DOCSLIB.ORG

Quantitative Phytochemical and Antioxidant Studies in Leaf Extracts of Mangrove Grass Myriostachya Wightiana

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Quantitative Phytochemical and Antioxidant Studies in Leaf Extracts of Mangrove Grass Myriostachya Wightiana See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/290883864 Phytochemical analysis and antibacterial activity of Crossandra infundibuliformis Ethanolic stem extract Article · February 2016 CITATIONS READS 0 387 4 authors, including: Sudhakar POLA Pola Bhagavatula venkata Sandeep Andhra University Andhra University 43 PUBLICATIONS 207 CITATIONS 50 PUBLICATIONS 284 CITATIONS SEE PROFILE SEE PROFILE Some of the authors of this publication are also working on these related projects: Genetic Transformation View project CINAR PATHOBACTER View project All content following this page was uploaded by Sudhakar POLA Pola on 18 November 2017. The user has requested enhancement of the downloaded file. Indo American Journal of Pharmaceutical Research, 2016 ISSN NO: 2231-6876 QUANTITATIVE PHYTOCHEMICAL AND ANTIOXIDANT STUDIES IN LEAF EXTRACTS OF MANGROVE GRASS MYRIOSTACHYA WIGHTIANA M. Kiran Kumar, M. B. K. Priyanka, S. J. Mounika, Pola Sudhakar, B. V. Sandeep Department of Biotechnology, Andhra University, Visakhapatnam, Andhra Pradesh, India. ARTICLE INFO ABSTRACT Article history Myriostacya wightiana is a perennial mangrove grass belongs to Poaceae family, occurs in Received 15/02/2016 India, Bangladesh and extending to Myanmar, Malaysia and Vietnam. Due to more salinity in Available online its habitat Myriostacya wightiana possess high antioxidant potential. The present study 29/02/2016 evaluates the phytochemicals, antioxidants and free radical scavenging activities of the Myriostacya wightiana leaf extracts. Specific extraction and estimation methods were used to Keywords quantify the phytochemicals and antioxidants. The results of in vitro studies were analysed Antioxidants, with Mean ± Standard Deviation (SD) obtained from three independent experiments. Among Carotenoids, the phytochemicals flavonoids were found in more concentration. i.e., 416±8.2mg/gm. Free Radicals, highest enzymatic antioxidant activity was showed by catalase (32.7±1.555 U/mg protein) Mangroves, whereas lowest activity was showed by peroxidase. Carotenoids occupies the major Phytochemicals. proportion among the non enzymatic antioxidant i.e., 90.16±0 mg/g and ascorbate has least. Leaf extracts of Myriostacya wightiana shows highest percent of scavenging activity with superoxide radicals (80±6.4%). The present study revealed that Myriostacya wightiana had valuable phytochemicals, antioxidants such as enzymatic and non enzymatic which prevents oxidative damage. Because of these properties Myriostacya wightiana is referred as rich medicinal source. Corresponding author M. Kiran Kumar Research Scholar, Department of Biotechnology, Andhra University, Visakhapatnam – 530003. Andhra Pradesh. India. [email protected] Please cite this article in press as M. Kiran Kumar et al. Quantitative Phytochemical and Antioxidant Studies in Leaf Extracts of Mangrove Grass Myriostachya wightiana. Indo American Journal of Pharmaceutical Research.2016:6(02). C opy right © 2016 This is an Open Access article distributed under the terms of the Indo American journal of Pharmaceutical 4472 Research, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Page www.iajpr.com Vol 6, Issue 02, 2016. M. Kiran Kumar et al. ISSN NO: 2231-6876 INTRODUCTION Mangroves are the large plant community with divergent families being adapted to saline environment and grow in estuarine tropical world especially in continuous exposure of tidal influence. Due to more saline in its habitat, mangroves possess high phytochemicals and antioxidant potential. Phytochemicals and antioxidants protect cells and biomolecules from oxidative damage. In developing countries people eat rice which is not a complete food, it may cause for nutrient deficiency. In India also people were suffering with many diseases because of malnutrition. Oryza sativa possess very low content of phytochemicals and antioxidants when compared to mangroves like Porteresia coarctata. Mangrove plants are rich in phytochemicals such as alkaloids, flavonoids, phenolics, and tannins, etc., which have medical uses [1]. Stress tolerant plants produce enzymatic and non enzymatic antioxidants [26]. Zizania aquatica is a mangrove associate grass show significant phytochemical and antioxidant activities [19]. Along with commercial uses like timber and fire wood they also provide non timber products such as tannin, fish poison medicine, food fodder, etc [3]. Myriostachya wightiana is a perennial grass belongs to Poaceae family with 1-2 m height, leaves are linear with 1-1.5 m length and smooth surface. It has raceme type inflorescence, ascending solitary spikelet and laterally compressed ovoid shaped fruit. Myriostachya grows in inter-tidal mangrove swamps of Ganges Delta of India. In India it is mainly distributed in east coast of the Bay of Bengal, South India [34]. The presence of ample phytochemicals and antioxidants protect plants from oxidative stress. Naturally adapted salt tolerant plants provide an excellent material for investigating the adaptive mechanism they use to encounter salinity. Myriostacya wightiana showed a large range of anatomical adaptive features and it is used as a fodder grass, thatching material [29] [31]. The present study aimed to evaluate the medicinal quality of Myriostachya wightiana by quantifying the phytochemicals like phenolics, flavonoids, tannins, alkaloids and assess enzymatic antioxidants such as superoxide dismutase, peroxidase, catalase, polyphenol oxidase and quantitatively analyse non enzymatic antioxidants such as reduced glutathione, Carotenoids, lycopenes, ascorbate and also determine the free radical scavenging activities. MATERIALS AND METHODS Sample collection Healthy leaves of Myriostachya wightiana were collected from Bhavanapadu creek, Tekkali, Andhra Pradesh, India. Leaves were cleaned under tap water and used for evaluation of phytochemicals, antioxidants. Chemicals Analytical grade chemicals and reagents used for evaluation of phytochemicals and antioxidants were purchased from Merck. The experiments were performed at room temperature, otherwise stated. Phytochemical analysis Methanolic extract of fresh leaves was prepared according to modified method of [14]. The total alkaloid content was estimated by the method of [36]. Standard solution was prepared by dissolving 5 gm of boldine in 5 ml distilled water. The results of alkaloids were expressed as mg of boldine equivalents per gm extract. Total flavonoids content was quantified by the Calorimetric method [4]. Quercetin was used for standard calibration curve and the results were expressed as mg of quercetin equivalents per gm extract. Total phenolics were determined according to the method of Folin-Ciocalteu [17]. and the results were expressed as mg of gallic acid equivalents per gm of extract as calculated from standard gallic acid graph. The total tannins were estimated by the method of [16]. The results were calculated and expressed as mg of tannic acid equivalents per gm of extract from standard tanninc acid graph. Enzymatic Antioxidants Young leaves of Myriostachya wightiana were macerated in pre cooled homogenizer with extraction buffer containing 1 M sucrose, 0.2 M tris Hcl, 0.056 M β-mercaptoethanol and 0.1 g PVP. (pH-8.5). The extracts were centrifuged at 10,000 rpm for 20 min at 40C. Supernatant was stored at -200C and used for enzymatic antioxidant assays. The activity of superoxide dismutase was determined by the method of [5]. based on the principle reduction of nitroblue tetrazolium. Units of SOD were expressed as amount of enzyme required for inhibiting the reduction of 50% NBT. The enzyme activity was expressed in terms of Units per mg of protein. Catalase activity was determined by the titrimetric method of [7]. Units of enzyme activity were expressed as ml of 0.1 N potassium permanganate equivalents of H2O2 decomposed per mg protein per min. Assay of Peroxidase was performed by spectrophotometry [20]. Polyphenol oxidase activity was quantified by the spectrophotometry [12]. Results observed were expressed in Units/mg of protein. Nonenzymatic antioxidants Ascorbic acid was extracted using the methodology of [10]. Dried plants were homogenized in a 2% Meta phosphoric acid and centrifuged at 2500 rpm for 15 min. the supernatant was used to estimate the ascorbic acid by the procedure of [18]. Reducing glutathione was estimated by the [22] method. Carotenoids and Lycopenes were evaluated by the procedure of [39]. 0.5 gm of leaves 0 were macerated and saponified with 12% alcoholic KOH for 30 min at 60 C. The extract was mixed with petroleum ether in separating funnel. The aqueous and petroleum ether layers were separated. The upper layer was collected, after repeated extractions the aqueous layer becomes colourless and anhydrous sodium sulphate was added to remove excess moisture. Final volume of petroleum ether was noted. The absorbance was read at 450 nm and 503 nm for Carotenoids and lycopenes respectively. Results were expressed in mg/gm. 4473 Page www.iajpr.com Vol 6, Issue 02, 2016. M. Kiran Kumar et al. ISSN NO: 2231-6876 Estimation of free radical scavenging activities Superoxide scavenging activity was determined by the methodology of [38] by using NBT. DMSO was used instead of enzyme extract in control. According to the [21] method DPPH activity was determined in leaf extracts. ABTS radical scavenging activity of leaf extract was measured by using [33] method. Hydrogen peroxide radical
Load more

Recommended publications
  • Lyonia 8(1) 2005
    Lyonia 8(1) 2005 Volume 8(1) July 2005 ISSN: 0888-9619 Introduction Lyonia, Volume 8(1), July 2005 Editorial Board Editor-in-Chief Rainer Bussmann Contact Information Surface mail: Lyonia Harold L. Lyon Arboretum 3860 Manoa Rd.Honolulu, HI 98622 USA Phone: +1 808 988 0456 e-mail: [email protected] Editorial Board Balslev, Henrik, University of Aarhus, Denmark Brandt, Kirsten, Denmark Bush, Marc, Florida Institure of Technology, USA Cleef, Antoine, University of Amsterdam, Netherlands Cotton, Elvira, University of Aarhus, Denmark Goldarazena, Arturo, NEIKER, Spain Geldenhuys, Coert, FORESTWOOD, South Africa Goikoetxea, Pablo G., NEIKER, Spain Gradstein, Rob, University of Goettingen, Germany Gunderson, Lance, Emory University, USA Hall, John B., University of Bangor, United Kingdom Janovec, John, BRIT, USA Joergensen, Peter, Missouri Botanical Garden, USA Kilpatrick, Alan, San Diego State University, USA Kueppers, Manfred, University of Hohenheim, Germany Lovett, Jon C., University of York, United Kingdom Lucero Mosquera, Hernan P., Universidad Tecnica Particular Loja, Ecuador Matsinos, Yiannis G., University of the Aegean, Greece Miller, Marc, Emory University, USA Navarete Zambrano, Hugo G., Pontifica Universidad Catholica Quito, Ecuador Onyango, John C., Maseno University, Kenya Pritchard, Lowell, Emory University, USA Pitman, Nigel, Duke University, USA Pohle, Perdita, University of Giessen, Germany Poteete, Amy R., University of New Orleans, USA Sarmiento, Fausto, University of Georgia, USA Sharon, Douglas, University of California
    [Show full text]
  • Group B: Grasses & Grass-Like Plants
    Mangrove Guidebook for Southeast Asia Part 2: DESCRIPTIONS – Grasses & grass like plants GROUP B: GRASSES & GRASS-LIKE PLANTS 271 Mangrove Guidebook for Southeast Asia Part 2: DESCRIPTIONS – Grasses & grass like plants Fig. 25. Cyperus compactus Retz. (a) Habit, (b) spikelet, (c) flower and (d) nut. 272 Mangrove Guidebook for Southeast Asia Part 2: DESCRIPTIONS – Grasses & grass like plants CYPERACEAE 25 Cyperus compactus Retz. Synonyms : Cyperus dilutus Vahl., Cyperus grabowskianus Bolck., Cyperus luzonensis Llanos, Cyperus septatus Steud., Duraljouvea diluta Palla, Mariscus compactus Boldingh, Mariscus dilutus Nees, Mariscus microcephalus Presl., Sphaeromariscus microcephalus Camus Vernacular name(s) : Prumpungan, Jekeng, Suket (Ind.), Wampi lang (PNG), Baki-baking- pula, Durugi, Giron (Phil.). Description : A robust, perennial herb, 15-120 cm tall. Does not have stolons, and the rhizome is either very short or absent altogether. Stems are bluntly 3-angular, sometimes almost round, smooth, and with a diameter of up to 6 mm. The stem, leaves and sheath have numerous air-chambers. Leaves are 5-12 mm wide, stiff, deeply channelled, and as long as or shorter than the stem. Leaf edges and midrib are coarse towards the end of the leaf. Lower leaves are spongy and reddish-brown. Flowers are terminal and grouped in a large, up to 30 cm diameter umbrella-shaped cluster that has a reddish-brown colour. Large leaflets at the base of the flower cluster are up to 100 cm long. Spikelets (see illustration) are stemless and measure 5-15 by 1-1.5 mm. Ecology : Occurs in a variety of wetlands, including swamps, wet grasslands, coastal marshes, ditches, riverbanks, and occasionally in the landward margin of mangroves.
    [Show full text]
  • Ana Maria Benko-Iseppon, Marccus Alves & Rafael Louzada
    Rodriguésia 66(2): A1-A66. 2015 http://rodriguesia.jbrj.gov.br DOI: 10.1590/2175-7860201566228 An overview and abstracts of the First World Congress on Bromeliaceae Evolution Ana Maria Benko-Iseppon, Marccus Alves & Rafael Louzada Abstracts of the Conferences, Symposia, Oral Presentations and Poster Presentations performed during the 1st World Congress on Bromeliaceae Evolution, March 2015 (Brazil): Reactive oxygen species and antioxidant enzyme activities in leaves of Guzmania monostachia plants under water deficit Abreu, Maria Elizabeth1; Carvalho, Victória2 & Mercier, Helenice1 CAM plants have the capacity to deal with highly changing environments due to the flexibility of reversible morphological and physiological adaptations to multiple stresses. However, little is known about the signalling pathway of ROS in plants with CAM metabolism, other than the knowledge that ROS production is limited in CAM plants. In the present study, we assessed the effects of drought stress on reactive oxygen species and antioxidant enzyme activities in leaf portions of Guzmania monostachia. The exposure of G. monostachia plants to 10 days of water deficit led to a decrease in the leaf relative water content (RWC) from 75% to 50% in all leaf portions (apical, middle and basal); hence, it was concluded that plants subjected to drought produced higher levels of reactive oxygen species (ROS) when compared with control plants. Significant variations to the formation of ROS were also identified in all leaf portions during the diurnal cycle. After ten days of CAM induction, H2O2 concentration increased significantly in contrast to control plants during the day-night cycle. In addition, the activity of antioxidant enzymes in processes related to the elimination of ROS was also evaluated.
    [Show full text]
  • ACANTHACEAE 爵床科 Jue Chuang Ke Hu Jiaqi (胡嘉琪 Hu Chia-Chi)1, Deng Yunfei (邓云飞)2; John R
    ACANTHACEAE 爵床科 jue chuang ke Hu Jiaqi (胡嘉琪 Hu Chia-chi)1, Deng Yunfei (邓云飞)2; John R. I. Wood3, Thomas F. Daniel4 Prostrate, erect, or rarely climbing herbs (annual or perennial), subshrubs, shrubs, or rarely small trees, usually with cystoliths (except in following Chinese genera: Acanthus, Blepharis, Nelsonia, Ophiorrhiziphyllon, Staurogyne, and Thunbergia), isophyllous (leaf pairs of equal size at each node) or anisophyllous (leaf pairs of unequal size at each node). Branches decussate, terete to angular in cross-section, nodes often swollen, sometimes spinose with spines derived from reduced leaves, bracts, and/or bracteoles. Stipules absent. Leaves opposite [rarely alternate or whorled]; leaf blade margin entire, sinuate, crenate, dentate, or rarely pinnatifid. Inflo- rescences terminal or axillary spikes, racemes, panicles, or dense clusters, rarely of solitary flowers; bracts 1 per flower or dichasial cluster, large and brightly colored or minute and green, sometimes becoming spinose; bracteoles present or rarely absent, usually 2 per flower. Flowers sessile or pedicellate, bisexual, zygomorphic to subactinomorphic. Calyx synsepalous (at least basally), usually 4- or 5-lobed, rarely (Thunbergia) reduced to an entire cupular ring or 10–20-lobed. Corolla sympetalous, sometimes resupinate 180º by twisting of corolla tube; tube cylindric or funnelform; limb subactinomorphic (i.e., subequally 5-lobed) or zygomorphic (either 2- lipped with upper lip subentire to 2-lobed and lower lip 3-lobed, or rarely 1-lipped with 3 lobes); lobes ascending or descending cochlear, quincuncial, contorted, or open in bud. Stamens epipetalous, included in or exserted from corolla tube, 2 or 4 and didyna- mous; filaments distinct, connate in pairs, or monadelphous basally via a sheath (Strobilanthes); anthers with 1 or 2 thecae; thecae parallel to perpendicular, equally inserted to superposed, spherical to linear, base muticous or spurred, usually longitudinally dehis- cent; staminodes 0–3, consisting of minute projections or sterile filaments.
    [Show full text]
  • To a Specific Tab Number CTRL+N (N Can Be 1-8) Switch to the Last Tab CTRL+9 Close Current Tab CTRL+W Close All Tabs ALT+F4 Close Other Tabs CTRL+ALT+F4
    Open links in a new tab in the CTRL+click background Open links in a new tab in the CTRL+SHIFT+click foreground Open a new tab in the foreground CTRL+T Open a new tab from the Address bar ALT+ENTER Open a new tab from the search box ALT+ENTER Open Quick Tabs (thumbnail view) CTRL+Q Switch between tabs CTRL+TAB/CTRL+SHIFT+TAB Switch to a specific tab number CTRL+n (n can be 1-8) Switch to the last tab CTRL+9 Close current tab CTRL+W Close all tabs ALT+F4 Close other tabs CTRL+ALT+F4 Mouse shortcuts To The Manager , Visakhapatnam. Dear Sir, Sub: Pre-closure of Loan Account No_______________________________ This has reference to the above subject; I have decided to sell my property to Mr. ____________________ whose loan is sanctioned from IDBI Bank, Siripuram, Visakhapatnam. I requested IDBI Bank to close my loan Account No.___________________. Kiran Bedi (Hindi: िकरण बेदीीीीीीीीीीीीीीी ) (Punjabi:ਿਕਰਣ ਬੇਦੀ) (born 9 June 1949) is an Indian social activist and a retired Indian Police Service (IPS) officer. She became the first woman to join the IPS in 1972, and most recently held the post of Director General, BPR&D (Bureau of Police Research and Development), Ministry of Home Affairs. She retired from the IPS in December, 2007, after taking voluntary retirement. She was the host and TV judge of the popular TV series "Aap Ki Kachehri" (English, "Your Court"), broadcast on the Indian TV channel, Star Plus. This program features Indian families approaching her TV court and explaining their problems to her.
    [Show full text]
  • Red List of Bangladesh 2015
    Red List of Bangladesh Volume 1: Summary Chief National Technical Expert Mohammad Ali Reza Khan Technical Coordinator Mohammad Shahad Mahabub Chowdhury IUCN, International Union for Conservation of Nature Bangladesh Country Office 2015 i The designation of geographical entitles in this book and the presentation of the material, do not imply the expression of any opinion whatsoever on the part of IUCN, International Union for Conservation of Nature concerning the legal status of any country, territory, administration, or concerning the delimitation of its frontiers or boundaries. The biodiversity database and views expressed in this publication are not necessarily reflect those of IUCN, Bangladesh Forest Department and The World Bank. This publication has been made possible because of the funding received from The World Bank through Bangladesh Forest Department to implement the subproject entitled ‘Updating Species Red List of Bangladesh’ under the ‘Strengthening Regional Cooperation for Wildlife Protection (SRCWP)’ Project. Published by: IUCN Bangladesh Country Office Copyright: © 2015 Bangladesh Forest Department and IUCN, International Union for Conservation of Nature and Natural Resources Reproduction of this publication for educational or other non-commercial purposes is authorized without prior written permission from the copyright holders, provided the source is fully acknowledged. Reproduction of this publication for resale or other commercial purposes is prohibited without prior written permission of the copyright holders. Citation: Of this volume IUCN Bangladesh. 2015. Red List of Bangladesh Volume 1: Summary. IUCN, International Union for Conservation of Nature, Bangladesh Country Office, Dhaka, Bangladesh, pp. xvi+122. ISBN: 978-984-34-0733-7 Publication Assistant: Sheikh Asaduzzaman Design and Printed by: Progressive Printers Pvt.
    [Show full text]
  • A Study of the Plant Ecology of the Coast Region of Kenya Colony
    ^•ooooo0Oooooeo0Oooooooeocooo«oeooooooo«oeGso0O«oeoeoeO0oeooGoo0Ooo0OO€ A STUDY OF THE PLANT ECOLOGY OF THE * * * * COAST REGION ¥ ¥ * OF KENYA COLONY M » BRITISH EAST AFRICA * * by JAMES C. MOOMAW * Fulbiißht Research Scholar KENYA DEPARTMENT OF AGRICULTURE and EAST AFRICAN AGRICULTURE AND FORESTRY RESEARCH ORGANIZATION co-operating with the UNITED STATES EDUCATIONAL COMMISSION in the United Kingdom 7K I960 BRBfFED BY THE GOVERNMENT PRINTER, NAIROBI * Price: Sh. 10 ¥ ISRIC LIBRARY KE - 1960.04 OOOOOOOeOtOtOOGOOOOtOaOtOOOOGtOOOOOtOOOBOOOOOOOK Wageningen The Netherlands Scanned from original by ISRIC - World Soil Information, as ICSU World Data Centre for Soils. The purpose is to make a safe depository for endangered documents and to make the accrued ku=. information available for consultation, following Fair Use jdo.oH Guidelines. Every effort is taken to respect Copyright of the Wageningen, The Netherlands materials within the archives where the identification of the Copyright holder is clear and, where feasible, to contact the originators. For questions please contact soil.isricgiwur.nl indicating the item reference number concerned. A STUDY OF THE PLANT ECOLOGY OF THE COAST REGION OF KENYA COLONY BRITISH EAST AFRICA by JAMES C. MOOMAW Fulbright Research Scholar 15 f.o& The following is the first approximation to what will be a more detailed study when more time is avail­ able. Your comments, corrections, criticisms, and additions are solicited. JAMES C. MOOMAW, Department of Agronomy and Soil Science, University of Hawaii, Honolulu,
    [Show full text]
  • PLANT SCIENCE TODAY, 2021 Vol 8(3): 590–595 HORIZON E-Publishing Group ISSN 2348-1900 (Online)
    PLANT SCIENCE TODAY, 2021 Vol 8(3): 590–595 HORIZON https://doi.org/10.14719/pst.2021.8.3.1133 e-Publishing Group ISSN 2348-1900 (online) RESEARCH COMMUNICATION Phylogenetic study of mangrove associate grass Myriostachya wightiana (Nees ex Steud.) Hook. f. using rbcL gene sequence Kiran Kumar M* & Sandeep B V Department of Biotechnology, College of Science and Technology, Andhra University, Visakhapatnam, Andhra Pradesh, India *Email: [email protected] ARTICLE HISTORY ABSTRACT Received: 14 February 2021 Myriostachya is a monotypic genus in the family Poaceae, with the only known species Myriostachya Accepted: 05 May 2021 wightiana (Nees ex Steud.) Hook.f. It is a mangrove associate grass primarily distributed along the Available online: 01 July 2021 muddy streams and channels in intertidal mangrove swamps of India, Bangladesh, Sri Lanka, Myanmar, Thailand and Sumatra. Molecular identification and evolutionary studies ofM. wightiana is unreported till now. Therefore, in this study, the phylogenetic analysis of M. wightiana was established with KEYWORDS related family members by using chloroplast rbcL gene-based systematics. The molecular phylogeny PCR amplification was accomplished by DNA extraction, PCR amplification and sequencing of the rbcL gene and BLASTn phylogenetic analysis. The genomic DNA was extract using the CTAB method and the rbcL gene MEGAX amplification is by using the F-5IATGTCACCACAAACAGAAACTAAAGC3I and R- Multiple sequence alignment 5ICTTCGGCACAAAATAAGAAACGATCTC3I primers. Phylogenetic analysis of M. wightiana was performed Poaceae by multiple sequence alignment with UPGMA, and the Maximum-parsimony phylogenetic tree was constructed using MEGAX. Myriostachya wightiana rbcL gene sequence shows the highest similarity to Paspalum species, and in the phylogenetic tree M.
    [Show full text]
  • Malay Peninsula, Plants Kedah, Botanically However, the Malayan
    Origin of the flora of the Malay Peninsula by H.N. Ridley (Kew). work the I included such In my on Malay Peninsula, plants as were known from the districts of North Kedah, Perlis and Setul. Botanically however, the Malayan flora ceases at a line running from a little north of Kedah peak Lat. 6.5, to Kota Bahru in North Kelantan Lat. 6.10. It is in fact approximately the termination of the Granitic in of Mountains as shown SCRIVENOR’S Map the Geology of Malaya. North of this line there is a remarkable sudden change in the flora (with also a change of climate and soil) from the Malayan to Indo- Chinese. More than 60 genera of typical Malay plants entirely disappear, and many more are represented by a single species which has crossed the line, and disappears in Tenasserim. Among these plants are the Durioneae, Lowiaceae, Schismatoglottis, Homalomena, Cyrtandra, Neuwiedia, Plocoglottis, Leptaspis and most of Palms. A few plants from southern Siam and Cambodia have invaded the north of the Peninsula chiefly on the East side where the soil is most suitable. It Tenasserim— is quite clear that the Peninsula was separated from the Siam Isthmus of distant of region through the Kra at no very period time and was thus an island. The whole of the Peninsula (Malaya) contains about 52.000 square miles, and is about 485 miles long and 200 miles wide in its widest part. It consists of a mass of mountains usually rising to 5.000 feet alt., with two, Gunong Tahan and Gunong Kerbau 7.000 feet alt., and is west coast lowlands with the fringed on the by mangrove bordering and the East with on the latter the sea, on coast sandy plains.
    [Show full text]
  • A Classification of the Chloridoideae (Poaceae)
    Molecular Phylogenetics and Evolution 55 (2010) 580–598 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev A classification of the Chloridoideae (Poaceae) based on multi-gene phylogenetic trees Paul M. Peterson a,*, Konstantin Romaschenko a,b, Gabriel Johnson c a Department of Botany, National Museum of Natural History, Smithsonian Institution, Washington, DC 20013, USA b Botanic Institute of Barcelona (CSICÀICUB), Pg. del Migdia, s.n., 08038 Barcelona, Spain c Department of Botany and Laboratories of Analytical Biology, Smithsonian Institution, Suitland, MD 20746, USA article info abstract Article history: We conducted a molecular phylogenetic study of the subfamily Chloridoideae using six plastid DNA Received 29 July 2009 sequences (ndhA intron, ndhF, rps16-trnK, rps16 intron, rps3, and rpl32-trnL) and a single nuclear ITS Revised 31 December 2009 DNA sequence. Our large original data set includes 246 species (17.3%) representing 95 genera (66%) Accepted 19 January 2010 of the grasses currently placed in the Chloridoideae. The maximum likelihood and Bayesian analysis of Available online 22 January 2010 DNA sequences provides strong support for the monophyly of the Chloridoideae; followed by, in order of divergence: a Triraphideae clade with Neyraudia sister to Triraphis; an Eragrostideae clade with the Keywords: Cotteinae (includes Cottea and Enneapogon) sister to the Uniolinae (includes Entoplocamia, Tetrachne, Biogeography and Uniola), and a terminal Eragrostidinae clade of Ectrosia, Harpachne, and Psammagrostis embedded Classification Chloridoideae in a polyphyletic Eragrostis; a Zoysieae clade with Urochondra sister to a Zoysiinae (Zoysia) clade, and a Grasses terminal Sporobolinae clade that includes Spartina, Calamovilfa, Pogoneura, and Crypsis embedded in a Molecular systematics polyphyletic Sporobolus; and a very large terminal Cynodonteae clade that includes 13 monophyletic sub- Phylogenetic trees tribes.
    [Show full text]
  • Using the Checklist N W C
    Using the checklist • The arrangement of the checklist is alphabetical by family followed by genus, grouped under Pteridophyta, Gymnosperms, Monocotyledons and Dicotyledons. • All species and synonyms are arranged alphabetically under genus. • Accepted names are in bold print while synonyms or previously-used names are in italics. • In the case of synonyms, the currently used name follows the equals sign (=), and only refers to usage in Zimbabwe. • Distribution information is included under the current name. • The letters N, W, C, E, and S, following each listed taxon, indicate the known distribution of species within Zimbabwe as reflected by specimens in SRGH or cited in the literature. Where the distribution is unknown, we have inserted Distr.? after the taxon name. • All species known or suspected to be fully naturalised in Zimbabwe are included in the list. They are preceded by an asterisk (*). Species only known from planted or garden specimens were not included. Mozambique Zambia Kariba Mt. Darwin Lake Kariba N Victoria Falls Harare C Nyanga Mts. W Mutare Gweru E Bulawayo GREAT DYKEMasvingo Plumtree S Chimanimani Mts. Botswana N Beit Bridge South Africa The floristic regions of Zimbabwe: Central, East, North, South, West. A checklist of Zimbabwean vascular plants A checklist of Zimbabwean vascular plants edited by Anthony Mapaura & Jonathan Timberlake Southern African Botanical Diversity Network Report No. 33 • 2004 • Recommended citation format MAPAURA, A. & TIMBERLAKE, J. (eds). 2004. A checklist of Zimbabwean vascular plants.
    [Show full text]
  • Anatomical Adaptations of Myostachya Wightiana Hook
    Dhaka Univ. J. Biol. Sci. 20(2): 205‐208, 2011 (July) ‐ Short communication ANATOMICAL ADAPTATIONS OF MYRIOSTACHYA WIGHTIANA HOOK. F. TO SALT STRESS PARVEEN RASHID AND ASHFAQUE AHMED Department of Botany, University of Dhaka, Dhaka‐1000, Bangladesh Key words: Anatomy, Salt stress, Stem, Leaf, Root, Myriostachya wightiana A naturally adapted salt tolerant grass, Myriostachya wightiana found in the coastal saline area of Bangladesh, was studied for its adaptive mechanism in the internal structures of stem, leaf and root. In the stem, adaptive features include thick epidermis, 4 ‐ 5 layers thick walled sclerenchyma cells in the hypodermis, vascular bundles with prominent metaxylem, large phloem area, sclerification in the vascular bundles and around lacunae while in the root thick epidermis, lignification in the exodermis, thick cortex were noticed. Development of salt glands in the leaf, thick epidermis, sclerification in the vascular bundles, prominent metaxylem and large phloem area were found. All these anatomical modifications seemed to be crucial for its survival under saline environments. Morphological and anatomical adaptations in plant body are capable of minimizing detrimental effects of salt stress.(1) Natural populations, particularly many grass species had shown good tolerance to salinity.(2) Myriostachya wightiana Hook. f., belonging to the family Poaceae, is a perennial grass grows along the muddy creeks and channels in inter‐tidal mangrove swamps of Ganges Delta of India and Bangladesh and extending into Myanmar, Malaysia and Vietnam. It is the only species of the genus Myriostachya found in Bangladesh. In the western shoreline of Bangladesh where salinity is low, Myriostachya wightiana appears first within two years following surfacing of land from water.
    [Show full text]