.8 1,100 PRP (mL) 0.8 mL NS ∼ volume Table 4: Continued. spins) (number of Centrifugation NS NS NS NS NSNS NS 2 1 mL 5 mL 2 0.18 mL 8 mL 2 0.6-0.7 mL NS CaCl (mL) 10 mL 2 1 mL NS CaCl Blood 27 mL 1 3 mL NS volume 500 mL NS NS -TCP NS NS NS NS 𝛽 PRP Coral sponge alginate hydrogel rhBMP-2 hydrogel + combination PRP + gelatin PRP + PGA + PRP + Gelatin PRP + gelatine PRP + chitosan microspheres + PRP + PDBM or SEW2871-micelles Lactosorb or BMP PRP + ringed PTFE vascular grafts HA + hPRP + Persian Gulf or collagen gel beads Activated/inactivated PRP PRP PRP + Ca-P 120 mL 2 20 mL NS PRP PRP hPRP + coral NS NS NS PRP PRP PRP PRP + HA or PRP PRP PRP APC + HBO 2.5 mL 1 1.5 mL NS NS NS PRP PRPPRP + rhBMP2-BCP 10 mL 2PRP NS PRP + PCL-TCP 10 mL 2 1.5 mL PRP PRP PRP + Ti + Bone 10 mL 2 1 mL PRP PRP PRP + BG 10 mL 1 0.8 mL NS formulation Tissue type Mini. pig tibia Rabbit cranium Rabbit radius Beagles calvaria Rabbit calvaria Rat cranium Nude rat calvaria Rabbit radius Rabbit fibula Rabbit calvaria Rabbit iliac crest Rat femur Rat ulna Rabbit radius Cattle hoof Rabbit radius 10 BioMed Research International ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] 81 91 83 85 78 82 87 92 77 79 88 89 80 86 84 90 [ [ [ [ Reference Not Not Not Not PAW P1-x-B [ applicable applicable applicable applicable classification L ) 1.9 𝜇 − ± NS x [ NS x [ NS xNS [ x [ NS x [ NS P3-xNS [ NS x [ P3-xNS [ x [ (+/ 1000/ 4.3 leukocytes Leukocytes / / / / / / 2 2 2 ) 2 2 2 2 2 2 − NS NS P4 [ (+/ CaCl CaCl CaCl CaCl CaCl CaCl CaCl CaCl CaCl thrombin thrombin thrombin thrombin thrombin gluconate Activator thrombin/ Thrombin/ Thrombin/ 10% calcium bovine thrombin L 𝜇 /mL 6 L 10 /mL 12 𝜇 9 × ± 10 platelets/ × Platelet 6 118 1000/ 10 1.0 thrombocytes concentration × 3 800–1200 LNSNSNS 𝜇 PRP (mL) volume Table 4: Continued. NS NS NS spins) (number of Centrifugation h 3g NS NS NS NS NS 3 NS 7 mL 2 NS NS (mL) Blood 54 mL 2 10 mL NS 250 mL NS mL 7.5 volume 500 mL 250 cm -TCP 8 mL 2 0.7 mL NS NS NS 𝛽 -TCP; -TCP + BMC 9 mL 1 NS NS Calcium gluconate NS x [ PRP PRP + BMSC BMSCs 𝛽 𝛽 combination hPRP + bone gPRP + HA or PRP + Calcium PRP + CDHA + +non-coatedor Carbonate + HA rPRP or hPRP or PRP + rBMSCs + induced/uninduced nanohydroxypaptite Ca-P-coated implant poly (ester urethane) PRP liquid or PRP gel PRP PRP PRP PRP PRP PRP hPRP + ADSCs 2 NS PRP hPRP + hADSCs 400 mL 3 NS NS PRP PRP + PRP PRP + BMSCsPRP 10 mL PRP + BMSCs 2 2.0 mL 1 mL 2PRP PRP + CDHA + MSC NS NS NS NS NS NS NS NS NS PRP PRP + CA + Mel 4 mL NS 325 PRP Gel Membrane formulation Tissue type Goats cranium Rabbit radius Porcine skull PRP PRP + ankyloss graft NS NS NS Rabbit spinal fusion Rabbit calvaria Sheep tibia Rabbit tibia PRP PRP + Rabbit ulna Rat calvaria PRP PRP + BCP or MSCs NS 2 0.5 mL NS NS NS Nude mice inguinal groove Rabbit calvaria Rabbit calvaria Mice calvaria Rabbit radius Goats tibia PRP Ovx. rat calvaria BioMed Research International 11 ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] 18 93 95 97 98 99 94 96 101 103 102 105 107 108 100 106 104 [ [ [ [ [ [ [ Reference Not Not Not Not Not Not Not P2-A [ PAW P4-x-B [ applicable applicable applicable applicable applicable applicable applicable classification 3 × ) /L − 16.7 /mm 9 2 NS x [ NS x [ NS P4-x [ ± 10 (+/ 10 × Leukocytes 42.1 1 / 2 2 2 ) 2 − NS NS P1 [ NS NS P1 [ NS NS P2/P3-x [ NS /thrombin NS x/thrombin [ NS P4-x [ (+/ CaCl 2 2 CaCl thrombin Activator CaCl 3 /L 9 3 × × 10 /mm 6 /mL × 4 L L 10 𝜇 72.3) 𝜇 10 0.848 platelets/L / × 4 ± 6 9 × ± 103.2 10 10 Platelet 10 445–862 ± × concentration 313.5 ( 523.8 thousand/mm 12.87 13.8 (2.2–2.9) 639.7 PRP (mL) volume Table 4: Continued. spins) (number of Centrifugation 3 mL 2 0.5 mL NS NS NS (mL) 10 mL 1 1 mL NS CaCl Blood 27 mL NS NS NS NS NS volume -TCP + 𝛽 PRP BMAC BMSCs combination PRP + BiOss + granule + MSCs PRP + PRGF + Nano-HA PC PC 9 mL 1 0.5 mL PRP PRP 8 mL 1 2 mL NS NS NS PRP PRP 8 mL 1 2 mL NS NS NS PRP PRP PRPPRPNS2NS PRP PRP 8 mL 1 2 mL NS NS NS PRP PRP 8 mL NS 2 mL NS NS NS PRP PRP 5 mL 2 NS PRP PRP 60 mL 2 NS PRP PRP + DPB + MSCs 60 mL 2 NS PRP PRP PRP 7-8 mL 2 NS NS CaCl PRPF PRP/PRPF 10 mL 2 ns PRGF PRGF 20 mL 1 2 mL NS CaCl PRPGF formulation HorseSDFT PRP PRP NS NS 3mL Horse SDFT PRP PRP NS NS 3 mL NS NS NS Rabbit calvaria Rabbit Achilles tendon Rabbit patellar tendon Sheep Achilles tendon Tissue type Nude mice cranium Rat Achilles tendon Rabbit patellar tendon Rabbit Achilles tendon Rat patellar tendon Rat rotator cuff Rat patellar tendons Rabbit radius Rabbit intrasynovial flexor tendons Rat calvaria Rat tendon-from- bone supraspinatus tear 12 BioMed Research International ] ] ] ] ] ] ] ] ] ] ] ] ] ] ] 111 113 115 117 112 118 121 119 114 110 116 123 122 120 109 [ [ [ [ Reference Not Not Not Not PAW applicable applicable applicable applicable classification ) − NS xNS [ P3-xNS [ P3-x [ NS (+/ Leukocytes 2 2 2 2 ) − Ca NS P4-x [ NS NS P3 [ NS NS P4 [ NS NS P4 [ NS NS P3 [ NS NS P4 [ NS NS P1 [ NS NS P4 [ (+/ CaCl CaCl Activator Thrombin/CaCl L × 3 L 3 𝜇 × cells / /mL 𝜇 10 3 6 8 / L 8 3 /L 4 𝜇 9 × 10 10 10 L 10 10 86.1 479.5 10 𝜇 10 × × × / × × ± /mL ± × 4 199 platelets/L × 3 87 1.1 9 10 ± 10 Platelet 858 0.57 10.0 ± ± 10 platelet/ 1511 platelets/mL ± concentration platelets/mm × 1240.9 882 125.59 2103.56 874 8 (range 642–1,085) 16.7 2.2 L 𝜇 PRP (mL) volume Table 4: Continued. spins) (number of Centrifugation 8mL 2 400 (mL) 18 mL 2 0.5 mL 18 mL NS 3/5 mL 10 mL 2 NS NS CaCl 10 mL 2 NS NS NS NS Blood 20 mL 2 NS 60 mL 1 10 mL 40 mL 2 NS volume 6 10 ADSCs × 7 10 × PRP fragments + combination chondrocytes chondrocytes PRP + ADSCs PRP + 10 PRP + BMSCs sponge + TSCs hyaluronic acid PRP + Collagen PRP + BMSCs + biphasic scaffold fibrin glue + PRP PRP + hydrogel + PRP + hydrogel + derivative + human Autologous cartilage autologous PB-MSCs PRP + 1 PRP PRP PRP PRP PRP PRP + chondrocytes 10 mL 2 1 mL NS NS NS PRP PRP PRP PRP PRP + SDMC 9 mL 2 1 mL PRP PRP + collagen-HA 20 mL 1 NS PRP PRP + PLGAPRP 16 mL PRP + DBM 2 27 mL 0.8 mL 1 3 mL PRP PRP PRCR 10% PRCR in DCs 50 mL 2 NS PRPFM PRPFM + APD 9 mL NS NS NS NS NS formulation Rabbit articular cartilage Tissue type Sheep DDFT Mini pig articular cartilage Rabbit articular cartilage Rabbit articular cartilage Rabbit Achilles tendon Rabbit articular cartilage Rabbit articular cartilage Sheep articular cartilage Mice abdominal cavities Rabbit articular cartilage Caprine articular cartilage Rat articular cartilage Rat Achilles tendon Sheep Achilles tendon BioMed Research International 13 ] ] ] ] ] ] ] ] 130 131 125 127 128 124 129 126 [ [ [ [ Reference P3 P4 Not Not Not PAW applicable applicable applicable classification ) − NS x [ NS P1-x [ (+/ Leukocytes roteinized bovine bone mineral (DBBM), calcium- ), rat PRP (rPRP), human PRP (hPRP), goat (gPRP), lcium (Ca). P), fresh frozen bone allograft (FFBA), autogenous bone marrow cells (BMC), adipose derived stem cell (ADSC) ) uoromethyl) thiophen-2-yl]-3-[3-(trifluoromethyl) phenyl] L), platelet-rich plasma fibrinmatrix (PRPFM), concentrate apatite (HA), synovial membrane derived mesenchymal stem − , periferal blood mesenchymal stem cells (PB-MSCs), adipose /bovine autogenous particled bone (APB), allogeneic BMSC (aBMSCs), NS NS NS NS P1 [ NS NS P2 [ 2 (+/ thrombin Activator Thrombin Fibrinogen CaCl /L /L 9 9 /mL 9 3 10 10 10 10 × × × × platelets/L 51 9 179 304 ± 164 Platelet 10 ± ± platelets/L ± × 669 concentration -TCP), polytetrafluoroethylene (PTFE), platelet-rich growth factor (PRGF), autologous bone (AB), 1161 1951 𝛽 1415 13.8 PRP (mL) volume Table 4: Continued. 1,250,000), x (exogenous activation), A (above baseline), B (below baseline), h (human), and g (goat). > spins) ymal stem cells (BMSCs), calcium aluminate (CA), rabbit BMSC (rBMSC), dep (number of Centrifugation ), titanium (Ti), human adipose derived stem cell (hADSC), human PRP (hPR wth factors (PRGF), PRP with fibrinmatrix (PRPF), tendon stem cells (TSCs) NS NS NS NS NS NS NS NS + NS 1 NS NS NS NS (mL) Blood 60 mL 2 9 mL NS NS NS volume 750,000–1,250,000), P4 ( > ood cells (WBC), poly(lactic-co-glycolic acid) (PLGA), demineralized bone matrix (DBM), hydroxy PRP hydrogel hydrogel hydrogel combination Collagen-PRP Collagen-PRP Collagen-PRP baseline-750,000), P3 ( 3X or 5X PRP + collagen scaffold > baseline), P2 ( PRP PRP PRP + DPB NS 2 NS NS PRP PRP + microfractures NS 2 NS ≤ formulation Sonnleitner method. ∘ Anitua method. Mini. pig ACL PRP Canine ACL PRP Tissue type Sheep cartilage PRP PRP + microfractures 60 mL 2 6–8 mL Rabbit ACL Canine ACL PRP Porcine ACL PRP Rat articular cartilage Canine ACL PRP PRP 20 mL 3 1 mL cell (SDMC), bone marrow mesenchymal stem cell (BMSC), adipose derived stem cell (ADSC), deproteinized bone (DPB), and calcium chloride (CaCl2), ca hydroxyapatite (HA), calcium phosphate cement (CPC),deficient bone hydroxyapatite (CDHA), marrow allogeneic-mesenchymal mesench stem cells (aMSC Not specified (NS), biphasic calcium phosphate (BCP), mesenchymal stem cell (MSC), beta-tricalcium phosphate ( ∗ PAW classification: P1 ( derived mesenchymal stem cells (ADSCs), white bl (AB), hyperbaric oxygen (HBO) therapy, autologous plateletacellular concentrate (APC), porcine adipose dermal tissue derived patch stemperforated (APD) cells bone (ASC), polyglycolic matrix calcium acid phosphate (PDBM), (Ca-P), (PGA), bone recombinant morphogenetic human proteins (BMP), bone polycaprolactone-20% morphogenetic tricalcium proteins phosphate (rhBMP2), (PCL-TCP), platelet-poor (5-[4-phenyl-5-(trifl plasmaplasma (PC), (PPP platelet-rich plasma-clot release (PRCR), plasma rich in gro 1,2,4-oxadiazole) SEW2871, borate glass (BG),bone marrow platelet-rich aspirate fibrin concentrate (BMAC), (PRF), superficial deproteinized digital boneflexor matrixtendon (SDFT), (DPB), low-medium-high deep digital flexor (L-M-HPRP tendon (DDFT), bone anteriorPRP), cruciate (AC ligament 14 BioMed Research International

treatments, although it is necessary to consider inter- and PRP,later activated with thrombin/calcium chloride (CaCl2). intraspecies variability principally in terms of PLTs count. WhilegivingnorealcluesontheeffectofPRP,thepaper As reported by Mitruka and Rawnsley [160]eachspecies showedthecreationofaconstructthatmaybesuitablefor has its own number of PLTs, also with a wide range within bone tissue engineering. Finally, Simson et al. [16] detected the same species. Thus, the knowledge of the exact number that the combination of an injectable chondroitin sulfate ofPLTs,whenananimalmodelisused,isfundamental tissue adhesive and PRP with human MSCs could support for understanding the effectiveness of the PRP application. bone growth. Additional variability is added by some species-specific More recently, Perut et al. [17] investigated the efficacy of peculiarities [148]. This important variability needs to be different components of PLT concentrates on the osteogenic considered in evaluating results from different animal models differentiation of BMSCs. Comparing two different procure- because it could be one of the reasons for dissimilar results ment techniques, the authors reported that, in addition to the obtained when PRP is used, as also demonstrated by the differences in PLT recovery between systems, the composi- studies described below. tion of PRP was associated with variance in the progressive release of bFGF from the platelet gel, which is associated with 3.2.5. Safety Profile. It is well known that PRP derive from the proliferation of BMSCs and their ability to mineralize. autologous blood and this implies minimal risks for disease The authors concluded that the ability of different PLT gels to transmission, immunogenic reactions, and cancer [161]. GFs induce proliferation and osteogenic differentiation of BMSCs act on cell membranes rather than on the cell nucleus and was related to the composition of PRP including the platelet, activate normal gene expression [161]; they are not mutagenic leukocyte, and GF concentrations and availability. and act through gene regulation and normal wound healing feedback control mechanisms. At a Glance. (1) PRP addition in culture medium of MSCs, Considering the long-term clinical experience with the both BMSCs and ADSCs, and OBs improved proliferation use of PRP in oral and maxillofacial field, its use is consid- and osteogenic activity; (2) the ability of different PLT gels to ered to be safe [162, 163]. Differently, no long-term studies induce proliferation and osteogenic differentiation of BMSCs with PRP exist in the musculoskeletal field, despite a large was related to the PRP composition (Table 3). number of treated patients [164]. Recently, a nonrandomized, prospective, longitudinal study on 808 patients indicated no 4.2. In Vivo Studies. Clots of PRP, PLT-rich GF (PRGF), and adverse effects following injection of PRGF into the knee joint PLT-rich fibrin (PRF) were studied in different experimental at 6 months [165]. Contrary, a recent case report reported conditions (sheep sternal wounds, critical size defect in rat an exuberant inflammatory reaction after 1 injection of PRP calvaria, tibia and femurs, and nude mice calvaria bone to treat jumper’s knee in a 35-year-old male type 1 diabetic defect) with good results in terms of bone regeneration [30– patient, revealing that PRP should be proposed only after 35] and promotion of the expression of TGF-𝛽 and bone careful consideration in cases of patients with morbidity morphogenetic protein-2 (BMP-2) [34]. Additionally, Mes- risks [146]. Although the adverse effects are unusual, as with sora et al. [33] observed a better outcome for PRP activated any injection, there is always a slight risk of injection site by CaCl2 in comparison to PRP activated by thromboplastin. morbidity, infection, or injury to nerves or blood vessels. Contrary to the above mentioned studies, Torres et al. [36] Scar tissue formation and calcification at the injection site are showed no beneficial effect of PRP on osseous regeneration remote risks [166]. Infrequently, development of antibodies in rabbit calvaria. Regarding the effect of topical application against clotting factors V and IX leading to life threatening of PRP and platelet-poor plasma (PPP), it was compared coagulopathies has been reported [161, 167]. To date, no con- in a rabbit model of full thickness calvaria defects, noticing vincing preclinical studies and clinical trials demonstrating better results for PRP [37]. Two studies focused on the systemic effects following local PRP injections are reported application of PRP in osteoporosis [38, 39]. Chen et al. [38] and, as showed by Dhillon et al., this is probably due to the administered different concentrations of PRP to promote the limited need of PRP injections in clinics and the short in vivo healing in osteoporotic rat femur. The results highlighted half-lives and local bioavailability of GFs produced by PRP that, if on the one hand PRP enhanced bone regeneration, [168]. on the other hand too high concentrations could prevent a complete healing. Interestingly, Liu et al. [39], instead, used 4. The Role of PRP in PRP to demonstrate its ability to prevent and treat osteo- the Regeneration of Bone porosis by controlling the ratio of osteoblast and adipocyte in ovariectomized female mice. The study detected that PRP 4.1. In Vitro Studies. Several studies [9–13]evaluatedthe treatment improved bone quality in osteoporotic mice via in vitro effectofPRPshowingthatitwasabletoinduce promoting osteogenesis while suppressing adipogenesis in proliferation and osteogenic activity of human OB and OB- the bone marrow. like cells. Additionally, Parsons et al. [14]investigatedthe PRP was also added to autografts [40–45], Bio-Oss [46, effect of PRP on the osteogenic potential of human MSCs, 47], and fresh frozen bone allograft [48] in different animal suggesting the promotion of OB differentiation. models (i.e., critical size defects in mini. pigs, rat calvaria, and Bukharova et al. [15]developedaconstructusingahighly rabbit femur and tibia) and improved bone regeneration. In purifiedbonematrixasscaffoldandosteogeniccommitted addition, Nagata et al. [44] explored the influence that the human adipose derived stem cells (ADSCs) together with different proportion between particulate autogenous bone BioMed Research International 15 grafts and PRP (50, 100, 150 𝜇L) could exert on rat calvaria Additionally, Behnia et al. [94]combinedPRGFwithascaf- healing. The dose of 100 𝜇LofPRPprovedtobethemost folddesignedascarrierforGFsandstemcells,provingnot effective in promoting bone formation, while the inhibitory only the applicability of the material but also the good poten- effect of the highest PRP doses was noticed. However, other tiality in promoting bone regeneration when combined with authors, using various animal models, found no benefits PRGF and MSC. Man et al. [12] also tested the angiogenic and when PRP was added to autologous bone [49–53], autologous osteogenic potential of alginate microspheres combined with bone and Bio-Oss [55, 56], and xenografts57 [ ]. ADSCs and increasing percentage of PRP, demonstrating a Besides the use of PRP in combination with autografts, high rate of mineralization in a model of nude mice with allografts, or xenografts, numerous studies have focused their thepresenceofnewvesselformation,with10and15%of attention on the PRP association with other synthetic and PRP. Finally, Zhang et al. [95] evaluated the immunogenicity biologic materials such as ceramics (hydroxyapatite, HA, bio- of allogeneic PRP and the effect of a construct of allo- glass, calcium phosphate, CaP,and beta-tricalcium phosphate geneic PRP/deproteinized bone matrix/autologous MSCs, (𝛽-TCP)) [58–65], metals [66], polymers (polyglycolic acid with promising results not only regarding immunity but also (PGA)) [67], composites (polycaprolactone-20% tricalcium for bone healing and vascularization. Contrary to the above phosphate (PCL-TCP)) [68], hydrogels [69, 70], alginate [71], coral [72, 73], and chitosan [74]. The majority of studies mentioned study, Khojasteh et al. [169] evaluated the different obtained good outcomes regarding the bone regenerative contribution of PRP and BMSCs to various materials in rat potential when PRP was added to the above mentioned calvaria defect, observing better bone formation with BMSCs materials [58–74]. Additionally, a significant bone formation alone as compared to their combination with PRP. was observed when PRP was used with biphasic CaP or At a Glance. (1) Clots of PRP, PRGF, and PRF improved bone PGA containing BMP-2 [64, 67]. A different application was 𝛽 proposed by Paulo et al., which treated rabbit fibula fracture regeneration, promoting expression of TGF- and BMP- with PRP and daily hyperbaric oxygen therapy sessions, 2; (2) topical application of PRP showed better results in with promising results [75]. However, several studies found comparison to PPP; (3) PRP in osteoporotic animal models opposite outcomes [76]comparedtothosejustquoted,in promoted bone healing; (4) PRP addition to autografts, Bio- particular, when PRP was used in association with ceramic Oss, fresh frozen bone allografts, or other synthetic and [77–80], metallic [81], or composite materials [82]. A work biologic materials showed discordant results in term of bone by Clafshenkel et al. [80], exploring the association of healing; (5) PRP in association with BMSCs or ADSCs, also melatonin-calcium aluminate scaffold with the addition of in combination with different materials, showed good bone PRP in an ovariectomized rat model of calvaria defect, regeneration (Table 4). explained the failure in promoting bone regeneration with a possible conflict between the proliferative thrust induced by 5.TheRoleofPRPin PRP and the differentiative stimuli mediated by melatonin. the Regeneration of Tendons Newly formed bone in rabbit [83, 84]andmice[85] calvaria defects were also obtained using PRP and bone 5.1. In Vitro Studies. Several in vitro studies observed good marrow mesenchymal stem cells (BMSCs). Niemeyer et al. results with different PRP formulations or PRP associated [86],alsousingalargeanimalmodel,observedthatthe withscaffoldsandBMSCsontenocytesortendonculture presence of PRP could in part balance the differences in explants. It was observed that the addition of PRP to the osteogenic potential of BMSCs and ADSCs. Kawasumi et al. culture medium counteracted the inhibition of tenocytes via- [13], instead, evaluating PRP with increasing concentration bility and proliferation induced by the osteoblasts-tenocytes of PLTs in combination with BMSCs in rat limb-lengthening coculture system [18] or by ciprofloxacin or dexametha- model, detected a better qualitative regeneration of bone sone [19]. In addition, some studies compared different tissue using the higher PRP concentration. Lastly, Liu et PRP formulations. Platelet-poor clot releasate (PPCR) or al. [87], also in a study on heterotopic site of nude mice, leukocyte-reduced PRP (lrPRP) showed better results than testing a novel injectable tissue-engineered bone combined platelet-rich clot releasate (PRCR) or high-concentration with induced hADSCs resuspended in PRP, showed an improvement in bone formation. PRP (hcPRP), respectively. Indeed PPCR or lrPRP increased DNA content and total collagen and decreased VEGF-A, Comparing the contribution of MSCs and PRP to the 𝛽 regenerative capacity of ceramic bone substitutes, several TGF- 1, metalloproteinases (MMP) expression [20], and studies indicated that the combined use of the three elements proinflammatory cytokines in tenocytes or flexor digitorum got better results in terms of osteogenesis [88–91]. Addition- superficialis tendon explants21 [ ]. ally, Kasten et al. [89] showed that over the positive effect It was also observed that the best results were found in of PRP with MSC and ceramic material on bone healing, an tenocytes with PRP gel activated with calcium and thrombin effect on vascularization was also proven. Batista et al.92 [ ], (PRP-Ca-Thr) in comparison to that activated with calcium instead, proved the effectiveness in the repair of rabbit tibial (PRP-Ca) [22] and after the addition of PRFMembrane eluent defects of PRP compared to bone marrow concentrate added in comparison to PRFMatrix ones in tenocytes medium [23]. separately to 𝛽-TCP scaffold, while Zhong et al.93 [ ]obtained The addition of PRP to collagen patch seeded with comparable results between PRP and bone marrow aspirate BMSCs improved biomechanical and histological features of concentrate in combination with 𝛽-TCP in nude mice. digitorum profundus tendon in in vitro repair model [24]. 16 BioMed Research International

At a Glance. PRP added to the culture medium of teno- showing that collagen matrix stimulated integrins and CD44 cytes or tendon explants improved viability and proliferation signaling was coordinated with the addition of PRP. These (Table 3). interactions play a critical role in regulating cell proliferation, chondrogenic and inflammatory gene expressions, and 5.2. In Vivo Studies. The effects of PRP alone were evaluated matrix remodeling of human articular chondrocytes. The in acute lesions of rat supraspinatus, horse superficial digital study demonstrated a schematic model of collagen matrix flexor, rat rotator cuff, rat patellar, rabbit intrasynovial flexor, cooperating with PRP to inhibit the ECM degradation and and sheep and rat Achilles tendons. An improvement in promote ECM synthesis and deposition. Recently, Cavallo et biomechanical, collagen fiber orientation, metabolic activity al. [26] assessed the effect of various PRP formulations on properties, and extracellular matrix (ECM) gene expression human chondrocytes. Results showed that PRP with a rela- and a decrease in inflammatory cell number, vascularity, tively low concentration of platelets and very few leukocytes IGF-1, and TGF-𝛽 were observed [96–105]. In addition, stimulated chondrocyte appearing to favor some mechanisms platelet-rich growth factor (PRGF) and PRP with fibrin that stimulate chondrocyte anabolism, as demonstrated by matrix (PRPF) showed the same results [106, 107]. On the the expression of type-II collagen and aggrecan, whereas PRP contrary, no significant improvements were observed after with high concentrations of both platelets and leukocytes the injection of PLT concentration (PC) in patellar tendons appeared to promote other biological pathways involving [108]. various cytokines. This might be due to the presence of Also the combinations of PRP formulations with cells or leukocytes in PRP; the leukocytes may have been responsible scaffolds were studied. No synergic effect on sheep digital for the increased expression of certain molecules such as flexor healing was shown, when PRP was combined with IL-1b, IL-6, VEGF, and FGF-b, which in turn could have peripheral blood MSCs (PBMSCs) [109]. On the other hand, stimulated TIMP-1 and IL-10. the best results were observed when PRP was combined with ADSCs [110] or platelet-rich plasma fibrin matrix (PRPFM) At a Glance. (1) Collagen matrix and PRP promoted cartilage with cross-linked acellular porcine dermal patch (APD), ECMsynthesis;(2)PRPwitharelativelylowconcentration respectively, in rabbit and sheep Achilles tendon lesions [111, of PLTs and very few leukocytes stimulated chondrocyte 130]. anabolism; (3) PRP with high concentrations of both PLTs The use of PRP, collagen sponge, and tendon stem cells andleukocytesappearedtopromotechondrocytecatabolism (TSCs) improved histological parameters and Coll I and Coll (Table 3). III expressions and productions of rat Achilles tendon lesions, especially after physical activity112 [ ]. 6.2. In Vivo Studies. Some in vivo studies evaluated the effects Finally, after the injection into mice abdominal cavities, of PRP when combined with scaffolds (polymers, collagen, tenocytes precultured with platelet-rich plasma-clot release and demineralized bone matrix), cells (chondrocytes and (PRCR) induced high collagen production and tenocyte MSCs), or a combination of them. markers expression [113]. In rabbit chondral defects, PRP incorporated in poly(lactic-co-glycolic acid) (PLGA) successfully improved At a Glance. (1) On tendon lesions, PRP improved biome- the healing [114], while, in sheep and goat osteochondral chanical, collagen fibers orientation, metabolic activity prop- defects, PRP with collagen-HA scaffolds or demineralized erties, and ECM gene expression with a decrease of inflam- bone matrix did not improve or even decreased the healing matory cell number, vascularity, IGF-1, and TGF-𝛽;(2)PRP [115, 116]. Kon et al. showed not only the lack of a positive and PBMSCs combination did not improved tendon healing; effect but also a negative influence of autologous PRP on bone (3) PRP combined with ADSCs or PRPFM with cross-linked and cartilage regeneration with amorphous cartilaginous APD improved tendon healing (Table 4). repair tissue and a poorly spatially organized underlying bone tissue [115]. 6. The Role of PRP in After the assessment of feasibility of PRP as injectable the Regeneration of Cartilage scaffold [117], an improvement in the repair of rabbit osteochondral defects after the implantation of PRP seeded with 6.1. In Vitro Studies. PLT-derived GFs are proteins with the chondrocytes and a chondrocyte differentiation of BMSCs capacity to stimulate chondrocytes to regenerate cartilage. and ADSCs seeded within the PRP scaffold was observed PRGF-treated chondrocytes showed markedly increased syn- [118]. Similarly, Lee et al. [119], using PRP gel embedded thesis of proteoglycans and collagen. Plasma rich in GFs is with synovial membrane derived mesenchymal stem cell an excellent vehicle for GFs, especially PDGF and TGF-𝛽. (SDSCs), showed a substantial improvement in the repair of In fact, several studies have documented the effectiveness of osteochondral defects in a rabbit model. GFs in chondrogenesis and prevention of joint degeneration The combination of hydrogel scaffold, chondrocytes, and by controlling the synthesis and degradation of extracellular PRP promoted the in vivo healing of articular or nonarticular matrix proteins. Their mode of action is to bind to the cartilage lesions, respectively, in rabbit and rat, revealing extracellular domain of a target GF receptor, which in turn successful regeneration of hyaline chondrocytes with forma- activates the intracellular signal transduction pathways. tion of perichondrium-like normal joint cartilage [120, 121]. Wu et al. [25] evaluate the effect of collagen matrix on the Onthecontrary,theseparateaddingofPRPorBMSCsto regeneration potentials of PRP for chondrocytes homeostasis already available composite biphasic scaffold, composed by BioMed Research International 17

PLGA, poly(glycolic acid), and calcium sulfate, resulted in promoted revascularization and reinnervation during ACL a significantly better mini. pig osteochondral defect healing, healing (Table 4). but with no synergic effects [122]. To preserve the advan- tages of chondrocyte therapy in a single-stage approach to 8. Discussion osteochondral defects, Marmotti and coworkers [123]offered a single-step therapeutic approach for osteochondral defects Bone, cartilage, tendon, and ligament injuries have serious using autologous cartilage fragments loaded onto a scaffold socioeconomic consequences in terms of health, rehabili- composed of a hyaluronic acid derivative, human fibrin glue, tation, and lost working hours. The rationale of the use and PRP,in a rabbit model. Finally, the same studies [124, 125] of PRP is that it concentrates more PLTs than the whole using sheep and rats, evaluated the effect of PRP combined blood, allowing the delivery of bioactive GFs and molecules with microfractures on healing of chondral defects, showing that promote tissue healing. Recently, regenerative medicine that PRP application in addition to microfractures resulted in and tissue engineering focused on the use of GFs [163] a better cartilage healing than microfractures alone. andcell-basedtherapytoimprovethequalityandspeedof healing suggesting that this combined biological approach At a Glance. (1) PRP incorporated in PLGA improved may be useful even for the treatment of recalcitrant overuse cartilage healing; (2) PRP with collagen-HA or demineralized musculoskeletal injuries in highly demanding patients if the bone matrix did not improve or even decreased cartilage appropriate dose of cells and GFs is applied [170]. healing; (3) good quality results in cartilage regeneration No of fewer importance, PLT-rich preparations may also when PRP was associated with chondrocytes or MSCs with improve long-term outcomes in patients expected to have or without scaffoldsTable ( 4). impaired healing, such as those with harmful lifestyle choices (e.g., smoking), medications (e.g., steroids), comorbidities 7. The Role of PRP in the Regeneration of (e.g., diabetes, osteoporosis, atherosclerosis, and Alzheimer), Anterior Cruciate Ligament and advanced age [171, 172]. The use of PRP is a quick, minimally invasive, and 7.1. In Vitro Studies. Mastrangelo et al. [27]observedthat relatively low-cost therapeutic strategy and, for these rea- porcine and ovine ACL fibroblasts within a collagen-platelet sons, from the last three decades, PRP injections have been scaffold from skeletally immature animals have greater studied as a therapeutic alternative for different muscu- proliferation and migration potential than adolescent and loskeletal injuries. The present study evaluated the last 10 adult cells. Similar results were obtained by Magarian et al. years preclinical results on regenerative medicine and PRP [28] observing the response to PRP treatment in human in the musculoskeletal tissues in order to summarize the ACLfibroblastsderivedfrom5skeletallyimmatureand5 most important findings on both positive and negative data adolescent patients. Yoshida et al. [29]evaluatedtheoptimal and to stimulate further preclinical and clinical research. concentration of PLTs (1x, 3x, and 5x) to stimulate ACL Until 2006 PRP was preclinically investigated mainly for healing using porcine ACL fibroblasts, revealing that 1x PRP bone regeneration but in the last few years, the number of was the best stimulator while higher concentrations of PLTs studies on the treatment of cartilage, ligaments, and especially had diminishing effects. tendon lesions is increasing. Even if the preclinical results did not report adverse effects, there was a wide variability among At a Glance. (1) ACL fibroblasts within a collagen-platelet the results making it impossible to draw a standard protocol scaffold from skeletally immature animals had greater pro- or indication for the so different musculoskeletal injuries. liferation than adolescent and adult cells; (2) 1x PRP was the First and foremost, the generalized nature of the terminology best stimulator for ACL healing in ACL fibroblasts (Table 3). may be a probable barrier to differentiate between various products and their respective protocols and it is possible that 7.2. In Vivo Studies. Several authors using different animal the different PRP preparation techniques, doses, and appli- models, porcine and canine, demonstrated that healing of cation modalities produce different results. The other main transected ACL could be enhanced with the use of a collagen- differences emerging regarded the number of centrifugations, PRP hydrogel placed within the repair site [126–128]sug- thewithdrawnbloodvolume,theobtainedPRPfinalvolume, gesting also that there was little functional difference in the different PLT concentrations, the presence or absence of ligamenthealingwiththeuseofcollagenscaffoldssaturated leukocytes in the final preparation, and, lastly, the use of an with 3x or 5x PRP [129]. Differently, Zhai and coworkers activator. The above listed factors are subjected to a great [130] showed that platelet-rich gel + deproteinized bone could variability and in many papers are not specified in detail. trigger tendon-bone healing by promoting the maturation The adoption of one of the proposed classification systems andossificationofthetendon-bonetissueinarabbitmodel. (PAWclassification), in order to compare data, was not always Finally, the role of PRP in promoting revascularization and and completely applicable, making it impossible to reach a reinnervation during ACL healing was clarified, using a conclusion on the best PLT concentration to be used. canine animal model [131]. The application of PRP in vitro showed promising results in all examined tissues. Researchers on bone demonstrated At a Glance. (1) Healing of transected ACL enhanced with that the addition of PRP in cell culture medium determined the use of a collagen-PRP hydrogel; (2) PLTt-rich gel + good proliferation and osteogenic activity of MSCs (both deproteinized bone triggered tendon-bone healing; (3) PRP BMSCs and ADSCs) and OBs. The presence of PRP had 18 BioMed Research International a positive effect in the culture of tenocytes or tendon explants Acknowledgments and promising results were also observed with chondrocytes and ACL fibroblasts. The in vivo protocols are even more This work was supported by grants from Rizzoli Orthopaedic varyingandcomplexthanthein vitro ones. In bone, a wide Institute (Ricerca Corrente), “Cinque per Mille 2011” funds, spectrum of defects in different anatomic locations have FIRB RBAP10MLK7 “Scaffold per la rigenerazione dei tessuti been analyzed (calvarium, radius, tibia, condyle, iliac crest, scheletrici: valutazione preclinica della loro compatibilita’ ulna,femur,fibula,sternum,spine,frontalbone,andskull), ed efficienza” and by the Operational Programme ERDF besides vessel and bone formations in ectopic sites, employ- 2007–2013 in the region Emilia-Romagna: Activity The 1.1 ing the combination of PRP with scaffolds or autologous “Creation of Technology Centers for Industrial Research and bone. Despite some contrasting data, in vivo studies showed Technological Transfer.” encouraging results when PRP was used, also in combination with MSCs with or without other cells. References Different PRP formulations have been used for the regeneration of the most important tendons of the body: patellar, [1] A. D. Woolf and B. Pfleger, “Burden of major musculoskeletal Achilles, superficial or deep digital flexor, rotator cuff, and conditions,” Bulletin of the World Health Organization,vol.81, intrasynovial flexor tendons. Similar to the bone tissue, for in no.9,pp.646–656,2003. vivo tendon regeneration, good results were observed when [2] R. Bitton, “The economic burden of osteoarthritis,” The Ameri- PRP was employed. can Journal of Managed Care,vol.15,no.8,pp.S230–S235,2009. Finally, contrasting findings were observed in partial [3]R.Burge,B.Dawson-Hughes,D.H.Solomon,J.B.Wong,A. thickness, full thickness, osteochondral defects, and ACL King, and A. Tosteson, “Incidence and economic burden of reconstruction, although the in vivo studies on cartilage osteoporosis-related fractures in the United States, 2005–2025,” regeneration reported good quality results when PRP was Journal of Bone and Mineral Research,vol.22,no.3,pp.465–475, associated with chondrocytes or MSC with or without scaf- 2007. folds. Regarding ACL, all examined in vivo studies showed [4] R.B.Frobell,L.S.Lohmander,andH.P.Roos,“Acuterotational high-quality results in terms of regeneration. trauma to the knee: Poor agreement between clinical assess- To summarize, in vitro studies underlined the role of PRP ment and magnetic resonance imaging findings,” Scandinavian for tissue regeneration and, when comparing different PRP JournalofMedicine&ScienceinSports,vol.17,no.2,pp.109–114, 2007. formulations, concluded that a specific range of PLT number is required in order to obtain the best results with an increase [5]R.A.E.ClaytonandC.M.Court-Brown,“Theepidemiology in ECM protein expression and a decrease in the levels of of musculoskeletal tendinous and ligamentous injuries,” Injury, vol. 39, no. 12, pp. 1338–1344, 2008. proinflammatory cytokines and MMPs, via downregulation of known catabolic signaling pathways. However, the in vitro [6]W.S.PietrzakandB.L.Eppley,“Plateletrichplasma:biology and new technology,” Journal of Craniofacial Surgery,vol.16,no. positive effects were not confirmed in all the in vivo studies 6, pp. 1043–1054, 2005. because of the many variables affecting the success rate in a [7] H.A.MejiaandJ.P.Bradley,“Theeffectsofplatelet-richplasma complexscenariowherebothPRPandthelesionsiteplaya on muscle,” Basic Science and Clinical Application,vol.19,pp. crucial role. 149–153, 2011. [8] C. D. Stiles, “The molecular biology of platelet-derived growth 9. Conclusions and Outlook for factor,” Cell, vol. 33, no. 3, pp. 653–655, 1983. Future Research [9]C.E.Markopoulou,P.Markopoulos,X.E.Dereka,E.Pepelassi, Despite the fact that many of the examined studies showed andI.A.Vrotsos,“EffectofhomologousPRPonproliferationof human periodontally affected osteoblasts. In vitro preliminary the potential positive effect of PRP in the treatment of mus- study. Report of a case,” Journal of Musculoskeletal Neuronal culoskeletal diseases, there is a paucity of human randomized Interactions,vol.9,no.3,pp.167–172,2009. controlled trials to provide level I evidence for the efficacy [10] J. Uggeri, S. Belletti, S. Guizzardi et al., “Dose-dependent effects of this intervention. In fact, most of the human studies of platelet gel releasate on activities of human osteoblasts,” arecaseseriesorretrospectivestudieswithoutacontrol Journal of Periodontology,vol.78,no.10,pp.1985–1991,2007. group. Generally, they are small in size and unpowered. Thus, [11] H. H. Lu, J. M. Vo, H. S. Chin et al., “Controlled delivery of further evaluations are recommended and future studies platelet-richplasma-derivedgrowthfactorsforboneforma- should (1) find uniform and standardized nomenclature and tion,” Journal of Biomedical Materials Research Part A,vol.86, preparation protocols; (2) optimize the number of PLTs and no. 4, pp. 1128–1136, 2008. leukocytes cells; (3) make a direct comparison with other [12] Y. Man, P. Wang, Y. Guo et al., “Angiogenic and osteogenic therapeutic techniques; (4) increase the quality of preclinical potential of platelet-rich plasma and adipose-derived stem cell trials on safety, efficacy, and proof of concept studies; (5) laden alginate microspheres,” Biomaterials,vol.33,no.34,pp. clarify the role of the patient and lesion characteristics 8802–8811, 2012. together with the local inflammatory microenvironment in [13] M. Kawasumi, H. Kitoh, K. A. Siwicka, and N. Ishiguro, “The the clinical outcome. effect of the platelet concentration in platelet-rich plasma gel on the regeneration of bone,” The Journal of Bone and Joint Conflict of Interests Surgery—British Volume,vol.90-B,no.7,pp.966–972,2008. [14] P. Parsons, A. Butcher, K. Hesselden et al., “Platelet-rich con- The authors declare that they have no conflict of interests. centrate supports human mesenchymal stem cell proliferation, BioMed Research International 19

bone morphogenetic protein-2 messenger RNA expression, stronger in vitro response to platelet concentrates than those alkaline phosphatase activity, and bone formation in vitro: a from mature individuals,” Knee, vol. 18, no. 4, pp. 247–251, 2011. mode of action to enhance bone repair,” Journal of Orthopaedic [29] R. Yoshida, M. Cheng, and M. M. Murray, “Increasing platelet Trauma,vol.22,no.9,pp.595–604,2008. concentration in platelet-rich plasma inhibits anterior cruciate [15]T.B.Bukharova,I.V.Arutyunyan,S.A.Shustrovetal.,“Tissue ligament cell function in three-dimensional culture,” Journal of engineering construct on the basis of multipotent stromal Orthopaedic Research, vol. 32, no. 2, pp. 291–295, 2014. adipose tissue cells and osteomatrix for regeneration of the bone [30] I. Gallo, A. Saenz,´ E. Artinano,˜ and J. Esquide, “Autologous tissue,” Bulletin of Experimental Biology and Medicine,vol.152, platelet-rich plasma: effect on sternal healing in the sheep no. 1, pp. 153–158, 2011. model,” Interactive Cardiovascular and Thoracic Surgery, vol. 11, [16] J. Simson, J. Crist, I. Strehin, Q. Lu, and J. H. Elisseeff, “An no. 3, pp. 223–225, 2010. orthopedic tissue adhesive for targeted delivery of intraopera- [31] E. H. Gumieiro, M. Abrahao,R.S.Jahnetal.,“Platelet-rich˜ tive biologics,” Journal of Orthopaedic Research,vol.31,no.3,pp. plasma in bone repair of irradiated tibiae of Wistar rats,” Acta 392–400, 2013. Cirurgica Brasileira, vol. 25, no. 3, pp. 257–263, 2010. [17] F. Perut, G. Filardo, E. Mariani et al., “Preparation method [32] R. Mariano, M. Messora, A. de Morais et al., “Bone healing and growth factor content of platelet concentrate influence in critical-size defects treated with platelet-rich plasma: a the osteogenic differentiation of bone marrow stromal cells,” histologic and histometric study in the calvaria of diabetic rat,” Cytotherapy,vol.15,no.7,pp.830–839,2013. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology and [18] W.Zhai,N.Wang,Z.Qi,Q.Gao,andL.Yi,“Platelet-richplasma Endodontology,vol.109,no.1,pp.72–78,2010. reverses the inhibition of tenocytes and osteoblasts in tendon- [33] M. R. Messora, M. J. H. Nagata, R. C. M. Dornelles et al., bone healing,” Orthopedics,vol.35,no.4,pp.e520–e525,2012. “Bone healing in critical-size defects treated with platelet- [19] N. Zargar Baboldashti, R. C. Poulsen, S. L. Franklin, M. S. rich plasma activated by two different methods. A histologic Thompson, and P. A. Hulley, “Platelet-rich plasma protects and histometric study in rat calvaria,” Journal of Periodontal tenocytes from adverse side effects of dexamethasone and Research,vol.43,no.6,pp.723–729,2008. ciprofloxacin,” The American Journal of Sports Medicine,vol.39, [34] R. Simman, A. Hoffmann, R. J. Bohinc, W. C. Peterson, and no. 9, pp. 1929–1935, 2011. A. J. Russ, “Role of platelet-rich plasma in acceleration of bone [20] M. de Mos, A. E. van der Windt, H. Jahr et al., “Can platelet- fracture healing,” AnnalsofPlasticSurgery,vol.61,no.3,pp.337– rich plasma enhance tendon repair? A cell culture study,” The 344, 2008. American Journal of Sports Medicine,vol.36,no.6,pp.1171–1178, [35] Y.-H. Kang, S. H. Jeon, J.-Y. Park et al., “Platelet-rich fibrin 2008. is a bioscaffold and reservoir of growth factors for tissue [21] T. M. McCarrel, T. Minas, and L. A. Fortier, “Optimization of regeneration,” Tissue Engineering. Part A,vol.17,no.3-4,pp. leukocyte concentration in platelet-rich plasma for the treat- 349–359, 2011. ment of tendinopathy,” The Journal of Bone and Joint Surgery. [36] J. Torres, F. M. Tamimi, I. F. Tresguerres et al., “Effect of solely American Volume,vol.94,no.19,pp.e143.1–e143.8,2012. applied platelet-rich plasma on osseous regeneration compared [22] C. H. Jo, J. E. Kim, K. S. Yoon, and S. Shin, “Platelet-rich to Bio-Oss: a morphometric and densitometric study on rabbit plasma stimulates cell proliferation and enhances matrix gene calvaria,” Clinical Implant Dentistry and Related Research,vol. expression and synthesis in tenocytes from human rotator cuff 10,no.2,pp.106–112,2008. tendons with degenerative tears,” The American Journal of Sports [37] K. Findikcioglu, F. Findikcioglu, R. Yavuzer, C. Elmas, and Medicine,vol.40,no.5,pp.1035–1045,2012. K. Atabay, “Effect of platelet-rich plasma and fibrin glue on [23] L. C. Visser, S. P. Arnoczky, O. Caballero, and M. Egerbacher, healing of critical-size calvarial bone defects,” The Journal of “Platelet-rich fibrin constructs elute higher concentrations of Craniofacial Surgery,vol.20,no.1,pp.34–40,2009. transforming growth factor-𝛽1 and increase tendon cell prolif- [38] L. Chen, X. Yang, G. Huang et al., “Platelet-rich plasma eration over time when compared to blood clots: a comparative promotes healing of osteoporotic fractures,” Orthopedics,vol. in vitro analysis,” Veterinary Surgery,vol.39,no.7,pp.811–817, 36,no.6,pp.e687–e694,2013. 2010. [39]H.-Y.Liu,A.T.H.Wu,C.-Y.Tsaietal.,“Thebalancebetween [24]Y.Morizaki,C.Zhao,K.-N.An,andP.C.Amadio,“Theeffects adipogenesis and osteogenesis in bone regeneration by platelet- of platelet-rich plasma on bone marrow stromal cell transplants rich plasma for age-related osteoporosis,” Biomaterials,vol.32, for tendon healing in vitro,” TheJournalofHandSurgery,vol. no. 28, pp. 6773–6780, 2011. 35,no.11,pp.1833–1841,2010. [40] M. Hakimi, P. Jungbluth, M. Sager et al., “Combined use of [25] C.-C. Wu, W.-H. Chen, B. Zao et al., “Regenerative potentials platelet-richplasmaandautologousbonegraftsinthetreatment of platelet-rich plasma enhanced by collagen in retrieving proof long bone defects in mini-pigs,” Injury,vol.41,no.7,pp.717– inflammatory cytokine-inhibited chondrogenesis,” Biomateri- 723, 2010. als,vol.32,no.25,pp.5847–5854,2011. [41]S.R.Kanthan,G.Kavitha,S.Addi,D.S.K.Choon,andT. [26] C. Cavallo, G. Filardo, E. Mariani et al., “Comparison of platelet- Kamarul, “Platelet-rich plasma (PRP) enhances bone healing in rich plasma formulations for cartilage healing: an in vitro study,” non-united critical-sized defects: a preliminary study involving The Journal of Bone and Joint Surgery—American Volume,vol. rabbit models,” Injury,vol.42,no.8,pp.782–789,2011. 96, no. 5, pp. 423–429, 2014. [42] F. Molina-Minano,˜ P. Lopez-Jornet,´ F. Camacho-Alonso, and [27] A. N. Mastrangelo, E. M. Magarian, M. P. Palmer, P. Vavken, V. Vicente-Ortega, “Plasma rich in growth factors and bone and M. M. Murray, “The effect of skeletal maturity on the regen- formation: a radiological and histomorphometric study in New erative function of intrinsic ACL cells,” JournalofOrthopaedic Zealand rabbits,” Brazilian Oral Research,vol.23,no.3,pp.275– Research,vol.28,no.5,pp.644–651,2010. 280, 2009. [28] E. M. Magarian, P.Vavken, and M. M. Murray, “Human anterior [43] M. J. H. Nagata, L. G. N. Melo, M. R. Messora et al., “Effect of cruciate ligament fibroblasts from immature patients have a platelet-rich plasma on bone healing of autogenous bone grafts 20 BioMed Research International

in critical-size defects,” Journal of Clinical Periodontology,vol. of platelet-rich plasma on early and late bone healing using a 36,no.9,pp.775–783,2009. mixture of particulate autogenous cancellous bone and Bio-Oss: [44]M.Nagata,M.Messora,R.Okamotoetal.,“Influenceofthe an experimental study in goats,” International Journal of Oral & proportion of particulate autogenous bone graft/platelet-rich Maxillofacial Surgery,vol.39,no.4,pp.371–378,2010. plasma on bone healing in critical-size defects. An immuno- [57] I. Guerra, F. Morais Branco, M. Vasconcelos, A. Afonso, H. histochemical analysis in rat calvaria,” Bone,vol.45,no.2,pp. Figueiral, and R. Zita, “Evaluation of implant osseointegration 339–345, 2009. with different regeneration techniques in the treatment of bone [45] M.J.H.Nagata,M.Messora,N.Polaetal.,“Influenceoftheratio defects around implants: an experimental study in a rabbit of particulate autogenous bone graft/platelet-rich plasma on model,” Clinical Oral Implants Research,vol.22,no.3,pp.314– bone healing in critical-size defects: a histologic and histometric 322, 2011. study in rat calvaria,” Journal of Orthopaedic Research,vol.28, [58] A. Oryan, A. Meimandi Parizi, Z. Shafiei-Sarvestani, and A. no. 4, pp. 468–473, 2010. S. Bigham, “Effects of combined hydroxyapatite and human [46] K. Lysiak-Drwal, M. Dominiak, L. Solski et al., “Early histolog- platelet rich plasma on bone healing in rabbit model: radi- ical evaluation of bone defect healing with and without guided ological, macroscopical, hidtopathological and biomechanical bone regeneration techniques: experimental animal studies,” evaluation,” Cell and Tissue Banking,vol.13,no.4,pp.639–651, PostępyHigienyiMedycynyDo´swiadczalnej,vol.62,pp.282– 2012. 288, 2008. [59] P. Metzler, C. von Wilmowsky, R. Zimmermann, J. Wiltfang, [47] T.-M. You, B.-H. Choi, J. Li et al., “The effect of platelet- and K. A. Schlegel, “The effect of current used bone substitution rich plasma on bone healing around implants placed in bone materials and platelet-rich plasma on periosteal cells by ectopic defects treated with Bio-Oss: a pilot study in the dog tibia,” site implantation: an in-vivo pilot study,” Journal of Cranio- Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology and Maxillofacial Surgery, vol. 40, no. 5, pp. 409–415, 2012. Endodontology, vol. 103, no. 4, pp. e8–e12, 2007. [60] J.-C. Chen, C.-L. Ko, C.-J. Shih, Y.-C. Tien, and W.-C. Chen, [48] M. Messora, L. Braga, G. Oliveira et al., “Healing of fresh frozen “Calcium phosphate bone cement with 10 wt% platelet-rich bone allograft with or without platelet-rich plasma: a histologic plasma in vitro and in vivo,” Journal of Dentistry,vol.40,no. and histometric study in rats,” Clinical Implant Dentistry and 2, pp. 114–122, 2012. Related Research,vol.15,no.3,pp.438–447,2013. [61] P. Jungbluth, M. Wild, J.-P. Grassmann et al., “Platelet-rich [49] N. Broggini, W. Hofstetter, E. Hunziker et al., “The influence of plasma on calcium phosphate granules promotes metaphyseal PRPonearlyboneformationinmembraneprotecteddefects. bone healing in mini-pigs,” Journal of Orthopaedic Research,vol. A histological and histomorphometric study in the rabbit 28,no.11,pp.1448–1455,2010. calvaria,” Clinical Implant Dentistry and Related Research,vol. [62] A. S. Plachokova, J. van den Dolder, P. J. Stoelinga, and J. A. 13, no. 1, pp. 1–12, 2011. Jansen, “Early effect of platelet-rich plasma on bone healing [50] A. F. Giovanini, T. M. Deliberador, C. C. Gonzaga et al., in combination with an osteoconductive material in rat cranial “Platelet-rich plasma diminishes calvarial bone repair asso- defects,” Clinical Oral Implants Research,vol.18,no.2,pp.244– ciated with alterations in collagen matrix composition and 251, 2007. elevated CD34+ cell prevalence,” Bone,vol.46,no.6,pp.1597– [63] Y.-D. Zhang, G. Wang, Y. Sun, and C.-Q. Zhang, “Combination 1603, 2010. of platelet-rich plasma with degradable bioactive borate glass [51] A. F. Giovanini, C. C. Gonzaga, J. C. Zielak et al., “Platelet-rich for segmental bone defect repair,” Acta Orthopaedica Belgica, plasma (PRP) impairs the craniofacial bone repair associated vol. 77, no. 1, pp. 110–115, 2011. with its elevated TGF-𝛽 levels and modulates the co-expression [64] K. Yoshida, Y. Sumita, E. Marukawa, M. Harashima, and I. betweencollagenIIIand𝛼-smooth muscle actin,” Journal of Asahina, “Effect of platelet-rich plasma on bone engineering Orthopaedic Research,vol.29,no.3,pp.457–463,2011. with an alloplastic substitute containing BMP2,” Bio-Medical [52] M. Hatakeyama, M. E. Beletti, D. Zanetta-Barbosa, and P. Materials and Engineering, vol. 23, no. 3, pp. 163–172, 2013. Dechichi, “Radiographic and histomorphometric analysis of [65] S.-H. Chang, Y.-M. Hsu, Y. J. Wang, Y.-P. Tsao, K.-Y. Tung, bone healing using autogenous graft associated with platelet- and T.-Y. Wang, “Fabrication of pre-determined shape of bone rich plasma obtained by 2 different methods,” Oral Surgery, Oral segment with collagen-hydroxyapatite scaffold and autogenous Medicine, Oral Pathology, Oral Radiology and Endodontology, platelet-rich plasma,” Journal of Materials Science: Materials in vol. 105, no. 1, pp. e13–e18, 2008. Medicine,vol.20,no.1,pp.23–31,2009. [53] M. A. de Oliveira Filho, P. A. N. Nassif, O. Malafaia et al., [66]H.C.Kroese-Deutman,J.W.M.Vehof,P.H.M.Spauwen,P. “Effects of a highly concentrated platelet-rich plasma on the J. W. Stoelinga, and J. A. Jansen, “Orthotopic bone formation bone repair using non-critical defects in the calvaria of rabbits,” in titanium fiber mesh loaded with platelet-rich plasma and Acta Cirurgica Brasileira,vol.25,no.1,pp.28–33,2010. placed in segmental defects,” International Journal of Oral and [54] S. R. Miranda, H. N. Filho, L. E. Marques Padovan, D. A. Maxillofacial Surgery,vol.37,no.6,pp.542–549,2008. Ribeiro, D. Nicolielo, and M. A. Matsumoto, “Use of platelet- [67] E.-J. Park, E.-S. Kim, H.-P. Weber, R. F. Wright, and D. rich plasma under autogenous onlay bone grafts,” Clinical Oral J. Mooney, “Improved bone healing by angiogenic factor- Implants Research,vol.17,no.6,pp.694–699,2006. enriched platelet-rich plasma and its synergistic enhancement [55] R. E. C. M. Mooren, M. A. W. Merkx, E. M. Bronkhorst, J. A. by bone morphogenetic protein-2,” The International Journal of Jansen, and P.J. W.Stoelinga, “The effect of platelet-rich plasma OralandMaxillofacialImplants,vol.23,no.5,pp.818–826,2008. on early and late bone healing: an experimental study in goats,” [68]B.Rai,M.E.Oest,K.M.Dupont,K.H.Ho,S.H.Teoh, International Journal of Oral and Maxillofacial Surgery,vol.36, and R. E. Guldberg, “Combination of platelet-rich plasma with no.7,pp.626–631,2007. polycaprolactone-tricalcium phosphate scaffolds for segmental [56]R.E.C.M.Mooren,A.C.A.Dankers,M.A.W.Merkx,E. bone defect repair,” Journal of Biomedical Materials Research M.Bronkhorst,J.A.Jansen,andP.J.W.Stoelinga,“Theeffect Part A, vol. 81, no. 4, pp. 888–899, 2007. BioMed Research International 21

[69] Y.-H. Kim, H. Furuya, and Y. Tabata, “Enhancement of bone [83]X.Cheng,D.Lei,T.Mao,S.Yang,F.Chen,andW.Wu,“Repair regeneration by dual release of a macrophage recruitment agent of critical bone defects with injectable platelet rich plasma/bone and platelet-rich plasma from gelatin hydrogels,” Biomaterials, marrow-derived stromal cells composite: experimental study in vol.35,no.1,pp.214–224,2014. rabbits,” Ulusal Travma ve Acil Cerrahi Dergisi,vol.14,no.2,pp. [70] A. Hokugo, Y. Sawada, R. Hokugo et al., “Controlled release 87–95, 2008. of platelet growth factors enhances bone regeneration at rabbit [84] Z.-Q. Jiang, H.-Y. Liu, L.-P. Zhang, Z.-Q. Wu, and D.-Z. Shang, calvaria,” Oral Surgery, Oral Medicine, Oral Pathology, Oral “Repair of calvarial defects in rabbits with platelet-rich plasma Radiology and Endodontology,vol.104,no.1,pp.44–48,2007. as the scaffold for carrying bone marrow stromal cells,” Oral [71] N. Tsuzuki, J.-P. Seo, K. Yamada, S. Haneda, Y. Tabata, and N. Surgery, Oral Medicine, Oral Pathology and Oral Radiology,vol. Sasaki, “Effect of compound of gelatin hydrogel microsphere 113, no. 3, pp. 327–333, 2012. incorporated with platelet-rich-plasma and alginate on sole [85]B.S.Monteiro,R.J.delCarlo,N.M.Argolo-Netoˆ et al., defect in cattle,” The Journal of Veterinary Medical Science,vol. “Association of mesenchymal stem cells with platelet rich 74,no.8,pp.1041–1044,2012. plasma on the repair of critical calvarial defects in mice,” Acta [72] A. Meimandi Parizi, A. Oryan, Z. Shafiei-Sarvestani, and A. Cirurgica Brasileira, vol. 27, no. 3, pp. 201–209, 2012. S.Bigham,“HumanplateletrichplasmaplusPersianGulf [86] P. Niemeyer, K. Fechner, S. Milz et al., “Comparison of mes- coral effects on experimental bone healing in rabbit model: enchymal stem cells from bone marrow and adipose tissue for radiological, histological, macroscopical and biomechanical bone regeneration in a critical size defect of the sheep tibia and evaluation,” Journal of Materials Science: Materials in Medicine, the influence of platelet-rich plasma,” Biomaterials,vol.31,no. vol. 23, no. 2, pp. 473–483, 2012. 13, pp. 3572–3579, 2010. [73] Z. Shafiei-Sarvestani, A. Oryan, A. S. Bigham, and A. [87] Y. Liu, Y. Zhou, H. Feng, G.-E. Ma, and Y. Ni, “Injectable tissue- Meimandi-Parizi, “The effect of hydroxyapatite-hPRP, and engineered bone composed of human adipose-derived stromal coral-hPRP on bone healing in rabbits: radiological, biome- cells and platelet-rich plasma,” Biomaterials,vol.29,no.23,pp. chanical, macroscopic and histopathologic evaluation,” Interna- 3338–3345, 2008. tional Journal of Surgery,vol.10,no.2,pp.96–101,2012. [88] S. Agacayak, B. Gulsun, M. C. Ucan, E. Karaoz, and Y. Nergiz, [74] E. O. Oktay, B. Demiralp, S. Senel, A. Cevdet Akman, K. “Effects of mesenchymal stem cells in critical size bone defect,” Eratalay, and H. Akincibay, “Effects of platelet-rich plasma and European Review for Medical and Pharmacological Sciences,vol. chitosan combination on bone regeneration in experimental 16, no. 5, pp. 679–686, 2012. rabbit cranial defects,” TheJournalofOralImplantology,vol.36, [89] P. Kasten, M. Beverungen, H. Lorenz, J. Wieland, M. Fehr, no. 3, pp. 175–184, 2010. and F. Geiger, “Comparison of platelet-rich plasma and VEGF- [75] C. F. N. Paulo, S. D. C. V. Abib, R. F. Neves et al., “Effect of transfected mesenchymal stem cells on vascularization and hyperbaric oxygen therapy combined with autologous platelet bone formation in a critical-size bone defect,” Cells Tissues concentrate applied in rabbit fibula fraction healing,” Clinics, Organs,vol.196,no.6,pp.523–533,2012. vol.68,no.9,pp.1239–1246,2013. [90] P. Kasten, J. Vogel, F. Geiger, P. Niemeyer, R. Luginbuhl,¨ and K. [76]Y.-C.Por,C.R.Barcelo,´ K. E. Salyer et al., “Bone generation Szalay, “The effect of platelet-rich plasma on healing in critical- in the reconstruction of a critical size calvarial defect in an size long-bone defects,” Biomaterials,vol.29,no.29,pp.3983– experimental model,” JournalofCraniofacialSurgery,vol.19,no. 3992, 2008. 2, pp. 383–392, 2008. [91] R. M. El Backly, S. H. Zaky, A. Muraglia et al., “A platelet- [77] A. S. Plachokova, J. van den Dolder, J. J. J. P. van den Beucken, rich plasma-based membrane as a periosteal substitute with and J. A. Jansen, “Bone regenerative properties of rat, goat and enhanced osteogenic and angiogenic properties: a new concept human platelet-rich plasma,” International Journal of Oral and for bone repair,” Tissue Engineering, Part A,vol.19,no.1-2,pp. Maxillofacial Surgery,vol.38,no.8,pp.861–869,2009. 152–165, 2013. [78] B. Ozdemir,¨ B. Kurtis¸, G. Tuter¨ et al., “Double-application of [92]M.A.Batista,T.P.Leivas,C.J.Rodrigues,G.C.F.Arenas,D.R. platelet-rich plasma on bone healing in rabbits,” Medicina Oral, Belitardo, and R. Guarniero, “Comparison between the effects Patologia Oral y Cirugia Bucal,vol.17,no.1,pp.e171–e177,2012. of platelet-rich plasma and bone marrow concentrate on defect [79] G. Cinotti, A. Corsi, B. Sacchetti, M. Riminucci, P. Bianco, consolidation in the rabbit tibia,” Clinics,vol.66,no.10,pp. and G. Giannicola, “Bone ingrowth and vascular supply in 1787–1792, 2011. experimental spinal fusion with platelet-rich plasma,” Spine,vol. [93]W.Zhong,Y.Sumita,S.Ohbaetal.,“Invivocomparison 38,no.5,pp.385–391,2013. of the bone regeneration capability of human bone marrow [80] W.P.Clafshenkel, J. L. Rutkowski, R. N. Palchesko et al., “Anovel concentrates vs. platelet-rich plasma,” PLoS ONE,vol.7,no.7, calcium aluminate-melatonin scaffold enhances bone regener- Article ID e40833, 2012. ation within a calvarial defect,” JournalofPinealResearch,vol. [94] H. Behnia, A. Khojasteh, M. T. Kiani et al., “Bone regeneration 53,no.2,pp.206–218,2012. with a combination of nanocrystalline hydroxyapatite silica [81] K. A. Schlegel, M. Thorwarth, A. Plesinac, J. Wiltfang, and gel, platelet-rich growth factor, and mesenchymal stem cells: a S. Rupprecht, “Expression of bone matrix proteins during the histologic study in rabbit calvaria,” Oral Surgery, Oral Medicine, osseus healing of topical conditioned implants: an experimental Oral Pathology and Oral Radiology, vol. 115, no. 2, pp. 7–15, 2013. study,” Clinical Oral Implants Research, vol. 17, no. 6, pp. 666– [95]Z.-Y.Zhang,A.-W.Huang,J.J.Fanetal.,“Thepotential 672, 2006. use of allogeneic platelet-rich plasma for large bone defect [82] D. Nikolidakis, J. van den Dolder, J. G. C. Wolke, and J. treatment: immunogenicity and defect healing efficacy,” Cell A. Jansen, “Effect of platelet-rich plasma on the early bone Transplantation,vol.22,no.1,pp.175–187,2013. formation around Ca-P-coated and non-coated oral implants [96] D. N. Lyras, K. Kazakos, G. Agrogiannis et al., “Experimen- in cortical bone,” Clinical Oral Implants Research,vol.19,no.2, tal study of tendon healing early phase: is IGF-1 expression pp.207–213,2008. influenced by platelet rich plasma gel?” Orthopaedics and 22 BioMed Research International

Traumatology: Surgery and Research,vol.96,no.4,pp.381–387, biomechanical and immunohistochemical evaluation,” Journal 2010. of Plastic, Reconstructive & Aesthetic Surgery,vol.65,no.12,pp. [97] D. N. Lyras, K. Kazakos, M. Tryfonidis et al., “Temporal and 1712–1719, 2012. spatial expression of TGF-beta1 in an Achilles tendon section [111] T. L. Sarrafian, H. Wang, E. S. Hackett et al., “Comparison of model after application of platelet-rich plasma,” Foot and Ankle Achilles tendon repair techniques in a sheep model using a Surgery,vol.16,no.3,pp.137–141,2010. cross-linked acellular porcine dermal patch and platelet-rich [98] D. Lyras, K. Kazakos, D. Verettas et al., “Immunohistochemical plasma fibrin matrix for augmentation,” Journal of Foot and study of angiogenesis after local administration of platelet-rich Ankle Surgery,vol.49,no.2,pp.128–134,2010. plasma in a patellar tendon defect,” International Orthopaedics, [112] L. Chen, S.-W. Dong, J.-P. Liu, X. Tao, K.-L. Tang, and J.-Z. vol.34,no.1,pp.143–148,2010. Xu, “Synergy of tendon stem cells and platelet-rich plasma in [99] G. Bosch, P. Rene´ van Weeren, A. Barneveld, and H. T. M. tendon healing,” Journal of Orthopaedic Research,vol.30,no.6, van Schie, “Computerised analysis of standardised ultrasono- pp. 991–997, 2012. graphic images to monitor the repair of surgically created core [113] X. Wang, Y. Qiu, J. Triffitt, A. Carr, Z. Xia, and A. Sabok- lesions in equine superficial digital flexor tendons following bar, “Proliferation and differentiation of human tenocytes in treatment with intratendinous platelet rich plasma or placebo,” responsetoplateletrichplasma:aninvitroandinvivostudy,” The Veterinary Journal,vol.187,no.1,pp.92–98,2011. Journal of Orthopaedic Research,vol.30,no.6,pp.982–990, [100]G.Bosch,H.T.M.vanSchie,M.W.deGrootetal.,“Effects 2012. ofplatelet-richplasmaonthequalityofrepairofmechani- [114]Y.Sun,Y.Feng,C.Q.Zhang,S.B.Chen,andX.G.Cheng,“The cally induced core lesions in equine superficial digital flexor regenerative effect of platelet-rich plasma on healing in large tendons: a placebo-controlled experimental study,” Journal of osteochondral defects,” International Orthopaedics,vol.34,no. Orthopaedic Research,vol.28,no.2,pp.211–217,2010. 4, pp. 589–597, 2010. [101]Y.Kajikawa,T.Morihara,H.Sakamotoetal.,“Platelet-rich [115] E. Kon, G. Filardo, M. Delcogliano et al., “Platelet autologous plasma enhances the initial mobilization of circulation-derived growth factors decrease the osteochondral regeneration capa- cells for tendon healing,” Journal of Cellular Physiology,vol.215, bility of a collagen-hydroxyapatite scaffold in a sheep model,” no. 3, pp. 837–845, 2008. BMC Musculoskeletal Disorders, vol. 11, article 220, 2010. [102] O. Hapa, H. C¸akici,A.Kukner,¨ H. Aygun,¨ N. Sarkalkan, and [116] C. J. A. van Bergen, G. M. M. J. Kerkhoffs, M. Ozdemir¨ et G. Baysal, “Effect of platelet-rich plasma on tendon-to-bone al., “Demineralized bone matrix and platelet-rich plasma do healing after rotator cuff repair in rats: an in vivo experimental not improve healing of osteochondral defects of the talus: an study,” Acta Orthopaedica et Traumatologica Turcica,vol.46,no. experimental goat study,” Osteoarthritis and Cartilage,vol.21, 4, pp. 301–307, 2012. no. 11, pp. 1746–1754, 2013. [103] J.-F. Kaux, P. V. Drion, A. Colige et al., “Effects of platelet-rich [117]W.Wu,F.Chen,Y.Liu,Q.Ma,andT.Mao,“Autologous plasma (PRP) on the healing of Achilles tendons of rats,” Wound injectable tissue-engineered cartilage by using platelet-rich Repair and Regeneration, vol. 20, no. 5, pp. 748–756, 2012. plasma: experimental study in a rabbit model,” Journal of Oral [104] J. Beck, D. Evans, P. M. Tonino, S. Yong, and J. J. Callaci, “The and Maxillofacial Surgery,vol.65,no.10,pp.1951–1957,2007. biomechanical and histologic effects of platelet-rich plasma [118]X.Xie,Y.Wang,C.Zhaoetal.,“Comparativeevaluationof on rat rotator cuff repairs,” The American Journal of Sports MSCs from bone marrow and adipose tissue seeded in PRP- Medicine,vol.40,no.9,pp.2037–2044,2012. derived scaffold for cartilage regeneration,” Biomaterials,vol.33, [105]D.N.Lyras,K.Kazakos,G.Georgiadisetal.,“Doesasingle no. 29, pp. 7008–7018, 2012. application of PRP alter the expression of IGF-I in the early [119]J.-C.Lee,H.J.Min,H.J.Park,S.Lee,S.C.Seong,andM. phaseoftendonhealing?”Journal of Foot and Ankle Surgery, C. Lee, “Synovial membrane-derived mesenchymal stem cells vol. 50, no. 3, pp. 276–282, 2011. supported by platelet-rich plasma can repair osteochondral [106] J. A. Fernandez-Sarmiento,´ J. M. Dom´ınguez, M. M. Granados defects in a rabbit model,” Arthroscopy,vol.29,no.6,pp.1034– et al., “Histological study of the influence of plasma rich in 1046, 2013. growth factors (PRGF) on the healing of divided Achilles [120]H.-R.Lee,K.M.Park,Y.K.Joung,K.D.Park,andS.H.Do, tendons in sheep,” The Journal of Bone & Joint Surgery— “Platelet-rich plasma loaded in situ-formed hydrogel enhances American Volume,vol.95,no.3,pp.246–255,2013. hyaline cartilage regeneration by CB1 upregulation,” Journal [107]D.Sato,M.Takahara,A.Naritaetal.,“Effectofplatelet-rich of Biomedical Materials Research—Part A, vol. 100, no. 11, pp. plasma with fibrin matrix on healing of intrasynovial flexor 3099–3107, 2012. tendons,” Journal of Hand Surgery,vol.37,no.7,pp.1356–1363, [121]H.-R.Lee,K.M.Park,Y.K.Joung,K.D.Park,andS.H.Do, 2012. “Platelet-rich plasma loaded hydrogel scaffold enhances chon- [108]J.T.Spang,T.Tischer,G.M.Salzmannetal.,“Plateletconcen- drogenic differentiation and maturation with up-regulation of trate vs. saline in a rat patellar tendon healing model,” Knee CB1 and CB2,” Journal of Controlled Release,vol.159,no.3,pp. Surgery, Sports Traumatology, Arthroscopy,vol.19,no.3,pp. 332–337, 2012. 495–502, 2011. [122] M. Betsch, J. Schneppendahl, S. Thuns et al., “Bone marrow [109] T. Martinello, I. Bronzini, A. Perazzi et al., “Effects of in aspiration concentrate and platelet rich plasma for osteochon- vivo applications of peripheral blood-derived mesenchymal dral repair in a porcine osteochondral defect model,” PLoS ONE, stromal cells (PB-MSCs) and platlet-rich plasma (PRP) on vol.8,no.8,ArticleIDe71602,2013. experimentally injured deep digital flexor tendons of sheep,” [123]A.Marmotti,M.Bruzzone,D.E.Bonasiaetal.,“One-step Journal of Orthopaedic Research,vol.31,no.2,pp.306–314,2013. osteochondral repair with cartilage fragments in a composite [110] C. A. Uysal, M. Tobita, H. Hyakusoku, and H. Mizuno, scaffold,” Knee Surgery, Sports Traumatology, Arthroscopy,vol. “Adipose-derived stem cells enhance primary tendon repair: 20, no. 12, pp. 2590–2601, 2012. BioMed Research International 23

[124] G. Milano, E. S. Passino, L. Deriu et al., “The effect of platelet ligament reconstruction: a prospective, randomized, double- rich plasma combined with microfractures on the treatment blind, clinical trial,” European Surgical Research,vol.45,no.2, of chondral defects: an experimental study in a sheep model,” pp. 77–85, 2010. Osteoarthritis and Cartilage, vol. 18, no. 7, pp. 971–980, 2010. [138] M. S. A. Hamid, A. Yusof, and M. R. Mohamed Ali, “Platelet- [125] O. Hapa, H. C¸akici,H.Y.Yuksel,¨ T. Firat, A. Kukner,¨ and rich plasma (PRP) for acute muscle injury: a systematic review,” H. Aygun,¨ “Does platelet-rich plasma enhance microfracture PLoS ONE,vol.9,no.2,ArticleIDe90538,2014. treatment for chronic focal chondral defects? An in-vivo study [139] I. Andia and N. Maffulli, “Platelet-rich plasma for muscle injury performed in a rat model,” Acta Orthopaedica et Traumatologica and tendinopathy,” Sports Medicine and Arthroscopy Review,vol. Turcica,vol.47,no.3,pp.201–207,2013. 21, no. 4, pp. 191–198, 2013. [126] M. M. Murray, K. P. Spindler, E. Abreu et al., “Collagen-platelet [140] J.-F. Kaux, C. Le Goff, L. Seidel et al., “Comparative study of five rich plasma hydrogel enhances primary repair of the porcine techniques of preparation of platelet-rich plasma,” Pathologie anterior cruciate ligament,” Journal of Orthopaedic Research,vol. Biologie,vol.59,no.3,pp.157–160,2011. 25,no.1,pp.81–91,2007. [141] T. N. Castillo, M. A. Pouliot, and J. L. Dragoo, “Comparison [127]M.M.Murray,K.P.Spindler,P.Ballard,T.P.Welch,D. of growth factor and platelet concentration from commercial Zurakowski, and L. B. Nanney, “Enhanced histologic repair in a platelet-rich plasma separation systems,” The American Journal central wound in the anterior cruciate ligament with a collagen- of Sports Medicine, vol. 39, no. 2, pp. 266–271, 2011. platelet-rich plasma scaffold,” Journal of Orthopaedic Research, [142] E. Anitua, M. Sanchez,´ G. Orive, and I. And´ıa, “The potential vol. 25, no. 8, pp. 1007–1017, 2007. impact of the preparation rich in growth factors (PRGF) in different medical fields,” Biomaterials,vol.28,no.31,pp.4551– [128]M.M.Murray,M.Palmer,E.Abreu,K.P.Spindler,D. 4560, 2007. Zurakowski, and B. C. Fleming, “Platelet-rich plasma alone is not sufficient to enhance suture repair of the ACL in skeletally [143] K. Werther, I. J. Christensen, and H. J. Nielsen, “Determination immature animals: an in vivo study,” Journal of Orthopaedic of vascular endothelial growth factor (VEGF) in circulating Research,vol.27,no.5,pp.639–645,2009. blood: significance of VEGF in various leucocytes and platelets,” Scandinavian Journal of Clinical and Laboratory Investigation, [129] A. N. Mastrangelo, P.Vavken, B. C. Fleming, S. L. Harrison, and vol.62,no.5,pp.343–350,2002. M. M. Murray, “Reduced platelet concentration does not harm [144] E. Anitua, I. Andia, B. Ardanza, P. Nurden, and A. T. Nurden, PRP effectiveness for ACL repair in a porcine in vivo model,” “Autologous platelets as a source of proteins for healing and Journal of Orthopaedic Research,vol.29,no.7,pp.1002–1007, tissue regeneration,” Thrombosis and Haemostasis,vol.91,no. 2011. 1, pp. 4–15, 2004. [130] W. Zhai, C. Lv, Y. Zheng, Y. Gao, Z. Ding, and Z. Chen, [145]J.-F.Kaux,L.Janssen,P.Drionetal.,“Vascularendothelial “Weak link of tendon-bone healing and a control experiment to growth factor-111 (VEGF-111) and tendon healing: preliminary promote healing,” Archives of Orthopaedic and Trauma Surgery, results in a rat model of tendon injury,” Muscles, Ligaments and vol. 133, no. 11, pp. 1533–1541, 2013. Tendons Journal,vol.4,no.1,pp.24–28,2014. [131] X. Xie, S. Zhao, H. Wu et al., “Platelet-rich plasma enhances [146] J. F. Kaux, J. L. Croisier, O. Bruyere et al., “One injection autograft revascularization and reinnervation in a dog model of platelet-rich plasma associated to a submaximal eccentric of anterior cruciate ligament reconstruction,” Journal of Surgical protocol to treat chronic jumper’s knee,” The Journal of Sports Research,vol.183,no.1,pp.214–222,2013. Medicine and Physical Fitness.Inpress. [132] B. di Matteo, G. Filardo, M. Lo Presti, E. Kon, and M. Marcacci, [147] J. R. Evanson, M. K. Guyton, D. L. Oliver et al., “Gender and age “Chronic anti-platelet therapy: a contraindication for platelet- differences in growth factor concentrations from platelet-rich rich plasma intra-articular injections?” European Review for plasma in adults,” Military Medicine,vol.179,no.7,pp.799–805, Medical & Pharmacological Sciences,vol.18,no.1,supplement, 2014. pp.55–59,2014. [148] M. Tschon, M. Fini, R. Giardino et al., “Lights and shadows [133] F. Vannini, B. Di Matteo, G. Filardo, E. Kon, M. Marcacci, and S. concerning platelet products for musculoskeletal regeneration,” Giannini, “Platelet-rich plasma for foot and ankle pathologies: Frontiers in Bioscience—Elite,vol.3,no.1,pp.96–107,2011. a systematic review,” Foot and Ankle Surgery,vol.20,no.1,pp. [149] J. M. Delong, R. P. Russell, and A. D. Mazzocca, “Platelet- 2–9, 2014. rich plasma: the PAW classification system,” The Journal of Arthroscopic and Related Surgery, vol. 28, no. 7, pp. 998–1009, [134]G.Filardo,E.Kon,A.Roffi,B.DiMatteo,M.L.Merli,and 2012. M. Marcacci, “Platelet-rich plasma: why intra-articular? A systematic review of preclinical studies and clinical evidence on [150] D. M. Dohan Ehrenfest, I. Andia, M. A. Zumstein, C.-Q. PRP for joint degeneration,” Knee Surgery, Sports Traumatology, Zhang, N. R. Pinto, and T. Bielecki, “Classification of platelet Arthroscopy,2013. concentrates (Platelet-Rich Plasma-PRP, Platelet-Rich Fibrin- PRF) for topical and infiltrative use in orthopedic and sports [135] G. Filardo, E. Kon, B. Di Matteo, P. Pelotti, A. Di Martino, and medicine: current consensus, clinical implications and perspec- M. Marcacci, “Platelet-rich plasma for the treatment of patellar tives,” Muscles, Ligaments and Tendons Journal,vol.4,no.1,pp. tendinopathy: clinical and imaging findings at medium-term 3–9, 2014. follow-up,” International Orthopaedics,vol.37,no.8,pp.1583– [151] A. P. M. H. Wroblewski, H. A. Mejia, and V. J. Wright, 1589, 2013. “Application of platelet-rich plasma to enhance tissue repair,” [136] F. A. Barber, S. A. Hrnack, S. J. Snyder, and O. Hapa, “Rotator Operative Techniques in Orthopaedics, vol. 20, no. 2, pp. 98–105, cuff repair healing influenced by platelet-rich plasma construct 2010. augmentation,” Arthroscopy,vol.27,no.8,pp.1029–1035,2011. [152] A. T. Nurden, P. Nurden, M. Sanchez, I. Andia, and E. Anitua, [137] M. Vogrin, M. Rupreht, D. Dinevski et al., “Effects of a platelet “Platelets and wound healing,” Frontiers in Bioscience,vol.13, gel on early graft revascularization after anterior cruciate no.9,pp.3532–3548,2008. 24 BioMed Research International

[153] A. T. Nurden, “Platelets, inflammation and tissue regeneration,” Medicine,OralPathology,OralRadiologyandEndodontology, Thrombosis and Haemostasis,vol.105,supplement1,pp.13–33, vol. 106, no. 3, pp. 356–362, 2008. 2011. [170] P. Torricelli, M. Fini, G. Filardo et al., “Regenerative medicine [154] R. E. Marx, “Platelet-rich plasma (PRP): what is PRP and what for the treatment of musculoskeletal overuse injuries in com- is not PRP?” Implant Dentistry,vol.10,no.4,pp.225–228,2001. petition horses,” International Orthopaedics,vol.35,no.10,pp. [155] B. C. Halpern, S. Chaudhury, and S. A. Rodeo, “The role of 1569–1576, 2011. platelet-rich plasma in inducing musculoskeletal tissue heal- [171] E. Anitua, C. Pascual, D. Antequera et al., “Plasma rich ing,” HSS Journal,vol.8,no.2,pp.137–145,2012. in growth factors (PRGF-Endoret) reduces neuropathologic [156] T. E. Foster, B. L. Puskas, B. R. Mandelbaum, M. B. Gerhardt, hallmarks and improves cognitive functions in an Alzheimer’s and S. A. Rodeo, “Platelet-rich plasma: from basic science to disease mouse model,” Neurobiology of Aging,vol.35,no.7,pp. clinical applications,” The American Journal of Sports Medicine, 1582–1595, 2014. vol. 37, no. 11, pp. 2259–2272, 2009. [172]V.L.Davis,A.B.Abukabda,N.M.Radioetal.,“Platelet-rich [157] H. El-Sharkawy, A. Kantarci, J. Deady et al., “Platelet-rich preparations to improve healing. Part I: workable options for plasma: growth factors and pro- and anti-inflammatory proper- every size practice,” JournalofOralImplantology,vol.40,no.4, ties,” Journal of Periodontology,vol.78,no.4,pp.661–669,2007. pp.500–510,2014. [158]F.L.Gimeno,S.Gatto,J.Ferro,J.O.Croxatto,andJ.E.Gallo, “Preparation of platelet-rich plasma as a tissue adhesive for experimental transplantation in rabbits,” Thrombosis Journal, vol. 4, article 18, 2006. [159] B. Han, J. Woodell-May, M. Ponticiello, Z. Yang, and M. Nimni, “The effect of thrombin activation of platelet-rich plasma on demineralized bone matrix osteoinductivity,” The Journal of Bone and Joint Surgery—American Volume,vol.91,no.6,pp. 1459–1470, 2009. [160]B.M.MitrukaandH.M.Rawnsley,Clinical Biochemical and Hematological Reference Values in Normal Experimental Animals, Masson, 1977. [161] P. A. M. Everts, J. Hoffmann, G. Weibrich et al., “Differences in platelet growth factor release and leucocyte kinetics during autologous platelet gel formation,” Transfusion Medicine,vol.16, no. 5, pp. 363–368, 2006. [162] G. Bettega and E. Schir, “Contribution of platelet concentrates to oral and maxillo-facial surgery,” Revue de Stomatologie et de Chirurgie Maxillo-Faciale, vol. 113, no. 4, pp. 205–211, 2012. [163] E. Anitua, M. Sanchez,´ and G. Orive, “The importance of understanding what is platelet-rich growth factor (PRGF) and what is not,” Journal of Shoulder and Elbow Surgery,vol.20,no. 1, pp. e23–e24, 2011. [164] V. Y. Moraes, M. Lenza, M. J. Tamaoki, F. Faloppa, and J. C. Belloti, “Platelet-rich therapies for musculoskeletal soft tissue injuries,” The Cochrane Database of Systematic Reviews,vol.12, Article ID CD010071, 2013. [165] A. Wang-Saegusa, R. Cugat, O. Ares, R. Seijas, X. Cusco,´ and M. Garcia-Balletbo,´ “Infiltration of plasma rich in growth factors for osteoarthritis of the knee short-term effects on function and quality of life,” Archives of Orthopaedic and Trauma Surgery,vol. 131, no. 3, pp. 311–317, 2011. [166] S. Sampson, M. Gerhardt, and B. Mandelbaum, “Platelet rich plasma injection grafts for musculoskeletal injuries: a review,” Ethics in Science and Environmental Politics,vol.1,no.3-4,pp. 165–174, 2008. [167]J.L.ZehnderandL.L.K.Leung,“Developmentofantibodies to thrombin and factor V with recurrent bleeding in a patient exposed to topical bovine thrombin,” Blood,vol.76,no.10,pp. 2011–2016, 1990. [168]R.S.Dhillon,E.M.Schwarz,andM.D.Maloney,“Platelet- rich plasma therapy—future or trend?” Arthritis Research and Therapy,vol.14,no.4,article219,2012. [169] A. Khojasteh, M. B. Eslaminejad, and H. Nazarian, “Mesenchy- mal stem cells enhance bone regeneration in rat calvarial critical size defects more than platelete-rich plasma,” Oral Surgery, Oral Hindawi Publishing Corporation BioMed Research International Volume 2015, Article ID 371746, 15 pages http://dx.doi.org/10.1155/2015/371746

Review Article PRP Augmentation for ACL Reconstruction

Luca Andriolo,1 Berardo Di Matteo,1 Elizaveta Kon,2 Giuseppe Filardo,1 Giulia Venieri,1 and Maurilio Marcacci1

1 II Orthopaedic and Traumatology Clinic, Biomechanics and Technology Innovation Laboratory, RizzoliOrthopaedicInstitute,ViadiBarbianoNo.1/10,40136Bologna,Italy 2Nano-Biotechnology Laboratory, Rizzoli Orthopaedic Institute, Via di Barbiano No. 1/10, 40136 Bologna, Italy

Correspondence should be addressed to Luca Andriolo; [email protected]

Received 29 May 2014; Accepted 15 August 2014

Academic Editor: Tomokazu Yoshioka

Copyright © 2015 Luca Andriolo et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Current research is investigating new methods to enhance tissue healing to speed up recovery time and decrease the risk of failure in Anterior Cruciate Ligament (ACL) reconstructive surgery. Biological augmentation is one of the most exploited strategies, in particular the application of Platelet Rich Plasma (PRP). Aim of the present paper is to systematically review all the preclinical and clinical papers dealing with the application of PRP as a biological enhancer during ACL reconstructive surgery. Thirty-two studies were included in the present review. The analysis of the preclinical evidence revealed that PRP was able to improve the healing potential of the tendinous graft both in terms of histological and biomechanical performance. Looking at the available clinical evidence, results were not univocal. PRP administration proved to be a safe procedure and there were some evidences that it could favor the donor site healing in case of ACL reconstruction with patellar tendon graft and positively contribute to graft maturation over time, whereas the majority of the papers did not show beneficial effects in terms of bony tunnels/graft area integration. Furthermore, PRP augmentation did not provide superior functional results at short term evaluation.

1. Introduction procedure: not all patients are able to regain their previous sport activity level and many factors could influence the Anterior cruciate ligament (ACL) tears are among the most clinical outcome, such as the type of graft used and the pre- common sport-related injuries and therefore ACL recon- op. knee laxity [2, 9].ThisisamajorconcernsinceACL structivesurgeryisonethemostfrequentlyperformed injured patients can be a very demanding category, especially procedures in the field of sport medicine [1]. Epidemiological professional sport players who also need to return to the data reveal that the majority of patients are young and sport- playing field as soon as possible. Current research is therefore active, with high expectations in terms of functional recovery investigating novel strategies to enhance ACL healing, to andreturntosport[2]. There is a flourishing literature reduce the failure rate and accelerate recovery time. Among concerning ACL reconstructive procedures: several different the different available options, biological augmentation is techniques have been documented over the years and, despite the most sought after approach and recently platelet rich overall good clinical outcomes reported at mid/long-term plasma (PRP), which is an autologous blood derivative, followup, ACL is still on the edge of current clinical and largely applied in orthopaedic practice especially in the preclinical research [3]. treatment of degenerative cartilage and tendon lesions, is ACL surgery (and the related research) is a classic gaining increasing interest [10–12]. PRP is a source of several example of integration between biomechanics and biology: growth factors (GFs) and other bioactive molecules that the progress made in recent decades can be attributed to the mightpromotetissuehealingandregulatejointhomeostasis big steps forward in the knowledge of both the mechanical [13, 14]. It is an easily available product obtained directly from and biological properties of ACL and its healing process [4– thevenousbloodofthepatientanditsuseisallowedalso 8]. Although almost all available techniques can provide sat- in athletes, since antidoping regulations do not consider this isfactory results, ACL reconstruction is not a “100%-success” bloodderivativeasabannedsubstance[15]. Furthermore, it is 2 BioMed Research International a versatile product since it can be prepared and used directly 3. Results in the operating theatre, through intra-articular injections or in the shape of a membrane that can be placed directly The database search identified 60 records, and the abstracts onto the target site. The healing potential of PRP has been were screened and selected according to the inclusion/ex- shown in several preclinical and clinical studies [13, 16, 17], clusion criteria. As shown in Figure 1,atotalof33full- revealing that its action is directed toward all the articular text articles were assessed for eligibility. Four articles [18– tissues, ranging from meniscus to cartilage and even soft 21] did not fulfill the criteria and were further excluded, tissues like synovium, tendons, and ligaments: the effects of and 3 articles came from the screening of the reference lists, PRP are several, including an anabolic stimulus toward cells, leading to a total of 32 studies included in the final analysis. an increase in extracellular matrix deposition, reduction of A detailed description of preclinical studies is reported in proapoptotic signals, and even an anti-inflammatory effect in Table 1, whereas clinical studies are summarized in Table 2 the joint environment [13]. and discussed in more detail in the following paragraph. Inlightofsuchpotential,thepossibilityofapplyingthis biologicalproducttoenhanceACLreconstructivesurgery 3.1. Clinical Evidence. Fifteen clinical trials were selected appears attractive: PRP not only might promote a better and according to the inclusion criteria: 11 were randomized faster ligamentization of the graft used for ACL reconstruc- controlled trials, 3 were prospective comparative studies, and tion and reduce the proinflammatory factors released imme- 1wasaretrospectivecomparativetrial(Table 2). diately after surgery, but might also contribute to a better WithregardtothegraftusedtoperformACLreconstruc- integration of the graft within the bone tunnels, thus avoiding tion, in 9 studies, authors used hamstring tendons (gracilis their enlargement and failure over time. Furthermore, PRP and semitendinosus), in 4 studies bone-patellar tendon-bone could be used to accelerate healing and reduce donor-site (BPB) graft, in 1 study allograft, and in 1 paper authors both morbidity at the harvest site of the tendon graft. hamstring tendons and BPB graft. Fourteen papers described a single-bundle reconstruction technique, whereas just in one The aim of the present paper is to review systematically trial a double-bundle procedure was used. Concerning PRP the current preclinical and clinical evidence concerning the delivery methods, in 2 papers (both dealing with BPB graft) application of PRP as a biological augmentation, to determine PRP was used to promote harvest site healing, in 1 paper PRP safety and efficacy of this biological approach to improve ACL was applied intra-articularly by a suprapatellar injection at reconstruction surgery. theveryendofthesurgicalprocedure,in1paperPRPwas used just to coat the intra-articular portion of the graft, and 2. Materials and Methods in 11 papers it was administered both on the graft and in the bony tunnels to enhance the graft-bone integration. Among Asystematicreviewoftheliteraturewasperformedonthe the delivery techniques used, in 2 studies peculiar approaches use of PRP in ACL reconstruction. The search was conducted wereapplied.WhilemostoftheauthorsappliedPRPonthe onthePubMeddatabaseonFebruary20th,2014usingthe graft surface, Sanchez´ et al. [22] placed PRP inside the graft following parameters: ((ACL) OR (ACL reconstruction) OR through multiple intratendinous depots, while Radice et al. (ACL lesion)) AND ((PRP) OR (platelet rich plasma) OR [23]usedamorecomplextechnique:beforePRPapplication (platelet gel) OR (platelet derived) OR (platelet concentrate)). a bioabsorbable spongy membrane (Gelfoam, Pfizer, New The guidelines for Preferred Reporting Items for Systematic York, NY) was carefully sutured on the harvested tendon Reviews and Meta-Analysis (PRISMA) were used. Screening andaroundthefemoralboneplugincaseoftheBPBgraft. process and analysis were conducted separately by 2 indepen- Then, PRP was administered to allow the spongy membrane dent observers (BDM and LA). to absorb the PRP and avoid its dispersion in the articular First,thearticleswerescreenedbytitleandabstract.The space. following inclusion criteria for relevant articles were used In all but one case PRP was activated before administra- during the initial screening of titles and abstracts: clinical tion. Details regarding PRP preparation methods, number and preclinical reports of any level of evidence, written in of patients included, patients’ characteristics, and follow-up English language, with no time limitation, on the use of PRP evaluations are included in Table 2. in ACL reconstruction, and reporting results on PRP effects. To make the results more understandable, they will Exclusion criteria were articles written in other languages, be discussed separately according to the specific aspects reviews, or studies analyzing other applications of PRP in analyzed in the clinical trials: knee surgery not related to ACL procedures. In the second (i) harvest site healing; step, the full texts of the selected articles were screened, (ii) tendon graft maturation and bony tunnel/graft inte- with further exclusions according to the previously described gration; criteria. Moreover, the articles not reporting clinical, MRI, or histologic results were excluded. Reference lists from (iii) clinical results. the selected papers were also screened. A flowchart of the systematic review is provided in Figure 1.Relevantdatawere 3.2. Healing of the Harvest Site. Two papers were specifically thenextractedandcollectedinauniquedatabasewith aimed at assessing the contribution of PRP in the healing of the consensus of the two observers to be analyzed for the the harvest site after ACL reconstruction with BPB graft, and purposes of the present paper. both of them reported positive outcomes with PRP. BioMed Research International 3

Records identified through PubMed searching (n=60) Identification

Abstracts screened Abstracts excluded (n=60) (n=27) Screening

Additional records identified through references (n=3)

Full-text articles excluded (n=4) Full-text articles assessed Reasons: for eligibility 1 Eligibility - No results on PRP effects (Biercevicz et al., 2013) (n=36) - No application of PRP (Kuroda et al., 2000, Slater et al., 1995, and Vavken et al., 2010) 3

Studies included in qualitative synthesis (n=32)

Included - Clinical study 15 - Preclinical study 17

Figure 1: Flowchart of the systematic review.

InthestudyledbydeAlmeidaetal.[24]twogroupsof maturation over time and (b) graft integration in the bone patients (15 and 12, resp.) were randomized to receive or not tunnels. receive PRP after BPB tendon harvesting. Total amount of 20– Among the 6 studies reporting data about graft mat- 40 mL of PRP was locally applied and then the peritendineum uration,4ofthemwereinfavourofPRPaugmentation, was sutured. Clinical and MRI evaluations were performed whereas 2 reported no intergroup difference. With respect to up to 6 months’ after operation. The authors found that bony tunnels/graft area, 9 studies focused on the integration, PRP augmentation determined a significantly smaller patellar documenting in 7 cases no advantage after PRP admin- tendon gap area with respect to the control group and also a istration. The evolution over time was investigated more lower postoperation pain reaction in the PRP group. How- specificallyin3trialsfocusedonthebonytunnelwidening: ever, at the final clinical evaluation no statistical intergroup none demonstrated that PRP was able to prevent tunnels’ difference was recorded in the questionnaires used or in the enlargement over time. isokinetic test. In the paper authored by Cervellin et al. [25], Looking in more detail at the available literature, the 40 patients were included and divided into two treatment first paper was published by Orrego et al. [53]in2008:108 groups in the same manner. At 1-year followup, the PRP patients were divided into 4 treatment groups due to the group showed statistically superior clinical outcomes when evaluatedbytheVISA-Pscoreand,althoughnotsignificant, fact that the authors also used an autologous spongy bone a better bone healing when analyzed by MRI imaging, at both graft (placed by interference fit in the femoral tunnel after patellar and tibial defect sites (85% of patients in PRP versus graft fixation) as autologous augmentation. A control group 60% in the control group). was compared to PRP, bone plug, and PRP + bone plug groups. At 6 months MRI revealed a statistically significant 3.3. Tendon Graft Maturation and Bony Tunnel/Graft Integra- advantage for the PRP group in terms of graft maturation tion. Twelve papers examined outcome regarding (a) graft (lower signal intensity at MRI) with respect to the control 4 BioMed Research International No significant difference mechanical in propertiesmaximum tensile laxity, (ACL load, and linear stiffness) of repaired ACL. The application of collagen-PRP scaffold allowseffects significant of increasing the woundpresence filling of fibronectin, andenhancing fibrinogen, the PDGF-A, TBG-b1,procollagen FGF-2, I, and vWF. The addition of collagen-PRP a compositedetermined for a higherrepair ACL yield load andcell linear density stiffness at and 3 higher months. Significant improvements in mechanical properties (load at yield, maximum load, and linear stiffness)compared of to repaired sutured ACL only at 4 weeks after surgery. PRPallowsanincreaseinexpressionofvascularendothelial growth factor, thrombospondin-1, neurotrophin-3, growth-associated protein-43, and nerve growth factor mRNA. PRP alters the expression of targetcollagen genes type1A1, (growth collagen factor-b1, type3A1, decorin, biglycan,metalloproteinase-1, matrix matrix metalloproteinase-13, and tissue inhibitor of metalloproteinase-1 during the remodelling process (evaluations performed at 2, 6,surgery). and 12 weeks after No statistical difference biomechanicalin properties (anteroposterior laxity and structural properties). Histological aspects: compared to 3x PRP,significantly 5x greater PRP cellular groupdensity had number and better organization of vessels of and cells and collagen fibres. The application of collagen-PRP scaffold allowsimprovements significant of histological scores and biomechanical properties, compared to control. Injected around the suture material Collagen scaffold augmentation Collagen-PRP composite Collagen scaffold augmentation Injected into ACL graft Injected into ACL graft Collagen scaffold augmentation Collagen scaffold augmentation (a) Animal trials 3 3 :— :— :— :— : : :— :— pts/L (5x PRP) pts/L (3x PRP) pts/mm : :— :— :— :— :— :— :— /mm pts/L 9 9 3 3 pts/L 9 : : : :— : : : :— 9 times times Platelet count Platelet count Platelet count Platelet count 669 ± 51 × 10 1279 ± 775 × 10 2.83 ± 0.53 Activation method Leukocyte count 1.95 ± 0.34 Activation method Leukocyte count Activation method Leukocyte count Activation method Leukocyte count Activation method 10% calcium chloride Leukocyte count Activation method 10% calcium chloride Leukocyte count 1161 ± 179 × 10 Activation method Leukocyte count Platelet count Platelet count Platelet count 669 ± 313 × 10 1951 ± 304 × 10 780 − 2300 × 10 Platelet count Activation method Leukocyte count Table 1: Synopsis of the preclinical studies dealing with the use of PRP in ACL reconstruction. Study protocol PRP characteristics Application method Results Collagen-PRP versus control Collagen-PRP versus control Collagen scaffold augmented with PRP 5x versus PRP 3x Collagen-PRP versus control Collagen-PRP versus control Animal model 6 pigs PRP versus control 10 dogs 36 dogs PRP versus control 27 pigs 8 minipigs 5 pigs 36 dogs PRP versus control 24 dogs ] ] ] 33 32 27 ] ] ] ] ] 29 30 31 26 28 Publication Xie et al., JSR 2013 [ Xie et al., JSR 2013 (2) [ Mastrangelo et al., JOR 2011 [ Joshi et al., AJSM 2009 [ Murray et al., JOR 2009 [ Murray et al., JOR 2007 [ Murray et al., JOR 2007 (2) [ Murray et al., JOR 2006 [ BioMed Research International 5 Significantly improvements between PRP group andgroup control concerning cross-sectional area, failure load,and stiffness, tensile stress after 3,weeks 6, this differenceor 12 weeks; notis however, confirmedare after worse 24 mechanical and than scores the intact ACL. PRP with PBMCs determined an increasingIII of procollagen type gene I expression, and collagen type proteinand expression, cell proliferation. An increasedetected of in PBMCs IL-6 exposed expression to was PRP. NoeffectofPBMCswithoutPRP. PRP group had higher concentration ofnumber, growth and factors, total cell collagen production, comparedgroup. to PPP Highest cell metabolism, lowest apoptosis rates,collagen and gene highest expression with PPP and 1x PRP. Thecomparison between immature adolescent and showed cells a significantly higher cell migrationin immature proliferation and group, whereas no differencesscaffold were contraction. seen in PRP increases cellular metabolic activityapoptotic and reduced rate and stimulation ofimmature collagen and adolescent production cells, on compared toscaffold.LowereffectsofPRPonadultcells. collagen only The addition PPP, of platelets, orand PRP enhanced reduced all metabolic apoptosis activitycell of fibroblasts. Significantly higherexpression collagen of only with PRP. Injected into ACL graft Scaffold’s augmentation (collagen scaffold) PRP clot added to culture environment Scaffold’s augmentation (collagen scaffold) Scaffold’s augmentation (collagen scaffold) Scaffold’s augmentation (collagen scaffold) Scaffold’s augmentation (collagen scaffold) with PRP, pts, or PPP (a) Continued. (b) In vitro trials :— :— :— : :— : :— : :— : (1x PRP); pts/mL cells/mL : : : :— : : 6 6 6 ; 6 cells/mL cells/L (3x PRP); pts/mL (5x PRP) pts/mL pts/L pts/mL 6 9 6 6 6 9 6 5×10 Platelet count Activation method Leukocyte count 911 × 10 129 × 10 8×10 Platelet count PPP: Platelet count PRP: Platelet count 628 × 10 Platelet count Activation method 10% thrombin solution Leukocyte count Platelet count 684 × 10 PRP: 615 × 10 370 × 10 Leukocyte count 0.03 × 10 Leukocyte count Leukocyte count 2.78 × 10 Leukocyte count PRP: — PBMC: Leukocyte count Platelet count 911 × 10 Study protocol PRP characteristics Application method Results Does increasing platelet concentration enhance ACL fibroblast proliferation and collagen production? How peripheral blood mononuclear cells (PBMCs) in PRP affect fibroblast behaviour? Age dependence of ACL fibroblast response to PRP Does cell’s age influence the ACLcellresponsetoPRP? Effects of autologous PRP on cell viability and collagen synthesis of human ACL cells. Does PRP components (pts or PPP) independently influence ACL cells behaviour? Animal model 48 sheep PRP versus control ] ] ] ] ] ] ] 34 38 40 35 37 36 39 Publication Weiler et al., AJSM 2004 [ Publications PurposeYoshida et al., JOR 2014 [ Yoshida and Murray, JOR PRP characteristics2013 [ Cheng et al., JOR 2012 [ Fallouh et al., Application methodJBJSAm 2010 [ Results Magarian et al., Knee 2011 [ Cheng et al., TissEngA 2010 [ 6 BioMed Research International Epidermal GF, basic fibroblast GF, and plateletdetermined derived aGF-BB significantly higher fibroblast’s proliferation than the untreated cells. No significant differenceothers reported GFs for the analysed. Comparison between adult, adolescent, and immatureconcerning cells cell proliferation and cellular migration:results better for immature cells. Scaffold’s augmentation (collagen scaffold) (b) Continued. : : cells/L (porcine PRP); pts/L (porcine PRP); pts/L (ovine PRP) cells/L (ovine PRP) 9 9 9 9 : Platelet count 915 × 10 Growth factor analysed are as follows epidermal GF, basic fibroblast GF, platelet derived GF-BB, acid fibroblast GF, TGF-b1, insulin-like GF-1, platelet derived GF-AA, and interleukin-1a 9.6 × 10 369 × 10 Leukocyte count 5.37 × 10 Age dependence in ACL healing Analysis of effects of single growth factors (GF) on fibroblasts harvested from medial collateral ligament and ACL of skeletally mature rabbits ] ] 41 42 PublicationsMastrangelo Purpose et al., JOR 2010 [ Scherping et al., CTR PRP characteristics1997 [ Application method Results BioMed Research International 7 10 ± 4 weeks. No ). 8±4 ), month 6 ), and month 12 )inthePRPgroup 𝑃 = 0.354 𝑃=0.003 𝑃 = 0.003 𝑃 = 0.0001 DWI and DCE-MRI measurements indicate a reduced extent of edema during the first postoperative month as well as an increased vascular density and microvessel permeability in the proximal tibial tunnel at 1 and 2.5 postoperativemonthsasthe effect of the applicationPRPG. of Results A gradual increase in the percentage of the tunnel wall consisting of tunnel wall cortical bone (TCB) during the followup was observed. At six months the mean percentageTCB of was significantly higher ( than in the control group. Despite slightly less tunnel widening in the PRP group, there were no significant differences at any of thesites measurement of between immediately after surgery and three months postoperatively. ( (but NS More patients in the PRP group than controls attained higher stages of remodelling at month 4( Decreased effusions at days were noted in the PRP group, but this difference disappeared by differences patient-reported in outcomes were noted in thepatients 58 with two-year outcome data. The use of PRP todoes be not seem effective preventing in tunnel enlargement. Physical examination as well as the evaluation scales used showed no differences between the two groups. 6m F-Up 6m 3m 12 m 24 m 14.7 m Applied after autograft positioning, into the femoral and tibial tunnels (1 mL in eachthem), of as well as onto the graft itself (3 mL) without arthroscopic fluid Application method After autograft positioning into the femoral and tibial tunnels (1 mL in eachthem), of and onto the graft itself (3 mL) without arthroscopic fluid. Graft immersed in the PRP solution for five minutes before implantation; 2 mL of PRP injected into the femoral tunnel and 1.5 mL into the tibial tunnel at the end of the surgery. 8mLofPRP percutaneously injected into the suprapatellar joint after portal suture. After graft positioning intra-articular portion of the graft was coatedwith PRP. (i) 5 mL of PRP between the peripheral part of the graft and the femoral tunnel wall; (ii) 5 mL of PRP insemisolid its pattern above the graft; (iii) 5 mL of liquid and semisolid PRP on the tibial side. Double-looped semitendinosus and gracilis tendon autograft. Fixation: 2 bioabsorbable cross-pins in the femoral tunnel and one bioabsorbable interference screw in the tibial tunnel. ACL reconstruction technique Double-looped semitendinosus and gracilis tendon autograft. Fixation: 2 bioabsorbable cross-pins in the femoral tunnel and one bioabsorbable interference screw in the tibial tunnel. Single-bundle quadrupled autograft of hamstrings. Fixation: a cross-pin in the femoral tunnel and a bioabsorbable interference screw in the tibial tunnel Autologous patellar tendon grafts with bone plugs of 9 mm. Fixation: hydroxylapatite screws in the femur and tibia. Allograft tibial tendon. Fixation: an absorbable cross-pin in the femoral tunnel and an absorbable interference screw in the tibial tunnel ACLreconstructionwith hamstrings (Out-In technique). Fixation: Swing-Bridge device on the femoral side and Evolgate screw on the tibial side. /L 9 :— : :— :PRGF :GPS :PRP :— :— :none : :calcium :calcium 190 × 10 :— :— : :— :— :— :— :— :few :N? :Y? :Y? Activation method Leukocyte Preparation method Platelet count Activation method Leukocyte Preparation method Double syringe system (Arthrex) Platelet count Activation method Leukocyte Preparation method Platelet count chloride Leukocyte chloride Leukocyte Preparation method technique (BTI Systems Vitoria, Spain) Platelet count Activation method Preparation method II Platelet Concentrate Separation Kit (Biomet, Inc., Warsaw, IN, USA) Platelet count Activation method Preparation method Fast Biotech kit (MyCells PPT-Platelet Preparation Tube). Platelet count Activation method addition of thrombin and 10% Ca-gluconate Leukocyte : 37.2 versus 32.6 :— : 26.4 versus 26.9 : 35.1 versus 35.3 : 37.2 versus 32.6 :34.5 : 13 M—8 F versus 15 :— : 20 M—3 F versus 22 :— : 13 M—8 F versus 15 :40M 41 (21 versus 20) Age Sex M—5 F 98 (49 versus 49) Age Sex 46 (23 versus 23) Age Sex M—1 F 58 (29 versus 29) Age Sex 41 (21 versus 20) Age Sex M—5 F 40 (20 versus 20) Age Sex after that clinical prevention tunnel wall Table 2: Synopsis of the clinical studies dealing with the use of PRP in ACL reconstruction. edema and vascularity MRI quantitative evaluation of cortical bone (TCB) formation Evaluate if PRPG hasinfluence an on the extent of the inthetibialtunnel can be assessed by DWI and DCE-MRI CT evaluation of the efficacyplatelet-rich of plasma (PRP) in reducing femoral and tibial tunnel enlargement and clinical score MRI evaluation of remodelling stages of the graft Clinical, CT, and arthrometric evaluation of PRP role in of tunnel widening ACL reconstruction Evaluation of the effect of intraoperative PRP on patient-reported outcomes Randomized trial (PRP versus control) Randomized trial (PRP versus control) Randomized trial (PRP versus control) Randomized trial (PRP versus control) Randomized trial (PRP versus control) Retrospective comparative study (PRP versus control) ] ] ] ] ] ] 43 44 45 46 47 48 ` aetal.,KSSTA PublicationRuprehtetal., Study protocolRadioOncol 2013 [ PurposeSeijas et al., JOR 2013 [ Patients characteristic PRP characteristics Mirzatolooei et al., BJJ 2013 [ Magnussen et al., Knee 2013 [ Ruprehtetal.,JMRI 2013 [ Vadal 2013 [ 8 BioMed Research International ). ; ). 2 )than mm 5.1 ± 1.4 )thanin 0.16 ± 0.09 3.8 ± 1.0 9.4 ± 4.4 )thaninthe 2 )inthePRPgroup 0.33 ± 0.09 mm ). In the 𝑃 = 0.046 4.9 ± 5.3 Visual analog scale score for pain was lower in the PRP group immediately postoperatively ( in the control group ( There were no differences after 6 months in questionnaire and isokinetic testing results comparing both groups. control group ( Patellar tendon gap area was significantly smaller ( ( After 4–6 weeks, the PRP-treated group demonstrated a significantly higher level of vascularization in the osteoligamentous interface ( the control group ( 𝑃 < 0.001 intra-articular part of the graft,we found no evidence of revascularization in either group. No statistically significant benefit inthe PRP group in terms of integration assessment and graft maturation (ligamentization). Results VISA scores were significantly higher in the patients treated with PRP, whereas no significant difference in postoperative VAS scores between the two groups was observed. In 85% of PRPpatients, group the tibial and patellar bone defect was satisfactorily filled by new bony tissue, whereas this percentage was just of 60% in control group patients, but this difference was not statistically significant. 6m 4–6 weeks 6m F-Up 12 m Thepatellar tendon defect was completely filled with 20 to 40 mLPRP of gel and the peritendon was closed with absorbable 3–0 sutures. PRP was applied into the femoral and tibial tunnels as well as onto the graft itself. PRP was applied under arthroscopy in both the tibial (3 mL) and femoral (3 mL) tunnels with a long needle syringe and directly applied in the intra-articular graft portion (4 mL) Application method PRP was applied to both the patellar and tendon-bone plug harvestsiteand stabilized by peritendon suture Autologous bone-patellar tendon-bone graft. Fixation: absorbable transverse double pin system in the femur and an absorbable interference screw in the tibia. Double-looped semitendinosus and gracilis tendon graft. Fixation: 2 bioabsorbable cross-pins in the femoral tunnel and 1 bioabsorbable interference screw in the tibial tunnel. ACLreconstructionwith hamstring tendons (ST-G). Fixation: a cross-pin in the femoral tunnel and a bioabsorbable interference screw in the tibial tunnel. ACL reconstruction technique Autologous bone-patellar tendon-bone graft. Fixation: — ± : : : :the 3 : : : : L 𝜇 / 3 : :— : :— ± 3 3 :present(?) :0.91/mm :Y :Y? 3 Activation method autologous human thrombin Leukocyte 0.81/mm Activation method thrombin and 0.8 mL of calcium chloride Leukocyte 404,472/mm Preparation method Haemonetics MCS1 9000 cell separator with a specific kit for platelet apheresis 995-E (Haemonetics Corp, Braintree, Massachusetts) Platelet count 1,185,166/mm Preparation method Magellan system (Medtronic, Minneapolis, MN) Platelet count Activation method autologous human thrombin Leukocyte Preparation method Magellan (Medtronic Biologic Therapeutics and Diagnostics, Minneapolis, MN, USA) Platelet count 160 − 350 × 10 Preparation method Gravitational Platelet Separation II (GPS) system (Biomet Biologics, Inc., Warsaw, IN, USA) Platelet count Activation method thrombin and calcium chloride Leukocyte Table 2: Continued. :25.8versus23.1 : 22.9 versus 22.7 :26.8versus23.6 : 37.2 versus 32.6 : 10 M—2 F versus 14 :40M : 18 M—12 F versus 15 : 13 M—8 F versus 15 27 (12 versus 15) Age Sex M—1 F 40 (20 versus 20) Age Sex 50 (30 versus 20) Age Sex M—5 F 41 (21 versus 20) Age Sex M—5 F healing healing of of MRI evaluation of of patellar tendon harvest site MRI and clinical evaluation of patellar tendon harvest site MRI evaluation of integration and maturation semitendinosus-gracilis (STG) grafts anterior in cruciate ligament (ACL) MRI evaluation of the revascularization process in the osteoligamentous interface zone in the bone tunnels and in the intra-articular part of the graft after ACL reconstruction Randomized trial (PRP versus control) Randomized trial (PRP versus control) Comparative study (PRP versus control) Randomized trial (PRP versus control) ] 49 ] ] ] 50 24 25 Publication Study protocolde Almeida et al., AJSM 2012 [ Purpose Patients characteristic PRP characteristics Cervellin et al., KSSTA 2012 [ Vogrin et al., ESR 2010 [ Figueroa et al., Arthroscopy 2010 [ BioMed Research International 9 ). ). 𝑃 = 0.051 𝑃 = 0.024 The results didnot show any statistically significant differences between the groups for inflammatory parameters, magnetic resonance imaging appearance of the graft, and clinical evaluation scores. Thegraft integration not is complete at 3 months after surgery in the PL andfemoral AM tunnel, using Endobutton CL for fixation, and the use of PRP isolated orthrombin with seems not to accelerate tendon integration Results Overall, arthroscopic evaluations were not statistically differentbetweenPRGFand control groups ( PRGF treatment influencedthe histologic characteristics of the tendon graft, resulting tissue in thatwasmorematurethanin controls ( Histologically evident newly formed connective tissue enveloping the graft was present in 77.3% of PRGF-treated grafts and 40% of controls. ACLreconstructionwiththe useofPRPGachievescomplete homogeneous grafts assessed by MRI, in 179 days compared with 369 days for ACL reconstruction without PRPG. This represents a time shortening of 48% with respect toACLreconstructionwithout PRPG. 18 m 3m F-Up 15 m 9versus12m Ligament covered with PRP and sutured over itself with PRP in its interior.Therestofthe gel was introduced after implantation of the graft inside the tibial tunnel. PRP was placed between the strands of the graft in each femoral tunnel. Application method Six mL PRP was injected within the tendon graft fascicles with several punctures performed along the graft length, graft soaked PRP in until implantation and the remaining aliquots were applied at the portals during suturing. PRP administered with thehelpofasuturedand compressed Gelfoam; 5mLPRPwasadded homogeneously so as to completely cover the graft. ACLreconstructionwith patellar tendon allograft. Fixation: 2 biodegradable cross-pins in the femoral bone and a tibial biodegradable interference screw. Double-bundle arthroscopic ACLreconstructionwith autologous hamstring tendons. Fixation: 2 Endobutton for the AM and PL bundlethe in femur, 2 bioabsorbable interference screw in the tibia. ACLreconstructionwith hamstring tendons. Fixation: transcondylar screw proximally and PRGF-treated bone plug and 2metalstaplesdistally. BPTB autograft (15versus 10) or hamstring (10 versus 15). Fixation: in BPTB autograft metallic interference screws; in hamstring autograft metallic or bioabsorbable cross-pin in the distal femur; and a bioabsorbable screw with a metallic staple in the proximal tibia. ACL reconstruction technique :Mini :BTI :GPS : :10% :calcium :calcium :calcium 3 :— :2-to3-fold :— : :present(?) :Y? :scarce :Y? /mm 3 Table 2: Continued. Activation method calcium chloride Leukocyte chloride Leukocyte Preparation method GPS III Kit (Biomet) Platelet count Activation method chloride Leukocyte leukocytes chloride Leukocyte Preparation method System II (BTI Biotechnology Institute, Vitoria, Spain) Platelet count the platelet count of peripheral blood Activation method Preparation method system of Biomet (Warsaw, IN) Platelet count Activation method Preparation method 40 mL of citrated blood was centrifuged for 8 minutes at 3,000 rpm (2,217 g) by use of astandardcentrifuge Platelet count 837 × 10 :26.8 :28 :30versus32 : 26.1 versus 26.6 : 38 M—2 F : 26 M—11 F : 18 M—7 F versus 21 : 40 M—10 F versus 40 (10 versus 10 versus 10 versus 10) Age Sex 37 (22 versus 15) Age Sex 50 (25 versus 25) Age Sex M—4 F 100 (50 versus 50) Age Sex 38 M—12 F of tendon parameters )after accelerates cell proliferation FT ( clinical and hamstring double-bundle ACL reconstruction. Macroscopic and histologic evaluation of ligamentization grafts MRI evaluation of PRPG effect on and collagen production in the human tendon and plays a key role inremodeling the and repair processes of the graft used in ACL reconstruction. To assess withresonance (MR) imaging magneticif the PRP tendon-to-bone integration in the femoral tunnel To evaluatethe and compareinflammatory with the addition of platelet-derived growth factor (PDGF) in primary anterior cruciate ligament (ACL) reconstruction with bone-patellar tendon-bone allograft. Comparative study (PRP versus control) Comparative study (PRP versus control) Randomized trial (4 groups: group A control; group B PRP in FT; group C with PRP in FT and intra-articular at 2 and4weeks;groupD with PRP activated with thrombin in FT) Randomized trial (PRP versus control) ] 51 ] ] ] ıNin 52 ´ 23 22 ´ anchez et al., Arthroscopy 2010[ et al., 2009 Arthroscopy [ Publication Study protocolS Purpose Patients characteristic PRP characteristics Radice et al., Arthroscopy 2010 [ Valent Silva and Sampaio, KSSTA 2009 [ 10 BioMed Research International Results TheuseofPChadanenhancing effect on the graft maturation process evaluated only by MRIsignal intensity, without showing any significanteffect in the osteoligamentous interface or tunnel widening evolution. The use of preventeda BP effectively tunnel widening. The BP and PC combination didshow not a synergic effect as compared to PC or BP individually. F-Up 6m Application method Five mL PRP was added between the strands of the quadruple STG graft before passing into the tunnel. After fixation, 1mLofPRPwasinjected into the femoral tunnel between the strands of the graft. ACL reconstruction technique ACLreconstructionwith quadruple STG. Fixation: a biodegradable transfixing pin proximally and a biodegradable interference screw distally; theboneplugwasplacedby interference fit at the level of the femoral tunnel. : :calcium :— :Y? Preparation method Biomet GPS II kit (Biomet, Warsaw, IN) Platelet count Activation method chloride Leukocyte Table 2: Continued. 8 − :30 : 99 M—17 F ( 108 (27 versus 26 versus 28 versus 27) Age Sex dropout) maturation of the graft, Determineiftheuseof platelet concentrate (PC) andboneplug(BP)does accelerate the healing process in anterior cruciate ligament (ACL) reconstruction, in terms of osteoligamentous interface, and widening of the femoral tunnel. Randomized trial (lesser quality, 4 groups: control, PC, BP, and PC +BP) ] 53 Publication Study protocolOrrego et al., Arthroscopy 2008 [ Purpose Patients characteristic PRP characteristics BioMed Research International 11 group. However, no differences were observed regarding the no significant intergroup difference was found either inthe evaluation of osteoligamentous interface between the tunnels first parameter or in the second. Another study by Vogrin and the graft and, with regard to tunnel widening, the best et al. [49] investigated the vascularization at the interface resultswereachievedinthebonepluggroupwhichshowed betweenbonetunnelsandgraft,andalongtheintra-articular the lowest rate of widening, without further advantage from portion of the graft: a superior vascularization was found PRP administration. A positive influence of PRP local admin- in the PRP group only at 4–6 weeks with MRI but not at istration in graft maturation was also shown by other authors. 10–12 weeks, and no difference was observed with respect The study authored by Radice et al. [23], who performed to the control group in the vascularization of the intra- ACL reconstruction through both hamstring and PBP grafts, articular part of the graft. Another randomized study by Nin found a better maturation of the intra-articular portion of et al. [51] on 100 patients revealed that PRP augmentation the graft in the PRP group. In particular, serial postoperation did not provide superior results in terms of clinical scores, MRI assessments revealed that the mean time to achieve biomechanical tests, and MRI parameters of graft maturation a homogenous “ligamentous-like” signal of the graft was at 12 months evaluation. Furthermore, the authors found no 179 days in PRP group versus 362 days in control group. Subgroup analysis proved that the best responding category difference either in postoperation swelling or in C-reactive was the one where BPB graft reconstruction was performed. protein levels (inflammatory index) at 10 days after operation Similarly, Sanchez´ et al. [22] performed macroscopic and Finally, with regard to the evolution of the bony tendon/graft histologic evaluations in 37 ACL patients (22 PRP and 15 area, beside the previously mentioned study by Orrego et control) who underwent second-look arthroscopies for other el. [53], more recently Vadalaetal.in2013[` 48]analyzed reasons. The authors found that, in patients who received PRP the role of PRP in preventing bone tunnel enlargement augmentation, there was a superior arthroscopic appearance after ACL reconstruction: CT evaluation in 40 patients at a of the graft (although not significant; 𝑃 = 0.051)andeven mean of 14.7 months’ followup did not reveal any beneficial biopsies revealed a superior tissue quality for PRP,with newly effect of PRP and furthermore the clinical scores were not formed synovial-like tissue enveloping the graft in 77% of positively affected by this biological augmentation. In a casesversus40%ofthecontrolgroup.Seijasetal.[44] similar randomized study on 46 patients led by Mirzatolooei were the only authors that administered PRP by an intra- et al. [45] the same findings were reported regarding bone articular injection immediately after closing the arthroscopic tunnel widening, without any advantage using PRP. portals, thus avoiding its selective delivery onto the graft or into the bony tunnels: the authors found that, despite 3.4. Clinical Results. Seven studies reported clinical out- this unselective administration, there was significant superior comes after ACL reconstructive surgery with or without graft maturation in PRP group at MRI evaluation both at3 PRP augmentation, focusing on the short-term outcome, and 6 months. Finally, with regard to positive PRP effects, with followup reported from 6 months to 2 years. None Rupreht et al. were the only ones documenting benefit in of them showed any statistical inter-group difference. Only the bony tunnel/graft area. In a randomized study [47]they Magnussen et al. in a comparative retrospective trial [46] showed that PRP administration reduced edema around observed a lower swelling reaction in the PRP group at a mean thetibialtunnelduringthefirstpostoperationmonthand of 10 days after operation, but the difference was no longer also increased vascular density and microvessel permeability significant after 8 weeks. intheproximaltibialtunnelat1and2.5months’MRI evaluation, thus suggesting that PRP is most effective in the 4. Discussion early phases of healing. In another paper [43], the same authors reported that PRP increased cortical bone formation The reduction of recovery time and prevention of reinjury around the tibial tunnel wall at 6 months followup, thus afterACLreconstructionarethemaingoalsofsportmedicine suggesting that PRP might effectively contribute to graft-bone surgeons. In recent years a number of studies have been integration. published aimed at clarifying the best surgical techniques and Among the studies documenting no beneficial effects considering the different types of grafts, the fixation devices, of PRP administration, the first one was authored by Silva and other biomechanical and technical variables. Biological et al. [52] who evaluated the effect of PRP augmentation augmentation through PRP administration is one of the in promoting graft integration within the femoral tunnels. latest topics for researchers, with the aim of enhancing ACL Forty patients were randomly divided into 4 groups: 10 were reconstruction via the help of powerful biological agents. In controls, 10 received PRP on the graft and in the femoral vitro studies and also animal trials have highlighted overall tunnels, 10 received the same treatment with thrombin- encouraging results (Table 1), thus confirming the expecta- activated PRP, and 10 received further PRP intra-articular tions about the potential of platelet-derived GFs in stimulat- injections at 2 and 4 weeks after surgery. MRI controls ing tissue healing: the use of PRP increased the expression of 3 months after operation showed no statistical intergroup procollagen gene and collagen protein and also contributed to difference regarding maturation of fibrous interzone and, reduce apoptosis and stimulate fibroblast metabolic activity therefore, in osteoligamentous integration. Similar results at 6 [35–42].IntheanimalmodelitwasalsoobservedthatPRP months’ evaluation were reported by Figueroa et al. [50]who was able to determine superior biomechanical properties treated50patientsandanalyzedMRIwiththepurposeof such as a higher tensile load and linear stiffness of the assessing graft maturation and osteoligamentous integration: graft26 [ –34]. In light of these findings, the application 12 BioMed Research International of PRP augmentation in clinical practice appeared justi- able to perform arthroscopic and histological evaluations in fied. However, this systematic review underlines that results a selected group of patients who underwent second-look are more controversial when looking at clinical published arthroscopies [22]. The biopsies from PRP-augmented grafts data. confirmed the superior tissue quality that was hypothesized at According to the clinical trials currently available, it is imaging. Two studies did not show a significantly better graft possible to highlight some important findings. The first one maturation following PRP augmentation [50, 51]: however, in regards the safety of this approach. The intraoperative use of both these studies PRP determined superior MRI results and PRP proved to be safe: in none of the clinical trials considered the lack of statistical significance might be attributed to the adverse events related specifically to its use could be identi- lowsamplesizeincludedinthesetrials[54].Basedonthis fied, and no infections or other complications were reported evidence, it is possible to assume that PRP might positively after PRP administration. PRP actually proved to even reduce influence graft maturation. the surgical morbidity in two papers [24, 25] specifically Finally, another important aspect regarding the clinical investigating its role in promoting graft harvest site healing. benefit that could be related to the observed tissue changes In both cases a BPB graft was used for ACL reconstruction in terms of graft integration and maturation. The literature and PRP contributed to better healing response evaluated analysis on the clinical outcome of ACL reconstruction radiographically and, in one case [25], this difference was did not show any superior results with PRP augmentation. also reflected in the clinical score (VISA-P). These findings However, the majority of the published clinical studies did underline that PRP is beneficial in the tendon healing process not consider clinical results as the primary outcome of the andconfirmtheresultsobtainedinotherstudiesdealingwith biological augmentation. Clinical evaluations were carried PRP treatment of patellar tendon disease [10].Basedonthese out in only a few studies and were limited to short-term results, PRP could be considered as a valid option to address followup, which prevents an accurate analysis of difference the problem of donor-site morbidity when the patellar tendon in failure rate and revision surgeries between the treatment is the surgeon’s choice for graft harvesting. groups, and further studies at longer followup should focus More controversial are the results in terms of biologi- the real overall clinical benefit of PRP. calefficacyonthereconstructedACL.Theapplicationof The present literature analysis is affected by some limi- PRP has been hypothesized to improve graft integration tations.Firstofalleachtrialinvolvesadifferenttechnique within the tunnels. Concerning the osteoligamentous inte- for ACL reconstruction: different types of graft were used, gration, Rupreht et al. showed increased vascular density different tunneling, and also different fixation devices, so and microvessel permeability in the proximal tibial tunnel comparison of results is difficult and, at least hypothetically, at 1 and 2.5 months’ MRI evaluation, as well as reduced it should be considered that some techniques might have a bone edema around the tunnel and increased cortical bone better response to biological stimulation than others. Fur- formation around the tibial tunnel wall at 6 months followup thermore, PRP has been administered in different ways: some [43, 47]. Vogrin et al. [49]alsoshowedasignificantlyhigher authors applied it by a simple intra-articular injection after neovascularization 4–6 weeks after PRP administration, but theprocedure,othersusedittocoverthegraftbeforeorafter the advantage of PRP was not confirmed at further fol- its intra-articular fixation, and others injected it into the graft, lowup, thus suggesting that PRP is most effective in the andPRPcouldbeevencombinedwithsubstratestoincrease earlyphasesofhealing.Otherstudiesdidnotshowany ACL augmentation. Moreover, besides the intra-articular difference in osteoligamentous integration50 [ , 52], and the area of the graft, some authors also applied PRP inside the three studies, all randomized trials [45, 48, 53]focusedon bone tunnels: some in both the tibial and femoral one and the evolution of bony tunnel/graft area, found that biolog- some only in the femoral one. Therefore, different applica- ical augmentation did not contribute to preventing tunnel tive methods on different specific targets might determine enlargement with respect to the control group. Therefore, different outcomes. Finally, another confounding factor is this particular aspect still remains controversial and further directlylinkedtoPRPitself,thatis,awell-knownanddebated studies should better clarify if the role of PRP in bone- topic, that is, the dramatic variability among different PRP graft integration is limited in favouring just the first healing formulations [55]. Currently there are several different PRPs phases. in clinical use, differing in terms of preparation methods, Also with respect to the graft maturation process, the activation, and cell content. These features affect the final literature is not univocal, but in this case PRP seems to have concentration of GFs and other bioactive molecules delivered amorepositiveinfluence.ThestudiesledbyOrregoetal., in situ and might influence the overall regenerative potential Radice et al., and Seijas et. al proved that PRP augmentation of PRP.In light of these aspects, it is even harder to summarize is able to determine a faster and better graft maturation results of clinical trials: each author uses his own formulation with respect to the control groups [23, 44, 53]. In these and so it is impossible, at present, to establish the best trials MRI evaluations revealed that at 4 to 12 months PRP for improving ACL reconstruction, as well as the real after surgery the signal of the graft in the PRP group was potentialofthisbiologicalapproachforACLaugmentation. significantly more homogenous and comparable to that of the Considering the great interproduct variability and the various intact posterior cruciate ligament. Radice et al. [23]reported applicative strategies, further high quality studies are needed that PRP augmentation contributed to reducing the time to determine the best formulation, administration modalities, needed to have a homogenous, low-intensity graft signal and the best responding targets of PRP augmentation in ACL by almost 50%. Besides MRI findings, Sanchez´ et al. were reconstructive surgery. BioMed Research International 13

5. Conclusion [10] B. Di Matteo, G. Filardo, E. Kon, and M. Marcacci, “Platelet- rich plasma: evidence for the treatment of patellar and Achilles ThissystematicreviewunderlinesthatclinicalresultsonPRP tendinopathy—a systematic review,” MUSCULOSKELETAL use for ACL augmentation are controversial. The intraopera- SURGERY,vol.99,no.1,pp.1–9,2015. tiveuseofPRPprovedtobesafe,andPRPactuallyshowedto [11] E. Kon, G. Filardo, B. Di Matteo, and M. Marcacci, “PRP for even reduce the surgical morbidity promoting graft harvest the treatment of cartilage pathology,” The Open Orthopaedics site healing. Based on current evidence, PRP seems to play Journal,vol.7,pp.120–128,2013. a positive role in the healing mechanisms after ACL surgery [12] T. Yuan, C. Q. Zhang, and J. H. Wang, “Augmenting tendon for what regards graft maturation, whereas the majority of and ligament repair with platelet-rich plasma (PRP),” Muscle, the studies showed no benefit in terms of graft integration, Ligaments and Tendons Journal,vol.3,no.3,pp.139–149,2013. especially in preventing bone tunnel widening. Finally, PRP [13]G.Filardo,E.Kon,A.Roffi,B.DiMatteo,M.L.Merli,and did not provide a superior clinical outcome at short-term M. Marcacci, “Platelet-rich plasma: why intra-articular? A followup, whereas data at longer followup are lacking to systematic review of preclinical studies and clinical evidence on address the overall clinical benefit of PRP augmentation. PRP for joint degeneration,” Knee Surgery, Sports Traumatology, Arthroscopy,2013. [14]N.A.Smyth,C.D.Murawski,L.A.Fortier,B.J.Cole,andJ.G. Conflict of Interests Kennedy, “Platelet-rich plasma in the pathologic processes of cartilage: review of basic science evidence,” Arthroscopy,vol.29, This work was partially supported by Italian Ministry of no. 8, pp. 1399–1409, 2013. Health (Project “Ricerca Finalizzata”-2009-1498841). [15] L. Engebretsen, K. Steffen, J. Alsousou et al., “IOC consensus paper on the use of platelet-rich plasma in sports medicine,” References British Journal of Sports Medicine,vol.44,no.15,pp.1072–1081, 2010. [1] A. M. Buoncristiani, F. P. Tjoumakaris, J. S. Starman, M. Fer- [16] N. Baksh, C. P. Hannon, C. D. Murawski, N. A. Smyth, and J. G. retti, and F. H. Fu, “Anatomic double-bundle anterior cruciate Kennedy, “Platelet-rich plasma in tendon models: a systematic ligament reconstruction,” Arthroscopy,vol.22,no.9,pp.1000– review of basic science literature,” Arthroscopy,vol.29,no.3,pp. 1006, 2006. 596–607, 2013. [2] K. B. Freedman, M. J. D’Amato, D. D. Nedeff, A. Kaz, and B. R. [17]S.G.Boswell,B.J.Cole,E.A.Sundman,V.Karas,andL. Bach Jr., “Arthroscopic anterior cruciate ligament reconstruc- A. Fortier, “Platelet-rich plasma: a milieu of bioactive factors,” tion: a metaanalysis comparing patellar tendon and hamstring Arthroscopy,vol.28,no.3,pp.429–439,2012. tendon autografts,” The American Journal of Sports Medicine, [18] A. M. Biercevicz, D. L. Miranda, J. T. MacHan, M. M. Murray, vol. 31, no. 1, pp. 2–11, 2003. * and B. C. Fleming, “In situ, noninvasive, T2 -weighted mri- [3] H. S. Kim, J. K. Seon, and A. R. Jo, “Current trends in anterior derived parameters predict Ex vivo structural properties of cruciate ligament reconstruction,” Knee Surgery & Related an anterior cruciate ligament reconstruction or bioenhanced Research, vol. 25, no. 4, pp. 165–173, 2013. primary repair in a porcine model,” The American Journal of [4] S. Abe, M. Kurosaka, T. Iguchi, S. Yoshiya, and K. Hirohata, Sports Medicine,vol.41,no.3,pp.560–566,2013. “Light and electron microscopic study of remodeling and [19] R. Kuroda, M. Kurosaka, S. Yoshiya, and K. Mizuno, “Local- maturation process in autogenous graft for anterior cruciate ization of growth factors in the reconstructed anterior cruciate ligament reconstruction,” Arthroscopy,vol.9,no.4,pp.394–405, ligament: immunohistological study in dogs,” Knee Surgery, 1993. Sports Traumatology, Arthroscopy,vol.8,no.2,pp.120–126, [5]S.Cho,T.Muneta,S.Ito,K.Yagishita,andS.Ichinose, 2000. “Electron microscopic evaluation of two-bundle anatomically [20]M.Slater,J.Patava,K.Kingham,andR.S.Mason,“Involve- reconstructed anterior cruciate ligament graft,” Journal of ment of platelets in stimulating osteogenic activity,” Journal of Orthopaedic Science,vol.9,no.3,pp.296–301,2004. Orthopaedic Research, vol. 13, no. 5, pp. 655–663, 1995. [6] R. P. Falconiero, V. J. DiStefano, and T. M. Cook, “Revascu- [21] P. Vavken, F. A. Saad, and M. M. Murray, “Age dependence larization and ligamentization of autogenous anterior cruciate of expression of growth factor receptors in porcine ACL ligament grafts in humans,” Arthroscopy,vol.14,no.2,pp.197– fibroblasts,” Journal of Orthopaedic Research,vol.28,no.8,pp. 205, 1998. 1107–1112, 2010. [7]S.M.Howell,K.E.Knox,T.E.Farley,andM.A.Taylor, [22] M. Sanchez,´ E. Anitua, J. Azofra, R. Prado, F. Muruzabal, and “Revascularization of a human anterior cruciate ligament graft I. Andia, “Ligamentization of tendon grafts treated with an during the first two years of implantation,” The American endogenous preparation rich in growth factors: gross morphol- Journal of Sports Medicine,vol.23,no.1,pp.42–49,1995. ogy and histology,” Arthroscopy,vol.26,no.4,pp.470–480, [8]L.L.Johnson,“Theoutcomeofafreeautogenoussemitendi- 2010. nosus tendon graft in human anterior cruciate reconstructive [23] F. Radice, R. Yanez,´ V. Gutierrez,´ J. Rosales, M. Pinedo, and S. surgery: a histological study,” Arthroscopy,vol.9,no.2,pp.131– Coda, “Comparison of magnetic resonance imaging findings in 142, 1993. anterior cruciate ligament grafts with and without autologous [9] C. Signorelli, T. Bonanzinga, N. Lopomo et al., “Do pre- platelet-derived growth factors,” Arthroscopy,vol.26,no.1,pp. operative knee laxity values influence post-operative ones 50–57, 2010. after anterior cruciate ligament reconstruction?” Scandinavian [24] A. M. de Almeida, M. K. Demange, M. F. Sobrado, M. B. Journal of Medicine and Science in Sports,vol.23,no.4,pp.e219– Rodrigues, A. Pedrinelli, and A. J. Hernandez, “Patellar tendon e224, 2013. healing with platelet-rich plasma: a prospective randomized 14 BioMed Research International

controlled trial,” The American Journal of Sports Medicine,vol. [38] L. Fallouh, K. Nakagawa, T. Sasho et al., “Effects of autologous 40, no. 6, pp. 1282–1288, 2012. platelet-rich plasma on cell viability and collagen synthesis in [25] M. Cervellin, L. de Girolamo, C. Bait, M. Denti, and P. injured human anterior cruciate ligament,” Journal of Bone and Volpi, “Autologous platelet-rich plasma gel to reduce donor- Joint Surgery,vol.92,no.18,pp.2909–2916,2010. site morbidity after patellar tendon graft harvesting for anterior [39] E. M. Magarian, P.Vavken, and M. M. Murray, “Human anterior cruciate ligament reconstruction: a randomized, controlled cruciate ligament fibroblasts from immature patients have a clinical study,” Knee Surgery, Sports Traumatology, Arthroscopy, stronger in vitro response to platelet concentrates than those vol.20,no.1,pp.114–120,2012. from mature individuals,” Knee, vol. 18, no. 4, pp. 247–251, 2011. [26] X. Xie, S. Zhao, H. Wu et al., “Platelet-rich plasma enhances [40]M.Cheng,H.Wang,R.Yoshida,andM.M.Murray,“Platelets autograft revascularization and reinnervation in a dog model and plasma proteins are both required to stimulate collagen of anterior cruciate ligament reconstruction,” Journal of Surgical gene expression by anterior cruciate ligament cells in three- Research,vol.183,no.1,pp.214–222,2013. dimensional culture,” Tissue Engineering A,vol.16,no.5,pp. [27] X. Xie, H. Wu, S. Zhao, G. Xie, X. Huangfu, and J. Zhao, “The 1479–1489, 2010. effect of platelet-rich plasma on patterns of gene expression [41] A. N. Mastrangelo, E. M. Magarian, M. P. Palmer, P. Vavken, in a dog model of anterior cruciate ligament reconstruction,” and M. M. Murray, “The effect of skeletal maturity on the regen- Journal of Surgical Research, vol. 180, no. 1, pp. 80–88, 2013. erative function of intrinsic ACL cells,” JournalofOrthopaedic [28] A. N. Mastrangelo, P.Vavken, B. C. Fleming, S. L. Harrison, and Research,vol.28,no.5,pp.644–651,2010. M. M. Murray, “Reduced platelet concentration does not harm [42] S. C. Scherping Jr., C. C. Schmidt, H. I. Georgescu, C. K. PRP effectiveness for ACL repair in a porcine in vivo model,” Kwoh,C.H.Evans,andS.L.Woo,“Effectofgrowthfactorson Journal of Orthopaedic Research,vol.29,no.7,pp.1002–1007, the proliferation of ligament fibroblasts from skeletally mature 2011. rabbits,” Connective Tissue Research, vol. 36, no. 1, pp. 1–8, 1997. [29] S. M. Joshi, A. N. Mastrangelo, E. M. Magarian, B. C. Fleming, [43] M. Rupreht, M. Vogrin, and M. Hussein, “MRI evaluation of and M. M. Murray, “Collagen-platelet composite enhances tibial tunnel wall cortical bone formation after platelet-rich biomechanical and histologic healing of the porcine anterior plasma applied during anterior cruciate ligament reconstruc- cruciate ligament,” The American Journal of Sports Medicine,vol. tion,” Radiology and Oncology,vol.47,no.2,pp.119–124,2013. 37, no. 12, pp. 2401–2410, 2009. [30] M. M. Murray, M. Palmer, E. Abreu, K. P. Spindler, D. [44]R.Seijas,O.Ares,J.Catala,P.Alvarez-Diaz,X.Cusco,and Zurakowski, and B. C. Fleming, “Platelet-rich plasma alone is R. Cugat, “Magnetic resonance imaging evaluation of patel- not sufficient to enhance suture repair of the ACL in skeletally lar tendon graft remodelling after anterior cruciate ligament immature animals: an in vivo study,” Journal of Orthopaedic reconstruction with or without platelet-rich plasma,” Journal of Research,vol.27,no.5,pp.639–645,2009. Orthopaedic Surgery,vol.21,no.1,pp.10–14,2013. [31] M. M. Murray, K. P. Spindler, E. Abreu et al., “Collagen-platelet [45] F. Mirzatolooei, M. T. Alamdari, and H. R. Khalkhali, “The rich plasma hydrogel enhances primary repair of the porcine impact of platelet-rich plasma on the prevention of tunnel anterior cruciate ligament,” Journal of Orthopaedic Research,vol. widening in anterior cruciate ligament reconstruction using 25,no.1,pp.81–91,2007. quadrupled autologous hamstring tendon: a randomised clinical trial,” Journal of Bone and Joint Surgery,vol.95-B,no.1,pp. [32] M. M. Murray, K. P. Spindler, P. Ballard, T. P. Welch, D. 65–69, 2013. Zurakowski, and L. B. Nanney, “Enhanced histologic repair in a central wound in the anterior cruciate ligament with a collagen- [46] R. A. Magnussen, D. C. Flanigan, A. D. Pedroza, K. A. Heinlein, platelet-rich plasma scaffold,” Journal of Orthopaedic Research, and C. C. Kaeding, “Platelet rich plasma use in allograft ACL vol. 25, no. 8, pp. 1007–1017, 2007. reconstructions: two-year clinical results of a MOON cohort [33] M. M. Murray, K. P.Spindler, C. Devin et al., “Use of a collagen- study,” Knee,vol.20,no.4,pp.277–280,2013. platelet rich plasma scaffold to stimulate healing of a central [47] M. Rupreht, V. Jevtic,ˇ I. Serˇsa,M.Vogrin,andM.Jevˇsek, defect in the canine ACL,” Journal of Orthopaedic Research,vol. “Evaluation of the tibial tunnel after intraoperatively adminis- 24, no. 4, pp. 820–830, 2006. tered platelet-rich plasma gel during anterior cruciate ligament [34] A. Weiler, C. Forster,¨ P. Hunt et al., “The influence of locally reconstruction using diffusion weighted and dynamic contrast- applied platelet-derived growth factor-BB on free tendon graft enhanced MRI,” Journal of Magnetic Resonance Imaging,vol.37, remodeling after anterior cruciate ligament reconstruction,” The no. 4, pp. 928–935, 2013. American Journal of Sports Medicine,vol.32,no.4,pp.881–891, [48] A. Vadala,` R. Iorio, A. De Carli et al., “Platelet-rich plasma: 2004. does it help reduce tunnel widening after ACL reconstruction?” [35] R. Yoshida, M. Cheng, and M. M. Murray, “Increasing platelet Knee Surgery, Sports Traumatology, Arthroscopy,vol.21,no.4, concentration in platelet-rich plasma inhibits anterior cruciate pp. 824–829, 2013. ligament cell function in three-dimensional culture,” Journal of [49] M. Vogrin, M. Rupreht, D. Dinevski et al., “Effects of a platelet Orthopaedic Research, vol. 32, no. 2, pp. 291–295, 2014. gel on early graft revascularization after anterior cruciate [36] R. Yoshida and M. M. Murray, “Peripheral blood mononuclear ligament reconstruction: a prospective, randomized, double- cells enhance the anabolic effects of platelet-rich plasma on blind, clinical trial,” European Surgical Research,vol.45,no.2, anterior cruciate ligament fibroblasts,” Journal of Orthopaedic pp. 77–85, 2010. Research,vol.31,no.1,pp.29–34,2013. [50] D. Figueroa, P. Melean, R. Calvo et al., “Magnetic reso- [37] M. Cheng, V. M. Johnson, and M. M. Murray, “Effects of age nance imaging evaluation of the integration and matura- and platelet-rich plasma on ACL cell viability and collagen gene tion of semitendinosus-gracilis graft in anterior cruciate lig- expression,” Journal of Orthopaedic Research,vol.30,no.1,pp. ament reconstruction using autologous platelet concentrate,” 79–85, 2012. Arthroscopy, vol. 26, no. 10, pp. 1318–1325, 2010. BioMed Research International 15

[51] J. R. Valent´ı Nin, G. Mora Gasque, A. Valent´ı Azcarate,´ J. D. Aquerreta Beola, and M. Hernandez Gonzalez, “Has platelet- rich plasma any role in anterior cruciate ligament allograft healing?” Arthroscopy,vol.25,no.11,pp.1206–1213,2009. [52] A. Silva and R. Sampaio, “Anatomic ACL reconstruction: does the platelet-rich plasma accelerate tendon healing?” Knee Surgery, Sports Traumatology, Arthroscopy,vol.17,no.6,pp. 676–682, 2009. [53]M.Orrego,C.Larrain,J.Rosalesetal.,“Effectsofplatelet concentrate and a bone plug on the healing of hamstring tendons in a bone tunnel,” Arthroscopy,vol.24,no.12,pp.1373– 1380, 2008. [54] P. Vavken, P. Sadoghi, and M. M. Murray, “The effect of platelet concentrates on graft maturation and graft-bone interface healing in anterior cruciate ligament reconstruction in human patients: a systematic review of controlled trials,” Arthroscopy, vol. 27, no. 11, pp. 1573–1583, 2011. [55] M. Tschon, M. Fini, R. Giardino et al., “Lights and shadows concerning platelet products for musculoskeletal regeneration,” Frontiers in Bioscience, vol. 3, no. 1, pp. 96–107, 2011. Hindawi Publishing Corporation BioMed Research International Volume 2015, Article ID 542502, 19 pages http://dx.doi.org/10.1155/2015/542502

Review Article PRP and Articular Cartilage: A Clinical Update

Antonio Marmotti,1,2 Roberto Rossi,1 Filippo Castoldi,1 Eliana Roveda,3 Gianni Michielon,3 and Giuseppe M. Peretti3,4

1 Department of Orthopaedics and Traumatology, University of Torino, 10100 Torino, Italy 2Molecular Biotechnology Center, University of Torino, 10126 Torino, Italy 3Department of Biomedical Sciences for Health, University of Milan, 20133 Milan, Italy 4IRCCSIstitutoOrtopedicoGaleazzi,20161Milan,Italy

Correspondence should be addressed to Antonio Marmotti; [email protected] and Giuseppe M. Peretti; [email protected]

Received 25 August 2014; Revised 20 October 2014; Accepted 6 November 2014

Academic Editor: Giuseppe Filardo

Copyright © 2015 Antonio Marmotti et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

The convincing background of the recent studies, investigating the different potentials of platelet-rich plasma, offers theclinician an appealing alternative for the treatment of cartilage lesions and osteoarthritis. Recent evidences in literature have shown that PRP may be helpful both as an adjuvant for surgical treatment of cartilage defects and as a therapeutic tool by intra-articular injection in patients affected by osteoarthritis. In this review, the authors introduce the trophic and anti-inflammatory properties of PRP and the different products of the available platelet concentrates. Then, in a complex scenario made of a great number of clinical variables, they resume the current literature on the PRP applications in cartilage surgery as well as the use of intra-articular PRP injections for the conservative treatment of cartilage degenerative lesions and osteoarthritis in humans, available as both case series and comparative studies. The result of this review confirms the fascinating biological role of PRP,although many aspects yet remain to be clarified and the use of PRP in a clinical setting has to be considered still exploratory.

1. Introduction (EGF), and Hepatocyte Growth Factor (HFG) [3, 4]. In platelets microvesicles, different microRNAs5 [ ]involvedin Platelets are one of the smallest structures among the cir- mesenchymal tissue regeneration [6–8] are also present and culating cells in blood; they are anucleate, therefore unable some of them, as microRNA-23b, has been hypothesized to to replicate, their diameter is between 2 and 4 𝜇m, and they be strictly involved in differentiation of MSC into chondro- consistofcytoplasmandvesiclesandsurvivenomorethan cytes [9] or, as miRNA210, has been already proposed as a 10 days in circulation [1]. therapeutic alternative to increase ligament healing by means Yet,theyareincontinual“callofduty”becauseinside of intra-articular injections in a small animal model [10]. them lies one of the most powerful reservoirs of factors Moreover, clear anti-inflammatory properties of platelet responsible for tissue repair. Indeed, these little “bag of concentrates have been investigated as an associate effect in molecules” are essential for the regenerative process in promotingtissuehealing.Thisaspectcouldbeamainstay human. Recent literature has shown, in the platelet microvesi- when dealing with articular cartilage lesions. It is known cles and exosomes [2], the presence of prepackaged multiple that an inflammatory response of appropriate magnitude growth factors (GFs) in an inactive form. The most relevant and timing is essential for tissue repair as the majority of are platelet-derived growth factor (PDGF), transforming mesenchymal repair arise from a “controlled” inflammation. growth factor beta (TGF-beta), fibroblast growth factor In this regard, lowering the inflammation in the synovial tis- (FGF), insulin-like Growth Factor 1 (IGF-1), Connective sue would lead to a reduction of matrix-metalloproteinases, Tissue Growth Factor (CTGF), Epidermal Growth Factor which are cartilage-matrix degrading enzymes [4]. 2 BioMed Research International

The in vitro and preclinical evidences are the premises simply positioned during the gelling phase on a skin wound. for the fascinating trophic properties of PRP [3, 11]that,with It can be prepared by plasmapheresis, but for a wide clinical regards to articular cartilage, may be resumed in application it may result unpractical. Anitua et al. [21]have proposed a method that implies a centrifugation at 580 g for (i) the presence of specific chondrogenic growth factors 8 minutes of the extracted blood and a separation of the such as PDGF (that may stimulate proliferation and plasma fractions by pipetting. They have named the product collagen synthesis), TGF-beta (that may enhance Plasma Rich in Growth Factors or Preparations Rich in chondrocyte synthetic activity, matrix production, Growth Factors or EndoRet. The disadvantage is the manual andcellproliferationanddecreasesthecatabolic pipetting steps that may hamper the reproducibility of the activity of IL-1), and FGF (that promotes different final product. anabolic pathways); (2) Leukocyte rich PRP (L-PRP) is a product with leuko- (ii) the chemotactic migration of mesenchymal stem cells cytes and with a low-density fibrin network after activa- (MSC) and human subchondral progenitor cells, by tion and it is composed of a greater content of platelets mechanisms that may involve a synergistic action of than that of pure PRP and a higher content of leukocytes. TGF-beta and FGF [12]; Similarly to P-PRP, it can be used as an activated gel or (iii) the stimulation of the proliferation rate of MSC, in a liquid form to be injected intra-articularly. It can be independently from donor age [13, 14]; produced by automated double centrifugation systems and many commercial alternatives are available as Harvest Smart- (iv) the differentiation of MSC and surrounding cells PreP (Harvest Technologies, Plymouth, MA, USA), Biomet toward a chondrogenic lineage [12, 15]: this effect GPS III (Biomet Inc., Warsaw, IN, USA), Plateltex (Prague, has also been demonstrated in vitro with autologous Czech Republic), or Regen PRP (RegenLab, Le Mont-sur- human peripheral blood stem cells; Lausanne, Switzerland) [22]. (v) the anti-inflammatory action of PRP [4, 16, 17]; In both P-PRP and L-PRP, the activated gel is formed (vi) a hypothesizable antiapoptotic effect, by means of through activation of platelets and fibrinogen (that creates a inhibition of apoptotic related factors (i.e., downreg- fibrin net) by different activating molecules (i.e., thrombin, ulation of programmed cell death protein 5 by IGF-1) CaCl2). Once activated, platelets deliver nearly 70% of their [18]. GFs within the first 10 minutes and within an hour most of the stored GFs have been already secreted [23]. The Therefore, during the last 10 years, this convincing back- platelet-derived growth factors are firstly absorbed and then ground of basic science studies about PRP has offered the released by the fibrin net that behaves in the same way as clinician a promising opportunity of a new approach to the the extracellular matrix does. So, in the PRP, a release kinetic treatment of cartilage lesions and osteoarthritis. of the platelet GFs can be conceived. This kinetic depends In a clinical setting, autologous PRP may be defined as a on the content of fibrin in the final product. This content platelet concentration product containing at least 200% of the varies according to the individual platelets and fibrinogen peripheral blood platelet count. It can be produced essentially concentration and on the fibrin structure diversity created through 3 different methods: by the different procoagulant enzymes that induce the gel (i) blood filtration and plateletpheresis, that allow formation. These basic concepts allow explaining the length obtaining PRP products with high concentrations of of action of PRP, once delivered at the lesion site. As an human platelets and platelet-derived growth factors example, a recent study by Anitua et al. [24]showedthat70% and low numbers of contaminating leucocytes, but ofthestoredPDGFisreleasedfromaPRPgelformedbya implying high costs [19]; single slow centrifugation and CaCl2 activation in a period of 3 days, while 70% of VEGF, 60% of HGF, and 60% of IGF-1 in (ii) centrifugation by a “single-spinning” that has low 24 hours; then, the GF release usually reaches a plateau and costs and allows for a concentration of platelets up to a slow secretion of the remaining content is completed up to 3 times that of baseline level, avoiding the presence of 7-8 days. white cells; A traditional activator of platelets is bovine or autologous (iii) centrifugation by a “double-spinning,” from which a thrombin. Concerns about the tolerability of the bovine higher concentration of platelets (up to 8 fold the products, along with some observations showing a fast release baseline level) may be achieved, together with the of GFs and some adverse effects in presence of thrombin [25], presence of a high content of leukocyte. have suggested the use of different activators. Indeed, calcium Following these basic concepts, 4 categories of final products chloride,batroxobin,andcollagentypeImaybeused,the of platelet concentrates can be identified for clinical purposes, latter leading in vitro to a slower release of GFs compared to as suggested by Dohan Ehrenfest et al. [20]. thrombin.ItisalsopossibletheuseofanonactivatedPRPthat (1) Pure PRP, with a low content of leukocyte (P-PRP) may count on the activating effect of endogenous collagen (in or leukocyte-poor platelet-rich plasma. It is a preparation situ activation), although the liquid state would restrict the without leukocytes and with a low-density fibrin network clinical applicability. Moreover, to allow for a prolonged and after activation. It can be employed as liquid solution or in an sustained release of GFs, a novel approach theorize the use of activated gel form and it can be injected intra-articularly or common scaffolds (i.e., chitosan [26, 27]) as a carrier of PRP, BioMed Research International 3 and surprising results have been obtained with a prolonged by a specific commercial system, to allow for the correct release of GFs up to 20 days. choice of a suitable final formulation. Nevertheless, for this (3) Pure platelet-rich fibrin (P-PRF or PRFM, platelet purpose, the presence of leukocyte in regard to the treatment rich fibrin matrix). This is obtained, firstly, by a slow cen- of cartilage lesions should not be viewed straightforwardly as trifugation (approximately 1000 g) in a separator gel, that a“foe,”butasastilldebatedissue.Indeed,inarecentinvitro allows for the isolation of both the inactivated platelets studybyCavalloetal.,apreparationofL-PRPwasableto and fibrinogen-containing plasma from the packed red and promote chondrocyte proliferation as well as a P-PRP at end white cell fraction. Subsequently, a second centrifugation term of the culture and the production of hyaluronan was at high speed (approximately 3500 g) is performed in the greater with L-PRP compared to that of P-PRP [36]. More presence of Ca (calcium chloride, CaCl2). CaCl2 initiates the studies are needed to determine the best PRP formulation clotting cascade and the precipitation of a fibrin scaffold, for the treatment of cartilage lesions and osteoarthritis in thus obtaining the formation of a gel containing fibrin as a humans. stabilizer of the “platelet clot.” The end product is a platelet- In the perspective of a translation from “bench to bed- rich fibrin scaffold, which is stiffer than the conventional side,” these observations suggest that a clinical application PRP. It has a four-fold increment of platelets [28]anda of PRP for cartilage lesions and osteoarthritis has more low content of leukocyte and has the shape of a moldable questionsthananswersandagreatnumberofvariableshave tridimensional gel. A commercial alternative of P-PRF is to be considered as: named Fibrinet PRFM (Platelet- Rich Fibrin Matrix, Cascade Medical, Wayne, NJ, USA). This gel can be sutured or pressed (i) the interindividual differences in platelets and fibrin in a defect site. It cannot be injected, due to the strongly concentration; activated gel form. Therefore, due to the high content in (ii) the different methods of PRP preparation [37]; fibrin, this PRP formulation may release the platelet growth (iii) the unpredictable individual response to a spe- factors in a more extensive period, up to 7 days, with a cific method; intraindividual variations have been high variability of the release kinetic. Indeed, an abundant observed within the same method performed on release of the GFs has been observed within the first day samples taken at a different time periods38 [ ]andalso and a gradual decrease of the release of the growth factors significant variations in PRP obtained from different thereafter, within 2 days for VEGF and PDGF and within 7 preparation systems have been described in a single- days for EGF and FGF [29]. donor model [39]; (4) Leukocyte- and platelet-rich fibrin (L-PRF), similar to the latter, but with high content of leukocyte. As P- (iv) the storage of platelets: fresh PRP seems to better PRF, L-PRF is a strongly activated gel with a high-density preserve platelet function and GF-release compared fibrin network and it cannot be injected. It has the form to freeze-thawed PRP; nevertheless, the use of fresh of a solid material and it can be locally applied at the PRP implies blood harvesting and PRP preparation lesion site. It was derived from a one-step centrifugation of every time a PRP injection has to be performed, blood without anticoagulant and without blood activator. while freeze-thawing would allow for a preservation A commercial product of L-PRF is the Intra-Spin L-PRF of multiple PRP samples from the same patient; (Intra-Lock Inc., Boca Raton, FL, USA). This is a simple and (v) the possible use of homologous PRP produced by a inexpensive method and it allows producing large quantities bloodbank;thisalternativewouldreducethebias ofproductinaveryshorttime.Ithasbeenwidelyusedinoral derived from the interindividual platelet differences and maxillofacial surgery and, in orthopaedics, it has been and would offer a single homogeneous and repro- proposed to facilitate the rotator cuff repair [30]. ducible product available for clinical use, similarly to In general, a high content of leukocyte has been associated the blood transfusion concept; this method has been with antimicrobial activity, as studies have shown that L- adopted in different clinical settings, in example for PRPhasanegativeeffectonthegrowthofStaphylococcus the cure of necrobiosis lipoidica in diabetic patients aureus and Escherichia coli in vitro [31]. A L-PRP is also with good results [40]; recently, the use of allogenous associated with a greater presence of catabolic cytokines as PRP has been also proposed in literature for the treat- matrix metalloproteinase-9 (MMP-9) and interleukin-1 beta ment of cartilage defects in humans; allogenous PRP (IL-1beta) [32, 33]aswellasagreaternumberofplatelets.As was used as a carrier for autologous culture expanded a consequence, a theoretical greater content of growth factors bone marrow MSC in the pilot study of Haleem et al. like PDGF and TGF-beta is linked to L-PRP. Nevertheless, [41]; it may represent a potential opportunity in the an interesting study by Anitua et al. [34]hasshownan field of PRP application for cartilage repair. important decrease of the availability of VEGF after 3 days of incubation and a decrease of PDGF release in L-PRP. In such a complex clinical landscape, some promising studies Moreover, in a recent preclinical (rabbit) [35]study,L-PRP have been completed in the last 10 years. Literature indicates hasbeenobservedtocausegreaterinflammatoryreactions that the evidence of a valid effect of PRP for cartilage repair and more undesirable side effects than P-PRP following the isperceptiblebothforthetreatmentofcartilagelesions injection at the lesion site. by means of reconstructive surgery and for the treatment Therefore, for a proper clinical use, it is of primary of osteoarthritis by means of conservative intra-articular importance to know what type of preparation will be created delivery. 4 BioMed Research International

2. PRP and Cartilage Surgery recovery of talar osteochondral lesions treated by microfracture technique. A rationale for PRP application in cartilage surgery is sug- PRP has been also locally applied by means of scaffolds, gested by in vitro and preclinical experiences [11]duetothe following the principles of the acellular one-stage cartilage trophic properties, the ability to help MSC to differentiate repair. Several preclinical evidences have shown a positive toward cartilage and bone in an appropriate environment and effect of PRP in association with different materials [47]. the anti-inflammatory capacity. Nevertheless the experience of the Rizzoli group has rec- One of the first experiences came from the study of ommended caution when using PRP in association with Sanchez´ et al. in 2003 [42]. They treated a patient with osteo- their nanostructured three-layered scaffold made of collagen- chondritis dissecans of the medial femoral condyle by means hydroxyapatite [48]. Overall, these preclinical observations of arthroscopic reattachment of the loose chondral body and suggest that PRP seems to “make a difference” when com- PRP injection between the crater and the fixed fragment. bined to scaffold with a simple tridimensional structure, as They obtained a promising clinical result demonstrated by a bilayer collagen matrix [49] or a microporous PLGA [50]. magnetic resonance imaging (MRI). The positive influence of PRP may indeed be hampered by Subsequently, PRP has been associated with the micro- the presence of scaffolds with more complex configuration fracture technique to improve the cartilage repair. The pre- as the nanostructured membranes. These nanoscaffolds, per clinical sheep model of Milano et al. [43] offered a convincing se, would already lead to an improved osteochondral repair “proof of concept” of this intuition, advocating the use of through peculiar modalities like the chondrogenic effect of gel rather than a liquid preparation for this specific surgical the nanoparticles of hydroxyapatite [51, 52]. With regard to approach. In humans, this approach has been validated in that, recent clinical studies have proposed PRP in association a recent randomized study by Lee et al. [44]. These authors with collagen or synthetic implants, showing a positive effect investigated the potential of PRP as an adjunct at the end of PRP augmentation. In the first study, Dhollander et al.53 [ ] of the microfracture procedure for knee cartilage defects treated patellar cartilage defects by means of microfractures 2 up to 4 cm in patients older than 40 years of age. They with slow speed drilling. They covered the defect site with used a L-PRP and the process of preparation did not imply a collagen I/III membrane, manually inserted a L-PRP gel the use of activator. PRP was injected in situ around the beneath the scaffold and named this technique “AMIC plus,” microfracture holes after removal of arthroscopic fluid from a modification of the original AMIC (autologous matrix- the joint, following the principle of the in situ activation. induced chondrogenesis) procedure. After a follow-up of Their outcomes were convincing with regards to the clinical 24 months, they obtained good results in terms of clinical scores (IKDC and Lysholm) at 2 years and the second outcome. They observed improvement in KOOS (Knee injury arthroscopic view at a short time follow-up (4–6 months). and Osteoarthritis Outcome Score), Tegner activity scale, This was thought to be due to the double action of PRP in Kujala patellofemoral score, and VAS scale. The MRI evalua- enhancing bone marrow MSC migration and activation and tion with the MOCART system showed an incomplete repair in reducing the inflammation and, subsequently, the pain at with subchondral lamina, bone changes, and intralesional the surgical site. These results propose PRP as a promoter of osteophytes. Albeit confined in a low level of evidence, healing process after microfracture. Moreover, theoretically, these results are encouraging both for the effect of PRP for they allow for broadening the indication of this technique to a enhancing cartilage repair and for the controversial treatment population older than 40 years of age, in which microfracture of patellar chondral lesions. In the studies of Siclari et al. repair alone may become less efficient compared to younger [54, 55], polyglycolic acid- (PGA-) hyaluronan (HA) scaffolds patients. were soaked by a P-PRP and used to cover femoral and tibial condyle defects previously treated with microfractures by However, PRP may also be used postoperatively means of K-wire drilling (as in the Pridie technique). As an with encouraging results. The recent comparative study adjunct, the tibial defect was stabilized by the PRP gelled by of Manunta and Manconi [45]proposedaprotocolof calcium gluconate and thrombin additives, while the femoral multiple L-PRP injections given at a short distance from the fixation was performed with small barbed polylactic acid microfracture procedures. The authors obtained at 1 year (PLA) nail. Clinical improvement was demonstrated by the similar results to that of the study of Lee, although their small evidence of better KOOS at 12 months of follow-up, compared numberofcasesdidnotleadtoastatisticalsignificance. to that of the preoperative period. This result was stable also Similar promising effects were as well obtained in treating at 24 months. Biopsies taken from second look arthroscopies osteochondral talar lesion in the randomized, prospectively at 18–24 months of follow-up suggested that the repair tissue designed study of Guney et al. [46]. They used a L-PRP had some features of the hyaline articular cartilage. Even if administered 6–24 hours postoperatively through the arthro- these studies lack a control group, their results suggested a scopic portal entry site. At a medium term follow-up (average potential of PRP in association with a scaffold for one stage 16 months), the authors observed better scores in the visual treatment of chondral lesions. analogue scale (VAS) scale, in the American Orthopaedic The association with MSC is an alternative method of Foot and Ankle Society (AOFAS) scoring system and in the applying the positive effect of PRP for the repair of cartilage Foot and Ankle Ability Measure (FAAM), compared to that defects. In this convincing perspective, the PRP may directly of control cases. Thus, they sustained that an immediate enhance the reparative properties of the MSC seeded at the postoperative PRP injection may improve the functional defect. In the pilot study of Haleem et al. [41], autologous BioMed Research International 5 bone marrow cells, previously expanded for 4 weeks, were of talar osteochondral lesions, with lower costs and less seeded in an allogeneic PRP. The PRP was obtained by invasivity for the patients. An analogous approach was used double centrifugation and mixed with fibrin glue, made by by these authors to treat femoral condyle cartilage defects fibrinogen and thrombin, to constitute platelet rich fibrin [65]. They firstly implanted the esterified hyaluronic acid- glue. This stable scaffold was kept in situ by a periosteal flap. derivative membrane, soaked with bone marrow concentrate, 6 2 The inoculum density of MSC was2 × 10 cells/cm .The at the previously debrided lesion site and, at the end of the design of this study recalls the valiant works of Wakitani [56, procedure, they applied the P-PRF onto the scaffold. Similarly 57]. Albeit the few cases treated, the clinical improvements, to the outcome in the ankle, they observed, after 2 years, the macroscopic results of two second-look arthroscopies at clinical (KOOS and IKDC score) and MRI improvement, as 12 months and the magnetic resonance images make this well as a histological appearance of regenerated proteoglycan- study an interesting premise for future developments. rich matrix in the middle and deep zones of biopsies taken at 12 months. Their results were also confirmed at 3 years of However, the strongest contribution to this approach follow-up in a case series [66]. Again, these observations indi- came from the group of Giannini. Both talar and knee cate that the one-step approach with a combination of PRP cartilage lesions were treated by a novel arthroscopic one- and bone marrow concentrate may represent an interesting stage approach consisting of a scaffold loaded with bone alternative among the different cartilage repair procedures. marrow concentrate and platelet-rich fibrin gel (P-PRF). The studies concerning PRP application in cartilage surgery The rationale of this method is the combination of the are summarized in Table 1. positive effect of platelet growth factors and the synergistic + − Thus, considering the available literature, PRP seems to action of CD34 and CD34 precursor cells harvested from positively influence the cartilage repair process. Nevertheless, iliac crest bone marrow. In that, the evidence in literature + no clear evidence is yet available for ascertaining the exact oftheroleofCD34 precursor cells for cartilage repair contribution of PRP with respect to the surgical treatments aremultipleinvitro[58], in vivo in preclinical models performed alone. Indeed, the association of PRP with other (rat, rabbit) [59, 60],andalsoinhumans,asshownin biological treatments, as the implantation of MSC or the the pilot work of Saw et al. [61]. Moreover, no major cell use of scaffold, and the lack of comparative studies have manipulation is involved in this technique and autologous hampered the possibility to define the specific role of PRP in elements are utilized. All these features lead to a reproducible improving the outcomes. In the future, prospective clinical and economic procedure with promising results, as shown by trials will be certainly helpful in determining the basic rules Giannini et al. for talar osteochondral lesions [62–64]. The of using PRP in cartilage regenerative techniques. authors distributed the bone marrow concentrate and the P- PRF either by mixing with a porcine collagen powder or by loading an esterified hyaluronic acid-derivative membrane. 3. PRP and Intra-Articular Injections for The composite was placed at the lesion site after debridement of cartilage fragments and pathologic subchondral bone and Cartilage Pathology it was stabilized by an additional amount of platelet-rich The concept of a conservative treatment for cartilage degener- fibrin gel. In the first case series, after 24 months of follow- ative lesions and osteoarthritis (OA) in humans by means of up, they observed an improvement in the AOFAS score and the regenerative and anti-inflammatory potential of PRP has a consistent repair tissue at MRI. Second-look arthroscopies been widely investigated. It represents an appealing approach at 24 months showed a macroscopic aspect similar to that derived from the promising in vitro and preclinical evidences of articular cartilage, with a histological staining positive for [13], associated with low cost and minimally invasive proce- SAFRANIN-0 and with collagen type II in the intermediate dure (Figure 1). and deep zone of the newly generated repair tissue. Better 2 Several case series (Table 2)andcomparativetrials results were found in smaller lesions (less than 2 cm )and (Table 3) with different protocol regimens have shown a in patients without previous surgery. They confirmed the positive effect of PRP, leading to an overall improvement stability of their clinical results at 4 years of follow-up, of the symptoms. The most common side effects reported although a slight decline in the AOFAS scores was observed werepainatthesiteofinjection,lastingforsomeminutes, between 24 and 48 months postoperatively [64]. The authors swelling and postinjective pain in the affected joint, that compared also this technique with previously performed usually subsided in few days [67] without hampering the end- cartilage repair procedures by means of open field autologous term PRP positive results. chondrocyte implantation (ACI), using a periosteal flap as a In one of the first trials in 2010, Sampson et al. [68] sealing for the cells, and arthroscopic ACI, in which the same used L-PRP to treat 14 patients with knee OA by means esterified hyaluronic acid-derivative membrane was used as of 3 ultrasound-guided injections at 4 week intervals. They a scaffold [63]. This comparative retrospective study showed observed pain and symptoms relief at the KOOS and at a intriguing result: similar pattern of AOFAS improvement the Brittberg-Peterson scores still after 12 months, although was observed for the three groups at the end of the follow- no significant differences were observed in the ultrasound up (36 months) as well as comparable histological and MRI measurement of the cartilage thickness during the first 6 findings. This suggests that the single-stage association of months. bone marrow concentrate and the PRP may be as effective as In a larger study group, Wang-Saegusa et al. [69]treated other regenerative techniques like the ACI for the treatment 261 patients with symptomatic OA of the knee. They used 6 BioMed Research International

Table 1: Studies concerning PRP application in cartilage surgery.

PRP and cartilage surgery Number of cases Level of Type of Authors Year Study Procedure and observations Clinical results (age and evidence PRP range in y) Arthroscopic reattachment Excellent functional of the loose chondral body Sanchez´ 1 outcome, rapid resumption 2003 Case report IV / and PRP injection between et al. [42] (age 12) of symptom-free athletic the crater and the fixed activity. fragment. Improvement at 6 and 12 MSC seeded in a platelet months postoperatively in Haleem 5 rich fibrin glue; femoral 2010 Case series IV L-PRP (?) Lysholm and Revised et al. [41] (age 21–37) condyle cartilage lesions Hospital for Special Surgery (size 3–12 cm2). Knee (RHSSK) scores. Bone marrow concentrate and P-PRF either by mixing with a porcine collagen Improvement in AOFAS 25 Retrospective Giannini powder or by loading a score from preoperatively 2010 (mean age comparative III P-PRF et al. [63] esterified hyaluronic to 12 months and from 12 to 28 ± 9) study acid-derivative membrane; 36 months. talar osteochondral lesions (mean size >1.5 cm2). PRP gel inserted beneath a Improvement in VAS, collagen I/III membrane KOOS and Kujala Dhollander 5 after the microfracture patellofemoral score at 1 2011 Case series IV L-PRP et al. [53] (age 24–45) procedure; patellar focal and 2 years; no difference in cartilage lesions (size Tegner activity scale during 1–3 cm2). the 24-month follow-up. PRP injection at the end of Randomized, Better improvements in the microfracture Lee et al. 24 prospectively VAS and IKD C s cores 2013 II L-PRP procedure for femoral [44] (age 40–50) designed compared to control group condyle cartilage defects up study at 2 years postop. to 4 cm2 of size. Better improvements in PRP injection 6–24 h after Randomized, VAS, AOFAS, FAAM the microfracture Guney et al. 19 prospectively overall pain domain, and 2013 II L-PRP procedure for talar [46] (age 18–63) designed FAAM 15-min walking osteochondral lesion study domain at 16 months (diameterlessthan20mm). compared to control group. 3 PRP injections (1 week Manunta after surgery, then at an Better improvement at 6 and 10 Randomized interval of 1 month); medial and 12 months in IKDC 2013 II L-PRP Manconi (age 30–55) clinical study femoral condyle cartilage score compared to control [45] defects (Outerbridge II and group. III). Improvement in AOFAS score from preoperatively Bone marrow concentrate to 24 months, slight and P-PRF either by mixing decrease at 36 and 48 with a porcine collagen months; inverse Giannini 49 2009, powder or by loading a relationship at 24 months et al. (mean age Case series IV P-PRF 2013 esterified hyaluronic between the area of the [62, 64] 28 ± 9) acid-derivative membrane; lesion (< or >2cm2)and talar osteochondral lesions the AOFAS score and at 48 (mean size 2 cm2). months between the time from trauma to surgery and the AOFAS score. BioMed Research International 7

Table 1: Continued. PRP and cartilage surgery Number of cases Level of Type of Authors Year Study Procedure and observations Clinical results (age and evidence PRP range in y) Hyaluronic acid membrane filled with bone-marrow concentrate; a layer of Improvement at 29 months Buda et al. 2010, 20 Case series IV P-PRF P-PRF applied onto the postoperatively in IKDC [65, 66] 2013 (age 15–50) implanted material; femoral and KOOS scores. condyle lesions ICRS III and IV. PGA-HA scaffolds soaked by PRP to cover the defect site previously treated by Improvement at 12 and 24 Siclari et al. 2012, 52 Case series IV P-PRP microfracture procedure; months postoperatively in [54, 55] 2014 (age 31–65) femoral and tibial condyle KOOS scores. cartilage lesions (size 1.5–5 cm2). y = years; PRP = Platelet-Rich Plasma; MSC = Mesenchymal Stem Cells; P-PRP = Pure PRP, with a low content of leukocyte; L-PRP = Leukocyte rich PRP; P-PRF = Pure Platelet-Rich Fibrin.

(a) (b)

Figure 1: Preparation of PRP from peripheral blood sample; (a) blood aspiration; (b) transfer of patient blood into the PRP preparation chamber; (c) final PRP product; (d) intra-articular PRP injection.

a P-PRP prepared following Anitua’s technique (PRGF, the IKDC and EQ VAS scores. They obtained 80% of “preparation rich in growth factors” or plasma-rich growth patients’ satisfactions and improvement of all scores from factors or platelet rich growth factors) and administered basal values. Nevertheless, this study is the first that outlined 3 intra-articular injections of autologous PRGF at 2 week two fundamental aspects of this approach: (i) the correlation intervals. Their results showed improvement after 6 months between the worst outcomes and the older age of the patients in all 4 tests used, namely, the VAS, SF-36 Health Physical and the advanced OA and (ii) the decrease of the clinical parameters, WOMAC, and Lequesne Algofunctional Index. improvement after 6 months from the end of the treatment. Kon et al. [70] treated 91 patients with chondropathy or They also outlined inferior outcomes in the presence of knee OA with a regimen of 3 intra-articular injections of higher body mass index (BMI) and in female patients, while L-PRP and follow-up of the patients for 12 months with previous surgery did not affected the results. These findings 8 BioMed Research International

Table 2: Case series concerning PRP intra-articular injections for cartilage pathology.

PRP and intra-articular injections for cartilage pathology: case series Number of cases Level of Type of Authors Year Study Procedure and observations Clinical results (age and evidence PRP range in y) Improvement at 52 weeks from baseline in Brittberg-Peterson VAS for Sampson 14 Case 3 L-PRP injections at 2010 IV L-PRP Pain—resting, Pain—moving, et al. [68] (age 18–87) series 4-week interval; and Pain—bent knee and in KOOS for Pain and Symptom Relief. 3 L-PRP injections at Improvement at 6 and 12 3-week interval; before the months from baseline in injection: Ca-chloride was Kon et al. 91 Case IKDC, objective and 2010 IV L-PRP added to activate platelets; [70] (age 24–82) series subjective, and EQ VAS; knee articular damage: tendency of worsening grades 0–4 of between 6 and 12 months. Kellgren-Lawrence scale. Improvement at 6 months PRGF obtained following from baseline in VAS pain Wang- 261 Case Anitua’s technique; 3 score, Lequesne Index, SF-36 Saegusa 2011 (mean age IV P-PRP series injections at 2-week physical, WOMAC Index for et al. [69] 48 ± 17) interval. pain, stiffness and functional capacity. 3 L-PRP injections at Improvement at 24 months 3-week interval; before the from baseline in IKDC, injection: Ca-chloride was Filardo et al. 90 Case objective and subjective, and 2011 IV L-PRP added to activate platelets; [71] (age 24–82) series EQ VAS; worsening of all knee articular damage: scores between 12 and 24 grades 0–4 of months. Kellgren-Lawrence scale. 3 infiltrations of PRP at Improvement at 6 months weekly intervals; calcium from baseline in Numerical gluconate 10% was added; Rating Scale (NRS) for Napolitano 27 Case 2012 IV L-PRP knee articular damage: subjective measurement of et al. [72] (age 18–81) series chondropathy (Outerbridge pain and the WOMAC index 1-2), grades 1–3 of forpatientswithkneearthritis Kellgren-Lawrence scale. and cartilage disease. Improvement at 6 and 12 2 infiltrations of PRP at 1 months from baseline in VAS Gobbi et al. 50 Case month interval; articular 2012 IV L-PRP for pain, IKDC subjective and [74] (age 32–60) series damage: grades 1–3 of objective score, KOOS Tegner Kellgren-Lawrence scale. and Marx scores. Improvement at 6 months from baseline in VAS, 3 infiltrations of PRP at WOMAC Index, and the weekly intervals; Calcium Sanchez´ 40 Case Harris pain subscale; no 2012 IV P-PRF chloride was added; hip et al. [80] (age 33–84) series significant changes in pain articular damage: Tonnis scores between the 6- to 2-3. 7-week and 6-month time points. Single intra-articular injection of PRP; knee Improvement at 6 months Torrero 30 Case 2012 IV L-PRP articular damage: from baseline in VAS and et al. [73] (age 18–65) series chondropathy (Outerbridge KOOS. 1–3). BioMed Research International 9

Table 2: Continued. PRP and intra-articular injections for cartilage pathology: case series Number of cases Level of Type of Authors Year Study Procedure and observations Clinical results (age and evidence PRP range in y) Improvement at 6 months PRP obtained through from baseline in VAS and Magellan Autologous IKDC score; worsening from Jang et al. 90 Case Platelet Separator; knee 6to12months;negative 2013 IV L-PRP [77] (age 32–85) series articular damage: correlation with age, Kellgren-Lawrence Grade Kellgren-Lawrence grade and 1–3. presence of patellofemoral joint degeneration. 2 L-PRP injections at Improvement at 6 months 4-week interval; no from baseline in WOMAC 60 Raeissadat Case exogenous activation; knee Indexandthenative(Farsi) 2013 (mean age 57 IV L-PRP et al. [76] series articular damage: grades edition of the SF-36 ± 9) 1–4 of Kellgren-Lawrence questionnaire (physical and scale. mental). 1 PRP injection (Cascade 15 Improvement at 12 months Halpern Case system); knee articular 2013 (mean age 54 IV P-PRF from baseline in VAS and et al. [75] series damage: grades 0–2 of age 30–70) WOMAC Index. Kellgren-Lawrence scale. Improvement at 24 months 3 PRP injections at a from baseline in VAS, KOOS, monthly interval; articular Tegner and Marx scores; Gobbi et al. 119 Case damage: Kellgren-Lawrence tendency of worsening from 2014 IV P-PRP [79] (age 40–65) series Grade 1-2; 50 cases received 12 to 24 months; at 18 months, asecondcycleatthe greater improvement in completion of 1 year. patients who received the second cycle. Improvement at 12 months 3 L-PRP injections at from baseline in WOMAC 3-week interval; knee Mangone 72 Case index , VAS at rest, and VAS in 2014 IV L-PRP articular damage: et al. [78] (age 52–82) series movement; WOMAC index Kellgren-Lawrence Grade improved only in the first 3 2-3. months. y = years; PRP = Platelet-Rich Plasma; P-PRP = Pure PRP, with a low content of leukocyte; L-PRP = Leukocyte rich PRP; P-PRF = Pure Platelet-Rich Fibrin. were confirmed in a subsequent study with a longer follow- a single L-PRP injection in a group of 30 patients affected up [71]. The authors confirmed the short-term efficacy of by knee chondropathy (Outerbridge 1–3) and Gobbi et al. PRP injections. They also showed that all the evaluated scores [74] described improvement up to 1 year from a cycle of 2 worsened from 12 to 24 months, even though a positive effect PRP injections in 50 active patients with low to intermediate was still detectable. Indeed at 24 months clinical parameters grade knee OA (Kellgren-Lawrence 1–3). In Gobbi’s study, were still higher with respect to those measured as basal val- a peculiar feature was that half of the patients underwent a ues. Following these observations, the authors hypothesized previous arthroscopic treatment (shaving or microfracture), a role of PRP in temporarily reducing the synovial membrane but this aspect did not influence the final results after the hyperplasia and modulating the cytokine level in the arthritic PRP injections. More recently, in 2013, Halpern et al. [75] joint, rather than a long lasting chondroregenerative and observed pain reduction and functional improvement at 6 chondroprotective effect. months and 1 year from baseline (at the VAS and WOMAC Similarly to these studies, in 2012 Napolitano et al. [72] scores) in a group of 15 patients with low grade knee OA showed decrease of pain and functional improvements at 6 (Kellgren-Lawrence0–2)andtheywereevenabletoshow months at the WOMAC (Western Ontario and McMaster at MRI no further cartilage degeneration at the end of the Universities Arthritis Index) score after 3 L-PRP injections study in 73% of their patients. In the same year, Raeissadat in a group of 27 patients with knee OA (Kellgren and in et al. [76] showed a beneficial clinical effect after 6 months Lawrence 1–3) and knee cartilage disease (Outerbridge 1-2). attheSF-36(ShortForm-36)andintheWOMACquestion- Inthesameyear,Torreroetal.[73]observedasimilartrend naires in patients affected by knee OA ranging from low to of functional recovery at the VAS and KOOS scores after advanced grades. Similarly to other previous studies, these 10 BioMed Research International

Table 3: Comparative studies concerning PRP intra-articular injections for cartilage pathology.

PRP and intra-articular injections for cartilage pathology: comparative studies Number of cases Level of Type of Authors Year Study Procedure and observations Clinical results (age and evidence PRP range in y) 3 PRGF injections at 1-week 30 Observational interval; control group: Better improvement of Sanchez´ 2008 (mean age retrospective III P-PRP HMW-HA (30 pts); knee PRGF group at 5 weeks in et al. [81] 63 ± 8) cohort study articular damage: Ahlback¨ WOMAC index. grades 1–4. Better improvement of PRP group at 6 months in IKDC 3 L-PRP injections at and EQ VAS scores; better 2-week interval; before the results in subgroup of injection: Ca-chloride was patients with cartilage Prospective added to activate platelets; Kon et al. 50 degeneration; worsening 2011 comparative II L-PRP control group: HMW-HA [82] (age 30–81) from 2 to 6 months study (50 pts), LMW-HA (50 pts); subgroup in patients with knee articular damage: advanced OA; no difference grades 0–4 of between PRP and control Kellgren-Lawrence scale. groups in patients over 50 years. 3 PRP injections at 3-week No difference in IKDC interval; before the score, WOMAC score, and Randomized injection: Ca-chloride was 15 Lequesne index between 2 Li et al. [83]2011 prospective II L-PRP added to activate platelets; (age 36–76) groups within 4 months; study control group: sodium better improvement of PRP hyaluronate (LMW-HA) group at 6 months. (15 pts). Improvement at 12 months from baseline in IKDC, 3 L-PRP injections at Randomized KOOS, EQ-VAS, and 1-week interval; control 54 double blind Tegner for both groups; no Filardo et al. group: HMW-HA (55 pts); 2012 (mean age 55; prospective I L-PRP differences between PRP [67] knee articular damage: age 18–80) comparative group and controls; trend grades 0–4 of study toward better results for the Kellgren-Lawrence scale. PRP group in patients with less degenerated joints. Better improvement of PRP 60 group at 6 months in Spakova´ Prospective 3 PRP injections; control 2012 (mean age II L-PRP Numerical Rating Scale et al. [84] cohort study group: HA. 53 ± 12) (NRS) and the WOMAC index. Better improvement of PRP group at 24 weeks in the percentage of patients having a 50% decrease in WOMAC pain subscale; trend toward better 3 P-PRP injections at improvement (not 79 1-week interval; control significant) of PRP group in Sanchez´ Randomized 2012 (mean age I P-PRP group: HMW-HA (74 pts); scores on the WOMAC et al. [86] controlled trial 60 ± 8) knee articular damage: subscales for stiffness and Ahlback¨ grade I–III. physical function, in Lequesne index, in the percentage of OMERACT-OARSI responders, and in the amount of acetaminophen in mg/day. BioMed Research International 11

Table 3: Continued. PRP and intra-articular injections for cartilage pathology: comparative studies Number of cases Level of Type of Authors Year Study Procedure and observations Clinical results (age and evidence PRP range in y) Better improvement of PRP 60 4 PRP injections at 1-week group at 24 weeks in Cerza et al. Randomized 2012 (mean age I P-PRP interval; control group: WOMAC scores; no [85] controlled trial 66 ± 11) LMW-HA (60 pts). correlation with the grade of gonarthrosis. 3PRGFinjectionsat Better improvement of PRP 2-week interval; control group at 28 weeks in 15 group: HMW-HA (15 AOFAS Ankle-Hindfoot Mei-Dan Randomized 2012 (mean age II P-PRP lesions; 1-week interval); Scale (AHFS), VAS for et al. [92] controlled trial 43 ± 18) ankle articular damage: pain, stiffness, and Ferkel grade 1–3 function, subjective global osteochondral lesions. function scores. 3 P-PRP injections at Better improvement of PRP 1-week interval; control group at 48 weeks in group: HMW-HA (48 pts; 1 Vaquerizo 48 Randomized WOMAC index, Lequesne 2013 I P-PRP single injection); knee et al. [87] (age 62 ± 7) controlled trial index and articular damage: grades OMERACT-OARSI 2–4 of Kellgren-Lawrence responders. scale. 1 P-PRP injections; control Better improvement of PRP Say et al. 45 Prospective group: HA (45 pts; 3 2013 II P-PRP group at 6 months in [88] (mean age 55) study injections at 1-week KOOS and VAS for pain. interval). Group A (52 knees): single Better improvement of PRP 52 injection of PRP; group B groups at 6 months in (group A; age (50 knees): 2 injections of WOMAC, VAS and overall Patel et al. 33–80) Randomized PRP at 3-week interval; satisfaction with the 2013 I P-PRP [89] 50 controlled trial group C (46 knees): single procedure; no difference (group B; age injection of normal saline; between group A and B; 34–70) knee articular damage: slight worsening from 3 to Ahlback¨ grade I-II. 6months. 9 PRP injections during 1 year; control group (50 pts): 1% mesocain; knee articular Better improvement of PRP Hart et al. 50 Randomized damage: Grade II groups at 12 months in 2013 I P-PRP [90] (age 31–75) controlled trial (fibrillation), Grade III Lysholm, Tegner, IKDC, (fissuring and and Cincinnati scores. fragmentation, but no bone exposed). 3 PRP injections at 1-week No difference at 12 months interval; control group: between the groups in Battaglia 50 Randomized HMW-HA (50 pts); hip 2013 I L-PRP Harris Hip Score (HHS), et al. [91] (age 25–76) controlled trial articular damage: grades NSAID consumption and 2–4 of Kellgren-Lawrence VAS. scale. y = years; PRP = Platelet-Rich Plasma; P-PRP = Pure PRP, with a low content of leukocyte; L-PRP = Leukocyte rich PRP; P-PRF = Pure Platelet-Rich Fibrin; LMWHA = Low Molecular Weight Hyaluronic Acid; HMW-HA = High Molecular Weight Hyaluronic Acid; pts = patients; PRGF = “Preparation Rich In Growth Factors” or Plasma-Rich Growth Factors or Platelet Rich Growth Factor with a very low/absent content of leukocytes. authors also demonstrated an improvement in pain, stiffness, osteoarthritis or the platelet concentration (ranging in their and functional capacity, with reverse relationship between study from 2.4 to 8.6 times). On the contrary, the study of patient’s age and degree of pain reduction. Nevertheless, Jang et al. [77] pointed out the negative correlation between they were not able to observe any correlation between the patellofemoral joint degeneration and poorer outcomes, symptoms improvement and the patients’ weight, the grade of along with symptoms worsening after 1 year from the first 12 BioMed Research International injection. They also observed a relapse of pain approximately low molecular weight (LMW) and high molecular weight 9 months after the procedure and an adverse effect of patient’s (HMW) hyaluronic acid (HA) administrations. At 2 months, ageinthefinaloutcome. no difference was detected between PRP and the HA, and In 2014, a study of Mangone et al. [78] again confirmed the worst results were described for patients treated with HMW- value of L-PRP injections in a group of 79 patients selectively HA. Nevertheless, the authors observed at 6 months a affected by intermediate grade knee OA (Kellgren-Lawrence clear positive effect of PRP, while LMW-HA treated patients 1–3). They showed improvement up to 1 year after the end showed a worsening of the performances. This effect was of the treatment in WOMAC scale, VAS at rest, and VAS more evident in young patients and in the presence of early in movement. The treatment involved 3 PRP injections at cartilage degeneration, as demonstrated by an improvement 3-week interval. They outlined the role of PRP as a second of symptoms and function at the IKCD score and at the EQ- approach to the treatment of knee OA due to the still high VAS score. They did not find superior benefit of PRPwith costs of this procedure compared to that of traditional HA regards to HA in older patients (more than 50 years old) and therapy. An original observation came the same year from a inthepresenceofadvancedOA.ThepatientswithearlyOA study by Gobbi et al. [79]. They evaluated a group of patients treated with PRP displayed an “intermediate” effect, having after 2 years. They indicated a greater improvement of the stable score at 2 and 6 months, while the LMW-HA group clinical scores when the cycle of PRP injections was repeated worsened. Again, these results supported the hypothesis of after 1 year. However, they also perceived a decline in the an efficacy of PRP injections in reducing pain and symptoms performances at the end of follow-up. This was the first study and recovering articular function in patients affected by supporting the value of a cyclical treatment with PRP. knee degeneration. This was particularly evident in patients PRP injections have been also applied to treat hip OA younger than 50 years and affected by early stage of the with limited results. In a preliminary study by Sanchez´ et al. pathology. In this subgroup of patients, these effects were [80], the outcomes were less satisfactory: 57% only of patients longer (up to 6 months) than the well-known transient results reported a clinically relevant relief of pain. An improvement of the HA injections. These observations were confirmed in in the Harris score, WOMAC pain score, and VAS scale was a blinded randomized study from the same authors at 1- detected at 6 weeks but no further changes were observed. year follow-up [67]. They compared L-PRP injections with From these case series, PRP appears to have a potential for HMW-HA and both groups showed improvement in the improving knee function and quality of life of patients suffer- performances at the clinical scores (IKDC, KOOS, EQ-VAS, ing from chondropathy or initial OA, by means of reducing Tegner), although no significant differences were observed at the inflammation and, in a lesser extent, the degenerative 12 months of follow-up. Nevertheless, a trend toward a better articular processes. Nevertheless, some suggestions can be result was observed in the PRP group in the presence of early proposed; indeed, a better result seems to be related to joint degeneration. The positive longer effect of PRP injections was also (i) younger patients, confirmed in the randomized prospective study by Li et al. (ii) lower degree of cartilage degeneration, [83]. They matched PRP with sodium hyaluronate in a small (iii) male gender, group of patients with knee articular cartilage degeneration. Even if similar outcomes where observed at 4 months in (iv) low BMI, both groups, significant differences in IKDC score, WOMAC (v) short-term follow-up (the median duration of the effi- score,andLequesneindexwereshownat6months.This cacy of PRP injections being estimated at 9 months), confirmed the more durable improvement of PRP compared (vi) protocols implying a repeated course of injections to that of HA. The study of Spakovaetal.[´ 84]further (i.e., after 1 year). strengthened these assumptions. In particular, by comparing PRP with HA, they did not notice similar early outcomes However, if the analysis of the case series enlightens some between the two groups but a constant superiority of the limits in the use of PRP injections, more promising signs outcomes of patients treated by PRP injections at both 3 and 6 come from the analysis of comparative studies regarding the months of follow-up. Similarly, the study of Cerza et al. [85]in benefit of PRP as a conservative therapy for chondropathy or 2012 demonstrated that a formulation of P-PRP (autologous initial OA. In fact, PRP has been matched with viscosupple- conditioned plasma, ACP) was superior to HA at any time mentation, local anesthetics, and saline solution to assess its point over 24 weeks of follow-up. The authors did not even possible positive effect. noticed any worsening of the PRP effect in the presence of One of the first contributions came from the study severe gonarthrosis (Kellgren-Lawrence grade III), while the of Sanchez´ et al. in 2008 [81]. The authors compared 3 outcomes of the HA control group were strongly influenced injections of a single-spinning P-PRP (“preparation rich in by the degree of osteoarthritis. growth factors,” PRGF) with those of a low molecular weight Conversely, in the same year, a randomized study from hyaluronic acid (LMW-HA) at a short-term follow-up. The Sanchez´ et al. [86] failed to demonstrate a statistically sig- WOMAC score showed clinical improvement: 5 weeks after nificant superiority in overall knee performances of patients the third injection significant pain reduction was recorded in treated with P-PRP (PRGF) injections, compared to a control 33% of PRP group while only in 10% of the control one. group treated with HMW-HA. The authors found a clear Subsequently, in a complex multicenter study of Kon difference only in the evaluation of pain, observing a 50% et al. in 2011 [82], L-PRP injections were compared with decrease in the WOMAC pain subscale from baseline to BioMed Research International 13

6 months in approximately 40% of patients treated with their results are promising. Battaglia et al. [91] investigated P-PRP and in 24% of patients treated with HMW-HA. the effect of ultrasound-guided PRP injections versus HWM- Nevertheless, using the same PRP preparation (PRFG) of HA intra-articular administration for the treatment of hip the study of Sanchez´ et al., a recent comparative study with OA. They assessed the clinical benefit through the useof HMW-HA has given surprising results. Indeed, Vaquerizo the Harris Hip Score (HHS) and the VAS scale at 1 year. et al. [87] observed an improvement in both pain and physical They observed an improvement up to 6 months, with a performances (i.e., stiffness and physical function) at 24 slight decrease from 6 to 12 months, that paralleled the and 48 weeks in patients affected by knee OA of Kellgren- effect of the HA, and a reduction of the nonsteroidal anti- Lawrence grades 2 to 4. Compared to the study of Sanchez´ inflammatory drugs (NSAID) consumption in the PRP group et al., the main differences of the Vaquerizo’s trial were (i) the in a short-term follow-up. This confirmed the temporary HA formulation (a higher HMW-HA), (ii) the inclusion of efficacy of PRP also for the treatment of hip OA. In a different patients with higher degree of OA, and (iii) the single HA perspective, Mei-Dan et al. [92] examined the use of PRP injection compared with a cycle of 3 injections on a weekly versus HA injections for the nonoperative treatment of talar basis of PRP. These results seem in accordance with the study osteochondral lesions. At a short-term follow-up (28 weeks), of Kon et al. in 2011 with regards to HMW-HA. They support they found a better improvement of the Ankle-Hindfoot Scale apossiblebiologicalefficacyofPRPfortreatmentofknee (AHFS), and VAS scales (for pain, stiffness, and function) OAinamediumtolongtermfollow-up(lessthan1year). for the PRP-treated group, along with a similar trend for the Moreover, a recent study of Say et al. [88]showedthateven subjective global function perceived by the patients. Again, a single dose of P-PRP (PRGF) may exert a benefit at the this work confirmed the superior short-term efficacy of PRP KOOS and VAS scales when compared to 3 intra-articular with respect to HA also for the treatment of talar cartilage injections of HA in a short-term follow-up (6 months), in lesions. patients affected by bilateral gonarthrosis. This “single-shot Therefore, in the “history so far,” the results of all these approach” may offer the advantage of a greater safety and comparative studies offer some basic answers to the sug- cost-effectiveness compared to the approach with multiple gestions driven by the case series in literature. Indeed, injections. length of action, grade of OA, age of the patients, safety of PRP has been recently compared to saline solution, as a the administration, and superiority of PRP towards LMW- placebo, in an interesting study by Patel et al. [89]. The authors HA and HMW-HA have been actually clarified. PRP intra- investigated also 2 different modalities of PRP administration articular administration appears a relatively safe procedure (1 injection versus 2 injections regimen) in patients with with few negligible short-term side effects, as transient joint knee OA (Ahlback¨ grade 1 and 2). In this randomized painandeffusion.Thereisalsoastrongevidencethat controlled trial, many of the previously reported evidences about the use of intra-articular PRP were confirmed. Indeed, (i) PRP injection may exert a positive influence in theauthorsfoundthatastatisticallysignificantimprovement patients affected by knee cartilage degeneration and was present both with a single dose and with 2 injections of OA (with a preliminary suggestion, even for talar PRP compared to placebo. They also observed that the effects osteochondral lesions); were present up to 6 months of follow-up, even though at (ii) PRP injection may have a greater and longer effi- the end term evaluation the scores in the PRP groups started cacy than HA or placebo (saline) administration in to deteriorate. Furthermore, better outcomes were found in improving pain and articular function; patients with low grade of articular degeneration (Ahlback¨ (iii) the beneficial effect of PRP injection is still temporary grade 1). Surprisingly, no correlation of improvement by anditcouldbeestimatedtolastupto1year,witha means of PRP was found with respect to age, sex, or BMI. peak of action detectable at 6 months. A completely different approach has been used by Hart et al. [90] in a recent trial investigating the use of intra- Moreover, the previously mentioned comparative studies articular PRP versus mesocain injection. The rationale of agree with the recent reviews and meta-analysis from Abrams their therapeutic design was the cyclical treatment with P- et al. [93], Anitua et al. [94], Chang et al. [95], Dold PRP. In the study, patients underwent 6 injections at 1-week et al. [96], Khoshbin et al. [97], Pourcho et al. [98], and intervals, treatment interruption for 3 months, and then Tietze et al. [99], confirming the safety of PRP injections, three PRP injections at 3-month intervals as a maintenance the reduction of pain, the short term clinical benefit for dose. This is actually the comparative study dealing with the symptomaticmildtomoderatekneeOA,andtheinfluence highest number of PRP injections. The amazing result is that of the severity of the degenerative process on the response the outcomes of such a “PRP loaded” procedure are not so to the treatment. Indeed, the greatest results are achieved in different from other “more essential” study. Indeed, at 12 young patients affected by lower degree of OA or cartilage months after the end of the PRP treatment, the authors found degeneration. This is in accordance with the concept that an improvement of pain and knee function at the Lysholm, all biological therapies are positively influenced by a proper Tegner, IKDC, and Cincinnati scores, but no significant active microenvironment at the lesion site in order to reach influence on cartilage trophism was observed at the MRI. So, the higher level of success. no clear benefit of such a large PRP course was validated. These conclusions suggest that the primary role of PRP Few comparative studies, finally, exist in literature regard- injections has to be found not in a direct stimulation of ing the use of intra-articular PRP outside the knee joint, and chondrocyte anabolic processes, but rather in a temporary 14 BioMed Research International modulation of joint homeostasis by the anti-inflammatory a promising trial by Pak et al. [104, 105]. They obtained effects of PRP. This may lead to a reduction of synovial MSC in the form of a stromal vascular fraction of adi- hyperplasia and cytokine production (i.e., IL-1b [17]) and, pose tissue. They injected a mixture composed by the cell consequently, to the observed significant improvements of concentrate, PRP, hyaluronic acid, and calcium chloride, the clinical outcomes in a short-term follow-up. obtaining promising results in patients with chondromalacia Considering all the present evidences, literature does patellae. Further studies will clarify the value of this appealing not justify an indiscriminate practice of PRP injections therapeutic perspective. as a fist line treatment. The PRP seems to be instead an Finally, the issue about PRP preparation method and the ideal candidate for a discriminative usage in the field of presence of leukocyte is a challenging topic. The controversial conservative therapy of degenerative chondropathy and mild role of leukocyte originates from the observation that white OA, addressing specifically to a selected group of patients cells may release inflammatory mediators, proteases, and less than 50 years old or patients resistant to other current reactive oxygen species in the intra-articular space, causing nonsurgical treatments [78, 95]. With regard to that, the transient joint inflammation that may hamper the effect literature continues to suggest the use of PRP injections in of PRP. From a different perspective, white cells, especially clinical trials [100], to allow for a deeper comprehension of peripheral blood mononuclear cells (lymphocytes and mono- the limits and the effectiveness of this therapeutic approach. cytes) may exert a positive effect by means of releasing Still, in this scenario, some questions remain unsolved. anaboliccytokinesasIL-6aswellasproteinsandenzymes It is unclear if PRP injection may sustain a substantial effect involved in the prevention of joint infection [31, 106]. A beyond the medium-term follow-up (1 year), independently prospective study of Filardo et al. [107]comparedP-PRP from the number of doses given to the patients. Furthermore, (PRGF) and L-PRP in 144 patients affected by knee OA. They the best administration protocol is yet to be determined, failed to find a significant difference in the clinical outcomes although most of the studies propose a minimal requirement (KDC, EQ VAS and Tegner scores) up to 12 months, besides of 3 doses. Solving these aspects may lead to recommend the occurrence of minor adverse events as pain and swelling a cyclic regimen of treatment in which patients receive inthepresenceofleukocytes.Nevertheless,recentinvitro repetitive course of PRP injections (i.e., at 1 year interval) in evidences [108] have questioned this result pointing out the order to achieve longer lasting results and to ultimately delay upregulation of proinflammatory factors, (IL-1beta, IL-8 and more invasive surgical treatments. FGF-2) and the downregulation of HGF and TIMP-4 in It is also a matter of debate if PRP may have a secondary synoviocytes in the presence of L-PRP. Therefore, the quest substantial chondroprotective effect toward the progression for the best PRP formulation is still open. of joint degeneration. From the current studies, no clear evidence of anabolic responses of cartilage tissue has been 4. Conclusion observed at the MRI. Nevertheless, the preclinical evidences suggest that PRP effects seem to “go beyond” a simple anti- The review of the literature, along with the new in vitro and inflammatory action. If this concept will be confirmed in preclinical perspectives, gives PRP a fascinating biological the future, the clear impact of PRP on the natural history of possibility as a therapeutic approach for cartilage pathology. degenerative OA will be determined. Certainly, more works has to be done in order to establish No clear consensus exists concerning some secondary common guidelines. At this regard, high quality trials will aspects of patient selection, as the influence of BMI and of help to clarify some of the open questions about the specific sex, even though low BMI and male sex seems to lead to better use of PRP as (i) a component of the surgical management clinical results. of cartilage lesions, as well as (ii) a nonoperative injective The better activation method of PRP is unknown. Due modality for treating low grade osteoarthritis and cartilage to the differences in the study protocols available, it is degeneration. With regard to that, some new intuitions may impossible to determine which, if any, activating agent is be useful in the future. preferable. However, a recent report by Textor et al. [101] In the field of surgery, a recent study outlined that the has outlined that thrombin may cause inflammatory cytokine activity of PRP may be enhanced in presence of specific responses in joints, while no activation or the use of calcium biphasic tridimensional porous scaffold made of collagen chloride seems advisable. Moreover, novel approach, as the type I and glycosaminoglycan [109]. Indeed, this combination photoactivation [102], starts to be popular, even if the value led to a spontaneous activation of PRP without the need of these new methods is still investigational. of thrombin or any other activating factors and a sustained The concurrent use of other treatment modalities is also release of growth factors as PDGF,FGF-2, and TFG-beta. This an unclear aspect of the PRP injection approach. Indeed, PRP might also represent an increasing evidence for the use of has been studied alone, but the combined use of PRP and scaffold carrying PRP for cartilage healing. other substances with dissimilar biological mechanisms may It is, however, from the study of synergistic approaches constitute a novel field of application, in order to broaden that some attractive proposal may be suggested. A new the indication and the effect of the simple PRP injection. perspective is, indeed, the modulation of PRP by means of Recently, the association of PRP and HA injections has been other substances that may hasten the positive anabolic effect proposed [103] to modify the altered joint microenviron- of PRP itself. In that, the intuitions of Jonny Huard and ment of osteoarthritic knee. Furthermore, the percutaneous his research group about the use of PRP and losartan to MSC injections have been recently associated with PRP in improvemusclehealinghavebeenfundamental[110]. Indeed, BioMed Research International 15 the association of PRP and anti-VEGF antibody seems [6] S. Nagalla, C. Shaw, X. Kong et al., “Platelet microRNA-mRNA promising for cartilage regeneration, considering the well- coexpression profiles correlate with platelet reactivity,” Blood, known effect of VEFG in promoting hypervasculariza- vol. 117, no. 19, pp. 5189–5197, 2011. tion and stimulating angiogenesis [11, 111]. The intravenous [7]A.Yuan,E.L.Farber,A.L.Rapoportetal.,“Transferof administration of a monoclonal anti-VEGF antibody (beva- microRNAs by embryonic stem cell microvesicles,” PLoS ONE, cizumab) has already given promising results in preclinical vol. 4, no. 3, Article ID e4722, 2009. rabbit model [112]. Moreover, a recent preclinical study has [8] J. W. Semple, “Platelets deliver small packages of genetic shown the positive effect of a VEGF antagonist combined function,” Blood,vol.122,no.2,pp.155–156,2013. with PRP in improving cartilage repair increasing type II [9] O. Ham, B.-W. Song, S.-Y. Lee et al., “The role of microRNA- collagen production in a rat model [113]. 23b in the differentiation of MSC into chondrocyte by targeting The local delivery of PRP associated with systemic admin- protein kinase A signaling,” Biomaterials,vol.33,no.18,pp. istration of G-CSF seems also a promising horizon. The 4500–4507, 2012. theoretical advantage of stem cell mobilization by means [10] T. Shoji, T. Nakasa, K. Yamasaki et al., “The effect of intra- of subcutaneous G-CSF injection in association with PRP articular injection of microRNA-210 on ligament healing in a administration has been recently proposed by Turajane et al. rat model,” The American Journal of Sports Medicine,vol.40,no. [58] in an in-vitro study. They showed that the addition of 11, pp. 2470–2478, 2012. PRP and G-CSF stimulated peripheral blood stem cells to [11] Y. Zhu, M. Yuan, H. Y. Meng et al., “Basic science and clinical proliferate toward a chondrocyte phenotype. Furthermore, application of platelet-rich plasma forcartilage defects and a previous study by Deng et al. have already outlined the osteoarthritis: a review,” Osteoarthritis and Cartilage,vol.21,no. potential of G-CSF-mobilized peripheral blood stem cells 11, pp. 1627–1637, 2013. in promoting articular regeneration in OA in a preclinical [12] J. P. Kruger,S.Hondke,M.Endres,A.Pruss,A.Siclari,andC.¨ rat model [59]. These observations suggest new therapeutic Kaps, “Human platelet-rich plasma stimulates migration and potential approaches for cartilage repair by means of systemic chondrogenic differentiation of human subchondral progenitor G-CSF and local PRP injection for the treatment of low-grade cells,” Journal of Orthopaedic Research,vol.30,no.6,pp.845– osteoarthritis. 852, 2012. So, the story “goes on” and, while new clinical studies [13] E. Rubio-Azpeitia and I. Andia, “Partnership between platelet- will be proposed, preclinical evidences will emerge with new rich plasma and mesenchymal stem cells: in vitro experience,” fascinating proposals: the future directions of PRP in the Muscles, Ligaments and Tendons Journal,vol.4,no.1,pp.52–62, field of cartilage therapy is really a whole new world tobe 2014. discovered. [14]M.Vogl,J.Fischer,M.Jager,¨ C. Zilkens, R. Krauspe, and M. Herten, “Can thrombin-activated platelet releasate compensate the age-induced decrease in cell proliferation of MSC?” Journal Conflict of Interests of Orthopaedic Research, vol. 31, no. 11, pp. 1786–1795, 2013. [15] J. P. Kruger,A.-K.Ketzmar,M.Endres,A.Pruss,A.Siclari,and¨ All the authors declare that there is no conflict of interests C. Kaps, “Human platelet-rich plasma induces chondrogenic regarding the publication of this paper. differentiation of subchondral progenitor cells in polyglycolic acid-hyaluronan scaffolds,” Journal of Biomedical Materials Research—Part B Applied Biomaterials,vol.102,no.4,pp.681– References 692, 2014. [1] P. Harrison, “Platelet function analysis,” Blood Reviews,vol.19, [16] S. Lippross, B. Moeller, H. Haas et al., “Intraarticular injection no.2,pp.111–123,2005. of platelet-rich plasma reduces inflammation in a pig model of rheumatoid arthritis of the knee joint,” Arthritis and Rheuma- [2]H.F.G.Heijnen,A.E.Schiel,R.Fijnheer,H.J.Geuze,andJ.J. tism, vol. 63, no. 11, pp. 3344–3353, 2011. Sixma, “Activated platelets release two types of membrane vesi- [17] J.Liu,W.Song,T.Yuan,Z.Xu,W.Jia,andC.Zhang,“Acompar- cles: microvesicles by surface shedding and exosomes derived ison between platelet-rich plasma (PRP) and hyaluronate acid from exocytosis of multivesicular bodies and alpha-granules,” on the healing of cartilage defects,” PLoS ONE,vol.9,no.5, Blood,vol.94,no.11,pp.3791–3799,1999. Article ID e97293, 2014. [3] R. Civinini, L. Nistri, C. Martini, B. Redl, G. Ristori, and M. [18] G. Filardo, E. Kon, A. Roffi, B. Di Matteo, M. L. Merli, and Innocenti, “Growth factors in the treatment of early osteoarthri- M. Marcacci, “Platelet-rich plasma: why intra-articular? A tis,” Clinical Cases in Mineral and Bone Metabolism,vol.10,no. systematic review of preclinical studies and clinical evidence on 1,pp.26–29,2013. PRP for joint degeneration,” Knee Surgery, Sports Traumatology, [4] P. Bendinelli, E. Matteucci, G. Dogliotti et al., “Molecular Arthroscopy,2013. basis of anti-inflammatory action of platelet-rich plasma on [19] R. Zimmermann, S. Reske, P. Metzler, A. Schlegel, J. Ringwald, human chondrocytes: Mechanisms of NF-𝜅Binhibitionvia and R. Eckstein, “Preparation of highly concentrated and HGF,” Journal of Cellular Physiology,vol.225,no.3,pp.757–766, white cell-poor platelet-rich plasma by plateletpheresis,” Vox 2010. Sanguinis,vol.95,no.1,pp.20–25,2008. [5] C. Stratz, T. G. Nuhrenberg,¨ H. Binder et al., “Micro-array pro- [20] D. M. Dohan Ehrenfest, I. Andia, M. A. Zumstein, C.-Q. filing exhibits remarkable intra-individual stability of human Zhang, N. R. Pinto, and T. Bielecki, “Classification of platelet platelet micro-RNA,” Thrombosis and Haemostasis,vol.107,no. concentrates (Platelet-Rich Plasma-PRP, Platelet-Rich Fibrin- 4, pp. 634–641, 2012. PRF) for topical and infiltrative use in orthopedic and sports 16 BioMed Research International

medicine: current consensus, clinical implications and perspec- effect of leukocyte inclusion,” Journal of Biomedical Materials tives,” Muscle, Ligaments and Tendons Journal,vol.4,no.1,pp. Research A,vol.103,no.3,pp.1011–1020,2015. 3–9, 2014. [35] J. L. Dragoo, H. J. Braun, J. L. Durham et al., “Comparison of the [21] E. Anitua, M. Sanchez,´ G. Orive, and I. And´ıa, “The potential acute inflammatory response of two commercial platelet-rich impact of the preparation rich in growth factors (PRGF) in plasma systems in healthy rabbit tendons,” American Journal of different medical fields,” Biomaterials,vol.28,no.31,pp.4551– Sports Medicine,vol.40,no.6,pp.1274–1281,2012. 4560, 2007. [36] C. Cavallo, G. Filardo, E. Mariani et al., “Comparison of platelet- [22] D. M. D. Ehrenfest, L. Rasmusson, and T. Albrektsson, “Classi- rich plasma formulations for cartilage healing: an in vitro study,” fication of platelet concentrates: from pure platelet-rich plasma The Journal of Bone and Joint Surgery—American Volume,vol. (P-PRP) to leucocyte- and platelet-rich fibrin (L-PRF),” Trends 96,no.5,pp.423–429,2014. in Biotechnology,vol.27,no.3,pp.158–167,2009. [37] A. S. Wasterlain, H. J. Braun, and J. L. Dragoo, “Contents and [23] S. P.Arnoczky, D. Delos, and S. A. Rodeo, “What is Platelet-Rich formulations of platelet-rich plasma,” Operative Techniques in plasma?” Operative Techniques in Sports Medicine,vol.19,no.3, Orthopaedics,vol.22,no.1,pp.33–42,2012. pp. 142–148, 2011. [38] A. D. Mazzocca, M. B. R. McCarthy, D. M. Chowaniec et al., [24]E.Anitua,M.M.Zalduendo,M.H.Alkhraisat,andG.Orive, “Platelet-rich plasma differs according to preparation method “Release kinetics of platelet-derived and plasma-derived growth and human variability,” The Journal of Bone & Joint Surgery— factorsfromautologousplasmarichingrowthfactors,”Annals American Volume,vol.94,no.4,pp.308–316,2012. of Anatomy,vol.195,no.5,pp.461–466,2013. [39] J. Magalon, O. Bausset, N. Serratrice et al., “Characterization [25] W. K. Hsu, A. Mishra, S. R. Rodeo et al., “Platelet-rich plasma andcomparisonof5platelet-richplasmapreparationsina in orthopaedic applications: evidence-based recommendations single-donor model,” Arthroscopy, vol. 30, no. 5, pp. 629–638, for treatment,” The Journal of the American Academy of 2014. Orthopaedic Surgeons,vol.21,no.12,pp.739–748,2013. [40]A.Motolese,F.Vignati,A.Antelmi,andV.Saturni,“Effec- [26]A.Busilacchi,A.Gigante,M.Mattioli-Belmonte,S.Manzotti, tiveness of platelet-rich plasma in healing necrobiosis lipoidica and R. A. A. Muzzarelli, “Chitosan stabilizes platelet growth diabeticorum ulcers,” Clinical and Experimental Dermatology, factors and modulates stem cell differentiation toward tissue vol.40,no.1,pp.39–41,2015. regeneration,” Carbohydrate Polymers,vol.98,no.1,pp.665– [41] A. M. Haleem, A. A. El Singergy, D. Sabry et al., “The clinical 676, 2013. use of human culture-expanded autologous bone marrow mes- [27] B. Kutlu, R. S. T. Aydın, A. C. Akman, M. Gum¨ us¨¸derelioglu, and enchymal stem cells transplanted on platelet-rich fibrin glue in R. M. Nohutcu, “Platelet-rich plasma-loaded chitosan scaffolds: the treatment of articular cartilage defects: a pilot study and preparation and growth factor release kinetics,” Journal of preliminary results,” Cartilage,vol.1,no.4,pp.253–261,2010. Biomedical Materials Research Part B: Applied Biomaterials,vol. [42] M. Sanchez,´ J. Azofra, E. Anitua et al., “Plasma rich in growth 101, no. 1, pp. 28–35, 2013. factors to treat an articular cartilage avulsion: a case report,” [28] L. Mazzucco, V. Balbo, E. Cattana, R. Guaschino, and P. Medicine and Science in Sports and Exercise,vol.35,no.10,pp. Borzini, “Not every PRP-gel is born equal Evaluation of growth 1648–1652, 2003. factor availability for tissues through four PRP-gel preparations: [43] G. Milano, E. Sanna Passino, L. Deriu et al., “The effect of Fibrinet, RegenPRP-Kit, Plateltex and one manual procedure,” platelet rich plasma combined with microfractures on the Vox Sanguinis,vol.97,no.2,pp.110–118,2009. treatment of chondral defects: an experimental study in a sheep [29] E. Lucarelli, R. Beretta, B. Dozza et al., “A recently developed model,” Osteoarthritis and Cartilage, vol. 18, no. 7, pp. 971–980, bifacial platelet-rich fibrin matrix,” European Cells and Materi- 2010. als,vol.20,pp.13–23,2010. [44] G. W.Lee, J.-H. Son, J.-D. Kim, and G.-H. Jung, “Is platelet-rich [30] M. A. Zumstein, S. Berger, M. Schober et al., “Leukocyte- and plasma able to enhance the results of arthroscopic microfracture platelet-rich fibrin (L-PRF) for long-term delivery of growth in early osteoarthritis and cartilage lesion over 40 years of age?” factor in rotator cuff repair: review, preliminary results and European Journal of Orthopaedic Surgery and Traumatology,vol. future directions,” Current Pharmaceutical Biotechnology,vol. 23,no.5,pp.581–587,2013. 13,no.7,pp.1196–1206,2012. [45] A. F. Manunta and A. Manconi, “The treatment of chondral [31] D. J. F. Moojen, P. A. M. Everts, R.-M. Schure et al., “Antimi- lesions of the knee with the microfracture technique and crobial activity of platelet-leukocyte gel against staphylococcus platelet-rich plasma,” Joints,vol.1,no.4,pp.167–170,2013. aureus,” Journal of Orthopaedic Research,vol.26,no.3,pp.404– [46] A. Guney, M. Akar, I. Karaman, M. Oner, and B. Guney, 410, 2008. “Clinical outcomes of platelet rich plasma (PRP) as an adjunct [32] E. A. Sundman, B. J. Cole, and L. A. Fortier, “Growth factor and to microfracture surgery in osteochondral lesions of the talus,” catabolic cytokine concentrations are influenced by the cellular Knee Surgery, Sports Traumatology, Arthroscopy,2013. composition of platelet-rich plasma,” American Journal of Sports [47] E. Kon, G. Filardo, B. Di Matteo, F. Perdisa, and M. Marcacci, Medicine, vol. 39, no. 10, pp. 2135–2140, 2011. “PRP-augmented scaffolds for cartilage regeneration: a system- [33] H. J. Braun, H. J. Kim, C. R. Chu, and J. L. Dragoo, “The effect atic review,” Operative Techniques in Sports Medicine,vol.21,no. of platelet-rich plasma formulations and blood products on 2, pp. 108–115, 2013. human synoviocytes: Implications for intra-articular injury and [48] E. Kon, G. Filardo, M. Delcogliano et al., “Platelet autologous therapy,” The American Journal of Sports Medicine,vol.42,no. growth factors decrease the osteochondral regeneration capa- 5, pp. 1204–1210, 2014. bility of a collagen-hydroxyapatite scaffold in a sheep model,” [34] E. Anitua, M. M. Zalduendo, R. Prado, M. H. Alkhraisat, and BMC Musculoskeletal Disorders, vol. 11, article 220, 2010. G. Orive, “Morphogen and proinflammatory cytokine release [49] Y.Y.Qi,X.Chen,Y.Z.Jiangetal.,“Localdeliveryofautologous kinetics from PRGF-Endoret fibrin scaffolds: evaluation of the platelet in collagen matrix simulated in situ articular cartilage BioMed Research International 17

repair,” Cell Transplantation, vol. 18, no. 10-11, pp. 1161–1169, [63] S. Giannini, R. Buda, M. Cavallo et al., “Cartilage repair 2009. evolution in post-traumatic osteochondral lesions of the talus: [50]Y.Sun,Y.Feng,C.Q.Zhang,S.B.Chen,andX.G.Cheng,“The from open field autologous chondrocyte to bone-marrow- regenerative effect of platelet-rich plasma on healing in large derived cells transplantation,” Injury, vol. 41, no. 11, pp. 1196– osteochondral defects,” International Orthopaedics,vol.34,no. 1203, 2010. 4, pp. 589–597, 2010. [64] S. Giannini, R. Buda, M. Battaglia et al., “One-step repair in talar [51] C. Spadaccio, A. Rainer, M. Trombetta et al., “Poly-l-lactic osteochondral lesions: 4-year clinical results and T2-mapping acid/hydroxyapatite electrospun nanocomposites induce chon- capability in outcome prediction,” The American Journal of drogenic differentiation of human MSC,” Annals of Biomedical Sports Medicine,vol.41,no.3,pp.511–518,2013. Engineering,vol.37,no.7,pp.1376–1389,2009. [65] R. Buda, F. Vannini, M. Cavallo, B. Grigolo, A. Cenacchi, and [52] L. Zheng, X. Jiang, X. Chen, H. Fan, and X. Zhang, “Eval- S. Giannini, “Osteochondral lesions of the knee: a new one- uation of novel in situ synthesized nano-hydroxyapatite/col- step repair technique with bone-marrow-derived cells,” The lagen/alginate hydrogels for osteochondral tissue engineering,” Journal of Bone and Joint Surgery—American Volume,vol.92, Biomedical Materials,vol.9,no.6,ArticleID065004,2014. supplement 2, pp. 2–11, 2010. [66] R. Buda, F. Vannini, M. Cavallo et al., “One-step arthroscopic [53] A. A. M. Dhollander, F. de Neve, K. F. Almqvist et al., “Autol- technique for the treatment of osteochondral lesions of the ogous matrix-induced chondrogenesis combined with platelet- knee with bone-marrow-derived cells: three years results,” rich plasma gel: technical description and a five pilot patients Musculoskeletal Surgery,vol.97,no.2,pp.145–151,2013. report,” Knee Surgery, Sports Traumatology, Arthroscopy,vol.19, no. 4, pp. 536–542, 2011. [67] G. Filardo, E. Kon, A. di Martino et al., “Platelet-rich plasma vs hyaluronic acid to treat knee degenerative pathology: study [54] A. Siclari, G. Mascaro, C. Gentili, R. Cancedda, and E. Boux, design and preliminary results of a randomized controlled trial,” “A Cell-free scaffold-based cartilage repair provides improved BMC Musculoskeletal Disorders, vol. 13, article 229, 2012. function hyaline-like repair at one year,” Clinical Orthopaedics [68] S.Sampson,M.Reed,H.Silvers,M.Meng,andB.Mandelbaum, and Related Research,vol.470,no.3,pp.910–919,2012. “Injection of platelet-rich plasma in patients with primary and [55] A. Siclari, G. Mascaro, C. Gentili, C. Kaps, R. Cancedda, and E. secondary knee osteoarthritis: a pilot study,” American Journal Boux, “Cartilage repair in the knee with subchondral drilling of Physical Medicine & Rehabilitation,vol.89,no.12,pp.961– augmented with a platelet-rich plasma-immersed polymer- 969, 2010. based implant,” Knee Surgery, Sports Traumatology, Arthroscopy, [69] A. Wang-Saegusa, R. Cugat, O. Ares, R. Seijas, X. Cusco,´ and M. vol. 22, no. 6, pp. 1225–1234, 2014. Garcia-Balletbo,´ “Infiltration of plasma rich in growth factors [56]S.Wakitani,K.Imoto,T.Yamamoto,M.Saito,N.Murata, for osteoarthritis of the knee short-term effects on function and and M. Yoneda, “Human autologous culture expanded bone quality of life,” Archives of Orthopaedic and Trauma Surgery,vol. marrow-mesenchymal cell transplantation for repair of carti- 131, no. 3, pp. 311–317, 2011. lage defects in osteoarthritic knees,” Osteoarthritis and Carti- [70]E.Kon,R.Buda,G.Filardoetal.,“Platelet-richplasma:intra- lage,vol.10,no.3,pp.199–206,2002. articular knee injections produced favorable results on degen- [57] S. Wakitani, T. Okabe, S. Horibe et al., “Safety of autologous erative cartilage lesions,” Knee Surgery, Sports Traumatology, bone marrow-derived mesenchymal stem cell transplantation Arthroscopy,vol.18,no.4,pp.472–479,2010. for cartilage repair in 41 patients with 45 joints followed for [71] G. Filardo, E. Kon, R. Buda et al., “Platelet-rich plasma intra- up to 11 years and 5 months,” Journal of Tissue Engineering and articular knee injections for the treatment of degenerative Regenerative Medicine,vol.5,no.2,pp.146–150,2011. cartilage lesions and osteoarthritis,” Knee Surgery, Sports Trau- [58]T.Turajane,T.Thitiset,S.Honsawek,U.Chaveewanakorn,J. matology, Arthroscopy,vol.19,no.4,pp.528–535,2011. Aojanepong, and K. I. Papadopoulos, “Assessment of chondro- [72] M. Napolitano, S. Matera, M. Bossio et al., “Autologous platelet genic differentiation potential of autologous activated periph- gel for tissue regeneration in degenerative disorders of the knee,” eral blood stem cells on human early osteoarthritic cancellous Blood Transfusion,vol.10,no.1,pp.72–77,2012. tibial bone scaffold,” Musculoskeletal Surgery,vol.98,no.1,pp. [73] J. I. Torrero, F. Aroles, and D. Ferrer, “Treatment of knee 35–43, 2014. chondropathy with platelet rich plasma. Preliminary results at [59] M.-W. Deng, S.-J. Wei, T.-L. Yew et al., “Cell therapy with G- 6 months of follow-up with only one injection,” JournalofBio- CSF-mobilized stem cells in a rat osteoarthritis model,” Cell logical Regulators and Homeostatic Agents,vol.26,supplement Transplantation,2014. 1, no. 2, pp. 71S–78S, 2012. [60] W.-L. Fu, C.-Y. Zhou, and J.-K. Yu, “Anew source of mesenchy- [74] A. Gobbi, G. Karnatzikos, V. Mahajan, and S. Malchira, mal stem cells for articular cartilage repair: MSCs derived from “Platelet-rich plasma treatment in symptomatic patients with mobilized peripheral blood share similar biological character- knee osteoarthritis: preliminary results in a group of active istics in vitro and chondrogenesis in vivo as MSCs from bone patients,” Sports Health,vol.4,no.2,pp.162–172,2012. marrow in a rabbit model,” AmericanJournalofSportsMedicine, [75] B. Halpern, S. Chaudhury, S. A. Rodeo et al., “Clinical and vol.42,no.3,pp.592–601,2014. MRI outcomes after platelet-rich plasma treatment for knee [61] K.-Y. Saw, A. Anz, C. Siew-Yoke Jee et al., “Articular cartilage osteoarthritis,” Clinical Journal of Sport Medicine,vol.23,no.3, regeneration with autologous peripheral blood stem cells versus pp. 238–239, 2013. hyaluronic acid: a randomized controlled trial,” Arthroscopy, [76] S. A. Raeissadat, S. M. Rayegani, M. Babaee, and E. Ghorbani, vol. 29, no. 4, pp. 684–694, 2013. “The effect of platelet-rich plasma on pain, function, and quality [62] S. Giannini, R. Buda, F. Vannini, M. Cavallo, and B. Grigolo, of life of patients with knee osteoarthritis,” Pain Research and “One-step bone marrow-derived cell transplantation in talar Treatment,vol.2013,ArticleID165967,7pages,2013. osteochondral lesions,” Clinical Orthopaedics and Related [77] S.-J. Jang, J.-D. Kim, and S.-S. Cha, “Platelet-rich plasma (PRP) Research, vol. 467, no. 12, pp. 3307–3320, 2009. injections as an effective treatment for early osteoarthritis,” 18 BioMed Research International

European Journal of Orthopaedic Surgery and Traumatology,vol. [91] M. Battaglia, F. Guaraldi, F. Vannini et al., “Efficacy of 23,no.5,pp.573–580,2013. ultrasound-guided intra-articular injections of platelet-rich [78]G.Mangone,A.Orioli,A.Pinna,andP.Pasquetti,“Infiltrative plasma versus hyaluronic acid for hip osteoarthritis,” Orthope- treatment with platelet rich plasma (PRP) in gonarthrosis,” dics,vol.36,no.12,pp.e1501–e1508,2013. Clinical Cases in Mineral and Bone Metabolism,vol.11,no.1,pp. [92] O. Mei-Dan, M. R. Carmont, L. Laver, G. Mann, N. Maffulli, 67–72, 2014. and M. Nyska, “Platelet-rich plasma or hyaluronate in the [79] A. Gobbi, D. Lad, and G. Karnatzikos, “The effects of repeated management of osteochondral lesions of the talus,” American intra-articular PRP injections on clinical outcomes of early Journal of Sports Medicine,vol.40,no.3,pp.534–541,2012. osteoarthritis of the knee,” Knee Surgery, Sports Traumatology, [93] G.D.Abrams,R.M.Frank,L.A.Fortier,andB.J.Cole,“Platelet- Arthroscopy,2014. rich plasma for articular cartilage repair,” Sports Medicine and [80] M. Sanchez,´ J. Guadilla, N. Fiz, and I. Andia, “Ultrasound- Arthroscopy Review,vol.21,no.4,pp.213–219,2013. guided platelet-rich plasma injections for the treatment of [94] E. Anitua, M. Sanchez,J.J.Aguirre,R.Prado,S.Padilla,´ osteoarthritis of the hip,” Rheumatology,vol.51,no.1,pp.144– and G. Orive, “Efficacy and safety of plasma rich in growth 150, 2012. factors intra-articular infiltrations in the treatment of knee [81] M. Sanchez,´ E. Anitua, J. Azofra, J. J. Aguirre, and I. Andia, osteoarthritis,” Arthroscopy,vol.30,no.8,pp.1006–1017,2014. “Intra-articular injection of an autologous preparation rich in [95]K.-V.Chang,C.-Y.Hung,F.Aliwarga,T.-G.Wang,D.-S.Han, growth factors for the treatment of knee OA: a retrospective and W.-S. Chen, “Comparative effectiveness of platelet-rich cohort study,” Clinical and Experimental Rheumatology,vol.26, plasma injections for treating knee joint cartilage degenerative no. 5, pp. 910–913, 2008. pathology: a systematic review and meta-analysis,” Archives of [82] E. Kon, B. Mandelbaum, R. Buda et al., “Platelet-rich plasma Physical Medicine and Rehabilitation, vol. 95, no. 3, pp. 562–575, intra-articular injection versus hyaluronic acid viscosupple- 2014. mentation as treatments for cartilage pathology: from early [96]A.P.Dold,M.G.Zywiel,D.W.Taylor,T.Dwyer,andJ. degeneration to osteoarthritis,” Arthroscopy, vol. 27, no. 11, pp. Theodoropoulos, “Platelet-rich plasma in the management of 1490–1501, 2011. articular cartilage pathology: a systematic review,” Clinical [83] M.Li,C.Zhang,Z.Ai,T.Yuan,Y.Feng,andW.Jia,“Therapeutic Journal of Sport Medicine,vol.24,no.1,pp.31–43,2014. effectiveness of intra-knee-articular injection of platelet-rich [97] A. Khoshbin, T. Leroux, D. Wasserstein et al., “The efficacy plasma on knee articular cartilage degeneration,” Zhongguo Xiu of platelet-rich plasma in the treatment of symptomatic knee Fu Chong Jian Wai Ke Za Zhi,vol.25,no.10,pp.1192–1196,2011. osteoarthritis: a systematic review with quantitative synthesis,” [84] T. Spakova,´ J. Rosocha, M. Lacko, D. Harvanova,´ and A. Arthroscopy,vol.29,no.12,pp.2037–2048,2013. Gharaibeh, “Treatment of knee joint osteoarthritis with autolo- [98] A. M. Pourcho, J. Smith, S. J. Wisniewski, and J. L. Sellon, gousplatelet-richplasmaincomparisonwithhyaluronicacid,” “Intraarticular platelet-rich plasma injection in the treatment AmericanJournalofPhysicalMedicine&Rehabilitation,vol.91, of knee osteoarthritis: review and recommendations,” The no. 5, pp. 411–417, 2012. AmericanJournalofPhysicalMedicineandRehabilitation,vol. 93,no.11,supplement3,pp.S108–S121,2014. [85] F. Cerza, S. Carn`ı, A. Carcangiu et al., “Comparison between hyaluronic acid and platelet-rich plasma, intra-articular infil- [99] D. C. Tietze, K. Geissler, and J. Borchers, “The effects of platelet- tration in the treatment of gonarthrosis,” The American Journal rich plasma in the treatment of large-joint osteoarthritis: a of Sports Medicine,vol.40,no.12,pp.2822–2827,2012. systematic review,” The Physician and Sportsmedicine,vol.42, no. 2, pp. 27–37, 2014. [86] M. Sanchez,´ N. Fiz, J. Azofra et al., “A randomized clinical trial evaluating plasma rich in growth factors (PRGF-Endoret) ver- [100]Y.-G.Park,S.B.Han,S.J.Song,T.J.Kim,andC.-W.Ha, sus hyaluronic acid in the short-term treatment of symptomatic “Platelet-rich plasma therapy for knee joint problems: review of knee osteoarthritis,” Arthroscopy, vol. 28, no. 8, pp. 1070–1078, the literature, current practice and legal perspectives in Korea,” 2012. Knee Surgery & Related Research, vol. 24, no. 2, pp. 70–78, 2012. [87] V. Vaquerizo, M. A.´ Plasencia, I. Arribas et al., “Comparison [101] J. A. Textor, N. H. Willits, and F. Tablin, “Synovial fluid of intra-articular injections of plasma rich in growth factors growth factor and cytokine concentrations after intra-articular (PRGF-Endoret) versus durolane hyaluronic acid in the treat- injection of a platelet-rich product in horses,” The Veterinary ment of patients with symptomatic osteoarthritis: a randomized Journal,vol.198,no.1,pp.217–223,2013. controlled trial,” Arthroscopy,vol.29,no.10,pp.1635–1643,2013. [102] J. Freitag, A. Barnard, and A. Rotstein, “Photoactivated platelet- [88] F. Say, D. Gurler,¨ K. Yener, M. Bulb¨ ul,¨ and M. Malkoc, rich plasma therapy for a traumatic knee chondral lesion,” BMJ “Platelet-rich plasma injection is more effective than hyaluronic Case Reports,vol.2012,2012. acid in the treatment of knee osteoarthritis,” Acta Chirurgiae [103] I. Andia and M. Abate, “Knee osteoarthritis: hyaluronic acid, Orthopaedicae et Traumatologiae Cechoslovaca,vol.80,no.4, platelet-rich plasma or both in association?” Expert Opinion on pp. 278–283, 2013. Biological Therapy,vol.14,no.5,pp.635–649,2014. [89] S. Patel, M. S. Dhillon, S. Aggarwal, N. Marwaha, and A. Jain, [104]J.Pak,J.-J.Chang,J.H.Lee,andS.H.Lee,“Safetyreporting “Treatment with platelet-rich plasma is more effective than on implantation of autologous adipose tissue-derived stem cells placebo for knee osteoarthritis: a prospective, double-blind, with platelet-rich plasma into human articular joints,” BMC randomized trial,” The American Journal of Sports Medicine,vol. Musculoskeletal Disorders, vol. 14, article 337, 2013. 41, no. 2, pp. 356–364, 2013. [105]J.Pak,J.H.Lee,andS.H.Lee,“Anovelbiologicalapproachto [90]R.Hart,A.Safi,M.Komzak,´ P. Jajtner, M. Puskeiler, and P. treat chondromalacia patellae,” PLoS ONE,vol.8,no.5,Article Hartova,´ “Platelet-rich plasma in patients with tibiofemoral ID e64569, 2013. cartilage degeneration,” Archives of Orthopaedic and Trauma [106] R. Yoshida and M. M. Murray, “Peripheral blood mononuclear Surgery,vol.133,no.9,pp.1295–1301,2013. cells enhance the anabolic effects of platelet-rich plasma on BioMed Research International 19

anterior cruciate ligament fibroblasts,” Journal of Orthopaedic Research,vol.31,no.1,pp.29–34,2013. [107]G.Filardo,E.Kon,M.T.P.Ruizetal.,“Platelet-rich plasma intra-articular injections for cartilage degeneration and osteoarthritis: single- versus double-spinning approach,” Knee Surgery, Sports Traumatology, Arthroscopy,vol.20,no.10,pp. 2082–2091, 2012. [108] E. Assirelli, G. Filardo, E. Mariani et al., “Effect of two different preparations of platelet-rich plasma on synoviocytes,” Knee Surgery, Sports Traumatology, Arthroscopy,2014. [109] A.Getgood,F.Henson,R.Brooks,L.A.Fortier,andN.Rushton, “Platelet-rich plasma activation in combination with biphasic osteochondral scaffolds-conditions for maximal growth factor production,” Knee Surgery, Sports Traumatology, Arthroscopy, vol. 19, no. 11, pp. 1942–1947, 2011. [110] S. Terada, S. Ota, M. Kobayashi et al., “Use of an antifibrotic agent improves the effect of platelet-rich plasma on muscle healing after injury,” The Journal of Bone & Joint Surgery Series A, vol. 95, no. 11, pp. 980–988, 2013. [111] N. Pallua, T. Wolter, and M. Markowicz, “Platelet-rich plasma in burns,” Burns,vol.36,no.1,pp.4–8,2010. [112] T. Nagai, M. Sato, T. Kutsuna et al., “Intravenous administration of anti-vascular endothelial growth factor humanized monoclonal antibody bevacizumab improves articular cartilage repair,” Arthritis Research & Therapy,vol.12,no.5,articleR178, 2010. [113] Y. Mifune, T. Matsumoto, K. Takayama et al., “The effect of platelet-richplasmaontheregenerativetherapyofmuscle derived stem cells for articular cartilage repair,” Osteoarthritis and Cartilage,vol.21,no.1,pp.175–185,2013. Hindawi Publishing Corporation BioMed Research International Volume 2014, Article ID 926481, 8 pages http://dx.doi.org/10.1155/2014/926481

Research Article Hyperuricemic PRP in Tendon Cells

I. Andia,1 E. Rubio-Azpeitia,1 and N. Maffulli2,3

1 Regenerative Medicine Laboratory, BioCruces, Cruces University Hospital, 48903 Barakaldo, Spain 2 Department of Musculoskeletal Disorders, School of Medicine and Surgery, University of Salerno, 89100 Salerno, Italy 3 Queen Mary University of London, Barts and the London School of Medicine and Dentistry Centre for Sports and Exercise Medicine, MileEndHospital,275BancroftRoad,LondonE14DG,UK

Correspondence should be addressed to I. Andia; [email protected]

Received 30 May 2014; Revised 31 July 2014; Accepted 4 August 2014; Published 8 September 2014

Academic Editor: Giuseppe Filardo

Copyright © 2014 I. Andia et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Platelet-rich plasma (PRP) is injected within tendons to stimulate healing. Metabolic alterations such as the metabolic syndrome, diabetes, or hyperuricemia could hinder the therapeutic effect of PRP. We hypothesise that tendon cells sense high levels ofuric acid and this could modify their response to PRP.Tendon cells were treated with allogeneic PRPs for 96 hours. Hyperuricemic PRP did not hinder the proliferative actions of PRP. The gene expression pattern of inflammatory molecules in response to PRP showed absence of IL-1b and COX1 and modest expression of IL6, IL8, COX2, and TGF-b1. IL8 and IL6 proteins were secreted by tendon cells treated with PRP. The synthesis of IL6 and IL8 proteins induced by PRP is decreased significantly in the presence of hyperuricemia (P = 0.017 and P = 0.012, resp.). Concerning extracellular matrix, PRP-treated tendon cells displayed high type-1 collagen, moderate type-3 collagen, decorin, and hyaluronan synthase-2 expression and modest expression of scleraxis. Hyperuricemia modified the expression pattern of extracellular matrix proteins, upregulating COL1 (P = 0.036) and COMP (P = 0.012) and downregulating HAS2 (P = 0.012). Positive correlations between TGF-b1 and type-1 collagen (R = 0.905, P = 0.002) and aggrecan (R = 0.833, P = 0.010) and negative correlations between TGF-b1 and IL6 synthesis (R = −0.857, P = 0.007) and COX2 (R = −0.810, P = 0.015) were found.

1. Introduction Hyperuricemia is a relatively common metabolic disease withaprevalenceofmorethan10%incertainpopulations The use of platelet-rich plasma (PRP) to treat tendon pathol- [7]. When uric acid, the end product of purines metabolism, ogy has widely expanded in the last five years [1]. PRP is rises above 6.8 mg/dL in peripheral blood, urate sediments injected within tendons aiming at healing, reducing pain, and can form within tissues. Actually, hyperuricemic patients improving tendon function [2]. A recent meta-analysis has have supersaturated levels of uric acid in their body fluids, shown a significant reduction of pain at three years, six years, and a minority develop gout when uric acid condensates and one year after PRP treatment in different tendons [3]. and forms monosodium urate crystals (MSU). The latter can PRP injection is an autologous treatment derived from deposit in skin, tendons, and synovium [8] stimulating acute the patient’s own blood; thus metabolic alterations such as inflammatory flares. the metabolic syndrome, diabetes, or hyperuricemia could Additionally, extracellular uric acid concentration rises hinder the therapeutic effect of autologous PRP in these locally upon cell death. In fact, cells normally contain very patients. Despite a higher risk of suffering tendinopathy4 [ ], high levels of uric acid intracellularly [9]andproduceeven patients with metabolic diseases are often excluded from the more upon death, signalling danger. Cell death is a patholog- clinical trials testing PRP efficacy [5, 6]. However, whether ical event in tendinopathy, affecting not only the area where metabolic disorders should be an exclusion criterion from the tendinopathy is located but also the adjacent tendon tissue PRP therapies is open to question. [10]. Thus, the response of tendon cells to hyperuricemia 2 BioMed Research International may help to understand some aspects of tendinopathy. Recent from three young healthy patients during anterior cruci- data show that high serum uric acid is associated with ate ligament reconstruction surgery with semitendinosus hypertension, kidney disease, cardiovascular disease, and tendon, after informed consent and local ethic committee diabetes [11]. However, the association of hyperuricemia with approval. Tendon fragments, which otherwise would have tendinopathy is still ambiguous. been discarded, were minced and incubated with active ∘ Previous studies have described the pathophysiological 0.3% Collagenase II (Gibco, Life Technologies) at 37 Cfor role of MSU crystals in alerting the immune system to 40 min. The cell suspension was centrifuged, resuspended danger, and the possibility of suffering harm is sensed by in DMEM F-12 (Gibco, Life Technologies) supplemented monocytes/macrophages that drive an inflammatory reaction with 5% Penicillin/Streptomycin solution (5,000 U/mL Pen. by releasing active IL-1b [12]. Whether other cell types, 5,000 𝜇g/mL Strep. Gibco, Life Technologies), filtered, and molecular sensors, and synergic mediators participate in seeded in a 6-well plate. Cells were allowed to grow until the inflammatory response is being explored. For example, subconfluence and then were trypsinized (TryPLE select serum amyloid A (SAA) protein primed synovial fibroblasts 1x,Gibco,LifeTechnologies)andpassagedtoaT75flask 2 to produce active IL-1b and IL-1a when exposed to MSU at a density of 4000 cells/cm . All the experiments were crystals [13]. SAA is a proinflammatory protein present in performed in cells at passages between two and three. PRP. In addition to SAA and uric acid, PRP also contains other proinflammatory stimuli of self-origin that transmit 2.3. Preparation of PRP and Hyperuricemic PRP. Pure PRP, danger signals including hyaluronan fragments, ATP, DNA, thesameformulationweuseinclinicalapplications,was RNA, and HMGB1 [14]. The levels of uric acid are the same in obtained by single spin method as previously described [17]. PRP as in serum (3.4–7.2mg/dL in men and 2.4–6.1 mg/dL in Leukocyte and platelet counts were assessed in peripheral women), since uric acid is not a platelet-derived product but blood and PRP using a Beckman Coulter. a result of hepatic metabolism. Platelet activation and lysis were performed by three We raised the hypothesis that tendon cells sense elevated freezethawcycles,thenfilteredthrough0.22𝜇mfilters,and ∘ levels of uric acid and this could modify their response to PRP. stored frozen at −80 C. In cell culture, heparin was added We explored whether hyperuricemic PRP induces inflamma- at 2 U/mL to PRP lysates. A supersaturated solution of uric tory, phenotypic, or metabolic changes in tendon cells. To acid (Sigma Cat. no. U2625) was prepared with 1 mg uric acid test this hypothesis, we examined in parallel the response in1mLofDMEMF12(100mg/dL).Thefinalconcentration of tendon cells to PRP and hyperuricemic PRP exposure by of uric acid in hyperuricemic PRP cultures was ≈20 mg/dL, assessing the expression of specific tendon tissue molecules, that is, the upper concentration in most kits designed for including type 1 collagen (COL1A1), scleraxis (SCX), decorin hyperuricemicpatientstomonitortheiruricacidlevelsin (DCN), tenomodulin (TNMD), cartilage oligomeric protein blood. (COMP), and aggrecan (ACAN). In addition, the expression of molecules that characterize early tissue repair such as type 3collagen(COL3A1)andhyaluronansynthase2(HAS2) 2.4. Cell Proliferation Assays. Cells were harvested from was determined as well as the expression of inflammatory T75 flasks after trypsinization (TryPLE select, Gibco, Life Technologies) and seeded in 96-well plates (Corning) at modulators IL-1b, IL-8, COX-1, and COX2. Finally, we have 2 explored whether hyperuricemic PRP may influence the a density of 4000 cells/cm and starved overnight before synthesis of pleiotropic cytokines such as TGF-beta1 and IL- treatments were performed. Cells were treated with PRP 6, which might have a role in enhancing collagen synthesis lysate or hyperuricemic PRP lysate from the six donors; in [15, 16]. parallel, as a reference, cells were cultured with 10% FBS. Cell proliferation was measured at 0, 24, 48, 72, and 96 h with the XTT method. Population doubling time was used to determine prolif- 2. Materials and Methods eration rate as a total culture time divided by the number 𝑁 𝑁 2 𝑐/ 0 𝑁 2.1. Demographic Characteristics of PRP and Cell Donors. We of generations calculated as Log ,where 𝑐 is the 𝑁 have used primary tendon cells (up to passage 3) isolated from population at confluence and 0 is the seeded cells. three young male healthy donors (T1, T2, and T3) of similar age (27±1.4 years), in order to minimize heterogeneity of cells 2.5. RNA Extraction and Real-Time RT-PCR. Total RNA was among donors. On the other hand, we have used PRP from extracted from tenocytes at passages 2-3, after 4 days of six donors, three male and three female donors with different PRP treatment using High Pure RNA Isolation Kit (Roche), age (median age = 41.5 years, range = 26–62) and hormonal following manufacturer instructions. RNA concentrations status.Themeanuricacidandcholesterollevelswere4.4 ± were measured with the NanoDrop 2000 (Thermo Scientific, 0.8 mg/dL and 223.8±44.2 mg/dL. The PRPs contained 2.29± Waltham, MA, USA). 0.50 fold peripheral blood platelet count, and mean platelet 1 𝜇g RNA was reverse-transcribed to cDNA using random volume was 7.65 ± 1.01 ftL. Leukocytes were not detected. hexamers in 20 𝜇L, (SuperScript III First-Strand Synthesis System, Invitrogen, Life Technologies). For the real-time PCR, cDNA from each sample was diluted 5-fold and 2 𝜇L 2.2. Isolation and Culture of Tendon Cells. Human ten- of cDNA (20 ng) was mixed with Power SYBR Green PCR don samples were obtained, under anonymous conditions, Master Mix (Applied Biosystems, Life Technologies) and 5 BioMed Research International 3 pmoles of primers to a final volume of 20 𝜇L. Real-time was 40.365 (SD = 2.34) hours in the presence of 10% PRP and PCR reactions were performed on the ABI-7900 (Applied 44.72 (SD = 1.14) hours when cultured with 10% FBS. Biosystems, Life Technologies, Carlsbad, CA, USA). The PCR Hyperuricemia did not affect cell proliferation; the teno- reactions were performed in triplicate for each sample. cyte numbers increased by 548% and 545.5%, respectively We assessed gene expression for tendon tissue markers (𝑡 = 0.59; 𝑃 = 0.954). The population doubling time of scleraxis (SCX), decorin (DCN), tenomodulin (TNMD), the cells cultured in PRP was 40.40 hours (SD = 6.105); matrix proteins including COMP,COL1A1, and COL3A1, and the doubling time of the population of cells cultured in the enzyme for HA synthesis, HAS2. In addition, the expres- hyperuricemic PRP was 39.97 hours (SD = 5.265) (Figure 1). sion of cartilage markers COL2A1, aggrecan, and SOX9 was assessed. Likewise inflammatory modulators such as IL-1b, 3.2. Response of Tendon Cells to PRP Treatment: Gene Expres- COX1, COX2, and pleiotropic cytokines including IL-6, IL-8, sion Pattern of Inflammation and Extracellular Matrix. After and TGF-beta1 were assessed. Amplification reactions were 96 hours of treatment with PRP, the tendon cells showed performed for GAPDH and TBP as reference genes. Primers modest expression of IL-6, IL-8, and COX2 (Table 2). Also, and annealing temperatures are shown in Table 1 [18, 19]. the tendon cells treated with PRP showed high expression of Standard curves were generated for every gene; the slope of type 1 collagen and moderate expression of type 3 collagen the curves was always between 3.2 and 3.7.Relative expression and HAS2. The expression of scleraxis and COMP was low levels of tendon cells treated with PRP were normalized using in T1 and T2 and moderate in T3. These cells also showed glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and a moderately low expression of TGF-b1. Instead, tendon cells 2−ΔCt calculated by means of the method (Ct, cycle threshold). treated with PRP did not express TNMD, COL2A1, SOX9, IL- To assess the effect of hyperuricemia, relative expression 1beta, and COX1. levels were normalized to the average of GAPDH and TBP, and gene expression data were calculated as fold versus −ΔΔ control using the 2 Ct (hyperuricemic PRP versus PRP). 3.3. Hyperuricemia Modifies the Gene Expression Pattern and Interleukin Synthesis by Tendon Cells in Response to PRP Treatment 2.6. Assessment of IL-6 (CXCL6) and IL-8 (CXCL8) in the Conditioned Media. IL-6 and IL-8 were measured in cell 3.3.1. Hyperuricemic PRP and Inflammation. The levels of IL- culture supernatants using EASIA kits (Invitrogen, Life Tech- 1beta and COX1 were not detectable (Ct > 32) when tendon nologies). The procedures were performed according to the cells were treated with PRP or hyperuricemic PRP.COX2 was manufacturer’sinstructions. Briefly, the reaction was detected significantly stimulated by hyperuricemia in T1 but not in by peroxidase-conjugated streptavidin followed by a substrate T2. There was evidence of expression and synthesis of two mixture that contained hydrogen peroxidase as a substrate pleiotropic interleukins, IL-8 (CXCL8) and IL-6 (CXCL6), in andABTSaschromogen.Theabsorbancewasmeasuredin the conditioned media. Constitutive synthesis of interleukins a microplate ELISA reader (PolarStar Omega, BMG Labtech, was IL-6, 416 pg/mL (range 328–503) and IL-8 166 pg/mL Offenburg, Germany) at 450 nm, and the concentration was (range 123–196). PRP induced a 3-fold increase over consti- calculated using standard curves. The contribution of 10% tutive values for IL-6 and 9.6-fold for IL-8. Notwithstanding, PRP was subtracted in order to obtain the cytokine amount hyperuricemic PRP induced a 2-fold increase of IL-6 and 3- produced by cells. fold increase of IL-8 over constitutive values. Remarkably, the expression and synthesis of IL-6 and IL-8 induced by PRP aredecreasedsignificantlyinthepresenceofhyperuricemia 2.7. Statistical Analysis. The experiments were performed in (Figures 2 and 3). triplicate for each of the six PRP donors per three tendon These findings corroborate changes in the inflammatory donors. The effects of PRP on proliferation are shown as response to PRP induced by hyperuricemia. means ± standard deviation (SD). The effect of PRP on tendon There was evidence of a statistically significant positive cells expression is shown as median and 25–75 percentiles. association between COX2 and IL-6 (𝑅 = 0.8330, 𝑃 = 0.010) Spearman coefficient was used to describe correlations. The and TGF-b1 (𝑅 = 0.81, 𝑃 = 0.015). There was evidence ofa effect of hyperuricemic PRP was expressed as the mRNA statistically significant negative association between IL-6 and ratio of hyperuricemic PRP versus PRP expression. 𝑃 values scleraxis (𝑅 = −0.711, 𝑃 = 0.048)andaggrecan(𝑅 = −0.726, were determined using Student’s 𝑡-test or Wilcoxon test for 𝑃 = 0.041). There was evidence of a statistically significant nonparametric matched values. A 𝑃 value of less than 0.05 positive association between the expression of COLA1 and was considered to be significant. Data were analyzed using aggrecan (𝑅 = 0.881, 𝑃 = 0.004)andscleraxis(𝑅 = 0.714, SPSS 18 (SPSS, Chicago, IL, USA). 𝑃 = 0.047). Additionally, there was evidence of a statistically significant positive association between the expression of 3. Results COMP and the expression of HAS2 (𝑅 = 0.826, 𝑃 = 0.011). Taken together, these results could indicate coregulation 3.1. Hyperuricemic PRP Does Not Interfere with PRP Induced of some proteins and can be used to infer that a greater Proliferation. After 96 hours in culture, PRP significantly inflammatory cell response to the molecular environment enhanced tendon cell proliferation when compared to FBS is associated with cell dedifferentiation and a decreased (𝑃 = 0.008). The doubling time of the tenocyte population synthesis of aggrecan. 4 BioMed Research International

Table 1: Real-time PCR primers used in this study.

󸀠 󸀠 󸀠 󸀠 ∘ Gene Forward primer (5 → 3 ) Reverse primer (5 → 3 )T(C) SCX CAGCCCAAACAGATCTGCACCTT CTGTCTTTCTGTCGCGGTCCTT 58 DCN GGTGGGCTGGCAGAGCATAAGT TGTCCAGGTGGGCAGAAGTCA 58 TNMD GAAGCGGAAATGGCACTGATGA TGAAGACCCACGAAGTAGATGCCA 60 COMP CCGACAGCAACGTGGTCTT CAGGTTGGCCCAGATGATG 55 ACAN ACAGCTGGGGACATTAGTGG GTGGAATGCAGAGGTGGTTT 55 SOX9 AGCGAACGCACATCAAGAC GCTGTAGTGTGGGAGGTTGAA 55 COL1A1 GGCAACAGCCGCTTCACCTAC GCGGGAGGACTTGGTGGTTTT 58 COL3A1 CACGGAAACACTGGTGGACAGATT ATGCCAGCTGCACATCAAGGAC 58 COL2A1 AACCAGATTGAGAGCATCCG AACGTTTGCTGGATTGGGGT 55 HAS2 GTCCCG GTGAGACAGATGAG ATGAGGCTGGGTCAAGCATAG 58 IL-1b TCCAAGGGGACAGGATATGGAGCA AGGCCCAAGGCCACAGGTATTT 58 IL-6 GAGGCACTGGCAGAAAACAACC CCTCAAACTCCAAAAGACCAGTGATG 58 IL-8 CTGTCTGGACCCCAAGGAAAACT GCAACCCTACAACAGACCCACAC 57 COX1 GGTTTGGCATGAAACCCTACACCT CCTCCAACTCTGCTGCCATCT 58 COX2 AACTGCGCCTTTTCAAGGATGG TGCTCAGGGACTTGAGGAGGGT 58 TGF-beta1 GAGGTCACCCGCGTGCTAATG CACGGGTTCAGGTACCGCTTCT 58 GAPDH GCATTGCCCTCAACGACCACT CCATGAGGTCCACCACCCTGT 58 TBP TGCACAGGAGCCAAGAGTGAA CACATCACAGCTCCCCACCA 58 Scleraxis (SCX), decorin (DCN), tenomodulin (TNMD), cartilage oligomeric protein (COMP), aggrecan (ACAN), SRY (sex determining region Y)-box 9 (SOX9), collagen type I alpha 1 (COL1A1), collagen type 3 alpha 1 (COL3A1), collagen type II alpha 1 (COL2A1), hyaluronan synthase 2 (HAS2), interleukin 1, beta (IL-1b), interleukin-6 (IL-6), interleukin-8 (IL-8), cytochrome c oxidase 1 (COX1), cytochrome c oxidase 2 (COX2), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and TATA box binding protein (TBP).

(a) (b)

Figure 1: Representative images of tendon cells (passage 2) (a) treated with PRP for 96 hours and (b) treated with hyperuricemic PRP for 96 hours, magnification 20x.

3.3.2. Changes in the Pattern of Expression of the Genes The expression of HAS2, the enzyme involved in hyaluro- Codifying Extracellular Matrix Proteins. In hyperuricemic nansynthesis,wassignificantlyreducedinhyperuricemic PRP conditions, the expression of type 1 collagen was sig- PRP compared with PRP (𝑃 = 0.012). nificantly increased𝑃 ( = 0.036)(Figure 4(a)). Similar to type 1 collagen, COMP expression was significantly increased by hyperuricemia, 𝑃 = 0.012. The expression of COL3A1, 4. Discussion the gene codifying type 3 collagen, is not altered by hyperuricemia, 𝑃 = 0.674. In addition, the expression of decorin We explored whether tendon cells can sense hyperuricemia did not change (𝑃 = 0.080)(Figure 4(b)). There was evidence in their biological milieu and whether hyperuricemic PRP of a statistically significant positive association between TGF- can incite tendon cells to switch to an inflammatory phe- b1 and type 1 collagen (𝑅 = 0.811, 𝑃 = 0.015)andTGF-b1and notype. We found that PRP induces a modest inflammatory aggrecan (𝑅 = 0.761, 𝑃 = 0.028). molecular response in tendon cells compared to constitutive BioMed Research International 5 0.828 0.590 0.6676 (0.616–10.98) (0.504–0.676) (0.4728–1.3547) )givenasmediansand25–75 Ct 0.568 0.007 −Δ 0.0202 2 (0.172–0.812) (0.006–0.008) (0.0124–0.0342) 0.02 2.058 0.045 OX9), collagen type I alpha 1 (COL1A1), collagen type 3 (0.016–0.159) (1.885–2.480) (0.039–0.057) ean of GAPDH and TBP ( -8 (IL-8), cytochrome c oxidase 1 (COX1), cytochrome c oxidase 2 0.149 0.088 0.048 (0.037–0.112) (0.117–0.227) (0.045–0.343) ) given as medians and 25–75 percentiles. Ct −Δ 2 0.166 0.052 0.805 (0.481–1.254) (0.149–0.172) (0.032–0.076) 1.697 2.256 0. 489 (1.444–2.216) (1.670–2.789) (0.419–0.854) 0.025 0.025 2.003 (1.91–5.17) (0.023–0.038) (0.020–0.030) ) treated with allogeneic PRP (six donors) for 96 hours, normalised to the m 1.517 7.052 3.558 (1.174–1.60) (2.831–5.468) (3.252–11.519) 137.16 158.67 74.792 (104.5–154.5) (40.05–113.63) (136.07–166.94) Table 2: Relative gene expression normalised to the mean of GAPDH and TBP ( 1.710 1.308 2.055 (0.816–1.610) (1.493–2.232) (1.909–2.974) SCX HAS2 COLA1 COLA3 COMP DCN IL6 COX2 IL8 ACAN TGF-b1 0.073 0.005 0.049 (0.057–0.113) (0.003–0.136) (0.035–0.068) Cell donor T1 T2 T3 percentiles. Scleraxis (SCX), decorin (DCN), tenomodulin (TNMD),alpha cartilage 1 oligomeric (COL3A1), protein collagen (COMP), type aggrecan (ACAN), II(COX2), SRY alpha glyceraldehyde (sex 3-phosphate 1 determining dehydrogenase (COL2A1), region (GAPDH), hyaluronan Y)-box and synthase 9 TATA box 2 (S binding (HAS2), protein interleukin-1, (TBP). beta (IL-1b), interleukin-6 (IL-6), interleukin Relative expression levels of tendon cells from three donors (T1, T2, and T3 6 BioMed Research International

50 PRP.Most commonly, tendon cells are used between passages 3 and 5, showing a more homogeneous behaviour, but being less representative of in vivo conditions. Actually, we have 40 found some heterogeneity between cell donors, which can be attributed to the early passage (passages 1–3). 30 One of the central observations in this study is that PRP induces modest inflammation, evidenced by the production ofIL-6,IL-8,COL1A1,andCOX2.Analogoustoourin 20 vitro model, in painful Achilles tendinopathy, the expres- PRP versus PRP PRP versus sion of COL1A1, COX2, and IL-6 increased compared with

mRNA ratio hyperuricemic ratio mRNA 10 normal tendon [16]. This could be attributed to the set of circumstances underlying the failed healing that occurs in ∗ tendinopathy and to the subsequent positive feedback reac- 0 tion. In fact, an inflammatory molecular response expressed TGF-b1 COX2 IL-6 IL-8 by local cells is crucial for tissue healing; PRP can reproduce this modest inflammatory response driving tendon cells Figure 2: Boxplots of modulators of inflammation. Boxes illustrate to produce IL-6 and IL-8. The latter is known not only the relative mRNA expression of modulators of inflammation (TGF- because of its ability to attract neutrophils but also for its b1, COX2, IL-6, and IL-8); the band inside the box is the median. proangiogenic properties. Actually, IL-8 could act in synergy mRNA folds of hyperuricemic PRP treated cells are calculated with angiogenic factors such as HGF and VEGF produced relative to PRP treated cells. IL-8 expression is significantly reduced by tendon cell in response to PRP [22, 23]. Angiogenesis and ∗𝑃 < 0.05 in cells treated with hyperuricemic PRP. . inflammation are closely linked in the early phases of tissue repair. Interestingly, hyperuricemia reduced significantly the expression and synthesis of IL-8. Whether the reduction in IL-8 in the context of hyperuricemia has relevant conse- 2.500 quences derived from reduced neutrophil infiltration and diminished angiogenesis in vivo is still unexplored. The synthesis of IL-6 is also reduced by hyperuricemia. 2.000 IL-6 may play a crucial role in tendon healing as tendon ∗ healing was significantly reduced in IL-6 knockout mice 1.500 8 [22].Moreover,IL-6playsaroleasmediatoroftheanti- inflammatory effects of exercise15 [ ]andisincreasedalong ∗ with COL1A1 expression in painful tendons [16]. More- 1.000 over, tendon is a highly mechanosensitive tissue, and both IL-6 and TGF-beta1 have been involved in transforming

Protein synthesis (pg/mL) synthesis Protein 500 mechanical loading into collagen synthesis after exercise [24]. Corroborating these findings, our experiments showed coregulation between these molecules embodied by evidence 0 of statistically significant associations in gene expression. IL-6 IL-6 uric IL-8 IL-8 uric Howcellssenseuricacidisnotclear.Inparticular, our experiments show that tendon cells sense uric acid Figure 3: Synthesis of IL-6 and IL-8 proteins. The concentration of but whether it could occur via TLR2 as in chondrocytes IL-6 and IL-8 is reduced in tendon cells treated with hyperuricemic is unexplored [25]. Actually, tenocytes express the main PRPcomparedtocellstreatedwithPRP.Dataarecomparedusing receptors involved in sterile inflammation, TLR2 and TLR4, ∗ the Wilcoxon signed-rank test for matched samples. 𝑃 < 0.05. [26], but it is not clear in what circumstances these receptors are functional. Uric acid can also enter the cell via specific transporters where it can modulate inflammatory and oxida- tive events. values and that hyperuricemia can mitigate this reaction. Priming TLR2 and TLR4 with other molecules such Furthermore, we report that hyperuricemia modifies the as SAA induced TLR-dependent production of IL-6 and expression pattern of extracellular matrix proteins induced by IL-8andfacilitatedtheinflammatoryactionsofMSUin PRP treatment. synoviocytes [13]. Hyperuricemic PRP can induce sterile One possible way of investigating whether hyperuricemia inflammation if uric acid behaves as an immunological may affect inflammation and tendon metabolism is to expose danger signal. While some data about the interactions of primary tendon cells to hyperuricemic PRP in vitro. immune cells [12], chondrocytes [25], or synovial fibroblasts To achieve the greatest approximation to the in vivo cell with MSU crystals are available [13], little is known about we have used cells up to passage 3 [20, 21]. the response of tendon cells to hyperuricemic fluids. Recent These cells exposed to PRP for 96 hours could bean data show that tendon-like fibroblasts interact with MSU acceptable representation of the in situ tenocytes treated with decreasing the expression and deposition of collagens [27]. BioMed Research International 7

25 25

∗ ∗ 20 20

15 15

10 10 PRP versus PRP PRP versus PRP versus PRP PRP versus 6 mRNA ratio hyperuricemic ratio mRNA 5 hyperuricemic ratio mRNA 5 3 ∗ 1 0 0

COL1A1 COL3A1 HAS2 SCX DCN COMP ACAN (a) (b)

Figure 4: Relative expression of (a) fibrillar extracellular matrix proteins and (b) nonfibrillar extracellular matrix proteins in tendon cells ∗ treatedwithhyperuricemicPRPcomparedwithcellstreatedwithPRP. 𝑃 < 0.05.

Corroborating these findings, we found further induction treatment. However, not only local tenocytes but also infil- of COX2 expression, but not of IL-1b and COX1, when trated innate immune cells respond to PRP cues. Therefore, tendon cells were further exposed to 100 ug of monosodium depending on the immunological microenvironment and uratecrystals(MSU)for24hafter96-hourtreatmentwith the reciprocal interactions, local cells can acquire distinct hyperuricemic PRP (data not shown). In these conditions, the functional properties. expression of IL-6 and IL-8 dropped below detection limits. Our results corroborate the idea that only crystallised Conflict of Interests uric acid induces inflammation. Indeed, in our experimental conditions, hyperuricemic PRP further enhanced the syn- The authors declare that there is no conflict of interests thesis of type I collagen and reduced the synthesis of IL-6 regarding the publication of this paper. and IL-8. This reduction may hinder the regenerative effects of PRP, assuming that they are linked to angiogenesis and inflammation. Acknowledgment The present results set the rationale for performing future This work was supported by SAIO2012-PE12BF007. in vivo research aiming to assess whether the depletion of IL- 6 and IL-8 hinders the regenerative effects of PRP in tendon lesions. As further data were collected about the angiogenic or References parainflammatory responses induced by PRP, we found that hyperuricemia is a minor stressor for tendon cells [28]. [1] I. Andia and N. Maffulli, “Platelet-rich plasma for muscle injury and tendinopathy,” Sports Medicine and Arthroscopy Review,vol. Our study has several limitations and from these data 21, no. 4, pp. 191–198, 2013. itisdifficulttoreachconclusionstobeextrapolatedto [2] I. Andia, M. Sanchez, and N. Maffulli, “Tendon healing and in vivo conditions. Some uncertainties can be unveiled platelet-rich plasma therapies,” Expert Opinion on Biological by coculturing tenocytes with monocytes/macrophages, as Therapy, vol. 10, no. 10, pp. 1415–1426, 2010. they synthesise major inflammatory triggers such as IL- [3]I.Andia,P.M.Latorre,M.C.Gomez,N.Burgos-Alonso,M. 1beta with paracrine actions on tenocytes. Also, whether the Abate, and N. Maffulli, “Platelet-rich plasma in the conservative response of healthy and tendinopathic cells to a challenge treatment of painful tendinopathy : a systematic review and with hyperuricemic PRP may differ warrants additional meta-analysis of controlled studies,” British Medical Bulletin, studies. Moreover, patients with hyperuricemia may have vol. 110, no. 1, pp. 99–115, 2014. some systemic comorbidities including diabetes or metabolic [4] M. Abate, C. Schiavone, V. Salini, and I. Andia, “Occurrence of syndrome, and their PRP will reflect these alterations. tendon pathologies in metabolic disorders,” Rheumatology,vol. In conclusion, we show that hyperuricemic PRP may 52,no.4,pp.599–608,2013. exert a positive effect on tendons by increasing the produc- [5]J.C.Peerbooms,J.Sluimer,D.J.Bruijn,andT.Gosens, tion of type 1 collagen and COMP, and at the same time “Positive effect of an autologous platelet concentrate in lateral decreasing the production of IL-6 and IL-8. Thus, a priori, epicondylitis in a double-blind randomized controlled trial: patients with hyperuricemia shall not be excluded from PRP platelet-rich plasma versus corticosteroid injection with a 1-year 8 BioMed Research International

follow-up,” The American Journal of Sports Medicine,vol.38,no. [21]L.Yao,C.S.Bestwick,L.A.Bestwick,N.Maffulli,andR.M. 2, pp. 255–262, 2010. Aspden, “Phenotypic drift in human tenocyte culture,” Tissue [6] S. Kesikburun, A. K. Tan, B. Yilmaz, E. Yas¸ar, and K. Yazicioglu,˘ Engineering,vol.12,no.7,pp.1843–1849,2006. “Platelet-rich plasma injections in the treatment of chronic [22] E. Anitua, I. And´ıa, M. Sanchez et al., “Autologous preparations rotator cuff tendinopathy: a randomized controlled trial with rich in growth factors promote proliferation and induce VEGF 1-year follow-up,” TheAmericanJournalofSportsMedicine,vol. and HGF production by human tendon cells in culture,” Journal 41,no.11,pp.2609–2616,2013. of Orthopaedic Research,vol.23,no.2,pp.281–286,2005. [7] F. Martinon, “Update on biology: uric acid and the activation [23]E.Anitua,M.Sanchez,A.T.Nurdenetal.,“Autologous of immune and inflammatory cells,” Current Rheumatology fibrin matrices: a potential source of biological mediators that Reports,vol.12,no.2,pp.135–141,2010. modulate tendon cell activities,” JournalofBiomedicalMaterials [8]H.Uratsuji,Y.Tada,T.Kawashimaetal.,“P2Y6receptor Research A,vol.77,no.2,pp.285–293,2006. signaling pathway mediates inflammatory responses induced by [24] M. B. Andersen, J. Pingel, M. Kjær, and H. Langberg, monosodium urate crystals,” Journal of Immunology, vol. 188, “Interleukin-6: a growth factor stimulating collagen synthesis no.1,pp.436–444,2012. in human tendon,” JournalofAppliedPhysiology,vol.110,no.6, [9] K. M. Kim, G. N. Henderson, X. Ouyang et al., “A sensitive pp. 1549–1554, 2011. and specific liquid chromatography-tandem mass spectrometry [25] T.Sillat,G.Barreto,P.Clarijsetal.,“Toll-likereceptorsinhuman method for the determination of intracellular and extracellular chondrocytes and osteoarthritic cartilage,” Acta Orthopaedica, uric acid,” Journal of Chromatography B: Analytical Technologies vol. 84, no. 6, pp. 585–592, 2013. in the Biomedical and Life Sciences,vol.877,no.22,pp.2032– [26] M. de Mos, L. A. B. Joosten, B. Oppers-Walgreen et al., “Tendon 2038, 2009. degeneration is not mediated by regulation of toll-like receptors [10] K. Lundgreen, Ø. B. Lian, L. Engebretsen, and A. Scott, “Teno- 2 and 4 in human tenocytes,” Journal of Orthopaedic Research, cyte apoptosis in the torn rotator cuff: a primary or secondary vol.27,no.8,pp.1043–1047,2009. pathological event?” British Journal of Sports Medicine,vol.45, [27] A. Chhana, K. E. Callon, M. Dray et al., “Interactions no.13,pp.1035–1039,2011. between tenocytes and monosodium urate monohydrate crys- [11] Q. Lv, X.-F. Meng, F.-F. He et al., “High serum uric acid and tals: implications for tendon involvement in gout,” Annals of the increased risk of type 2 diabetes: a systemic review and meta- Rheumatic Diseases,vol.73,no.9,pp.1737–1741,2014. analysis of prospective cohort studies,” PLoS One,vol.8,no.2, [28] I. Andia and E. Rubio-Azpeitia, “Angiogenic and innate Article ID e56864, 2013. immune responses triggered by PRP in tendon cells are not [12]F.Martinon,V.Petrilli,´ A. Mayor, A. Tardivel, and J. Tschopp, modified by hyperuricemia,” Muscles, Ligaments and Tendons “Gout-associated uric acid crystals activate the NALP3 inflam- Journal. In press. masome,” Nature,vol.440,no.7081,pp.237–241,2006. [13] K. Migita, T. Koga, K. Satomura et al., “Serum amyloid A triggers the mosodium urate -mediated mature interleukin-1𝛽 production from human synovial fibroblasts,” Arthritis Research and Therapy,vol.14,no.3,articleR119,2012. [14] I. Andia and N. Maffulli, “Platelet-rich plasma for managing pain and inflammation in osteoarthritis,” Nature Reviews Rheumatology,vol.9,no.12,pp.721–730,2013. [15]M.Kjaer,P.Magnusson,M.Krogsgaardetal.,“Extracellular matrix adaptation of tendon and skeletal muscle to exercise,” Journal of Anatomy,vol.208,no.4,pp.445–450,2006. [16] K. Legerlotz, G. C. Jones, H. R. C. Screen, and G. P.Riley, “Cyclic loading of tendon fascicles using a novel fatigue loading system increases interleukin-6 expression by tenocytes,” Scandinavian Journal of Medicine and Science in Sports,vol.23,no.1,pp.31–37, 2013. [17] J.I.Martin,J.Merino,L.M.Areizagaetal.,“Platelet-richplasma (PRP) in chronic epicondylitis: study protocol for a randomized controlled trial,” Trials,vol.14,article410,2013. [18] M. L. Bayer, P. Schjerling, A. Herchenhan et al., “Release of tensile strain on engineered human tendon tissue disturbs cell adhesions, changes matrix architecture, and induces an inflammatory phenotype,” PLoS ONE,vol.9,no.1,ArticleID e86078, 2014. [19] L. Leone, M. Vetrano, D. Ranieri et al., “Extracorporeal shock wave treatment (ESWT) improves in vitro functional activities of ruptured human tendon-derived tenocytes,” PLoS ONE,vol. 7, no. 11, Article ID e49759, 2012. [20] L. Yao, C. S. Bestwick, L. A. Bestwick, R. M. Aspden, and N. Maffulli, “Non-immortalized human tenocyte cultures as a vehicle for understanding cellular aspects to tendinopathy,” Translational medicine @ UniSa,vol.1,pp.173–194,2011. Hindawi Publishing Corporation BioMed Research International Volume 2014, Article ID 890630, 10 pages http://dx.doi.org/10.1155/2014/890630

Review Article Platelet Rich Plasma and Knee Surgery

Mikel Sánchez,1,2 Diego Delgado,2 Pello Sánchez,2 Nicolás Fiz,1 Juan Azofra,1 Gorka Orive,3 Eduardo Anitua,3 and Sabino Padilla3

1 Arthroscopic Surgery Unit, Hospital Vithas San Jose, C/Beato Tomas´ de Zumarraga 10, 01008 Vitoria-Gasteiz, Spain 2 Arthroscopic Surgery Unit Research, Hospital Vithas San Jose, C/Beato Tomas´ de Zumarraga 10, 01008 Vitoria-Gasteiz, Spain 3 Fundacion´ Eduardo Anitua, C/Jose Mar´ıa Cagigal 19, 01007 Vitoria-Gasteiz, Spain

Correspondence should be addressed to Mikel Sanchez;´ [email protected]

Received 12 June 2014; Accepted 30 July 2014; Published 2 September 2014

Academic Editor: Tomokazu Yoshioka

Copyright © 2014 Mikel Sanchez´ et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

In orthopaedic surgery and sports medicine, the knee joint has traditionally been considered the workhorse. The reconstruction of every damaged element in this joint is crucial in achieving the surgeon’s goal to restore the knee function and prevent degeneration towards osteoarthritis. In the last fifteen years, the field of regenerative medicine is witnessing a boost of autologous blood-derived platelet rich plasma products (PRPs) application to effectively mimic and accelerate the tissue healing process. The scientific rationale behind PRPs is the delivery of growth factors, cytokines, and adhesive proteins present in platelets and plasma, as well as other biologically active proteins conveyed by the plasma such as fibrinogen, prothrombin, and fibronectin; with this biological engineering approach, new perspectives in knee surgery were opened. This work describes the use of PRP to construct and repair every single anatomical structure involved in knee surgery, detailing the process conducted in ligament, meniscal, and chondral surgery.

1. Introduction interplay among the aforementioned knee structures and knee function, it is easy to recognize that the reconstruction In orthopaedic surgery and sports medicine, the knee joint of every damaged element in this joint will be crucial in has traditionally been considered the workhorse. Unlike achievingthesurgeon’sgoaltorestorethekneefunctionand other synovial joints of the body, the knee encompasses a prevent degeneration towards osteoarthritis. Both intense cluster of anatomical structures such as meniscus, extra- and physical activity, a common feature shared by elite sports, intra-articular ligaments, bones, cartilage, and periarticular andtheabsenceofsurgicalrepairchieflyofACLinjurythat muscles; its integrity, congruity, and alignment guarantee its givesrisetoactthekneejointasaneccentricstructureare dynamicyetfragilestability,aswellasitscapacitytoface likely to result in a joint degenerative osteoarthritis [2, 3]. extremely demanding biomechanical tradeoffsFigure ( 1). From a mechanical viewpoint, the knee is a complex, shock- In the last fifteen years, the field of regenerative medicine is absorbing interface in which a coordinated and sequentially witnessing a boost of autologous blood-derived platelet rich ordered engagement of the joint’s elements and muscles is plasma products (PRPs) application to effectively mimic and required to maintain the physical integrity of anatomical accelerate the tissue healing process [4]. structures and homeostasis of knee tissues. In this respect, Ten years ago, Sanchez´ et al. [5, 6] published two proprioceptive acuity, which depends on periarticular knee important papers depicting the application of plasma rich tissues,willplayacrucialroleinbothkneeinjurymecha- in growth factor (PRGF-Endoret) on arthroscopic surgery of nisms and rehabilitation. From a biomechanical perspective the knee, being the first to report the successful application ofthekneejoint,itismostefficacioustopresentaholistic of PRGF-assisted regenerative techniques in the treatment approach when the intention is to restore the function of an articular cartilage avulsion in a 12-year-old soccer of such fragile joint [1]. Grasping the significance of the player [5]. With this biological engineering approach, new 2 BioMed Research International

to make inferences about other autologous platelet rich plasma products, thereby suggesting that all these blood- derived products are useless in the treatment of, for example, tendinopathies. The approach of using PRGF-Endoret tissue- engineering biology, both in situ and in operating theater,has yielded extremely promising outcomes in the treatment of 2 musculoskeletal system pathologies [9, 13–18].

1 2. Highlighting Features of the Use of PRP 6 Products in Knee Surgery 3 4 The scientific rationale behind PRPs is the delivery of growth factors, cytokines, and adhesive proteins present in platelets 5 and plasma, as well as other biologically active proteins conveyed by the plasma such as fibrinogen, prothrombin, and fibronectin [19]. PRGF-Endoret is an autologous enriched platelet plasma product that does not contain leukocytes and is obtained by spinning a small sample of a patient’s blood using a defined protocol [20](Figure 2). After centrifugation, an autologous “liquid formulation” based on platelet enriched plasma is obtained. From this initial formulation we can prepare four distinct therapeutic formulations by adding calcium 1 Synovium 5 Subchondral bone chloride to this liquid, thereby unleashing the activation of 2 Bone 6 Cartilage platelets and the polymerization of fibrin [13]. In orthopaedic 3 Ligament 7 Synovial liquid surgery we primarily use an activated liquid formulation, a 4 Meniscus fibrin scaffold, or a fibrin membrane. They are all biomaterials conceived and prepared in situ,aprocedurewhichfollows Figure 1: Anatomical structures of knee joint. The complexity and integration of all the structures that compose the knee joint a kind of Occam’s razor: making biological engineering make this have to be considered as an organ. Those structures are simple can be best achieved attempting to keep it simple synovium (1), bone (2), ligament (3), meniscus (4), subchondral [21] by applying nature’s original technology. The technology bone (5), cartilage (6), and synovial fluid (7), which coat the joint. of PRGF-Endoret mimics and harnesses the spontaneous defense-repair mechanisms with two biological outcomes: it avoids the formation of scar tissue which might lead to the loss of functionality and shortens the duration of repair perspectives in knee surgery were opened. Furthermore, events. The effectiveness of the application of PRGF-Endoret Sanchez´ et al. [5, 6] pioneered the comprehensive distributed on knee surgery includes its mediation by multiple soluble application of PRGF-Endoret at different surgical junctures biomoleculeswhicharelocallyconveyed,namely,growth in the ACL reconstruction process, drawing on the paradigm factors and cytokines, and stem from the activated platelets, of tissue-engineering biology. This procedure involves the use plasma, and three-dimensional fibrin network. ofactivatedliquidPRGF-Endorettoinfiltratetheallograftsor Some growth factors present in platelets such as PDGF autografts achieving its biological reconditioning, to immerse and TGF𝛽 have been shown to promote the proliferation of bone plugs, and to fill the tibial and femoral tunnels in osteoblasts [22]. PRP preparations facilitate bone repair in the operating theater [6]. Since then, several groups have vitro and in vivo by expressing the proosteogenic and angio- not stopped harnessing the paradigm of tissue-engineering genic functions of endothelial cells, recruiting osteoblast biology to construct and repair every single anatomical precursors, and the expression of adhesion molecules (osteo- structure of the musculoskeletal system, including tendons, protegerin) while inhibiting their proosteolytic activity [23]. bones, cartilage, muscles, meniscus, and ligaments [7–12]. In two recent clinical studies, Seijas’s and our group have Despite the care and seriousness with which the medical shown that the application of PRGF-Endoret in the treatment staff elaborate and apply PRPs in different medical fields, of nonunion and delayed consolidation fractures might be the poor standardization in PRP therapies, the modalities of both osteoinductive and osteoconductive [24, 25]bymeans their application, and the in vitro versus in vivo assessments of chemotaxis and osteoblast activity through growth factors are elements that somehow are hampering advancement as such as PDGF, IGF-I, and TGF𝛽1[26]. This research evidence well as drawing misleading conclusions about their clinical supports the application of activated liquid PRGF-Endoret in efficacy. It is now commonplace to apply PRPs or even bone regeneration of the tibial and femoral tunnel in ACL unguided injections of autologous whole blood to manage reconstruction. musculoskeletalinjuriesasamagicbulletinsteadofadopting Of further interest, there is a great deal of evidence a rationale evidence based biological approach. In the wake illustrating the anabolic effects of PRPs on tendon cells. of poor clinical results shown by this approach, it is tempting PRPs stimulate the synthesis of types I and III collagen BioMed Research International 3

Blood extraction

Centrifugation

Blood separation F1 F2

(a) PRP preparation F1 F2 F1 F2

+CaCl2 +CaCl2 +CaCl2

󳰀 󳰀 󳰀 󳰀 󳰀 Scaffolds 20–30 Fibrin 40–60 Liquid 1–5 Scaffolds 20–30 Fibrin 40–60

(b) PRP different formulation

Figure 2: Platelet rich plasma protocol. Obtaining platelet rich plasma involves the extraction of a small volume of blood from the patient, its centrifugation to fractionate the blood, and the separation of platelet rich fractions (F1 and F2) (a). After activation of PRP fractions with calcium chloride, various formulations including liquid, clot, and membrane (b) can be obtained. and cartilage oligomeric matrix proteins, resulting in a overall arthroscopic evaluation and found the morphology synthesis of extracellular matrix which is conducive to the and histology of tendon grafts treated with infiltration with osseointegration of grafts [11, 26, 27]. The wide spectrum of more signs of remodeling, maturation, and a synthesis of in vitro and in vivo cell response in both tendon stem cell new connective tissue than the nontreated one; moreover, the differentiation and proliferation, together with a substantial infiltrated tendon graft presented more and better-oriented expression of VEGF and HGF that generates a balanced cells and more akin to the native ACL [11]. A key aspect angiogenesis and an anti-inflammatory effect, constitutes the to consider is the TGF-𝛽1family,whichdrivesfibrogenesis rationale for the application of activated liquid and fibrin and potentially might stimulate the formation of scar tissue scaffolds; they are applied in the donor site of the graft in the tendon graft; however, the fibrotic effect of TGF- to prompt the repair events in one area with a great deal 𝛽1 present in PRGF-Endoret would be either modulated, of morbidity [12, 27–31]. The infiltration of activated liquid counterbalanced, or even hindered by the presence and local PRGF-Endoret to a previous implantation in Hamstring production of VEGF and HGF, a potent antifibrotic and anti- tendon graft elicits a set of sequential remodeling events inflammatory agent32 [ , 33], as has been shown by our work that leads to the ligamentization of the tendon graft [11]. on cells cultured on fibrin matrices [27, 34, 35]. Therefore, the Inonestudyconductedbyourgroupwecomparedthe concurrent presence of TGF-𝛽1, VEGF, and HGF in the same 4 BioMed Research International local environment makes the PRGF-Endoret an antifibrotic 3.1. Ligament Repair Process. When ligament rupture occurs and antiapoptotic autologous system and a useful toolkit for due to excessive mechanical energy, the vascular elements contributing to musculoskeletal tissue repair [36]. and extracellular matrix are disrupted. Consequently, there Cartilage is another knee structure often damaged and is an extravasation of plasma and blood cells into the difficult to repair that can benefit from the healing potential damaged area and into the surrounding tissues [43]. Then, of PRGF-Endoret. Growth factors conveyed by platelet rich the mesenchymal stem cells are activated and migrate from plasma have been shown to produce a chondroprotective their niches to the injured site [44]. Both these stem cells and endothelial and blood cells (platelets and macrophages) effectinthesynovialjointduetothehyaluronicacidsecretion release growth factors and cytokines causing heat, edema, by synoviocytes [37]. In addition, type II collagen cleavage 𝛽 pain, and dysfunction in order to protect the knee from can be arrested by the presence of TGF and FGF and thereby further damage. Cytokines attract macrophages and mono- contribute to the homeostasis of articular cartilage [38, 39]. cytes that remove those proteins and cells remaining in the Last but not least, PRGF-Endoret has been revealed as a damaged area, which is filled with plasma elements and mighty anti-inflammatory response that might be mediated blood cells. In addition, a fibrin clot is formed to integrate on the basis of the high concentration of HGF present in platelet and mesenchymal stem cells, which release molecules PRP,besides being secreted by several cells, thereby inhibiting involved in repair processes. Simultaneously with activation the intracellular signaling regulator of the inflammatory and and cell migration, angiogenesis occurs, and thereby new stress-induced response pathway NF-k𝛽 [32, 40]. blood vessels are created and new extracellular matrix is synthesized [44]. Furthermore, the fibrin clot and its environment begin to transform into granular scar tissue where 3. PRP and Ligament Injuries fibroblasts synthesize collagen types I and III, among other proteins. Finally, the remodeling process begins, which is a A ligament is a fibrous connective tissue band that connects long stage characterized by a drop in cellularity, vascularity, bones together and is essential for joint stability. This is and water content. achieved by its mechanical behavior and its viscoelastic Bearing this in mind the use of PRP in ACL recon- composition, which prevents the excessive motion caused struction using hamstring autografts, a standard technique by different forces exerted on the joint. Ligaments are in this condition, can be better understood. Although it composedof70%waterand30%solidmaterial,mainly often produces good results, this technique also suffers extracellular matrix (EMC) (80%) and fibroblasts (20%), the from considerable variability in both final outcomes and most abundant cell elements in this anatomical structure. recovery time [45]. For this reason, ACL reconstruction is Concerning EMC, collagen is the most characteristic protein under constant revisions in which aspects such as graft type, of the ligament reaching 75% of the dry weight and is position of the tunnels, or anchor methods are studied. dividedintocollagenfiberstypeI(90%)andtypeIII(10%) However, the biological aspect must not be ignored. In [41]. These collagen fibers are arranged in a wide variety of ACL reconstruction [11] PRGF-Endoret induces the prolif- directions and orientations since ligaments are submitted to eration of cells in tendon used as graft. Angiogenesis is several torsion and traction forces. Other extracellular matrix promoted,acceleratingtheprocessesofremodeling,ligamen- proteins present in ligaments are proteoglycans, elastin, tization, and integration of the graft. Together with an ade- actin, laminins, and integrins. The entire ECM is formed by quate physiotherapy that generates appropriate mechanical fibroblasts, which are also responsible for the maintenance stimuli [46], this biological intervention achieves better and and repair of this tissue [42]. faster recovery of the patient who is undergoing this surgical Ligaments are covered by the epiligament, which provides procedure [6]. the microvascularity, and proprioceptive and nociceptive nerve endings, by which the organism is able to involuntarily 3.2. Arthroscopic Anterior Cruciate Ligament Reconstruc- detect the position and the movement of the knee. However, tion Associated with PRGF-Endoret. The following profile this vascular contribution is limited in the ligaments, a tissue describes the process of ACL reconstruction by arthroscopy with scant regeneration properties. This condition hampers combined with PRGF-Endoret and using the autografts of itsrecoveryfrominjuriesandfavorsrelapses. semitendinosus tendon, gracilis tendon, and bone-tendon- There are different ligaments present in the knee; however bone patellar tendon [12]. we will use the anterior cruciate ligament (ACL) to exem- plify the use of PRGF-Endoret together with the surgical (1) Before inducing anesthesia, prophylactic antibiotic reconstruction procedure. The ACL is frequently damaged treatment, and saline, seventy-two mL of peripheral inthefieldofsportsanditspoorrepairabilitycauses venous blood is withdrawn into 9 mL tubes con- the joint to work in an eccentric manner, triggering early taining 3.8% (wt/vol) sodium citrate as anticoagu- knee osteoarthritis and making its surgical reconstruction lant. Blood is centrifuged at 580g for 8 minutes at almost mandatory [3]. Before explaining this technology, it room temperature (PRGF-Endoret, Vitoria, Spain) is necessary to understand the regeneration process which (Figure 2). The upper volume of plasma contains a takes place in ligament injury. In this way, PRGF-Endoret similarnumberofplateletasperipheralblood,and technologywillbebetterunderstoodandusedinthesetypes it is drawn off and deposited in a collection tube of procedures. (F1). The 2 mL plasma fraction, located just above the BioMed Research International 5

sedimented red blood cells, is collected in another To complete the whole of the procedure it is necessary to tube without aspirating the buffy coat. This plasma implement mechanical stimuli by means of a rehabilitation contains a moderate enrichment in platelets (2-3-fold plan and physiotherapy. The achieved mechanotransduction the platelet count of peripheral blood) with scarce stimulates the cells in order to act synergistically with this leukocytes (F2). surgical technique and PRP [46]. The proper execution of this process (surgery, PRP, and (2) F1 is activated with calcium chloride (10% wt/vol) and ∘ rehabilitation) will improve patient recovery. It can be seen incubated at 37 C for 30–60 minutes in a glass dish, to postoperatively by a decrease in the number of hematomas allow the formation of either a biocompatible fibrin and signs of inflammation such as pain. There is also a better scaffold or a fibrin membrane that will be placed in osseointegration of the graft and as a result a better adaptation the donor region of the goose’s foot tendon at the end in the joint kinematics. All this leads to a shortening of the of the process. In the case of using a bone-tendon- time of initiation of rehabilitation [6]. bone autograft, a fibrin scaffold is placed in the area Posterior cruciate ligament, medial collateral ligament, where the graft was obtained, namely, tibia, patella, and lateral collateral ligament can be reconstructed by apply- and patellar tendon; in addition, F2 activated with ing the same principles described for ACL reconstruction, calcium chloride will be infiltrated in an intraosseous both arthroscopically and via open surgery. manner. (3) An assessment of the joint is conducted by arthroscopy in order to detect associated pathologies 4. PRP and Meniscal Surgery such as meniscal, synovial, or chondral injuries. The meniscus is an intra-articular structure formed by (4) Once the remains of the ACL are cleaned, a condy- fibrocartilaginous tissue, composed mainly of type I collagen loplasty is initiated to prevent future graft impinge- fibers (more than 90%), and is frequently damaged, affect- ments, especially in chronic cases with narrower ing the knee stability and lubrication. Meniscus reparation groove, and to promote the correct location of the process is determined by its tissue characteristics such as its femoral anchor point of the graft. It also will create abundant extracellular matrix (between 60 and 70% of tissue a bed of bleeding spongy bone, providing cells and weight) where cells, namely, fibrochondrocytes, fibroblasts, proteins that will enhance the integration of the graft. and cells of the surface area, are dispersed. Moreover its poor vascularity is limited to 10–30% of its outer portion or (5) When the joint site is prepared, the autologous grafts meniscal wall, which also receives nerve endings and presents are obtained from those places already indicated. the most cellularity [47]. Such zone differentiation conditions If allografts are used, they will have been prepared meniscus recovery capacity, a decisive factor if the injury beforehand. Calcium chloride is added to the F2 occurs in the central area or in the peripheral area (meniscal aliquots just before infiltration; then, six milliliters of wall), which is the reparative part and generates regeneration activated F2 is injected within the tendinous fascia processes [48]. of graft fascicles (auto- or allografts) in the operating Meniscus injuries compromise joint functions, as this theater itself (10 mL syringes and 21 G needles). The structure provides stability to the knee and supports compres- graft is immersed in a recipient with activated F2 until sive stress as well as traction and shearing forces. Meniscus implantation. also absorbs some of the mechanical stress that the joint (6)Thetunnelsareproducedusingtheselectedproce- receives and participates in the lubrication of the knee with dures and guides. As in our surgical technique, it synovial membrane. Because of its functional importance in is important that the guide allows bone plugs to be the knee and its vulnerability to repetitive injures throughout extracted. These plugs are soaked in activated F2 and the lifetime of a person, it is necessary to improve its limited when the graft (in the case of goose’s foot tendons) has reparative capacity to achieve an optimal recovery. been introduced, they are reimplanted; thus, the tibial In laboratory experiments, PRP has proved to have a tunnel is sealed supplying a biological anchorage. positive effect on meniscal cells [49]andithasbeenproposed as a treatment for meniscal tears [50]. However, to use (7) As PRP can be removed by irrigation saline, the inlet PRPsproperly,itmustbeappliedfollowingthecorrect is closed when the graft is placed. Furthermore, the protocol appropriate indications. In surgical procedures, its remaining saline is aspirated to prevent dilution of use is focused on meniscectomies and meniscal sutures, by PRP. applying the activated F2 especially in the area of the meniscal wall. (8) Three mL of F2 is injected with long needles into each bone tunnel after graft fixation. In this way the bone is exposed to a source of proteins and cells that enhance 4.1. Meniscectomy. As mentioned above, the meniscal wall graft integration. After placing the graft in the tunnels, is infiltrated with activated F2 during a partial or subtotal it is again infiltrated with activated F2, since some meniscectomy. This infiltration is carried out in an extra- of the previously infiltrated PRP may be lost during articular way (from outside to inside) using a 21 G needle and this process. Finally, an intra-articular infiltration is a 3 mL syringe. An exception to this procedure is the infil- carried out with the remaining F2 (Figure 3). tration of the posterior horn of the external meniscus, which 6 BioMed Research International

Ligamentization

(a) (b) (c) (d) (a, b) Ligamentization of the graft. (c) Graft infiltration with 6 mL of activated F2. Graft immersed in activated PRGF. (d) Arthroscopic graft infiltration. Fibrin membrane at the donor site. Osteogenesis (graft-bone healing)

(a) (b) (c) (d) (a) Bone plugs soaked in activated F2. (b, c) Intraosteal infiltration of the tunnels and (d) infiltration of the auto- or allograft with activated F2.

Intraosteal infiltration

(a) (b) (c) (a, b, c) Intraosteal infiltration of subchondral bone with activated F2.

Chondrogenesis

(a) (b) (c) (d) (a) Allocation of activated F2 stained with methylene blue. (b, c) Microfractures at the injury site. (d) Intraosteal infiltration of microfractures with activated F2.

Anti-inflammatory-antifibrotic + HGF TLRs PRGF PDGF MD2 IGF1 Tropic balance

MyD8 TRIF IRAK1-4 TRAF6 IKK𝛼 − Inhibition IKK𝛽 IKK𝛾 I𝜅B 1 1 NF-𝜅B VEGF IGF- HGF TGF B - Chondrocyte - Fibroblast - Endothelial cells

(a) (b) (c) (d) (a, b) Intra-articular infiltration of activated F2. (c, d) Cellular target of some growth factors within PRGF: NF𝜅𝛽 pathway, and trophic homeostasis.

Figure 3: Platelet rich plasma and knee surgery. Platelet rich plasma can help in different surgical processes of the knee due to its effects on ligamentization, osteogenesis, or chondrogenesis as well as its anti-inflammatory and antifibrotic properties. is conducted from within in order to avoid vascular/nerve sinceitistheareawherethecellsandbloodvesselsareto damage (Figure 4). be found and it will induce the biological elements required This technique is justified owing to the high density of for regeneration. Finally, an intra-articular infiltration is the meniscus compared with other tissues like muscle or performed with 8 mL of activated F2 (Figure 4). tendon, and a high pressure is required to spread the PRP into meniscus. The meniscal wall should be maintained whenever 4.2. Meniscal Sutures. When feasible, meniscal sutures allow possible in order to reach a partial repair and healing process, reconstituting the fine anatomy of the joint and achieving BioMed Research International 7

Experimental work on sheep’s meniscus

(a) (b) (c) (a, b, c) Diffusion of activated F2 stained with methylene blue. Meniscal suture

(a) (b) (c) (a, b) A representative diagram showing a meniscal rupture, its suture, and (c) infiltration with activated F2. PRGF infiltration

(a) (b) (c) (a) External infiltration into the meniscal wall. (b, c) Arthroscopic view of infiltration “from within” of the posterior horn of the meniscal remnants.

Figure 4: Platelet rich plasma and meniscus. Factors such as the spread of platelet rich plasma in the meniscus and tissue density require a proper protocol in order to perform a correct application.

greater stability and protection of cartilage. In this case intracellular signaling regulator of the inflammatory pathway PRGF-Endoret infiltration will be conducted into the suture NF-k𝛽 [32, 40]. The third is a cell-phenotypic modulation area and meniscal wall, and when the whole process is of chondrocytes, preventing hypertrophic differentiation and finished,thekneewillbeinfiltratedinanintra-articularway. maintaining them in an arrested state, and MSCs, which The infiltration protocol is the same as that explained inthe promote chondrogenic differentiation. They migrate from meniscectomies (Figure 4). vascular areas (synovium and subchondral bone) towards Depending on the patient’s progress, an outpatient intra- injuredareasundertheactionofPRPandgrowthfactors articular infiltration after two weeks can be taken into such as TGF 𝛽, IGFs, or FGF-2. Fourth, by attenuating and consideration, in order to enhance recovery. reducing joint pain, physical activity levels might improve and increase the physiological load tolerable for the joints. 5. PRP and Chondral Surgery The increased tolerable physical load might entail a chondroprotective effect, since it has been proved that moderate The treatment of cartilage injuries remains daunting despite mechanical loading has an anticatabolic effect on the articular both advances in pharmacological management of the pain cartilageeitherthroughtheactionofCITED2orbysuppress- 𝛽 and inflammation and advances in the surgical procedures ing NF-k activation [52]. and techniques. The application of PRP intra-articular injec- All procedures described below are based on a fractions is underpinned by a substantial body of evidence in ture/avulsion case published by our group. We observed how basicscience,aswellasinpreclinicalandclinicallevelsof the integration of a cartilaginous fragment by arthroscopy practice [51]. With this biological approach, new perspectives combined with the use of PRGF-Endoret achieved an excel- in knee surgery have been opened, and, drawing on the lent cartilage repair [5]. aforementioned evidence, we led to suggest four synergetic effects of PRGF-Endoret on cartilage diseases [51]. The first 5.1. Fracture/Avulsion and Osteochondritis Dissecans. Firstly, one is a chondroprotective effect from both the hyaluronic the osteochondral wound bed is debrided and the fragment acid secretion by synoviocytes and the arresting of type II separated; the bone surface of the fragment is refreshed in collagen, cleavage by the combination of TGF𝛽 and FGF order to reach bone with a suitable appearance. Next, a [38, 39]. Second, an anti-inflammatory effect on human bleeding bed is achieved by spongialization, and 3 mL of acti- chondrocytes on the basis of the HGF effect present in vated F2 is infiltrated into the wound bed in an intraosseous PRPaswellassecretedbythesynoviocytesinhibitsthe manner. After fixing the osteochondral fragment into its 8 BioMed Research International original niche and ensuring its stability, 2 mL of activated F2 injuries assisted by PRGF-Endoret. Collectively the applica- will be infiltrated again using a fine needle. This infiltration is tion of tissue-engineering biology to repair and reconstruct applied into space between the crater and the fragment; thus, anatomical parts of the knee, using different formulations the area around all edges of the reinserted fragment is filled of PRGF-Endoret, has yielded promising clinical outcomes. andsealed(Figure 3). These efforts point to a future where tailored PRPs will be used for each specific medical purpose. 5.2. Osteochondral Injuries with an Inviable Fragment. As in the previous case, the subchondral bone is debrided and Conflict of Interests all damaged tissue is removed. Again, a bleeding bed is achieved by spongialization and bone is drilled by using the Sabino Padilla and Eduardo Anitua are researchers at B.T.I. Pridie procedure or microfractures. Next, it is infiltrated with Biotechnology Institute and Fundacion´ Eduardo Anitua. liquid activated F2 by means of a trocar specially designed for this arthroscopic application (Figure 3). With this step, References multipotent mesenchymal stem cells are mobilized, and generated cell signals (SDF-1 and other chemokines) trigger [1] K. D. Brandt, E. L. Radin, P. A. Dieppe, and L. van de Putte, thejointcartilagerepairprocess.Thecellsmigratingtothe “Yet more evidence that osteoarthritis is not a cartilage disease,” area of the lesion will be trapped in a three-dimensional fibrin Annals of the Rheumatic Diseases,vol.65,no.10,pp.1261–1264, scaffold formed from PRGF-Endoret. This fact contributes 2006. to the synthesis of new tissue which performs the same [2] U. M. Kujala, P. Marti, J. Kaprio, M. Hernelahti, H. Tikkanen, mechanical function as the original. and S. Sarna, “Occurrence of chronic disease in former top-level athletes: predominance of benefits, risks or selection effects?” 5.3. Extensive Osteochondral Injuries and Necrosis. After Sports Medicine,vol.33,no.8,pp.553–561,2003. debridement of the injured tissue and until a bleeding [3]N.Stergiou,S.Ristanis,C.Moraiti,andA.D.Georgoulis, spongy bone bed is achieved, a series of microfractures is “Tibial rotation in anterior cruciate ligament (ACL)-deficient performed and the intra-articular wash serum is aspirated. and ACL-reconstructed knees: a theoretical proposition for the developmentofosteoarthritis,”Sports Medicine,vol.37,no.7,pp. Next, two infiltrations of activated liquid F2 are performed: 601–613, 2007. intraosseous (3–5 mL) and intra-articular (8 mL) (Figure 3). In cases like those involving the internal condyle of the [4] E. Anitua, M. H. Alkhraisat, and G. Orive, “Perspectives and knee, where there is osteonecrosis with severe involvement challenges in regenerative medicine using plasma rich in growth factors,” Journal of Controlled Release,vol.157,no.1,pp.29–38, of the subchondral bone, autologous osteochondral grafts are 2012. performed. Depending on the size of the injury, large-scale osteochondral grafts with a fresh frozen allograft can be used [5] M. Sanchez,´ J. Azofra, E. Anitua et al., “Plasma rich in growth by means of an open-sky surgical technique. factors to treat an articular cartilage avulsion: a case report,” Medicine and Science in Sports and Exercise,vol.35,no.10,pp. The integration is improved by infiltrated liquid activated 1648–1652, 2003. F2 into the bed and bony part of the osteochondral graft. An additional infiltration is performed in the interface when the [6] M. Sanchez,´ J. Azofra, B. Aizpurua et al., “Use of autologous allograft has been insertedFigure ( 3). plasma rich in growth factors in arthroscopic surgery,” Cuader- nos de Artroscopia,vol.10,pp.12–19,2003. In all the cases described here, the last step of surgery consists in the aspiration of serum and as many intra- [7] M. Sanchez,´ E. Anitua, J. Azofra, I. And´ıa,S.Padilla,andI. articular washes as possible and in an intra-articular infil- Mujika, “Comparison of surgically repaired Achilles tendon tears using platelet-rich fibrin matrices,” American Journal of tration of liquid activated F2. A further three intra-articular Sports Medicine,vol.35,no.2,pp.245–251,2007. infiltrations of 8 mL on a weekly basis are conducted during the postoperative period, on an outpatient basis (Figure 3). [8] M. Sanchez,´ E. Anitua, J. Azofra, J. J. Aguirre, and I. Andia, During the first four weeks postintervention chondrocyte “Intra-articular injection of an autologous preparation rich in growth factors for the treatment of knee OA: a retrospective synthesis has to be stimulated and an anabolic environment cohort study,” Clinical and Experimental Rheumatology,vol.26, has to be promoted. Therefore, assisted walking with crutches no.5,pp.910–913,2008. and a minimal initial load is recommended. Two weeks after surgery, rehabilitation should involve passive mobility and [9] M. Sanchez,´ E. Anitua, G. Orive, I. Mujika, and I. Andia, “Platelet-rich therapies in the treatment of orthopaedic sport avoidance of axial movements. After week 4, partial support injuries,” Sports Medicine,vol.39,no.5,pp.345–354,2009. and resistance-free cycling together with swimming pool exercises are encouraged. [10] M. Sanchez,´ E. Anitua, E. Lopez-Vidriero, and I. And´ıa, “The future: optimizing the healing environment in anterior cruciate ligament reconstruction,” Sports Medicine and Arthroscopy 6. Concluding Remarks Review,vol.18,no.1,pp.48–53,2010. [11] M. Sanchez,´ E. Anitua, J. Azofra, R. Prado, F. Muruzabal, and There is a great deal of research demonstrating the safety and I. Andia, “Ligamentization of tendon grafts treated with an efficacy of PRPs in the field of orthopedic surgery. Drawing endogenous preparation rich in growth factors: gross morphol- on biological evidence, our team has developed several ogy and histology,” Arthroscopy,vol.26,no.4,pp.470–480, innovative procedures for the arthroscopic repair of knee 2010. BioMed Research International 9

[12] M. Sanchez,´ J. Azofra, N. Fiz et al., “Biological approach to modulate tendon cell activities,” JournalofBiomedicalMaterials anterior cruciate ligament surgery,” Operative Techniques in Research A,vol.77,no.2,pp.285–293,2006. Orthopaedics,vol.22,no.2,pp.64–70,2012. [28] J. Zhang, K. K. Middleton, F. H. Fu, H.-J. Im, and J. H.-C. Wang, [13] E. Anitua, M. Sanchez,´ and G. Orive, “Potential of endogenous “HGF mediates the anti-inflammatory effects of PRP on injured regenerative technology for in situ regenerative medicine,” tendons,” PLoS ONE,vol.8,no.6,ArticleIDe67303,2013. Advanced Drug Delivery Reviews,vol.62,no.7-8,pp.741–752, [29] L. V. Schnabel, H. O. Mohammed, B. J. Miller et al., “Platelet 2010. Rich Plasma (PRP) enhances anabolic gene expression pat- [14] M. Sanchez,´ E. Anitua, N. Fiz et al., “Plasma rich in growth terns in flexor digitorum superficialis tendons,” Journal of factors (PRGF-Endoret) in the treatment of symptomatic knee Orthopaedic Research,vol.25,no.2,pp.230–240,2007. osteoarthritis: a randomized clinical trial,” Arthroscopy,vol.28, [30] M. de Mos, A. E. van der Windt, H. Jahr et al., “Can platelet- no. 8, pp. 1070–1078, 2012. rich plasma enhance tendon repair? A cell culture study,” The [15] A. Wang-Saegusa, R. Cugat, O. Ares, R. Seijas, X. Cusco,´ and M. AmericanJournalofSportsMedicine,vol.36,no.6,pp.1171–1178, Garcia-Balletbo,´ “Infiltration of plasma rich in growth factors 2008. for osteoarthritis of the knee short-term effects on function and [31] J. Zhang and J. H.-C. Wang, “Platelet-rich plasma releasate pro- quality of life,” Archives of Orthopaedic and Trauma Surgery,vol. motes differentiation of tendon stem cells into active tenocytes,” 131, no. 3, pp. 311–317, 2011. The American Journal of Sports Medicine,vol.38,no.12,pp. [16] G. Filardo, E. Kon, M. T. Pereira Ruiz et al., “Platelet-rich 2477–2486, 2010. plasma intra-articular injections for cartilage degeneration and [32]P.Bendinelli,E.Matteucci,G.Dogliottietal.,“Molecularbasis osteoarthritis: Single- versus double-spinning approach,” Knee of anti-inflammatory action of platelet-rich plasma on human Surgery, Sports Traumatology, Arthroscopy,vol.20,no.10,pp. chondrocytes: Mechanisms of NF-𝜅B inhibition via HGF,” The 2082–2091, 2012. Journal of Cellular Physiology,vol.225,no.3,pp.757–766,2010. [17] O. Mei-Dan and M. R. Carmont, “The role of platelet-rich plasma in rotator cuff repair,” Sports Medicine and Arthroscopy [33] J.-K. Min, Y.-M. Lee, H. K. Jeong et al., “Hepatocyte growth Review,vol.19,no.3,pp.244–250,2011. factor suppresses vascular endothelial growth factor-induced expression of endothelial ICAM-1 and VCAM-1 by inhibiting [18] O. Mei-Dan, M. R. Carmont, L. Laver, G. Mann, N. Maffulli, the nuclear factor-𝜅Bpathway,”Circulation Research,vol.96,no. and M. Nyska, “Platelet-rich plasma or hyaluronate in the man- 3, pp. 300–307, 2005. agement of osteochondral lesions of the talus,” The American Journal of Sports Medicine,vol.40,no.3,pp.534–541,2012. [34]E.Anitua,M.Sanchez,´ G. Orive, and I. And´ıa, “The potential impact of the preparation rich in growth factors (PRGF) in [19]E.Anitua,I.Andia,B.Ardanza,P.Nurden,andA.T.Nurden, different medical fields,” Biomaterials,vol.28,no.31,pp.4551– “Autologous platelets as a source of proteins for healing and 4560, 2007. tissue regeneration,” Thrombosis and Haemostasis,vol.91,no. 1, pp. 4–15, 2004. [35] E. Anitua, M. Sanchez,´ M. M. Zalduendo et al., “Fibroblastic response to treatment with different preparations rich in growth [20]E.Anitua,R.Prado,M.Sanchez,´ and G. Orive, “Platelet-rich factors,” Cell Proliferation,vol.42,no.2,pp.162–170,2009. plasma: preparation and formulation,” Operative Techniques in Orthopaedics,vol.22,no.1,pp.25–32,2012. [36] E.Anitua,M.Sanchez,A.T.Nurdenetal.,“Reciprocalactionsof 𝛽 [21] D. Endy, “Foundations for engineering biology,” Nature,vol. platelet-secreted TGF- 1 on the production of VEGF and HGF 438,no.7067,pp.449–453,2005. byhumantendoncells,”Plastic and Reconstructive Surgery,vol. 119, no. 3, pp. 950–959, 2007. [22] Y. Ogino, Y. Ayukawa, T. Kukita, and K. Koyano, “The contribution of platelet-derived growth factor, transforming [37] E. Anitua, M. Sanchez,´ A. T. Nurden et al., “Platelet-released growth factor-𝛽1, and insulin-like growth factor-I in platelet- growth factors enhance the secretion of hyaluronic acid and rich plasma to the proliferation of osteoblast-like cells,” Oral induce hepatocyte growth factor production by synovial fibrob- Surgery, Oral Medicine, Oral Pathology, Oral Radiology and lasts from arthritic patients,” Rheumatology,vol.46,no.12,pp. Endodontology,vol.101,no.6,pp.724–729,2006. 1769–1772, 2007. [23] E. Cenni, G. Ciapetti, D. Granchi et al., “Endothelial cells incu- [38] M. Cheng, V. M. Johnson, and M. M. Murray, “Effects of age bated with platelet-rich plasma express PDGF-B and ICAM- and platelet-rich plasma on ACL cell viability and collagen gene 1 and induce bone marrow stromal cell migration,” Journal of expression,” Journal of Orthopaedic Research,vol.30,no.1,pp. Orthopaedic Research,vol.27,no.11,pp.1493–1498,2009. 79–85, 2012. [24] M. Sanchez, E. Anitua, R. Cugat et al., “Nonunions treated [39] E. V. Tchetina, “Developmental mechanisms in articular carti- with autologous preparation rich in growth factors,” Journal of lage degradation in osteoarthritis,” Arthritis,vol.2011,ArticleID Orthopaedic Trauma,vol.23,no.1,pp.52–59,2009. 683970, 16 pages, 2011. [25] R.Seijas,R.Y.Santana-Suarez,´ M. Garc´ıa-Balletbo,´ X. Cusco,´ O. [40] G. M. van Buul, W. L. M. Koevoet, N. Kops et al., “Platelet- Ares, and R. Cugat, “Delayed union of the clavicle treated with rich plasma releasate inhibits inflammatory processes in plasma rich in growth factors,” Acta Orthopaedica Belgica,vol. osteoarthritic chondrocytes,” The American Journal of Sports 76,no.5,pp.689–693,2010. Medicine, vol. 39, no. 11, pp. 2362–2370, 2011. [26] E. Anitua, R. Tejero, M. M. Zalduendo et al., “lasma rich in [41] G. Rizzello, U. G. Longo, S. Petrillo et al., “Growth factor and growth factors (PRGF- Endoret ) promotes bone tissue regen- stem cells for the management of anterior cruciate ligament eration by stimulating proliferation, migration and autocrine tears,” The Open Orthopaedics Journal,vol.6,pp.525–530,2012. secretion on primary human osteoblasts,” Journal of Periodon- [42] A. Hoffmann and G. Gross, “Tendon and ligament engineering tology,vol.84,no.8,pp.1180–1190,2012. in the adult organism: mesenchymal stem cells and gene- [27] E. Anitua, M. Sanchez, A. T. Nurden et al., “Autologous therapeutic approaches,” International Orthopaedics,vol.31,no. fibrin matrices: a potential source of biological mediators that 6, pp. 791–797, 2007. 10 BioMed Research International

[43]S.L.-Y.Woo,S.D.Abramowitch,R.Kilger,andR.Liang, “Biomechanics of knee ligaments: injury, healing, and repair,” Journal of Biomechanics,vol.39,no.1,pp.1–20,2006. [44] A. I. Caplan and J. E. Dennis, “Mesenchymal stem cells as trophic mediators,” Journal of Cellular Biochemistry, vol. 98, no. 5, pp. 1076–1084, 2006. [45] W. R. Shelton and B. C. Fagan, “Autografts commonly used in anterior cruciate ligament reconstruction,” Journal of the American Academy of Orthopaedic Surgeons,vol.19,no.5,pp. 259–264, 2011. [46] K. M. Khan and A. Scott, “Mechanotherapy: how physical therapists’ prescription of exercise promotes tissue repair,” British Journal of Sports Medicine,vol.43,no.4,pp.247–252, 2009. [47] S. P. Arnoczky amd and C. A. McDevitt, “The meniscus: Structure, function, repair and replacement,” in Orthopaedic Basic Science: Biology and Biomechanics of the Musculoskeletal System, J. A. Buckwalter, T. A. Einhorn, and S. R. Simon, Eds., pp. 531–545, American Academy of Orthopaedic Surgeon, Rosemont, Ill, USA, 2nd edition, 2000. [48] S. A. Rodeo and S. Kawamura, “Form and function of the meniscus,” in Orthopaedic Basic Science: Biology and Biome- chanics of the Musculoskeletal System,J.A.Buckwalter,T.A. Elnhorn, and R. J. Okeefe, Eds., pp. 175–190, American Academy of Orthopaedic Surgeon, Rosemont, Ill, USA, 2nd edition, 2000. [49]K.Ishida,R.Kuroda,M.Miwaetal.,“Theregenerativeeffects of platelet-rich plasma on meniscal cells in vitro and its in vivo application with biodegradable gelatin hydrogel,” Tissue Engineering, vol. 13, no. 5, pp. 1103–1112, 2007. [50] L.-C. Wei, S.-G. Gao, M. Xu, W. Jiang, J. Tian, and G.-H. Lei, “A novel hypothesis: the application of platelet-rich plasma can promote the clinical healing of white-white meniscal tears,” Medical Science Monitor, vol. 18, no. 8, pp. HY47–HY50, 2012. [51] E. Anitua, M. Sanchez, G. Orive et al., “A biological therapy to osteoarthritis treatment using platelet-rich plasma,” Expert OpiniononBiologicalTherapy,vol.13,no.8,pp.1–12,2013. [52] D. J. Leong, Y. H. Li, X. I. Gu et al., “Physiological loading of joints prevents cartilage degradation through CITED2,” The FASEB Journal, vol. 25, no. 1, pp. 182–191, 2011. Hindawi Publishing Corporation BioMed Research International Volume 2014, Article ID 537686, 10 pages http://dx.doi.org/10.1155/2014/537686

Research Article Are Applied Growth Factors Able to Mimic the Positive Effects of Mesenchymal Stem Cells on the Regeneration of Meniscus in the Avascular Zone?

Johannes Zellner,1 Christian Dirk Taeger,1,2 Markus Schaffer,1 J. Camilo Roldan,1 Markus Loibl,1 Michael B. Mueller,1 Arne Berner,1 Werner Krutsch,1 Michaela K. I. Huber,1 Richard Kujat,1 Michael Nerlich,1 and Peter Angele1,3

1 Department of Trauma Surgery, University Medical Center Regensburg, Franz Josef Strauß Allee 11, 93042 Regensburg, Germany 2 Department of Plastic and Hand Surgery, University Hospital of Erlangen, Friedrich-Alexander University Erlangen-Nurnberg,¨ 91054 Erlangen, Germany 3 Sporthopaedicum Regensburg, 93053 Regensburg, Germany

Correspondence should be addressed to Johannes Zellner; [email protected]

Received 4 June 2014; Revised 16 August 2014; Accepted 18 August 2014; Published 31 August 2014

Academic Editor: Giuseppe Filardo

Copyright © 2014 Johannes Zellner et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Meniscal lesions in the avascular zone are still a problem in traumatology. Tissue Engineering approaches with mesenchymal stem cells (MSCs) showed successful regeneration of meniscal defects in the avascular zone. However, in daily clinical practice, a single stage regenerative treatment would be preferable for meniscus injuries. In particular, clinically applicable bioactive substances or isolated growth factors like platelet-rich plasma (PRP) or bone morphogenic protein 7 (BMP7) are in the focus of interest. In this study,theeffectsofPRPandBMP7ontheregenerationofavascularmeniscaldefectswereevaluated.Invitroanalysisshowedthat PRP secretes multiple growth factors over a period of 8 days. BMP7 enhances the collagen II deposition in an aggregate culture model of MSCs. However applied to meniscal defects PRP or BMP7 in combination with a hyaluronan collagen composite matrix failed to significantly improve meniscus healing in the avascular zone in a rabbit model after 3 months. Further information ofthe repair mechanism at the defect site is needed to develop special release systems or carriers for the appropriate application of growth factors to support biological augmentation of meniscus regeneration.

1. Introduction of meniscal lesions in the avascular zone in animal trials [3– 5]. Meniscal lesions in the avascular zone are still an unsolved However, in these models, the application of MSCs problem. Due to the poor self-healing potential of meniscal required a two-step procedure with cell expansion between tissueintheinnerzone,partialmeniscectomyoftenisthe two operations. In a hypothetical clinical use, such an ap- only treatment option. However, the meniscus plays an im- proach would have high regulatory burdens and costs. Ad- portant role in the biomechanics of the knee joint concerning ditionally, it is still unclear how MSCs promote healing in force transmission, shock absorption, provision of joint, a Tissue Engineering approach. Besides the possibility that stability, lubrication, and proprioception [1]. Consecutively, MSCs serve as the repair cells themselves, it seems more than the loss of meniscus predisposes the knee joint to degenera- likely that they promote regeneration by delivery of bioactive tive changes [2]. substances like growth factors [6]. Regeneration of meniscus in the avascular zone is possi- Platelet-rich plasma (PRP) is a clinically available source ble. In particular, the use of mesenchymal stem cells (MSCs) for the application of growth factors [7]. Depending on the in a Tissue Engineering approach showed improved healing different ways of preparation, PRP provides a huge variety 2 BioMed Research International of multiple growth factors [8]. In clinical use, PRP already aperiodof8daysandthereleaseofPDGF,TGF𝛽1, and VEGF showed promising results for the regeneration of different was measured over time. tissue types like rotator cuff9 [ ]andcartilage[10, 11]and for enhanced healing during ligament reconstruction [12]. 2.3. Preparation of Human PRP and Loading of Composite Positive effects on meniscal healing also seem to be possible. Scaffolds. FortheinvitroanalysisofPRP,humanbloodwas Additionally isolated growth factors have shown impli- drawn from 4 volunteers with the approval of the local ethical cations for healing of musculoskeletal tissue. Regarding committee. Clotting was prevented with citrate and ACD- cartilage tissue, BMP7 showed improved proliferation of A. 10 mL blood was spun down unrestrained at 200 G for human chondrocytes [13] and chondrogenic differentiation 15 minutes and after removal of the erythrocytes-layer again of adipose tissue derived MSCs [14].InaphaseIclinical at 4000 G for 15 minutes. The platelet-rich cell pellet was study, it showed no dose depending toxicity when injected isolated by removal of the plasma [19]. into osteoarthritic knees [15]. In clinical application, BMP7 In pretests, microscopical analysis and thrombocytes/cell revealed improved healing of osteochondral defects of the counts were performed to assess the quality and compo- knee by development of hyaline cartilage-like tissue [16], sition of the pellets and the concentration of thrombo- which is also present in the central avascular part of the men- cytes. To assess viability of the isolated thrombocytes, the iscus. standard procedure of a life-dead kit (LIVE/DEAD Viabil- The goal of this study was the analysis of a combination ity/Cytotoxicity Kit (L-3224), Mo Bi Tec, Gottingen)¨ had of growth factors administered by PRP or of a single growth to be modified as thrombocytes lack sufficient quantity of factor with chondrogenic potential like BMP7 to mimic the DNA or RNA to detect dead cells. Therefore, vital cells were role of MSCs for promotion of meniscal healing in the stained with calcein AM and a photo was taken under the avascular zone. The implication of this one-step biological fluorescencemicroscope.Anotherpictureofthesamesection augmentation on the repair capacity of meniscal tissue should was taken under transmitted light in order to count the be evaluated. We hypothesized that PRP or BMP7 delivered totalnumberofcells.Bothpictureswereputtogetherand to meniscal lesions in the avascular zone with a hyaluronan transparence reduced to 50% each. The number of vital cells collagen composite matrix are able to improve regeneration was subtracted from all cells to get the number of dead cells. in standardized previously described [4, 5]animalmodels. For further analysis, hyaluronan collagen composite matrices were seeded with PRP by soaking the buffy coat into 2. Materials and Methods the scaffolds.

To ensure a lasting effect of growth factors directly at the me- 2.4. In Vitro Analysis of Growth Factor Release Kinetics. Four niscal lesion sites, we decided to deliver PRP or BMP7 with a PRP hyaluronan collagen composite matrix constructs of hyaluronan collagen composite matrix. This scaffold showed each of the 4 volunteers were cultured in vitro over a period positive characteristics as a carrier for biological augmenta- of 8 days in 1 mL autologous plasma. tion in previous studies [3–5, 17]. Concentrations of the growth factors PDGF, TGF𝛽1, and VEGF were measured by ELISA technique at 0 h, 8 h, 12 h, 2.1. Composite Scaffolds. The sponge scaffolds were manufac- 24 h, 48 h, and 192 h (8 days) using kits from R&D Systems: tured from 70% derivatized hyaluronan-ester and 30% gelatin Human PDGF-AB DuoSet (DY222), Human TGF𝛽1DuoSet as described previously [17, 18]. The hyaluronan component (DY240), and Human VEGF DuoSet (DY293B). Results of was obtained from the commercially available product Ja- cultured empty control scaffolds were subtracted from the loskin (Fidia Advanced Biopolymers, Abano Terme, Italy), growth factor concentrations obtained from the cultured which is manufactured from hyaluronate, highly esterified PRP loaded scaffolds in order to exclude an influence of the with benzyl alcohol on the free carboxyl groups of glucu- remaining small growth factor activity in the autologous plas- ronic acid along the polymer. The gelatin component was ma. hydrolyzed bovine collagen type I (Sigma, Taufkirchen, Ger- many). 2.5. In Vitro BMP7 Analysis. TheeffectofBMP7onchondro- The porous scaffolds were manufactured by the solvent genesis was tested to evaluate the potential use of this isolated casting, particulate leaching technique, using NaCl with grain growth factor for regeneration in the cartilaginous avascular size of 250–350 𝜇m as primary porogen. Additionally, the part of the meniscus. For this analysis, the aggregate culture insufflating air which replaced the evaporating solvent gen- chondrogenesis model with MSCs of rabbits described by erated secondary pores with the size of 50–100 𝜇m. Scaffolds Johnstone et al. [20, 21] was used. After preparation of the had a diameter of 2.2 mm and a height of 3 mm. MSCs, the pellets were cultured in vitro in chondrogenic medium with different concentrations of BMP7. Chondroge- 2.2. In Vitro PRP Analysis. For in vitro analysis of growth fac- nesis was measured by a collagen II ELISA. tor release kinetics, hyaluronan collagen composite scaffolds were seeded with prepared human PRP. Because of the re- 2.6. Bone Marrow Harvest and Culture. The bone marrow quired amount of blood and the subsequent potential clini- harvest and cell isolation of MSCs were performed as de- cal use, we decided to analyze release kinetics with human scribed elsewhere [20]. Marrow derived cells were harvested PRP.The growth factor matrix composites were cultured over from the iliac crest of New Zealand White Rabbits and BioMed Research International 3 collected into a heparinized syringe. Dulbecco’s modified 24 New Zealand White rabbits (five-month-old males) Eagle’smedium(DMEM),lowglucoseconcentration,with were used for the in vivo PRP analysis. The rabbits were 10% fetal bovine serum, 1% penicillin, and 1% Hepes was anesthetized and exposure of the lateral joint compartment 6 addedtotheaspirate.Nucleatedcells(20×10 )wereplatedin was achieved by a lateral parapatellar arthrotomy. Avascular 2 ∘ 75 cm culture dishes and cultivated at 37 C. The medium was meniscal defects were made by using a 2 mm punch device changed twice a week until the adherent cells reached 80% (Stiefel, Offenbach am Main, Germany) (12 rabbits) or by confluence. inserting a 4 mm long longitudinal meniscal tear in the avascularzone(12rabbits).Thepunchdefectsweretreatedwitha 2.7. In Vitro Chondrogenic Differentiation. In vitro chondro- hyaluronan collagen composite matrix loaded with PRP. The genesis was performed according to recently published pro- meniscal tears were treated by a PRP seeded composite matrix tocols [17, 20]. Expanded MSCs were trypsinized, and aggre- and a 5–0 PDS outside-in suture. This procedure was done 5 gates of 2×10 cells were formed through centrifuga- bilaterally, with the contralateral knee serving as control; an tion at 2000 RPM for 5 minutes in V-bottomed 96-well empty hyaluronan-gelatin scaffold was the control implant plates. Chondrogenic differentiation was induced by treat- for all rabbits. Postoperatively, the animals were allowed free ment with serum-free high-glucose DMEM (Gibco, Invitro- movement without use of any type of immobilization. Rabbits gen) containing 100 nM dexamethasone (Sigma, Steinheim, started full weight bearing immediately after recovery from Germany), 1% ITS 3 (insulin-transferrin-selenium solution) anesthesia. The animals were sacrificed at 6 or 12 weeks. Each (Sigma), 200 𝜇M L-ascorbic acid 2-phosphate (Sigma), 1 mM group consisted of six New Zealand White rabbits. sodium pyruvate (Gibco Invitrogen), and 10 ng/mL human For the in vivo evaluation of BMP7 effects on meniscal TGF𝛽1 (R&D Systems, Wiesbaden, Germany). Culture time healing, 12 animals were used. A 2 mm circular shaped menis- was 21 days. cal defect in the avascular zone was inserted and treated with For analysis of the influence of BMP7 on the chondrogen- a hyaluronan collagen composite matrix and an additional 𝜇 esis of MSCs of rabbits, 5, 10, 50, 100, or 200 ng/mL BMP7 injection of 1 g BMP7 at the time of implantation (Group (generous gift from Genera Biotech, Zagreb, Croatia) was 1, 6 rabbits). In another group, the defect was filled with added with or without 10 ng/mL TGF𝛽1 to the culture medi- a 14-day precultured construct of MSCs and a hyaluronan um. collagen composite matrix (Group 2, 6 rabbits). Harvesting of the MSCs and seeding of the scaffold was performed like 1.5 × 106 2.8. Collagen II ELISA Analysis for Chondrogenic Differen- described above [5]. Each scaffold was seeded with MSCs. The chondrogenic medium consisted of DMEM (high tiated MSC Aggregates. An enzyme-linked immunosorbent 𝜇 assay test for collagen II was performed on chondrogenically glucose), 200 Mascorbicacid2-phosphate,1%ITS(both from Sigma, Taufkirchen, Germany), 1 mM pyruvate, 100 nM differentiated MSC aggregates. Pellets were homogenized in 𝛽 0.05 M acetic acid plus 0.5 M NaCl (pH 2.9-3.0), digested dexamethasone, 10 ng/mL TGF 1 (R&D systems, Wiesbaden, with 10 mg/mL pepsin dissolved in 0.05 M acetic acid on the Germany), and 50 ng/mL BMP7. The implantation of a cell- ∘ rotator for 48 hours at 4 C. The further steps of digestion and free hyaluronan collagen composite matrix in a 2 mm circular the collagen type II estimation were performed as described avascular defect in the lateral meniscus of the contralateral intheNativeTypeIICollagenDetectionKit6009protocol side served as a control group. Follow-up period was 3 (Chondrex, Redmond, WA, USA). The DNA concentration months. in collagen digests was assayed using the Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen, Eugene, OR, USA). Collagen 2.11. Gross Assessment of Joint Morphology. Rabbits with type II was determined as a ratio between content of Collagen surgical implants were euthanized for tissue harvest with type II and DNA for each pellet. an overdose of pentobarbital (1600 mg/mL) given intraperi- toneally. After exposure of the knee joint, the macroscopic 2.9. In Vivo Analysis of the Effects of Applied PRP or BMP7 on morphology of the meniscus and the attachments of the Meniscal Lesions in the Avascular Zone. Harvest of platelet- meniscus to the tibial plateau were evaluated and photo- rich plasma and loading of composite scaffolds for the animal graphed. trial: for the animal trail, autologous blood (10 mL) was drawn from the anesthetized rabbit’s ear vein. This procedure 2.12. Histology. The lateral menisci harvested from the in vivo was approved by the Local Institution of Animal Care. The experiments were fixed in 4% phosphate buffered parafor- preparation of the PRP and the seeding of the scaffolds were maldehyde embedded in Tissue-Tek O.C.T. and frozen in done according to the human protocol described above. liquid nitrogen. Ten-micrometer radial sections of all samples were produced and every fifth of them was stained with tolui- 2.10. Surgical Procedure for Meniscus Defects. The rabbit dine blue or DMMB. animal models were already described and are validated standardized models for testing of meniscal treatment in the 2.13. Immunohistochemistry. As the pars intermedia of rab- avascular zone [3–5]. Similar to human meniscus untreated bit’s meniscus contains mainly collagen type II, especially or only sutured lesions in the avascular zone show no ten- towards the avascular central part of the meniscus, the im- dency for healing. The procedures were approved by the Insti- munohistochemical analysis was performed for collagen type tutional Animal Care and Use Committee of our institution. II. Sections were washed and then digested for 15 min with 4 BioMed Research International

Table 1: Scoring system for the evaluation of the quality of meniscal repair tissue.

01 2 3 Defect filling No fill <25% 25–75% >75% Surface No surface ruptured Fissured/fibrillated Meniscus-like Bilateral partial or Partial, unilateral Bilateral complete Integration No integration unilateral complete integration integration integration No cell cluster/slide, Meniscus-like Cellularity No cells >10 cell clusters/slide cell-ECM-ratio >0,5 cell-ECM-ratio <25% meniscus-like >75% meniscus-like Cell morphology No cells 25–75% meniscus-like cells cells cells Content of No staining for <25% 25–75% >75% proteoglycan proteoglycan No staining for Content of collagen II <25% 25–75% >75% collagen II Stable to pressure and Stability No stability Weak Stable in shape pulling stress ECM: extracellular matrix.

0.1% pepsin at pH 3.5 to facilitate antibody access to the 3. Results target epitopes. Type II collagen was immunolocalized by the immunoperoxidase ABC technique (Vector, Burlingame, 3.1. In Vitro Analysis of PRP. Human PRP seeded in hyaluro- CA, USA), applying monoclonal primary antibodies ms. anti nan collagen composite matrices resulted in a high number collagen II, clone II-4C11 (Calbiochem-Merck, Schwalbach, of vital thrombocytes (94%). The PRP was leukocyte-poor 2,5 × 107 𝜇 Germany), biotin conjugated polyclonal secondary antibod- with an average of platelets/ L and a 3 times higher ies (goat anti-mouse IgG (Jackson, West Grove, PA, USA)), concentration of thrombocytes compared to the correspond- and the nickel and cobalt enhanced DAB stain visualization. ing blood samples. After seeding of the composite matrix, an equal distribution of the thrombocytes throughout the 2.14. Meniscus Scoring System. In order to compare the mac- scaffold was obtained (data not shown). roscopical, histological, and immunohistochemical results To imitate the joint environment, the PRP/hyaluronan after repair of the meniscal lesions, a validated meniscus collagencompositematrixconstructswereculturedfor8 scoring system was used, which was developed and published days in autologous plasma. The results of the ELISA analysis 𝛽 for the evaluation of meniscal defects [4, 5]. Subgroups in showed a constant increase in PDGF and TGF 1fromday0 macroscopical assessment were “stability” and “defect filling to day 8 indicating that growth factors were released over the with repair tissue” and for histological analysis the “quality of whole follow-up period. No VEGF was detectable over the the surface area,” “integration,” “cellularity,” and “cell mor- period of 8 days (Figure 1). phology” and subgroup for immunohistochemical characterization was the “expression of proteoglycan and moderate 3.2. In Vivo Analysis of the Meniscal Treatment in the Avascular collagen type II in the repair tissue.”The repair was graded by Zone with PRP. The implantation of a hyaluronan collagen summing up the scores from 0 to 3 of eight individual sub- compositematrixloadedwithPRPshowednosignificant groups. Consequently, the final scores were between 0 points improvement of the repair of avascular meniscal punch (no repair) and maximal 24 points (complete reconstitution defects compared to an implantation of a cell-free scaffold. of the meniscus) (Table 1). The data was collected from 2 After 6 and 12 weeks, the lesions were only partially filled with blinded scorers, both experienced in knee anatomy of rabbits fibrous-like scar tissue. Tears in the tip of the native meniscus andinhistologicalassessment. couldoftenbedetected(Figures2(a), 2(b),and2(c)). In the control group, repair of the punch defects with cell- 2.15. Statistical Analysis. For the in vitro BMP7 evaluation, free matrices resulted in partial defect filling in half of the independent unpaired t-tests were performed to compare the animals after 6 weeks and also after 12 weeks (Figures 2(d), different collagen II ELISA groups. For the in vivo testing, the 2(e),and2(f)). Macroscopically, the repair tissue was soft and scoring results of each group were compared to the results of only partially integrated. Microscopically, the punch defects the control group (cell-free hyaluronan collagen composite were partially filled with fibrous and cell-rich scar tissue. matrix on the contralateral side). Paired t-tests were done No residuals of the implanted scaffolds could be detected for the analysis of the scoring results of all groups. For all (Figure 3). evaluations, the level of statistical significance was set ata Regarding the meniscus tear model, a significant better probability value of less than 0.05. repair of avascular meniscal tears could be detected after BioMed Research International 5

Growth factor release were detectable in the BMP7 treated meniscal defects and 40000 in the control defects (Figures 6(a)–6(f)). However, the 35000 defects treated with MSC composite matrix constructs and 𝛽 30000 precultured in a BMP7 and TGF 1 containing chondrogenic medium showed superior meniscal scoring results compared 25000 to the cell-free matrices (Figure 7). In defects treated with 20000 precultured MSC matrix constructs, differentiated meniscus- 15000 like repair tissue was detectable after 3 months in vivo. In 10000 contrast, the treatment with a cell-free composite matrix Concentration (pg/mL) Concentration 5000 showed only fibrous defect filling after 3 months invivo (Figures 6(g)–6(i)). 0 0 6 12 24 48 192 Time (h) 4. Discussion VEGF PDGF-AB The study analyzed the effects of PRP on meniscus regener- TGF𝛽1 ation in two different meniscus defect models. PRP seeded hyaluronan collagen composite matrices failed to repair a cir- Figure 1: Release kinetics of the growth factors TGF𝛽1, PDGF, and cular full size meniscal defect as well as meniscus tears in the VEGF from PRP hyaluronan collagen composite matrix constructs avascularzone.After3months,thelocalinjectionofBMP7in over a period of 8 days cultured in rabbits’ autologous plasma (mean composite matrices for treatment of circular meniscal defects values of 4 volunteers with standard deviation). in the avascular zone showed no improvement of meniscus regeneration compared to treatment with composite matrices without BMP7.Only treatment with constructs of autologous MSCs seeded on a hyaluronan collagen composite matrix treatment with PRP seeded matrices compared to the cell- showed improvement of meniscal healing and defect filling free matrices after 6 weeks (𝑃 < 0,05). However, this positive with differentiated meniscus-like tissue after 3 months in effect of PRP was not significant after 3 months mainly dueto vivo. Nevertheless, growth factors are still in the focus of a a high inter-animal variability. Defect filling with constructs potential clinical use for biological augmentation of menis- containing matrices with PRP resulted in a poor tear filling cus treatment as they provide the possibility of a one-step without regeneration of the meniscal tear after 3 months. In procedure. afewcases,mutedinstablefibrousattachmentsbetweenthe Tissue Engineering is a promising therapy option for two parts of the meniscus could be detected (Figures 2(g), the treatment of meniscal lesions especially in the avascular 2(h),and2(i)). No signs of meniscus-like tissue reconstitution zone. Recent studies showed that MSCs are able to fill avas- could be seen (Figures 2(j), 2(k),and2(l)). In contrast to cular meniscal defects with differentiated repair tissue3 [ – complete empty tears in the control group, this mutant repair 5]. However, these approaches require a two-step procedure tissue was responsible for the improved scores (Figure 4). with the need of cell expansion between two operations. Such approaches would have high regulatory burdens and costs in 3.3. In Vitro Analysis of BMP7. All tested BMP7 concentra- daily clinical practice. tions, added to chondrogenic medium with TGF𝛽1, revealed Additionally, it is still unclear how MSCs promote menis- chondrogenic differentiation of MSCs. The addition of cal healing. Caplan and Dennis [6] described a dual role of 50 ng/mL BMP7 showed the best results regarding chondro- MSCs in musculoskeletal regeneration. On the one hand, genesis in the pellet culture model with the highest content MSCs could differentiate into repair cells that are required of collagen II in the ELISA analysis. The addition of higher at the defect site. On the other hand, MSCs could act as a concentrations of BMP7 showed no beneficial effect on the mediator for bioactive substances and secrete, for example, development of collagen II under TGF𝛽1 medium condition. growth factors. So it seems very likely that the use of In culture condition without TGF𝛽1, BMP7 showed a growth factors only could have similar positive effects on the concentration dependent increase in collagen II deposition regeneration of meniscus tissue compared to a stem cell based but less chondrogenic differentiation compared to TGF𝛽1 approach by mimicking the delivery of bioactive substances. containing conditions (Figure 5). PRP represents an easy available source for a combination of multiple growth factors that is already in clinical use 3.4. In Vivo Analysis of the Influence of BMP7 on the Regen- and can be applied in a one-step procedure. Properties like eration of Meniscal Defects. The additional injection of 1 𝜇g “biological glue,”contribution to coagulation and hemostasis, BMP7 in meniscus lesions at the time of treatment of a intra-articular restoration of hyaluronic acid, anti-inflamma- circular avascular meniscal defect with cell-free hyaluronan tion, and pain relief are described [7]. collagen composite matrices (group 1) showed no beneficial Beneficial effects by clinical use of PRP were seen in treat- effect compared to matrix implantation without BMP7 injec- ment of rotator cuff tears [9], Achilles tendon ruptures [22], tion (control). After 3 months in vivo, only mixed tissue with chronic tendinosis [23], muscle injuries [7], ACL-rupture scar and small-differentiated areas (collagen type II positive) [12], and cartilage defects [11, 24]. 6 BioMed Research International

(a) (b) (c)

(d) (e) (f)

(g) (h) (i)

(j) (k) (l)

Figure 2: Gross morphology and histological and immunohistochemical (collagen type II) analysis 3 months after treatment of a meniscal punchdefectwithaPRPhyaluronancollagencompositematrixconstruct(a,b,andc)oranemptymatrix(control)(d,e,andf)and3months after treatment of meniscal tears with a PRP hyaluronan collagen composite matrix construct (g, h, and i) or an empty matrix (j, k, and l).No improvement by treatment of meniscal lesions with PRP could be detected. Magnification bars: (a, d, g, and j): 10 mm; (b, c, e, f, h, i, k,and l): 1 mm.

Different techniques were described to prepare PRP. The the neutrophils in the PRP [25] could be neglected. The quality and composition of the PRP depend on the speed number of platelets in the PRP is essential for their bio- and number of centrifugations, the use of anticoagulant or logical potential. For treatment of bone defects, defined activator, and the presence of leukocytes [7]. The PRP used concentrations of platelets in the PRP are described for in this study was leukocyte-poor so that a described dele optimal effects on bony regeneration [26]. However, there terious effect from matrix metalloproteinases 8 and 9 from are no data in literature that evaluated the most effective BioMed Research International 7

Scoring results after treatment of meniscal punch defects Collagen II content of MSC aggregates after 21 days 24 22 22 ∗ 20 20 18 18 16 16 14 14 12 12 Score 10 8 10 6 8 4 6

2 II / DNA collagen Ratio 4 0 2 6 weeks 3 months 0 Time point 0 5 10 50 100 200 7 PRP with hyaluronan collagen composite matrix Concentration BMP (pg/mL) Empty matrix/control −TGF𝛽 + 𝛽 Figure 3: Results of the scoring of meniscal repair tissue after TGF 6 weeks and 3 months in vivo. No significant improvement by Figure 5: ELISA analysis of the collagen II content of chondrogenic treatment of a meniscal punch defect with PRP could be detected ∗ differentiated mesenchymal stem cell (MSC) aggregates after 21 days compared to the control group ( 𝑃 ≤ 0,05). of culture under different conditions. The pellets were cultured with 0, 5, 10, 50, 100, or 200 ng/mL BMP7 with or without 10 ng/mL TGF𝛽1. The addition of 50 ng/mL BMP7 to the TGF𝛽1 containing Scoring results after treatment of meniscal tears 24 culture medium showed the highest content of collagen II compared 22 to other BMP7 concentrations with a significant difference between ∗ 20 10 ng/mL and 50 ng/mL BMP7 ( 𝑃 ≤ 0,05). A BMP7 concentration 18 16 dependent increase in collagen II content was detected under culture 14 conditions without TGF𝛽1. 12 ∗ Score 10 8 6 4 2 seen over the whole measure period of 8 days. The content of 0 collagen type I in the composite matrix might be a possible 6 weeks 3 months reason for the constant release of growth factors, as collagen Time point typeIisknownasanactivatorforPRP,forexample,from PRP with hyaluronan collagen composite matrix chitosan matrices [29]. Similar to this study, Harrison et al. Empty matrix/control saw a constant prolonged release of growth factors compared to other activators like thrombin when collagen type I was Figure 4: Results of the scoring of meniscal repair tissue after 6 used as a component of a PRP seeded scaffold30 [ ]. weeks and 3 months in vivo. Significant improvement by treatment However, no release of VEGF was detectable over 8 days. of meniscus tears with PRP could be detected after 6 weeks ∗𝑃 ≤ 0,05 While other authors report a high concentration of VEGF in compared to the control group ( ). the PRP [8], recently, Anitua et al. also saw a fast decrease in VEGF release from their PRP matrix [31]. The different methods of preparation or presence of soluble VEGF concentration of platelets and released growth factors for a receptors from remaining leukocytes [31]mightbepossible biological support of meniscus regeneration. Additionally, reasons for the varying amounts of VEGF. Theoretically, a in this study, the way of preparation of the PRP had to be highly angiogenic growth factor like VEGF [32]mighthavea adapted to the rabbit model. In order to reach a high number positive effect on the regeneration of an avascular tissue like ofactiveandvitalthrombocytes,decisionwasmadeforan the inner zone of the meniscus. However, there are reports unrestrained centrifugation with 200 G for 15 minutes and that VEGF coated PDLLA sutures failed and showed even 4000Gforanother15minuteswithACD-Aandcitrateto worse results than uncoated sutures when meniscal tears in inhibit coagulation. By this method, a high number of vital the avascular zone of meniscus were reconstructed in a rabbit thrombocytes were reached with only 10 mL blood of the model [33]. So VEGF does not seem to be a mandatory factor rabbits. for regeneration in the avascular zone of meniscus. Growth factor release was measured over a period of 8 In this study, PRP delivered to an avascular meniscal days. In order to imitate the synovial fluid environment of defect in combination with a hyaluronan collagen composite the knee, the PRP hyaluronan collagen composite matrix matrix failed to improve meniscal healing. No sufficient constructs were cultured in rabbits’ autologous plasma. Con- repair tissue was detectable in the circular punch defect after stant release of PDGF and TGF𝛽1thatareknowntoenhance 6or12weeks.However,Ishidaetal.showedpositiveresultsin differentiation and proliferation of meniscal cells [27, 28]was vitro and in vivo by treatment of avascular meniscal defects 8 BioMed Research International

(a) (b) (c)

(d) (e) (f)

(g) (h) (i)

Figure 6: Gross morphology and histological and immunohistochemical (collagen type II) analysis 3 months after treatment of a meniscal punch defect with a cell-free hyaluronan collagen composite matrix and a single injection of 1 𝜇gBMP7atthetimeofsurgery(a,b,andc) or with an empty matrix (control) (d, e, and f). Images (g, h, and i) show the results after treatment with a hyaluronan collagen composite matrix seeded with mesenchymal stem cells (MSCs) and precultured in chondrogenic medium containing BMP7 for 14 days. Treatment with MSCs showed the best defect filling with differentiated repair tissue. Magnification bars: (a, d, and g): 10 mm; (b, c, e, f, h, andi):1mm.

with PRP [34], but the meniscal defect size was smaller than Besides the application of a combination of multiple that in the present study. growth factors with PRP, also isolated growth factors are In treatment of meniscus tears, a tendency of improved interesting for enhancement of meniscal repair in a clinical healing with the addition of PRP to the meniscal suture could one-step setting. One of these growth factors that are clini- be seen after 6 weeks; however, this effect was not significant cally applicable is BMP7.BMP7 showed promising results for after3monthsinvivomainlyduetoahighinter-animalvaria- induction of bone formation [36]butalsointhefieldofcarti- bility. Partially stable repair tissue was detectable with the lage therapy. So BMP7 improved the culture and proliferation addition of PRP, which was responsible for the higher scores of human chondrocytes [13] and enhanced the chondrogenic compared to complete empty tears in groups with meniscus differentiation of adipose tissue derived MSCs in vitro. Cook suture alone. Clinically, Kessler and Sgaglione [35] explored et al. were able to successfully treat osteochondral defects the clinical use of PRP to augment meniscal repairs and with BMP7 injection in clinical use [16]. In this study, the found successful healing along with an 80% success rate in addition of BMP7 to the chondrogenic medium with TGF𝛽1 Tegner and Lysholm scores of 40 young patients treated with induced higher contents of collagen II in chondrogenically meniscal repair and PRP. However, this clinical study was a differentiated aggregates of MSCs. However, high concentra- case series without a control group. So there is still no clear tions of BMP7 in culture conditions without TGF𝛽1showed evidence of improvement of meniscal healing with PRP, but also increasing contents of collagen II deposition indicating signs for a positive influence on meniscal regeneration. the highly chondrogenic potential of this growth factor. BioMed Research International 9

Scoring results of meniscal defect treatment during the regeneration process. Specific release systems and 24 carriers will be necessary to reach that goal. 22 ∗ 20 5. Conclusions 18 16 In the current study, PRP and BMP7 showed positive aspects 14 to promote meniscus regeneration in a one-step procedure 12 but failed to improve significantly meniscal healing in the Score 10 avascular zone in vivo. Uncontrolled release of growth factors 8 in vivo might be a possible reason. However, biological aug- 6 mentation for regenerative meniscal treatment in a one-step 4 procedure still seems to be possible. One aspect of further 2 investigations might be the analysis of the effective secretion 0 patternsofbioactivesubstancesofMSCstodeveloprelease Empty matrix +1𝜇g BMP7 MSC matrix construct systems for a defined and specific application of growth precultured with BMP7 factors at the meniscal defect site. Treatment Control/empty matrix Conflict of Interests Figure 7: Results of the scoring of meniscal repair tissue after 3 The authors declare that there is no conflict of interests months in vivo. Treatment with mesenchymal stem cell composite regarding the publication of this paper. matrix constructs showed significant repair improvement compared ∗ to the control group ( 𝑃 ≤ 0,05). Acknowledgments The authors thank Daniela Drenkard and Thomas Boettner for their excellent technical assistance. This work was sup- In vivo, the local injection of BMP7 at the defect site in ported by the German Research Foundation (DFG) within addition to the insertion of a hyaluronan collagen composite the funding program Open Access Publishing. matrix showed partially differentiated repair tissue but no significant improvement of meniscal healing in an avascular References meniscal punch defect compared to a matrix without BMP7. In contrast, treatment of meniscal punch defects with a MSC [1] E. A. Makris, P. Hadidi, and K. A. Athanasiou, “The knee composite matrix construct resulted in a significant improve- meniscus: structure-function, pathophysiology, current repair ment of meniscal healing in the avascular zone. techniques, and prospects for regeneration,” Biomaterials,vol. 32, no. 30, pp. 7411–7431, 2011. In this study, BMP7 was added to the chondrogenic medium during the 14 days of preculturing period of the [2] I. D. McDermott and A. A. Amis, “The consequences of menis- MSC composite matrix constructs. As comparable results in cectomy,” Journal of Bone and Joint Surgery, vol. 88, no. 12, pp. 1549–1556, 2006. treatment of avascular meniscal defects were achieved without the use of BMP7, in recent studies, BMP7 does not seem [3] P. Angele, B. Johnstone, R. Kujat et al., “Stem cell based tissue engineering for meniscus repair,” JournalofBiomedicalMateri- to be mandatory in the preculturing period. als Research A, vol. 85, no. 2, pp. 445–455, 2008. Limitations of the study are the rabbit animal model and the different cell sources used in the study that make the re- [4] J. Zellner, K. Hierl, M. Mueller et al., “Stem cell-based tissue- engineering for treatment of meniscal tears in the avascular sults less comparable. zone,” Journal of Biomedical Materials Research B Applied PRP and BMP7 failed to significantly improve meniscal Biomaterials,vol.101,pp.1133–1142,2013. healinginvivointhisanimalmodel.Nevertheless,shortterm [5]J.Zellner,M.Mueller,A.Berneretal.,“Roleofmesenchymal improvement in treatment of meniscal tears by PRP,constant stem cells in tissue engineering of meniscus,” Journal of Biomed- release of growth factors from a PRP seeded hyaluronan ical Materials Research A, vol. 94, no. 4, pp. 1150–1161, 2010. collagen composite matrix, and support of MSCs by BMP7 [6] A. I. Caplan and J. E. Dennis, “Mesenchymal stem cells as are promising aspects for a possible clinical application of trophic mediators,” Journal of Cellular Biochemistry, vol. 98, no. growth factors to support meniscal treatment. As a promising 5, pp. 1076–1084, 2006. biological augmentation applicable in a one-step procedure, [7] E. Lopez-Vidriero, K. A. Goulding, D. A. Simon, M. Sanchez, growth factors still have to be in the focus of future research. andD.H.Johnson,“Theuseofplatelet-richplasmainarthro- One of the actual problems for treatment with bioactive scopy and sports medicine: optimizing the healing environ- substances like PRP or isolated growth factors might be the ment,” Arthroscopy,vol.26,no.2,pp.269–278,2010. uncontrolled manner of acting at the defect site. As MSCs [8] A. D. Mazzocca, M. B. R. McCarthy, D. M. Chowaniec et al., promote meniscal healing, their secretion pattern of bioactive “Platelet-rich plasma differs according to preparation method substanceshastobeelucidatedtobeabletoapplytheright and human variability,” Journal of Bone and Joint Surgery A,vol. growth factors with the correct concentration at the right time 94,no.4,pp.308–316,2012. 10 BioMed Research International

[9]P.Randelli,P.Arrigoni,V.Ragone,A.Aliprandi,andP.Cabitza, tendinopathy: clinical and imaging findings at medium-term “Platelet rich plasma in arthroscopic rotator cuff repair: a follow-up,” International Orthopaedics,vol.37,no.8,pp.1583– prospective RCT study, 2-year follow-up,” Journal of Shoulder 1589, 2013. and Elbow Surgery, vol. 20, no. 4, pp. 518–528, 2011. [24] M. Sanchez,´ J. Azofra, E. Anitua et al., “Plasma rich in growth [10] M. Sanchez,´ E. Anitua, J. Azofra, J. J. Aguirre, and I. Andia, factors to treat an articular cartilage avulsion: a case report,” “Intra-articular injection of an autologous preparation rich in Medicine and Science in Sports and Exercise,vol.35,no.10,pp. growth factors for the treatment of knee OA: a retrospective 1648–1652, 2003. cohort study,” Clinical and Experimental Rheumatology,vol.26, [25] E. Anitua, M. Sanchez,A.T.Nurden,P.Nurden,G.Orive,and´ no. 5, pp. 910–913, 2008. I. And´ıa, “New insights into and novel applications for platelet- [11] G. Filardo, E. Kon, A. Roffi, B. di Matteo, M. L. Merli, and rich fibrin therapies,” Trends in Biotechnology,vol.24,no.5,pp. M. Marcacci, “Platelet-rich plasma: why intra-articular? A 227–234, 2006. systematic review of preclinical studies and clinical evidence on [26] G. Weibrich, T. Hansen, W. Kleis, R. Buch, and W. E. Hitzler, PRP for joint degeneration,” Knee Surgery, Sports Traumatology, “Effect of platelet concentration in platelet-rich plasma on peri- Arthroscopy,2013. implant bone regeneration,” Bone,vol.34,no.4,pp.665–671, [12]R.Seijas,O.Ares,J.Catala,P.Alvarez-Diaz,X.Cusco,and 2004. R. Cugat, “Magnetic resonance imaging evaluation of patel- [27] C.A.PangbornandK.A.Athanasiou,“Effectsofgrowthfactors lar tendon graft remodelling after anterior cruciate ligament on meniscal fibrochondrocytes,” Tissue Engineering, vol. 11, no. reconstruction with or without platelet-rich plasma,” Journal of 7-8, pp. 1141–1148, 2005. Orthopaedic Surgery,vol.21,pp.10–14,2013. [28]C.A.PangbornandK.A.Athanasiou,“Growthfactors [13] K. Masuda, B. E. Pfister, R. L. Sah, and E. J.-M. A. Thonar, and fibrochondrocytes in scaffolds,” Journal of Orthopaedic “Osteogenic protein-1 promotes the formation of tissue- Research,vol.23,no.5,pp.1184–1190,2005. engineered cartilage using the alginate-recovered-chondrocyte [29] B. Kutlu, R. S. Tigliˇ Aydin, A. C. Akman, M. Gum¨ us¨¸derelioglu, method,” Osteoarthritis and Cartilage,vol.14,no.4,pp.384–391, and R. M. Nohutcu, “Platelet-rich plasma-loaded chitosan scaf- 2006. folds: preparation and growth factor release kinetics,” Journal of [14] H.-J. Kim and G.-I. Im, “Combination of transforming growth Biomedical Materials Research B: Applied Biomaterials,vol.101, factor-beta2 and bone morphogenetic protein 7 enhances chon- no. 1, pp. 28–35, 2013. drogenesis from adipose tissue-derived mesenchymal stem cells,” Tissue Engineering A,vol.15,no.7,pp.1543–1551,2009. [30] S. Harrison, P. Vavken, S. Kevy, M. Jacobson, D. Zurakowski, and M. M. Murray, “Platelet activation by collagen provides [15]D.J.Hunter,M.C.Pike,B.L.Jonas,E.Kissin,J.Krop,and sustained release of anabolic cytokines,” The American Journal T. McAlindon, “Phase 1 safety and tolerability study of BMP- of Sports Medicine,vol.39,no.4,pp.729–734,2011. 7 in symptomatic knee osteoarthritis,” BMC Musculoskeletal Disorders, vol. 11, article 232, 2010. [31]E.Anitua,M.M.Zalduendo,R.Prado,M.H.Alkhraisat,and G. Orive, “Morphogen and proinflammatory cytokine release [16]S.D.Cook,R.L.Barrack,L.P.Patron,andS.L.Salkeld, kinetics from PRGF-Endoret fibrin scaffolds: evaluation of the “Osteogenic protein-1 in knee arthritis and arthroplasty,” Clin- effect of leukocyte inclusion,” Journal of Biomedical Materials ical Orthopaedics and Related Research,no.428,pp.140–145, Research Part A,2014. 2004. [32] S. Kopf, F. Birkenfeld, R. Becker et al., “Local treatment of [17] P. Angele, R. Muller,¨ D. Schumann et al., “Characterization meniscal lesions with vascular endothelial growth factor,” The of esterified hyaluronan-gelatin polymer composites suitable Journal of Bone and Joint Surgery American Volume,vol.92,no. for chondrogenic differentiation of mesenchymal stem cells,” 16, pp. 2682–2691, 2010. Journal of Biomedical Materials Research A,vol.91,no.2,pp. 416–427, 2009. [33] W.Petersen,T.Pufe,C.Starke¨ et al., “The effect of locally applied [18] P.Angele,R.Kujat,M.Nerlich,J.Yoo,V.Goldberg,andB.John- vascular endothelial growth factor on meniscus healing: gross stone, “Engineering of osteochondral tissue with bone marrow and histological findings,” Archives of Orthopaedic and Trauma mesenchymal progenitor cells in a derivatized hyaluronan- Surgery,vol.127,no.4,pp.235–240,2007. gelatin composite sponge,” Tissue Engineering,vol.5,no.6,pp. [34]K.Ishida,R.Kuroda,M.Miwaetal.,“Theregenerativeeffects 545–553, 1999. of platelet-rich plasma on meniscal cells in vitro and its in [19] W. S. Pietrzak and B. L. Eppley, “Platelet rich plasma: biology vivo application with biodegradable gelatin hydrogel,” Tissue and new technology,” JournalofCraniofacialSurgery,vol.16,no. Engineering, vol. 13, no. 5, pp. 1103–1112, 2007. 6, pp. 1043–1054, 2005. [35] M. W. Kessler and N. A. Sgaglione, “All-arthroscopic meniscus [20] B. Johnstone, T. M. Hering, A. I. Caplan, V. M. Goldberg, and repair of avascular and biologically at-risk meniscal tears.,” J. U. Yoo, “In vitro chondrogenesis of bone marrow-derived Instructional course lectures,vol.60,pp.439–452,2011. mesenchymal progenitor cells,” Experimental Cell Research,vol. [36] J. C. Roldan,´ S. Jepsen, J. Miller et al., “Bone formation in 238, no. 1, pp. 265–272, 1998. thepresenceofplatelet-richplasmavs.bonemorphogenetic [21] B. Johnstone and J. Yoo, “Bone marrow-derived mesenchymal protein-7,” Bone,vol.34,no.1,pp.80–90,2004. progenitor cells,” Methods in Molecular Biology,vol.137,pp.313– 315, 2000. [22] M. Sanchez,´ E. Anitua, J. Azofra, I. And´ıa, S. Padilla, and I. Mujika, “Comparison of surgically repaired Achilles tendon tears using platelet-rich fibrin matrices,” The American Journal of Sports Medicine,vol.35,no.2,pp.245–251,2007. [23] G. Filardo, E. Kon, B. di Matteo, P. Pelotti, A. di Martino, and M. Marcacci, “Platelet-rich plasma for the treatment of patellar Hindawi Publishing Corporation BioMed Research International Volume 2014, Article ID 129515, 9 pages http://dx.doi.org/10.1155/2014/129515

Review Article Regenerative Medicine in Rotator Cuff Injuries

Pietro Randelli,1,2 Filippo Randelli,2 Vincenza Ragone,2 Alessandra Menon,2 Riccardo D’Ambrosi,2 Davide Cucchi,2 Paolo Cabitza,1,2 and Giuseppe Banfi1,3

1 Dipartimento di Scienze Biomediche per la Salute, Universita` degli Studi di Milano, Via Mangiagalli 31, 20133 Milan, Italy 2 IRCCS Policlinico San Donato, Via Morandi 30, San Donato Milanese, 20097 Milan, Italy 3 IRCCS Istituto Ortopedico Galeazzi, Via Galeazzi 4, 20161 Milan, Italy

Correspondence should be addressed to Vincenza Ragone; [email protected]

Received 28 February 2014; Revised 23 July 2014; Accepted 27 July 2014; Published 13 August 2014

Academic Editor: Tomokazu Yoshioka

Copyright © 2014 Pietro Randelli et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Rotator cuff injuries are a common source of shoulder pathology and result in an important decrease in quality of patient life. Given the frequency of these injuries, as well as the relatively poor result of surgical intervention, it is not surprising that new and innovative strategies like tissue engineering have become more appealing. Tissue-engineering strategies involve the use of cells and/or bioactive factors to promote tendon regeneration via natural processes. The ability of numerous growth factors to affect tendon healing has been extensively analyzed in vitro and in animal models, showing promising results. Platelet-rich plasma (PRP) is a whole blood fraction which contains several growth factors. Controlled clinical studies using different autologous PRP formulations have provided controversial results. However, favourable structural healing rates have been observed for surgical repair of small and medium rotator cuff tears. Cell-based approaches have also been suggested to enhance tendon healing. Bone marrow is a well known source of mesenchymal stem cells (MSCs). Recently, ex vivo human studies have isolated and cultured distinct populations of MSCs from rotator cuff tendons, longead h of the biceps tendon, subacromial bursa, and glenohumeral synovia. Stem cells therapies represent a novel frontier in the management of rotator cuff disease that required further basic and clinical research.

1. Introduction A recent meta-analysis has shown that the development and introduction of novel surgical techniques are not related Rotator cuff lesions represent the vast majority of shoulder to an improvement of clinical and anatomical results over the injuries in adult patients and are a common contributing investigated period (1980–2012) [4]. factor to shoulder pain and occupational disability. To enhance tendon tissue regeneration, new biologi- The incidence of this condition is increasing along with cal solutions including growth factors, platelet-rich plasma an aging population [1]. The management of rotator cuff tears (PRP), and stem cells are being investigated. is complex and multifactorial. Operative treatment allows primary repair to be performed either as an open or arthro- This review will outline the current evidence for the novel scopic procedure. frontier in the management of rotator cuff disease including Improvements in arthroscopic instrumentation and growth factor and stem cell therapy. suture anchor technology have allowed the development of stronger constructs with multiple suture configurations, 2. Growth Factors allowing repair of large and massive tears through minimally invasive means. However, although repair instrumentation Growth factors are signal molecules involved in the control and techniques have improved, healing rates have not. A of cell growth and differentiation and are active in different high failure rate remains for large and massive rotator cuff phases of inflammation. They are produced by inflammatory tears [2, 3]. cells, platelets, and fibroblasts. 2 BioMed Research International

Rotator cuff healing occurs via a sequence of inflam- cellular proliferation, differentiation, and matrix synthesis mation, repair, and remodeling [21]. Several growth fac- [24]. tors released in the repair phase act in both an autocrine Of the three isoforms, TGF-𝛽3 holds the greatest promise and paracrine fashion to promote cellular proliferation and to enhance the local microenvironment of the rotator cuff matrix deposition. These include basic fibroblast growth repair site because its high expression during fetal wound factor (bFGF), bone morphogenetic proteins 12, 13, and 14 healing correlates with no formation of scar tissue [29]. (BMP-12,13,14), vascular endothelial growth factor (VEGF), By contrast, postnatal wound healing is characterized by platelet derived growth factor (PDGF-𝛽), transforming extensive scar formation, with high levels of TGF-𝛽1and growth factor-beta (TGF-𝛽), and insulin-like growth factor-1 TGF-𝛽2 expression and low level of TGF-𝛽3. Because TGF- (IGF-1) [22, 23]. 𝛽3 is not present within the adult healing environment, its Because rotator cuff healing results in reactive scar for- exogenous application could promote a scarless regenerative mation rather than a histologically normal insertion site, healing process. Based on this assumption, three recent 𝛽 addition of these factors may enhance the repair-site biology. studies have specifically examined the use of TGF- 3inarat PDGF is a basic protein composed of two subunits, an rotator cuff model [29–31]. AandaBchain,thatexistsinthreemainisoforms(PDGF- Kim et al. [30].usedanosmoticpumpdeliverysystem 𝛽 𝛽 AA, PDGF-BB, and PDGF-AB). These isoforms function to specifically investigate the role of TGF- 1andTGF- 3at as chemotactic agents for inflammatory cells and help to the tendon-to-bone insertion of repaired rat supraspinatus 𝛽 increasetypeIcollagensynthesisandinduceTGF-𝛽1 expres- tendons. The TGF- 1 group showed increased type III col- sion [22]. The homodimer PDGF-BB has been the subject lagen production compared with control shoulders, which of most research because it stimulates both matrix synthesis is consistent with a scar-mediated healing response. There andcelldivision[24, 25].Kobayashietal.[23]studiedthe was also a trend toward reduced mechanical properties 𝛽 expression of PDGF-BB during the early healing of the within this group. By contrast, the TGF- 3groupshowed supraspinatus tendon in New Zealand white rabbits. They no histological or biomechanical differences compared with 𝛽 found that the highest concentration of PDGF-BB occurred thepairedcontrols.WhiletheseresultssupporttheTGF- 1 between days 7 and 14. This period coincides with the mediated reparative healing response, the lack of improve- 𝛽 terminal part of the inflammatory phase of tendon healing ment in the TGF- 3groupcouldbeattributedtothedelivery and the early part of the repair phase. system used. A subsequent study by the same group using a heparin- Several studies have examined the role of PDGF as a /fibrin-based TGF-𝛽3 delivery system to the tendon-to-bone mitogenic and chemotactic cytokine that can enhance tendon insertion demonstrated accelerated healing with increased and ligament healing. inflammation, cellularity, vascularity, and cell proliferation Uggen et al. [26] showed restoration of normal crimp at early time points [29]. In addition, there were significant patterning and collagen-bundle alignment in a rat rotator improvements in structural and mechanical properties, com- cuff repair model after delivery of cells expressing PDGF- pared with controls. These findings suggest that TGF-𝛽3can BB on a polyglycolic acid scaffold, compared with controls. enhance tendon-to-bone healing in vivo in a rat model. In Later,thesameauthorsexaminedtheeffectsofrecombinant a further study the authors examined the delivery to the humanPDGF-BB-coatedsuturesonrotatorcuffhealingin tendon-bone interface of repaired rat supraspinatus tendons a sheep model [27]. This study showed enhanced histological of TGF-𝛽3inaninjectablecalcium-phosphatematrix(Ca-P) scores of the treatment group in comparison with controls at a [31]. The authors found new bone formation, increased fibro- follow-up period of 6 weeks; however, there was no significant cartilage, and improved collagen organization with the use of difference between the groups in terms of ultimate load-to- the osteoconductive Ca-P matrix alone. With the addition of failure. TGF-𝛽3 to the Ca-P matrix, there was a significant improve- A similar study used an interpositional graft composed of ment in strength at the repair site 4 weeks postoperatively a type I collagen matrix, enriched with recombinant human and a more favorable collagen type I/III ratio, which reflects PDGF-BB (rhPDGF-BB), implanted in an ovine model for more mature healing. These results further support the role rotator cuff repair [28]. At 12 weeks after repair, the inter- of TGF-𝛽3inimprovingtendonhealingaftersurgicalrepair; positional graft at low and medium dosages of rhPDGF- however, future studies are needed to optimize delivery tech- BB (75 and 150 mg) had improved biomechanical strength niques and dosing as well as to examine the effects of multiple and anatomic appearance compared with the control group growth factors administration on the healing process. and the 500 mg rhPDGF-BB group. These studies highlight again the importance of PDGF dosing, timing, and delivery methods. Although the exact answer still remains unclear, 3. PRP PDGF augmentation holds promise for augmenting tendon- The use of PRP as a biological solution to improve rotator to-bone healing. cuff tendon healing has gained popularity over the last several TGF-𝛽 is a family of cytokines that includes three years. isoforms (TGF-𝛽1, 2, and 3). Although this superfamily is PRP is a whole blood fraction containing high platelet responsible for numerous physiologic effects, it is of particu- concentrations that, once activated, provides a release of lar interest in biological augmentation, as it is thought to play various growth factors which participate in tissue repair proc- an important role in tendon and ligament formation through esses [32]. BioMed Research International 3

In vitro studies on the effect of PRP on human tenocytes Conflicting results on the effectiveness of PRP use in rota- from rotator cuff with degenerative lesions showed that tor cuff tendon repair were produced, making it now difficult growth factors released by platelets may enhance cell prolifer- to draw definitive conclusions. ation of tenocytes and promote the synthesis of extracellular The clinical studies published to date have different matrix [33, 34]. experimental designs with a level of evidence that varies from PRP not only inhibits the inflammatory effects of inter- 1 to 4. Moreover, there are differences in PRP formulations in leukin 1𝛽 (IL-1𝛽) but also enhances TGF-𝛽 production. terms of growth factor concentration and catabolic enzyme Increased concentration of IL-1𝛽 is significantly correlated content [39]. A PRP classification system exists, which is with rotator cuff tendon degeneration; conversely, TGF-𝛽 based on whether white blood cells are present and whether enhances rotator cuff tendon repair strength [35]. Further- PRPisusedinanactivated(ex vivo activation with thrombin more, an in vivo animal study showed that different types of and/orcalcium)orunactivatedform(in vivo activation via application did not influence the effect of PRP on rotator cuff endogenous collagen) [48]. healing [36]. Experimental protocols present differences among the trials, concerning volume of autologous blood collected, 3.1. PRP Formulation. There are several different PRP for- speed and time of centrifugation, method of administration, mulations currently available. PRP can be classified into activating agent, presence of leukocytes, final volume of PRP, four main categories: pure PRP (P-PRP), leucocyte-rich PRP and final concentration of platelets and growth factors. The (L-PRP), pure platelet-rich fibrin (P-PRF), and leucocyte- surgical technique (transosseous equivalent, single, or double rich platelet-rich fibrin (L-PRF). In each category, platelet row) and the rehabilitation protocol (standard or rapid) were concentration can be obtained by different processes, either not the same among different studies. in a fully automatized setup or by manual protocols [37]. In spite of the differences in surgical techniques, PRP Among PRP formulations, a further division can be made formulation, size of the lesions, retear rate have been recal- between those which are activated ex vivo with thrombin culated by combining the available data from studies in order and/or calcium and those unactivated, which rely on in vivo to determine the role of PRP in improving the rotator cuff activation via endogenous collagen [38]. healing after surgical repair. The role of leucocytes in PRP is a controversial issue in Differences in term of retear rate between PRP and the literature. control group were assessed by a chi-square test. The analysis Basic science studies showed that growth factors and of all studies examined showed that there was no significant cytokine concentrations are influenced by the cellular com- difference in the retear rate between PRP and control group. position of PRP, with leukocytes increasing catabolic signal- Theretearratewas31%(101outof323)and37%(115outof ing molecules [39]. 312), respectively (𝑃 value > 0.05). Furthermore L-PRP has been found more proinflamma- A significant difference was found when a stratified tory when injected in rabbits [40]andincreasedthelevels analysis was performed to analyze the results of small and of MMPs when assayed in tenocyte cultures compared with medium lesions of the rotator cuff. The rate of reinjury was pure PRP [41]. However, other studies have pointed out the 7.9% among patients treated with PRP, compared to 26.8% of positive role of leucocytes in PRP as anti-infectious and those treated without PRP [49]. immune regulatory agents [42–45]. It is important to emphasize that, with the exception of Most clinical studies have used numerous different PRP two cases of infection, no complications have been reported formulations. The obtained results have never been analyzed from the use of PRP. Bergeson et al. [17]showedaninfection using the leucocyte content of the final concentrate as a rate of 12% among patients treated with fibrin matrix rich in key parameter. Thus, differences between P-PRP and L-PRP platelets without leucocytes compared to 0% in the control preparations are still unknown. group. However, this difference did not reach statistical However the leukocyte content does not seem to induce significance, and no difference in the rates of infection or negative effects or to impair the potentially beneficial effects complication rates was found in the remaining studies. of PRP and no uncontrolled immune reactions of L-PRPs have been also reported; on the contrary, the use of L-PRP Although clinical studies have produced conflicting could diminish pain and inflammation of the treated sites results, data on PRP suggest a beneficial effect on healing [46, 47]. Further randomized controlled trials comparing the process when applied during rotator cuff repair. The stratified effectiveness of L-PRP versus P-PRP will help in defining the analysis of small or medium lesions showed a significantly optimal PRP formulation to manage rotator cuff injuries. lower retear rate in the PRP group. Therefore, it currently seems that PRP may improve healing of arthroscopically 3.2. Surgical Use of PRP in Arthroscopic Rotator Cuff Repair. repaired small and medium rotator cuff lesions, which appear Literature showed that PRP can be applied either by direct more prone to a biological response to treatment with growth injection or by application of a PRP matrix scaffold on factors. repaired tissues. The main characteristics of controlled clin- Further prospective randomized controlled trials (level 1 ical studies using PRP in arthroscopic rotator cuff repair are evidence) are necessary to define the role of PRP in healing reported in Table 1 [5–18]. of rotator cuff repair. 4 BioMed Research International

Table 1: Controlled clinical studies investigating the use of PRP in rotator cuff lesions.

Surgical use of PRP in arthroscopic rotator cuff repair Number of Author Evidence PRP formulation Surgical technique Comments patients Level 1 Better clinical outcomes at 3 mo; better Randelli et al. Injectable PRP Randomized Single row 53 clinical outcomes at 12, 24 months for (2011) [5] (GPS system) controlled smaller tears with PRP Level 1 Injectable PRP Ruiz-Moneo et al. No differences in rotator cuff healing or Randomized (PRGF Endoret Double row 63 (2013) [6] function at 1 year controlled system) Level 2 Antuna˜ et al. Injectable PRP No differences in clinical outcomes and Randomized Single row 28 (2013) [7] (Vivostat system) healing rate at 2 years controlled No differences in cuff healing or function Charousset et al. Level 3 Injectable PRP at 2 years Double row 70 (2014) [8] Case control (GPS system) A significant advantage for the L-PRP patients in terms of smaller iterative tears Level 1 Suturable PRP Gumina et al. Lower retear in the PRP group; no Randomized (RegenKit-THT Single row 76 (2012) [9] differences for clinical outcomes controlled system) Level 2 Suturable PRP Trend for lower re-tearing in the PRP Jo et al. Transosseous Prospective (COBE spectra 42 group; no differences for recovery and (2011) [10] equivalent cohort system) function Level 1 Suturable PRP Jo et al. Transosseous Lower retear and function at 1 year in the Randomized (COBE spectra 48 (2013) [11] equivalent PRP group controlled system) Level 1 Zumstein et al. Suturable PRP Transosseous Increased vascularization for cuff tears Randomized 20 (2014) [12] (PRF process) equivalent with PRP controlled No difference for clinical outcomes at 16 Level 1 months; better restoration of footprint in Castricini et al. Suturable PRP Randomized Double row 88 PRP group (2011) [13] (Cascade system) controlled Lower retear using the chi-square test for binomial in Arnoczky [14]analysis Level 2 Single OR double Rodeo et al. Suturable PRP No difference in tendon healing, tendon Randomized row/transosseous 67 (2012) [15] (Cascade system) vascularity, and clinical scores at 1 year controlled equivalent Level 3 Barber et al. Suturable PRP Lower retear in the PRP group; better Case-control Single row 40 (2011) [16] (Cascade system) healing for smaller tears with PRP study Higher retear rate in patients with at-risk Bergeson et al. Level 3 Suturable PRP Single or double rotator cuff tears with PRFM; no 37 (2012) [17] Cohort study (Cascade system) row difference in functional outcome scores Historical control group Level 1 Weber et al. Suturable PRP No difference in perioperative morbidity, Randomized Single row 60 (2013) [18] (Cascade system) clinical outcomes, or structural integrity controlled PRP injections for rotator cuff tendinopathy Control Number of Author Evidence PRP intervention Comments intervention patients Level 1 2 PRP (3 mL) 2 dry needling PRP was superior with respect to pain, Rha et al. Randomized injections at a procedures at a 39 function, and range of motion over a (2013) [19] controlled 4-week interval 4-week interval 6-month period Level 1 Kesikburun et al. 1 injection of PRP 1 injection of saline No difference for quality of life, pain, Randomized 40 (2013) [20] (5 mL) solution (5 mL) disability, and range of motion at 1 year controlled BioMed Research International 5

3.3. PRP Injections for Rotator Cuff Tendinopathy. Injections 4.3. Source of MSCs. Bonemarrowisthemainsourceof of PRP have gained popularity in the treatment of tendi- MSCs for rotator cuff healing and can be easily accessed nopathy because of their promoting effects on tendon cell by surgeons to harvest cells, the extraction and culture proliferation, collagen synthesis, and vascularization, which techniques of which, as well as the conditions for propaga- have been shown in animal and in vitro studies [34, 50]. tion, have been extensively defined. For these reasons, bone In spite of this popularity and increasing use in clinical marrow-derived MSCs (BMSCs) may have valid clinical use, settings we have found only two controlled randomized and there is evidence showing that BMSCs can be manip- trials evaluating the use of PRP injections in rotator cuff ulated to differentiate into a tenogenic lineage and produce tendinopathy [19, 20]. tendon tissue when exposed to the appropriate stimuli. The iliac crest is the most common site for MSC harvest- Thesestudieshavereportedcontroversialresultsonthe ing, although a number of other sources have been recently effectiveness of the use of PRP injection in chronic rotator identified. Recent research performed by Mazzocca et al. cuff tendon diseases. [52] demonstrated that MSCs can be successfully and safely The systems of PRP preparation were not the same among harvested from the proximal humerus during arthroscopic trials and different treatment protocols were used (single or rotator cuff repair in humans and thus potentially applied to double PRP injections). Furthermore, the presence of some the repair site of the same patient to augment tendon-to-bone bias including the concomitant standard exercise program healing. In another study, authors characterized the harvested and the needle stimulus effect can have influenced the results cells as BMSCs and induced differentiation in tenocyte-like of studies. The nature of rotator cuff disease was also not cells by treatment with insulin [53].Thisgrouphasshownthat thesamethroughoutthestudiesandpatientsrefractoryto it is possible to extract culture and differentiate stem cells into physical therapy and corticosteroid injection seem to have a tendon cells in humans. benefit from the PRP use. Beitzel et al. [54, 55]showedthatarthroscopicbonemar- Extrinsic and intrinsic factors including anatomical prob- row aspiration from the proximal humerus is a reproducible lems, joint kinematics alterations, and age- and vascularity- technique and yields reliable concentrations of MSCs. These related degenerative changes may play a role in developing studies demonstrate that BMSCs can be harvested avoiding such disease. an additional surgical site for aspiration (i.e., iliac crest) or a More studies with a high level of evidence are required to second operative procedure, making future use of MSCs in validate the role of PRP injections in the subacromial space arthroscopic rotator cuff surgery easy. for treatment of rotator cuff diseases. MSCscanalsobecollectedfromothersources,suchas adipose tissue; this can be easily accessible although its cells have an apparently reduced ability to differentiate compared 4. Stem Cells to BMSCs [56]. Tendon derived stem cells (TDSCs) are considered of 4.1. Definition. Stem cells are defined as unspecialized cells extreme interest for rotator cuff repair enhancement. Exis- with a self-renewal potential, which are able to differentiate tence of TDSCs has been first shown in murine patellar and into various adult cell types. The most common stem cell human hamstring tendons by Bi et al. [57]. More recent ex sources are embryonic and adult stem cells. vivo studies confirmed TDSCs isolation from animal and Embryonic stem cells are truly pluripotent; that is, they humanrotatorcufftissues.Tsaietal.[58]showedon5 are able to differentiate into all derivatives of the three patients that cells harvested from the rotator cuff tendon primary germ layers: ectoderm, endoderm, and mesoderm. could be successfully isolated and differentiated into cells In contrast to embryonic stem cells, multipotent adult with MSCs characteristics. In 2013, Randelli et al. [59] stem cells are characterized by a differentiation potential confirmed the existence of new stem cell populations in restricted to tissues of 1 germ layer. Those which can differ- shoulder tissues; samples from human supraspinatus tendon entiate into various forms of mesenchymal tissue (i.e., bone, and human long head of the biceps tendon were collected tendon, cartilage, and muscle) are termed mesenchymal stem during arthroscopic rotator cuff repairs from 26 patients. cells (MSCs). Morphology, self-renewal capacity, immunophenotype, gene Most of the clinical related stem cells research to date and protein expression profiles, and differentiation capacity has focused on adult stem cells rather than embryonic stem were evaluated and resulted in characterization of two new cells, as the latter are associated with numerous regulatory types of human stem cells. In the same year, Utsunomiya et and ethical constraints. al. [60] isolated and characterized MSCs from four shoulder tissues: synovium of glenohumeral joint, subacromial 4.2. Mesenchymal Stem Cells. MSCs are progenitor cells that bursa, rotator cuff tendon, and enthesis at greater tuberosity, have the capacity to self-renew and differentiate into several obtained from shoulder joint of 19 patients undergoing different mesenchymal tissues including muscle, fat, bone, arthroscopic rotator cuff repair, suggesting that subacromial ligament, tendon, and cartilage [51]. For this reason, MSCs bursa is a good candidate for the source of MSCs in rotator can theoretically be stimulated to undergo differentiation to cuff tears. a preferred lineage (osteocytes, chondrocytes, tenocytes, and Recently, Song et al. [61]isolatedMSCsfrombursa adipocytes), thus recreating a specific tissue for therapeutic tissueassociatedwithrotatorcufftendonsfromfivepatients use [51]. undergoing rotator cuff surgery and characterized them for 6 BioMed Research International multilineage differentiation in vitro and in vivo. These results with repairs augmented with a nonloaded scaffold. No showed in animal models that the cells isolated from bursa reject reactions were observed and increased fibroblastic cell tissue exhibited MSCs characteristics and high proliferative ingrowth and reduced infiltration of lymphocytes within the capacity, and differentiated toward cells of mesenchymal implantation site were observed in the treatment group after lineages (osteoblasts, tenocytes, and fibrochondrocytes) with 4 and 8 weeks. Morphological evaluation performed after 12 high efficiency suggesting that bursa, a tissue usually dis- weeks showed an improvement in structural and mechanical carded during rotator cuff tear repairs, is a new abundant proprieties, as compared with control. source of MSCs with a high potential for application. 4.5. Clinical Studies. Up to now, only one cohort study 4.4. Animal Studies. The use of MSCs to enhance tendon has evaluated the safety of clinical application of MSCs in regeneration has been examined in multiple animal models shoulder surgery. In this study Gomes et al. [68] investigated of tendon healing. MSC can be applied directly to the site the effects of bone marrow mononuclear cells (BMMCs) in of injury or can be delivered on a suitable carrier matrix, 14 patients with complete rotator cuff tears, suggesting that which functions as a scaffold while tissue repair takes place. BMMCs are a safe and promising alternative to other biolog- In an attempt to augment tendon-bone healing in a rat rotator ical approaches to enhance tissue quality in affected tendons. cuff repair model, Gulotta et al. [62]in2009conducted Autologous BMMCs were harvested from the iliac crest a case-control study on 80 rats that underwent unilateral prior to the surgical repair and subsequently injected into ten- detachment and repair of the supraspinatus tendon. BMSCs don borders after being fixed down by transosseous stitches. obtained from long bones of 10 rats were applied to the The BMMC fractions were obtained by cell sorting and repair site. No significant differences were observed with resuspended in saline enriched with 10% autologous serum. the control group, in which the rotator cuff repair was not Each patient was monitored for a minimum of 12 months, followed by stem cells injection. Authors concluded that and University of California, Los Angeles (UCLA), scores MSCs alone are not sufficient to improve tendon-to-bone improved on average from 12 to 31, and magnetic resonance healinginarotatorcuffmodelastherepairsitemaylackthe imaging showed tendon integrity in all 14 patients. No control cellular and/or molecular signals needed to induce appropri- group was included in this study, but for this procedure, ate differentiation of the transplanted cells, suggesting that overall rates of rerupture during the first postoperative year additional differentiation factors may need to be combined range from 25% to 65%, depending on lesion diameter. Only with this cell-based therapy to be effective. Knowledge of the 1 patient in the following year relapsed with loss of strength biological signaling events that lead to the formation of the and pain. Unfortunately, only 14 patients were enrolled in natural enthesis suggests candidate molecules that could be this study, making it difficult to determine the efficacy of used in combination with MSCs to augment the repair site. BMMCs as an adjunct to cuff repair at this time. However, Therefore, in later studies, Gulotta et al. [63, 64] examined these results suggest that BMMC therapy is a safe treatment various types of transduced MSCs with the aim of driving the that has potential to enhance tendon repair. Further research healing process toward regeneration rather than repair of the will be critical to better investigate the use of this biologic tendon-bone structure. Three controlled laboratory studies approach. showed that transducing cells with scleraxis or membrane type 1 matrix metalloproteinase improved histological quality and biomechanical strength as early as 4 weeks after repair, 5. Conclusions whereas transducing the cells with BMP-13 did not achieve favorable results. Several regenerative approaches have been investigated to augment tendon healing after arthroscopic cuff repair. Yokoya et al. [65]studiedtheimplantationofapolyg- The ability of numerous growth factors to affect tendon lycolic acid sheet seeded with cultured autologous BMSCs healing has been extensively analyzed in vitro and in animal in a complete infraspinatus lesion created in a rabbit model. models, showing promising results. However there is still no Sixteen weeks after the implantation, an increased production studyontheuseofgrowthfactorsinthetreatmentofrotator of type I collagen and an increment of the mechanical cuff on human. strength was seen as compared with both a nonaugmented Different delivery systems for these factors, including control and a nonloaded scaffold group. simple injection, coated sutures, fibrin sealants, heparin- Kimetal.[66]harvestedBMSCsfromtheiliaccrestof fibrindeliverysystems,collagen,andhyaluronicacid 2 rabbits and cultured and seeded them on a tridimensional sponges, are being tested. PRP is a whole blood fraction which open-cell polylactic acid scaffold. A similar scaffold without contains several growth factors. Different PRP formulations stem cells was implanted on the contralateral shoulder as exist: leucocyte-poor and leucocyte-rich, activated and unac- control.ThisstudyshowedthatBMSCssurvivedfor2,4,and tivated. Moreover, PRP can be administrated either with 6 weeks within the scaffold and type I collagen expression a simple injection or in a fibrin-matrix clot. Clinical trials was increased in the scaffold with BMSCs as compared with using different autologous PRP formulations after rotator control. cuff tear repairs have provided controversial results. Shen et al. [67] used a knitted silk-collagen scaffold, However, favourable structural healing rates have been loaded with allogenous Achilles tendon stem cells, to aug- observedforsurgicalrepairofsmallandmediumrotatorcuff ment a rotator cuff repair in rabbits, and compared these tears. BioMed Research International 7

Cell-based approaches have also been suggested to [11] C. H. Jo, J. S. Shin, Y. G. Lee et al., “Platelet-rich plasma for enhance tendon healing. Bone marrow is a well known arthroscopic repair of large to massive rotator cuff tears: a source of MSCs; recently, ex vivo human studies have isolated randomized, single-blind, parallel-group trial,” The American andcultureddistinctpopulationsofMSCsfromrotator Journal of Sports Medicine,vol.41,no.10,pp.2240–2248,2013. cuff tendons, long head of the biceps tendon, subacromial [12] M. A. Zumstein, A. Rumian, V. Lesbats, M. Schaer, and P. bursa, and glenohumeral synovia. A single clinical study has Boileau, “Increased vascularization during early healing after been conducted on stem cell-based therapies for rotator cuff biologic augmentation in repair of chronic rotator cuff tears healing, proving the injection of bone marrow mononuclear using autologous leukocyte- and platelet-rich fibrin (L-PRF): a prospective randomized controlled pilot trial,” Journal of cells to be safe. Clinical research regarding the use of MSCs Shoulder and Elbow Surgery,vol.23,no.1,pp.3–12,2014. in shoulder surgery is very limited. Further basic and clinical [13]R.Castricini,U.G.Longo,M.deBenedettoetal.,“Platelet- investigations are required until a procedure can be defined rich plasma augmentation for arthroscopic rotator cuff repair: for the routine use of these cells in shoulder surgery. a randomized controlled trial,” American Journal of Sports Medicine,vol.39,no.2,pp.258–265,2011. Conflict of Interests [14] S. P. Arnoczky, “Platelet-rich plasma augmentation of rotator cuff repair: letter,” The American Journal of Sports Medicine,vol. The authors declare that there is no conflict of interests 39, no. 6, pp. 8–11, 2011. regarding the publication of this paper. [15]S.A.Rodeo,D.Delos,R.J.Williams,R.S.Adler,A.Pearle,and R. F. Warren, “The effect of platelet-rich fibrin matrix on rotator cuff tendon healing: a prospective, randomized clinical study,” References The American Journal of Sports Medicine,vol.40,no.6,pp.1234– 1241, 2012. [1]J.S.Sher,J.W.Uribe,A.Posada,B.J.Murphy,andM.B. Zlatkin, “Abnormal findings on magnetic resonance images of [16] F. A. Barber, S. A. Hrnack, S. J. Snyder, and O. Hapa, “Rotator asymptomatic shoulders,” Journal of Bone and Joint Surgery A, cuff repair healing influenced by platelet-rich plasma construct vol. 77, no. 1, pp. 10–15, 1995. augmentation,” Arthroscopy,vol.27,no.8,pp.1029–1035,2011. [17]A.G.Bergeson,R.Z.Tashjian,P.E.Greis,J.Crim,G.J. [2]M.Chen,W.Xu,Q.Dong,Q.Huang,Z.Xie,andY.Mao, Stoddard, and R. T. Burks, “Effects of platelet-rich fibrin matrix “Outcomes of single-row versus double-row arthroscopic rota- on repair integrity of at-risk rotator cuff tears,” The American tor cuff repair: a systematic review and meta-analysis of current Journal of Sports Medicine,vol.40,no.2,pp.286–293,2012. evidence,” Arthroscopy,vol.29,no.8,pp.1437–1449,2013. [18] S. C. Weber, J. I. Kauffman, C. Parise, S. J. Weber, and S. D. Katz, [3] Y. G. Rhee, N. S. Cho, and J. H. Yoo, “Clinical outcome and “Platelet-rich fibrin matrix in the management of arthroscopic repair integrity after rotator cuff repair in patients older than 70 repair of the rotator cuff: a prospective, randomized, double- years versus patients younger than 70 years,” Arthroscopy,vol. blinded study,” The American Journal of Sports Medicine,vol.41, 30, no. 5, pp. 546–554, 2014. no. 2, pp. 263–270, 2013. [4]M.D.McElvany,E.McGoldrick,A.O.Gee,M.B.Neradilek, [19] D. Rha, G. Park, Y. Kim, M. T. Kim, and S. C. Lee, “Comparison and F. A. Matsen III, “Rotator cuff repair: published evidence of the therapeutic effects of ultrasound-guided platelet-rich on factors associated with repair integrity and clinical outcome,” plasma injection and dry needling in rotator cuff disease: a The American Journal of Sports Medicine,2014. randomized controlled trial,” Clinical Rehabilitation,vol.27,no. [5]P.Randelli,P.Arrigoni,V.Ragone,A.Aliprandi,andP.Cabitza, 2, pp. 113–122, 2013. “Cabitza P. Platelet rich plasma in arthroscopic rotator cuff [20] S. Kesikburun, A. K. Tan, B. Yilmaz, E. Yas¸ar, and K. Yazicioglu,˘ repair: a prospective RCT study, 2-year follow-up,” Journal of “Platelet-rich plasma injections in the treatment of chronic Shoulder and Elbow Surgery, vol. 20, no. 4, pp. 518–528, 2011. rotator cuff tendinopathy: a randomized controlled trial with [6] P. Ruiz-Moneo, J. Molano-Munoz,˜ E. Prieto, and J. Algorta, 1-year follow-up,” The American Journal of Sports Medicine,vol. “Plasma rich in growth factors in arthroscopic rotator cuff 41, no. 11, pp. 2609–2616, 2013. repair: a randomized, double-blind, controlled clinical trial,” [21]L.M.Galatz,L.J.Sandell,S.Y.Rothermichetal.,“Character- Arthroscopy,vol.29,no.1,pp.2–9,2013. istics of the rat supraspinatus tendon during tendon-to-bone [7] S. Antuna,R.Barco,J.M.M.D˜ ´ıez,andJ.M.S.Marquez,´ healing after acute injury,” Journal of Orthopaedic Research,vol. “Platelet-rich fibrin in arthroscopic repair of massive rotator 24,no.3,pp.541–550,2006. cuff tears: a prospective randomized pilot clinical trial,” Acta [22] C. C. Wurgler-Hauri,L.M.Dourte,T.C.Baradet,G.R.¨ Orthopaedica Belgica,vol.79,no.1,pp.25–30,2013. Williams, and L. J. Soslowsky, “Temporal expression of 8 growth [8] C. Charousset, A. Zaoui, L. Bella¨ıche, and M. Piterman, factors in tendon-to-bone healing in a rat supraspinatus model,” “Does autologous leukocyte-platelet-rich plasma improve ten- Journal of Shoulder and Elbow Surgery, vol. 16, no. 5, pp. S198– don healing in arthroscopic repair of large or massive rotator S203, 2007. cuff tears?” Arthroscopy,vol.30,no.4,pp.428–435,2014. [23] M. Kobayashi, E. Itoi, H. Minagawa et al., “Expression of growth [9] S. Gumina, V. Campagna, G. Ferrazza et al., “Use of platelet- factors in the early phase of supraspinatus tendon healing in leukocyte membrane in arthroscopic repair of large rotator cuff rabbits,” Journal of Shoulder and Elbow Surgery,vol.15,no.3, tears: a prospective randomized study,” Journal of Bone and Joint pp. 371–377, 2006. Surgery A,vol.94,no.15,pp.1345–1352,2012. [24] F. Oliva, A. G. Via, and N. Maffulli, “Role of growth factors in [10] C. H. Jo, J. E. Kim, K. S. Yoon et al., “Does platelet-rich plasma rotator cuff healing,” Sports Medicine and Arthroscopy Review, accelerate recovery after rotator cuff repair? A prospective vol. 19, no. 3, pp. 218–226, 2011. cohort study,” American Journal of Sports Medicine,vol.39,no. [25] S. Thomopoulos, M. Zaegel, R. Das et al., “PDGF-BB released 10, pp. 2082–2090, 2011. in tendon repair using a novel delivery system promotes cell 8 BioMed Research International

proliferation and collagen remodeling,” Journal of Orthopaedic or autologous blood: observational review of anatomic distri- Research,vol.25,no.10,pp.1358–1368,2007. bution of injected material,” American Journal of Roentgenology, [26] J. C. Uggen, J. Dines, C. W. Uggen et al., “Tendon gene therapy vol. 199, no. 4, pp. W501–W505, 2012. modulates the local repair environment in the shoulder,” The [41] B. Carofino, D. M. Chowaniec, M. B. McCarthy et al., “Cor- Journal of the American Osteopathic Association,vol.105,no.1, ticosteroids and local anesthetics decrease positive effects of pp. 20–21, 2005. platelet-rich plasma: an in vitro study on human tendon cells,” [27] J. Ide, K. Kikukawa, J. Hirose, K. Iyama, H. Sakamoto, and Arthroscopy,vol.28,no.5,pp.711–719,2012. H. Mizuta, “The effects of fibroblast growth factor-2 on rota- [42] D. M. Dohan, J. Choukroun, A. Diss et al., “Platelet-rich tor cuff reconstruction with acellular dermal matrix grafts,” fibrin (PRF): a second-generation platelet concentrate. Part III: Arthroscopy,vol.25,no.6,pp.608–616,2009. leucocyte activation: a new feature for platelet concentrates?” [28] C. K. Hee, J. S. Dines, D. M. Dines et al., “Augmentation of a OralSurgery,OralMedicine,OralPathology,OralRadiology,and rotator cuff suture repair using rhPDGF-BB and a type I bovine Endodontics,vol.101,no.3,pp.e51–e55,2006. collagen matrix in an ovine model,” American Journal of Sports [43] D. J. Moojen, P. A. Everts, R. M. Schure et al., “Antimicrobial Medicine,vol.39,no.8,pp.1630–1639,2011. activity of platelet-leukocyte gel against Staphylococcus aureus,” [29] C. N. Manning, H. M. Kim, S. Sakiyama-Elbert, L. M. Galatz, Journal of Orthopaedic Research, vol. 26, no. 3, pp. 404–410, N. Havlioglu, and S. Thomopoulos, “Sustained delivery of 2008. transforming growth factor beta three enhances tendon-to- [44] A. Cieslik-Bielecka, T. S. Gazdzik, T. M. Bielecki, and T. Cieslik, bone healing in a rat model,” Journal of Orthopaedic Research, “Why the platelet-rich gel has antimicrobial activity?” Oral vol. 29, no. 7, pp. 1099–1105, 2011. Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology,vol.103,no.3,pp.303–306,2007. [30] H. M. Kim, L. M. Galatz, R. Das, N. Havlioglu, S. Y.Rothermich, and S. Thomopoulos, “The role of transforming growth factor [45] H. El-Sharkawy, A. Kantarci, J. Deady et al., “Platelet-rich beta isoforms in tendon-to-bone healing,” Connective Tissue plasma: growth factors and pro- and anti-inflammatory proper- Research,vol.52,no.2,pp.87–98,2011. ties,” Journal of Periodontology,vol.78,no.4,pp.661–669,2007. [31] D. Kovacevic, A. J. Fox, A. Bedi et al., “Calcium-phosphate [46]P.A.Everts,R.J.Devilee,C.BrownMahoneyetal.,“Exogenous matrix with or without TGF-𝛽3 improves tendon-bone healing application of platelet-leukocyte gel during open subacromial after rotator cuff repair,” AmericanJournalofSportsMedicine, decompression contributes toimproved patient outcome. A vol. 39, no. 4, pp. 811–819, 2011. prospective randomized double-blind study,” European Surgical Research,vol.40,pp.203–210,2007. [32] B. L. Eppley, J. E. Woodell, and J. Higgins, “Platelet quantification and growth factor analysis from platelet-rich plasma: [47] A. Mishra and T. Pavelko, “Treatment of chronic elbow tendi- implications for wound healing,” Plastic and Reconstructive nosis with buffered platelet-rich plasma,” American Journal of Surgery,vol.114,no.6,pp.1502–1508,2004. Sports Medicine,vol.34,no.11,pp.1774–1778,2006. [48] D. M. Dohan Ehrenfest, T. Bielecki, A. Mishra et al., “In search [33]S.Hoppe,M.Alini,L.M.Benneker,S.Milz,P.Boileau,andM. of a consensus terminology in the field of platelet concentrates A. Zumstein, “Tenocytes of chronic rotator cuff tendon tears for surgical use: Platelet-Rich Plasma (PRP), Platelet-Rich can be stimulated by platelet-released growth factors,” Journal Fibrin (PRF), fibrin gel polymerization and leukocytes,” Current of Shoulder and Elbow Surgery,vol.22,no.3,pp.340–349,2013. Pharmaceutical Biotechnology, vol. 13, no. 7, pp. 1131–1137, 2012. [34] C. H. Jo, J. E. Kim, K. S. Yoon, and S. Shin, “Platelet-rich [49] J. Chahal, G. S. Van Thiel, N. Mall et al., “The role of plasma plasma stimulates cell proliferation and enhances matrix gene arthroscopic rotator cuff repair: a systematic review with expression and synthesis in tenocytes from human rotator cuff quantitative synthesis,” Arthroscopy,vol.28,no.11,pp.1718–1727, tendons with degenerative tears,” American Journal of Sports 2012. Medicine,vol.40,no.5,pp.1035–1045,2012. [50] M. de Mos, A. E. van der Windt, H. Jahr et al., “Can platelet- [35] H. Namazi, “Rotator cuff repair healing influenced by platelet- rich plasma enhance tendon repair? A cell culture study,” The rich plasma construct augmentation: a novel molecular mech- AmericanJournalofSportsMedicine,vol.36,no.6,pp.1171–1178, anism,” Arthroscopy, vol. 27, no. 11, p. 1456, 2011. 2008. [36] A. Ersen, M. Demirhan, A. C. Atalar, M. Kapicioglu,˘ and G. [51] M. F. Pittenger, A. M. Mackay, S. C. Beck et al., “Multilineage Baysal, “Platelet-rich plasma for enhancing surgical rotator cuff potential of adult human mesenchymal stem cells,” Science,vol. repair: evaluation and comparison of two application methods 284, no. 5411, pp. 143–147, 1999. in a rat model,” Archives of Orthopaedic and Trauma Surgery, [52] A. D. Mazzocca, M. B. R. McCarthy, D. M. Chowaniec, M. vol. 134, no. 3, pp. 405–411, 2014. P.Cote,R.A.Arciero,andH.Drissi,“Rapidisolationof [37] D. M. Dohan Ehrenfest, L. Rasmusson, and T. Albrektsson, human stem cells (connective tissue progenitor cells) from the “Classification of platelet concentrates: from pure platelet-rich proximal humerus during arthroscopic rotator cuff surgery,” plasma (P-PRP) to leucocyte- and platelet-rich fibrin (L-PRF),” The American Journal of Sports Medicine,vol.38,no.7,pp.1438– Trends in Biotechnology,vol.27,no.3,pp.158–167,2009. 1447, 2010. [38]A.Mishra,P.Randelli,C.Barr,T.Talamonti,V.Ragone,andP. [53] A. D. Mazzocca, M. B. R. McCarthy, D. Chowaniec et al., Cabitza, “Platelet-rich plasma and the upper extremity,” Hand “Bone marrow-derived mesenchymal stem cells obtained dur- Clinics,vol.28,no.4,pp.481–491,2012. ing arthroscopic rotator cuff repair surgery show potential [39] E. A. Sundman, B. J. Cole, and L. A. Fortier, “Growth factor and for tendon cell differentiation after treatment with insulin,” catabolic cytokine concentrations are influenced by the cellular Arthroscopy,vol.27,no.11,pp.1459–1471,2011. composition of platelet-rich plasma,” American Journal of Sports [54] K. Beitzel, M. B. McCarthy, M. P. Cote et al., “Rapid isolation of Medicine, vol. 39, no. 10, pp. 2135–2140, 2011. human stem cells (connective progenitor cells) from the distal [40] M. L. Loftus, Y. Endo, and R. S. Adler, “Retrospective analysis femur during arthroscopic knee surgery,” Arthroscopy,vol.28, of postinjection ultrasound imaging after platelet-rich plasma no. 1, pp. 74–84, 2012. BioMed Research International 9

[55] K. Beitzel, M. B. R. McCarthy, M. P. Cote et al., “Compari- son of mesenchymal stem cells (osteoprogenitors) harvested from proximal humerus and distal femur during arthroscopic surgery,” Arthroscopy,vol.29,no.2,pp.301–308,2013. [56] R. Izadpanah, C. Trygg, B. Patel et al., “Biologic properties of mesenchymal stem cells derived from bone marrow and adipose tissue,” Journal of Cellular Biochemistry,vol.99,no.5, pp.1285–1297,2006. [57] Y. Bi, D. Ehirchiou, T. M. Kilts et al., “Identification of tendon stem/progenitor cells and the role of the extracellular matrix in their niche,” Nature Medicine,vol.13,no.10,pp.1219–1227,2007. [58]C.Tsai,T.Huang,H.Ma,E.Chiang,andS.Hung,“Isolationof mesenchymal stem cells from shoulder rotator cuff: a potential source for muscle and tendon repair,” Cell Transplantation,vol. 22,no.3,pp.413–422,2013. [59] P. Randelli, E. Conforti, M. Piccoli et al., “Isolation and characterization of 2 new human rotator cuff and long head of biceps tendon cells possessing stem cell-like self-renewal and multipotential differentiation capacity,” The American Journal of Sports Medicine,vol.41,no.7,pp.1653–1664,2013. [60] H. Utsunomiya, S. Uchida, I. Sekiya, A. Sakai, K. Moridera, and T. Nakamura, “Isolation and characterization of human mesenchymal stem cells derived from shoulder tissues involved in rotator cuff tears,” The American Journal of Sports Medicine, vol. 41, no. 3, pp. 657–668, 2013. [61]N.Song,A.D.Armstrong,F.Li,H.Ouyang,andC.Niyibizi, “Multipotent mesenchymal stem cells from human subacromial bursa: potential for cell based tendon tissue engineering,” Tissue Engineering A,vol.20,no.1-2,pp.239–249,2014. [62] L. V. Gulotta, D. Kovacevic, J. R. Ehteshami, E. Dagher, J. D. Packer, and S. A. Rodeo, “Application of bone marrow-derived mesenchymal stem cells in a rotator cuff repair model,” The American Journal of Sports Medicine,vol.37,no.11,pp.2126– 2133, 2009. [63] L. V. Gulotta, D. Kovacevic, S. Montgomery, J. R. Ehteshami, J. D. Packer, and S. A. Rodeo, “Stem cells genetically modified with the developmental gene MT1-MMP improve regeneration of the supraspinatus tendon-to-bone insertion site,” The American Journal of Sports Medicine,vol.38,no.7,pp.1429–1437,2010. [64] L. V. Gulotta, D. Kovacevic, J. D. Packer, X. H. Deng, and S. A. Rodeo, “Bone marrow-derived mesenchymal stem cells transduced with scleraxis improve rotator cuff healing in a rat model,” The American Journal of Sports Medicine,vol.39,no.6, pp.1282–1289,2011. [65] S. Yokoya, Y. Mochizuki, K. Natsu, H. Omae, Y. Nagata, and M. Ochi, “Rotator cuff regeneration using a bioabsorbable material with bone marrow-derived mesenchymal stem cells in a rabbit model,” The American Journal of Sports Medicine,vol.40,no.6, pp.1259–1268,2012. [66] Y.S. Kim, H. J. Lee, J. H. Ok, J. S. Park, and D. W.Kim, “Survivor- ship of implanted bone marrow-derived mesenchymal stem cells in acute rotator cuff tear,” Journal of Shoulder and Elbow Surgery,vol.22,no.8,pp.1037–1045,2013. [67] W. Shen, J. Chen, Z. Yin et al., “Allogenous tendon stem/progenitor cells in silk scaffold for functional shoulder repair,” Cell Transplantation,vol.21,no.5,pp.943–958,2012. [68] J. L. E. Gomes, R. C. da Silva, L. M. R. Silla, M. R. Abreu, and R. Pellanda, “Conventional rotator cuff repair complemented by the aid of mononuclear autologous stem cells,” Knee Surgery, Sports Traumatology, Arthroscopy,vol.20,no.2,pp.373–377, 2012. Hindawi Publishing Corporation BioMed Research International Volume 2014, Article ID 630870, 12 pages http://dx.doi.org/10.1155/2014/630870

Research Article Platelet Concentration in Platelet-Rich Plasma Affects Tenocyte Behavior In Vitro

Ilaria Giusti,1 Sandra D’Ascenzo,1 Annalisa Mancò,2 Gabriella Di Stefano,1 Marianna Di Francesco,1 Anna Rughetti,3 Antonella Dal Mas,4 Gianfranco Properzi,1 Vittorio Calvisi,1,2 and Vincenza Dolo1

1 Department of Life, Health and Environmental Sciences, University of L’Aquila, Italy 2 Postgraduate School in Orthopedics and Traumatology, University of L’Aquila, Italy 3 Immunotransfusion Medicine Unit, “San Salvatore” Hospital, L’Aquila, Italy 4 Pathological Anatomy Unit, “San Salvatore” Hospital, L’Aquila, Italy

Correspondence should be addressed to Vincenza Dolo; [email protected]

Received 12 March 2014; Accepted 3 July 2014; Published 23 July 2014

Academic Editor: Mikel Sanchez´

Copyright © 2014 Ilaria Giusti et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Since tendon injuries and tendinopathy are a growing problem, sometimes requiring surgery, new strategies that improve conservative therapies are needed. Platelet-rich plasma (PRP) seems to be a good candidate by virtue of its high content of growth factors, most of which are involved in tendon healing. This study aimed to evaluate if different concentrations of platelets in PRP have different effects on the biological features of normal human tenocytes that are usually required during tendon healing. The 6 different platelet concentrations tested (up to 5 × 10 plt/𝜇L) stimulated differently tenocytes behavior; intermediate concentrations 6 6 (0.5 × 10 ,1× 10 plt/𝜇L) strongly induced all tested processes (proliferation, migration, collagen, and MMPs production) if compared to untreated cells; on the contrary, the highest concentration had inhibitory effects on proliferation and strongly reduced migration abilities and overall collagen production but, at the same time, induced increasing MMP production, which could be counterproductive because excessive proteolysis could impair tendon mechanical stability. Thus, these in vitro data strongly suggest the need for a compromise between extremely high and low platelet concentrations to obtain an optimal global effect when inducing in vivo tendon healing.

1. Introduction helps the healing of tissues because these factors contribute to several required processes, such as cell proliferation, Platelet-rich plasma (PRP) is a portion of the plasma fraction chemotaxis, cell differentiation, and angiogenesis3 [ , 6]. In that has a platelet concentration above baseline values (whole normal healing processes, activated platelets are trapped in blood) [1]. PRP is obtained by centrifugation of whole blood, a clot and release approximately 95% of the growth factors, which separates the various components of blood according stored in a presynthesized form in 𝛼-granules, within the to their specific weight, and its activation through an activa- first hour. Platelets then secrete additional growth factors tor, for example, thrombin, results in the formation of platelet for another 7 days, which sustains the healing process for gel (PG) [2]. Activation of platelets in PRP induces the release of several growth factors that are stored in 𝛼-granules, such as longer time [7]. These growth factors bind to receptors platelet-derived growth factor (PDGF), transforming growth on cell membranes and activate the pathways involved in factor- (TGF-) 𝛽, insulin-like growth factor (IGF), vascular tissue healing. Therefore, PG increases platelet numbers and, endothelial growth factor (VEGF), fibroblast growth factor consequently, the concentration of growth factors at lesion (FGF), and epidermal growth factor (EGF) [3]. sites to induce faster healing. The release of growth factors at the site of injury in Even if the concentration of most of these growth factors higher concentrations than those found in whole blood [4, 5] is higher in PRP than in respective serum, this is not true 2 BioMed Research International for IGF, whose level is not elevated [8–12]. This circumstance Table1:Sexandageofcells’donors. is very meaningful if we considered that, even if usually the concentration and availability of circulating IGF vary greatly Sample Donor sex Donor age among individuals and are dependent on several factors AMale53 (including sex, age, genetic influences, hormones, nutritional BMale39 status, and catabolic stressors) [13], there are some indications CFemale34 thatelevatedIGFlevelcouldbeinsomewayrelatedtocancer DMale25 development [11]; IGF level in PRP, as already said, is not EMale37 significantly higher than circulating level and there is no sig- nificative systemic increase of IGF after PRP administration without, consequently, an increased risk of cancer [11]. The transferred to 6-well plates containing complete medium: safeness of PRP use is further highlighted if we considered DMEM/Ham’s F-12 culture medium (Euroclone SpA, Milan, that PRP is mainly an autologous product and, consequently, Italy, and Sigma, St. Louis, MO, USA, resp.; 1 : 1 vol/vol) an excellent treatment from a safety point of view. Moreover, that was supplemented with 10% fetal bovine serum (FBS) due to its low cost, availability, and safety, PRP has become an (Euroclone SpA, Milan, Italy), 1 × penicillin/streptomycin interesting clinical tool as a source of growth factors and is, (Euroclone SpA, Milan, Italy), 2 mM glutamine (Euroclone therefore, used in a wide range of surgery fields such as oral, SpA, Milan, Italy), 50 𝜇g/mL gentamicin (Sigma, St. Louis, periodontal, maxillofacial, cosmetic, general, and orthopedic MO, USA), and 2.5 𝜇g/mL amphotericin B (Sigma, St. Louis, [6, 14, 15]. Clinical applications range from the treatment of MO, USA). Tenocytes migrated out of the minced tissue nonhealing ulcers, chronic tendinopathy, and ligamentous and adhered to the bottom of the well. The cells were and acute muscle injuries and as an adjuvant in bone grafting then successively cultured in the same medium, maintained ∘ to intraoperative use in the reconstruction of anterior cruciate at 37 Cinahumidifiedatmospherewith5%CO2,and ligaments and in joint arthroplasty or in the repair of rotator trypsinized at subconfluency. The cells were used until the cuffs, cartilage lesions, or tendons [6, 15]. fourth passage. Recently, interest in the use of PRP for tendon healing has increased because growth factors that are released from platelets could be involved in tendon-repair processes. 2.2. Vimentin Immunostaining. Human primary gracilis and/ Tendon healing occurs through inflammation, proliferation, or semitendinosus tenocytes were characterized by staining and remodeling phases that are regulated by several growth for vimentin. Briefly, cells were seeded onto glass slides factors, some of which are released from platelets [16]. TGF- and grown until they reached 80% confluency; then, they 𝛽 and IGF seem to be involved in fibroblast proliferation and were fixed for 3 min in ice-cold methanol and 2 min in ice- migration,andinthefollowingincreaseincollagensynthesis; cold acetone. After incubation in 10%-buffered formalin for VEGF has an important role in angiogenesis induction; 5 min, the slides were washed in water and stained using andPDGFisinvolvedintissueremodelingandhelpsto the EnVision FLEX, High pH system with Autostainer Link stimulate the production of other growth factors [3, 17, 18]. 48 (Dako, Glostrup, Denmark), which is a high-sensitivity, To better understand the effect of PRP on human tendon two-step visualization system that uses a unique, enzyme- cells, controlled clinical trials are important, but detailed in conjugated polymer backbone that also carries secondary vitro studies are also critical. In most of the studies that have antibody molecules. The primary antibody that was used been performed, the concentration of PRP was expressed as was the anti-vimentin mouse monoclonal antibody (ready- a percentage, making it impossible to understand how many to-use for Autostainer Link, Clone V9, Dako, Glostrup, Den- platelets/𝜇Lwereeffectivelyused[17, 19]. mark). After counterstaining with hematoxylin and eosin, the slides were covered with glass coverslips using an aqueous- The aim of this study was to fully characterize the mounting medium (Crystal/Mount, Biomeda Corporation, effect of several specific concentrations of platelets (expressed 𝜇 Foster City, CA, USA), and representative images were as plt/ L) from activated PRP (i.e., PG) on the cellular obtained by contrast-phase microscopy. parameters of human tenocytes and on the expression of matrix metalloproteinases (MMPs) and collagen, which are usually used as markers of tendon cell biology [19]. 2.3. Preparation of the Platelet-Gel-Released Supernatant. Whole blood (450 mL) was collected using triple bags (Teru- flex with CPD/S.A.G.M., Terumo, Rome, Italy), and each 2. Materials and Methods donor provided consent according to current laws (Decree Law 3, March 2005, and Law 21, October 2005, n. 219) 2.1. Isolation and Culture of Human Tenocytes. Human ten- (Table 2). Fractionation was carried out by initial centrifuga- ∘ don samples were obtained during surgical reconstruction tion of the bag for 10 min at 22 C using a Heraeus Cryofuge of the anterior cruciate ligament with gracilis and/or semi- 6000i centrifuge (AHSI SpA, Massa Martana (PG), Italy) at tendinosus tendon autograft; informed consent was obtained 462 g to obtain PRP and red-cell concentrates. Subsequently, from all patients (Table 1). All samples used for the study the obtained PRP was subjected to a second centrifugation ∘ were considered surgical waste and would otherwise have for 6 min at 22 C at 3932 g to produce the platelet concentrate been discarded. The tendon samples were cleaned of the and platelet-poor plasma. Finally, the platelets were hyper- surrounding adipose tissue and peritendineum, minced, and concentrated in 10–15 mL of plasma, and PG was produced BioMed Research International 3

Table 2: Properties of PRP. Each experiment was performed in triplicate and ± 𝜇 𝜇 repeated at least twice. The data are expressed as the means PRP plt/ LWBC/L Donor sex Donor age standard deviations. A 5229000 17010 Male 52 B 4341000 8100 Female 30 2.5. In Vitro Scratch Wound Closure Assay. The in vitro C 5886000 24000 Male 50 scratch wound closure assay was used to study directional cell migration in vitro and is based on the observation of cell migration into a scratch “wound” that is created on a cell by placing tubes of platelet concentrate in a Vacutainer Plus monolayer. Tenocytes were cultured in 24-well microplates (Becton Dickinson, Plymouth, UK) containing 5 NIH units under normal culture conditions and allowed to reach maxi- of thrombin and adding calcium gluconate (Bioindustria mum confluency. A previously sterilized, round-tipped, steel Laboratorio Italiano Medicinali SpA, Novi Ligure (AL), Italy) needle was used to create a wound of approximately 0.2 mm at a 1 : 20 dilution. Subsequently the solution was allowed to in the cellular stratum; then, the microplates were washed (to ∘ clot for 5 min at 37 C, and the obtained clot was centrifuged remove debris and smooth the edge of the wound) 3 times for 10 min at 153 g to obtain a supernatant that was rich in (10 min each) with medium + 1% FBS, and the cells were the growth factors that had been released from the activated cultured in complete medium (positive control), medium + platelets. The supernatant was subjected to a succession of 1% FBS (negative control), or in PG supernatant diluted to × 6 𝜇 centrifugations (10 min each at 153 g, 1250 g, and 1770 g) to several concentrations (0.5–3 10 plt/ L) with the same remove red cells, debris, and cellular stroma and was imme- medium as the negative control. The status of the scratch diately used in the experimental tests. Because preliminary wounds was monitored using phase-contrast microscopy at thebeginningoftheassayandatregularintervals(0,8,22, findings [8]showedthatPGandPG-releasedsupernatant 30, and 46 h), and representative images were collected. had the same effect on cellular parameters (i.e., morphology and proliferation), all experiments were performed using PG-released supernatants, rather than GP itself, for higher 2.6. Gelatin Zymography. To analyze the release of MMPs from tenocytes, cells were seeded onto 6-well plates in feasibility in performing experiments. The initial concentra- ∘ tion of platelets in the platelet concentrates was different in complete medium and incubated overnight at 37 Candin5% 6 each preparation (ranging from approximately 4.5 × 10 to CO2to allow for cell adhesion and spreading. When the cells 6 were subconfluent, they were starved for 24 h and successively 6 × 10 plt/𝜇L); as showed in Table 2, white blood cells were treated with PG supernatant diluted with medium + 1% FBS also present in PRP. To obtain different concentrations of × 6 𝜇 𝜇 to 0.5–3 10 plt/ Lfor72h,andcellsgrowninmedium+1% plt/ L, the supernatant was diluted with medium that was FBS or in complete medium were used as negative and pos- supplemented with 1% FBS. itive controls, respectively. The cells were then washed with DMEM/F-12 and incubated for 24 h in complete medium in 2.4. Proliferation Assay. Cell proliferation was determined which FBS was replaced with 0.2% LEH (Lactalbumin Enzy- using a 2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetra- matic Hydrolysate, Sigma, St. Louis, MO, USA) to remove zolium-5-carboxanilide (XTT) assay (Sigma, St. Louis, MO, the contribution of MMPs from the serum. The recovered USA). The metabolic reduction of XTT by living cells supernatants that contained MMPs were concentrated using produces a colored, nontoxic, water-soluble formazan whose Centricon Ultracel YM-10 filters (Amicon Bioseparations; value, when measured by an ELISA reader, is directly propor- Millipore Corporations, MA, USA; cutoff: 10 kDa) and analyzed via gelatin zymography. The samples were normalized tionaltothenumberofviablecells.Briefly,1,000cells/well by volume. Gelatin zymography was performed using sodium were seeded onto a 96-well plate, incubated for 24 h in ∘ dodecyl sulfate-polyacrylamide gel (SDS-PAGE, 7.5%) that complete medium at 37 Cand5%CO2 to enable cell adhesion was copolymerized with 1 mg/mL gelatin type B (Sigma, St. and spreading, starved with serum-free medium for 24 h, and Louis,MO,USA),andthesupernatantsweredilutedinSDS- then treated with the PG-released supernatant by diluting the PAGE sample buffer under nonreducing conditions without original preparation with medium + 1% FBS to obtain dif- 6 heating. After electrophoresis, the gels were washed twice ferent platelet concentrations (0.5–5 × 10 plt/𝜇L). Tenocytes for 30 minutes in 2.5% Triton X-100 at room temperature maintained in medium + 1% FBS or complete medium were andincubatedovernightinacollagenasebuffer(50mMTris- used as negative and positive controls, respectively. FBS (1%) HCl, pH 7.4, containing 5 mM CaCl2and 120 mM NaCl) at ∘ provides enough nourishment to support cell viability but 37 C. The gels were then stained with Coomassie Blue R does not stimulate proliferation, while complete medium is 250 (Bio-Rad, Hercules, CA, USA) dissolved in a mixture known to support cell proliferation. The cells were incubated of methanol : acetic acid : water (4 : 1 : 5) for 1 h and were ∘ at 37 C in a humidified atmosphere containing 5% CO2for destained in the same solution without dye. The gelatinase 72,96,and120h.Attheendofeachperiod,anXTTassay activities were visualized as distinct bands that indicated was performed, and the OD was evaluated at 450 nm. XTT proteolysis of the substrate. tests were performed before the positive-control cells reached confluency to prevent possible artifactual decreases in the 2.7. Western Blotting. Western blotting was performed to results due to contact inhibition. analyze the modulation of scleraxis and the release of collagen 4 BioMed Research International type I from tenocytes after treatment with PG. Briefly, cells gel documentation system Alliance LD2 (Uvitec, Cambridge, were seeded on a 6-well plate in complete medium and UK). Normalization was performed accordingly using the ∘ incubated overnight at 37 Candin5%CO2 to allow for cell same protocol using a primary goat antibody that recognized adhesion and spreading. When the cells were subconfluent, actin isoforms (Santa Cruz Biotechnology, Santa Cruz, CA, they were starved for 24 h and treated. For collagen analysis, USA) and a secondary rabbit anti-goat HRP-conjugated anti- the tenocytes were treated with PG supernatant that was body (Millipore, Millipore Corporation, Billerica, MA, USA). 6 diluted with medium + 1% FBS to 0.5−3 × 10 plt/𝜇Lfor72h, Densitometricanalysisofproteinbandswasperformedusing andcellsgrowninmedium+1%FBSorincompletemedium Alliance LD2 gel documentation system or the Image J were used as negative and positive controls, respectively. public domain software. Relative values were calculated by The cells were then washed with DMEM/F-12 and incubated comparison with negative control, defined as 1, and, where for 72 h in complete medium to allow for the release of possible, normalized by the corresponding values of loading collagen. The recovered supernatants containing collagen control (actin). were concentrated using Centricon Ultracel YM-10 filters (Amicon Bioseparations, Millipore Corporations, MA, USA; 2.8. Statistical Analysis. All data shown are from at least three cutoff: 10 kDa) and analyzed via western blotting. The samples independent experiments and are expressed as the mean ± were normalized by volume, resolved using sodium dodecyl SD. Data were analyzed by two-way ANOVA, followed by sulfate-5% polyacrylamide gel electrophoresis (SDS-PAGE) Dunnett test, using the GraphPad Prism 4 software (Graph- under native, nonreducing conditions, and transferred to Pad Inc., San Diego, CA, USA). Statistical significance was set nitrocellulose. Nonspecific binding sites were blocked bya at 𝑃 < 0.05. 1.5 h incubation with 10% nonfat dry milk in TBS-T (TBS containing 0.5% Tween-20) at room temperature. The blots were then incubated overnight with a rabbit antibody against 3. Results and Discussion human type I collagen (both 1𝛼 and 2𝛼 subtypes) that was ∘ diluted1:1,000(Abcam,Cambridge,UK)at4 C, and this step Tendon disorders account for a large percentage (30−50%) was followed by incubation with a peroxidase-conjugated of all sports-related injuries and frequently lead to cessation secondary antibody (Santa Cruz Biotechnology, Santa Cruz, of sport activities for long periods [20]becausetendon CA, USA) in blocking buffer for 1 h at room temperature. healing is naturally slow [21]. However, tendon injuries and After washing, the reactive bands were visualized using a tendinopathy are a growing problem not only in athletes but chemiluminescence detection kit (SuperSignal West Femto also in elderly subjects who are still physically active [22]. Chemiluminescent Substrate, Thermo Scientific, Rockford, Conservative treatments are not always satisfying, and they IL, USA) and the gel documentation system Alliance LD2 force orthopedists to resort to surgery for some patients [20]. (Uvitec, Cambridge, UK). For scleraxis analysis, tenocytes Therefore, it is desirable to find new ways to improve con- were treated with PG supernatant that was diluted with servativetherapy;inthiscontext,PRPhasraisedincreased 6 medium + 1% FBS to 0.5−3 × 10 plt/𝜇Lfor18h,and interest due to its high content of growth factors, most of cells grown in medium + 1% FBS or in complete medium which are involved in tendon healing [17]. were used as negative and positive controls, respectively. Several studies on animal models showed that PRP- Subsequently, total proteins were extracted from the teno- treated tendons healed in a shorter time and with better cytes using RIPA buffer containing 50 mM Tris-HCl, pH 7.6; results regarding the quality of the tendon. In an established 150 mM NaCl; 5 mM EDTA; 1% Triton-X; 100 mM sodium rat model of transected Achilles tendon, the mechanical characteristics of the tendon improved after injection of fluoride (NaF); 2 mM sodium orthovanadate (Na3VO4); 2 mM sodium pyrophosphate (NaPPi); 1 mM phenylmethyl- platelet concentrate [23].Inthetransectedtendonsofrabbits, sulphonyl fluoride (PMSF); and a classical protease-inhibitor PRP seems to be able to promote the formation of scar tissue cocktail (Sigma, St. Louis, MO, USA). Forty micrograms of better histological quality and improve neovascularization, of total protein were electrophoresed by 12.5% SDS-PAGE which accelerates the healing process (poor vascularity seems under nonreducing, denaturing conditions and transferred to be one of the most important limiting factors in the healing capacity of tendons) [24];thesameeffectwasconfirmedfor to nitrocellulose membranes (Schleicher & Schuell, Das- surgically created, equine tendon lesions [25]. Injection of sel, Germany). Nonspecific binding sites were blocked by PRP into an intact rabbit patellar tendon was able to induce incubation with 10% nonfat dry milk in TBS-T containing collagen remodeling and hypercellularity [26]. 0.5%Tween-20for1.5hatroomtemperature.Theblot Some studies on humans have also been conducted was incubated overnight with an antibody against human and show an improvement in tendon healing when using scleraxis (anti-scleraxis rabbit polyclonal antibody 1 : 1,000; ∘ PRP [27–29].Atthesametime,otherstudiesshowedno Abcam, Cambridge, UK) at 4 ,andthisstepwasfollowed significant improvement in chronic Achilles tendinopathy by an incubation with peroxidase-conjugated secondary anti- [20, 30, 31] or rotator cuff tendon healing [32]aftertreatment body (Santa Cruz Biotechnology, Santa Cruz, CA, USA) in with PRP when compared to controls. Some authors have blocking buffer for 1 h at room temperature. After washing, argued that it is difficult to correctly compare the few studies reactive bands were visualized using a chemiluminescence that have been performed in this field, and controlled studies detection kit (SuperSignal West Femto Chemiluminescent are still needed to determine the real effectiveness of PRP Substrate; Thermo Scientific, Rockford, IL, USA) and the treatment in tendon healing [33]. In addition to in vivo BioMed Research International 5

Scleraxis

(a) (b)

Figure 1: Tenocytes characterization. Tenocytes were characterized through vimentin immunostaining (a) and assay of scleraxis expression by western blot (b). Magnification 200x. studies, some in vitro investigations have been performed how different concentrations of platelets in PG-released on tenocytes isolated from several tendon origins (healthy supernatants were able to condition proliferation, migration tendons or rotator cuff tendons with degenerative tears), and into wounds, and the production of collagen type I and these studies showed that PRP stimulated cell proliferation gelatinases was evaluated. [3, 34–36]andcollagenproduction[3, 35] in tenocytes. It is important to consider, however, that tenocyte biology 3.1. Tenocyte Characterization. First, to confirm the identity could differ depending on donor age, anatomic origin, and of tenocytes, immunocytochemistry of vimentin, an inter- status of the tendon (healthy, injured, or degenerated tendon) mediate filament that is characteristically found in cells of [35]. Most importantly, in some of these studies, the platelet mesenchymal origin and usually used as a tenocyte marker, concentration of PRP was unclear, and it is critical to know was performed [40, 41].Theexpressionofthismarkerwas the exact concentration of platelets to correctly compare so high that counterstaining with hematoxylin and eosin was studies. It was clearly shown in other cell types involved in not perceptible (Figure 1(a)). wound healing (such as endothelial cells and fibroblasts) that To further assess the identity of the isolated cells, the specific concentrations of platelets have different effects and presence of scleraxis, a transcription factor that is a highly that excessively high concentrations could be less effective specific marker for tendons and ligaments, was evaluated [42, [5, 8, 37]. This evidence suggests that excessively high concen- 43]. Western blotting confirmed the presence of this marker trations of platelets have an inhibitory effect on the wound- at a molecular weight of approximately 40 kDa (Figure 1(b)). healing processes and are therefore counterproductive. With regard to scleraxis, we found this marker at a molecular Forthesereasons,ourpurposewastoevaluatethein vitro weight of approximately 40 kDa; however, this molecule, effect of different concentrations of platelets (and of different when in its monomeric form, has a molecular weight of growth factor concentrations) on the biological features of 22 kDa. Scleraxis belongs to a family of transcription factors tenocytes. As the platelet source used was platelet gel, the (the basic helix-loop-helix [bHLH]) that are known to form activated form of PRP that was obtained adding thrombin heterodimers and homodimers [44, 45]; therefore, it is and calcium gluconate to the latter; more specifically, super- possible that we revealed the dimeric form of this protein. natant released from PG was used because it had already The presence of these markers, however, confirmed that the been shown that it had the same effect as PG on cellular isolated cells were tenocytes. parameters [8]. Therefore, for convenience, all experiments were performed using PG-released supernatants. Platelet 3.2. Platelet-Gel-Released Supernatant Stimulates Tenocyte concentration in the PG-released supernatants was expressed Proliferation. Once the identity of the cells was confirmed, 𝜇 as plt/ L because the concentration of the factors that are tenocyteproliferationinresponsetoPG-releasedsupernatant released from the platelets is assumed to be proportional to was evaluated. Because the tenocyte doubling time is approx- 𝜇 the initial concentration of plt/ L, and it was assumed that imately 96h (data not shown), proliferation was evaluated in the supernatants would maintain the same concentration of thetreatedcellsatthistimeand24hafterandbeforethat 𝜇 plt/ L even if platelets were no longer present in the releasate. time. Cells were treated with diluted PG-released supernatant 6 6 The present study evaluated the ability of PG-released to obtain the indicated concentrations (0.5 × 10 ,1× 10 ,2 6 6 6 supernatants to affect tenocyte activities that are required for × 10 ,3× 10 ,and5× 10 plt/𝜇L), and tests showed a dose- the tendon-healing process that occurs in three overlapping dependent response of the cells, with higher stimulation after phases (inflammatory, proliferative, and remodeling phase). 120 h (Figure 2). However, at all of the tested intervals, the 6 During these phases, in addition to other processes, the optimal concentration seemed to be 0.5 × 10 plt/𝜇L, which ECM is produced and remodeled from tenocytes, and the resulted in a rate of proliferation that was approximately 2.6-, cells proliferate and migrate into wounds [38, 39]. Therefore, 4.3-, and 5.8-fold higher than that of untreated cells after 72, 6 BioMed Research International

96 h 72 h 120 h stimulate tenocyte migration was evaluated using the scratch ∗∗∗ wound-healing assay (Figure 4). 600 ∗∗∗ Tenocyte migration was slow; after 8 h, no evidence of ∗∗∗ 500 migration was observed yet (data not shown), and after 22 h ∗∗∗ the process began to be evident. Cells treated with complete 400 medium (positive control) began to migrate into the wound ∗∗∗ as a loosely connected population after 22 h, and after 46 h 300 ∗∗∗ the number of cells in the wound area was high. In contrast, cells treated with medium with 1% FBS (negative control)

Proliferation (%) Proliferation 200 showed a decreased ability to close the wound, and after 46 h the number of cells was lower in the wound area than in the 100 positive control. PG-released supernatant at concentrations 6 of 0.5 × 10 plt/𝜇L was not able to induce wound healing in 0 1 2 3 5 1 2 3 5 1 2 3 5 a shorter time than the positive control, but after 46 h the + + + − − − 0.5 0.5 0.5 number of cells that had migrated into the wound was clearly CTRL CTRL CTRL CTRL CTRL CTRL higher. Wound healing was achieved by incubation with PG- 6 6 (plt/𝜇L ∗10) released supernatant at concentrations of 1 × 10 plt/𝜇Latthe same interval, but no closure of the wound occurred at higher Figure 2: Platelet-gel-released supernatant stimulates tenocyte 6 proliferation. The effects of different PG concentrations on tenocyte concentrations (2 and 3 × 10 plt/𝜇L). As already observed by proliferation after 72, 96, and 120 h. The value obtained from proliferation assay (Figure 3), these concentrations induced untreated cells (CTRL−) was considered to be 100% proliferation. an unusual arrangement of tenocytes. The observation of Whitebars(CTRL+)refertocellsgrownincompletemedium wounds was ended after 46 h because it was important that (positive control). Data originated in triplicate (𝑛=3)andwere ∗∗∗ the wounds were closed by means of cell migration and not analyzed by two-way ANOVA, followed by Dunnett test, =𝑃< 0.001. Error bars correspond to standard deviation. by proliferation of the cells themselves (evident effects on proliferation induced by PG treatments are significant only after 72 h, as shown in the proliferation test). For this reason, only results that were obtained within 46 h were considered 96,and120h,respectively.Atthisconcentration,theprolifer- significant. It seems as if PG did not influence the interval that ationratewasalsohigherthanthatofcellsgrownincomplete was required for wound healing but rather the number of cells − × 6 𝜇 medium. Higher concentrations (1.0 2.0 10 plt/ L) were migrating into the wound, which was higher in treated than able to induce proliferation, although to a lower extent, and 6 in control cells. the concentration of 3.0 × 10 plt/𝜇L was ineffective after 72 h and was weakly efficient after 96 and 120 h. It was not possible 3.4. Platelet-Gel-Released Supernatant Affects the Expression to observe the trend of proliferation at longer times because, of Molecules Involved in ECM Remodeling. Finally, the ability after 120 h, cells treated with the optimal concentration of PG to stimulate tenocyte production of gelatinases and showed a confluence so high that it prevented further growth collagen type I was evaluated. These molecules are fun- due to contact inhibition. As demonstrated for other cell damental to tendon healing because MMPs are involved types [5, 8, 37], high concentrations could be less effective in extracellular matrix remodeling, and collagen type I or even counterproductive toward inducing proliferation. In × 6 𝜇 production is necessary to restore the extracellular matrix fact, the highest tested concentration (5 10 plt/ L) induced that is lost after injury [38, 39]. These molecules were cell death. For this reason, in the subsequent experiments, the analyzed in conditioned medium from cells that had been highest concentration was no longer tested. previously treated with PG-released supernatant. Samples for A morphological analysis of cells (Figure 3)after120h these analyses were normalized only per volume to take into of treatment confirmed that, with respect to the untreated account simultaneous effects on cell proliferation. cells (Figure 3(b)), the maximum effect on human tenocyte MMPshaveanimportantroleintendonhealingbecause, proliferation was reached using PG at a concentration of × 6 𝜇 by being involved in extracellular matrix degradation, they 0.5 10 plt/ L(Figure 3(c)); the induced proliferation was could contribute to angiogenesis, which should improve the even higher than that of cells grown in complete medium tendon healing process and promote the formation of scar (Figure 3(a)). Higher concentrations induced lower stimula- tissue with better histological quality [24, 46, 47]. These pro- tion and abnormal cell arrangement. These cells tended to teases are also needed to remodel tendon injury [48]. It seems align, cluster, and form masses (Figures 3(d)–3(f)). Weare not that both gelatinases, MMP-2 and MMP-9, are involved in able to explain this phenotype, but it has also been observed collagen degradation, whereas collagen remodeling involves in fibroblasts [5]. However, this arrangement seems to be only MMP-2 [49]. In contrast, excessive proteolysis could unnatural when compared to the accurate arrangement of the impair the mechanical stability of tendons [3]. The expression control cells. of some MMPs that were induced in PRP-treated tendon cells has been previously investigated, although the concentration 3.3. The Effect of Platelet-Gel-Released Supernatant on Teno- of PRP was expressed as a percentage, making it impossible to cyte Migration. The ability of the PG-released supernatant to understand how many platelets/𝜇Lwereeffectivelyused[3]. BioMed Research International 7

(a) (b)

(e) (f)

Figure 3: Morphological analysis of PG-supernatant-treated tenocytes. (a) Positive control (cells grown in complete medium); (b) negative 6 6 control (cells grown in medium + 1% FBS); (c) cells treated with 0.5 × 10 plt/𝜇L;(d)cellstreatedwith1× 10 plt/𝜇L;(e)cellstreatedwith2× 6 6 10 plt/𝜇L; and (f) cells treated with 3 × 10 plt/𝜇L. Magnification 100x.

The proteolytic activity of MMPs and particularly of 1, resp.); the lytic activity of pro-MMP-9 weakly increased the gelatinases MMP-2 and MMP-9 was evaluated by ana- with increased platelet concentration and high-molecular- lyzing supernatants from PG-treated cells through gelatin weight bands corresponding to gelatinase complexes were zymography. The pattern of the lytic bands is presented in also evident at a molecular weight of approximately 120 kDa Figure 5. Several bands were present in the supernatant of (Figure 5, lanes 3–6). Densitometric analysis showed a dose- cells grown in complete medium: pro-MMP-2 was evident, dependent trend of pro-MMP-2 and pro-MMP-9 activity whereas the MMP-2 band was barely visible; a weak activity (Figure 5, table). at a molecular weight of approximately 120 kDa was also So, our findings suggest that the bioactive molecules present, probably corresponding to gelatinase complexes containedinPGwereinvolvedininducingtheproduction (Figure 5,lane1).Inthesupernatantsofuntreatedcells, and activation of gelatinases, and we found that all tested only pro-MMP-2 was present (Figure 5, lane 2), whereas in concentrations were able to induce gelatinase activity in a the supernatants of PG-treated cells (Figure 5,lanes3–6) dose-dependent manner. Therefore, is it possible that the evident bands corresponding to pro-MMP-2 and activated highest concentrations, in addition to having a negative effect forms of MMP-2 were observed. Lytic activity due to the on proliferation, would have a negative effect on tendon pro-andactiveformsofMMP-2tendedtoincrease,with remodeling by inducing too much lytic activity. higher activity in the supernatant from cells that were To further assess the ability of PG to affect extracellular treated with higher platelet concentrations (Figure 5,lane matrixremodeling,weanalyzedthecollagentypeIcontentin 6). In the supernatants of treated cells (Figure 5,lanes3– supernatants from cells treated with different concentrations 6), pro-MMP-9 was also evident, but this protein was not of platelets. The main constituent of the tendon extracellular visibleinuntreatedorcontrolcells(Figure 5,lanes2and matrix is collagen. Collagen type I accounts for nearly 95% 8 BioMed Research International

0 h

Positive control

Negative control

6 0.5 × 10 plt/𝜇L

6 1×10 plt/𝜇L

6 2×10 plt/𝜇L

6 3×10 plt/𝜇L

22 h 30 h 46 h

Figure 4: The effect of platelet-gel-released supernatant on tenocyte migration. A summary panel presenting the effects of different concentrations (rows) of platelet-gel-released supernatant on wound healing after 22, 30, and 46 h (columns). Image at 0 h is representative of the starting situation of all conditions. Magnification 100x. BioMed Research International 9

123456 123456

290–300 kDa dimer Pro-MMP-9

Pro-MMP-2 MMP-2 180 kDa pro-𝛼1 145 kDa 𝛼1 and pro-𝛼2 1234 5 6 Pro-MMP-9 0 0 100 94 109 152 100–120 kDa 𝛼2 Pro-MMP-2 128 100 186 140 200 233

Figure 5: Gelatinases assay. Gelatin zymography showing the effects of different platelet-gel-released supernatant concentrations on gelatinases (MMP-2 and MMP-9) production. The figure was 1 23456 cropped removing upper and lower parts of gel, which contained no Pro-𝛼1160 100 355 1075 1010 528 bands. Lane 1: positive control (cells grown in complete medium). 𝛼2 88 100 312 961 1187 873 Lane 2: negative control (cells grown in medium + 1% FBS). Lane 6 3: cells treated with 0.5 × 10 plt/𝜇L. Lane 4: cells treated with 1 Figure 6: The effect of platelet-gel-released supernatant on collagen 6 6 × 10 plt/𝜇L. Lane 5: cells treated with 2 × 10 plt/𝜇L. Lane 6: cells release. The effects of different PG-released supernatant concen- 6 treated with 3 × 10 plt/𝜇L. The table shows the densitometric values trationsontypeIcollagenrelease.Lane1:positivecontrol(cells expressed as % volume of pro-MMP-9 and pro-MMP-2. For the pro- grown in complete medium). Lane 2: negative control (cells grown 6 MMP-9 densitometric analysis the band of cells that were treated in medium + 1% FBS). Lane 3: cells treated with 0.5 × 10 plt/𝜇L. 6 6 with 0.5 × 10 plt/𝜇L was set at 100%, and for the pro-MMP-2 Lane 4: cells treated with 1 × 10 plt/𝜇L. Lane 5: cells treated with 2 × 6 6 densitometric analysis the band of untreated cell (negative control) 10 plt/𝜇L. Lane 6: cells treated with 3 × 10 plt/𝜇L. The table shows was set at 100%. the densitometric values (expressed as % volume; band of negative control was set to 100%) of the pro-𝛼1and𝛼2collagensubtypes. ofthetotalcontentofthematrix,andtheremaining5%is formed from collagen types III, V, VI, XII, and XIV [50– bands (pro-𝛼1and𝛼2)andshowedthatcellstreatedwith 6 6 52]. Controversial studies on the effect of PRP on collagen concentrations of 1 × 10 plt/𝜇Land2× 10 plt/𝜇Lproduced expression in tenocytes have been reported, and in some approximately 10 times more collagen than untreated cells of those studies the expression of collagen types I and III (Figure 6,table). seems to be induced [35]. Other studies have shown an So, the data showed that PG-released supernatant was increase in the total amount of collagen, even after PRP had able to induce collagen type I expression at all tested concen- induced a decrease in the number of collagen transcripts. The trations when compared to untreated or control cells, and a authors explain this phenomenon by stating that the collagen reversal of this trend only occurred at the highest concentra- 6 productionpercellwasreducedwhilstthetotalcollagenthat tion that was tested (3 × 10 plt/𝜇L). These data indicate that was synthesized was higher due to the higher total numbers PG is able to induce the production of collagen I in tenocytes, of tenocytes after cell proliferation [3, 19]. which is necessary to restore the lost extracellular matrix after We analyzed the amount of collagen that was released in injury. the cell medium after stimulation with PG-released super- Becauseitwasshownthatcollagenexpressioncouldbe natant using an antibody capable of detecting the 𝛼1and regulated by scleraxis [54, 55] we aimed to understand if 𝛼2 subtypes, in active, proactive, or dimer form [53]. As in collagen expression induced by platelet gel was mediated previous experiments, the cell medium was normalized per by scleraxis induction. It was also shown that some stimuli, volumebutnotpercellnumbertotakeintoaccountthe such as TGF-𝛽,whichiscontainedinplateletgel,areable simultaneous effect on cell proliferation. As Figure 6 shows, to induce scleraxis expression in a time ranging from 12 to the antibody was able to detect the 𝛼1and𝛼2subtypesthat 46 h [55, 56]. Therefore, to investigate one of the molecular were in active, proactive, or dimer form (molecular weight of pathways involved in collagen stimulation, we treated tendon 290−300 kDa for the dimer, 180 kDa for pro-𝛼1, 145 kDa for cellsforanintervalbetweentheseextremes(18h)and 𝛼1andpro-𝛼2, and 100–120 kDa for 𝛼2). The collagen level successively analyzed scleraxis expression. As Figure 7 shows, was similar in cells grown in complete medium (Figure 6, treatment with increasing concentrations of platelets induced lane 1) and in untreated cells (Figure 6,lane2),andthislevel an increase in scleraxis levels, and after normalization to weakly increased in cells treated with lower concentrations actin bands corresponding to cells treated with higher con- of PG (Figure 6,lane3).However,concentrationsof1× centrations of platelets (Figure 7, lanes 4–6) showed higher 6 6 10 plt/𝜇Land2× 10 plt/𝜇L induced an evident increase in expression of scleraxis (approximately 2.5×)thaninuntreated allcollagentypeIforms(Figure 6, lanes 4-5), and the level cells (Figure 7,lane1). of collagen tended to decrease when cells were treated with These data seemed to be in contrast with previous data 6 the highest concentration of PG (3 × 10 plt/𝜇L) (Figure 6, showing that collagen levels increased when exposed to up 6 lane 6). Densitometric analysis was performed on the sharper to 2 × 10 plt/𝜇L and then decreased when exposed to 3 × 10 BioMed Research International

123456 somewaydifferentfromthatofhealthycellsusedinthisstudy, Scleraxis so the application of GP in degenerated tendons needs further investigation.

11.63 1.52 2.52 2.34 2.73 Abbreviations Actin bHLH: Basic helix-loop-helix ECM: Extracellular matrix Figure 7: Platelet-gel-released supernatant affects scleraxis expres- EGF: Epidermal growth factor sion. The effects of different PG-released supernatant concentrations FBS: Fetal bovine serum on scleraxis expression. The figures were cropped for more clarity; FGF: Fibroblast growth factor the removed areas contained no bands. Lane 1: negative control (cells IGF: Insulin-like growth factor growninmedium+1%FBS).Lane2:positivecontrol(cellsgrown 6 LEH: Lactalbumin enzymatic hydrolysate in complete medium). Lane 3: cells treated with 0.5 × 10 plt/𝜇L. 6 MMPs: Matrix metalloproteinases Lane 4: cells treated with 1 × 10 plt/𝜇L. Lane 5: cells treated with 2 × 6 6 PDGF: Platelet-derived growth factor 10 plt/𝜇L. Lane 6: cells treated with 3 × 10 plt/𝜇L. Actin detection was utilized as loading control. Values from densitometric analysis PG: Platelet gel are shown on base of each protein band and were calculated as PRP: Platelet-rich plasma described in the Materials and Methods section. SDS-PAGE: Sodium dodecyl sulfate-polyacrylamide gel electrophoresis 𝛽 𝛽 6 TGF- : Transforming growth factor- 10 plt/𝜇L because, in our case, scleraxis was higher in cells VEGF: Vascular endothelial growth factor. 6 treated with 3 × 10 plt/𝜇L. In our opinion, the reversal of this trend in collagen expression at higher concentrations is Conflict of Interests due to the simultaneous effect of the platelet gel on tenocyte proliferation. It is most likely that the collagen production per The authors declare that there is no conflict of interests cell is increased whilst the total collagen that is synthesized is regarding the publication of this paper. lower due to the lower proliferation of tenocytes. Acknowledgments 4. Conclusions This work was partially supported by Fondazione Cassa di The present study provides scientific indications of the real Risparmio della Provincia dell’Aquila. The authors thank Dr. ability of PG to induce, in vitro, all the necessary mechanisms Luigi Dell’Orso, the Chief of Immunotransfusional Unit of that are required for tenocytes to restore normal tissue during “San Salvatore” Hospital, L’Aquila, for providing hemocom- tendon healing in vivo. We are not aware of other studies ponents. The authors are grateful to Dr. Enzo Emanuele, a of this type that were conducted on healthy tenocytes (i.e., holder of both the M.D. and Ph.D. degrees (Living Research tenocyte biology could differ depending on the status of the s.a.s., Robbio, Pavia, Italy), for his expert editorial assistance. tendon: healthy, injured, or degenerated) [35]. Overall, our 𝜇 findings suggest that different concentrations of plt/ L(most References likely different concentrations of the growth factors that are released from the platelets) exhibit different levels of efficacy [1] W. S. Pietrzak and B. L. Eppley, “Platelet rich plasma: biology in inducing these processes. Excessively high concentrations and new technology,” Journal of Craniofacial Surgery,vol.16,no. of PG have an inhibitory effect on proliferation (and massive 6, pp. 1043–1054, 2005. cell death occurs at the highest concentration that was [2]C.E.Sommeling,A.Heyneman,H.Hoeksema,J.Verbelen,F. tested), migration, and the production of collagen type I. B. Stillaert, and S. Monstrey, “The use of platelet-rich plasma In contrast, MMP production increased with increasing in plastic surgery: a systematic review,” Journal of Plastic, concentration until the highest concentration, which could Reconstructive & Aesthetic Surgery,vol.66,no.3,pp.301–311, be counterproductive because excessive proteolysis could 2013. impair tendon mechanical stability. In light of this, it is [3]M.deMos,A.E.vanderWindt,H.Jahretal.,“Canplatelet- obvious that the “more is better theory” is not valid in this rich plasma enhance tendon repair? A cell culture study,” The AmericanJournalofSportsMedicine,vol.36,no.6,pp.1171–1178, case because not all concentrations were equally useful. In 2008. fact, excessively high values of platelets/𝜇Lseemedtobe [4] B. L. Eppley, J. E. Woodell, and J. Higgins, “Platelet quantifica- counterproductive for tenocyte biology. Therefore, we can tionandgrowthfactoranalysisfromplatelet-richplasma:impli- suppose that PG can be successfully employed to facilitate cations for wound healing,” Plastic and Reconstructive Surgery, human tendon regeneration due to its ability to induce vol. 114, no. 6, pp. 1502–1508, 2004. cellular processes useful to tendon healing (proliferation, [5] I. Giusti, A. Rughetti, S. D’Ascenzo et al., “The effects of platelet migration, and collagen production) and that its use could gel-released supernatant on human fibroblasts,” Wound Repair influence the strategies that are classically used in tendon and Regeneration,vol.21,no.2,pp.300–308,2013. reconstructive/corrective surgery. We have to be aware, any- [6] T. E. Foster, B. L. Puskas, B. R. Mandelbaum, M. B. Gerhardt, way, that in tendon disorders tenocytes biology could be and S. A. Rodeo, “Platelet-rich plasma: from basic science to BioMed Research International 11

clinical applications,” American Journal of Sports Medicine,vol. [23] P. Aspenberg and O. Virchenko, “Platelet concentrate injection 37, no. 11, pp. 2259–2272, 2009. improves Achilles tendon repair in rats,” Acta Orthopaedica [7] R. Landesberg, A. Burke, D. Pinsky et al., “Activation of platelet- Scandinavica,vol.75,no.1,pp.93–99,2004. rich plasma using thrombin receptor agonist peptide,” Journal of [24] D. N. Lyras, K. Kazakos, D. Verettas et al., “The influence of Oral and Maxillofacial Surgery,vol.63,no.4,pp.529–535,2005. platelet-rich plasma on angiogenesis during the early phase of [8] I. Giusti, A. Rughetti, S. D’Ascenzo et al., “Identification of an tendon healing,” Foot and Ankle International,vol.30,no.11,pp. optimal concentration of platelet gel for promoting angiogen- 1101–1106, 2009. esis in human endothelial cells,” Transfusion,vol.49,no.4,pp. [25] G. Bosch, M. Moleman, A. Barneveld, P. R. van Weeren, and H. 771–778, 2009. T. M. van Schie, “The effect of platelet-rich plasma on the neo- [9] A. S. Wasterlain, H. J. Braun, A. H. S. Harris, H. Kim, and J. L. vascularization of surgically created equine superficial digital Dragoo, “The systemic effects of platelet-rich plasma injection,” flexor tendon lesions,” Scandinavian Journal of Medicine and The American Journal of Sports Medicine,vol.41,no.1,pp.186– Science in Sports, vol. 21, no. 4, pp. 554–561, 2011. 193, 2013. [26]J.G.Lane,R.M.Healey,D.C.Chase,andD.Amiel,“Useof [10] L. V. Schnabel, H. O. Mohammed, B. J. Miller et al., “Platelet platelet-rich plasma to enhance tendon function and cellular- Rich Plasma (PRP) enhances anabolic gene expression pat- ity,” The American Journal of Orthopedics,vol.42,no.5,pp.209– terns in flexor digitorum superficialis tendons,” Journal of 214, 2013. Orthopaedic Research, vol. 25, no. 2, pp. 230–240, 2007. [27] M. Sanchez,´ E. Anitua, J. Azofra, I. And´ıa,S.Padilla,andI. [11] G. Schippinger, K. Oettl, F. Fankhauser, S. Spirk, W. Domej, Mujika, “Comparison of surgically repaired Achilles tendon and P. Hofmann, “Influence of intramuscular application of tears using platelet-rich fibrin matrices,” American Journal of autologous conditioned plasma on systemic circulating IGF-1,” Sports Medicine,vol.35,no.2,pp.245–251,2007. JournalofSportsScienceandMedicine,vol.10,no.3,pp.439– [28] K. Gaweda, M. Tarczynska, and W. Krzyzanowski, “Treatment 444, 2011. of achilles tendinopathy with platelet-rich plasma,” Interna- [12] B. L. Eppley, J. E. Woodell, and J. Higgins, “Platelet quantifi- tional Journal of Sports Medicine,vol.31,no.8,pp.577–583,2010. cation and growth factor analysis from platelet-rich plasma: [29] K. Harmon, J. Drezner, and A. Rao, “Platelet rich plasma for implications for wound healing,” Plastic and Reconstructive chronic tendinopathy,” British Journal of Sports Medicine,vol. Surgery,vol.114,no.6,pp.1502–1508,2004. 47, p. e2, 2013. [13] C. J. Rosen and M. Pollak, “Circulating a new century,” Trends in [30] S. de Jonge, R. J. de Vos, A. Weir et al., “One-year follow-up of Endocrinology and Metabolism,vol.10,no.4,pp.136–141,1999. platelet-rich plasma treatment in chronic achilles tendinopathy: [14] S. Mehta and J. T. Watson, “Platelet rich concentrate: basic sci- a double-blind randomized placebo-controlled trial,” American ence and current clinical applications,” Journal of Orthopaedic Journal of Sports Medicine,vol.39,no.8,pp.1623–1629,2011. Trauma,vol.22,no.6,pp.432–438,2008. [31]T.Schepull,J.Kvist,H.Norrman,M.Trinks,G.Berlin,andP. [15]S.E.SmithandT.S.Roukis,“Boneandwoundhealing Aspenberg, “Autologous platelets have no effect on the healing augmentation with platelet-rich plasma,” Clinics in Podiatric of human Achilles tendon ruptures: a randomized single-blind Medicine and Surgery, vol. 26, no. 4, pp. 559–588, 2009. study,” The American Journal of Sports Medicine,vol.39,no.1, [16] N. Maffulli, U. G. Longo, and V. Denaro, “Novel approaches pp. 38–47, 2011. for the management of tendinopathy,” Journal of Bone and Joint [32] J. Chahal, G. S. van Thiel, N. Mall et al., “The role of platelet-rich Surgery,vol.92,no.15,pp.2604–2613,2010. plasma in arthroscopic rotator cuff repair: a systematic review [17] T. Molloy, Y. Wang, and G. A. C. Murrell, “The roles of growth with quantitative synthesis,” Arthroscopy—Journal of Arthro- factors in tendon and ligament healing,” Sports Medicine,vol. scopic and Related Surgery,vol.28,no.11,pp.1718–1727,2012. 33,no.5,pp.381–394,2003. [33] J. Kaux and J. Crielaard, “Platelet-rich plasma application in [18]E.V.Cheung,L.Silverio,andJ.W.Sperling,“Strategiesin the management of chronic tendinopathies,” Acta Orthopaedica biologic augmentation of rotator cuff repair: a review,” Clinical Belgica,vol.79,no.1,pp.10–15,2013. Orthopaedics and Related Research,vol.468,no.6,pp.1476– [34] E. Anitua, I. And´ıa, M. Sanchez et al., “Autologous preparations 1484, 2010. rich in growth factors promote proliferation and induce VEGF [19]X.Wang,Y.Qiu,J.Triffitt,A.Carr,Z.Xia,andA.Sabok- and HGF production by human tendon cells in culture,” Journal bar, “Proliferation and differentiation of human tenocytes in of Orthopaedic Research,vol.23,no.2,pp.281–286,2005. response to platelet rich plasma: an in vitro and in vivo study,” [35] C. H. Jo, J. E. Kim, K. S. Yoon, and S. Shin, “Platelet-rich Journal of Orthopaedic Research,vol.30,no.6,pp.982–990, plasma stimulates cell proliferation and enhances matrix gene 2012. expression and synthesis in tenocytes from human rotator cuff [20] R. J. De Vos, A. Weir, H. T. M. Van Schie et al., “Platelet- tendons with degenerative tears,” The American Journal of Sports rich plasma injection for chronic Achilles tendinopathy: a Medicine,vol.40,no.5,pp.1035–1045,2012. randomized controlled trial,” Journal of the American Medical [36] A. D. Mazzocca, M. B. R. McCarthy, D. M. Chowaniec et al., Association,vol.303,no.2,pp.144–149,2010. “Thepositiveeffectsofdifferentplatelet-richplasmamethods [21] M. Sanchez,´ E. Anitua, G. Orive, I. Mujika, and I. Andia, on human muscle, bone, and tendon cells,” American Journal of “Platelet-rich therapies in the treatment of orthopaedic sport Sports Medicine,vol.40,no.8,pp.1742–1749,2012. injuries,” Sports Medicine,vol.39,no.5,pp.345–354,2009. [37] A. Rughetti, I. Giusti, S. D’Ascenzo et al., “Platelet gel-released [22] N. Zargar Baboldashti, R. C. Poulsen, S. L. Franklin, M. S. supernatant modulates the angiogenic capability of human Thompson, and P. A. Hulley, “Platelet-rich plasma protects endothelial cells,” Blood Transfusion,vol.6,no.1,pp.12–17,2008. tenocytes from adverse side effects of dexamethasone and [38] P. Sharma and N. Maffulli, “Tendon injury and tendinopathy: ciprofloxacin,” The American Journal of Sports Medicine,vol.39, Healing and repair,” Journal of Bone and Joint Surgery A,vol.87, no. 9, pp. 1929–1935, 2011. no. 1, pp. 187–202, 2005. 12 BioMed Research International

[39] R. James, G. Kesturu, G. Balian, and A. B. Chhabra, “Tendon: [56] Y. Liu, P. Cserjesi, A. Nifuji, E. N. Olson, and M. Noda, biology, biomechanics, repair, growth factors, and evolving “Sclerotome-related helix-loop-helix type transcription factor treatment options,” The Journal of Hand Surgery,vol.33,no.1, (scleraxis)mRNAisexpressedinosteoblastsanditslevelis pp. 102–112, 2008. enhanced by type-𝛽 transforming growth factor,” Journal of [40] M. Vetrano, F. d’Alessandro, M. R. Torrisi, A. Ferretti, M. C. Endocrinology,vol.151,no.3,pp.491–499,1996. Vulpiani, and V. Visco, “Extracorporeal shock wave therapy promotes cell proliferation and collagen synthesis of primary cultured human tenocytes,” Knee Surgery, Sports Traumatology, Arthroscopy, vol. 19, no. 12, pp. 2159–2168, 2011. [41] L. J. Backman, G. Fong, G. Andersson et al., “Substance P is a mechanoresponsive, autocrine regulator of human tenocyte proliferation,” PLoS ONE,vol.6,no.11,ArticleIDe27209,2011. [42] R. Schweitzer, J. H. Chyung, L. C. Murtaugh et al., “Analysis of the tendon cell fate using scleraxis, a specific marker for tendons and ligaments,” Development,vol.128,no.19,pp.3855–3866, 2001. [43] S. Pauly, F. Klatte, C. Strobel et al., “Characterization of tendon cell cultures of the human rotator cuff,” European Cells and Materials, vol. 20, pp. 84–97, 2010. [44] V. Lejard,´ G. Brideau, F. Blais et al., “Scleraxis and NFATc regulate the expression of the pro-𝛼1(I) collagen gene in tendon fibroblasts,” TheJournalofBiologicalChemistry,vol.282,no.24, pp. 17665–17675, 2007. [45] P.Cserjesi, D. Brown, K. L. Ligon et al., “Scleraxis: A basic helix- loop-helix protein that prefigures skeletal formation during mouse embryogenesis,” Development,vol.121,no.4,pp.1099– 1110, 1995. [46] M. A. Akhavani, B. Sivakumar, E. M. Paleolog, and N. Kang, “Angiogenesis and plastic surgery,” Journal of Plastic, Recon- structive & Aesthetic Surgery,vol.61,no.12,pp.1425–1437,2008. [47] D. Lyras, K. Kazakos, D. Verettas et al., “Immunohistochemical study of angiogenesis after local administration of platelet-rich plasma in a patellar tendon defect,” International Orthopaedics, vol.34,no.1,pp.143–148,2010. [48] T. M. Ritty and J. Herzog, “Tendon cells produce gelatinases in response to type I collagen attachment,” Journal of Orthopaedic Research,vol.21,no.3,pp.442–450,2003. [49]W.Oshiro,J.Lou,X.Xing,Y.Tu,andP.R.Manske,“Flexor tendon healing in the rat: a histologic and gene expression study,” JournalofHandSurgery,vol.28,no.5,pp.814–823,2003. [50] P. Kannus, “Structure of the tendon connective tissue,” Scandi- navian Journal of Medicine and Science in Sports,vol.10,no.6, pp.312–320,2000. [51] G. P. Riley, “Gene expression and matrix turnover in overused and damaged tendons,” Scandinavian Journal of Medicine & Science in Sports,vol.15,no.4,pp.241–251,2005. [52] G. Gross and A. Hoffmann, “Therapeutic strategies for tendon healing based on novel biomaterials, factors and cells,” Pathobi- ology,vol.80,no.4,pp.203–210,2013. [53] H. Qiao, J. Bell, S. Juliao, L. Li, and J. M. May, “Ascorbic acid uptake and regulation of type I collagen synthesis in cultured vascular smooth muscle cells,” Journal of Vascular Research,vol. 46,no.1,pp.15–24,2008. [54] R. A. Bagchi and M. P. Czubryt, “Synergistic roles of scleraxis and Smads in the regulation of collagen 1𝛼2 gene expression,” Biochimica et Biophysica Acta—Molecular Cell Research,vol. 1823, no. 10, pp. 1936–1944, 2012. [55]Y.M.Farhat,A.A.Al-Maliki,T.Chenetal.,“Geneexpression analysis of the pleiotropic effects of TGF-𝛽1inaninvitromodel of flexor tendon healing,” PLoS ONE,vol.7,no.12,ArticleID e51411, 2012. Hindawi Publishing Corporation BioMed Research International Volume 2014, Article ID 249498, 15 pages http://dx.doi.org/10.1155/2014/249498

Review Article Clinical Applications of Platelet-Rich Plasma in Patellar Tendinopathy

D. U. Jeong,1,2 C.-R. Lee,2 J. H. Lee,2 J. Pak,3 L.-W. Kang,4 B. C. Jeong,2 andS.H.Lee2

1 School of Medicine, Korea University College of Medicine, 73 Inchon-ro, Seongbuk-gu, Seoul 136-705, Republic of Korea 2 National Leading Research Laboratory, Department of Biological Sciences, Myongji University, 116 Myongji-ro, Yongin, Gyeonggi-do 449-728, Republic of Korea 3 Stems Medical Clinic, 32-3 Chungdam-dong, Gangnam-gu, Seoul 135-950, Republic of Korea 4 Department of Biological Sciences, Konkuk University, 1 Hwayang-dong, Gwangjin-gu, Seoul 143-701, Republic of Korea

Correspondence should be addressed to S. H. Lee; [email protected]

Received 5 February 2014; Revised 26 June 2014; Accepted 9 July 2014; Published 21 July 2014

Academic Editor: Giuseppe Filardo

Copyright © 2014 D. U. Jeong et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Platelet-rich plasma (PRP), a blood derivative with high concentrations of platelets, has been found to have high levels of autologous growth factors (GFs), such as transforming growth factor-𝛽 (TGF-𝛽), platelet-derived growth factor (PDGF), fibroblastic growth factor (FGF), vascular endothelial growth factor (VEGF), and epidermal growth factor (EGF). These GFs and other biological active proteins of PRP can promote tissue healing through the regulation of fibrosis and angiogenesis. Moreover, PRP is considered to be safe due to its autologous nature and long-term usage without any reported major complications. Therefore, PRP therapy could be an option in treating overused tendon damage such as chronic tendinopathy. Here, we present a systematic review highlighting the clinical effectiveness of PRP injection therapy in patellar tendinopathy, which is a major cause of athletes to retire from their respective careers.

1. Introduction application in clinical and surgical settings. However, the efficacy of PRP therapy has not yet been clearly defined Platelet-rich plasma (PRP) is prepared by centrifuging anti- [1, 4–6]. This systematic review article will demonstrate the coagulated whole blood obtained by phlebotomy. Therefore, properties of PRP and its application in clinical therapy it contains a hyperphysiological concentration of autologous (especially focusing on patellar tendinopathy). platelets, 3–8 times the concentration of platelets in whole When PRP injection occurs, highly concentrated platelets blood [1]. However, the exact definition of PRP has not been are activated. As a result, there is an exponential increase determined in terms of the concentration of platelet, and in numerous GFs (Table 1)atthesightofinjection[1]. most published reports differ on PRP concentrations2 [ ]. These various GFs include insulin-like growth factor (IGF-1), Platelets are nonnucleated cytoplasmic bodies derived transforming growth factor (TGF-𝛽), platelet-derived growth from megakaryocyte precursors. They play a pivotal role in hemostasis and wound healing via the formation of fibrin factor (PDGF), vascular endothelial growth factor (VEGF), clots [1, 3]. Therefore, increasing platelet concentration in fibroblast growth factor (FGF), platelet-derived angiogenic compromised (or injured) tissue may result in an exponential factor (PDAF), and platelet-derived endothelial growth factor releaseofdiversebioactivefactorsand,subsequently,enhance (PDEGF) [1, 2]. Hepatocyte growth factor (HGF), epidermal the healing process [1]. PRP therapy is considered safe, growth factor (EGF), cytokines, chemokines, and metabolites because it has an autologous nature and long-term clinical also appear to be involved [1, 2, 7]. Bioactive molecules effects without any reported major side effects1 [ , 4–6]. In that facilitate various components of healing exist in higher addition to the safety, the easy availability of PRP leads to concentrations in platelets than in native blood [8]. 2 BioMed Research International

∗ Table 1: GFs in PRP . Expression of a variety of GFs has a central role in the healing processes of tissues, including those of tendon Growth Function factor and ligament [9, 10]. The tendon healing process progresses inthreephases.Atthebeginning,theinflammatoryphase Cellular proliferation EGF occurs for 24 hours. Neutrophils and macrophages play a Differentiation of epithelial cells role in producing chemotactic and vasoactive factors. The Stimulates angiogenesis proliferative phase follows the inflammatory phase and is Cellular migration dominated by the synthesis of collagen type III and gran- FGF ulation tissue [11]. The last stage is the remodeling phase, Stimulates the proliferation of capillary endothelial cells which begins approximately six weeks later with a decrease Production of granulation tissue in cellular and vascular content and an increase in collagen Stimulation of hepatocyte proliferation and liver tissue typeIcontent[9, 12]. regeneration Clinical studies using cultured human tenocytes have HGF Stimulates angiogenesis shown that PRP, in the form of platelet-rich clot releasate (PRCR), the active releasate of PRP,stimulates differentiation Mitogen for endothelial cells of human tendon stem cells into active tenocytes with Antifibrotic high proliferation rates and total collagen production [1, Proliferation of myoblasts and fibroblasts 13]. Therefore, PRP has a number of potential beneficial Stimulation of protein synthesis properties, such as the release of GFs that could restart healing in the injured tissues [8]. IGF-1 Mediator in growth and repair of skeletal muscle Enhances bone formation by proliferation and differentiation of osteoblasts 2. Methods Enhances collagen and matrix synthesis We used the Preferred Reporting Items for Systematic Review Induces vascularization by stimulating vascular PDAF and Meta-Analysis (PRISMA) in our review [14](Figure 1). endothelial cells We conducted a systematic literature search in the fol- Stimulates the proliferation of keratinocytes and dermal PDEGF lowing databases: Medline via PubMed and the Cochrane fibroblasts Library. Additionally, we also searched on the following Macrophage activation Web sites: National Institute for Health and Care Excel- Stimulates angiogenesis lence (http://www.nice.org.uk), Canadian Agency for Drugs Fibroblast chemotaxis and proliferative activity and Technologies in Health (http://www.cadth.ca), Current PDGF Controlled Trials (http://www.controlled-trials.com), and Attracts stem cells and white blood cells BioMed Central (http://www.biomedcentral.com). We used Enhances collagen synthesis keywords as search terms. We combined terms for selected Contributes to tissue remodeling indications (platelet-rich plasma, patellar, tendinopathy, tendinosis, tendonitis, tendinitis, and tendon). The literature Enhances the proliferation of bone cells search included all studies published in English between Enhances the proliferative activity of fibroblasts 2000 and 2014. We identified 127 references after removing Stimulates biosynthesis of type 1 collagen and duplicates. We independently assessed full-text articles for fibronectin inclusion in our review. The criteria for inclusion of studies TGF-𝛽 Induces deposition of bone matrix in our review encompassed all clinical trials of PRP injection Inhibits osteoclast formation and bone resorption conducted on humans with patellar tendinopathy. After discarding 15 review articles, we identified 15 clinical trials Regulation in balance between fibrosis and myocyte (two randomized controlled trial (RCT) studies, six nonran- regeneration domized controlled trial (non-RCT) studies, two prospective Control of angiogenesis and fibrosis case-series study, three case studies, and two retrospective Immunosuppressant during inflammatory phase studies). Stimulates angiogenesis Migration and mitosis of endothelial cells 3. PRP Treatments in Patellar Tendinopathy VEGF Creation of blood vessel lumen PRP is a bioactive component of whole blood, which is now Chemotactic for macrophages and granulocytes being widely tested in different fields of medicine [4]. The Vasodilation use of PRP to favor tendon healing has been advocated only EGF: epidermal growth factor; FGF: fibroblast growth factor; HGF: hep- relatively recently [10, 15, 16]. Many researchers have been atocyte growth factor; IGF-1: insulin-like growth factor-1; PDAF: platelet- encouraged to investigate the effects of PRP injections in derived angiogenic factor; PDEGF: platelet-derived endothelial growth tendinopathyandtomeasuretheoutcomes. factor; PDGF: platelet-derived growth factor; TGF-𝛽:transforminggrowth factor-𝛽; VEGF: vascular endothelial growth factor. Clinicians are increasingly using the term “tendinopathy” ∗ Data from [1, 2, 7, 8]. to refer to tendon disorders [17]. The term is currently BioMed Research International 3

70 of records identified through 67 of additional records database searching identified through other sources

127 of records after duplicates removed

86 of records excluded ∙ No patellar tendinopathy (71) Screening 127 of records screened ∙ Other methods (10) ∙ Deficiency of useful data (5)

26 of full-text articles excluded, 41 of full-text articles with reasons assessed for eligibility ∙ Not a report in human (11) ∙ No clinical study (15)

15 of studies included in the systematic review Included Eligibility Identification Figure 1: Literature selection process (PRISMA flow diagram). accepted to indicate an overuse pathological condition in recommend a specific treatment protocol. Both treatments and around tendon. It refers to degenerative changes with share the same disputes: lack of hard evidence through lack of inflammatory features (“tendinosis”) or inflammatory randomized clinical trial and no standardized treatment process (“tendonitis” or “tendinitis”) [18]. At histopatholog- protocols [23]. Vetrano et al. [23]comparedtwoautologous ical examination, tendinopathy is a failed healing response. PRP injections versus three sessions of ESWT, through ran- In addition to an increase in noncollagenous matrix and domizedcontrolledtrial.ThePRPgroupshowedsignificantly neovascularization, it is characterized by haphazard prolif- better improvement than the ESWT group in the Victorian eration of tenocytes and disruption and altered organization Institute of Sports Assessment-Patellar questionnaire (VISA- of collagen fibers [18, 19]. Tendinopathy is overuse injuries P) and visual analog scale for pain (VAS) scores at 6- and 12- frequently associated with sports. It usually occurs in major monthfollow-upandinmodifiedBlanzinascalescoreat12- tendons, such as the Achilles, patellar, rotator cuff, and month follow-up [23]. Therefore, this report shows that thera- forearm extensor tendons. This review mainly focuses on peutic injections of PRP lead to better midterm clinical results the effectiveness of PRP, especially for a refractory chronic compared with focused ESWT in the treatment of jumper’s patellar tendinopathy. knee in athletes [23]. The explanation for better results in thePRPgroupmayberelatedtoamultifacetedmechanism of action involving platelet action as well as injection- 3.1. PRP in Patellar Tendinopathy. PRP may offer opportuni- related effects [23–25]. Additionally, the high expectations of ties in aiding regeneration of tissue with low healing potential patients about this new technology may have a great influence as in patellar tendinopathy [4, 20–22]. A complex regulation especially in sports medicine. The principal limitations of of several GFs stimulates the expression of procollagen types this study are the small number of patients enrolled, the I and III, improves mechanical properties, and promotes lack of a placebo control group, and follow-up assessment tendon cell proliferation and tendon healing [4, 20]. Since through qualitative outcome measures in the absence of patellar tendinopathy is one of major injuries that cause ath- clinical and instrumental quantitative assessments (e.g., color letes to retire from their field, we focused on the evaluation of ultrasonography, magnetic resonance imaging (MRI)) [23]. clinical studies documenting the potential of PRP treatment In addition, although the assessment was blinded, there was forpatellartendinopathy. no way to blind the patients to the treatment. Therefore, it is Through a systematic literature search, we found 15 possible that their awareness of the treatment modality may clinical studies about the efficacy of PRP treatment on patellar have had some effect on their perception of their response to tendinopathy: two RCT studies, six non-RCT studies, two the treatment and the results may be specific to the specific prospective case-series study, three case studies, and two formulation of PRP and the specific ESWT protocol used in retrospective studies. The main features of these studies were the study [23]. summarized in Table 2.Mostsubjectswereathletesinvarious sports and their ages ranged from 18 to 73 years. Most patients had not improved with various previous other treatments. 3.3. RCT by Dragoo et al. A second RCT studyis recently published. The study compared a regimen of eccentric exer- 3.2. RCT by Vetrano et al. Extracorporeal shock wave ther- cises combined with either ultrasound-guided PRP injection apy (ESWT) and PRP injections seem to be a safe and or ultrasound-guided dry needling alone in the treatment promising part of the rehabilitation program for jumper’s of patellar tendinopathy [26]. The PRP group showed sig- knee, although, given current knowledge, it is impossible to nificantly better improvement than the dry needling group 4 BioMed Research International Valid therapeuticoption (PRP) PRP injection accelerates the recovery from patellar tendinopathy relative to USG dry needling, but the apparent benefit of PRP dissipates over time Authors’ conclusion Therapeutic injections of PRP lead to better midterm clinical results compared with focused ESWT in the treatment of jumper’s knee in athletes = P 26 wk ≥ = 0.66) P Statistically significant improvement in VISA-P score for 7outof8patients treated Results G1 showed significantly better improvement than the G2 at 12 wk ( 0.02), but the difference between two groups was not significant at ( G1 showed significantly better improvement than the G2 in VISA-P, VAS s coresFU) and (6, in modified 12Blanzina mo scale score (12 mo FU) SF-12 Tegner; VISA-P; modified measures Outcome VISA-P, VAS, VISA-P; MRI Blanzina scale Lysholm; VAS; 7d; 6mo 120 d 9wk; 2mo; 6mo; 12 mo 12 wk; ≥ 30 d; 60 d; Follow-up 3 wk; 6 wk; Rest, walking (1st 7 d); stretching exercises, exercise bike, walking in water, light swim (7–21 d); eccentric quadriceps training, concentric strengthening (after 5 wk); muscular strengthening, jogging (after 7wk);normal sport activities (after 12 wk) G1, G2: physical therapy twice per week; standardized additional exercises at home Concurrent treatment G1, G2: standardized stretching, muscle strengthening protocol; gradual return to sports activities (after 4wk) Various treatments without any success Various treatments without any success Previous therapy Various treatments without any success 14 yr 8yr ± 9.1 yr; 8.5 yr; ± ± ± 26.6 (21–41) yr; at least 1 yr G1: 28 G2: 40 G1: 26.9 mean 18.9 mo G2: 26.8 Subject characteristic (age; symptoms’ duration) mean 17.6mo Table 2: Clinical studies on PRP treatments for patellar tendinopathy. G1: G2: subjects 9; 8 M/1 F Number of group; sex) (3 bilateral) 8/8; 7 M/1 F 12; 12 M/0 F (total/study G1: 23; 20 M/3 F G2: 23; 17 M/6 F RCT RCT Non-RCT; Study type prospective cohort study 2 Intervention treatment (per group) G1: USG PRP (6 mL) + 0.25% bupivacaine (3 mL) + 1 : 100,000 epinephrine injections; 10x MP G2: USG 0.25% bupivacaine (3 mL) + 1 : 100,000 epinephrine injections; 10x MP G1: 0.5 mL of local anaesthetic (lidocaine) injected; 1x USG (3 mL) PRP injected G2: no control group G1: 2x USG PRP (2 mL) injections every 1 wk G2: 3 sessions of focused ESWT (2.400 impulses at 0.17–0.25 mJ/mm per session) ] ] ] 23 26 21 Study (yr) Vetrano et al. (2013) [ Dragoo et al. (2014) [ Volpi et al. (2007) [ BioMed Research International 5 Statistically significant improvement Safe application, aiding the regeneration of tissue with low healing potential; long-term RCT needed Authors’ conclusion PRP can be useful for the treatment of chronic patellar tendinopathy, even in difficult cases with refractory tendinopathy (only physiotherapy approach had failed) VAS s cales:improved (G1, G2) VISA-P: less healing potential (G1); improved (G2) Overtime follow-up: both groups showed a clinically significant improvement Statistically significant improvements in all scores Results Statistically significant improvements in all scores level Tegner; Tegner; measures Outcome VISA-P; VAS EQ-VAS; pain questionnaires EQ-VAS; SF-36 Mean 18.4 mo ET; 6 mo ET; 6 mo Follow-up (after PRP treatment) Rest (between 1st and 2nd injection); stretching exercises and mild activities (after 2nd injection); stretching exercises and mild activities (after 3rd injection); normal sport activities (after 1 mo) Rest (1st 24 hr); standardized stretching protocol (after 24 hr–2 wk); eccentric muscle and tendon- strengthening program (after stretching); normal sport activities (after 1 mo) Concurrent treatment Rest (between 1st and 2nd injection); stretching exercises and mild activities (after 2nd injection); stretching exercises and mild activities (after 3rd injection); normal sport activities (after 1 mo) Table 2: Continued. Various treatments without any success G1: 14, various treatments without any success G2: 22, without treatment Previous therapy G1: various treatments without any success G2: without treatment (at least 2mo), primarily physiotherapy protocol only 28.4 mo 12.6 yr; 8.5 yr; 9.2 yr; 19.9 mo 4.1 mo ± ± ± ± ± ± 25.5 (18–47) yr; 20.7 (3–60) mo 30.9 40.3 Subject characteristic (age; symptoms’ duration) G1: 28.8 24.1 G2: 25.5 8.4 36/36; subjects 23 M/13 F 31/15; 31 M Number of group; sex) (5 bilateral) (7 bilateral) (total/study 20/20; 20 M Non-RCT Non-RCT; Non-RCT; Study type prospective prospective cohort study cohort study was added was added 2 2 Intervention treatment (per group) G1: PRP injections (3x) were administered every 15 d without USG; before the injection, 10% of CaCl G1: PRP injections (3x) were administered every 15 d without USG; before the injection, 10% of CaCl G1 and G2: 1 mL of PRP + bupivacaine HCl 0.5% + epinephrine injection (1st injection); remaining PRP + bupivacaine HCl 0.5% + epinephrine (ca. 4 mL) injected (2nd injection) to the PRP unit (5 mL with ca. 6.8 million platelets) to activate platelets; 4–6x MP G2: no control group to the PRP unit (5 mL with ca. 6.5 million platelets) to activate platelets; 4–6x MP G2: no injection ] ] ] 4 22 27 Study (yr) Kon et al. (2009) [ Filardo et al. (2010) [ Gosens et al. (2012) [ 6 BioMed Research International Good overall results for the treatment of chronic refractory patellar tendinopathy Statistically significant and lasting improvement of clinical symptoms; PRP injection leads to recovery of the tendon matrix potentially helping to prevent degenerative lesions Thecombination treatment reported in this study is feasible and seems to be promising for patients in the late/degenerative phase of patellar tendinopathy Authors’ conclusion Good and stable results over time; significantly poorer results with a longer history of symptoms; poor results with bilateral lesions; no correlation between US and clinical findings Nonsignificant improvement (20 d FU); intratendinous vascularity increased both 20 d FU and 6 mo FU; significant improvement (6 mo FU) Five of the six tendons showed an improvement of at least 30 points on the VISA-P after 26 weeks Results VISA-P VISA-P; VISA-P; EQ-VAS; tendons) Blanzina; measures Outcome VISA-A; US Tegner; US (26 ± 6wk; 26 wk 12 wk; 16 wk; 8.1 mo 6mo;up to 48.6 ET; 2 mo; 20 d; 6 mo Follow-up 8–15 × Rest, low load (0–2 wk); higher cycling intensity, home exercise program (2–4 wk); eccentric exercises, various exercises (5, 6wk);exercises progressing to higher % 1RM, 3 reps., rest interval 30 sec., more muscular hypertrophy (7, 8 wk); daily eccentric training continues, advance to more sport-specific exercises (after 8 wk) Rest (between 1st and 2nd injection); eccentric exercises (after 2nd injection-12 wk) Concurrent treatment Minimize physical activity (after 48 hr); physiokinesitherapy gradual return to sports activities (after 2wk) Table 2: Continued. Various treatments without any success Various treatments without any success Previous therapy Various treatments without any success 11.7 yr; ± 3mo 3mo 27 (23–31) yr; ≥ 30.6 ≥ Subject characteristic (age; symptoms’ duration) G1: 37.4 (21–56) yr; at least 3 mo G2: 38.6 (20–61) yr; at least 3 mo subjects 16 M/8 F 14 M/10 F Number of group; sex) (1 bilateral) G1 (patellar (total/study (6 bilateral) (4 bilateral) 5/5; 2 M/3 F tendon): 24; tendon): 24; (11 bilateral) G2 (Achilles 43/43; 42 M/1 F Non-RCT Non-RCT case series Study type Prospective /L) 9 10 was added 2 × 0.52 wk with ± G1: 3x USG PRP injections were administered every 14 d; before the injection, 10% of CaCl 1x USG, a low concentration of platelets (433 injected to the PRP unit (5 mL) to activate platelets G2: no control group Intervention treatment (per group) G1 and G2: local anesthesia (4 mL of 2% mepivacaine) injected; 2x PRP (6 mL) injected at a mean distance of 3 USG ] ] 28 29 ] 31 Study (yr) Ferrero et al. (2012) [ Filardo et al. (2013) [ van Ark et al. (2013) [ BioMed Research International 7 Emerging literature on PRP appears to be promising for patellar tendinopathy. PRP injection is a safe and cost-effective treatment method for chronic patellar tendinopathy Authors’ conclusion PRP injection allows fast recovery of athletes with patellar tendinopathy to a presymptom sporting level PRP injection is a safe and promising alternative for patients with chronic patellar tendinopathy Adiagnostic ultrasound confirmed complete resolution of the defect and the patients was symptom-free. An improvement of at least 19 points on the VISA-P; a 50% reduction in pain; reduced thickness of the tendon Results All patients showed an improvement in all scores at the 2 yr FU and twenty-one of 28 patients returned to their presymptom sporting level at 3mo An estimated 90% clinical improvement in function and a complete resolution of pain (1 mo FU); full activity without pain or limitation (2 mo FU) measures Outcome pain level VISA-P; US; US; pain level VISA-P; VAS; Lysholm; MRI 6wk 2 mo US; pain level 2mo 1mo; 4wk; 3mo; 6mo; 24 mo 12 mo; 18 mo; Follow-up ] 71 The rehabilitation program starting with warm-up exercises, stretching, and formal eccentric exercises on a flat board followed by progressive training such as cycling and mild exercises in the pool [ Non-weight bearing (0–2 wk); 50% weight-bearing (2-3 wk); eccentric decline-board squats and no other activity (3–7 wk); rehabilitation and aqua jogging (7–10 wk) Rest (1 wk); running, jumping, or doing resistance training (1–4 wk); progressive open chain resistance training (4–6 wk); closed chain exercises (after 6wk) Minimize physical activity (the few days); slow quadriceps eccentric strengthening exercises (after 2wk) Concurrent treatment Table 2: Continued. Various treatments without any success Various treatments without any success Various treatments without any success Various treatments without any success Previous therapy 9mo 6yr 1yr ≥ ≥ ≥ 4mo 27 (16–37) yr; ≥ Subject characteristic (age; symptoms’ duration) 28/28 subjects Number of group; sex) (total/study case series Study type Case study 1/1; 1 M 36 yr; Case study 1/1; 1 F 23 yr; Case study 1/1; 1 M 18 yr; Prospective Intervention treatment (per group) 3x USG PRP (2 mL) injections every 1 wk 1x USG PRP (3 mL) injections were administered 1x USG PRP (2 mL) injections were administered 1x USG PRP (5 mL) injections were administered ] ] ] 32 34 35 ] 33 Study (yr) Charousset et al. (2014) [ Brown and Sivan (2010) [ Rowan and Drouin (2013) [ Scollon- Grieve and Malanga (2011) [ 8 BioMed Research International Intratendinous injection of PRP allows rapid tendon healing and decreases in clinical complaints in patients Authors’ conclusion Majority of patients reported amoderate improvement in pain symptoms 50% ≥ Significant improvement in WOMAC score and residual US size of lesions Results Moderate improvement in symptoms: (patellar tendinopathy patients). Improvement in VAS: 78% (patellar tendinopathy patients) tario and McMaster Universities Osteoarthritis Index. VAS; VAS; US measures Outcome WOMAC; functional ay; hr: hour; VISA-P: Victorian Institute of Sports Assessment- satisfaction ian Institute of Sports Assessment-Achilles questionnaire; US: Likert scale; pain; overall : magnetic resonance imaging; ca.: approximately; ET: end of therapy; 6mo ± 6wk; 32 mo 15 Follow-up Not described Concurrent treatment A rehabilitation program (did not standardize the specific protocol) Table 2: Continued. Various treatments without any success Previous therapy Various treatments without any success 6mo 6mo Subject characteristic (age; symptoms’ duration) 48 (19–73) yr; ≥ ≥ 408/41 180/27; subjects Number of 100 M/80 F group; sex) (total/study cross- survey survey sectional Study type Retrospective Retrospective; Intervention treatment (per group) Survey on satisfaction and functional outcome; PRP injections with USG were administered for tendinopathy refractory to conventional treatments Survey on satisfaction and functional outcome; a single intratendinous injection of PRP under US guidance ] ` ere 17 ] 37 et al. (2014) [ Study (yr) Mautner et al. (2013) [ Dallaudi Patellarquestionnaire;Tegner:Tegneractivityscale;Lysholm:Lysholmkneescoringscale;VAS:VisualAnalogueScale;SF-12:shortform-12;MRI EQ-VAS: EuroQol-Visual Analogue Scale; SF-36 questionnaires:ultrasound; short 1RM: form-36 1 questionnaires repetition (health maximum; reps.: survey repetitions; score); ESWT: FU: Extracorporeal Shock follow-up; Wave VISA-A: Therapy; Victor NS: ten-point numeric scale; WOMAC: Western On G: group; USG: ultrasound-guided; MP: multiple penetration; RCT: randomized controlled trial; M: male; F: female; yr: year; mo: month; wk: week; d: d BioMed Research International 9 in VISA-P score at 12 weeks. However, at 26-week follow- in patients with chronic refractory patellar tendinopathy up, the difference between the PRP and dry needling groups and a further improvement was noted at six months, after dissipated in all assessed scores, such as VISA-P,Tegner, VAS, physiotherapy was added [22]. The result showed significantly and short form-12 (SF-12) scores. In other words, at 26-week better improvement in sports activity level in the PRP group follow-up, the dry needling group had also made clinically than in the control group. In other words, patients with and statistically significant improvements on VISA-P,Tegner, a long history (much longer with respect to that of the Lysholm, and VAS scores [26]. A previous result also showed control group) of chronic refractory jumper’s knee, who that dry needling and injection of autologous blood for patel- had previous failed nonsurgical or even surgical treatments, lar tendinopathy show promise as an alternative treatment for were able, through a combination of multiple PRP injections this chronic condition [25]. Although dry needling does not and physiotherapy, to achieve the same results obtainable introduce additional volume into the tendon, it can stimulate in less severe cases. As patients were subjected to PRP a healing response within the tendon by initiating bleeding and physiotherapy simultaneously, the fact that the relative [26]. Therefore, additional studies could compare the effect of importance and the real contributions of two therapies to the PRP injection versus dry needling, to better understand the therapeutic outcome were indistinguishable represents the importance of injection composition or injection in itself. A limitation of this study. The small number of patients treated limitation of this study is that anatomic tendon changes using and the lack of randomization (not usable in this case due to ultrasoundorMRIwerenotmeasured. the predetermined different selection criteria) are also weak points of this study. 3.4. Non-RCT by Volpi et al. Volpi et al. [21]provided preliminary proof about the efficacy of PRP injections for 3.7. Non-RCT by Gosens et al. Gosens et al. [27]aimedto the treatment of chronic patellar tendinopathy. The VISA-P evaluate the outcome of patients with patellar tendinopathy and MRI were used to evaluate the clinical outcomes of eight treated with PRP injections, and they examined whether high-level athletes. The results represented a 91% average certain characteristics, such as activity level or previous improvement in VISA-P score, and MRI images at the final treatment, affected the results. Clinical evaluations were follow-up demonstrated a noticeable reduction in irregularity made by VISA-P and VAS, assessing pain in activities of daily of the affected tendon compared with preinjection images for life (ADL), during work and sports, before and after treat- 80% of the treated tendons. ment with PRP. After PRP treatment, patients with patellar tendinopathy showed a statistically significant improvement 3.5. Non-RCT by Kon et al. Kon et al. [4] aimed to explore [27]. There was a significant difference between those that PRP application to treating chronic patellar tendinopathy, had chronic tendinopathy without previous failing therapies by gathering and assessing the number, timing, severity, and those with chronic tendinopathy of the same duration duration, and resolution of related adverse events occurring but with previous failing treatments. Although all patients of among study participants before and after treatment. They two groups significantly improved on the VAS scales, patients also evaluated the results, to determine the feasibility, safety, with previous failing treatments showed a smaller healing and potential of this application. Tegner, EuroQol-visual ana- potential on VISA-P than patients without previous failing logue scale (EQ-VAS), and short form-36 (SF-36) question- therapies. The main limitation of this study is also the fact naireswereusedtoassesstheclinicaloutcome.Astatistically that it is a nonrandomized and noncontrolled study [27]. significant improvement in all scores was observed up to six months after the treatment4 [ ]. Follow-up revealed that 3.8. Non-RCT by Ferrero et al. Ferrero et al. [28]aimedto the postprocedure protocol markedly influenced the results: evaluate the effectiveness of ultrasound-guided autologous participants who did not follow the rehabilitation programme PRP injections in patellar and Achilles tendinopathy. Clin- achieved poorer results [4]. The results suggest that this ical (using VISA score) and ultrasound evaluation of 28 PRP application may be safely used for the treatment of patellar tendons (4 bilateral) in 24 patients who underwent chronic patellar tendinopathy, by aiding the regeneration of ultrasound-guided PRP injection were performed after 20 tissue that otherwise has low healing potential [4]. However, days and 6 months after the injection. In this study, the this study lacked a control group and had a low number 6-month follow-up showed that ultrasound-guided PRP of patients treated. Furthermore, direct data (such as a injection improved symptoms and tendon structure [28]. The histopathological examination) confirming the regeneration significantly improved VISA scores at the 6-month follow- of damaged patellar tendon was not shown. up were consistent with results previously obtained by other reports [4, 28]. Moreover, the fact that tendon thickness and 3.6. Non-RCT by Filardo et al. Filardo et al. [22]usedanon- hypoechoic areas were reduced may be a sign of tendon RCT to evaluate the efficacy of multiple PRP injections on regeneration, as collagen fibers were more closely packed the healing of chronic refractory patellar tendinopathy after like in normal tendons. Finally, the increased power Doppler previous classical treatments had failed. The preparation and signal, both at the 20-day and 6-month follow-up, is a sign injection of platelet concentrate and postinjection phase used of an induced vascular response needed to improve tendon in this study were similar to the therapeutic procedures used regeneration [28]. The authors concluded that PRP injection by Kon et al. [4]. Outcome measures included Tegner, EQ- in patellar and Achilles tendinopathy results in a significant VAS, and pain level. A statistically significant improvement and lasting improvement of clinical symptoms and leads to in all scores was observed at the end of the PRP injections recovery of the tendon matrix potentially helping to prevent 10 BioMed Research International degenerative lesions [28]. The main limitation of this study is Lysholm scores of 28 patients improved from 39 to 94, 7 the lack of a control group. to 0.8, and 60 to 96, respectively [32]. Twenty-one of 28 patients recovered to their presymptom sporting level at three 3.9. Non-RCT by Filardo et al. To evaluate the therapeutic months after the PRP injection. MRI scan exhibited complete effects of multiple PRP injections on the healing of chronic recovery of 16 patients to normal structural integrity of the refractory patellar tendinopathy, Filardo et al. [29]assessed tendon and significant improved structural integrity of the the quality and duration of the clinical improvement up to a tendon in all other patients. The major limitations of this midterm(amean48months)follow-upinacohortgroup. study are the absence of a control group and the variation They also evaluated the changes in neovascularization level in the cellular content of PRP in terms of GFs, platelet induced by PRP injections and its correlation with the clinical concentrations, and platelet activation. The ideal protocol of findings. They treated 43 patients with multiple injections of PRP preparation has yet to be determined. PRPandevaluatedthepatientsbyBlanzina,VISA-P,EQ-VAS for general health, and Tegner scores. The results documented 3.12. Case Study by Brown and Sivan. Three case studies were were good and stable with the VISA-P score. The same trend performed. Brown and Sivan [33] treated a 36-year-old active was confirmed by other scores used. To a midterm follow- cricketer presenting with a 9-month history of right knee up, PRP injections provided a good clinical outcome. This pain. He had to discontinue cricket because of the severity of report is the only study examining PRP effect at midterm his pain. The patient’s symptoms did not improve despite a9- follow-up. The ultrasound measurements showed that tendon month trial of conservative treatment. By using a single point thickness and neovascularization level gradually decrease of entry, 3 mL of PRP was injected under ultrasound guidance over time, despite an initial increase after the injection cycle into multiple regions of the tendinopathic proximal patellar [29]. No correlation ultrasonographic and clinical finding tendon.TheoutcomefromthePRPinjectionwassuperiorto could be found. Therefore, the authors emphasize that there is the conventional physical therapy program, and the benefit a need to evaluate it carefully when managing a tendinopathic has been maintained, even eight months after the procedure. condition and to rely mainly on the clinical condition until new studies will provide more insights into the significance of 3.13. Case Study by Rowan and Drouin. A 23-year-old female imaging findings29 [ ]. The study has some limitations, such athlete was managed for bilateral patellar tendinopathy with as the imaging evaluation performed only in some of the a combination of traditional therapeutic interventions as well patients at different follow-ups and the lack of a randomized as a PRP injection. This athlete returned to preinjury level control group. of competition six months after injection [34]. This case report was of a high-level athlete treated more aggressively 3.10. Prospective Case Series by van Ark et al. Aphysical to allow for an earlier return to competition and may not therapy program performs an important role after PRP be the ideal course of treatment for the general population. injection treatment in patellar tendinopathy patients, because This report emphasizes the possible benefits of adding PRP a mechanical loading is needed after this injection30 [ ]. van injections as a complementary therapy along with manual Ark et al. [31] (prospective case-series study) reported the first therapy, pain-relieving modalities, shock wave therapy, and results of a combination treatment of PRP injection followed eccentric exercises. Considering the limited value of a single by a well-described physical therapy program. Five of the six case report with the absence of a control group, further tendons show an improvement of at least 30 points on the research is warranted to more conclusively determine the best VISA-P after 26 weeks and four of the five patients indicated course of therapy for patellar tendinopathy [34]. that they would positively recommend this treatment to family or friends with the same injury. In accordance with 3.14. Case Study by Scollon-Grieve and Malanga. An 18- apilotstudyonPRPbyKonetal.[4], the only patient year-old male competitive high school lacrosse player was who did not show improvement after treatment was the managed for patellar tendinopathy with a PRP injection. Two one with the lowest self-reported program compliance. This months after receiving the PRP injection, he returned to full study proposed a combination treatment of an injection activity and competitive collegiate lacrosse participation [35]. with PRP followed by a physical therapy program, because The author emphasizes that the PRP injection is a safe and a previous eccentric exercise physical therapy program and promising alternative for patients with patellar tendinopathy. other treatments alone did not result in positive effects [31]. This report also has the limited value of a single case report Limitationsofthisstudyarethesmallnumberofparticipants, with the absence of a control group. the lack of a control group, and the heterogeneity of the participants. It is important to state that due to several 3.15. Retrospective Study by Mautner et al. There are two ret- limitations of this case series, no well-grounded statements rospective reports investigating outcomes of patients treated canbemadeontheeffectivenessofthetreatment. with ultrasound-guided PRP injections at multiple academic institutions for chronic tendinopathies, including patellar 3.11. Prospective Case Series by Charousset et al. Charousset tendinopathy. Mautner et al. [17] (a multicenter, retrospective et al. [32] reported the prospective case results of 28 patients review; Table 2) aimed to determine whether ultrasound- with patellar tendinopathy treated by PRP injection. At the 2- guided PRP injections are an effective treatment for chronic year follow-up, the average preprocedure VISA-P, VAS, and tendinopathies. The primary outcome measurement was the BioMed Research International 11 perceived improvement in symptoms at least six months after and accelerates the patellar tendon healing process through the PRP injection(s). This perception was quantified using activation of numerous GFs [1, 38, 39], especially by over- a Likert scale: “not at all,” “slightly,” “moderately,” “mostly,” expression of IGF-1 [40]. Based on animal model studies, and “completely.” Secondary outcome measurements were there are 15 clinical reports to treat patellar tendinopathy. the following: perceived change in VAS before and after the These clinical studies include two RCT studies, six non-RCT procedure, functional pain after the procedure using the studies, two prospective case-series study, three case studies, NirschlPainPhaseScaleforoveruseinjuries,andoverall and two retrospective studies. All reports suggest that PRP satisfaction with the PRP procedure (quantified with the injection is an effective treatment for patellar tendinopathy. following Likert scale) [36]. No significant difference was Clinical evaluations have been carried out using various eval- found between the patients who answered the survey at one uation tools, including VISA-P,VISA-A, VAS,EQ-VAS, SF-36 year or less after the PRP procedure and those who answered questionnaires, Tegner, pain level, NS, (modified) Blanzina, more than one year after the procedure, thus refuting the Likert scale, functional pain, overall satisfaction, ultrasound argument that the observed improvements were simply due examination, and MRI images. A statistically meaningfully to spontaneous resolution of symptoms. The authors studied improvement in most evaluation scores was observed after the response of multiple tendons treated throughout the PRP treatment. It is noteworthy that PRP treatment is not body and determined overall improvement in symptoms. only effective in short-term follow-up (at 6 months), but good Asaresultofthistrial,inpatellartendongroup,78% and stable results were also obtained in longer follow-up, such of patients reported more than 50% improvement in VAS as 12 months or 4 years. Therefore, the clinical injection of andmorethanhalfoftheirpatientsreportedatleasta PRP seems to be more preferable to a long-term treatment, moderate improvement in symptoms. Therefore, the authors due to its long-term persistence. concluded that the majority of patients reported a moderate In spite of these recent clinical reports about the effect improvement in pain symptoms among patients with patellar of PRP for the treatment of patellar tendinopathy, many tendinopathy, as with patients with pain in other tendons. limitationsofPRPstudiesmakeithardtodrawclear The limitation of this study is that the response rate in the conclusions concerning the effectiveness of PRP treatment survey was 55%. In addition, some patients did not follow up from these results. First of all, most studies did not use a long term with their physician and thus may have benefited control group with the same population characteristics as from additional treatments. This study also required that a the treatment group. The small number of patients treated rehabilitation program be completed but did not standardize and the lack of a randomized control group should be also the specific protocol. improved. Case studies for a long-term period (more than two years) can assist the verification process of PRP effect on 3.16. Retrospective Study by Dallaudiere` et al. Asecond patellar tendinopathy. Despite the therapeutic applications of retrospective report was recently reported [37]. Dallaudiere` PRP in patellar tendinopathy as well as in many other injured et al. also aimed to assess the efficacy and tolerance of sites (such as Achilles, rotator cuff, and forearm extensor intratendinous injection of PRP to treat tendinopathy in a tendons), little information is available for the mechanism of large group of patients. This study included 408 patients its action. Understanding the exact working mechanism of (250 patients with tendinopathy in the upper limb and 158 PRP can enhance the efficacy of this clinical treatment. Lastly, patients with tendinopathy in the lower limb). Among 408 the effects of rehabilitation protocols after PRP treatment patients, 41 patients had patellar tendinopathy. Independent must also be established. Animal model studies showed that of age, gender, and type of tendinopathy, Western Ontario mechanical stimulation should initiate as soon as possible and McMaster Universities Osteoarthritis Index (WOMAC) after PRP injection because PRP influences especially the scores and residual US size of lesions were significantly early phases of regeneration [30, 41]. A recent study proposed improved at 6-week follow-up after the ultrasound-guided a simple and efficient 6-week rehabilitation program based on injection of PRP. The average WOMAC scores of 41 patients submaximal eccentric reeducation to add to PRP infiltrations with patellar tendinopathy improved from 38 to 16 at the 6- in case of patellar tendinopathy [42]. week follow-up and more improved (6 scores) at 32-month PRP has an autologous nature and no critical complica- follow-up. No clinical complication was reported during tionsorsideeffectshavebeenreported,suggestingthatthis follow-up [37]. This study demonstrates that the ultrasound- treatment could be considered safe. Nevertheless, up to now, guided injection of PRP allows rapid healing of tendon with the standard application protocol and the definition of PRP good tolerance. The limitations of this study are a lack of have not been established clearly. In the clinical application histologic assessment and the absence of a control group. using PRP, significant differences in platelet concentration or Additionally, the authors did not describe whether or not a the overall cell types contained in PRP could be happened rehabilitation program after the PRP injection is performed. [43]. These variations are strictly linked to the procedures employed [43]. There are two main preparation methods used 4. Discussions in clinical practice: the use of a laboratory centrifuge or a density gradient cell separator. In the use of a laboratory cen- PRP has the potential to recruit numerous GFs necessary trifuge, various parameters, such as speed, timing, number for wound healing. Due to its ability to regulate fibrosis and of centrifugation, and technician-dependent reproducibility, angiogenesis, it can be applied on tendon injury. Several could affect contents of the final PRP product. A density animal studies showed that the application of PRP enhances gradient cell separator is a closed-circuit device that allows 12 BioMed Research International

PRP preparation without excessive manipulation of the blood neoneurovascularization. It is hard to compare high-volume [44].However,becausealargenumberofthesedeviceswith injection with PRP injection and conclude definitely which its own features were available, it is impossible to obtain the therapeutic option shows better outcome, because of the same PRP product in all clinical trials. In some cases, the differences between the participants’ characteristics. Nev- PRP products could contain leukocytes and residual blood ertheless, when follow-up periods and the overall VISA-P cells, besides platelets and plasmas [43, 44]. As leukocytes improvement between high-volume injection therapy and can release matrix metalloproteases and reactive oxygen PRP injection therapy were compared, PRP showed better species capable of damaging articular tissues, some people improvement. One possible hypothesis is that the steroid insisted that leukocytes can induce inflammatory effect in having poor clinical outcomes on patellar tendinopathy is the tendon [44]. Really, a recent animal model study showed commonly used in the high-volume injection therapy, to that leukocyte-rich PRP causes a significantly greater acute prevent inflammatory reactions induced by injection of large inflammatory response than leukocyte-poor PRP at 5 days quantities of foreign materials. after injection [45], indicating that the difference of PRP Unlike the steroid, ESWT, or the high-volume injection, preparation can affect the host’s cellular response. Therefore, autologous blood injection was significantly effective on more detailed protocols for PRP treatment, such as standard patellar tendinopathy [25]. However, as autologous blood preparation method, injection dosage, and injection method, injection and dry needling are combined with physiotherapy will increase the quality of PRP research. as part of their treatment protocol, the effect of the autologous Even though several conservative treatments, such as blood injection alone cannot be estimated. To the best of eccentric training and ESWT, have been proposed for our knowledge, no studies have compared the injections with tendinopathy, very few of them are supported by randomized autologous GFs or with PRP. The rationale for autologous controlled trials [46]. Moreover, no single treatment has blood injection closely resembles the previously described been proven to result in a consistent, near-complete recovery rationale for PRP. Autologous preparations that are rich in all patients [20, 47–49]. The therapeutic exercise shows in GFs induce cell proliferation and promote synthesis of improvement of clinical symptoms when used alone, but angiogenic factors during the healing process [20]. Some it shows greater improvement when combined with PRP believe, however, that GFs work in a dose-dependent manner, injection [31]. ESWT is useful in patellar tendinopathy only and hence a more concentrated source of GFs, such as for improving subjective symptoms, but does not show an that provided by PRP, is needed for the technique to be actual clinical improvement in objective parameters [50, 51]. beneficial [12, 62]. In a recent study at competition horses Vetrano et al. [23] compared two PRP injections versus with overuse musculoskeletal injuries (suspensory ligament three sessions of ESWT, through an RCT study. Therapeutic desmopathy and superficial flexor tendinopathy), signifi- injections of PRP lead to better midterm clinical results cantly faster recovery was observed in cases of PRP with compared with focused ESWT in the treatment of jumper’s high concentrations of platelets [63], supporting the belief knee in athletes. that GFs work in a dose-dependent manner. Recently, Dragoo All injection therapies (steroid, aprotinin, high-volume, et al. showed that the dry needling had also made clini- autologous blood injection, and cell therapy) can relieve cally and statistically significant improvements of patellar symptoms of patients [20]. Aprotinin injection has a lasting tendinopathy on VISA, Tegner, Lysholm, and VAS scores beneficial effect for patellar tendinopathy patients52 [ , 53], [26]. Although dry needling does not introduce additional but, in very few cases, side effects of allergy were reported volume into the tendon, it can stimulate a healing response in the tendon trials [54, 55]. The role of steroids in the man- within the tendon by initiating bleeding [26]. Therefore, agement of tendinopathy is also controversial [20]. Although additional studies could compare the effect of PRP injection a steroid injection positively affected the short-term follow- versus dry needling or the autologous blood injection, to up of tendinopathy, it failed in long-term follow-up improve- better understand the importance of injection composition ment [56]. And the side effect of steroid injection, such as and injection volume. tendon rupture, has been reported [57–59]. Compared with Bone marrow mononuclear cells (BM-MNCs) are steroids and ESWT, PRP injection therapy is shown to be pluripotential cells and are believed to play an important more effective in long-term follow-up [60]. Crisp et al. [61] role in connective tissue repair such as tendon, ligament, evaluated a novel conservative management modality for bone, and cartilage [64]. Unlike other injection therapies patellar tendinopathy. They hypothesized that disruption of introduced above, two clinical trials using cell therapy neovascularization could be achieved by mechanical means, in patients with chronic patellar tendinopathy showed namely, by injecting large volumes of fluid (high-volume significant improvements in Tegner score (Pascual-Garrido injection) at the interface between the posterior aspect of the et al. [64]) and VISA-P (Clarke et at. [65]). Although those paratenon of the patellar tendon and the area from where the studies are conducted individually and controls of procedures neovessels penetrate the tendinopathic lesion, the so-called are different, according to the results, the cell therapy could Hoffa’s body. They found that the injection of a large volume be considered as a potential therapy for those with refractory of mixtures combined with bupivacaine, hydrocortisone, and chronic patellar tendinopathy. So far, as the number of studies normal saline triggered significant improvements in VAS is low and only few high-quality studies for the treatment and VISA-P scores, suggesting that the injected volumes, of jumper’s knee for human are available, it is hard to draw regardless of the injected contents, can affect improvement firm conclusions on the effectiveness of the cell therapy and of patellar tendinopathy through mechanical disruption of compare it with PRP. Moreover, the exact role of implanted BioMed Research International 13 stem cells on tendon healing remains uncertain [64]. It is not [3]K.S.Midwood,L.V.Williams,andJ.E.Schwarzbauer,“Tissue clear at what time point inoculation should be considered, repair and the dynamics of the extracellular matrix,” The the number of applications needed, and whether to combine International Journal of Biochemistry and Cell Biology,vol.36, it with PRP or not. PRP treatment, in the form of PRP-clot no. 6, pp. 1031–1037, 2004. releasate (PRCR), promotes differentiation of tendon stem [4]E.Kon,G.Filardo,M.Delcoglianoetal.,“Platelet-richplasma: cell (TSC) into active tenocytes exhibiting high proliferation new clinical application: a pilot study for treatment of jumper's rates and collagen production capability [13]. PRP has also knee,” Injury, vol. 40, no. 6, pp. 598–603, 2009. been successfully used as a cell culture additive to facilitate [5]R.Castricini,U.G.Longo,M.DeBenedettoetal.,“Platelet- growth and differentiation of autologous mesenchymal stem rich plasma augmentation for arthroscopic rotator cuff repair: cells (MSCs) [66–70]. So, PRP in combination with cell a randomized controlled trial,” The American Journal of Sports therapy could be promising in the patellar tendinopathy. Medicine,vol.39,no.2,pp.258–265,2011. However, further critical review and rigorous clinical studies [6]R.J.deVos,A.Weir,H.T.M.vanSchieetal.,“Platelet- are required to determine the real effectiveness of this rich plasma injection for chronic Achilles tendinopathy: a randomized controlled trial,” The Journal of the American combination therapy in the management of chronic patellar Medical Association,vol.303,no.2,pp.144–149,2010. tendinopathy. [7]N.T.BennettandG.S.Schultz,“Growthfactorsandwound In conclusion, injection therapy of PRP is effective for healing: biochemical properties of growth factors and their thetreatmentofpatellartendinopathyandhasthepromising receptors,” The American Journal of Surgery,vol.165,no.6,pp. potential to restore patients to their activities of daily living, 728–737, 1993. work, and sports. However, through the present research, [8] D. A. Lakkaraju, “Platelet-rich plasma: a review of actions and it is hard to draw a clear conclusion for the effectiveness applications in sports injuries,” SportEX Medicine,vol.56,pp. of PRP treatment on patellar tendinopathy. More precise 10–17, 2013. clinical researches are required and the standard application [9] L. E. Geaney, R. A. Arciero, T. M. Deberardino, and A. D. protocols, including standard preparation method, injection Mazzocca, “The effects of platelet-rich plasma on tendon and dosage, and injection method, must also be established. ligament: basic science and clinical application,” Operative In addition, PRP treatment in combination with the cell Techniques in Sports Medicine,vol.19,no.3,pp.160–164,2011. therapy could more efficiently cure patients with the patellar [10] A. Mishra, J. Woodall Jr., and A. Vieira, “Treatment of ten- tendinopathy. Thus, more high-quality clinical studies on don and muscle using platelet-rich plasma,” Clinics in Sports combination therapy are certainly required. Medicine,vol.28,no.1,pp.113–125,2009. [11] P. Sharma and N. Maffulli, “Tendon injury and tendinopathy: Conflict of Interests healing and repair,” Journal of Bone and Joint Surgery A,vol.87, no. 1, pp. 187–202, 2005. The authors have no conflict of interests. [12]T.Molloy,Y.Wang,andG.A.C.Murrell,“Therolesofgrowth factors in tendon and ligament healing,” Sports Medicine,vol. 33,no.5,pp.381–394,2003. Authors’ Contribution [13]J.ZhangandJ.H.Wang,“Platelet-richplasmareleasatepro- Da Un Jeong and Chang-Ro Lee contributed equally to this motes differentiation of tendon stem cells into active tenocytes,” The American Journal of Sports Medicine,vol.38,no.12,pp. work. 2477–2486, 2010. [14] D. Moher, A. Liberati, J. Tetzlaff, and D. G. Altman, “Preferred Acknowledgments reporting items for systematic reviews and meta-analyses: the PRISMA statement,” PLoS Medicine,vol.6,no.7,ArticleID This work was supported by the National Research Lab e1000097, 2009. Program through the National Research Foundation of Korea [15] A. Mishra and T. Pavelko, “Treatment of chronic elbow tendi- (NRF) funded by the Ministry of Science, ICT & Future Plan- nosis with buffered platelet-rich plasma,” The American Journal ning (no. 2011-0027928); the Marine and Extreme Genome of Sports Medicine, vol. 34, no. 11, pp. 1774–1778, 2006. Research Center Program funded by Ministry of Oceans [16] M. Sanchez,´ E. Anitua, J. Azofra, I. And´ıa,S.Padilla,andI. and Fisheries, Republic of Korea; and the Next Generation Mujika, “Comparison of surgically repaired Achilles tendon BioGreen 21 Program (no. PJ009082) of Rural Development tears using platelet-rich fibrin matrices,” The American Journal Administration in Republic of Korea. of Sports Medicine,vol.35,no.2,pp.245–251,2007. [17] K. Mautner, R. E. Colberg, G. Malanga et al., “Outcomes after References ultrasound-guided platelet-rich plasma injections for chronic tendinopathy: a multicenter, retrospective review,” PM & R : The [1] K. K. Middleton, V. Barro, B. Muller, S. Terada, and F. H. Fu, Journal of Injury, Function, and Rehabilitation,vol.5,no.3,pp. “Evaluation of the effects of platelet-rich plasma (PRP) therapy 169–175, 2013. involved in the healing of sports-related soft tissue injuries.,” The [18] N. Maffulli, K. M. Khan, and G. Puddu, “Overuse tendon con- Iowa Orthopaedic Journal,vol.32,pp.150–163,2012. ditions: time to change a confusing terminology,” Arthroscopy, [2] R. T. Nguyen, J. Borg-Stein, and K. McInnis, “Applications of vol. 14, no. 8, pp. 840–843, 1998. platelet-rich plasma in musculoskeletal and sports medicine: an [19] U. G. Longo, F. Franceschi, L. Ruzzini et al., “Histopathology of evidence-based approach,” PM & R,vol.3,no.3,pp.226–250, the supraspinatus tendon in rotator cuff tears,” The American 2011. Journal of Sports Medicine,vol.36,no.3,pp.533–538,2008. 14 BioMed Research International

[20] M. van Ark, J. Zwerver, and I. van den Akker-Scheek, “Injection with patellar tendinopathy—a case report,” The Journal of the treatments for patellar tendinopathy,” British Journal of Sports Canadian Chiropractic Association,vol.57,no.4,pp.301–309, Medicine, vol. 45, no. 13, pp. 1068–1076, 2011. 2013. [21] P. Volpi, L. Marinoni, C. Bait, L. de Girolamo, and H. Schoen- [35] K. L. Scollon-Grieve and G. A. Malanga, “Platelet-rich plasma huber, “Treatment of chronic patellar tendinosis with buffered injection for partial patellar tendon tear in a high school athlete: platelet rich plasma: a preliminary study,” Medicina dello Sport, a case presentation,” PM & R,vol.3,no.4,pp.391–395,2011. vol.60,no.4,pp.595–603,2007. [36]C.O.Ollivierre,R.P.Nirschl,andF.A.Pettrone,“Resection [22] G. Filardo, E. Kon, S. Della Villa, F. Vincentelli, P. M. Fornasari, and repair for medial tennis elbow. A prospective analysis,” The and M. Marcacci, “Use of platelet-rich plasma for the treatment American Journal of Sports Medicine,vol.23,no.2,pp.214–221, of refractory jumper's knee,” International Orthopaedics,vol.34, 1995. no. 6, pp. 909–915, 2010. [37] B. Dallaudiere,` L. Pesquer, P. Meyer et al., “Intratendinous [23] M. Vetrano, A. Castorina, M. C. Vulpiani, R. Baldini, A. injection of platelet-rich plasma under US guidance to treat Pavan, and A. Ferretti, “Platelet-rich plasma versus focused tendinopathy: a long-term pilot study,” Journal of Vascular and shock waves in the treatment of jumper’s knee in athletes,” The Interventional Radiology,vol.25,no.5,pp.717–723,2014. American Journal of Sports Medicine,vol.41,no.4,pp.795–803, [38] D. Lyras, K. Kazakos, D. Verettas et al., “Immunohistochemical 2013. study of angiogenesis after local administration of platelet-rich [24]M.P.Cotchett,K.B.Landorf,S.E.Munteanu,andA.M. plasma in a patellar tendon defect,” International Orthopaedics, Raspovic, “Consensus for dry needling for plantar heel pain vol.34,no.1,pp.143–148,2010. (plantar fasciitis): a modified Delphi study,” Acupuncture in [39] D. N. Lyras, K. Kazakos, D. Verettas et al., “The effect of platelet- Medicine,vol.29,no.3,pp.193–202,2011. rich plasma gel in the early phase of patellar tendon healing,” [25] S. L. J. James, K. Ali, C. Pocock et al., “Ultrasound guided dry Archives of Orthopaedic and Trauma Surgery,vol.129,no.11,pp. needling and autologous blood injection for patellar tendinosis,” 1577–1582, 2009. British Journal of Sports Medicine,vol.41,no.8,pp.518–521, [40] D. N. Lyras, K. Kazakos, G. Agrogiannis et al., “Experimen- 2007. tal study of tendon healing early phase: Is IGF-1 expression [26] J. L. Dragoo, A. S. Wasterlain, H. J. Braun, and K. T. Nead, influenced by platelet rich plasma gel?” Orthopaedics and “Platelet-rich plasma as a treatment for patellar tendinopathy: Traumatology: Surgery and Research,vol.96,no.4,pp.381–387, a double-blind, randomized controlled trial,” The American 2010. Journal of Sports Medicine,vol.42,no.3,pp.610–618,2014. [41]J.F.Kaux,P.V.Drion,A.Coligeetal.,“Effectsofplatelet-rich [27] T. Gosens, B. L. den Oudsten, E. Fievez, P. van’T Spijker, and plasma (PRP) on the healing of Achilles tendons of rats,” Wound A. Fievez, “Pain and activity levels before and after platelet-rich Repair and Regeneration,vol.20,no.5,pp.748–756,2012. plasma injection treatment of patellar tendinopathy: a prospec- [42] J. F. Kaux, B. Forthomme, M. H. Namurois et al., “Descrip- tive cohort study and the influence of previous treatments,” tion of a standardized rehabilitation program based on sub- International Orthopaedics,vol.36,no.9,pp.1941–1946,2012. maximal eccentric following a platelet-rich plasma infiltration [28] G. Ferrero, E. Fabbro, D. Orlandi et al., “Ultrasound-guided for jumper’s knee,” Muscles, Ligaments and Tendons Journal,vol. injection of platelet-rich plasma in chronic Achilles and patellar 4,no.1,pp.85–89,2014. tendinopathy,” Journal of Ultrasound,vol.15,no.4,pp.260–266, [43] M. Tschon, M. Fini, R. Giardino et al., “Lights and shadows 2012. concerning platelet products for musculoskeletal regeneration,” [29] G. Filardo, E. Kon, B. di Matteo, P. Pelotti, A. di Martino, and Frontiers in Bioscience,vol.3,no.1,pp.96–107,2011. M. Marcacci, “Platelet-rich plasma for the treatment of patellar [44] E. Kon, G. Filardo, B. Di Matteo, and M. Marcacci, “PRP for tendinopathy: clinical and imaging findings at medium-term the treatment of cartilage pathology,” The Open Orthopaedics follow-up,” International Orthopaedics,vol.37,no.8,pp.1583– Journal,vol.7,pp.120–128,2013. 1589, 2013. [45] J. L. Dragoo, H. J. Braun, J. L. Durham et al., “Comparison of [30] O. Virchenko and P.Aspenberg, “How can one platelet injection the acute inflammatory response of two commercial platelet- after tendon injury lead to a stronger tendon after 4 weeks? rich plasma systems in healthy rabbit tendons,” The American Interplay between early regeneration and mechanical stimula- Journal of Sports Medicine,vol.40,no.6,pp.1274–1281,2012. tion,” Acta Orthopaedica,vol.77,no.5,pp.806–812,2006. [46] M. Loppini and N. Maffulli, “Conservative management of [31] M. van Ark, I. van den Akker-Scheek, L. T. B. Meijer, and tendinopathy: an evidence-based approach,” Muscles, Ligaments J. Zwerver, “An exercise-based physical therapy program for and Tendons Journal,vol.1,no.4,pp.134–137,2011. patients with patellar tendinopathy after platelet-rich plasma [47] K. H. E. Peers and R. J. J. Lysens, “Patellar tendinopathy in injection,” Physical Therapy in Sport,vol.14,no.2,pp.124–130, athletes: current diagnostic and therapeutic recommendations,” 2013. Sports Medicine,vol.35,no.1,pp.71–87,2005. [32] C. Charousset, A. Zaoui, L. Bellaiche, and B. Bouyer, “Are [48] B. M. Andres and G. A. C. Murrell, “Treatment of tendinopathy: multiple platelet-rich plasma injections useful for treatment of what works, what does not, and what is on the horizon,” Clinical chronic patellar tendinopathy in athletes? a prospective study,” Orthopaedics and Related Research,vol.466,no.7,pp.1539– The American Journal of Sports Medicine,vol.42,no.4,pp.906– 1554, 2008. 911, 2014. [49] J. D. Rees, N. Maffulli, and J. Cook, “Management of tendinopa- [33] J. Brown and M. Sivan, “Ultrasound-guided platelet-rich plasma thy,” The American Journal of Sports Medicine,vol.37,no.9,pp. injection for chronic patellar tendinopathy:a case report,” PM 1855–1867, 2009. and R,vol.2,no.10,pp.969–972,2010. [50] E. C. Rodriguez-Merchan, “The treatment of patellar [34] T. L. Rowan and J. L. Drouin, “A multidisciplinary approach tendinopathy,” Journal of Orthopaedics and Traumatology, including the use of platelet-rich plasma to treat an elite athlete vol.14,no.2,pp.77–81,2013. BioMed Research International 15

[51] J. Zwerver, E. Verhagen, F. Hartgens, I. van den Akker-Scheek, [66] M. E. Bernardo, M. A. Avanzini, C. Perotti et al., “Optimization and R. L. Diercks, “The TOPGAME-study: effectiveness of of in vitro expansion of human multipotent mesenchymal extracorporeal shockwave therapy in jumping athletes with stromal cells for cell-therapy approaches: further insights in patellar tendinopathy. Design of a randomised controlled trial,” the search for a fatal calf serum substitute,” Journal of Cellular BMC Musculoskeletal Disorders, vol. 11, article 28, 2010. Physiology, vol. 211, no. 1, pp. 121–130, 2007. [52] G. Capasso, V. Testa, N. Maffulli, and G. Bifulco, “Aprotinin, [67] C. Doucet, I. Ernou, Y. Zhang et al., “Platelet lysates promote corticosteroids and normosaline in the management of patellar mesenchymal stem cell expansion: a safety substitute for animal tendinopathy in athletes: a prospective randomized study,” serum in cell-based therapy applications,” Journal of Cellular Sports Excercise and Injury, vol. 3, no. 3, pp. 111–115, 1997. Physiology,vol.205,no.2,pp.228–236,2005. [53]J.Orchard,A.Massey,R.Brown,A.Cardon-Dunbar,andJ. [68] U. Fredberg, “Local corticosteroid injection in sport: review of Hofmann, “Successful management of tendinopathy with injec- literature and guidelines for treatment,” Scandinavian Journal of tions of the MMP-inhibitor aprotinin,” Clinical Orthopaedics Medicine and Science in Sports,vol.7,no.3,pp.131–139,1997. and Related Research,vol.466,no.7,pp.1625–1632,2008. [69] I. Muller,¨ S. Kordowich, C. Holzwarth et al., “Animalserum-free [54] W. Beierlein, A. M. Scheule, W. Dietrich, and G. Ziemer, “Forty culture conditions for isolation and expansion of multipotent years of clinical aprotinin use: a review of 124 hypersensitivity mesenchymal stromal cells from human BM,” Cytotherapy,vol. reactions,” The Annals of Thoracic Surgery,vol.79,no.2,pp.741– 8,no.5,pp.437–444,2006. 748, 2005. [70] K. Schallmoser, C. Bartmann, E. Rohde et al., “Human platelet [55] N. Maffulli, U. G. Longo, M. Loppini, and V. Denaro, “Current lysate can replace fetal bovine serum for clinical-scale expan- treatment options for tendinopathy,” Expert Opinion on Phar- sion of functional mesenchymal stromal cells,” Transfusion,vol. macotherapy,vol.11,no.13,pp.2177–2186,2010. 47, no. 8, pp. 1436–1446, 2007. [56] M. Kongsgaard, V. Kovanen, P. Aagaard et al., “Corticosteroid [71] W. D. Stanish, R. M. Rubinovich, and S. Curwin, “Eccen- injections, eccentric decline squat training and heavy slow resis- tric exercise in chronic tendinitis,” Clinical Orthopaedics and tance training in patellar tendinopathy,” Scandinavian Journal of Related Research,vol.208,pp.65–68,1986. Medicine & Science in Sports,vol.19,no.6,pp.790–802,2009. [57] B. K. Coombes, L. Bisset, and B. Vicenzino, “Efficacy and safety of corticosteroid injections and other injections for management of tendinopathy: a systematic review of randomised controlled trials,” The Lancet,vol.376,no.9754,pp.1751–1767, 2010. [58] L. T. Ford and J. DeBender, “Tendon rupture after local steroid injection,” Southern Medical Journal,vol.72,no.7,pp.827–830, 1979. [59] M. Kleinman and A. E. Gross, “Achilles tendon rupture following steroid injection: report of three cases,” Journal of Bone and Joint Surgery A,vol.65,no.9,pp.1345–1347,1983. [60] J. C. Peerbooms, J. Sluimer, D. J. Bruijn, and T. Gosens, “Positive effect of an autologous platelet concentrate in lateral epicondylitis in a double-blind randomized controlled trial: platelet-rich plasma versus corticosteroid injection with a 1-year follow-up,” The American Journal of Sports Medicine,vol.38,no. 2, pp. 255–262, 2010. [61] T. Crisp, F. Khan, N. Padhiar et al., “High volume ultrasound guided injections at the interface between the patellar tendon and Hoffa’s body are effective in chronic patellar tendinopathy: a pilot study,” Disability and Rehabilitation,vol.30,no.20-22, pp.1625–1634,2008. [62] R. J. Kampa and D. A. Connell, “Treatment of tendinopathy: is there a role for autologous whole blood and platelet rich plasma injection?” International Journal of Clinical Practice,vol.64,no. 13, pp. 1813–1823, 2010. [63] P. Torricelli, M. Fini, G. Filardo et al., “Regenerative medicine for the treatment of musculoskeletal overuse injuries in competition horses,” International Orthopaedics,vol.35,no.10,pp. 1569–1576, 2011. [64] C. Pascual-Garrido, A. Rolon,´ and A. Makino, “Treatment of chronic patellar tendinopathy with autologous bone marrow stem cells: a 5-year-followup,” Stem Cells International,vol.2012, Article ID 953510, 5 pages, 2012. [65]A.W.Clarke,F.Alyas,T.Morris,C.J.Robertson,J.Bell, and D. A. Connell, “Skin-derived tenocyte-like cells for the treatment of patellar tendinopathy,” The American Journal of Sports Medicine,vol.39,no.3,pp.614–623,2011. Hindawi Publishing Corporation BioMed Research International Volume 2014, Article ID 692913, 10 pages http://dx.doi.org/10.1155/2014/692913

Research Article Does Platelet-Rich Plasma Freeze-Thawing Influence Growth Factor Release and Their Effects on Chondrocytes and Synoviocytes?

Alice Roffi,1 Giuseppe Filardo,2 Elisa Assirelli,3 Carola Cavallo,4 Annarita Cenacchi,5 Andrea Facchini,6,7 Brunella Grigolo,3 Elizaveta Kon,2 Erminia Mariani,6,7 Loredana Pratelli,8 Lia Pulsatelli,3 and Maurilio Marcacci2

1 Nano-Biotechnology Laboratory, Rizzoli Orthopaedic Institute, Via di Barbiano 1, 40136 Bologna, Italy 2 II Clinic-Biomechanics Laboratory and Nano-Biotechnology Laboratory, Rizzoli Orthopaedic Institute, Via di Barbiano 1/10, 40136 Bologna, Italy 3 Laboratory of Immunorheumatology and Tissue Regeneration/RAMSES, Rizzoli Orthopaedic Institute, Via di Barbiano 1/10, 40136 Bologna, Italy 4 Laboratory RAMSES, Rizzoli Orthopaedic Institute, Via di Barbiano 1/10, 40136 Bologna, Italy 5 Immunohematology and Transfusion Medicine and Cell and Musculoskeletal Tissue Bank, Rizzoli Orthopaedic Institute, Via di Barbiano 1/10, 40136 Bologna, Italy 6 Laboratory of Immunorheumatology and Tissue Regeneration Rizzoli Orthopaedic Institute, Via di Barbiano 1/10, 40136 Bologna, Italy 7 Department of Medical and Surgical Science, University of Bologna, Via Giuseppe Massarenti 9, 40138 Bologna, Italy 8 Clinical Pathology Unit, Rizzoli Orthopaedic Institute, Via di Barbiano 1/10, 40136 Bologna, Italy

Correspondence should be addressed to Elizaveta Kon; [email protected]

Received 27 February 2014; Accepted 23 June 2014; Published 17 July 2014

Academic Editor: Mikel Sanchez´

Copyright © 2014 Alice Roffi et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PRP cryopreservation remains a controversial point. Our purpose was to investigate the effect of freezing/thawing on PRP molecule release, and its effects on the metabolism of chondrocytes and synoviocytes. PRP was prepared from 10 volunteers, and a half volume underwent one freezing/thawing cycle. IL-1𝛽, HGF, PDGF AB/BB, TGF-𝛽1,andVEGFwereassayed1hourand7days after activation. Culture media of chondrocytes and synoviocytes were supplemented with fresh or frozen PRP, and, at 7days, proliferation, gene expression, and secreted proteins levels were evaluated. Results showed that in the freeze-thawed PRP the immediate and delayed molecule releases were similar or slightly lower than those in fresh PRP. TGF-𝛽1 and PDGF AB/BB concentrations were significantly reduced after freezing both at 1 hour and at 7 days, whereas HGF concentration was significantly lowerinfrozenPRPat7days.InfreshPRPIL-1𝛽 and HGF concentrations underwent a significant further increase after 7 days. Similar gene expression was found in chondrocytes cultured with both PRPs, whereas in synoviocytes HGF gene expression was higher in frozen PRP. PRP cryopreservation is a safe procedure, which sufficiently preserves PRP quality and its ability to induce proliferation and the production of ECM components in chondrocytes and synoviocytes.

1. Introduction for the repair of tissues with low healing potential, with an increasing number of preclinical and clinical studies The use of platelet concentrates is becoming very popular in over time [1–6]. The rationale behind the use of this kind the field of musculoskeletal tissue regeneration. A widespread of treatment is the release, from platelets 𝛼-granules, of interest has been shown for platelet-rich plasma (PRP) as an bioactive molecules such as growth factors (GFs) which play injective treatment or as a surgical augmentation procedure important roles in the regulation of growth and development 2 BioMed Research International of several tissues [7]. These molecules bind to the transmem- within 1 hour after activation and then platelets release brane receptors of their target cells regulating cell signaling additional proteins in one week [16], we tested whether there pathways [1, 7, 8]. Alpha-granules also contain cytokines, was any difference in GFs release after 1 h (immediate release) chemokines, and many other bioactive proteins that stimulate and 7 days for both PRPs. Moreover, we investigated whether chemotaxis, cell proliferation, and maturation, modulate freeze/thawing might affect the biological activity of PRP on inflammatory molecules, and attract leukocytes [8]. chondrocyte and synoviocyte cultures. Preclinical evidence supports the use of intra-articular PRP injections for joint degenerative pathology, by targeting 2. Materials and Methods not only cartilage but also synovial and meniscal tissues and thus promoting a favorable environment for joint tissue The study was approved by the Institutional Review Board healing [1]. However, few high-quality trials have been and the local Ethics Committee, and written informed con- published, which show the clinical usefulness of PRP but sentwassignedbyeachdonor. only with an improvement limited over time and mainly in Ten healthy volunteers (Caucasian male, age range: 27–38 younger patients not affected by advanced degeneration [1, 9– years, BMI: normal values) were enrolled to undergo a blood 11]. Although overall preclinical results are positive, clinical sample collection. Exclusion criteria were systemic disorders, findings are less exciting and sometimes controversial. This infections, smoking, nonsteroidal anti-inflammatory drug can be explained at least in part by the difficulties in the use5daysbeforeblooddonation,haemoglobinvalueslower 3 clinical research in this field, which arise from the lack of than 11 g/dL, and platelet values lower than 150 × 10 /𝜇L. standardized protocols both to produce and administer PRP, Subject anonymity was assured by assigning a code to each thusresultinginmanyvariablesthatmightinfluencethe sample. clinical outcome [12]. Platelet count, activation methods, leukocytes/red blood 2.1. PRP Preparations. To prepare PRP, a 150 mL venous cells content, and number of injections are the most debated bloodsamplewascollectedinabagcontaining21mLof aspects that led to a different effect on target tissues. PRP stor- sodium citrate and centrifuged at 730 g for 15 min. Most of age is also a key factor: freeze-thawing allows easier patient the red blood cells were eliminated and the resulting plasma management, but it is thought to impair platelet function and and buffy-coat were transferred to a separate bag through lifespan, alter the GF release pattern, favor the accumulation a closed circuit. After a second centrifugation at 3800 g for of pyrogenic cytokines, and increase the risk of bacterial 10 min, the supernatant was collected to produce PRP [14]. proliferation [2]. For these reasons some authors prefer the Platelet and white blood cell concentrations were determined fresh administration of PRP immediately after its prepara- byahematologyanalyzer(COULTERLH750):linearitywas tion, thus requiring blood harvesting for each injection in 5 1000 × 103 𝜇 0.1 100 × 103 𝜇 case of multiple treatments [13]. Conversely, some researchers – / Lfortheplateletcountand – / L for the white blood cell count. A half-volume of the PRP have used freeze/thaw cycles as an activation method of PRP ∘ obtained was frozen at −30 Cfor2handthenthawedinadry in in vitro studies, since the effect of freeze/thawing is to ∘ physically damage the platelet membranes and therefore to thermostat at 37 C for 30 min just before activation (frozen initiate the release of the granule content. However, there is no PRP). Both PRPs (fresh and frozen) from each donor were consensus regarding the precise number of freeze/thaw cycles tested on chondrocytes and synoviocytes, without pooling necessary for complete degranulation, which can vary from 2 them. to 4, or concerning the possibly negative effect on platelets and their bioactive molecules [13]. 2.2. Evaluation of Factors Released from PRP. All PRP Whether freeze/thawing PRP might lead to different samples (fresh and frozen) were activated with 10% CaCl2 (22.8 mM final concentration) and divided into two aliquots, release kinetics of molecules or different effects on tissue ∘ homeostasis with respect to fresh PRP is poorly understood. one incubated for 1 h and the other for 7 days at 37 Cin5% Perut et al. [14] reported a reduction of platelet and leukocyte CO2, in agreement with the cell culture scheduled time point number without affecting the bFGF release in frozen PRP and PRP clinical administration [9]. ∘ compared to fresh PRP. Moreover, proliferation and min- After centrifugation (for 15 min at 2800 g at 20 C), the ∘ eralization of bone marrow-derived mesenchymal stem cell released supernatant was collected and stored at −30 C. Inter- culture were similar in both PRPs, thus suggesting that PG leukin (IL)-1𝛽, hepatocyte growth factor (HGF), platelet- cryopreservation should be regarded as a safe procedure that derived growth factor AB/BB (PDGFAB/BB), transforming does not affect the final properties of platelet concentrate growth factor 𝛽1(TGF-𝛽1), and vascular endothelial growth andallowsadequatequalitycontroloftheproduct[14]. factor (VEGF) were assayed using commercially available Conversely, other authors believe that freeze-thawing PRP bead-based sandwich immunoassay kits (Bio-Rad Labo- may lead to deleterious changes in the product and therefore ratories, Hercules, CA, USA; and Millipore Corporation, negatively affect the efficacy of platelet concentrate15 [ ]. Billerica, MA, USA) [20]. The immunocomplexes formed on The purpose of this study was to compare fresh and distinct beads were quantified by using the Bio-Plex Protein frozen PRPs by analyzing whether the different state might Array System (Bio-Rad Laboratories). Data were analyzed by influence the release of bioactive molecules and their effects using the Bio-Plex Manager software version 6.0 (Bio-Rad on chondrocytes and synoviocytes. In particular, since some Laboratories). Standard levels between 70% and 130% of the authorsshowedthat95%ofthesemoleculesaresecreted expected values were considered accurate and were used. BioMed Research International 3

2.3. Cell Isolation and Culture. Chondrocytes (𝑛=4;male, VEGF, TGF𝛽1, FGF-2, HGF, hyaluronic acid (HA) synthases age range 62–73 years) and synoviocytes (𝑛=3;male, (HAS)-2, aggrecan, collagen II, and Sox-9 were determined. age range 68–73 years) were isolated from patients with The expression of specific genes by synoviocytes was assayed OA (Kellgren-Lawrence grades II-III [21]) undergoing joint with RT-PCR, and IL-1𝛽, IL-6, IL-8/CXCL8, TNF-𝛼,IL-10, surgery. Cells were isolated by enzymatic digestion. Briefly, IL-4, IL-13, MMP-13, TIMP-1, TIMP-3, TIMP-4, VEGF, cartilage and synovial tissues were washed twice in phosphate TGF𝛽1, FGF-2, HGF, HAS-1, HAS-2, and HAS-3 were bufferedsaline(PBS)andmincedintosmallpieces.Chondro- analyzed. Total RNA was isolated using TRIZOL reagent cytes were isolated by an enzymatic procedure as previously (Invitrogen) following the manufacturer’s recommended describedandusedatpassage3[22]. protocol. RNA was reverse-transcribed using SuperScript Synoviocytes were obtained from synovial tissue that was First-Strand kit (Invitrogen). ∘ digested with 0.1% Trypsin (Sigma-Aldrich) in PBS at 37 C, RNA specific primers for PCR amplification were gen- 5% CO2 for 30 minutes, and subsequently with 0.1% collage- erated from GeneBank sequences using Primer 3 software ∘ nase P (Roche) at 37 C for 1 hour under constant rotation. (Table 1). Real-time PCR was run on the LightCycler Instru- 5 Chondrocytes were plated at a density of 0.25 × 10 ment (Roche) using the SYBR Premix Ex Taq (TaKaRa 2 cells/cm in 12-well tissue-culture plates and cultured for 24 h biotechnology). The calculated RNA messenger (mRNA) lev- ∘ in a humidified atmosphere at 37 Cwith5%CO2 in Dulbecco els for each target gene were normalized to glyceraldehyde-3 Modified Eagle Medium (DMEM; Sigma, St. Louis, Missouri) phosphate dehydrogenase (GAPDH, reference gene), accord- ΔΔ without fetal bovine serum to permit them to adhere to the ing to the Ct method; the data were calculated as the wells. ratio of each gene to GAPDH and expressed as “number of molecules per 100,000 GAPDH.” Synoviocytes were plated at a density of 0.20–0.25 × 5 2 10 cells/cm in 12-well tissue-culture plates and maintained for 24 hours in serum free OPTIMEM (Gibco-BRL, Life 2.6. Measurement of HA an Lubricin Levels. HA levels were Technologies Grand Island, NY, USA) culture medium sup- measured in the supernatants of chondrocytes and synovio- plemented with 100 U/mL penicillin, 100 Mg/mL strepto- cytes that had been treated for 7 days with PRP and frozen mycin (Invitrogen, Carlsbad, CA, USA) in a humidified PRP, using commercial DuoSet ELISA kit (R&D Systems) ∘ following the manufacturer’s instructions. Lubricin protein atmosphere at 37 Cwith5%CO2. Then, culture media of both chondrocytes and synoviocytes were supplemented with level was measured in the supernatants of chondrocytes using either fresh PRP or frozen PRP at 10% (vol/vol) previously a specific Elisa Kit (PRG4) (Uscn, Life Science Inc., Wuhan, China). activated with 10% calcium chloride (CaCl222.8 mM final concentration) to produce a platelet gel and release the granule content. The incubation period was seven days, 2.7. Statistical Analysis. Data concerning the characterization during which time the culture medium was not changed. To of the PRP and frozen PRP were analyzed by Friedman’s maintain PRP activated platelets in contact with chondrocyte test for multiple comparisons of paired data and, when and synoviocyte monolayers while avoiding direct mixing, a significant, followed by Bonferroni’s post hoc correction for Transwell device was used (pore 0.4 𝜇m; Corning, Costar). multiple comparisons (a value of 𝑃 < 0.0125 was considered All experiments were run in parallel. significant after Bonferroni’s correction). Results obtained Attheendoftheincubationtime(7days),culturesuper- from the evaluations of the biological activity of PRP on ∘ natants were collected and maintained at −80 Cuntiltheir chondrocyte and synoviocyte cultures were analyzed by the use in ELISA tests, whereas chondrocytes and synoviocytes Wilcoxon matched-pairs test for multiple comparisons. were used for proliferation assay and then lysed for RNA Statistical analysis was carried out using the Statistica for extraction. Windows package release 6.1 (Statsoft Inc., Tulsa, OK) and GraphPad Prism for Windows (CA, USA). 2.4. Proliferation Assay. Chondrocyte and synoviocyte growth in the presence of each PRP formulation was evalu- 3. Results ated through the Alamar blue test [23]. Briefly, the cells were incubated with 10% of Alamar Blue for 3 hours and the 3.1. Characterization of PRP and Frozen PRP. Table 2 shows fluorescence was measured with use of a microplate reader the characterization of both fresh/frozen PRPs used in the (CytoFluor 2350, Millipore). The results were expressed as study. Platelet concentration in PRP presented a median apercentageofAlamarBluereductionasindicatedbythe value of 929,000/𝜇L (interquartile range 720,000–965,000) manufacturer’s data sheet (AbD Serotec, Oxford, United and was about 3-fold lower in frozen PRP. White blood cells Kingdom). (WBC) maintained concentrations that overlapped those of the peripheral blood in PRP (median 5,500/𝜇L; interquartile 2.5. Chondrocyte and Synoviocyte Gene Expression Analysis. range 5,000–6,500) and underwent an evident decrease after The expression of specific genes by chondrocytes was assayed freezing, being below the detection limit in seven subjects and with real-time quantitative reverse transcriptase polymerase about 3-fold lower than the starting values in the remaining chain reaction (RT-PCR). IL-1𝛽, IL-6, IL-8/CXCL8, tumor ones. necrosis factor-𝛼 (TNF-𝛼), IL-10, metalloproteinase-13 The soluble factors analyzed showed that in frozen PRP (MMP-13), tissue inhibitor of metalloproteinase (TIMP)-1, both the immediate and delayed releases were similar or 4 BioMed Research International

Table 1: List of primers used in real-time PCR.

󸀠 󸀠 ∘ ∗ RNA template Primer sequences (5 –3 ) Annealing temperature ( C) References 󸀠 5 -TGGTATCGTGGAAGGACTCATGAC GAPDH 󸀠 60 [17] 3 -ATGCCAGTGAGCTTCCCGTTCAGC 󸀠 5 -GACAATCTGGCTCCCAAC Collagen type II 󸀠 60 PRIMER 3 3 -ACAGTCTTGCCCCACTTAC 󸀠 5 -TCGAGGACAGCGAGGCC Aggrecan 󸀠 60 [18] 3 -TCGAGGGTGTAGCGTGTAGAGA 󸀠 5 -GAG CAG ACG CAC ATC TC Sox-9 󸀠 60 PRIMER 3 3 -CCT GGG ATT GCC CCG A 󸀠 5 -GTGGCAATGAGGATGACTTGTT IL-1𝛽 󸀠 60 PRIMER 3 3 -TGGTGGTCGGAGATTCGTAG 󸀠 5 -TAGTGAGGAACAAGCCAGAG IL-6 󸀠 60 PRIMER 3 3 -GCGCAGAATGAGATGAGTTG 󸀠 5 -CCAAACCTTTCCACCC IL-8 󸀠 60 PRIMER 3 3 -ACTTCTCCACAACCCT 󸀠 5 -CTTTAAGGGTTACCTGGGTTG IL-10 󸀠 60 PRIMER 3 3 -CTTGATGTCTGGGTCTTGG 󸀠 5 -AGCCCATGTTGTAGCAAACC TNF-𝛼 󸀠 60 PRIMER 3 3 -ACCTGGGAGTAGATGAGGTA 󸀠 5 -TGATGATTCTGCCCTCCTC VEGF 󸀠 60 PRIMER 3 3 -GCCTTGCCTTGCTGCTC 󸀠 5 -CGGCTGTACTGCAAAAACGG FGF-𝛽 󸀠 60 PRIMER 3 3 -TTGTAGCTTGATGTGAGGGTCG 󸀠 5 -ATACTCTTGACCCTCACACC HGF 󸀠 60 PRIMER 3 3 -TGTAGCCTTCTCCTTGACCT 󸀠 5 -CAACAATTCCTGGCGATACCT TGF-𝛽1 󸀠 60 PRIMER 3 3 -TAGTGAACCCGTTGATGTCC 󸀠 5 -TGGTGCTTCTCTCGCTCTACG HAS-1 󸀠 60 [19] 3 -GAACTTGGCAGGCAGGAGG 󸀠 5 -AAATGGGATGAATTCTTTGTTTATG HAS-2 󸀠 60 [19] 3 -GGCGGATGCACAGTAAGGAA 󸀠 5 -CAGCTGATCCAGGCAATCGT HAS-3 󸀠 60 [19] 3 -TGGCTGACCGGATTTCCTC 󸀠 5 -CCGACCTCGTCATCAG TIMP-1 󸀠 60 PRIMER 3 3 -GTTGTGGGACCTGTGGAA 󸀠 5 -CCTTGGCTCGGGCTCATC TIMP-3 󸀠 60 PRIMER 3 3 -GGATCACGATGTCGGAGTTG 󸀠 5 -CAGTTCCACAGGCACAAG IL-4 󸀠 60 PRIMER 3 3 -CTGGTTGGCTTCCTTCACA 󸀠 5 -GCACACTTCTTCTTGGTC IL-13 󸀠 60 PRIMER 3 3 -TGAGTCTCTGAACCCTTG 󸀠 5 -CTTTAAGGGTTACCTGGGTTG IL-10 󸀠 60 PRIMER 3 3 -CTTGATGTCTGGGTCTTGG 󸀠 5 -TCACGATGGCATTGCT MMP-13 󸀠 60 PRIMER 3 3 -GCCGGTGTAGGTGTAGA ∗ Primer sequences were obtained from published references and were indicated or designed using PRIMER 3. slightly lower than those of PRP. In particular, the TGF-𝛽1 after 7 days (𝑃 < 0.01), whereas the other factors were and PDGF AB/BB concentrations were significantly reduced unmodifiedbytimeinbothPRPs. afterfreezingbothat1handat7days(𝑃 < 0.01),whereas the HGF concentration was significantly lower in frozen PRP 3.2. Chondrocyte and Synoviocyte Proliferation Assay and (𝑃 < 0.01) 𝛽 only after 7 days .IL-1 and VEGF concentrations Gene Expression Analysis. Chondrocytes and synoviocytes were not significantly modified after PRP freezing, whatever grown in the presence of 10% of both PRPs were viable the time of incubation. and able to proliferate up to 7 days with no difference Concerning time-related modifications, in fresh PRP, IL- between preparations (data not shown). At 7 days, cells are 1𝛽 and HGF concentrations underwent a significant increase subconfluent. BioMed Research International 5

Table 2: Soluble factor concentrations in fresh (PRP) and frozen PRP 1 h and 7 days after activation. Concentrations are expressed as pg/mL and reported as median values and (interquartile ranges).

Incubation time Soluble factors Preparations 𝑃 value 1hour 7days PRP 1.015 (0.83–5.41) 70.11 (56.81–233.35) 𝑃 < 0.01 IL-1𝛽 Frozen PRP 1.22 (0.72–2.32) 14.43 (1.11–179.20) NS 𝑃 value NS NS PRP 107861.6 (81652–127793.0) 103553.4 (64935.69–1341400.0) NS TGF-𝛽1 Frozen PRP 33849.8 (23339.08–54974.0) 52511.5 (30092.61–201434.0) NS 𝑃 value 𝑃 < 0.005 𝑃 < 0.01 PRP 27714.68 (18591.50–35850.24) 31670.63 (18617.58–80462.27) NS PDGF AB/BB Frozen PRP 17388.90 (8648.29–29500.03) 6035.78 (4691.41–37053.02) NS 𝑃 value 𝑃 < 0.01 𝑃 < 0.01 PRP 157.94 (62.3–238.52) 226.79 (145.82–743.31) NS VEGF Frozen PRP 147.78 (9.39–209.94) 204.10 (136.85–632.23) NS 𝑃 value NS NS PRP 247.20 (148.75–305.97) 380.89 (370.58–493.17) 𝑃 < 0.01 HGF Frozen PRP 253.68 (109.87–283.97) 212.77 (149.44–261.94) NS 𝑃 value NS 𝑃 < 0.01

Collagen type II, aggrecan, and Sox-9 mRNAs were sim- 4. Discussion ilarly expressed on day 7 in chondrocytes treated with fresh andfrozenPRP(Figure 1). A different trend was observed for The heterogeneous clinical outcome reported in the literature some of the inflammatory genes evaluated, in particular IL-1𝛽 on PRP treatment for joint tissue regeneration reflects the lack and IL-6, which were highly induced by fresh PRP; however, of guidelines regarding the use of platelet concentrates, start- these differences were not statistically significantFigure ( 1). ing from their production up to their clinical application. The IL-8 and TNF-𝛼 were similarly expressed by the cells grown increasing awareness on the need for PRP standardization in presence of both fresh and frozen PRPs (Figure 1). No is shown by the numerous biological studies investigating differences between fresh and frozen PRP were observed for the role of each PRP variable on the healing potential TGF-𝛽1, VEGF, HGF, IL-10, HAS-2, and MMP-13 expression. of platelet concentrates [24–26]. Among these factors, the mRNAs for TIMP-1 and FGF-2 were highly induced by fresh possibility to store PRP and the effects of freeze/thawing PRP compared to frozen PRP, even if these values were not PRP remain a controversial point. Although some researchers statistically significantly different. avoid freeze/thawing, fearing deleterious effects on platelet Gene expression analysis on synoviocyte cultures indi- function and GF release [2], others consider it to be a cated that, among proinflammatory factors, anti-inflam-ma- procedure that physically activates PRP [13]. tory factors, and/or anticatabolic factors, IL-1𝛽, IL-8/CXCL8, In this scenario, our aim was to investigate whether PRP IL-6, IL-10, and TNF-𝛼 were not differently modulated by freezing/thawing affected the release of GFs from platelets 𝛼- the two preparations, whereas IL-4 and IL-13 gene expression granules at two key experimental points: 1 hour (immediate levels were not detectable (Figure 2). release) and 7 days, as scheduled delivery time in the clinical With regard to GFs, cartilage matrix degrading enzymes, application, by evaluating the effects on chondrocyte and and their inhibitors, no difference was found in synoviocyte synoviocyte cultures, the main cell populations targeted in gene expression levels between fresh PRP and frozen PRP the joint. formostofthem(VEGF,TGF-𝛽1, FGF-2, MMP-13, TIMP-1, The results of GF release showed that in frozen PRP TIMP-3, and TIMP-4). A significantly different gene expres- theimmediatereleaseandthetotalamountat7dayswere sion level was found for HGF, which was higher in frozen not the same as in fresh PRP. Indeed, it seemed to be PRP (𝑃 = 0.0313). HA synthases gene expression did not similarorslightlylowerwithrespecttothefreshpreparation, seem to be differently influenced by the two PRP preparations as reported for TGF-𝛽1 and PDGF AB/BB. Similar results (Figures 1 and 2). were reported by Durante et al. [27],whoshowedaslight downregulation of all PDGF isoforms after repeating cycles 3.3. Hyaluronan Production. As shown in Figures 2 and 3,no of freezing and thawing. Conversely, they also described an differences were observed between fresh PRP and frozen PRP increased level of TGF-𝛽1. No significant differences were in hyaluronan secretion for both cell cultures and in lubricin detected for VEGF in this study. A different situation was production in chondrocytes. described for HGF, which showed similar concentrations in 6 BioMed Research International

Collagen II Aggrecan Sox-9 IL-1𝛽 IL-6 1.0 6 30 0.5 10 0.8 0.4 8 ×100000 ×100000 ×100000

4 ×100000 20 ×100000 0.6 0.3 6 GAPDH GAPDH 0.4 GAPDH 2 GAPDH 0.2 4 10 GAPDH 0.2 2 mol mRNA mol mol mRNA mol 0.1 mol mRNA mol ∘ ∘ mol mRNA mol mol mRNA mol ∘ ∘ ∘ n n n n 0.0 0 0 0.0 n 0

𝛼 𝛽1 IL-8 TNF- TGF- VEGF 0.025 HGF 80 0.15 30 150 0.020

60 ×100000 ×100000 ×100000 ×100000 20 100 ×100000 0.10 0.015 40

GAPDH 0.010 GAPDH GAPDH GAPDH GAPDH 0.05 10 50 20 0.005 mol mRNA mol mol mRNA mol ∘ mol mRNA mol mol mRNA mol ∘ mol mRNA mol ∘ ∘ n ∘ n n n 0 n 0.00 0 0 0.000

IL-10 HAS-2 MMP-13 TIMP FGF-2 0.5 15 0.20 250 150 0.4 0.15 200 ×100000 ×100000 ×100000

×100000 10

×100000 100 0.3 150 0.10 GAPDH GAPDH GAPDH GAPDH 0.2 5 100

GAPDH 50 0.05 0.1 50 mol mRNA mol mol mRNA mol mol mRNA mol ∘ mol mRNA mol ∘ ∘ mol mRNA mol ∘ n ∘ n n n 0.0 0 0.00 0 n 0

PRP PRP PRP PRP PRP Frozen PRP Frozen PRP Frozen PRP Frozen PRP Frozen PRP

Figure 1: RT-PCR analysis: messenger RNAs expression in chondrocytes grown in presence of 10% fresh or frozen PRP at 7 days. Data were normalized to GAPDH and expressed as a percentage of the reference gene. Boxes indicate the 25% and 75% percentiles, whiskers indicate the minimum to maximum values, and bars indicate the median.

bothPRPsat1hour,butat7daysasignificantdifference hour to 7 days was observed only in fresh PRP. In a previous was observed with a higher amount of HGF in fresh PRP study [29] we observed that the IL-1𝛽 levels might be strongly with respect to that of frozen PRP. One possible explanation correlated with WBC count. So, the absence of an increment mightbelinkedtoplateletstorage-derivedlesions:ithasbeen of IL-1𝛽 detected in frozen PRP might be explained by the reported [28] that during freezing storage platelets decrease fact that freezing and thawing led to leukocyte destruction in their responsiveness to aggregating agents and thus appear (which can produce inflammatory cytokines directly and to reflect a general loss in the ability to become activated indirectly by platelet stimulation), as we observed with the by various agonists. However, the functional defects of cold dramatic reduction in WBC number, preventing the “de stored platelets do not appear to be as extensive as those of novo” synthesis of this cytokine. room temperature stored platelets [28]. Thus, freeze/thawing Another key point is the release kinetics of GFs in both might still be a valid option to store PRP,although in this case PRPs. It has been recently reported that once platelets are frozen PRP might be less sensitive than fresh PRP to CaCl2, activated, an initial burst of GF release is followed by a further bynotliberatingthetotalamountofGFsstoredinthe𝛼- sustained release, 3- to 5-fold increase as compared with granules, and some platelets and bioactive molecules might baseline [30]. Our results highlighted a possible deviation be damaged. from this GF release kinetics for frozen PRP, which showed With regard to proinflammatory cytokines, the immedi- no significant differences in proteins release at 1 h and 7 days, ate release of IL-1𝛽 in this study did not significantly differ thus indicating a lower GF secretion over time. In fresh PRP in fresh PRP with respect to that of frozen PRP at 1 hour samples, overall more bioactive molecules were released both and 7 days. Interestingly, even if not statistically different, at 1 hour and at 7 days, and both IL-1𝛽 and HGF release there was a lower amount of IL-1𝛽 in frozen PRP with respect showedanincreaseat7dayswithrespectto1hour. to that of fresh PRP (14.4 pg/mL versus 70.1 pg/mL, resp.), Despite these differences in GF release, fresh and frozen andasignificanttrendofafurtherincreaseofIL-1𝛽 from 1 PRPs did not differ in their ability to induce cell proliferation BioMed Research International 7

𝛽 𝛼 8000 IL-1 35000 IL-8 10000 IL-6 40 IL-10 100 TNF- GAPDH GAPDH GAPDH GAPDH GAPDH 30000 8000 80 6000 25000 30 20000 6000 60 4000 20 ×100000 ×100000 15000 ×100000 4000 ×100000 ×100000 40 2000 10000 10 5000 2000 20 0 0 0 0 0 mol mRNA mol mRNA mol mRNA mol mRNA mol mRNA mol ∘ ∘ ∘ ∘ ∘ n n n n n

HGF VEGF TGF-𝛽1 FGF-2 MMP-13 15000 30000 50000 400 300 GAPDH GAPDH GAPDH GAPDH P < 0.05 GAPDH 40000 300 25000 200 10000 30000 200 ×100000 ×100000 10000 ×100000 ×100000 ×100000 20000 5000 100 100 5000 10000 0 0 0 0 0 mol mRNA mol mRNA mol mRNA mol mRNA mol mRNA mol ∘ ∘ ∘ ∘ ∘ n n n n n

TIMP-1 TIMP-3 TIMP-4 HAS-1 HAS-2 50 150000 20 900 5000

GAPDH GAPDH GAPDH 40 GAPDH GAPDH 15 4000 100000 30 600 3000 10 20

×100000 ×100000 ×100000 ×100000 ×100000 2000 50000 300 5 10 1000 0 0 0 0 0 mol mRNA mol mRNA mol mRNA mol mRNA mol mRNA mol ∘ ∘ ∘ ∘ ∘ n n n n n

1000 Hyaluronic acid 2000 HAS-3 GAPDH 800 1500 600 1000 (ng/mL) ×100000 400 500 200 0 0 mol mRNA mol ∘

n PRP PRP Frozen PRP Frozen PRP

Figure 2: Expression analysis of factors involved in joint physiopathology: messenger RNAs expression in synoviocytes grown in presence ∘ of 10% fresh or frozen PRP at 7 days. Data were expressed as n mol mRNA ×100000 GAPDH. Hyaluronic acid production was evaluated in culture supernatants and protein production was normalized per number of cells. Boxes indicate the 25% and 75% percentiles, whiskers indicate the minimum to maximum values, and bars indicate the median.

or ECM production and secretion in both chondrocytes and for the increased expression of IL-1𝛽,IL-6,FGF-2,andTIMP- synoviocytes. Concerning gene expression analysis, chondro- 1[31], and this might explain why their presence was not cytesculturedwithbothPRPsshowedsimilarresultsfor so marked in frozen PRP, in which freeze/thawing caused collagen II, aggrecan, and Sox-9, thus indicating that frozen leukocyte destruction. PRPdidnotloseorreduceitsabilitytoenhancechondrocyte Concerning synoviocyte culture, also in this case the two anabolism. Albeit with no statistical significant difference PRP preparations did not induce significant differences in the with respect to frozen PRP, IL-1𝛽,IL-6,FGF-2,andTIMP-1 expression of pro/anti-inflammatory agents and anticatabolic were highly induced by fresh PRP.It could be speculated that factors, whereas a higher expression of HGF was found in their amount might be ascribed to leukocytes in fresh PRP.In frozen PRP (𝑃 = 0.0313). Since it has been reported that fact, it has been reported that leukocytes may be responsible IL-1𝛽 inhibits the synovial production of HGF [32] and since 8 BioMed Research International

Hyaluronan Lubricin 10000 25000

8000 20000

6000 15000 (ng/mL) 4000 (ng/mL) 10000

2000 5000

0 0

PRP PRP Frozen PRP Frozen PRP

Figure 3: Hyaluronan levels in the culture media of human chondrocytes grown in presence of 10% fresh or frozen PRP at 7 days. Mean values are expressed as ng/mL, boxes indicate the 25% and 75% percentiles, whiskers indicate the minimum to maximum values, and bars indicate the median. slightly lower levels of IL-1𝛽 are found in frozen PRP with both the immediate and 7-day release were lower with respect respect to fresh PRP (which, however, was the only one to that of the fresh preparation, but without affecting the to present a significant increase over time), the high level ability of PRP to induce proliferation and ECM production of HGF gene expression reached in synoviocytes incubated in chondrocyte and synoviocyte cultures. The only significant with frozen PRP might be ascribable to the reduction of the difference was detected for synoviocyte HGF expression, potential inhibitory effect of IL-1𝛽.HGFhasbeenshown which was higher in the freeze/thawed PRP induced cells, to exert an anti-inflammatory effect on human chondro- thus suggesting that PRP cryopreservation is a safe procedure, cytes, by downregulating nuclear factor kappa B, the main which sufficiently preserves PRP quality and its biological transcription factor involved in the inflammatory process activity. [33]. Moreover, it has been reported that platelet activation increases levels of anti-inflammatory cytokines because of the presence of HGF [34]. Since there is increasing evidence that Conflict of Interests synovial inflammation plays a critical role in the symptoms Giuseppe Filardo is consultant and receives institutional and structural progression of OA [34], the level of HGF support from Finceramica Faenza Spa (Italy), Fidia Farma- (which also exerts proangiogenetic effects) might be an ceutici Spa (Italy), and CartiHeal (2009) Ltd (Israel). He intriguing aspect to be further explored in PRP procedures. is a consultant for EON Medica SRL (Italy). He receives Current research aims to optimize PRP production and institutional support from IGEA Clinical Biophysics (Italy), administration protocols. This study underlines two interest- BIOMET (USA), and Kensey Nash (USA). Elizaveta Kon is a ing aspects. The first one is that freeze/thawing affects PRP consultant for CartiHeal (2009) Ltd. (Israel) and has stocks of cell composition and its release of bioactive molecules. The CartiHeal (2009) Ltd (Israel). She is a consultant and receives second is that this different release kinetics does not signifi- institutional support from Finceramica Faenza Spa (Italy). cantly influence the effects on cell cultures. It is important to She receives institutional support from Fidia Farmaceutici recognize that biological studies give important indications Spa (Italy), IGEA Clinical Biophysics (Italy), BIOMET (USA), for the development of treatments, but their results do not and Kensey Nash (USA). Maurilio Marcacci receives royalties always directly translate into clinical findings, as previously and research institutional support from Fin-Ceramica Faenza shown by the same clinical outcome reported using two SpA (Italy). He receives institutional support from Fidia biologically completely different procedures [35]. However, Farmaceutici Spa (Italy), CartiHeal (2009) Ltd (Israel), IGEA until clinical studies explore and clarify the effects of PRP Clinical Biophysics (Italy), BIOMET (USA), and Kensey Nash storage on patient symptoms and functional improvement, (USA). All the other authors declare that there is no conflict this study suggests that freeze/thawing does not significantly of interests regarding the publication of this paper. affect PRP and can be considered as a storage option and thus simplify the management of patients undergoing multiple injection cycles of PRP. Authors’ Contribution Doctor Roffi Alice participated in writing of the paper. 5. Conclusion Doctor Filardo Giuseppe participated in writing of the paper and study design. Doctor Assirelli Elisa participated in tests PRP freezing is a controversial topic. Our results on GF on synoviocytes, data analysis, and writing of the paper. release from platelets 𝛼-granules showed that in frozen PRP Doctor Cavallo Carola participated in tests on chondrocytes, BioMed Research International 9

data analysis, and writing of the paper. Doctor Cenacchi Surgery, Sports Traumatology, Arthroscopy, vol. 20, no. 10, pp. Annarita participated in PRP production and is a hematology 2082–2091, 2012. consultant. Professor Facchini Andrea is a supervisor and [11] E. Kon, B. Mandelbaum, R. Buda et al., “Platelet-rich plasma senior consultant and participated in editing. Doctor Grigolo intra-articular injection versus hyaluronic acid viscosupple- Brunella participated in tests on chondrocytes, data analysis, mentation as treatments for cartilage pathology: from early andwritingofthepaperandisaconsultant.DoctorKon degeneration to osteoarthritis,” Arthroscopy, vol. 27, no. 11, pp. Elizaveta is a supervisor and participated in editing. Professor 1490–1501, 2011. Mariani Erminia is a supervisor and senior consultant and [12] M. Tschon, M. Fini, R. Giardino et al., “Lights and shadows participated in editing. Doctor Pratelli Loredana participated concerning platelet products for musculoskeletal regeneration,” Frontiers in Bioscience—Elite,vol.3,no.1,pp.96–107,2011. in data analysis. Doctor Pulsatelli Lia participated in tests on synoviocytes, data analysis, and writing of the paper and is a [13] A. S. Wasterlain, H. J. Braun, and J. L. Dragoo, “Contents and formulations of Platelet-Rich plasma,” Operative Techniques in consultant. Professor Marcacci Maurilio is a supervisor and Orthopaedics,vol.22,no.1,pp.33–42,2012. senior consultant and participated in editing. [14] F. Perut, G. Filardo, E. Mariani et al., “Preparation method and growth factor content of platelet concentrate influence Acknowledgments the osteogenic differentiation of bone marrow stromal cells,” Cytotherapy,vol.15,no.7,pp.830–839,2013. This work was supported by the Italian Ministry of Health [15]M.Dhillon,S.Patel,andK.Bali,“Platelet-richplasmaintra- (Project “Ricerca Finalizzata”-2009-1498841) and PRRU articular knee injections for the treatment of degenerative (Emilia-Romagna Region/University of Bologna Project) cartilage lesions and osteoarthritis,” Knee Surgery, Sports Trau- 2010–2012. matology, Arthroscopy,vol.19,no.5,pp.863–864,2011. [16] S. Kevy and M. Jacobson, “Preparation of growth factors enriched auologous platelet gel,” in Proceedings of the 27th References Annual Meeting of Service Biomaterials, April 2011. [1]G.Filardo,E.Kon,A.Roffi,B.DiMatteo,M.L.Merli,and [17] I. Martin, M. Jakob, D. Schafer,¨ W. Dick, and G. Spagnoli, M. Marcacci, “Platelet-rich plasma: why intra-articular? A “Quantitative analysis of gene expression in human articular systematic review of preclinical studies and clinical evidence on cartilage from normal and osteoarthritic joints,” Osteoarthritis PRP for joint degeneration,” Knee Surgery, Sports Traumatology, and Cartilage,vol.9,no.2,pp.112–118,2001. Arthroscopy,2013. [18] F. J. Blanco, Y. Geng, and M. Lotz, “Differentiation-dependent 𝛽 [2] E. Kon, G. Filardo, B. Di Matteo, and M. Marcacci, “PRP for effects of IL-1 and TGF- on human articular chondrocyte the treatment of cartilage pathology,” The Open Orthopaedics proliferation are related to inducible nitric oxide synthase Journal,vol.3,no.7,pp.120–128,2013. expression,” Journal of Immunology,vol.154,no.8,pp.4018– 4026, 1995. [3] G. Filardo, M. L. Presti, E. Kon, and M. Marcacci, “Nonoperative [19] M. David-Raoudi, B. Deschrevel, S. Leclercq, P. Ga´lera, K. biological treatment approach for partial achilles tendon lesion,” Boumediene, and J. P. Pujol, “Chondroitin sulfate increases Orthopedics,vol.33,no.2,pp.120–123,2010. hyaluronan production by human synoviocytes through differ- [4] P. Torricelli, M. Fini, G. Filardo et al., “Regenerative medicine ential regulation of hyaluronan synthases: role of p38 and Akt,” for the treatment of musculoskeletal overuse injuries in com- Arthritis and Rheumatism, vol. 60, no. 3, pp. 760–770, 2009. petition horses,” International Orthopaedics,vol.35,no.10,pp. [20] E. Mariani, L. Cattini, S. Neri et al., “Simultaneous evaluation 1569–1576, 2011. of circulating chemokine and cytokine profiles in elderly sub- [5]B.J.Cole,S.T.Seroyer,G.Filardo,S.Bajaj,andL.A.Fortier, jects by multiplex technology: relationship with zinc status,” “Platelet-rich plasma: where are we now and where are we Biogerontology,vol.7,no.5-6,pp.449–459,2006. going?” Sports Health,vol.2,no.3,pp.203–210,2010. [21] J. H. Kellgren and J. S. Lawrence, “Radiological assessment of [6]N.Baksh,C.P.Hannon,C.D.Murawski,N.A.Smyth,andJ.G. osteo-arthrosis,” Annals of the Rheumatic Diseases,vol.16,no. Kennedy, “Platelet-rich plasma in tendon models: a systematic 4, pp. 494–502, 1957. review of basic science literature,” Arthroscopy—Journal of [22] C. Cavallo, G. Desando, A. Facchini, and B. Grigolo, “Chondro- Arthroscopic and Related Surgery,vol.29,no.3,pp.596–607, cytesfrompatientswithosteoarthritisexpresstypicalextracel- 2013. lular matrix molecules once grown onto a three-dimensional [7] E. Anitua, M. Sanchez,´ and G. Orive, “Potential of endogenous hyaluronan-based scaffold,” JournalofBiomedicalMaterials regenerative technology for in situ regenerative medicine,” Research A,vol.93,no.1,pp.86–95,2010. Advanced Drug Delivery Reviews,vol.62,no.7-8,pp.741–752, [23]S.AnsarAhmed,R.M.GogalJr.,andJ.E.Walsh,“Anewrapid 2010. and simple non-radioactive assay to monitor and determine the [8]S.G.Boswell,B.J.Cole,E.A.Sundman,V.Karas,andL. proliferation of lymphocytes: an alternative to [3H]thymidine A. Fortier, “Platelet-rich plasma: a milieu of bioactive factors,” incorporation assay,” Journal of Immunological Methods,vol. Arthroscopy,vol.28,no.3,pp.429–439,2012. 170, no. 2, pp. 211–224, 1994. [9]G.Filardo,E.Kon,A.diMartinoetal.,“Platelet-richplasma [24]B.Hamilton,J.L.Tol,W.Knez,andH.Chalabi,“Exercise vs hyaluronic acid to treat knee degenerative pathology: study and the platelet activator calcium chloride both influence the design and preliminary results of a randomized controlled trial,” growth factor content of platelet-rich plasma (PRP): overlooked BMC Musculoskeletal Disorders,vol.13,pp.229–236,2012. biochemical factors that could influence PRP treatment,” British [10] G. Filardo, E. Kon, M. T. Pereira Ruiz et al., “Platelet-rich Journal of Sports Medicine,2013. plasma intra-articular injections for cartilage degeneration and [25] C. E. Giraldo, C. Lopez,´ M. E. Alvarez,´ I. J. Samudio, M. Prades, osteoarthritis: single-versus double-spinning approach,” Knee and J. U. Carmona, “Effects of the breed, sex and age on cellular 10 BioMed Research International

content and growth factor release from equine pure-platelet rich plasma and pure-platelet rich gel,” BMC Veterinary Research, vol. 9, article 29, 2013. [26] S.G.Boswell,L.V.Schnabel,H.O.Mohammed,E.A.Sundman, T. Minas, and L. A. Fortier, “Increasing platelet concentrations in leukocyte-reduced platelet-rich plasma decrease collagen gene synthesis in tendons,” TheAmericanJournalofSports Medicine,vol.42,no.1,pp.42–49,2014. [27] C. Durante, F. Agostini, L. Abbruzzese et al., “Growth factor release from platelet concentrates: analytic quantification and characterization for clinical applications,” Vox Sanguinis,vol. 105, no. 2, pp. 129–136, 2013. [28] S. Holme, “Storage and quality assessment of platelets,” Vox Sanguinis, vol. 74, no. 2, pp. 207–216, 1998. [29] E. Assirelli, G. Filardo, E. Mariani et al., “Effect of two different preparations of platelet-rich plasma on synoviocytes,” Knee Surgery, Sports Traumatology, Arthroscopy,2014. [30] Y. Zhu, M. Yuan, H. Y. Meng et al., “Basic science and clinical application of platelet-rich plasma for cartilage defects and osteoarthritis: a review,” Osteoarthritis Cartilage,vol.21,no.11, pp. 1627–1637, 2013. [31] C. Cavallo, G. Filardo, E. Mariani et al., “Comparison of Platelet- Rich Plasma formulations for cartilage healing,” Journal of Bone Joint Surgery,vol.5,no.96,pp.423–429,2014. [32] E. Anitua, M. Sanchez,´ A. T. Nurden et al., “Platelet-released growth factors enhance the secretion of hyaluronic acid and induce hepatocyte growth factor production by synovial fibroblasts from arthritic patients,” Rheumatology,vol.46,no.12,pp. 1769–1772, 2007. [33] P. Bendinelli, E. Matteucci, G. Dogliotti et al., “Molecular basis of anti-inflammatory action of platelet-rich plasma on human chondrocytes: mechanisms of NF-𝜅Binhibitionvia HGF,” Journal of Cellular Physiology,vol.225,no.3,pp.757–766, 2010. [34] C. R. Scanzello and S. R. Goldring, “The role of synovitis in osteoarthritis pathogenesis,” Bone,vol.51,no.2,pp.249–257, 2012. [35] G. Filardo, E. Kon, M. T. P. Ruiz et al., “Platelet-rich plasma intra-articular injections for cartilage degeneration and osteoarthritis: Single- versus double-spinning approach,” Knee Surgery, Sports Traumatology, Arthroscopy,vol.20,no.10,pp. 2082–2091, 2012.