DOCSLIB.ORG

Atypical Protein Kinase C Dependent Polarized Cell Division Is Required for Myocardial Trabeculation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Atypical Protein Kinase C Dependent Polarized Cell Division Is Required for Myocardial Trabeculation University of Nebraska Medical Center DigitalCommons@UNMC Theses & Dissertations Graduate Studies Fall 12-18-2015 Atypical Protein Kinase C Dependent Polarized Cell Division is Required for Myocardial Trabeculation Derek L. Passer University of Nebraska Medical Center Follow this and additional works at: https://digitalcommons.unmc.edu/etd Part of the Developmental Biology Commons Recommended Citation Passer, Derek L., "Atypical Protein Kinase C Dependent Polarized Cell Division is Required for Myocardial Trabeculation" (2015). Theses & Dissertations. 44. https://digitalcommons.unmc.edu/etd/44 This Dissertation is brought to you for free and open access by the Graduate Studies at DigitalCommons@UNMC. It has been accepted for inclusion in Theses & Dissertations by an authorized administrator of DigitalCommons@UNMC. For more information, please contact [email protected]. 1 Atypical Protein Kinase C Dependent Polarized Cell Division is Required for Myocardial Trabeculation By Derek Passer A DISSERTATION Presented to the Faculty of The Graduate College in the University of Nebraska In Partial Fulfillment of the Requirements For the Degree of Doctor of Philosophy Department of Cellular and Integrative Physiology Under the Supervision of Ibrahim J. Domian and Irving H. Zucker University of Nebraska Medical Center Omaha, Nebraska 2015 2 TABLE OF CONTENTS LIST OF FIGURES AND TABLES...........................................................................................4 LIST OF ABBREVIATIONS....................................................................................................6 CHAPTER I: INTRODUCTION .............................................................................................. 10 Development of the Early Mouse Heart ....................................................................... 11 Cell Polarity During Embryogenesis .............................................................................. 14 The Par Polarity Complex .............................................................................................. 15 Upstream Polarity Signaling Cues ................................................................................. 17 Function of the Par Complex in Multicellular Organisms ............................................. 17 Symmetric Polarized Divisions vs. Asymmetric Polarized Divisions ............................. 18 The Protein Kinase C Family ......................................................................................... 21 Essential Role of Prkci During Embryogenesis .............................................................. 21 Hypotheses: .................................................................................................................. 23 CHAPTER II: MATERIALS AND METHODS .......................................................................... 25 Immunohistochemistry ................................................................................................. 26 Animal breeding ............................................................................................................ 26 Image analysis ............................................................................................................... 27 Electron microscopy...................................................................................................... 27 Co-immunoprecipitation ............................................................................................... 28 qPCR .............................................................................................................................. 28 Ex vivo scratch assay ..................................................................................................... 30 Measurements, quantification, and statistical analysis ............................................... 30 CHAPTER III: RESULTS........................................................................................................ 32 Par Complex components localize asymmetrically in luminal myocardial cells. .......... 33 Prkci is required for polarized cell division, ventricular trabeculations, and embryonic viability. ......................................................................................................................... 51 NuMA is required for polarized cell division, ventricular trabeculations, and embryonic viability. ....................................................................................................... 66 Lineage tracing of ventricular trabeculations ............................................................... 76 CHAPTER IV: DISCUSSION ................................................................................................. 81 Summary and Main Experimental Findings .................................................................. 82 Polarity during embryogenesis ..................................................................................... 82 The Heart Polarity Model .............................................................................................. 83 Cardiac Jelly and Myocardial Polarity ........................................................................... 83 3 Hyaluronic acid does not signal myocardial polarity through CD44 ............................ 84 The role of Prkci during early cardiogeneis .................................................................. 85 In vitro cardiomyocyte polarization .............................................................................. 87 The role of NuMA during early cardiogeneis ................................................................ 88 Lineage tracing of early trabeculations ........................................................................ 89 Conclusions and perspectives ....................................................................................... 90 Polarity signaling during human disease ...................................................................... 90 Understanding myocardial polarity is essential for cardiovascular regenerative medicine ........................................................................................................................ 91 CHAPTER V: REFERENCES .................................................................................................. 92 4 LIST OF FIGURES AND TABLES Figure 1: Formation of trabeculations from the luminal surface of the primitive heart tube. .............................................................................................................................. 12 Figure 2: Diagram of Early Heart Development from E7.5-E10.5. ............................... 13 Figure 3: Partitioning (Par) complex proteins. ............................................................. 16 Figure 4: Symmetric vs. Asymmetric cell Division in Epithelial Cells. ........................... 20 Figure 5: Hypothetical Representation of the Spatial Organization of the Early Embryonic Heart. .......................................................................................................... 24 Figure 6: Luminal localization of Par complex members throughout the early embryonic heart. ........................................................................................................... 34 Figure 7: Luminal co-localization of Pard6g and Prkci in early embryonic hearts. ...... 35 Figure 8: Luminal localization of Par complex members in early embryonic hearts. .. 37 Figure 9: Confocal microscopy images of co-localization of Par complex members. 38 Figure 10: Polarized cell division in early mitotic luminal myocardial cells of E8.5 hearts. ........................................................................................................................... 40 Figure 11: Polarized cell division in late mitotic luminal myocardial cells of E8.5 hearts. ........................................................................................................................... 42 Hyaluronic Acid (HA) in the cardiac jelly is required for Par complex localization....... 43 Figure 12: HA in the cardiac jelly is required for Par complex localization in E8.5 mouse hearts. ............................................................................................................... 44 Figure 13: HA in the cardiac jelly is required for oriented cell division in early mitotic E8.5 cardiomyocytes. .................................................................................................... 45 Figure 14: HA in the cardiac jelly is required for oriented cell division in early mitotic E8.5 cardiomyocytes. .................................................................................................... 46 Figure 15: Figure 3: CD44 is not required for polarized cell division in E8.5 mouse hearts. ........................................................................................................................... 48 Figure 16: CD44 is not required for oriented cell division in early mitotic E8.5 cardiomyocytes. ............................................................................................................ 49 Figure 17: CD44 is not required for oriented cell division in late mitotic E8.5 cardiomyocytes. ............................................................................................................ 50 Figure 18: Genotypes of pups born from an Nkx 2.5+/cre/Prkci+/fl male crossed with a Prkcifl/fl female. ...........................................................................................................
Load more

Recommended publications
  • Supplemental Information Proximity Interactions Among Centrosome
    Current Biology, Volume 24 Supplemental Information Proximity Interactions among Centrosome Components Identify Regulators of Centriole Duplication Elif Nur Firat-Karalar, Navin Rauniyar, John R. Yates III, and Tim Stearns Figure S1 A Myc Streptavidin -tubulin Merge Myc Streptavidin -tubulin Merge BirA*-PLK4 BirA*-CEP63 BirA*- CEP192 BirA*- CEP152 - BirA*-CCDC67 BirA* CEP152 CPAP BirA*- B C Streptavidin PCM1 Merge Myc-BirA* -CEP63 PCM1 -tubulin Merge BirA*- CEP63 DMSO - BirA* CEP63 nocodazole BirA*- CCDC67 Figure S2 A GFP – + – + GFP-CEP152 + – + – Myc-CDK5RAP2 + + + + (225 kDa) Myc-CDK5RAP2 (216 kDa) GFP-CEP152 (27 kDa) GFP Input (5%) IP: GFP B GFP-CEP152 truncation proteins Inputs (5%) IP: GFP kDa 1-7481-10441-1290218-1654749-16541045-16541-7481-10441-1290218-1654749-16541045-1654 250- Myc-CDK5RAP2 150- 150- 100- 75- GFP-CEP152 Figure S3 A B CEP63 – – + – – + GFP CCDC14 KIAA0753 Centrosome + – – + – – GFP-CCDC14 CEP152 binding binding binding targeting – + – – + – GFP-KIAA0753 GFP-KIAA0753 (140 kDa) 1-496 N M C 150- 100- GFP-CCDC14 (115 kDa) 1-424 N M – 136-496 M C – 50- CEP63 (63 kDa) 1-135 N – 37- GFP (27 kDa) 136-424 M – kDa 425-496 C – – Inputs (2%) IP: GFP C GFP-CEP63 truncation proteins D GFP-CEP63 truncation proteins Inputs (5%) IP: GFP Inputs (5%) IP: GFP kDa kDa 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl Myc- 150- Myc- 100- CCDC14 KIAA0753 100- 100- 75- 75- GFP- GFP- 50- CEP63 50- CEP63 37- 37- Figure S4 A siCtl
    [Show full text]
  • Supplementary Information Method CLEAR-CLIP. Mouse Keratinocytes
    Supplementary Information Method CLEAR-CLIP. Mouse keratinocytes of the designated genotype were maintained in E-low calcium medium. Inducible cells were treated with 3 ug/ml final concentration doxycycline for 24 hours before performing CLEAR-CLIP. One 15cm dish of confluent cells was used per sample. Cells were washed once with cold PBS. 10mls of cold PBS was then added and cells were irradiated with 300mJ/cm2 UVC (254nM wavelength). Cells were then scraped from the plates in cold PBS and pelleted by centrifugation at 1,000g for 2 minutes. Pellets were frozen at -80oC until needed. Cells were then lysed on ice with occasional vortexing in 1ml of lysis buffer (50mM Tris-HCl pH 7.4, 100mM NaCl, 1mM MgCl2, 0.1 mM CaCl2, 1% NP-40, 0.5% Sodium Deoxycholate, 0.1% SDS) containing 1X protease inhibitors (Roche #88665) and RNaseOUT (Invitrogen #10777019) at 4ul/ml final concentration. Next, TurboDNase (Invitrogen #AM2238, 10U), RNase A (0.13ug) and RNase T1 (0.13U) were added and samples were incubated at 37oC for 5 minutes with occasional mixing. Samples were immediately placed on ice and then centrifuged at 16,160g at 4oC for 20 minutes to clear lysate. 25ul of Protein-G Dynabeads (Invitrogen #10004D) were used per IP. Dynabeads were pre-washed with lysis buffer and pre- incubated with 3ul of Wako Anti-Mouse-Ago2 (2D4) antibody. The dynabead/antibody mixture was added to the lysate and rocked for 2 hours at 4oC. All steps after the IP were done on bead until samples were loaded into the polyacrylamide gel.
    [Show full text]
  • The PRKCI and SOX2 Oncogenes Are Coamplified and Cooperate to Activate Hedgehog Signaling in Lung Squamous Cell Carcinoma
    Cancer Cell Article The PRKCI and SOX2 Oncogenes Are Coamplified and Cooperate to Activate Hedgehog Signaling in Lung Squamous Cell Carcinoma Verline Justilien,1 Michael P. Walsh,1 Syed A. Ali,1 E. Aubrey Thompson,1 Nicole R. Murray,1 and Alan P. Fields1,* 1Department of Cancer Biology, Mayo Clinic Cancer Center, Jacksonville, FL 32224, USA *Correspondence: fi[email protected] http://dx.doi.org/10.1016/j.ccr.2014.01.008 SUMMARY We report that two oncogenes coamplified on chromosome 3q26, PRKCI and SOX2, cooperate to drive a stem-like phenotype in lung squamous cell carcinoma (LSCC). Protein kinase Ci (PKCi) phosphorylates SOX2, a master transcriptional regulator of stemness, and recruits it to the promoter of Hedgehog (Hh) acyltransferase (HHAT) that catalyzes the rate-limiting step in Hh ligand production. PKCi-mediated SOX2 phosphorylation is required for HHAT promoter occupancy, HHAT expression, and maintenance of a stem-like phenotype. Primary LSCC tumors coordinately overexpress PKCi, SOX2, and HHAT and require PKCi-SOX2-HHAT signaling to maintain a stem-like phenotype. Thus, PKCi and SOX2 are genetically, biochemically, and functionally linked in LSCC, and together they drive tumorigenesis by establishing a cell-autonomous Hh signaling axis. INTRODUCTION Similar cell populations exist in several cancer types (Chen et al., 2012; Driessens et al., 2012; Schepers et al., 2012). Line- Lung cancer is the major cause of cancer death, with a 5-year- age tracing reveals these cells clonally expand to give rise to survival rate of 16% (Siegel et al., 2012). Non-small cell lung malignant and nonmalignant, differentiated cell types.
    [Show full text]
  • Downloaded from Bioscientifica.Com at 10/04/2021 03:09:50PM Via Free Access
    242 S-M Ho et al. Regulation of centrosome 24:2 83–96 Research duplication by BPA analogues Bisphenol A and its analogues disrupt centrosome cycle and microtubule dynamics in prostate cancer Shuk-Mei Ho1,2,3,4, Rahul Rao1, Sarah To1,5,6, Emma Schoch1 and Pheruza Tarapore1,2,3 1Department of Environmental Health, University of Cincinnati Medical Center, Cincinnati, Ohio, USA 2Center for Environmental Genetics, University of Cincinnati Medical Center, Cincinnati, Ohio, USA Correspondence 3Cincinnati Cancer Center, Cincinnati, Ohio, USA should be addressed 4Cincinnati Veteran Affairs Hospital Medical Center, Cincinnati, Ohio, USA to S-M Ho or P Tarapore 5Center for Cancer Research, Hudson Institute of Medical Research, Clayton, Victoria, Australia Email 6Monash University, Clayton, Victoria, Australia [email protected] or [email protected] Abstract Humans are increasingly exposed to structural analogues of bisphenol A (BPA), as Key Words BPA is being replaced by these compounds in BPA-free consumer products. We have f endocrine-disrupting previously shown that chronic and developmental exposure to BPA is associated with chemicals increased prostate cancer (PCa) risk in human and animal models. Here, we examine f bisphenol A analogues whether exposure of PCa cells (LNCaP, C4-2) to low-dose BPA and its structural analogues f BPA (BPS, BPF, BPAF, TBBPA, DMBPA and TMBPA) affects centrosome amplification (CA), f BPS a hallmark of cancer initiation and progression. We found that exposure to BPA, BPS, f BPF DMBPA and TBBPA, in descending order, increased the number of cells with CA, in a non- f TBBPA Endocrine-Related Cancer Endocrine-Related monotonic dose–response manner.
    [Show full text]
  • The Emerging Role of Ncrnas and RNA-Binding Proteins in Mitotic Apparatus Formation
    non-coding RNA Review The Emerging Role of ncRNAs and RNA-Binding Proteins in Mitotic Apparatus Formation Kei K. Ito, Koki Watanabe and Daiju Kitagawa * Department of Physiological Chemistry, Graduate School of Pharmaceutical Science, The University of Tokyo, Bunkyo, Tokyo 113-0033, Japan; [email protected] (K.K.I.); [email protected] (K.W.) * Correspondence: [email protected] Received: 11 November 2019; Accepted: 13 March 2020; Published: 20 March 2020 Abstract: Mounting experimental evidence shows that non-coding RNAs (ncRNAs) serve a wide variety of biological functions. Recent studies suggest that a part of ncRNAs are critically important for supporting the structure of subcellular architectures. Here, we summarize the current literature demonstrating the role of ncRNAs and RNA-binding proteins in regulating the assembly of mitotic apparatus, especially focusing on centrosomes, kinetochores, and mitotic spindles. Keywords: ncRNA; centrosome; kinetochore; mitotic spindle 1. Introduction Non-coding RNAs (ncRNAs) are defined as a class of RNA molecules that are transcribed from genomic DNA, but not translated into proteins. They are mainly classified into the following two categories according to their length—small RNA (<200 nt) and long non-coding RNA (lncRNA) (>200 nt). Small RNAs include traditional RNA molecules, such as transfer RNA (tRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), PIWI-interacting RNA (piRNA), and micro RNA (miRNA), and they have been studied extensively [1]. Research on lncRNA is behind that on small RNA despite that recent transcriptome analysis has revealed that more than 120,000 lncRNAs are generated from the human genome [2–4].
    [Show full text]
  • CDK5 Functions As a Tumor Promoter in Human Lung Cancer Jie Zeng1#, Shuanshuan Xie1#, Yang Liu1, Changxing Shen1, Xiaolian Song1, Guo-Lei Zhou2, 3, Changhui Wang1
    Journal of Cancer 2018, Vol. 9 3950 Ivyspring International Publisher Journal of Cancer 2018; 9(21): 3950-3961. doi: 10.7150/jca.25967 Research Paper CDK5 Functions as a Tumor Promoter in Human Lung Cancer Jie Zeng1#, Shuanshuan Xie1#, Yang Liu1, Changxing Shen1, Xiaolian Song1, Guo-Lei Zhou2, 3, Changhui Wang1 1. Department of Respiratory Medicine, Shanghai Tenth People’s Hospital, Tongji University, Shanghai 200072, PR China; 2. Department of Biological Sciences, Arkansas State University, State University, AR 72467, USA; 3. Molecular Biosciences Program, Arkansas State University, State University, AR 72467, USA. # These authors have contributed equally to this work. Corresponding author: Changhui Wang, No.301, Mid Yanchang Rd, Department of Respiratory Medicine, Shanghai Tenth People’s Hospital, Tongji University, Shanghai, China, 200072. Email: [email protected], Fax number: 86-021-66301685, Telephone: 86-021-66301685 © Ivyspring International Publisher. This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) license (https://creativecommons.org/licenses/by-nc/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2018.03.09; Accepted: 2018.08.19; Published: 2018.10.10 Abstract Cyclin-dependent kinase 5 (CDK5), an atypical member of the cyclin-dependent kinase family, plays an important role in the nervous system. Recent studies have shown that CDK5 is also associated with tumors. However, few studies have been done to investigate the mechanism underlying the connection between CDK5 and cancers. To explore the role of CDK5 in cancers by using an extensive bioinformatics data mining process. We mined the transcriptional, survival, functions and structure of CDK5 gene through databases and in vitro experiments.
    [Show full text]
  • CEP63 Deficiency Promotes P53-Dependent Microcephaly and Reveals a Role for the Centrosome in Meiotic Recombination
    ARTICLE Received 25 Mar 2015 | Accepted 30 May 2015 | Published 9 Jul 2015 DOI: 10.1038/ncomms8676 CEP63 deficiency promotes p53-dependent microcephaly and reveals a role for the centrosome in meiotic recombination Marko Marjanovic´1,2, Carlos Sa´nchez-Huertas1,*, Berta Terre´1,*, Rocı´oGo´mez3, Jan Frederik Scheel4,w, Sarai Pacheco5,6, Philip A. Knobel1, Ana Martı´nez-Marchal5,6, Suvi Aivio1, Lluı´s Palenzuela1, Uwe Wolfrum4, Peter J. McKinnon7, Jose´ A. Suja3, Ignasi Roig5,6, Vincenzo Costanzo8, Jens Lu¨ders1 & Travis H. Stracker1 CEP63 is a centrosomal protein that facilitates centriole duplication and is regulated by the DNA damage response. Mutations in CEP63 cause Seckel syndrome, a human disease characterized by microcephaly and dwarfism. Here we demonstrate that Cep63-deficient mice recapitulate Seckel syndrome pathology. The attrition of neural progenitor cells involves p53-dependent cell death, and brain size is rescued by the deletion of p53. Cell death is not the result of an aberrant DNA damage response but is triggered by centrosome-based mitotic errors. In addition, Cep63 loss severely impairs meiotic recombination, leading to profound male infertility. Cep63-deficient spermatocytes display numerical and structural centrosome aberrations, chromosome entanglements and defective telomere clustering, suggesting that a reduction in centrosome-mediated chromosome movements underlies recombination failure. Our results provide novel insight into the molecular pathology of microcephaly and establish a role for the centrosome in meiotic recombination. 1 Institute for Research in Biomedicine (IRB Barcelona), Barcelona 08028, Spain. 2 Division of Molecular Medicine, Rud–er Bosˇkovic´ Institute, Zagreb 10000, Croatia. 3 Departamento de Biologı´a, Edificio de Biolo´gicas, Universidad Auto´noma de Madrid, Madrid 28049, Spain.
    [Show full text]
  • GAK and PRKCD Are Positive Regulators of PRKN-Independent
    bioRxiv preprint doi: https://doi.org/10.1101/2020.11.05.369496; this version posted November 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 GAK and PRKCD are positive regulators of PRKN-independent 2 mitophagy 3 Michael J. Munson1,2*, Benan J. Mathai1,2, Laura Trachsel1,2, Matthew Yoke Wui Ng1,2, Laura 4 Rodriguez de la Ballina1,2, Sebastian W. Schultz2,3, Yahyah Aman4, Alf H. Lystad1,2, Sakshi 5 Singh1,2, Sachin Singh 2,3, Jørgen Wesche2,3, Evandro F. Fang4, Anne Simonsen1,2* 6 1Division of Biochemistry, Department of Molecular Medicine, Institute of Basic Medical Sciences, University of Oslo 7 2Centre for Cancer Cell Reprogramming, Institute of Clinical Medicine, Faculty of Medicine, University of Oslo, N-0316, Oslo, Norway. 8 3Department of Molecular Cell Biology, The Norwegian Radium Hospital Montebello, N-0379, Oslo, Norway 9 4Department of Clinical Molecular Biology, University of Oslo and Akershus University Hospital, 1478 Lørenskog, Norway 10 11 Keywords: GAK, Cyclin G Associated Kinase, PRKCD, Protein Kinase C Delta, Mitophagy, DFP, 12 DMOG, PRKN 13 14 *Corresponding Authors: 15 [email protected] 16 [email protected] 17 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.05.369496; this version posted November 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • PCM1 Is Necessary for Focal Ciliary Integrity and Is a Candidate for Severe Schizophrenia
    ARTICLE https://doi.org/10.1038/s41467-020-19637-5 OPEN PCM1 is necessary for focal ciliary integrity and is a candidate for severe schizophrenia Tanner O. Monroe 1,2, Melanie E. Garrett3, Maria Kousi4, Ramona M. Rodriguiz5,6, Sungjin Moon7, Yushi Bai8, Steven C. Brodar8, Karen L. Soldano3, Jeremiah Savage9, Thomas F. Hansen10,11, Donna M. Muzny12,13, Richard A. Gibbs12,13, Lawrence Barak8, Patrick F. Sullivan14,15,16, Allison E. Ashley-Koch 3, ✉ Akira Sawa 17,18,19,20, William C. Wetsel 5,6,8,21, Thomas Werge 10,11,22,23 & Nicholas Katsanis 1,2 1234567890():,; The neuronal primary cilium and centriolar satellites have functions in neurogenesis, but little is known about their roles in the postnatal brain. We show that ablation of pericentriolar material 1 in the mouse leads to progressive ciliary, anatomical, psychomotor, and cognitive abnormalities. RNAseq reveals changes in amine- and G-protein coupled receptor pathways. The physiological relevance of this phenotype is supported by decreased available dopamine D2 receptor (D2R) levels and the failure of antipsychotic drugs to rescue adult behavioral defects. Immunoprecipitations show an association with Pcm1 and D2Rs. Finally, we sequence PCM1 in two human cohorts with severe schizophrenia. Systematic modeling of all discovered rare alleles by zebrafish in vivo complementation reveals an enrichment for pathogenic alleles. Our data emphasize a role for the pericentriolar material in the postnatal brain, with progressive degenerative ciliary and behavioral phenotypes; and they support a contributory role for PCM1 in some individuals diagnosed with schizophrenia. 1 Department of Pediatrics, Northwestern University Feinberg School of Medicine, Chicago, IL 60611, USA.
    [Show full text]
  • Suppl. Table 1
    Suppl. Table 1. SiRNA library used for centriole overduplication screen. Entrez Gene Id NCBI gene symbol siRNA Target Sequence 1070 CETN3 TTGCGACGTGTTGCTAGAGAA 1070 CETN3 AAGCAATAGATTATCATGAAT 55722 CEP72 AGAGCTATGTATGATAATTAA 55722 CEP72 CTGGATGATTTGAGACAACAT 80071 CCDC15 ACCGAGTAAATCAACAAATTA 80071 CCDC15 CAGCAGAGTTCAGAAAGTAAA 9702 CEP57 TAGACTTATCTTTGAAGATAA 9702 CEP57 TAGAGAAACAATTGAATATAA 282809 WDR51B AAGGACTAATTTAAATTACTA 282809 WDR51B AAGATCCTGGATACAAATTAA 55142 CEP27 CAGCAGATCACAAATATTCAA 55142 CEP27 AAGCTGTTTATCACAGATATA 85378 TUBGCP6 ACGAGACTACTTCCTTAACAA 85378 TUBGCP6 CACCCACGGACACGTATCCAA 54930 C14orf94 CAGCGGCTGCTTGTAACTGAA 54930 C14orf94 AAGGGAGTGTGGAAATGCTTA 5048 PAFAH1B1 CCCGGTAATATCACTCGTTAA 5048 PAFAH1B1 CTCATAGATATTGAACAATAA 2802 GOLGA3 CTGGCCGATTACAGAACTGAA 2802 GOLGA3 CAGAGTTACTTCAGTGCATAA 9662 CEP135 AAGAATTTCATTCTCACTTAA 9662 CEP135 CAGCAGAAAGAGATAAACTAA 153241 CCDC100 ATGCAAGAAGATATATTTGAA 153241 CCDC100 CTGCGGTAATTTCCAGTTCTA 80184 CEP290 CCGGAAGAAATGAAGAATTAA 80184 CEP290 AAGGAAATCAATAAACTTGAA 22852 ANKRD26 CAGAAGTATGTTGATCCTTTA 22852 ANKRD26 ATGGATGATGTTGATGACTTA 10540 DCTN2 CACCAGCTATATGAAACTATA 10540 DCTN2 AACGAGATTGCCAAGCATAAA 25886 WDR51A AAGTGATGGTTTGGAAGAGTA 25886 WDR51A CCAGTGATGACAAGACTGTTA 55835 CENPJ CTCAAGTTAAACATAAGTCAA 55835 CENPJ CACAGTCAGATAAATCTGAAA 84902 CCDC123 AAGGATGGAGTGCTTAATAAA 84902 CCDC123 ACCCTGGTTGTTGGATATAAA 79598 LRRIQ2 CACAAGAGAATTCTAAATTAA 79598 LRRIQ2 AAGGATAATATCGTTTAACAA 51143 DYNC1LI1 TTGGATTTGTCTATACATATA 51143 DYNC1LI1 TAGACTTAGTATATAAATACA 2302 FOXJ1 CAGGACAGACAGACTAATGTA
    [Show full text]
  • Pericentrin Polyclonal Antibody Catalog Number:22271-1-AP 1 Publications
    For Research Use Only Pericentrin Polyclonal antibody Catalog Number:22271-1-AP 1 Publications www.ptglab.com Catalog Number: GenBank Accession Number: Purification Method: Basic Information 22271-1-AP NM_006031 Antigen affinity purification Size: GeneID (NCBI): Recommended Dilutions: 150UL , Concentration: 800 μg/ml by 5116 IF 1:50-1:500 Nanodrop and 360 μg/ml by Bradford Full Name: method using BSA as the standard; pericentrin Source: Calculated MW: Rabbit 378 kDa Isotype: IgG Applications Tested Applications: Positive Controls: IF,ELISA IF : MDCK cells, Cited Applications: IF Species Specificity: human, Canine Cited Species: human PCNT, also named as KIAA0402, PCNT2, Pericentrin-B and Kendrin, is an integral component of the filamentous Background Information matrix of the centrosome involved in the initial establishment of organized microtubule arrays in both mitosis and meiosis. PCNT plays a role, together with DISC1, in the microtubule network formation. Is an integral component of the pericentriolar material (PCM). PCNT is a marker of centrosome. Defects in PCNT are the cause of microcephalic osteodysplastic primordial dwarfism type 2 (MOPD2). The antibody is specific to PCNT, and it can recognize isoform 1 and 2. Notable Publications Author Pubmed ID Journal Application Won-Jing Wang 26609813 Elife IF Storage: Storage Store at -20°C. Stable for one year after shipment. Storage Buffer: PBS with 0.02% sodium azide and 50% glycerol pH 7.3. Aliquoting is unnecessary for -20ºC storage For technical support and original validation data for this product please contact: This product is exclusively available under Proteintech T: 1 (888) 4PTGLAB (1-888-478-4522) (toll free E: [email protected] Group brand and is not available to purchase from any in USA), or 1(312) 455-8498 (outside USA) W: ptglab.com other manufacturer.
    [Show full text]
  • PCM1 Monoclonal Antibody (CL0206) Catalog Number MA5-24589 Product Data Sheet
    Lot Number: 02985 Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 thermofisher.com/contactus PCM1 Monoclonal Antibody (CL0206) Catalog Number MA5-24589 Product Data Sheet Details Species Reactivity Size 100 µl Tested species reactivity Human Host / Isotype Mouse IgG1 Tested Applications Dilution * Class Monoclonal Immunohistochemistry (IHC) Assay-Dependent Type Antibody Western Blot (WB) 1 µg/mL Clone CL0206 * Suggested working dilutions are given as a guide only. It is recommended that the user titrate the product for use in their own experiment using appropriate negative and positive controls. Immunogen Recombinant protein corresponding to Human PCM1 Conjugate Unconjugated Form Liquid Concentration 0.7mg/ml Purification Protein A Storage Buffer PBS, pH 7.2, with 40% glycerol Contains 0.02% sodium azide Store at 4°C short term. For long Storage Conditions term storage, store at -20°C, avoiding freeze/thaw cycles. Product Specific Information Immunogen sequence: TIYSEVATLI SQNESRPHFL IELFHELQLL NTDYLRQRAL YALQDIVSRH ISESHEKGEN VKSVNSGTWI ASNSELTPSE SLATTDDETF EKNFE Highest antigen sequence identity to the following orthologs: Mouse - 94%, Rat - 95%. Binds to an epitope located within the peptide sequence RQRALYALQD as determined by overlapping synthetic peptides. Background/Target Information PCM-1 is required for centrosome assembly and function. This protein is essential for the correct localization of several centrosomal proteins including CEP250, CETN3, PCNT and NEK2. The protein is required to anchor microtubules to the centrosome. For Research Use Only. Not for use in diagnostic procedures. Not for resale without express authorization. For Research Use Only. Not for use in diagnostic procedures.
    [Show full text]