USOO8932839B2

(12) United States Patent (10) Patent No.: US 8,932,839 B2 Breuer et al. (45) Date of Patent: Jan. 13, 2015

(54) METHOD FOR THE BIOCATALYTIC USPC ...... 435/155, 166, 233 CYCLIZATION OF TERPENES AND See application file for complete search history. CYCLASE MUTANTS EMPLOYABLE THEREN (56) References Cited

(75) Inventors: Michael Breuer, Darmstadt (DE); FOREIGN PATENT DOCUMENTS Bernhard Hauer, Fu?gönheim (DE); Dieter Jendrossek, Tübingen (DE); WO WO-2010.139719 A2 12/2010 Gabriele Siedenburg, Stuttgart (DE); Juergen Pleiss, Asperg (DE); Demet OTHER PUBLICATIONS Sirim, Stuttgart (DE); Silvia Racolta, Devos et al., (Proteins: Structure, Function and Genetics, 2000, vol. Stuttgart (DE) 41: 98-107. Whisstocket al., (Quarterly Reviews of Biophysics 2003, vol. 36 (3): (73) Assignee: BASFSE, Ludwigshafen (DE) 307-340. *) Notice: Subject to anyy disclaimer, the term of this Witkowski et al., (Biochemistry 38: 11643-11650, 1999.* Kisselev L. (Structure, 2002, vol. 10:8-9.* patent is extended or adjusted under 35 Neumann et al Biol Chem. 1986, vol. 367, p. 723-729.* U.S.C. 154(b) by 93 days. "Nomenclature Committee of the International Union of Biochem istry and Molecular Biology (NC-IUBMB). Enzyme Supplement 5 (21) Appl. No.: 13/297,798 (1999), Eur, J. Biochem., 1999, vol. 264, pp. 610-650. Daum, M. et al., “Genes and Enzymes Involved in Bacterial (22) Filed: Nov. 16, 2011 Isoprenoid Biosynthesis”. Current Opinion in Chemical Biology, 2009, vol. 13, pp. 180-188. (65) Prior Publication Data Seo, J.-S. et al., “The Genome Sequence of the Ethanologenic Bac US 2012/O237991 A1 Sep. 20, 2012 terium Zymomonas mobilis ZM4” Nature Biotechnology, 2005, vol. 23, No. 1, pp. 63-68. Related U.S. Application Data * cited by examiner (60) Provisional application No. 61/414,434, filed on Nov. 17, 2010, provisional application No. 61/499.228, Primary Examiner — Tekchand Saidha filed on Jun. 21, 2011, provisional application No. Assistant Examiner — Md. Younus Meah 61/540,028, filed on Sep. 28, 2011. (74) Attorney, Agent, or Firm — Drinker Biddle & Reath (51) Int. Cl. LLP CI2P 5/00 (2006.01) CI2N I/19 (2006.01) (57) ABSTRACT CI2P 7/02 (2006.01) The present invention relates to novel mutants with cyclase CI2N 9/88 (2006.01) activity and use thereof in a method for biocatalytic cycliza (52) U.S. Cl. tion of terpenes, such as in particular for the production of CPC. CI2N 9/88 (2013.01); C12P 7/02 (2013.01); isopulegol by cyclization of citronellal; a method for the CI2P5/007 (2013.01); C12Y504/99017 preparation of menthol and methods for the biocatalytic con (2013.01) version of further compounds with structural motifs similar to USPC ...... 435/155; 435/166; 435/233 terpene. (58) Field of Classification Search CPC ...... C12P 5/007; C12N 9/88 22 Claims, 4 Drawing Sheets

U.S. Patent Jan. 13, 2015 Sheet 3 of 4 US 8,932,839 B2

100 rps or O 80 70 GO 50 (1) Scalen 2C : : of O

S. Citioch

: stop lago 3 No-Spigo so-soulego;

Kotoic Ap Bj Sc Zh S-Cl Zin SiCl2 Fig.5 U.S. Patent Jan. 13, 2015 Sheet 4 of 4 US 8,932,839 B2

100

O Citi’orea : soft logo

Nec) is optiego sort studigo

Kohtric A) 3. Sc Z SEC 1 ZnS, C2

OO , ------, , , , , , ------, , , , ,-, , , , ------, -, 90 8O O 60 S Citro (a SO isoploggi O ; : Neo-isopiego 30 E so-Isopulego 20 ; 10

Kot 'oe A} B S. Zn, SEC 1 Zn, SEC2 US 8,932,839 B2 1. 2 METHOD FOR THE BOCATALYTC base catalyst, Zeolite or silica gel. In recent times the silica gel CYCLIZATION OF TERPENES AND method has increasingly been superseded by the method with Zinc bromide, as the latter has higher selectivity. CYCLASE MUTANTS EMPLOYABLE The cyclization ofterpenes with the aid of special cyclases THEREN is generally known. For example, in nature squalene is cyclized by a squalene-hopene cyclase (SHC) to the pentacy RELATED APPLICATIONS clic hopene. The gene and protein sequences of squalene-hopene This application claims the benefit under 35 U.S.C. S 119 cyclase derived from the bacterium Zymomonas mobilia (e) of U.S. Provisional Application 61/414,434, filed Nov. 17. (Zm-SHC) are known (Genpept Accession No AAV90172 2010; U.S. Provisional Application 61/499.228, filed Jun. 21, 10 2004 and Nat Biotechnol 2005, 23:63-68, cf. SEQID NO: 1 2011; and U.S. Provisional Application 61/540,028, filed and 2). Sep. 28, 2011. In international application PCT/EP2010/057696 (WO2010139719 A2), to the complete disclosure of which SUBMISSION OF SEQUENCE LISTING reference is expressly made herein, polypeptides are pro 15 posed as biocatalysts for the cyclization homofarnesol to The Sequence Listing associated with this application is ambroXan. filed in electronic format via EFS-Web and hereby incorpo The biosynthesis of numerous monoterpenes in the corre rated by reference into the specification in its entirety. The sponding production organisms has already been elucidated. name of the text file containing the Sequence Listing is Thir Frequently this involves cyclization of linear precursor mol d Revised Sequence List 1311 1 00194 US. The size of ecules by highly specific biocatalysts. The precursors are the text file is 1,428 KB, and the text file was created on May generally esters of linear terpene alcohols and diphosphoric 31, 2012. acid. One typical example of Such a precursor is geranyl The present invention relates to novel methods for cycliz pyrophosphate. The pyrophosphate group is eliminated from ing terpenes using cyclases and to novel mutants with cyclase the molecule enzymatically, and is Subsequently hydrolyzed activity and use thereof in a method for biocatalytic cycliza into two phosphate ions. On the other side, a carbocation is tion of terpenes, such as in particular for the production of 25 formed, which is then able to undergo further intramolecular isopulegol by cyclization of citronellal; a method for the reaction and which recombines to form a cyclic monoterpene, preparation of menthol and methods for the biocatalytic con with elimination of a proton, for example (Curr. Opin. Chem. version of further compounds with structural motifs similar to Biol. 2009, 13: 180-188). terpene. A problem to be solved by the present invention, further 30 more, was to find an alternative to the known chemical BACKGROUND OF THE INVENTION cyclization methods for terpenes, allowing terpene com pounds to be cyclized by means of enzymatic catalysis, such Isopulegol of formula (II) (2-isopropenyl-5-methyl-cyclo as the linear citronellal to be cyclized to isopulegol, for hexanol) is a terpene that is used as an aroma compound, to example. generate “flower notes”. Moreover, it is an intermediate in the 35 The problem to be solved by the present invention was synthesis of menthol from citral. furthermore to provide novel biocatalysts that can be used for the cyclization of terpenes, for example of citronellal with formation ofisopulegol.

40 SUMMARY OF THE INVENTION N. Cyclase The above first problem is solved by a method of produc O He OH tion of isopulegol of general formula (I) (I) (I) (II) 45 Citronellal Isopulegol Isopulegol isomers occur in nature in a large number of essential oils. As isopulegol is formed relatively easily from OH citronellal, the compound of formula (I) (3,7-dimethyloct-6- 50 en-1-al), it often occurs accompanying citronellal or is formed during extraction of the essential oil. Isopulegol, which is produced industrially from (+)-citronellal, is as a rule a mixture of different isomers with a high proportion of comprising one reaction step, (-)-isopulegol. wherein citronellal of general formula (II) The industrial production of isopulegol is mainly carried 55 out by the chemical cyclization of (+)-citronellal. Originally (II) 80-85% pure raw material obtained from citronella oil was used. Since the 1990s this has increasingly been replaced with the optically purer (+)-citronellal (97.5%) from the so-called Takasago process. Here, geranyldiethyldiamine is isomerized 60 asymmetrically to (+)-citronellal using an Rh-BINAP-com No plex catalyst (Rh-complex with 2,2'-bis-(diphenylphos phino)-1,1'-binaphthyl). The chemical synthesis of isopulegol starting from cit ronellal has been described many times. (+)-Citronellal can 65 is cyclized biocatalytically to the corresponding isopulegol of be cyclized using a copper-chromium catalyst, Zinc bromide, formula (I) by means of an enzyme having the activity of alkylaluminum chloride, a rhodium complex, a solid acid citronellal-isopulegol cyclase. US 8,932,839 B2 3 4 The above second problem could, surprisingly, be solved On the basis of the reversibility of enzymatic reactions, the by providing mutants of wild-type enzymes, such as Zm present invention relates to the enzymatic reactions described SHC-1 (SEQID NO:2). In particular it was in fact found that herein in both directions of reaction. through targeted introduction of mutations in at least one “Functional mutants’ of a “cyclase' include the “func highly conserved sequence position in said cyclases, in par tional equivalents of such enzymes defined below. ticular squalene-hopene cyclases (cf. alignment of SEQ ID The term “biocatalytic process' refers to any process car NOs. 2 to 326, below) the enzymatic activity can be influ ried out in the presence of catalytic activity of a “cyclase' enced in the desired manner. according to the invention or of an enzyme with “cyclase activity', i.e. processes in the presence of raw, or purified, DESCRIPTION OF THE FIGURES 10 dissolved, dispersed or immobilized enzyme, or in the pres ence of whole microbial cells, which have or express such FIG. 1a shows the wad-type amino acid sequence (SEQID enzyme activity. Biocatalytic processes therefore include NO: 2) of squalene-hopene cyclase 1 from Zymomonas mobi both enzymatic and microbial processes. lis (Zm-SHC-1). Position 486 of saturation mutagenesis is The term “stereospecific’ means that one of several pos marked. 15 sible stereoisomers of a compound produced according to the FIG. 1b shows the wild-type nucleic acid sequence (SEQ invention is produced with at least one asymmetry center by ID NO: 1) of Zm-SHC-1. Positions 1456-1458 of saturation the action of an enzyme according to the invention in high mutagenesis are marked. “enantiomeric excess' or high “enantiomeric purity”, for FIG. 2 shows the turnover of the SHC 1 WT protein example at least 90% ee, in particular at least 95% ee, or at compared with the F486A mutant as a function of time with least 98% ee, or at least 99% ee. The ee 96 value is calculated 10 mM R(+)- and S(-)-citronellal as substrate. The percent from the following formula: age distribution of Substrate and isopulegol product isomers after incubation for various times at 30° C. is shown in each case. Citronellal (diamonds), isopulegol I (squares), isopule 25 in which X and X stand for the mole fraction ofenantiomers gol II (triangles) and isopulegol III (crosses). A and B respectively. FIG. 3 shows the turnover of the various mutants of Zm “First sphere residues and “second sphere residues are SHC-1 compared with the wild type (wt) and the control amino acid residues which, based on structural analyses of the without enzyme (K) with 10 mM citronellal racemate as protein, are assigned a special proximity to the reactive center Substrate. The percentage distribution of Substrate and isop 30 of the cyclase. The criterion for the first sphere is the distance ulegol product isomers after incubation overnight at 30°C. is from the ligand 2-azasqualene, which is given in a published shown in each case. X-ray structure (pdb: 1 ump). These residues were determined FIG. 4 shows the turnover of the various Zm-SHC-1 automatically with a computer program (ligin. Weizman mutants compared with the wild type (wt) and the control n.ac.il/cgi-bin/lpccSu/LpcCsu.cgi; Sobolev V. Sorokine A, 35 Prilusky J. Abola E. E. Edelman M. Automated analysis of without enzyme (K) with 25 mM squalene as substrate in the interatomic contacts in proteins. Bioinformatics 1999; 15(4): presence of 1% Triton. The percentage distribution of 327-332). This program assumes that two molecules are in squalene and hopene after incubation for 70 h at 30° C. is contact with each other when the distance between their shown in each case. atoms corresponds to the sum of their van der Waals radiit 1 FIGS. 5 to 7 show the reaction of in each case 20 mM 40 A. The second sphere includes all amino acids that are located substrate after incubation overnight with the mutants Ap in a radius of 5 A to each residue of the first sphere. Such SHC: F481C, B-SHC: F447C, Sc-SHC: F449C, Zm SHC-2: residues therefore appear to be especially suitable for under F438C and Zm SHC-1 compared with the control; the sub taking directed mutation, for further targeted modification of strates were citronellal racemate in FIG. 5, R(+)-citronellal in the enzyme activity. FIG. 6 and S(-)-citronellal in FIG. 7. 45 “Cyclase activity”, determined with a “reference substrate under standard conditions', is e.g. an enzyme activity that DETAILED DESCRIPTION OF THE INVENTION describes the formation of a cyclic product from a noncyclic Substrate. Standard conditions are e.g. Substrate concentra A. General Definitions tions from 10 mM to 0.2 M, in particular 15 to 100 mM, for 50 example about 20 to 25 mM, at pH4 to 8, and attemperatures “Cyclases” in the sense of the present invention are gener of e.g. 15 to 30 or 20 to 25°C. It can be determined with ally enzymes or enzyme mutants, which in particular display recombinant cyclase-expressing cells, lysed cyclase-express the activity of a citronellal-isopulegol cyclase. Intramolecular ing cells, fractions thereof or enriched or purified cyclase transferases from the isomerase subclass are Suitable as enzyme. In particular the reference substrate is a citronellal of enzymes with the activity of a citronellal-isopulegol cyclase; 55 formula (II); in particular R(+)-citronellal, or a citronellal i.e. proteins with the EC number EC 5.4. (Enzyme code racemate, in a concentration from 15 to 100 mM or about 20 according to Eur. J. Biochem. 1999, 264, 610-650). In par to 25 mM, at 20 to 25°C. and pH 4-6, such as 4.5; as is also ticular they are representatives of EC 5.4.99.17. described in more detail in the examples. Suitable enzymes with the activity of a citronellal-isopule An “F486-analog position corresponds to position F486 gol cyclase are in particular those cyclases that also bring 60 according to SEQ ID NO:2 from the functional standpoint about the cyclization of homofarnesol to ambroxan or of and can be determined by sequence alignment of SHCs from squalene to hopene (hence sometimes also designated organisms other than Zymomonas mobilis as explained “SHC': squalene hopene cyclase) and which are described in herein. For example the F486-analog position of SEQ ID detail in international application PCT/EP2010/057696, to NO:3 is position F449 and of SEQIDNO:4 position F481 and which reference is expressly made here. In particular, cycla 65 of SEQID NO:5 position F447 and of SEQID NO:6 position ses according to the invention are those that are derived by F438. Corresponding analogies apply to the other sequence mutation of SHCs. positions described concretely for SEQID NO: 2 herein, such US 8,932,839 B2 5 6 as the so-called “first sphere residues and “second sphere residues” or of the DXDD motif and their analogous positions in SEQID NO:3 to 326). R S “Terpenes are hydrocarbons that are made up of isoprene units (C5 units), in particular noncyclic terpenes, for example R S squalene, the carbon number of which is divisible by 5. “Terpenoids are substances that are derived from terpe OH 'OH nes, in particular noncyclic terpenes, e.g. by additional inser tion of carbon atoms and/or heteroatoms, for example cit 1S N ronellal. 10 “Terpene-like compounds for the purposes of the present 1R, 3R,6S 1S, 3S,6R invention comprise in particular hose compounds which fall Isopulegol within the general structural formula (IV) as defined below. Generally encompassed in accordance with the invention R S s are all isomeric forms of the compounds described herein, 15 Such as constitutional isomers and more particularly stereoi S R Somers and mixtures thereof. Such as optical isomers or geo 1 on OH metric isomers, such as E- and Z-isomers, and also combina tions thereof. Where there are two or more centers of asymmetry in a molecule, the invention encompasses all com 1N N binations of different conformations of these centers of asym 1S,3R,6S 1R, 3S,6R metry, Such as pairs of enantiomers, for example. “Menthol’ encompasses all stereoisomeric forms such as Neo-Isopulegol (+)-menthol, (+)-isomenthol, (+)-neomenthol, (+)-neoiso mentol, (-)-menthol, (-)-isomenthol, (-)-neomenthol, (-)- 25 neoisomenthol and any desired mixtures thereof. Citronellal of formula (II) is commercially available both as R(+)-citronellal of formula (R-II) and as S(-)-citronellal of OH formula (S-II) and as racemate of formula (II). i 30 N 1s (R-II) Iso-Isopulegol (R) 35 R S s

R S OH 1 von 40 (S-II) N 1s

Epi-Isopulegol 45 Isopulegol is also called isopulegol I, neo-isopulegol is also called Isopulegol II; iso-isopulegol is also called isop ulegol III; epi-isopulegol or neo-iso-isopulegol is also called isopulegol IV. Isopulegol of formula (I) 50 Unless indicated otherwise, the general chemical defini tions that apply herein are as follows: Alkyl and also all alkyl moieties in radicals derived there (I) from, such as hydroxyalkyl, for example: Saturated, straight chain or branched hydrocarbon radicals having 1 to 4, 1 to 6. 55 1 to 8 or 1 to 10 carbon atoms, e.g. C-C-alkyl: Such as methyl, ethyl, propyl, 1-methylethyl, butyl, 1-methylpropyl, 2-methylpropyl and 1,1-dimeth OH ylethyl as exemplary representatives of C-C-alkyl; and also pentyl, 1-methylbutyl, 2-methylbutyl, 3-methylbu 60 tyl, 2.2-dimethylpropyl, 1-ethylpropyl, hexyl, 1,1-dim ethylpropyl, 1,2-dimethylpropyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 1.1- has in positions 1, 3 and 6 in each case an optically active dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, center, so that in principle 4 different diastereomers with in 2,2-dimethylbutyl, 2,3-dimethylbutyl, 3.3-dimethylbu each case 2 enantiomers, thus altogether 8 stereoisomers, are 65 tyl, 1-ethylbutyl, 2-ethylbutyl, 1,1,2-trimethylpropyl, conceivable, starting from the racemate of citronellal of for 1.2.2-trimethylpropyl, 1-ethyl-1-methylpropyl and mula (I). 1-ethyl-2-methylpropyl. US 8,932,839 B2 7 8 Hydroxy-C-C-alkyl, comprising hydroxy-C-C-alkyl, catalyzed this reaction, but e.g. at lower product yield, Such as e.g. hydroxymethyl, 1- or 2-hydroxyethyl, 1-, 2 turnover rate and/or stereospecificity). Moreover, the or 3-hydroxypropyl, 1-hydroxymethylethyl, 1-, 2-, 3- or partial sequence or shortform of the cyclase also has this 4-hydroxybutyl, 1-hydroxymethylpropyl and 2-hy cyclase-typical mutation in a position corresponding to droxymethylpropyl. F486 from SEQIDNO: 2. For example, an N-terminally Alkenyl stands for mono- or polyunsaturated, more par shortened version of the cyclase according to SEQ ID ticularly monounsaturated, straight-chain or branched hydro NO: 2 is an example of said short version. This is char carbon radicals having 2 to 4, 2 to 6, 2 to 8, 2 to 10 or 2 to 20 acterized by the following N-terminus: (M) carbon atoms and one double bond in any desired position, KIFGAEKTSYKPASDTIIGTDTLKRPN ... wherein e.g. C-C-alkenyl such as ethenyl, 1-propenyl, 2-propenyl, 10 the N-terminal K corresponds to position 16 of SEQID 1-methylethenyl, 1-butenyl, 2-butenyl, 3-butenyl, 1-methyl NO:2. 1-propenyl, 2-methyl-1-propenyl, 1-methyl-2-propenyl, . Enzyme mutant according to one of the preceding embodi 2-methyl-2-propenyl, 1-pentenyl, 2-pentenyl, 3-pentenyl, ments in which up to 25% or up to 20, 15, 10,9,8,7,6, 5, 4-pentenyl, 1-methyl-1-butenyl, 2-methyl-1-butenyl, 3-me 4, 3, 2 or 1% of the amino acid residues, for example 1 to thyl-1-butenyl, 1-methyl-2-butenyl, 2-methyl-2-butenyl, 3-methyl-2-butenyl, 1-methyl-3-butenyl, 2-methyl-3-bute 15 30, 2 to 25, 3 to 20 or 4 to 15 or 5 to 10 of the amino acid nyl, 3-methyl-3-butenyl, 1,1-dimethyl-2-propenyl, 1,2-dim residues, are in each case altered relative to the unmutated ethyl-1-propenyl, 1,2-dimethyl-2-propenyl, 1-ethyl-1-prope wild-type sequence according to SEQID NO: 2 to 326, by nyl, 1-ethyl-2-propenyl, 1-hexenyl, 2-hexenyl, 3-hexenyl, deletion, insertion, Substitution, addition, inversion or a 4-hexenyl, 5-hexenyl, 1-methyl-1-pentenyl, 2-methyl-1-pen combination thereof. tenyl, 3-methyl-1-pentenyl, 4-methyl-1-pentenyl, 1-methyl . Enzyme mutant according to one of the preceding embodi 2-pentenyl, 2-methyl-2-pentenyl, 3-methyl-2-pentenyl, ments, in which the mutation in position F486 of SEQID 4-methyl-2-pentenyl, 1-methyl-3-pentenyl, 2-ethyl-3-pente NO:2 or in a position corresponding to this position in one nyl, 3-methyl-3-pentenyl, 4-methyl-3-pentenyl, 1-methyl-4- of the sequences according to SEQID NO: 3 to 326, is a pentenyl, 2-methyl-4-pentenyl, 3-methyl-4-pentenyl, 4-me substitution selected from F486N, F486Q, F486L, F486M, thyl-4-pentenyl, 1,1-dimethyl-2-butenyl, 1,1-dimethyl-3- 25 F486E, F486G, F486S, F486V, F486T, F486C, F4861 and butenyl, 1,2-dimethyl-1-butenyl, 1,2-diethyl-2-butenyl, 1.2- F486A or optionally selected from F48611, F486Y. dimethyl-3-butenyl, 1,3-diethyl-1-butenyl, 1,3-dimethyl-2- F486W and F486D. butenyl, 1,3-dimethyl-3-butenyl, 2,2-diethyl-3-butenyl, 2.3- . Enzyme mutant according to one of the preceding embodi dimethyl-1-butenyl, 2,3-diethyl-2-butenyl, 2,3-dimethyl-3- ments, in which additionally (or alternatively, but in par butenyl, 3.3-dimethyl-1-butenyl, 3.3-dimethyl-2-butenyl, 30 ticular additionally) at least one, for example 1,2,3,4, 5, 6, 1-ethyl-1-butenyl, 1-ethyl-2-butenyl, 1-ethyl-3-butenyl, 7, or 8, mutations in one of the positions W374, D437, 2-ethyl-1-butenyl, 2-ethyl-2-butenyl, 2-ethyl-3-butenyl, 1.1, D440, F428, W555,Y561,Y702,Y705 (the so-called “first 2-triethyl-2-propenyl, 1-ethyl-1-methyl-2-propenyl, 1-ethyl sphere residues') of SEQ ID NO: 2 or in at least one 2-methyl-1-propenyl and 1-ethyl-2-methyl-2-propenyl. corresponding position selected from these positions, is “Oxo’, for example, is a radical which together with the C 35 present in one of the sequences according to SEQID NO: atom to which it is bonded forms a keto group (C=O). 3 to 326. “Methylene' (=CH-), for example, is a radical which . Enzyme mutant according to one of the preceding embodi together with the C atom to which it is bonded forms a vinyl ments, in which there is no mutation in position D437 radical ( CH=CH-). and/or D439 and/or D440 of SEQID NO: 2 (DXDD motif) 40 or the respective corresponding position in one of the B. Special Embodiments of the Invention sequences according to SEQID NO:3 to 326. The present invention relates in particular to the following . Enzyme mutant according to one of the preceding embodi special embodiments: ments, in which there is no mutation in position Y702 of 1. Enzyme mutant with cyclase activity, selected from SEQID NO: 2 or in the corresponding position in one of mutants of a wild-type enzyme, which comprises an amino 45 the sequences according to SEQID NO:3 to 326, or if a acid sequence, selected from SEQ ID NO: 2 to 326 or a mutation is present, this is a substitution Y702F or option partial sequence thereof, wherein the mutant catalyzes at ally Y702E or Y702D or corresponding substitution. least the cyclization of at least one citronellal isomer (or a . Enzyme mutant according to one of the preceding embodi mixture of isomers, for example racemate) according to the ments, which optionally is further mutated in at least one, above definition to at least one isopulegol isomer (or to a 50 for example 1 to 15, 1 to 10 or 1 to 5, such as 1, 2, 3 or 4, of pair of diastereomers I to IV, for example I and/or II) positions P229, D439, D508, E601, G553, G556, N432, according to the above definition, wherein the partial P436, P499, R224, S371, T376, T563, W414 or W624 (the sequence or shortform of the cyclase comprises e.g. at least so-called “second sphere residues') of SEQID NO: 2 or in 50, 100, 150, 200, 250, 300,350, 400, 450, 500, 550, 600, at least one corresponding position selected from these 650 or 700 continuous amino acid residues of one of these 55 positions, in one of the sequences according to SEQ ID sequences, and is accessible e.g. by N- and/or C-terminal shortening of the concrete sequences. NO:3 to 326; and optionally a further mutation in position 2. Enzyme mutant according to embodiment 1, comprising E429. L700 and R554 of SEQID NO: 2 or the analogous a) a mutation in position F486 of SEQID NO: 2 or positions of SEQID NO:3 to 326. b) a mutation in a sequence selected from SEQID NO:3 to . Enzyme mutant according to one of the preceding embodi 326, wherein the mutated position corresponds to posi 60 ments, selected from tion F486 of SEQ ID NO: 2 (i.e. is an “F486-analog a) the single mutants position); F486X with X=N, Q, L, M, E, G, S. V. T. C. I or A wherein at least the cyclization of at least one citronellal according to SEQID NO: 2 or a short version thereof; isomer to at least one isopulegol isomer is made possible Y702X with X=F.A, C or Saccording to SEQID NO: 2 by the mutation (i.e. the corresponding original or wild 65 or a short version thereof, type protein did not catalyze this reaction) or is modified Y561X with X=A or Saccording to SEQID NO: 2 or a (i.e. the corresponding original or wild-type protein short version thereof US 8,932,839 B2 10 wherein the short version comprises e.g. the following 18. Biocatalytic process for producing isopulegol of general N-terminal sequence: form a (I)

(M) KIFGAEKTSYKPASDTIIGTDTLKRPN...... (I) b) the multiple mutants F486A/Y702A, F486A/Y561A or F486A/Y705A according to SEQID NO: 2 c) the mutants corresponding to a) or b), derived from one of SEQID NO:3 to 325, 10. Enzyme mutant according to one of the preceding 10 embodiments, which comprises at least 50%, for example OH 50 to 100% or more than 100%, for example >100 to 1000%, in each case determined understandard conditions using a reference Substrate that displays citronellal-isop ulegol cyclase activity of an enzyme, which has an amino acid sequence according to SEQID NO: 2 from position 1 15 wherein citronellal of general formula (II) to 725, 2 to 725 or 16 to 725, optionally extended N-ter minally with a methionine residue. 11. Enzyme mutant according to embodiment 10, wherein the citronellal-isopulegol cyclase activity is determined under (II) standard conditions using a citronellal, for example the racemate or the R(+) form, as reference substrate. 12. Enzyme mutant according to one of the preceding embodiments, wherein the mutation takes place in an enzyme, and comprises an amino acid sequence according to SEQID NO: 2 from position 1 to 725, 2 to 725 or 16 to 725, optionally extended N-terminally with a methionine 25 residue. 13, Nucleic acid sequence coding for a mutant according to one of the preceding embodiments. 14. Expression cassette, comprising a nucleic sequence is cyclized to isopulegol of formula (I) by means of an according to embodiment 13. 30 enzyme mutant according to one of embodiments 1 to 15. Recombinant vector, comprising, under the control of at 12, or in the presence of a microorganism expressing this least one regulatory element, at least one nucleic acid enzyme mutant according to embodiment 16. sequence according to embodiment 13 or at least one expression cassette according to embodiment 14. 19. A method of production of menthol formula III 16. Recombinant microorganism, comprising at east one nucleic acid sequence according to embodiment 13 or at 35 least one expression cassette according to embodiment 14 (III) or at least one vector according to embodiment 15. 17. Biocatalytic process for producing isopulegol of general formula (I) 40 OH (I)

45 by OH a) cyclizing citronellal to isopulegol by a method according to claim 17 or 18, and 50 b) catalytically hydrogenating isopulegol to menthol, 20. The method according to claim 19, where the hydrogena wherein citronellal of general formula (II) tion takes place in the presence of hydrogen and a catalyst comprising 30% to 70% by weight of oxygen-containing compounds (II) 55 of nickel, calculated as NiO, 15% to 45% by weight of oxygen-containing compounds of Zirconium, calculated as ZrO. 5% to 30% by weight of oxygen-containing compounds of No 60 copper, calculated as CuO, and 0.1% to 10% by weight of oxygen-containing compounds of molybdenum, calculated as MoC) is cyclized to isopulegol of formula (I) by means of an the '% by weight figures being based on the dry, unreduced enzyme of EC class EC 5.4.99, in particular of EC class 65 catalyst. EC 5.4.99.17, or in the presence of a microorganism 21. A method for enzymatic or biocatalytic conversions of expressing this enzyme. compounds of general formula IV US 8,932,839 B2 11 12 where a compound of the formula IV instereoisomerically

(IV) pure form, or a stereoisomer mixture thereof, is reacted using an enzyme of class EC 5.4.99, in particular of class EC 5.4.99.17, or an enzyme mutant according to one of embodiments 1 to 12 or in the presence of a microorgan ism according to embodiment 16 expressing these enzymes or enzyme mutants. 22. The method according to embodiment 21, in which a compound is converted which is selected from compounds 10 of the formula IVa in which (IVa) “a”, “b', 'c' and “d, in each case independently of one another, represent a single or double C C bond, with 15 the proviso that cumulative double bonds are excluded: and with the following provisos: R possesses the following definitions: (1) when “a” is a double bond: R is selected from oxo(=O), or CH (CH), Z. in which n is 0, 1 or 2 and in which R possesses the definitions indicated above and Z is OH, CHO, C(O)alkyl, such as C(O)C-C- in particular is the radical CH-(CH2)—Z alkyl, in particular C(O) CH or C(O)— 25 in which CHCHCOOH, C(CH) CH=CH: n=0 and Z=CHO, or COOH, or C(OH)(CH) CH=CH: C(CH)—CH n=1 and Z=OH; or CH=CH; or a radical of the formula C(CH) n=2 and Z=C(O)CH: COOH, C(CH) CH=CH: =CH CHY C(CH)=CH-CH=CH: in which 30 or is a radical of the formula C(CH)—CH-CHY Y is OH, CHOH, COOH, CHC(O)CH; or in which Y is OH, CHOH, COOH, or CHC(O)CH: (2) when “a” is a single bond: and 'a' optionally has E or Z configuration; R is selected from or of the formula IVb CH, CHO: CHCH-OH: CH=CH, CHC(O) OH: CHCHO or CHCH(CH,)CHO: 35 wherein, when “a” is a double bond, it has E or Z con (IVb) figuration; R and R possess the following definitions: (1) when “a” and “b' are each a single bond: R and R independently of one another are H, alkyl, 40 Such as C-C-alkyl or OH, or R and R together are a methylene (=CH-) or oxo (=O) group; or (2) when “a” or “b' is a double bond, one of the radicals RandR is absent and the other of the two radicals is H, C-C-alkyl, in particular methyl, or OH: 45 R is H or hydroxy-C-C-alkyl, in particular Hydroxym in which R possesses the definitions indicated above and ethyl: in particular is CHCHO: Rs and R possess the following definitions: or of the formula IVc (1) when 'c' is a single bond: Rs and Rare each H, or Rs and R together are an oxo 50 (=O) group; or (IVc) (2) when 'c' is a double bond, one of the radicals Rs and R is absent and the other of the two radicals is H: R7, Rs and R. possess the following definitions: (1) when 'd' is a single bond: 55 two of the radicals R. Rs and R in each case inde pendently of one another are H or alkyl, Such as C-C-alkyl, in particular methyl or ethyl, and the other of the radicals is OH, or (2) when 'd' is a double bond, one of the radicals R7, 60 in which RandR is absent and the other of the two radicals R possesses the definitions indicated above, and in par in each case independently of one another are H or ticular is CH-CHO; and one of the radicals R, and Rs alkyl, such as C-C-alkyl, in particular methyl or is Hand the other is C-C-alkyl, where in particular R, ethyl: is ethyl and the double bonds “a” and “d have Z con Ro is H or hydroxy-C-C-alkyl. Such as hydroxy-C-C- 65 figuration. alkyl, or mono- or polyunsaturated C-C-alkenyl, Such 23. The method according to one of embodiments 20 to 22, in as, in particular, H or CH=CH-C(CH)—CH which the compound of the formula IV is selected from US 8,932,839 B2 13 14 citronellal; citral; farnesol; homofarnesol; homofarnesol 30. The method according to one of embodiments 26 to 29, derivatives, such as homofarnesylic acid; geranylacetone, wherein the enzyme is encoded by a nucleic acid sequence melonal; nonadienal; and trimethyldecatetraene. according to SEQ ID NO: 1 or a functional equivalent 24. Use of an enzyme from EC class EC 5.4.99, in particular thereof, the nucleic acid sequence being part of a gene from EC class EC 5.4.99.17 for the cyclization of terpenes 5 construct or vector which are present in a host cell. and/or terpenoids, in particular for the conversion of cit 31. The method according to one of embodiments 26 to 30, ronellal to isopulegol. wherein the enzyme is present in a form selected from the 25. Use of an enzyme mutant according to one of embodi group consisting of ments 1 to 12, a nucleic acid according to embodiment 13, a) free, optionally purified or partly purified polypeptide an expression construct according to embodiment 14, a 10 having the activity of a citronellal-isopulegol cyclase; recombinant vector according to embodiment 15 or a recombinant microorganism according to embodiment 1 b) immobilized polypeptide having the activity of a cit for the cyclization terpenes and/or terpenoids, and for the ronellal-isopulegol cyclase; conversion of compounds of the general formula IV c) polypeptide according to a) or b) which is isolated from according to the definition in one of the embodiments 20 to cells; 23. 15 d) whole cell, optionally resting or digested cells, compris 25. Use according to embodiment 25 for the conversion of ing at least one polypeptide having the activity of a citronellal to isopulegol; or for the conversion of squalene citronellal-isopulegol cyclase; to hopene. e) cell lysate or cell homogenate of the cells described 26. A method of production ofisopulegol of general formula under d). 32. The method according to embodiment 31, wherein the (I) cells are microorganisms, preferably transgenic microor ganisms expressing at least one heterologous nucleic acid molecule coding for a polypeptide having the activity of a (I) citronellal-isopulegol cyclase. 25 33. The method according to one of embodiments 26 to 32, wherein the production of isopulegol takes place in one phase aqueous systems or in two-phase systems. 34. The method according to one of embodiments 26 to 33, in OH which the reaction of citronellal to isopulegol takes place at 30 a temperature in the range from 20 to 40°C. and/or at a pH in the range from 4 to 8. 35. The method according to one of embodiments 26 to 34, comprising one reaction step, wherein the enzyme having the activity of a citronellal wherein citronellal of general formula (II) isopulegol cyclase is encoded by a gene which has been 35 isolated from a microorganism selected from the group of microorganisms consisting of Zymomonas mobilis, Methy (II) lococcus capsulatus, Rhodopseudomonas palustris, Bradyrhizobium japonicum, Frankia spec. and Streptomy ces coelicolor, in particular Zymomonas mobilis. 40 36. The method according to one of embodiments 26 to 35, wherein the enzyme having the activity of a citronellal isopulegol cyclase has been produced by a microorganism No which overproduces the enzyme having the activity of a citronellal-isopulegol cyclase and which has been selected 45 from the group of microorganisms consisting of the genera Escherichia, Corynebacterium, Ralstonia, Clostridium, is cyclized biocatalytically to the corresponding isopulegol of Pseudomonas, Bacillus, Zymomonas, Rhodobacter; Strep formula (I) by means of an enzyme having the activity of a tomyces, Burkholderia, Lactobacillus and Lactococcus. citronellal-isopulegol cyclase. 37. The method according to one of embodiments 26 to 36, 27. The method according to embodiment 26, wherein the 50 wherein the enzyme having the activity of a citronellal enzyme possesses a polypeptide sequence which either isopulegol cyclase has been produced by transgenic micro a) is SEQID NO: 2, or organisms of the species Escherichia coli, Pseudomonas b) in which up to 25%, such as, for example, up to 20, 15, putida, Burkholderia glumae, Corynebacterium 10,9,8,7,6, 5, 4, 3, 2 or 1% of the amino acid residues glutamicum, Saccharomyces cerevisiae. Pichia pastoris, are altered relative to SEQID NO: 2 by deletion, inser 55 Streptomyces lividans, Streptomyces coelicolor, Bacillus tion, substitution or a combination thereof, and which subtilis or Zymomonas mobilis which overproduce the still has at least 50%, such as, for example, at least 60, enzyme having the activity of a citronellal-isopulegol 65, 70, 75, 80, 85,90 or 95%, of the enzymatic activity cyclase. of SEQID NO: 2. 38. Use of an enzyme having the activity of a citronellal 28. The method according to embodiment 26 or 27, wherein 60 isopulegol cyclase for the biocatalytic conversion of cit the enzyme is encoded by a nucleic acid sequence accord ronellal to isopulegol. ing to SEQID NO: 1 or a functional equivalent thereof. 39. Use according to embodiment 38, wherein the enzyme 29. The method according to one of embodiments 26 to 28, possesses a polypeptide sequence which either wherein the enzyme is encoded by a nucleic acid sequence a) is SEQID NO: 2, or according to SEQ ID NO: 1 or a functional equivalent 65 b) in which up to 25%, such as, for example, up to 20, 15, thereof, the nucleic acid sequence being part of a gene 10,9,8,7,6, 5, 4, 3, 2 or 1% of the amino acid residues COnStruct Or VectOr. are altered relative to SEQID NO: 2 by deletion, inser US 8,932,839 B2 15 16 tion, substitution or a combination thereof, and which SEQID NO: 1 or a functional equivalent thereof, for pre still has at least 50%, such as, for example, at least 60, paring an enzyme having the activity of a citronellal-isop 65, 70, 75, 80, 85,90 or 95%, of the enzymatic activity ulegol cyclase for the biocatalytic conversion of citronellal of SEQID NO: 2. to isopulegol. 40. Use according to embodiment 38 or 39, wherein the 5 enzyme 1s encoded by a nucleic acid sequence according to C. Further Embodiments of the Invention SEQID NO: 1 or a functional equivalent thereof. 41. Use of a gene construct or vector comprising a nucleic acid sequence according to SEQID NO: 1 or a functional 1. Especially Suitable Wild-Type Sequences equivalent thereof, which encode a polypeptide having the SHC wild-type sequences usable according to the inven activity of a citronellal-isopulegol cyclase, which serves tion, whose SEQ ID NO, source organism, GenBank refer for the biocatalytic conversion of citronellal to isopulegol, ence number, the amino acid residue 'corresponding to posi in a method of production of isopulegol by cyclization of tion F486 of SEQ ID NO:2, i.e. F486-analog (Aa) and citronellal. whose sequence position are presented in the following table. 42. Use of a host cell which comprises a gene construct or a The information is based on a sequence alignment, which was vector comprising a nucleic acid sequence according to set up as follows:

Program: CLUSTALW, Default parameters: Protein Gap Open Penalty 1O.O Protein Gap Extension Penalty O.2 Protein weight matrix: Gonnet series GINo. of the reference S IDDB SEQ ID NO Organism sequences Aa. Position S1 seq. ID 2 Zymomonas mobilis AAV90172. F 486 S2O sed ID3 Streptomyces coelicolor CAB39697. F 449 S911 seq. ID 4 Acetobacter pasteuriants BAH99456. F 481 s2 sed ID 5 Bradyrhizobium sp. ABQ33590. F 447 S940 sed ID 6 Zymomonas mobilis EER62728. F 438 S949 sed ID 7 Acidithiobacilius Caidius EET2.5937. Y 432 S167 seq. ID 8 Acidithiobacilius ferrooxidans ACH84004.1 Y 429 S41 sed ID 9 Acidobacterium capsulatin ACO34244. F 458 S36 seq. ID 10 Acidothermus cellulolyticus ABKS3469. F 426 S83 seq. ID 11 Adiantum capilius-veneris BAF932.09. Y 436 S143 seq. ID 12 Aiellomyces capsulatus EDNO9769. F 496 S995 seq. ID 13 Aiellomyces capsulatus EER4051O. 432 S163 seq. ID 14 Aiellomyces capsulatus EEEHO2950. F 429 S13 seq. ID 15 Alicyclobacilius acidocaidarius EEDO8231. Y 420 S14 seq. ID 16 Alicyclobacilius acidocaidarius P33247.4 Y 420 S1193 seq. ID 17 Alicyclobacilius acidocaidarius AATFO690. Y 116 S21 seq. ID 18 Alicyclobacilius acidoterrestris CAA61950.1 Y 420 S1189 seq. ID 19 Alicyclobacilius acidoterrestris AATFO691. Y 121 SS1 sed ID 20 Anabaena variabilis ABA24268. 423 S76 seq. ID 21 Anaeromyxobacter sp. ABS28257. 440 S159 seq. ID 22 Aspergilius clavatus EAWO7713. 446 S131 seq. ID 23 Aspergiiitisfia vils EED48353. 444 S176 seq. ID 24 Aspergilius finigatus EDPSO814. 502 S126 seq. ID 25 Aspergilius finigatus EAL84865. 449 S178 seq. ID 26 Aspergilius finigatus EAL86291.2 4O6 S121 seq. ID 27 Aspergilius niger CAK435O1.1 441 S115 seq. ID 28 Aspergilius niger CAK45506.1 440 S124 seq. ID 29 Aspergilius Oryzae BAE63941. 444 S119 sed ID 30 Azotobacter vineiandi EAMO7611.1 442 S223 seq. ID 31 Bacilius amyloiquefaciens ABS74269. 413 s221 sed ID 32 Bacilius anthracis AAP27368. 409 S976 sed ID 33 Bacilius cereus EEK66523. 423 S225 sed ID 34 Bacilius cereus EAL12758. 423 S972 sed ID 35 Bacilius cereus EEL44583. 412 s977 sed ID36 Bacilius cereus EEK43841. 412 S985 sed ID 37 Bacilius cereus EEK82938. 412 S988 sed ID38 Bacilius cereus EEK99528. 412 S981 sed ID 39 Bacilius cereus EEK77935. 412 s987 sed ID 40 Bacilius cereus EEL81079. 412 S960 sed ID 41 Bacilius cereus EEK88307. 412 S979 sed ID 42 Bacilius cereus EEL63943. 412 S974 sed ID 43 Bacilius cereus EELS9884. 412 S956 sed ID 44 Bacilius cereus EEL698.57. 412 S951 sed ID 45 Bacilius cereus EEL92663. 412 S986 sed ID 46 Bacilius cereus EEL49968. 411 S227 sed ID 47 Bacilius cereus AAU 16998.1 409 s224 sed ID 48 Bacilius cereus AAS42477.1 409 s212 sed ID 49 Bacilius cereus ACK95843.1 409 S289 sed ID 50 Bacilius coahuiensis 20537368O 276 US 8,932,839 B2 17 18 -continued

Se D51 Bacilius cytotaxicits ABS22481.1 411 Se D52 Bacilius licheniformis AAU23777. 414 Se D53 Bacilius mycoides EEL984.38.1 412 Se DS4 Bacilius mycoides EEMO4821. 411 Se D55 Bacilius pseudomycoides M16144. 411 Se D S6 Bacilius pumilus ABV62529. 409 Se D57 Bacilius pumilus EDW21137.1 409 Se D 58 Bacilius sp. EAR644O4. 425 Se D59 Bacilius sp. EDL66148.1 412 Se D 60 Bacilius subtilis Q796C3.1 415 Se D 61 Bacilius subtilis AAB84441. 415 Se D 62 Bacilius thuringiensis ABK86448. 423 Se D 63 Bacilius thuringiensis EEM21409. 412 Se D 64 Bacilius thuringiensis EEM82653. 412 Se D 65 Bacilius thuringiensis EEM52372. 412 Se D 66 Bacilius thuringiensis EEM27851. 412 Se D 67 Bacilius thuringiensis EEM4O716. 412 Se D 68 Bacilius thuringiensis M46814. 409 Se D 69 Bacilius thuringiensis EEM94969. 409 Se D 70 Bacilius weihenstephanensis ABY44436. 409 Se D 71 Bacterium EllinS14 EEF57225.1 461 Se D72 Bacterium EllinS14 EEF595.08.1 Y 435 Se D 73 Beijerinckia indica ACB96717. 441 Se D 74 Blastopirellula marina EAQ81955. 475 Se D 75 Blastopirellula marina EAQ78122. 389 Se D76 Bradyrhizabium japonicum CAA6O2SO. 439 Se D 77 Acetobacter pasteuriant is BAH98349. 437 Se D78 Bradyrhizobium sp. CAL798.93. 447 Se D. 79 Brevibacilius brevis BAH44778. 448 Se D 80 Burkholderia ambifaria EDTO5097. 450 Se D 81 Burkholderia ambifaria EDT37649. 450 Se D 82 Burkholderia ambifaria ACB683O3. 446 Se D 83 Burkholderia ambifaria EDT42454. 436 Se D 84 Burkholderia cenocepacia EAY66961. 451 Se D 85 Burkholderia cenocepacia ACA95661 451 Se D 86 Burkholderia cenocepacia CARS7099 451 SCC D 87 Burkholderia cenocepacia CARS6694 436 Se D 88 Burkhoideria doiosa EAY71311 437 Se D 89 Burkholderia glumae ACR.32572 555 Se D 90 Burkholderia glumae ACR30752 449 Se D91 Burkholderia graminis EDT12320. 462 Se D 92 Burkhoideria maiei ABM48844.1 436 Se D 93 Burkhoideria multivorans ABX196SO 450 Se D94 Burkhoideria multivorans ABX16859. 436 Se D95 Burkhoideria Okiahomensis 67567074 447 Se D 96 Burkholderia phymatum ACC732S8. 456 Se D 97 Burkholderia phytofirmans ACD21317. 455 Se D 98 Burkholderia pseudamallei EEC32728.1 436 Se D 99 Burkholderia sp. EEAO3SS3.1 460 Se OO Burkholderia sp. ABBO6563. 450 Se O1 Burkholderia sp. ABB10136. 436 Se O2 Burkholderia sp. CCGE1002 EFAS4357.1 473 Se O3 Burkhoideria thailandensis 6784O988 451 Se O4 Burkhoideria thailandensis 67617352 442 Se 05 Burkhoideria ubonensis 675898.07 445 Se O6 Burkhoideria ubonensis 67.584986 436 Se O7 Burkhoideria vietnamiensis ABOS6791.1 436 Se O8 Burkhoideria xenovorans ABE3591.2.1 457 Se 09 Candidatus Koribacter ABF4O741.1 435 Se 10 Candidatus Kienenia CA71215.1 273 Se 11 Candidatus Soibacter AB82180.1 439 Se 12 Candidatus Soibacter AB82254.1 429 Se 13 Catentispora acidiphila ACU7SS10. 418 Se 14 Chthoniobacter flavus EDY15838. 433 Se 15 Chthoniobacter flavus EDY22035. 384 Se 16 Crocosphaera waisonii EAMS3094.1 426 Se 17 Cipriavidiis taiwanensis CAQ72562. 454 Se 18 Cyanothece sp. ACBS3858. 441 S40 Se 19 Cyanothece sp. ACK71719. 430 Se 2O Cyanothece sp. EDYO2410. 429 S29 Se 21 Cyanothece sp. ACK66841. 429 S47 Se 22 Cyanothece sp. EDX97382. 428 S35 Se 23 Cyanothece sp. EAZ91809. 426 S39 Se 24 Cyanothece sp. ACL45896. 423 S925 Se 25 Cyanothece sp. PCC 8802 ACVO2092. 429 S64 Se 26 Destifovibrio Salexigens EEC62384. 475 S74 Se 27 Dryopteris crossinhizoma BAG68223 444 S59 Se 28 Frankia aini CAJ.61140. Y 533 S48 Se 29 Frankia aini CAJ6OO90. 493 US 8,932,839 B2 19 20 -continued

S56 Se 30 Frankia sp. ABD102O7.1 530 S60 Se 31 Frankia sp. ABW15063.1 512 S31 Se 32 Frankia sp. ABW14125.1 481 S948 Se 33 Frankia sp. Eul1c EFAS9873. 557 S919 Se 34 Frankia sp. Eul1c EFAS9089. 553 S628 Se 35 Gemmata obscuriglobus 1687OO710 387 S209 Se 36 Geobacilius sp. ED61885. 404 S2O6 Se 37 Geobacilius sp. DYO576O. 403 S964 Se 38 Geobacillus sp. Y412MC52 EN95021.1 404 S993 Se 39 Geobacillus sp. Y412MC61 CX793.99. 404 s2OS Se 40 Geobacilius thermodenitrificans BO67242. 403 Se 41 Geobacter hemidjiensis CH4O3SS. 468 Se 42 Geobacter lovlevi CD95949. 470 Se 43 Geobacter metaireducens BB30662. 493 Se Geobacter metaireducens BB33O38. 467 Se 45 Geobactersp. CM21577.1 487 Se 46 Geobactersp. DV72707. 468 Se 47 Geobactersp. CM22003.1 467 Se 48 Geobacter sp. M18 ET34621.1 468 Se 49 Geobacter sp. M21 T16952. 468 Se 50 Geobacter sulfurreducens R36453. 493 Se 51 Geobacter sulfurreducens s R34018. 467 Se 52 Geobacter uraniireducens A. BQ2.5226. 467 Se 53 Gioeobacter violiaceus BAC91998. 425 Se S4 Gluconacetobacter diazotrophicus ACIS1585.1 444 Se 55 Gluconacetobacter diazotrophicus CAP55563. 444 Se 56 Gluconobacter oxydans AAW 61994.1 445 Se 57 Grantibacter beihesdensis ABI63OOS-1 429 Se 58 Hyphomicrobium denitrificans EET65847. 444 Se 59 Leptospirilium ferrodiazotrophiin EES53.667. 460 Se 60 Leptospirilium raibartin EAY57382. 448 Se 61 Leptospirilium sp. EDZ38599.1 448 Se 62 Magnaporihe grisea EDKO2SS1. 445 Se 63 Magnetospirilium magnetotactictim 462O3107 447 Se 64 Methylacidiphilum infernorum ACD82457. 456 Se 65 Methyliobacterium chloromethanicum ACK83O67. 447 SCC 66 Methylobacterium chloromethanicum ACK38232. 426 Se 67 Methyliobacterium extorquens CAX24364. 447 Se 68 Methyliobacterium nodulans ACL61886. 442 Se 69 Methyliobacterium populi ACB79998. 447 Se 70 Methyliobacterium radiotolerans ACB27373. 445 Se 71 Methyliobacterium sp. ACA20611. 442 Se 72 Methylocella silvestris ACKS21SO. 451 Se 73 Methylococci is capsulatus CAA71098. 439 Se 74 Microcystis aeruginosa CAO86472. 423 Se 75 Neosartorya fischeri E AW2O752. 448 Se 76 Nitrobacter hamburgensis BE63461. 433 Se 77 Nitrobacter sp. AQ34404. 430 Se 78 Nitrobacter winogradskyi BAOSS23. 433 Se 79 Nitrococcus mobiis A. R22397. 436 Se 8O NitroSOCOccitS Oceani BAS7818. 446 Se 81 Nitrosomonas europaea D85079. 452 Se 82 Nitrosomonas elitropha 5975.2.1 456 Se 83 Nitrosomonas sp. AL212 T32702.1 452 Se 84 Nitrosospira multiformis B75845. 439 Se 85 Nostoc punctiforme C84529. 423 Se 86 Nostoc sp. BA B72732. 423 Se 87 Oligotropha carboxidovorans 93,782.1 433 Se 88 Paenibacilius sp. DS4.9994.1 399 Se 89 Paenibacilius sp. JDR-2 CS99948.1 399 Se 90 Paenibacilius sp. oral taxon 786 ES74793.1 428 Se 91 Paramecium tetratireia 45S42269 400 Se 92 Peliobacter carbinoicus BA877O1.1 494 Se 93 Peliobacter carbinoicus BA87615.1 435 Se 94 Pelobacter propionicus BK983951 486 Se 95 Pelobacter propionicus BK988.11.1 467 Se 96 Penicilium chrysogenium P997O7.1 440 Se 97 Planctomyces limnophilus O67214.1 490 Se 98 Planctomyces limnophilus EO68341.1 412 Se 99 Planctomyces maris LS8855.1 392 Se D2OO Polypodiodes niponica 48071.1 521 Se D2O1 Polypodiodes niponica 480701 443 Se D2O2 Populus trichocarpa EF12098.1 162 Se D2O3 Ralstonia eutropha 643O2.1 452 Se D 204 Ralstonia eutropha Y.96.989.1 451 Se D 205 Raistonia metailidurans F11015.1 448 Se D 206 Raistonia metailidurans A F11268.1 430 Se D2O7 Rhizobium sp. PSS348.1 433 Se D 208 Rhodopinellula baitica CAD74S17.1 428 US 8,932,839 B2 21 22 -continued

S4 Se D 209 Rhodopseudomonas palustris ABJO8391.1 445 S130 Se D 210 Rhodopseudomonas palustris CAA71101.1 433 S15S Se D 211 Rhodopseudomonas palustris ABDO6434.1 433 S97 Se D 212 Rhodopseudomonas palustris ABD87279.1 433 S13S Se D 213 Rhodopseudomonas palustris ACFO2757.1 432 s84 Se D214 Rhodospirilium rubrum ABC2O867.1 437 S1279 Se D 215 Rubrobacter xylanophilus ABGOS671.1 372 S915 Se D 216 Saccharomonospora viridis ACU97316.1 428 S42 Se D 217 Saccharopolyspora erythraea CAMO3596.1 421 S82 Se D 218 Schizosaccharomyces japonicus EEBO8219.1 437 S923 Se D 219 Sphaerobacter thermophilus ACZ394.37.1 404 S924 Se D 220 Streptomyces albus 239983S47 371 S23 Se D 221 Streptomyces avermitiis BAC693611 450 S44 Se D 222 Acaryochloris marina ABW29816.1 F 423 S921 Se D 223 Streptomyces filamentosus 239945.642 447 S934 Se D 224 Streptomyces fiavogrisetts EEWAO811.1 447 S92O Se D 225 Streptomyces ghanaensis 2399274.62 448 S922 Se D 226 Streptomyces griseofiavits 2S6812310 448 S28 Se D 227 Streptomyces grisetts BAG17791.1 447 S926 Se D 228 Streptomyces hygroscopicals 256775136 414 S916 Se D 229 Streptomyces lividans 256783.789 449 Se D 230 Streptomyces peticetius ACAS2O821 455 Se D 231 Streptomyces pristinaespiralis EDY61772.1 455 Se D 232 Streptomyces Scabiei CBG68454.1 447 Se D 233 Streptomyces sp. EDX257.60.1 453 Se D 234 Streptomyces sp. EDY46371.1 453 Se D 235 Streptomyces sp. AA4 2S66682SO 428 Se D 236 Streptomyces sp. C 256770952 454 Se D 237 Streptomyces sp. Mg1 2S438S931 453 Se D 238 Streptomyces sp. SPB74 2S4379682 453 Se D 239 Streptomyces sp. SPB78 2S6680470 404 Se D 240 Streptomyces Sviceus EDYS5942. 453 Se D 241 Streptomyces viridochromogenes 2S6805984 447 Se D 242 Synechococci is sp. EDX84551. 426 Se D 243 Synechococcus sp. PCC 7335 254422098 426 Se D 244 Synechocystis sp. BAA17978. 428 SCC D 245 Syntrophobacter fitmaroxidans ABK18414. 478 Se D 246 Syntrophobacter fumaroxidans ABK17672. 457 Se D 247 Teredinibacter turnerae ACR13362. 438 Se D 248 Thermosynechococci is elongatus BACO9861. 425 Se D 249 Trichodesmium erythraeum ABGSO159. 418 78 Se D 250 Uncultured organism ACAS856O. 8 76 Se D 251 Uncultured organism ABLO7SS7. 8 65 Se D 252 Uncultured organism ACAS8559. 6 66 Se D253 Uncultured organism ACAS8558. 6 68 Se D 254 Uncultured organism ABLO756O. 6 69 Se D 255 Uncultured organism ABLO7565. 6 70 Se D 256 Uncultured organism ABLO7566. 6 67 Se D 257 Uncultured organism ACAS8545. 6 71 Se D 258 Uncultured organism ACAS8535. 6 8O Se D 259 Uncultured organism ACAS8549. 6 79 Se D 260 Uncultured organism ACAS8554. 6 81 Se D 261 Uncultured organism ACAS8SSS. 6 82 Se D 262 Uncultured organism ACAS8556. 6 Se D 263 Uncultured organism ACAS8530. 6 88 Se D 264 Uncultured organism ACAS8534. 5 237 Se D 265 Uncultured organism ACAS8552. 5 223 Se D 266 Uncultured organism ABLO7558. 5 200 Se D 267 Uncultured organism ABLO7542. 5 236 Se D 268 Uncultured organism ACAS8539. 4 238 Se D 269 Uncultured organism ACAS8537. 4 233 Se D 270 Uncultured organism ACAS8543. 4 173 Se D 271 Uncultured organism ABLO7SS3. 4 241 Se D 272 Uncultured organism ABLO7540. 4 242 Se D 273 Uncultured organism ABLO7544. 4 225 Se D 274 Uncultured organism ACAS8557. 4 183 Se D 275 Uncultured organism ACAS852O. 3 197 Se D 276 Uncultured organism ACAS8524. 3 18S Se D 277 Uncultured organism ACAS8522. 3 190 Se D 278 Uncultured organism ACAS852S. 3 187 Se D 279 Uncultured organism ACAS8523. 3 184 Se D 280 Uncultured organism ACAS8521. 3 204 Se D 281 Uncultured organism ACAS8547. 3 221 Se D 282 Uncultured organism ACAS8544. 3 198 Se D 283 Uncultured organism ACAS8546. 2 226 Se D 284 Uncultured organism ACAS8527. 2 227 Se D 285 Uncultured organism ABLO7S37. 2 232 Se D 286 Uncultured organism ACAS851O. 2 230 Se D 287 Uncultured organism ACAS8538. 2 US 8,932,839 B2 23 24 -continued S1229 Seq ID 288 Uncultured organism ACA58542. S1231 seq. ID 289 Uncultured organism ACAS8540. S12O7 Seq ID 290 Uncultured organism ABLO7564. S1212 Seq ID 291 Uncultured organism ABLO7563. S1208 Seq ID 292 Uncultured organism ABLO7562. S1209 Seq ID 293 Uncultured organism ABLO7559. S1214 Seq ID 294 Uncultured organism ABLO7556. S1216 seq. ID 295 Uncultured organism ACAS8528. S1219 Seq ID 296 Uncultured organism ACAS8536. S1192. seq. ID 297 Uncultured organism ABLO7S33. S1195 seq. ID 298 Uncultured organism ABLO7S36. S1174 seq. ID 299 Uncultured organism ABLO7545. S1186 Seq ID 300 Uncultured organism ABLO7548. S1196 Seq ID 301 Uncultured organism ACAS8561. S1172 Seq ID 302 Uncultured organism ABLO7SSS. S1194 Seq ID 303 Uncultured organism ABLO7541. S1211 Seq ID 304 Uncultured organism ABLO7554. S1220 Seq ID 305 Uncultured organism ABLO7547. S12O3 Seq ID 306 Uncultured organism ABLO7SSO. S1199 Seq ID 307 Uncultured organism ABLO7SS1. S1228 Seq ID 308 Uncultured organism ACAS8iSO9. S12O1 seq. ID309 Uncultured organism ACAS8514. S1205 Seq ID 310 Uncultured organism ABLO7543. S12O6 Seq ID 311 Uncultured organism ABLO7534. s1177 Seq ID 312 Uncultured organism ABLO7546. S1210 Seq ID 313 Uncultured organism ABLO7S35. s1175 Seq ID 314 Uncultured organism ABLO7SS2. S1191. Seq ID 315 Uncultured organism ABLO7549. S1222 Seq ID 316 Uncultured organism ACAS8553. S1244 Seq ID317 Uncultured organism ABLO7S39. S1213 Seq ID 318 Uncultured organism ACAS8532. S1239 Seq ID 319 Uncultured organism ACAS8548. S1215 Seq ID 320 Uncultured organism ABLO7561. S1240 Seq ID 321 Uncultured organism ACAS8533. O S1234 Seq ID 322 Uncultured organism ABLO7538. S1224 Seq ID 323 Uncultured organism ACA58541. S1217 seq. ID 324 Uncultured organism ACAS8529. S596 seq. ID 325 Verrucomicrobium spinosum 17191OO93 sf0 seq. ID 326 Acidiphilium cryptum ABQ30890.

Further potential cyclase mutants with the desired sub limited to this, we may mention a test using a reference strate properties can be produced starting from these, on the substrate, for example citronellal racemate or R(+) form, basis of the findings for mutants of Zm-SHC-1. understandard conditions, as described above and explained 2. Further Proteins/Enzyme Mutants According to the Inven 40 in the experimental section. tion Functional equivalents are moreover stable e.g. between The present invention is not limited to the mutants with pH 4 to 11 and advantageously possess a pH optimum in a cyclase activity concretely disclosed herein, but rather also range from pH 5 to 10, such as in particular 6.5 to 9.5 or 7 to extends to functional equivalents thereof. 8 or at about 7.5, and a temperature optimum in the range "Functional equivalents’ or analogs of the concretely dis 45 from 15° C. to 80° C. or 20° C. to 70° C., for example about closed enzymes and enzyme mutants (F486 and “F486-ana 30 to 60° C. or about 35 to 45° C., such as at 40°C. log mutants, derived from SEQID NO: 2 to 326, in particular “Functional equivalents' are to be understood according to SEQ ID NO: 2 to 6) are, within the scope of the present the invention to include in particular also “mutants', which, invention, various polypeptides thereof, which furthermore as well as the concretely stated mutation(s) (e.g. an F486 and possess the desired biological activity, for example cyclase 50 “F486-analog” mutant, derived from SEQID NO: 2 to 326, in activity. particular SEQID NO: 2 to 6), have in at least one sequence For example “functional equivalents' are understood to position of the aforementioned amino acid sequences, an include enzymes and mutants that have, in a test applied for amino acid other than that concretely stated, but nevertheless “cyclase activity” in the sense of the invention (i.e. with a possess one of the aforementioned biological activities. reference Substrate understandard conditions), an at least 1%, 55 “Functional equivalents’ comprise the mutants obtainable in particular at least about 5 to 10%, for example at least 10% by one or more, for example 1 to 50, 2 to 30, 2 to 15, 4 to 12 or at least 20%, for example at least 50% or 75% or 90% or 5 to 10 “additional mutations', such as amino acid addi higher or lower activity of an enzyme, comprising an amino tions, Substitutions, deletions and/or inversions, wherein the acid sequence concretely defined herein (e.g. an F486 and stated changes can occur in any sequence position, provided “F486-analog” mutant, derived from SEQID NO: 2 to 326; in 60 they lead to a mutant with the property profile according to the particular SEQID NO: 2 to 6). invention. Functional equivalence is in particular also present The activity information for functional equivalents refers when the reactivity profiles between mutant and unaltered herein, unless stated otherwise, to activity determinations, polypeptide coincide qualitatively, i.e. for example the same performed by means of a reference substrate under standard substrates are converted at a different rate. conditions, as defined herein. 65 Additional mutations” of this kind occur at a position of The “cyclase activity” in the sense of the invention can be the respective amino acid sequence different from position detected by means of various known tests. Without being F486 according to SEQID NO: 2 or from the F486-analog US 8,932,839 B2 25 26 position according to one of SEQ ID NOs: 3 to 326, in tein parts). Nonlimiting examples of heterologous sequences particular SEQID NO:3 to 6. of this kind are e.g. signal peptides, histidine anchors or Nonlimiting examples of suitable amino acid substitutions enzymes. are given in the following table: "Functional equivalents' that are also included according to the invention are homologs to the concretely disclosed proteins. These possess at least 60%, preferably at least 75%, Original residue Examples of substitution especially at least 85%, for example 90,91, 92,93, 94, 95.96, Ala Ser 97.98 or 99%, homology (or identity) to one of the concretely Arg Lys disclosed amino acid sequences, calculated using the algo ASn Gln: His 10 rithm of Pearson and Lipman, Proc. Natl. Acad. Sci. (USA) Asp Glu 85 (8), 1988, 2444-2448. A percentage homology or identity Cys Ser of a homologous polypeptide according to the invention Gln ASn Glu Asp means in particular percentage identity of the amino acid Gly Pro residues relative to the total length of one of the amino acid His ASn; Glin 15 sequences concretely described herein. In particular, how Ile Leu; Val ever, these homologs also have the F486 or “F486-analog Leu Ile: Val Lys Arg: Gln: Glu mutation, derived from SEQ ID NO:2 to 326, in particular Met Leu: Ile SEQID NO: 2 to 6. Phe Met; Leu: Tyr The percentage identity values can also be determined on Ser Thr the basis of BLAST alignments, blastp algorithms (protein Thr Ser Trp Tyr protein BLAST), or using the Clustal settings given below. Tyr Trp; Phe In the case of a possible protein glycosylation, “functional Wal Ile: Leu equivalents' according to the invention comprise proteins of the type designated above in deglycosylated or glycosylated 25 form as well as modified forms obtainable by changing the “Functional equivalents’ in the above sense are also “pre glycosylation pattern. cursors” of the polypeptides described as well as “functional Homologs of the proteins or polypeptides according to the derivatives” and “salts' of the polypeptides. invention can be produced by mutagenesis, e.g. by point “Precursors' are natural or synthetic precursors of the mutation, lengthening or shortening of the protein. polypeptides with or without the desired biological activity. 30 Homologs of the proteins according to the invention can be The term “salts' means both salts of carboxyl groups and identified by Screening combinatorial databases of mutants, salts of acid addition of amino groups of the protein mol for example shortened mutants. For example a variegated ecules according to the invention. Salts of carboxyl groups database of protein variants can be produced by combinato can be produced in a manner known per se and comprise rial mutagenesis at nucleic acid level, for example by enzy inorganic salts, for example Sodium, calcium, ammonium, 35 matic ligation of a mixture of synthetic oligonucleotides. iron and Zinc salts, and salts with organic bases, for example There are a great many methods that can be used for produc amines, such as triethanolamine, arginine, lysine, piperidine ing databases of potential homologs from a degenerated oli and the like. Salts of acid addition, for example salts with gonucleotide sequence. The chemical synthesis of a degen mineral acids, such as hydrochloric acid or Sulfuric acid and erated gene sequence can be carried out in an automatic DNA salts with organic acids, such as acetic acid and oxalic acid, 40 synthesizer, and the synthetic gene can then be ligated into a are also objects of the invention. Suitable expression vector. The use of a degenerated set of “Functional derivatives” of polypeptides according to the genes makes it possible to provide all sequences, in one invention can also be produced on functional amino acid side mixture, which code for the desired set of potential protein groups or at their N- or C-terminal end by known techniques. sequences. Methods for the synthesis of degenerated oligo Derivatives of this kind comprise for example aliphatic esters 45 nucleotides are known by a person skilled in the art (e.g. of carboxylic acid groups, amides of carboxylic acid groups, Narang, S.A. (1983) Tetrahedron 39:3: Itakura et al. (1984) obtainable by reaction with ammonia or with a primary or Annu. Rev. Biochem. 53:323: Itakura et al., (1984) Science secondary amine; N-acyl derivatives of free amino groups, 198:1056; Ike et al. (1983) Nucleic Acids Res. 11:477). produced by reaction with acyl groups; or O-acyl derivatives Several techniques for screening gene products of combi of free hydroxyl groups, produced by reaction with acyl 50 natorial databases, which were produced by point mutations groups. or shortening, and for screening cDNA databases for gene "Functional equivalents' naturally also comprise polypep products with a chosen property, are known in the prior art. tides that are accessible from other organisms, and naturally These techniques can be adapted for rapid screening of gene occurring variants. For example areas of homologous banks that have been produced by combinatorial mutagenesis sequence regions can be established by sequence comparison 55 of homologs according to the invention. The techniques used and equivalent enzymes can be determined based on the con most often for Screening large gene banks, as the basis for crete information of the invention. high-throughput analysis, comprise cloning the gene bank "Functional equivalents' also comprise fragments, prefer into replicatable expression vectors, transforming Suitable ably individual domains or sequence motifs, of the polypep cells with the resultant vector bank and expressing the com tides according to the invention, which for example have the 60 binatorial genes in conditions in which detection of the desired biological function. desired activity facilitates the isolation of the vector that “Functional equivalents' are moreover fusion proteins, codes for the gene whose product was detected. Recursive which have one of the aforementioned polypeptide sequences ensemble mutagenesis (REM), a technique that increases the or functional equivalents derived therefrom and at least one frequency of functional mutants in the databases, can be used further, functionally different therefrom, heterologous 65 in combination with the screening tests, to identify homologs sequence in functional N- or C-terminal linkage (i.e. without (Arkin andYourvan (1992) PNAS 89:7811-7815; Delgrave et mutual Substantial functional impairment of the fusion pro al. (1993) Protein Engineering 6(3):327-331). US 8,932,839 B2 27 28 3. Nucleic Acids and Constructs brook et al. (1989), Molecular Cloning: A Laboratory 3.1. Nucleic Adds Manual, Cold Spring Harbor Laboratory Press. The invention also relates to nucleic acid sequences that The invention also relates to nucleic acid sequences code for an enzyme as described above or a mutant thereof (single-stranded and double-stranded DNA and RNA described above with cyclase activity. 5 sequences, for example cDNA and mRNA), coding for one of The present invention also relates to nucleic acids with a the above polypeptides and functional equivalents thereof, specified degree of identity to the concrete sequences which are accessible e.g. using artificial nucleotide analogs. described herein. The invention relates both to isolated nucleic acid mol “Identity” between two nucleic acids means identity of the ecules, which code for polypeptides or proteins according to 10 the invention or biologically active segments thereof, and to nucleotides in each case over the whole length of nucleic acid, nucleic acid fragments, which can be used for example as in particular the identity that is calculated by comparison by hybridization probes or primers for the identification or means of the Vector NTISuite 7.1 software from the company amplification of coding nucleic acids according to the inven Informax (USA) using the Clustal method (Higgins D G, tion. Sharp PM. Fast and sensitive multiple sequence alignments 15 The nucleic acid molecules according to the invention can on a microcomputer. Comput Appl. Biosci. 1989 April; 5(2): in addition contain untranslated sequences of the 3'- and/or 151-1), setting the following parameters: 5'-end of the coding gene region. Multiple Alignment Parameters: The invention further comprises the nucleic acid molecules complementary to the concretely described nucleotide sequences, or a segment thereof. Gap opening penalty 10 Gap extension penalty 10 The nucleotide sequences according to the invention make Gap separation penalty range 8 it possible to produce probes and primers that can be used for Gap separation penalty Off the identification and/or cloning of homologous sequences in % identity for alignment delay 40 other cell types and organisms. Said probes or primers usually Residue specific gaps Off Hydrophilic residue gap Off 25 comprise a nucleotide sequence region which hybridizes Transition weighting O under “stringent conditions (see below) to at least about 12, preferably at least about 25, for example about 40, 50 or 75 Successive nucleotides of a sense Strand of a nucleic acid Pairwise Alignment Parameter: sequence according to the invention or of a corresponding 30 antisense Strand. FAST algorithm Oil An "isolated nucleic acid molecule is separate from other K-tuple size nucleic acid molecules that are present in the natural source of Gap penalty the nucleic acid, and moreover can be essentially free of other Window size cellular material or culture medium, when it is produced by Number of best diagonals 35 recombinant techniques, or free of chemical precursors or other chemicals, when it is chemically synthesized. As an alternative, the identity can also be determined A nucleic acid molecule according to the invention can be according to Chema, Ramu, Sugawara, Hideaki, Koike, isolated by Standard techniques of molecular biology and the Tadashi, Lopez, Rodrigo, Gibson, Toby J. Higgins, Desmond sequence information provided according to the invention. G, Thompson, Julie D. Multiple sequence alignment with the 40 For example, cDNA can be isolated from a suitable cDNA Clustal series of programs. (2003) Nucleic Acids Res 31 bank, using one of the concretely disclosed complete (13):3497-500, according to Internet address: ebi.ac.uk/ sequences or a segment thereof as hybridization probe and Tools/clustalw/index.htmlil and with the following param standard hybridization techniques (as described for example eters: in Sambrook, Fritsch, E. F. and Maniatis, T. Molecular Clon 45 ing: A Laboratory Manual. 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold DNA Gap Open Penalty 1S.O Spring Harbor, N.Y. 1989). Moreover, a nucleic acid mol DNA Gap Extension Penalty 6.66 ecule, comprising one of the disclosed sequences or a seg DNA Matrix Identity Protein Gap Open Penalty 1O.O ment thereof, can be isolated by polymerase chain reaction, Protein Gap Extension Penalty O.2 50 using the oligonucleotide primers that were constructed on Protein matrix Gonnet the basis of this sequence. The nucleic acid thus amplified can Protein DNAENDGAP -1 be cloned into a suitable vector and can be characterized by Protein DNA GAPDIST 4 DNA sequence analysis. The oligonucleotides according to the invention can moreover be produced by standard methods All nucleic acid sequences mentioned herein (single 55 of synthesis, e.g. with an automatic DNA synthesizer. stranded and double-stranded DNA and RNA sequences, for Nucleic acid sequences according to the invention or example cDNA and mRNA) can be produced in a manner derivatives thereof, homologs or parts of these sequences, can known per se by chemical synthesis from the nucleotide be isolated for example with usual hybridization methods or building blocks, for example by fragment condensation of PCR techniques from other bacteria, e.g. via genomic or individual overlapping, complementary nucleic acid building 60 cDNA databases. These DNA sequences hybridize under blocks of the double helix. The chemical synthesis of oligo standard conditions to the sequences according to the inven nucleotides can for example be carried out in a known man tion. ner, by the phosphoroamidite technique (Voet. Voet, 2nd edi “Hybridization” means the capacity of a poly- or oligo tion, Wiley Press New York, pages 896-897). The adding-on nucleotide to bind to an almost complementary sequence of synthetic oligonucleotides and filling of gaps using the 65 under standard conditions, whereas under these conditions Klenow fragment of DNA polymerase and ligation reactions nonspecific binding between noncomplementary partners as well as general cloning techniques are described in Sam does not occur. For this, the sequences can be up to 90-100% US 8,932,839 B2 29 30 complementary. The property of complementary sequences stitution, insertion ordeletion of single or several nucleotides, of being able to bind specifically to one another is utilized for but furthermore code for polypeptides with the desired prop example in Northernor Southern blotting or in primer binding erty profile. in PCR or RT-PCR. The invention also includes nucleic acid sequences that Short oligonucleotides of the conserved regions are used comprise so-called silent mutations or are altered correspond advantageously for hybridization. However, longer frag ing to the codon-usage of a special original or host organism, ments of the nucleic acids according to the invention or the compared with a concretely stated sequence, as well as natu complete sequences can also be used for hybridization. These rally occurring variants, for example splice variants or allele standard conditions vary depending on the nucleic acid used variants, thereof. (oligonucleotide, longer fragment or complete sequence) or 10 It also relates to sequences obtainable by conservative nucleotide Substitutions (i.e. the amino acid in question is depending on which type of nucleic acid. DNA or RNA, is replaced with an amino acid of the same charge, size, polarity used for hybridization. Thus, for example, the melting tem and/or solubility). peratures for DNA:DNA hybrids are approx. 10° C. lower The invention also relates to the molecules derived by than those of DNA:RNA hybrids of the same length. 15 sequence polymorphisms from the concretely disclosed Standard conditions mean for example, depending on the nucleic acids. These genetic polymorphisms can exist nucleic acid, temperatures between 42 and 58°C. in an aque between individuals within a population owing to natural ous buffer solution with a concentration between 0.1 to variation. These natural variations usually bring about a vari 5xSSC (1xSSC=0.15 M NaCl, 15 mM sodium citrate, pH ance of 1 to 5% in the nucleotide sequence of a gene. 7.2) or additionally in the presence of 50% formamide, for Derivatives of the nucleic acid sequences according to the example 42°C. in 5xSSC, 50% formamide. Advantageously, invention coding for cyclase mutants derived from sequence the hybridization conditions for DNA:DNA hybrids are 0.1 x SEQID NO: 1 or from one of the coding sequences for SEQ SSC and temperatures between about 20°C. to 45° C., pref ID NO: 2 to 326, in particular SEQID NO: 2 to 6, include for erably between about 30° C. to 45° C. For DNA:RNA hybrids example allele variants that have at least 60% homology at the the hybridization conditions are advantageously 0.1 xSSC 25 derived amino acid level, preferably at least 80% homology, and temperatures between about 30°C. to 55°C., preferably quite especially preferably at least 90% homology over the between about 45° C. to 55°C. These stated temperatures for whole sequence region (regarding homology at the amino hybridization are for example calculated melting temperature acid level, reference should be made to the above account values for a nucleic acid with a length of approx. 100 nucle relating to polypeptides). The homologies can advanta otides and a G+C content of 50% in the absence of forma 30 geously be higher over partial regions of the sequences. Furthermore, derivatives also mean homologs of the mide. The experimental conditions for DNA hybridization nucleic acid sequences according to the invention, for are described in relevant textbooks on genetics, for example example fungal or bacterial homologs, shortened sequences, Sambrook et al., “Molecular Cloning, Cold Spring Harbor single-strand DNA or RNA of the coding and noncoding Laboratory, 1989, and can be calculated using formulas 35 DNA sequence. known by a person skilled in the art, for example depending Moreover, derivatives mean for example fusions with pro on the length of the nucleic acids, the type of hybrids or the moters. The promoters, which are added to the given nucle G+C content. Further information on hybridization can be otide sequences, can be altered by at least one nucleotide obtained by a person skilled in the art from the following exchange, at least one insertion, inversion and/or deletion, textbooks: Ausubel et al. (eds), 1985, Current Protocols in 40 without the functionality or efficacy of the promoters being Molecular Biology, John Wiley & Sons, New York; Hames impaired. Moreover, the efficacy of the promoters can be and Higgins (eds), 1985, Nucleic Acids Hybridization: A increased by altering their sequence or they can be exchanged Practical Approach, IRL Press at Oxford University Press, completely for more effective promoters even of organisms of Oxford; Brown (ed), 1991, Essential Molecular Biology: A a different species. Practical Approach, IRL Press at Oxford University Press, 45 3.2 Generation of Functional Mutants Oxford. Furthermore, methods for producing functional mutants of “Hybridization can in particular take place under strin enzymes according to the invention are known by a person gent conditions. Said hybridization conditions are described skilled in the art. for example by Sambrook, J., Fritsch, E. F., Maniatis, T. in: Depending on the technology used, a person skilled in the Molecular Cloning (A Laboratory Manual), 2nd edition, Cold 50 art can introduce completely random or even more-directed Spring Harbor Laboratory Press, 1989, pages 931-9.57 or in mutations in genes or also noncoding nucleic acid regions Current Protocols in Molecular Biology, John Wiley & Sons, (which for example are important for the regulation of expres N.Y. (1989), 6.3.1-6.3.6. sion) and then prepare gene libraries. The necessary methods “Stringent hybridization conditions mean in particular: of molecular biology are known by a person skilled in the art Incubation at 42°C. overnight in a solution consisting of 50% 55 and for example are described in Sambrook and Russell, formamide, 5xSSC (750 mM. NaCl, 75 mM trisodium cit Molecular Cloning, 3rd edition, Cold Spring Harbor Labora rate), 50 mM sodium phosphate (pH7.6), 5xDenhardt solu tory Press 2001. tion, 10% dextran sulfate and 20 g/ml denatured, sheared Methods for altering genes and therefore for altering the salmon sperm DNA, followed by a step of washing the filters proteins that they encode have long been familiar to a person with 0.1XSSC at 85°C. 60 skilled in the art, for example The invention also relates to derivatives of the concretely site-directed mutagenesis, in which single or several nucle disclosed or derivable nucleic acid sequences. otides of a gene are deliberately exchanged (Trower MK Thus, further nucleic acid sequences according to the (Ed.). In vitro mutagenesis protocols, Humana Press, invention coding for cyclase mutants can be derived e.g. from New Jersey), SEQID NO: 1 or from the coding sequences for SEQID NO: 65 saturation mutagenesis, in which a codon for any amino 2 to 326, in particular SEQ ID NO: 2 to 6, by an F486 or acid can be exchanged or added at any point of a gene F486-analog mutation and differ from them by addition, sub (Kegler-Ebo D M. Docktor C M, DiMaio D (1994) US 8,932,839 B2 31 32 Nucleic Acids Res 22:1593: Barettino D, Feigenbutz M, An 'expression unit’ means, according to the invention, a Valcárel R. Stunnenberg HG (1994) Nucleic Acids Res nucleic acid with expression activity, which comprises a pro 22:541; Barik S (1995) Mol Biotechnol 3:1), moter, as defined herein, and after functional linkage with a the error-prone polymerase chain reaction (error-prone nucleic acid to be expressed or a gene, regulates the expres PCR), in which nucleotide sequences are mutated by Sion, i.e. the transcription and the translation of said nucleic error-prone DNA polymerases (Eckert KA, Kunkel TA acid or said gene. Therefore in this connection it is also called (1990) Nucleic Acids Res 18:3739): a “regulatory nucleic acid sequence'. In addition to the pro the SeSaM method (sequence saturation method), in which moter, other regulatory elements, for example enhancers, can preferred exchanges are prevented by the polymerase. also be present. Schenket al., Biospektrum, Vol. 3, 2006, 277-279 10 An 'expression cassette' or “expression construct” means, the passaging of genes in mutator strains, in which, for according to the invention, an expression unit that is function example owing to defective DNA repair mechanisms, ally linked to the nucleic acid to be expressed or the gene to be there is an increased mutation rate of nucleotide expressed. In contrast to an expression unit, an expression sequences (Greener A, Callahan M. Jerpseth B (1996) cassette therefore comprises not only nucleic acid sequences An efficient random mutagenesis technique using an E. 15 that regulate transcription and translation, but also the nucleic coli mutator strain. In: Trower M K (Ed.) in vitro acid sequences that are to be expressed as protein as a result of mutagenesis protocols. Humana Press, New Jersey), or the transcription and translation. DNA shuffling, in which a pool of closely related genes is The terms “expression' or “overexpression” describe, in formed and digested and the fragments are used as tem the context of the invention, the production or increase in plates for a polymerase chain reaction, in which, by intracellular activity of one or more enzymes in a microor repeated Strand separation and bringing together again, ganism, which are encoded by the corresponding DNA. For finally mosaic genes of full length are produced (Stem this, it is possible for example to introduce a gene into an mer W P C (1994) Nature 370:389; Stemmer W P C organism, replace an existing gene with another gene, (1994) Proc Natl AcadSci USA'91: 10747). increase the copy number of the gene or genes, use a strong Using so-called directed evolution (described for instance 25 promoter or use a gene that codes for a corresponding enzyme in Reetz M T and Jaeger K-E (1999), Topics Curr Chem with a high activity; optionally, these measures can be com 200:31: Zhao H. Moore J C, Volkov AA, Arnold F H (1999), bined. Methods for optimizing industrial enzymes by directed evo Preferably said constructs according to the invention com lution, in: Demain A L. Davies J E (Ed.) Manual of industrial prise a promoter 5'-upstream of the respective coding microbiology and biotechnology. American Society for 30 sequence and a terminator sequence 3'-downstream and Microbiology), a person skilled in the art can produce func optionally other usual regulatory elements, in each case tional mutants in a directed manner and on a large scale. For operatively linked with the coding sequence. this, in a first step, gene libraries of the respective proteins are A "promoter', of a “nucleic acid with promoteractivity” or first produced, for example using the methods given above. of a “promoter sequence” means, according to the invention, The gene libraries are expressed in a suitable way, for 35 a nucleic acid which, functionally linked to a nucleic acid to example by bacteria or by phage display systems. be transcribed, regulates the transcription of said nucleic acid. The relevant genes of host organisms that express func A “functional or “operative' linkage means, in this con tional mutants with properties that largely correspond to the nection, for example the sequential arrangement of one of the desired properties can be submitted to another round of muta nucleic acids with promoter activity and of a nucleic acid tion. The steps of mutation and selection or screening can be 40 sequence to be transcribed and optionally further regulatory repeated iteratively until the present functional mutants have elements, for example nucleic acid sequences that ensure the the desired properties to a sufficient extent. Using this itera transcription of nucleic acids, and for example a terminator, tive procedure, a limited number of mutations, for example 1, in Sucha way that each of the regulatory elements can perform 2, 3, 4 or 5 mutations, can be effected in stages and can be its function during transcription of the nucleic acid sequence. assessed and selected for their influence on the enzyme prop 45 This does not necessarily require a direct linkage in the erty in question. The selected mutant can then be submitted to chemical sense. Genetic control sequences, for example a further mutation step in the same way. In this way the enhancer sequences, can even exert their function on the number of individual mutants to be investigated can be target sequence from more remote positions or even from reduced significantly. other DNA molecules. Arrangements are preferred in which The results according to the invention also provide impor 50 the nucleic acid sequence to be transcribed is positioned tant information relating to structure and sequence of the behind (i.e. at the 3'-end of) the promoter sequence, so that the relevant enzymes, which is required for deliberately generat two sequences are joined together covalently. The distance ing further enzymes with desired modified properties. In par between the promoter sequence and the nucleic acid sequence ticular so-called "hot spots’ can be defined, i.e. sequence to be expressed transgenically can be smaller than 200 base segments that are potentially suitable for modifying an 55 pairs, or smaller than 100 base pairs or smaller than 50 base enzyme property by introducing targeted mutations. pairs. Information can also be deduced regarding amino acid In addition to promoters and terminator, the following may sequence positions, in the region of which mutations can be be mentioned as examples of other regulatory elements: tar carried out that should probably have little effect on enzyme geting sequences, enhancers, polyadenylation signals, select activity, and can be designated as potential “silent mutations'. 60 able markers, amplification signals, replication origins and 3.3 Constructs the like. Suitable regulatory sequences are described for The invention further relates to, in particular recombinant, example in Goeddel, Gene Expression Technology: Methods expression constructs, containing, under the genetic control in Enzymology 185, Academic Press, San Diego, Calif. of regulatory nucleic acid sequences, a nucleic acid sequence (1990). coding for a polypeptide according to the invention; and, in 65 Nucleic acid constructs according to the invention com particular recombinant, vectors, comprising at least one of prise in particular a sequence coding for a cyclase mutant, e.g. these expression constructs. derived from SEQID NO: 1 or coding for a mutant of SEQID US 8,932,839 B2 33 34 NO: 2 to 326 or derivatives and homologs thereof, and the gous recombination into the genome of the host organism. nucleic acid sequences derivable therefrom, which have been This linear DNA can consist of a linearized vector such as a linked operatively or functionally with one or more regula plasmid or only of the nucleic acid construct or the nucleic tory signals advantageously for controlling, e.g. increasing, acid according to the invention. gene expression. For optimal expression of heterologous genes in organ In addition to these regulatory sequences, the natural regu isms, it is advantageous to alter the nucleic acid sequences lation of these sequences can still be present before the actual corresponding to the specific "codon usage' used in the structural genes and optionally can have been genetically organism. The "codon usage' can easily be determined on the altered, so that the natural regulation has been switched off basis of computer evaluations of other known genes of the and expression of the genes has been increased. The nucleic 10 organism in question. acid construct can, however, also be of simpler construction, An expression cassette according to the invention is pro i.e. no additional regulatory signals have been inserted before duced by fusion of a suitable promoter with a suitable coding the coding sequence and the natural promoter, with its regu nucleotide sequence and a terminator signal or polyadenyla lation, has not been removed. Instead, the natural regulatory tion signal. Common recombination and cloning techniques sequence is mutated so that regulation no longer takes place 15 are used, as described for example in T. Maniatis, E. F. Fritsch and gene expression is increased. and J. Sambrook, Molecular Cloning: A Laboratory Manual, A preferred nucleic acid construct advantageously also Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. contains one or more of the "enhancer” sequences already (1989) and in T. J. Silhavy, M. L. Berman and L. W. Enquist, mentioned, functionally linked to the promoter, which make Experiments with Gene Fusions, Cold Spring Harbor Labo increased expression of the nucleic acid sequence possible. ratory, Cold Spring Harbor, N.Y. (1984) and in Ausubel, P. M. Additional advantageous sequences can also be inserted at the et al., Current Protocols in Molecular Biology, Greene Pub 3'-end of the DNA sequences, such as further regulatory lishing Assoc. and Wiley Interscience (1987). elements or terminators. One or more copies of the nucleic For expression in a suitable host organism, advantageously acids according to the invention can be contained in the con the recombinant nucleic acid construct or gene construct is struct. The construct can also contain other markers, such as 25 inserted into a host-specific vector, which makes optimal antibiotic resistances or auxotrophy complementing genes, expression of the genes in the host possible. Vectors are well optionally for selection on the construct. known by a person skilled in the art and are given for example Examples of suitable regulatory sequences are contained in in “Cloning vectors’ (Pouwels P. H. et al., Ed., Elsevier, promoters such as cos-, tac-, trp-, tet-, trp-tet-, lpp-, lac-, Amsterdam-New York-Oxford, 1985). lpp-lac-, lac17. T7- T5-, T3-, gal-, trc-, ara-, rhap (rhab.) 30 4. Microorganisms SP6-, lambda-P- or in the lambda-P-promoter, which Depending on the context, the term “microorganism' can advantageously find application in gram-negative bacteria. mean the wild-type microorganism or a genetically altered, Further advantageous regulatory sequences are contained for recombinant microorganism or both. example in the gram-positive promoters amy and SPO2, in Using the vectors according to the invention, recombinant the yeast or fungal promoters ADC1, MFalpha, AC, P-60, 35 microorganisms can be produced, which are for example CYC1, GAPDH, TEF, rp28, ADH, Artificial promoters can transformed with at least one vector according to the inven also be used for regulation. tion and can be used for producing the polypeptides accord For expression in a host organism, the nucleic acid con ing to the invention. Advantageously, the recombinant con struct is advantageously inserted into a vector, for example a structs according to the invention, described above, are plasmid or a phage, which makes optimal expression of the 40 introduced into a suitable host system and expressed. Prefer genes in the host possible. Apart from plasmids and phage, ably common cloning and transfection methods, known by a vectors are also to be understood as all other vectors known by person skilled in the art, are used, for example coprecipita a person skilled in the art, e.g. viruses, such as SV40. CMV, tion, protoplast fusion, electroporation, retroviral transfec baculovirus and adenovirus, transposons. IS elements, phas tion and the like, for expressing the stated nucleic acids in the mids, cosmids, and linear or circular DNA. These vectors can 45 respective expression system. Suitable systems are described be replicated autonomously in the host organism or can be for example in Current Protocols in Molecular Biology, F. replicated chromosomally. These vectors represent a further Ausubel et al., Ed., Wiley Interscience, New York 1997, or embodiment of the invention. Sambrook et al. Molecular Cloning: A Laboratory Manual. Suitable plasmids are for example in E. coli plG338, 2nd edition, Cold Spring Harbor Laboratory, Cold Spring pACYC184, pBR322, puC18, pKC30, pRep4, pHS1, 50 Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. pKK223-3, pIDHE19.2, pHS2, pPLc236, pMBL24, pIG200, In principle, all prokaryotic or eukaryotic organisms may pUR290, pIN-III'-B1, gt11 or pBdCl, in Streptomyces be considered as recombinant host organisms for the nucleic pIJ101, pIJ364, pIJ702 or pIJ361, in Bacillus puB110, acid according to the invention or the nucleic acid construct. pC194 or p3D214, in Corynebacterium pSAT7 orpAJ667, in Advantageously, microorganisms such as bacteria, fungi or fungi pALS1, pIL2 or pBB 116, in yeasts 2alphaM, p.AG-1, 55 yeasts are used as host organisms. Advantageously, gram YEp6. YEp13 or pEMBLYe23 or in plants pIGV23, positive or gram-negative bacteria are used, preferably bac pGHlac", pBIN19, p.AK2004 orpDH51. The stated plasmids teria of the families Enterobacteriaceae, Pseudomonadaceae, represent a small selection of the possible plasmids. Further Rhizobiaceae, Streptomycetaceae or Nocardiaceae, espe plasmids are well known by a person skilled in the art and can cially preferably bacteria of the genera Escherichia, for example be found in the book Cloning Vectors (Eds. 60 Pseudomonas, Streptomyces, Nocardia, Burkholderia, Sal Pouwels P. H. et al. Elsevier, Amsterdam-New York-Oxford, monella, Agrobacterium, Clostridium or Rhodococcus. The 1985, ISBN 0444904018). genus and species Escherichia coli is quite especially pre In another embodiment of the vector, the vector containing ferred. Furthermore, other advantageous bacteria are to be the nucleic acid construct according to the invention or the found in the group of alpha-Proteobacteria, beta-Proteobac nucleic acid according to the invention can also advanta 65 teria or gamma-Proteobacteria. geously be introduced in the form of a linear DNA into the The host organism or the host organisms according to the microorganisms and integrated via heterologous or homolo invention preferably contain at least one of the nucleic acid US 8,932,839 B2 35 36 sequences, nucleic acid constructs or vectors described in the protein, yeast extract, meat extract and others. The nitrogen present invention, which code for an enzyme with phenyle Sources can be used alone or as a mixture. thanol dehydrogenase activity according to the above defini Inorganic salt compounds that can be present in the media tion. comprise the chloride, phosphorus or Sulfate salts of calcium, Depending on the host organism, the organisms used in the magnesium, sodium, cobalt, molybdenum, potassium, man method according to the invention are grown or cultured in a ganese, Zinc, copper and iron. manner known by a person skilled in the art. Microorganisms Inorganic Sulfur-containing compounds, for example Sul are as a rule grown in a liquid medium, which contains a fates, Sulfites, dithionites, tetrathionates, thiosulfates, Sul carbon Source generally in the form of Sugars, a nitrogen fides, as well as organic Sulfur compounds, such as mercap Source generally in the form of organic nitrogen sources Such 10 tans and thiols, can be used as the Sulfur source. as yeast extract or salts such as ammonium sulfate, trace Phosphoric acid, potassium dihydrogen phosphate or dipo elements such as iron, manganese and magnesium salts and tassium hydrogen phosphate or the corresponding sodium optionally vitamins, at temperatures between 0°C. and 100° containing salts can be used as the phosphorus Source. C., preferably between 10°C. to 60°C. with oxygen aeration. Chelating agents can be added to the medium, in order to The pH of the liquid nutrient can be kept at a fixed value, i.e. 15 keep the metal ions in Solution. Especially suitable chelating regulated or not during culture, Culture can be batchwise, agents comprise dihydroxyphenols, such as catechol or pro semi-batchwise or continuous. Nutrients can be present at the tocatechuate, or organic acids. Such as citric acid. beginning of fermentation or can be Supplied later, semicon The fermentation media used according to the invention tinuously or continuously. usually also contain other growth factors, such as vitamins or 5. Recombinant Production of Enzymes According to the growth promoters, which include for example biotin, ribofla Invention vin, thiamine, folic acid, nicotinic acid, pantothenate and The invention further relates to methods for recombinant pyridoxine. Growth factors and salts often originate from the production of polypeptides according to the invention or components of complex media, Such as yeast extract, molas functional, biologically active fragments thereof, wherein a ses, corn-steep liquor and the like. Moreover, Suitable precur polypeptide-producing microorganism is cultured, optionally 25 sors can be added to the culture medium. The exact compo the expression of the polypeptides is induced and these are sition of the compounds in the medium is strongly dependent isolated from the culture. The polypeptides can also be pro on the respective experiment and is decided for each specific duced in this way on an industrial scale, if desired. case individually. Information on media optimization can be The microorganisms produced according to the invention found in the textbook Applied Microbiol. Physiology, A can be cultured continuously or discontinuously in the batch 30 Practical Approach” (Ed, P. M. Rhodes, P. F. Stanbury, IRL method or in the fed-batch method or repeated fed-batch Press (1997) p. 53-73. ISBN 0 199635773), Growth media method. A summary of known cultivation methods can be can also be obtained from commercial suppliers, such as found in the textbook by Chmiel (Bioprozesstechnik 1, Ein Standard 1 (Merck) or BHI (brain heart infusion, DIFCO) and führung in die Bioverfahrenstechnik Bioprocess technology the like. 1. Introduction to bioprocess technology (Gustav Fischer 35 All components of the medium are sterilized, either by heat Verlag, Stuttgart, 1991)) or in the textbook by Storhas (20 min at 1.5 bar and 121°C.) or by sterile filtration. The (Bioreaktoren und periphere Einrichtungen Bioreactors and components can either be sterilized together, or separately if peripheral equipment (Vieweg Verlag, Braunschweig/Wies necessary. All components of the medium can be present at baden, 1994)). the start of culture or can be added either continuously or The culture medium to be used must suitably meet the 40 batchwise. requirements of the respective strains. Descriptions of culture The culture temperature is normally between 15° C. and media for various microorganisms are given in the manual 45° C., preferably 25°C. to 40° C. and can be varied or kept “Manual of Methods for General Bacteriology of the Ameri constant during the experiment. The pH of the medium can Society for Bacteriology (Washington D.C., USA, 1981). should be in the range from 5 to 8.5, preferably around 7.0. These media usable according to the invention usually 45 The pH for growing can be controlled during growing by comprise one or more carbon sources, nitrogen Sources, inor adding basic compounds such as Sodium hydroxide, potas ganic salts, vitamins and/or trace elements. sium hydroxide, ammonia or ammonia water or acid com Preferred carbon Sources are Sugars, such as mono-, di- or pounds such as phosphoric acid or Sulfuric acid. Antifoaming polysaccharides. Very good carbon Sources are for example agents, for example fatty acid polyglycol esters, can be used glucose, fructose, mannose, galactose, ribose, Sorbose, ribu 50 for controlling foaming. To maintain the stability of plasmids, lose, lactose, maltose, Sucrose, raffinose, starch or cellulose. Suitable selective Substances, for example antibiotics, can be Sugars can also be added to the media via complex com added to the medium. To maintain aerobic conditions, oxygen pounds, such as molasses, or other by-products of Sugar refin or oxygen-containing gas mixtures, for example ambient air, ing. It can also be advantageous to add mixtures of different are fed into the culture. The temperature of the culture is carbon sources. Other possible carbon sources are oils and 55 normally in the range from 20° C. to 45° C. The culture is fats, for example soybean oil, Sunflower oil, peanut oil and continued until a maximum of the desired product has coconut oil, fatty acids, for example palmitic acid, Stearic acid formed. This target is normally reached within 10 hours to or linoleic acid, alcohols, for example glycerol, methanol or 160 hours. ethanol and organic acids, for example acetic acid or lactic The fermentation broth is then processed further. Depend acid. 60 ing on requirements, the biomass can be removed from the Nitrogen sources are usually organic or inorganic nitrogen fermentation broth completely or partially by separation tech compounds or materials that contain these compounds. niques, for example centrifugation, filtration, decanting or a Examples of nitrogen sources comprise ammonia gas or combination of these methods or can be left in it completely. ammonium salts, such as ammonium sulfate, ammonium If the polypeptides are not secreted in the culture medium, chloride, ammonium phosphate, ammonium carbonate or 65 the cells can also be lysed and the product can be obtained ammonium nitrate, nitrates, urea, amino acids or complex from the lysate by known methods for isolation of proteins. nitrogen sources, such as corn-steep liquor, soya flour, Soya The cells can optionally be disrupted with high-frequency US 8,932,839 B2 37 38 ultrasound, high pressure, for example in a French press, by described for example in J. Lalonde and A. Margolin “Immo oSmolysis, by the action of detergents, lytic enzymes or bilization of Enzymes' in K. Drauz and H. Waldmann, organic solvents, by means of homogenizers or by a combi Enzyme Catalysis in Organic Synthesis 2002, Vol. III, 991 nation of several of the aforementioned methods. 1032, Weinheim. Further information on biotransformations The polypeptides can be purified by known chromato and bioreactors for carrying out methods according to the graphic techniques, such as molecular sieve chromatography invention are also given for example in Rehm et al. (Ed.) (gel filtration). Such as Q-Sepharose chromatography, on Biotechnology, 2nd Edn, Vol 3, Chapter 17, VCH, Weinheim. exchange chromatography and hydrophobic chromatogra 7. Enzymatic Cyclization of Terpenes phy, and with other usual techniques such as ultrafiltration, 7.1 General Description crystallization, salting-out, dialysis and native gel electro 10 In particular, the method of cyclization according to the phoresis. Suitable methods are described for example in Coo invention is carried out in the presence of an enzyme, wherein per, T.G., Biochemische Arbeitsmethoden Biochemical pro the enzyme is encoded by a nucleic acid sequence according cesses. Verlag Walter de Gruyter, Berlin, New York or in to SEQID NO: 1 or a functional equivalent thereof, wherein Scopes, R., Protein Purification, Springer Verlag, New York, the nucleic acid sequence is a constituent of a gene construct Heidelberg, Berlin. 15 or vector. Said gene constructs or vectors are described in For isolating the recombinant protein, it can be advanta detail in international application PCT/EP2010/057696 on geous to use vector systems or oligonucleotides, which pages 16 to 20, to which reference is expressly made here. lengthen the cDNA by defined nucleotide sequences and Said functional equivalents, in particular those with citronel therefore code for altered polypeptides or fusion proteins, lal-isopulegol cyclase activity, comprise in particular an F486 which for example serve for easier purification. Suitable or F486-analog mutation, as defined herein. modifications of this type are for example so-called “tags' The host cell, which contains a gene construct or a vector, functioning as anchors, for example the modification known in which the nucleic acid sequence is contained that codes for as hexa-histidine anchor or epitopes that can be recognized as the enzyme with the desired activity, is also designated as antigens of antibodies (described for example in Harlow, E. transgenic organism. The production of said transgenic and Lane. D., 1988, Antibodies: A Laboratory Manual. Cold 25 organisms is known in principle and is discussed for example Spring Harbor (N.Y.) Press). These anchors can serve for in international application PCT/EP2010/057696 on page 20, attaching the proteins to a solid carrier, for example a polymer to which reference is expressly made here. matrix, which can for example be used as packing in a chro Cells from the group comprising bacteria, cyanobacteria, matography column, or can be used on a microtiter plate or on fungi and yeasts are preferably selected as transgenic organ Some other carrier. 30 isms. The cell is preferably selected from fungi of the genus At the same time these anchors can also be used for recog Pichia or bacteria of the genera Escherichia, Corynebacte nition of the proteins. For recognition of the proteins, it is rium, Ralstonia, Clostridium, Pseudomonas, Bacillus, moreover also possible to use usual markers, such as fluores Zymomonas, Rhodobacter; Streptomyces, Burkholderia, Lac cent dyes, enzyme markers, which form a detectable reaction tobacillus or Lactococcus. Especially preferably, the cell is product after reaction with a substrate, or radioactive mark 35 selected from bacteria of the species Escherichia coli, ers, alone or in combination with the anchors for derivatiza Pseudomonas putida, Burkholderia glumae, Streptomyces tion of the proteins. lividans, Streptomyces coelicolor or Zymomonas mobilis. For the expression of mutants according to the invention, A method according to the invention is preferred, charac reference may be made to the description of expression of the terized in that the enzyme with the activity of a citronellal wild-type enzyme EbN1 and the expression systems usable 40 isopulegol cyclase is encoded by a gene that was isolated for this in WO2005/108590 and WO2006/094945, to which from a microorganism, selected from Zymomonas mobilis, reference is hereby expressly made. Methylococcus capsulatus, Rhodopseudomonas palustris, 6. Enzyme Immobilization Bradyrhizobium japonicum, Frankia spec, Streptomyces The enzymes according to the invention can be used free or coelicolor and Acetobacter pasteurianus. The relevant genes immobilized in the method described herein. An immobilized 45 isolated from Zymomonas mobilis, Streptomyces coelicolor, enzyme is an enzyme that is fixed to an inert carrier. Suitable Bradyrhizobium japonicum and Acetobacter pasteurianus carrier materials and the enzymes immobilized thereon are should be mentioned in particular. known from EP-A-1 149849. EP-A-1 069 183 and DE-OS A method according to the invention is further preferred, 100193773 and from the references cited therein. Reference characterized in that the enzyme with cyclase activity was is made in this respect to the disclosure of these documents in 50 generated by a microorganism that overproduces the enzyme their entirety. Suitable carrier materials include for example and that was selected from the group of microorganisms clays, clay minerals, such as kaolinite, diatomaceous earth, comprising the genera Escherichia, Corynebacterium, Ral perlite, silica, aluminum oxide, sodium carbonate, calcium stonia, Clostridium, Pseudomonas, Bacillus, Zymomonas, carbonate, cellulose powder, anion exchanger materials, Syn Rhodobacter, Streptomyces, Burkholderia, Lactobacillus and thetic polymers, such as polystyrene, acrylic resins, phenol 55 LactoCOCCus. formaldehyde resins, polyurethanes and polyolefins, such as In particular, a method according to the invention should be polyethylene and polypropylene. For making the Supported mentioned that is characterized in that the enzyme with enzymes, the carrier materials are usually employed in a cyclase activity was produced by transgenic microorganisms finely-divided, particulate form, porous forms being pre of the species Escherichia coli, Pseudomonas putida, ferred. The particle size of the carrier material is usually not 60 Burkholderia glumae, Corynebacterium glutamicum, Sac more than 5 mm, in particular not more than 2 mm (particle charomyces cerevisiae, Pichia pastoris, Streptomyces liv size distribution curve). Similarly, when using dehydroge idans, Streptomyces coelicolor, Bacillus subtilis or Zymomo nase as whole-cell catalyst, a free or immobilized form can be nas mobilis, which overproduce the enzyme with cyclase selected. Carrier materials are e.g. Ca-alginate, and carrag activity. eenan. Enzymes as well as cells can also be crosslinked 65 Further embodiments for carrying out the biocatalytic directly with glutaraldehyde (cross-linking to CLEAs). Cor cyclization method according to the invention, Such as, for responding and other immobilization techniques are example, the method for production of isopulegol: US 8,932,839 B2 39 40 The method according to the invention is characterized in the organic phase can easily be separated from the aqueous that the enzyme is in at least one of the following forms: phase that comprises the biocatalyst. a) free, optionally purified or partially purified polypep A method according to the invention is preferred wherein tide; the production ofisopulegol takes place in single-phase aque b) immobilized polypeptide; ous systems or in two-phase systems. c) polypeptide isolated from cells according to a) or b); The reaction product isopulegol can be extracted with d) whole cell, optionally dormant or growing cells, com organic solvents and optionally can be distilled for purifica prising at least one Such polypeptide; tion. e) lysate or homogenizate of the cell according to d). Suitable organic solvents are for example aliphatic hydro Another embodiment of the method according to the inven 10 carbons, preferably with 5 to 8 carbonatoms, such as pentane, tion is characterized in that the cells are microorganisms, cyclopentane, hexane, cyclohexane, heptane, octane or preferably transgenic microorganisms expressing at least one cyclooctane, halogenated aliphatic hydrocarbons, preferably heterologous nucleic acid molecule coding for a polypeptide with one or two carbon atoms, such as dichloromethane, with the cyclase activity. 15 chloroform, carbon tetrachloride, dichloroethane or tetra A preferred embodiment of the method according to the chloroethane, aromatic hydrocarbons, such as benzene, tolu invention comprises at least the following steps a), b) and d): ene, the Xylenes, chlorobenzene or dichlorobenzene, ali a) isolating or recombinantly producing a microorganism phatic acyclic and cyclic ethers or alcohols, preferably with 4 producing an enzyme with cyclase activity from a natural to 8 carbonatoms, such as ethanol, isopropanol, diethyl ether, Source or, methyl-tert-butyl ether, ethyl-tert-butyl ether, dipropyl ether, b) multiplying this microorganism, diisopropyl ether, dibutyl ether, tetrahydrofuran oresters such c) optionally isolating the enzyme with cyclase activity from as ethyl acetate or n-butyl acetate or ketones such as methyl the microorganism or preparing a protein fraction compris isobutyl ketone or dioxane or mixtures thereof. Especially ing said enzyme, and preferably, the aforementioned heptane, methyl-tert-butyl d) transferring the microorganism according to stage b) or the 25 ether, diisopropyl ether, tetrahydrofuran, and ethyl acetate are enzyme according to stage c) to a medium that contains used. Substrate, e.g. citronellal of general formula (I). The cyclases used according to the invention can be used in In the method according to the invention, Substrate. Such the method according to the invention as free or immobilized as, for example, citronellal is contacted with the enzyme, that enzyme, as already described above. has the activity of a citronellal-isopulegol cyclase, in a 30 medium and/or is incubated so that conversion of the sub For the method according to the invention it is possible to strate, such as, for example, of citronellal, to isopulegol, takes use dormant or growing, free or immobilized cells, which place in the presence of the enzyme. Preferably the medium is contain nucleic acids, nucleic acid constructs or vectors cod an aqueous reaction medium. ing for the cyclase. Lysed cells, such as cell lysates or cell The pH of the aqueous reaction medium in which the 35 homogenates can also be used. Lysed cells are for example method according to the invention is preferably carried out is cells that have been permeabilized by a treatment for example advantageously maintained between pH 4 and 12, preferably with solvents, or cells that have been disrupted by an enzyme between pH 4.5 and 9, especially preferably between pH 5 treatment, by a mechanical treatment (e.g. French press or and 8. ultrasound) or by some other method. The resultant raw The aqueous reaction media are preferably buffered solu 40 extracts are advantageously suitable for the method according tions, which as a rule have a pH of preferably from 5 to 8. The to the invention. Purified or partially purified enzymes can buffer used can be a citrate, phosphate, TRIS (Tris(hy also be used for the method. droxymethyl)-aminomethane) or MES buffer (2-(N-mor Where tree organisms or enzymes are used for the method pholino)ethanesulfonic acid). Moreover, the reaction according to the invention, they are usefully isolated, via a medium can contain other additives, for example detergents 45 filtration or centrifugation, for example, prior to the extrac (for example taurodeoxycholate). tion. The Substrate. Such as, for example, citronellal, is used The method according to the invention can be operated preferably in a concentration of 2-200 mM, especially pref batchwise, semibatchise or continuously. erably 5-25 mM in the enzymatic reaction and can be supplied 7.2. Enzymatic Cyclization of Citronellal continuously or discontinuously. 50 As a rule the enzymatic cyclization takes place at a reaction The citronellal of formula (II) used in accordance with the temperature below the deactivation temperature of the invention, and converted by means of an enzyme having enzyme used and above -10° C. Preferably the method citronellal-isopulegol cyclase activity, is available commer according to the invention is carried out at a temperature cially both as (+)-R-citronellal of the formula (R-II) and as between 0° C. and 95°C., especially preferably at a tempera 55 (-)-S-citronellal of the formula (S-II), and as a racemate of ture between 15° C. and 60°C., in particular between 20 and the formula (II). 40° C., e.g. at about 25 to 30° C. A method according to the invention in which the reaction of citronellal isopulegol takes place at a temperature in the (R-II) range from 20 to 40° C. and/or a pH in the range from 4 to 8 60 is especially preferred. (R) As well as these single-phase aqueous systems, in another variant of the invention, two-phase systems are also used. Then, as well as an aqueous phase, organic, non-water-mis cible reaction media are used as the second phase. As a result, 65 the reaction products accumulate in the organic phase. After the reaction, the product, Such as, for example, isopulegol, in US 8,932,839 B2 41 42 -continued continued

(S-II) R S

R S OH 1 “on N 1s 10 1R, 3R,6R 1S, 3S,6R Epi-Isopulegol The isopulegol formed in accordance with the invention, of formula (I) Suitable enzymes having the activity of a citronellal-isop 15 ulegol cyclase are intramolecular transferases from the Sub class of the isomerases; that is, proteins having the enzyme (I) code EC 5.4 (enzyme code in accordance with Eur. J. Bio chem. 1999, 264, 610-650). Preferably they are representa tives having the enzyme code 5.4.99.17. Also suitable in particular as enzymes having the activity of citronellal-isop ulegol cyclase are those cyclases which also bring about the cyclization of homofarnesol to ambroxan or of squalene to hopene, which are described exhaustively in international application PCT/EP2010/057696, hereby incorporated by 25 reference; the enzymes and mutants described here are also suitable. has a stereocenter in each of positions 1, 3 and 6, and so in One particularly suitable embodiment of the method principle there are 4 different diastereomers each with 2 enan according to the invention is that wherein the enzyme used in tiomers conceivable, in other words a total of 8 stereomers, if the method according to the invention and having the activity the starting point is the racemate of the citronellal of formula 30 of a citronellal-isopulegol cyclase possesses a polypeptide (I). sequence which either a) is SEQID NO: 2, or b) in which up to 25% of the amino acid residues are altered relative to SEQID NO: 2 by deletion, insertion, substitu 35 tion or a combination thereof, and which still has at least 50% of the enzymatic activity of SEQID NO: 2. Suitable enzymes with citronellal-isopulegol cyclase activity and comprising an amino sequence according to SEQ ID NO: 2, and also “functional equivalents’ or analogs of the 40 specifically disclosed enzymes (E) having citronellal-isop ulegol cyclase activity, are described, as already indicated above, exhaustively in the international application PCT/ EP2010/057696, hereby incorporated by reference. In one particularly preferred embodiment of the method, 45 the enzyme having citronellal-isopulegol cyclase activity is selected from enzymes which comprise an amino acid sequence according to SEQID NO: 2 or a sequence derived therefrom in which up to 25%, preferably up to 20%, more preferably up to 15%, in particular up to 10,9,8,7,6, 5, 4, 3, 50 2, 1% of the amino acid residues have been altered by a deletion, a Substitution, an insertion or a combination of dele tion, Substitution and insertion, the polypeptide sequences altered relative to SEQID NO: 2 still possessing at least 50%, preferably 65%, more preferably 80%, more particularly 55 more than 90% of the enzymatic activity of SEQID NO:2. In this context, enzymatic activity of SEQID NO: 2 refers to the capacity to effect biocatalytic cyclization of citronellal of general formula (II) to the corresponding isopulegol of for mula (I). 60 The method according to the invention is carried out pref erably in the presence of an enzyme, the enzyme being encoded by a nucleic acid sequence according to SEQID NO: 1 or a functional equivalent thereof. Functional equivalents here describe in principle nucleic 65 acid sequences which under standard conditions undergo Iso-Isopulegol hybridization with a nucleic acid sequence or parts of a nucleic acid sequence and are capable of bringing about the US 8,932,839 B2 43 44 expression of a protein having the same properties as those of isopulegol cyclase has been produced by transgenic microor the enzyme having citronellal-isopulegol cyclase activity in a ganisms of the species Escherichia coli, Pseudomonas cell or in an organism. putida, Burkholderia glumae, Corynebacterium glutamicum, A functional equivalent is additionally understood to refer Saccharomyces cerevisiae, Pichia pastoris, Streptomyces liv to nucleic acid sequences which are homologous or identical idans, Streptomyces coelicolor, Bacillus subtilis or Zymomo to a defined percentage with a particular nucleic acid nas mobilis which overproduce the enzyme having the activ sequence ("original nucleic acid sequence') and have the ity of a citronellal-isopulegol cyclase. same activity as the original nucleic acid sequences, and also, The above-described further embodiments for carrying out in particular, natural or artificial mutations of these nucleic the biocatalytic method according to the invention for cycliz acid sequences. 10 ing terpenes apply correspondingly in respect of the produc The nucleic acid sequences which can be used for encoding tion of isopulegol. the enzymes having citronellal-isopulegol cyclase activity A further subject of the present invention is also the use of that can be used in the method according to the invention are an enzyme having the activity of a citronellal-isopulegol likewise described exhaustively in international application cyclase for the biocatalytic conversion of citronellal to isop PCT/EP2010/057696, hereby incorporated by reference. 15 ulegol. With particular preference the method according to the Preference is given to the use of an enzyme having the invention is carried out in the presence of an enzyme, the activity of a citronellal-isopulegol cyclase for the biocatalytic enzyme being encoded by a nucleic acid sequence according conversion of citronellal to isopulegol, wherein the enzyme to SEQ ID NO: 1 or a functional equivalent thereof, the possesses a polypeptide sequence which either nucleic acid sequence being part of agene constructor vector. a) is SEQID NO: 2, or Such gene constructs or vectors are described exhaustively in b) in which up to 25% of the amino acid residues are altered international application PCT/EP2010/057696 on pages 16 relative to SEQID NO: 2 by deletion, insertion, substitu to 20, hereby incorporated by reference. tion or a combination thereof, and which still has at least With very particular preference the method according to 50% of the enzymatic activity of SEQID NO: 2. the invention is carried out in the presence of an enzyme, 25 Also preferred is the use of an enzyme having the activity where the enzyme is encoded by a nucleic acid sequence of a citronellal-isopulegol cyclase for the biocatalytic conver according to SEQID NO: 1 or a functional equivalent thereof, sion of citronellal to isopulegol, wherein the enzyme is the nucleic acid sequence being part of a gene construct or encoded by a nucleic acid sequence according to SEQID NO: vector which are present in a host cell. 1 or a functional equivalent thereof. The host cell which comprises a gene construct or a vector 30 A further subject of the present invention is also the use of in which the nucleic acid sequence is present that encodes the a gene constructor vector comprising a nucleic acid sequence enzyme having the citronellal-isopulegol cyclase activity is according to SEQID NO: 1 or a functional equivalent thereof also referred to as a transgenic organism. The production of which encode a polypeptide having the activity of a citronel Such transgenic organisms is known in principle and is dis lal-isopulegol cyclase which serves the biocatalytic conver cussed, for example, in international application PCT/ 35 sion of citronellal to isopulegol in a method of production of EP2010/057696 on page 20, hereby incorporated by refer isopulegol by cyclization citronellal. CCC. Likewise a further subject of the present invention is the Transgenic organisms selected are preferably cells from use, as well, of a host cell which comprises a gene construct the group consisting of bacteria, cyanobacteria, fungi and or a vector comprising a nucleic acid sequence according to yeasts. The cell is preferably selected from fungi of the genus 40 SEQID NO: 1 or a functional equivalent thereof for produc Pichia or bacteria of the genera Escherichia, Corynebacte ing an enzyme having the activity of a citronellal-isopulegol rium, Ralstonia, Clostridium, Pseudomonas, Zymomonas, cyclase for the biocatalytic conversion of citronellal isopule Rhodobacter, Streptomyces, Burkholderia, Lactobacillus or gol. Lactococcus. With particular preference the cell is selected The method described above opens up for the first time. from bacteria of the species Escherichia coli, Pseudomonas 45 The possibility of cyclizing citronellal to isopulegol by means putida, Burkholderia glumae, Streptomyces lividans, Strep of an enzyme. tomyces coelicolor or Zymomonas mobilis. 8. Methods of Production of Menthol A preferred method according to the invention is that The isopulegol prepared inventively can be converted into wherein the enzyme having the activity of a citronellal-isop menthol by catalytic hydrogenation in a conventional way. ulegol cyclase is encoded by a gene which has been isolated 50 Suitable for this purpose, as well as conventional hydrogena from a microorganism selected from the group of microor tion processes, is, in particular, a catalytic method, as ganisms consisting of Zymomonas mobilis, Methylococcus described in WO 2009/013 192. capsulatus, Rhodopseudomonas palustris, Bradyrhizobium The method according to the invention is implemented in japonicum, Frankia spec. and Streptomyces coelicolor. With particular using catalysts comprising particular preference the gene in question has been isolated 55 45% to 55% by weight of oxygen-containing compounds from Zymomonas mobilis. of nickel, calculated as NiO, Preferred furthermore is a method according to the inven 25% to 35% by weight of oxygen-containing compounds tion wherein the enzyme having the activity of a citronellal of Zirconium, calculated as ZrO2. isopulegol cyclase has been produced by a microorganism 5% to 20% by weight of oxygen-containing compounds of which overproduces the enzyme having the activity of a cit 60 copper, calculated as CuO. ronellal-isopulegol cyclase and which has been selected from 1% to 3% by weight of oxygen-containing compounds of the group of microorganisms consisting of the genera molybdenum, calculated as MoC), and Escherichia, Corynebacterium, Ralstonia, Clostridium, 0% to 5% by weight of further components, Pseudomonas, Bacillus, Zymomonas, Rhodobacter; Strepto the figures in % by weight adding up to 100% by weight and myces, Burkholderia, Lactobacillus and Lactococcus. 65 relating to the dry, unreduced catalyst. A particularly preferred method according to the invention One particularly preferred catalyst is composed of 49% to is that wherein the enzyme having the activity of a citronellal 53% by weight of NiO, 15% to 19% by weight of CuO, 28% US 8,932,839 B2 45 46 to 32% by weight of ZrO, and 1% to 2% by weight of MoO, least largely converted inventively into L-menthol. The reac and also, optionally, 0% to 3% by weight of further compo tion conditions here may be selected, independently of one nents such as graphite, for example, the respectively selected another, preferably in the ranges Stated above. weight fractions of the individual components being based on The method of the invention can be carried out batchwise, the dry, unreduced catalyst and adding up to 100% by weight. semibatchwise or continuously. It is preferred to carry out the Catalysts of this kind are known and can be produced for method continuously, more particularly entirely continu example as described in EP0 696572 or in WO 2009/013192. ously, in which case the starting materials are introduced In general the catalysts are used preferably in the form of continuously into the reactor and the resulting reaction mix unsupported catalyst. The term “unsupported catalyst” refers ture or reaction product is discharged continuously from the to a catalyst which in contrast to a Supported catalyst is 10 reactor. It has further proven advantageous, in view of the composed only of catalytically active material. Unsupported position of the melting point of the reaction product accord catalysts can be used by introducing the catalytically active ing to the invention, namely menthol, especially L-menthol, material, ground to a powder, into the reaction vessel, or by to provide for heating of the transport lines used. disposing the catalytically active material in the reactor after The method of the invention allows menthol to be produced grinding, mixing with shaping aids, shaping and heat-treating 15 by catalytic hydrogenation ofisopulegol, with typically only in the form of shaped catalyst bodies—for example, as a minor degree of formation of unwanted diastereomers of spheres, cylinders, tablets, rings, coils, strands and the like. menthol. Accordingly, when using isopulegol with a corre In the context of one preferred embodiment of the hydro sponding purity, the method of the invention yields menthol genation method according to the invention, the selected het of the formula (III) in a chemical purity of 97% by weight or erogeneous catalyst is employed in the form of a fixed-bed more, preferably of 98% to 100% by weight, more preferably catalyst. of 98.5% to 99.9% by weight, very preferably at least 99% to To implement the method according to the invention, the 99.9% by weight. The term “chemical purity” here also isopulegol starting material as described above is contacted encompasses the diastereomeric purity of the resulting men with hydrogen and with the selected catalyst. The hydrogen thol in relation to the diastereomers neoisomenthol of for here may be used in undiluted form, typically in a purity of mula (IIIa), neomenthol of formula (IIIb) and isomenthol of about 99.9% by volume, or in diluted form, i.e. in the form of 25 formula (IIIc). Accordingly, in the context, the method mixtures with inert gases such as nitrogen or argon, for according to the invention preferably yields menthol having a example. It is preferred to use hydrogen in undiluted form. diastereomeric purity of 97% by weight or more, preferably The reaction can be carried out Successfully without adding of 98% to 100% by weight, more preferably of 98.5% to Solvent or in the presence of organic solvents which are inert 99.9% by weight and very preferably of at least 99% to 999% under the reaction conditions, such as, for example, metha 30 by weight. nol, ethanol, isopropanol, hexane, heptane, cyclohexane and the like. It is preferred to carry out the reaction without adding (IIIa) solvent. The hydrogenation of isopulegol in accordance with the invention can be carried out under a hydrogen pressure (abso lute) in the range from 1 to 200 bar, such as from 2 or 3 to 200 bar, in particular from 4 or 5 to 150 bar, such as from 5 to 100 bar, or in the range from 5 to 50 bar. As a reaction temperature for implementing the hydrogenation according to the inven tion, a temperature is selected, advantageously, that is in the range from 20 to 150°C., such as from 40 to 130°C., or from s (IIIb) 60 to 110° C. and more particularly from 70 to 100° C. The practical approach to the implementation is generally to Supply the isopulegol for conversion to the catalyst, which is typically located in a fixedbed reactor heated, in particular, from the outside, Such as a tube reactor, autoclave or tube 45 bundle reactor, for example, at the desired reaction tempera ture and under the desired pressure. The velocity over the catalyst in this case is generally 0.1 to 1.0, such as 0.1 to 0.6 or 0.2 to 0.4 kg of isopulegol per kg of catalyst per hour. In (IIIc) this context it may be useful to heat the isopulegol that is to be 50 used, even before it is supplied to the reaction vessel or to the reactor, this heating being preferably to reaction temperature. The reactor can be operated either in liquid phase mode or in trickle mode—that is, the starting materials may be passed “oil through the reactor either from bottom to top or from top to bottom. The hydrogenation method of the invention can be 55 carried out either batchwise or continuously. In both cases, unreacted starting material can be circulated together with the Where isopulegol is used in optically active form prefer hydrogen. ably, in accordance with the invention, mixtures comprising The hydrogenation according to the invention may also be predominantly the L-isopulegol enantiomer—the method carried out in stages in a cascade of two or more reactors, i.e. 60 product according to the invention that is obtained is gener 2 to in general 4. Such as 2 or 3, for example, reactors con ally mentholin optically active form, preferably in the form of nected in series, preferably fixed bed reactors. In this case, in (-)- or L-menthol. The hydrogenation according to the inven the first reactor, typically referred to as the main reactor, the tion proceeds generally largely without notable racemization main conversion of the reaction is achieved under the reaction of the material used. Accordingly, according to the enantio conditions described above, and the crude product obtained is 65 meric excess of the optically active isopulegol used, optically passed to a second reactor, typically referred to as secondary active menthol, preferably L-menthol when using L-isopule reactor, in which the as yet unreacted starting material is at gol, is obtained as the product, with an enantiomeric excess US 8,932,839 B2 47 48 (ee) of 80% ee or more, preferably of 85% or 90% ee or more, TABLE A-continued more preferably of 95% to 100% ee, more preferably of 96% to 99.9% ee, very preferably of 97% to 99.8% ee, even more Further substrates preferably of 98% to 99.7% ee, and with more particular preference of 98.5% to 99.6% ee. The menthol obtained according to the invention is notable, furthermore, for a particularly low level of the unwanted by-products menthone of formula (IIId) and isomenthone of formula (IIIe) and neoisomenthol of formula (IIIa). 10

(IIId)

15 Name Neral

(IIIe)

25 Nerol

These by-products are obtained generally, in the context of 30 the method according to the invention, only in a proportion, relative to the amount of menthol obtained, of up to 0.5% by weight, preferably 0.4% by weight, more preferably 0.3% by weight, more particularly 0.2% by weight, and very prefer Nerylacetone ably 0.1% to 0% by weight. 9. Examples of Substrates which can be Used for Enzymatic 35 or Biocatalytic Conversions According to the Invention The enzymes and microorganisms described herein are especially Suitable for converting compounds of the general formula IV above. Non-limiting examples thereofare sum marized in table A below, which gives the structural formula 40 and the chemical name. Geranial TABLE A

Further substrates 45

50 Geraniol

55

Name Citral Geranylic acid 60

65 US 8,932,839 B2

TABLE A-continued TABLE A-continued

Further substrates Further substrates 5 Formula

10

15 (IV) Name

Homofarnesol (IV) Name N cis-Geranylic acid 2O 21 N O OH

25 OH Trimethyl tridecatetraene N N1s Geranylacetone 30 N

O Melonal 35

O Farnesol N 40

21 N Nonadienal

45 N OH O

Farnesylacetone

50 Citronellol

55 OH

Homofarnesylic acid B-Citronellene 60

65 US 8,932,839 B2 51 52 TABLE A-continued TABLE A-continued

Further substrates Further substrates

10

15 Name Name Myrcenol Citronellic acid

2O O OH OH

25 Dihydromyrcenol Hydroxycitronellal

30 N HO O OH OH Lavandulol 35 Heptanal

N O 40

Linalool OH Nerolidol N 45 OH

50 Farnesene (B) (E)-f-Ocimene N (4 isomers present)

Myrcene Tagetone 60 21

O 65 US 8,932,839 B2 53 54 TABLE A-continued b) Vector Constructs The respective squalene-hopene cyclase gene (e.g. Further substrates Zymomonas mobilis ZMO1548 NC 006526.2, region: 1578816 . . . 1580993) was PCR-amplified from chromo Somal DNA, using corresponding primer pairs (e.g. ZMO 1548-fwd (5'-gcgctgttcatatggg tattgaca-3") (SEQ. ID. NO: 327) and ZMO 1548-rev (5'-gcgcttaccctggatccticgaaaat 3') (SEQ. ID. NO:328)). The restriction enzyme digested (e.g. with NdeI/BamHI) PCR product was cloned into 10 pET16b, (obtaining e.g.) pET1584. The constructs were veri fied by DNA sequencing and transformed into E. coli XL 1 blue. The shc-gene from other microorganisms (e.g. from A. acidocaidarius) was cloned similarly. 15 All plasmids were transformed individually into E. coli Name BL21 (DE3) plysS or E. coli Rosetta plys-RAR62. Solanone c) Cyclization Assay with Various Substrates (Standard Con ditions) Recombinant E. coli cells were suspended in 20 mM Tris HCl pH 8.0 (3 ml per g moist cells). The cyclization mixture contained 250 ul of cell suspension, 50 ul of 1 Mcitrate buffer (pH 4.5), 20 mM (final concentration) of substrate and water to 500 ul. In the cyclization of squalene, 1% (v/v) Triton X100 was added. For the homofarnesol cyclization. E. coli 2,6,10-Trimethyl 25 cells (6 g moist cells) were suspended in solubilization buffer 9-undecanal (50 mM phosphate, 10 mM MgCl (pH 6.5; total volume: 25 ml). The cells were lysed at 1500 bar using a Manton-Gaulin homogenizer. Insoluble cellular debris was centrifuged off (15 min at 4°C. and 7150*g). The cyclization mixture con 30 tained 1 ml raw cell extract and 20 mM homofarnesol in 1.25 ml buffer (50 mM potassium phosphate, 45 mM MgCl (pH 6.5). The reaction mixture was stirred at 30°C. with a mag netic stirrer. The reaction was stopped by extraction with heptane. The organic phase was analyzed by gas chromatog The reaction products produced in the conversion of these Substrates can be detected and quantified in a conventional 35 raphy. Controls were carried out with E. coli cells bearing an way using standard analytical methods, such as chromatog empty vector and with heat-inactivated SHC-expressing raphy, HPLC, gas chromatography, mass spectrometry, cells. Formation of cyclization products was never observed GC/MS n, MALDI-TOF, and combinations thereof. with the controls (data not shown). If nonimmobilized organisms or enzymes are used for the d) Gas Chromatography method according to the invention, preferably these are sepa 40 Terpenoids were analyzed qualitatively and quantitatively rated prior to extraction, for example by filtration or centrifu by gas chromatography using an Agilent 7890A gas chro gation. matograph, equipped with a DB-5 column (20 mx0.1 The method according to the invention can be operated mmx0.1 um) and an ionization detector. 3 ul of the Solvent batchwise, semi-batchwise or continuously. extract was applied on the column (split ratio 1:5, helium flow Experimental Section 45 rate 0.25 or 0.5 ml/min, injector temperature 250° C.). In the absence of special information in the examples To separate linear and cyclic monoterpenoids, the initial below, the general information below is taken to apply. furnace temperature (60° C.) was raised to 130° C. at 40° C./min, at 2°C/min to 150° C. and then at 40°C/minto 200° A. General Information C. The retention times of the terpenoids were as follows: (R, 50 S)-citronellal (755 min), isopulegol (770 min), neo-isopule All materials and microorganisms used are commercially gol (7.90 min), iso-isopulegol (8.10 min), neoiso-isopulegol available products. (8.25 min), 1-decanol (9.91 min). Unless stated otherwise, the cloning and expression of For the detection of triterpenes, the injector temperature recombinant proteins is carried out by standard methods, as was set at 300°C. The furnace temperature was initially 60° described for example in Sambrook, J., Fritsch, E. F. and 55 C., and was increased at 40"C/min to 220° C. and then at Maniatis. T., Molecular Cloning: A Laboratory Manual, 2nd 6'C/min to 310° C. and held constant there for 10 min. edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Squalene and hopene eluted after 19.2 min and 26.9 min Laboratory Press, Cold Spring Harbor, N.Y., 1989. respectively. a) Bacterial Strains, Plasmids and Growing Conditions Homofarnesol and ambroxan were analyzed on a 10 m All experiments were carried out with E. coli. The SHC 60 Optima 1 column (Macherey & Nagel, Düren, Germany). proteins were expressed in E. coli BL21 (DE3) plysS or E. The initial furnace temperature (100°C.) was increased at 5° coli Rosetta plysRAR62, comprising pET16b constructs C./minto 200° C. and held at this temperature for 5 min. Then with the respective shc gene, by growing in Luria-Bertani it was increased at 30°C/min to 320°C. An analysis took 40 medium, Supplemented with amplicillin (100 ug/ml), min. The retention times were as follows: homofarnesol (10.8 chloramphenicol (34 g/ml); and 0.5 mM isopropylthio-f-D- 65 min), ambroxan (9.9 min). As an alternative, a Shimadzu galactoside at ODoo of 0.4 and additional growth for 4 hours GC-MS OP 2010 system with an FS Supreme 5 column (30 at 30° C. mx0.25mmx0.25um) was used for coupled GC/MS analysis US 8,932,839 B2 55 56 (split ratio 1:20; 3 min 120° C., increase to 135° C. at 2 PCR charge: C./minand further increase to 365° C. at 10°C/min, followed 1.8 pil DMSO by cooling to 300° C. at 70° C./min). The GC-MS data were 2 ul dNTPs (each 2.5 mM) 1.5ul forward primer (10 pmol/ul) analyzed using LabSolutions GCsolutions Postrun software. 1.5ul reverse primer (10 pmol/ul) It should be noted that the substrates citronellal racemate, 1 Jultemplates (1 lug/ul; recombinant plasmid bearing SHC (R)-citronellal and (S)-citronellal always contain small gene, for example plTZmSHC 1) amounts ofisopulegol and neo-isopulegol as impurities. The 0.2 lul Prime-Star Polymerase (Takara, 2.5 Units/ul) GC surface values for these linear terpenoids were estab 6 ul 5x buffer lished as 100%. The surface values for the isopulegol isomers 16 ul HO in the product were corrected by the amount of isopulegol 10 PCR program: isomer that was already present in the substrate. The standard (1) 95°C. 3 minutes deviation was calculated on the basis of 24 individual tests (2) 95°C. 45 seconds using two separately grown E. coli cultures. (3) 53° C. 1 minute (4) 68° C. 17 minutes 15 5x repetition of steps (2), (3) and (4) B. Examples After the PCR, 10 ul of the charge was digested with the restriction enzyme Dpnl for at least 1 hour at 37° C. Then Example 1: Production of Mutants of the F486X Type of the transformation into E. coli XL 1-blue cells was carried out. Squalene-Hopene Cyclases by Rational Protein Design After DNA sequencing, transformation into the expression Using Quick-Change Mutagenesis strain e.g. E. coli Rosetta plysRAR62 took place. The gene can also be modified similarly in other expression plasmids. The mutants of various squalene-hopene, cyclases were The following primers were used for the quick-change incorporated by means of “quick-change' mutagenesis into PCR. The respective exchange is shown printed in bold in the the corresponding gene. The procedure based on the manu primer names. The genes that are modified by the respective facturers information (Agilent Technologies, Waldbronn) primers are indicated with italics in the primer names; there is was largely followed. First, a FOR was carried out: the following correspondence:

Primer name Sequence SEO ID NO

ZnSHC1F486efor GTTATTATCCTTATCGATGGCTCCCCAACCG 329 ZnSHC1F486erew GGTTGGGGAGCCATCGATAAGGATAATAACAG 330

ZmSHC1F486Metfor GTTATTATCCTTATCCATGGCTCCCCAACCG 331 ZnSHC1F486Metrew GGTTGGGGAGCCATGGATAAGGATAATAACAG 332

ZmSHC1F486Thrfor GTTATTATCCTTATCGGTGGCTCCCCAACCG 333 ZmSHC1F486Thirrev GGTTGGGGAGCCACCGATAAGGATAATAACAG 334

ZnSHC1F486 Ginfor GTTATTATCCTTATCCTGGGCTCCCCAACCG 335 ZnSHC1F486 Grew GGTTGGGGAGCCCAGGATAAGGATAATAACAG 336

ZnSHC1F486Ashfor GTTATTATCCTTATCGTTGGCTCCCCAACCG 337 ZnSHC1F486Ashrew GGTTGGGGAGCCAACGATAAGGATAATAACAG 338

ZmSHC1F486Lys for GTTATTATCCTTATCTTTGGCTCCCCAACCG 339 ZmSHC1F486Lysrev GGTTGGGGAGCCAAAGATAAGGATAATAACAG 34 O

ZmSHC1F486Asp for GTTATTATCCTTATCATCGGCTCCCCAACCG 341 ZmSHC1F486Asprev GGTTGGGGAGCCGATGATAAGGATAATAACAG 342

ZnSHC1F486 Guilfor GTTATTATCCTTATCTTCGGCTCCCCAACCG 343 ZnSHC1F486 Gurew GGTTGGGGAGCCGAAGATAAGGATAATAACAG 344

ZmSHC1F486Trpfor GTTATTATCCTTATCCCAGGCTCCCCAACCG 345 ZmSHC1F486Trprev GGTTGGGGAGCCTGGGATAAGGATAATAACAG 346

ZmSHC1F486Arg for GTTATTATCCTTATCACGGGCTCCCCAACCG 347 ZmSHC1F486Argrew GGTTGGGGAGCCCGTGATAAGGATAATAACAG 348

ZmSHC1F486Cys for GTTATTATCCTTATCGCAGGCTCCCCAACCG 349 ZmSHC1F486Cysrev GGTTGGGGAGCCTGCGATAAGGATAATAACAG 350

GTTATTATCCTTATCACCGGCTCCCCAACCG 351 GGTTGGGGAGCCGGTGATAAGGATAATAACAG 352

GTTATTATCCTTATCGCTGGCTCCCCAACCG 353 GGTTGGGGAGCCAGCGATAAGGATAATAACAG 3.54

GTTATTATCCTTATCCGGGGCTCCCCAACCG 355 GGTTGGGGAGCCCCGGATAAGGATAATAACAG 356

GTTATTATCCTTATCATGGGCTCCCCAACCG 357 GGTTGGGGAGCCCATGATAAGGATAATAACAG 358 US 8,932,839 B2 57 58 - Continued

Primer name Sequence SEQ ID NO ZnSHC1F486L for GTTATTATCCTTATCCAGGGCTCCCCAACCG 359 ZnSHC1F486trew GGTTGGGGAGCCCTGGATAAGGATAATAACAG 360

GTTATTATCCTTATCAACGGCTCCCCAACCG 361 GGTTGGGGAGCCGTTGATAAGGATAATAACAG 362

ZmSHC1F486A for GTTATTATCCTTATCCGCGGCTCCCCAACCG 363 ZnSHC1F486Arew GGTTGGGGAGCCGCGGATAAGGATAATAACAG 364

GTTATTATCCTTATCATAGGCTCCCCAACCG 365 GGTTGGGGAGCCTATGATAAGGATAATAACAG 366

ZnSHC 1702Cfor GCCGATAAAAATCGCAACGCAGCATAAACG 367 ZmSHC 1702Crew CGTTTATGCTGCGTTGCGATTTTTATCGGC 3.68

ZmSHC 1702F for GCCGATAAAAATCTTTACGCAGCATAAACG 369 ZnSHC 1702Frew CGTTTATGCTGCGTAAAGATTTTTATCGGC 37O

ZmSHC 1702A for GCCGATAAAAATCCGCACGCAGCATAAACG 3.71 ZmSHC 1702Arew CGTTTATGCTGCGTGCGGATTTTTATCGGC 372

ZmSHC 1702Sfor GCCGATAAAAATCGCTACGCAGCATAAACG 373 ZmSHC 1702srev CGTTTATGCTGCGTAGCGATTTTTATCGGC 374

ZmSHC 1561Alfor GAACCGCACCGGTGCCATAGATCGCATTAACG 375 ZmSHC 1561Arew GGTTTGGTCGTTGGGGCGTTAATGCGATCTATGG 376

ZnSHC 1705A for CCATAATCGGGAAGAATTGCCGCGCAAAATC 377 ZmSHC 1705Arew CTGCGTTATGATTTTGCGCGGCAATTCTTC 378

ZmSHC2F486 Cfor GGCGGTTGGGGCGCTTGCGATGCCAATAACAG 379 ZnSHC2F486 Crew CTGTTATTGGCATCGCAAGCGCCCCAACCGCC 38O

ApF486 Crev CATTATCTTTATCGCATGCACCCCAACCACC 381 ApF486 Cfor GGTGGTTGGGGTGCATGCGATAAAGATAATG 382

BiF486 Cfor CGGCTGGGGCGCGTGCGATAAAGATAAC 383 BiF486 Crev GTTATCTTTATCGCACGCGCCCCAGCCG 384

ScF486 Cfor CGGCGCCTGGGGCGCCTGCGACGTCGACAAC 385 ScF486 Crew GTTGTCGACGTCGCAGGCGCCCCAGGCGCCG 386

ZnSHC 1 SEC ID NO: ZnSHC 2 SEC ID NO: Ap SEQ ID NO: 4; Bi SEQ ID NO: 5 and Sc SEC ID NO: 3.

Example 2: Activity Tests with Mutants of Squalene-hopene The increased activity of the SHC 1-F486A mutant was Cyclase-1 (SHC-1) from Zymomonas mobilis 45 then investigated in more detail. In addition to a for better The influence of various single mutations, produced conversion of the citronellal Substrate, it was also found that according to example 1, in the sequence position correspond this prefers the R(+) isomer as substrate and compared with ing to F486, on the cyclase activity was determined for vari the WT it is also converted in a much shorter time (cf. FIG. 2). ous Substrates. Whereas with the WT enzyme the reaction with R(+)-cit a) Citronellal ronellal is not measurable until after quite long incubation, After the general detection of a slight cyclization activity of 50 the F486A mutant shows high conversions, in particular at the the squalene-hopene cyclase-1 from Zymomonas mobilis start of the reaction. This effect is not observed with S(-)- (SEQ ID NO:2) with respect to citronellal, the turnover rate citronellal as substrate. It is notable that the F486A mutant was greatly improved by rational protein design. Exchange of only forms isopulegol I and II, whatever the Stereoconfigura the phenylalanine residue F486 for alanine led in preliminary tion of the substrate. The WT, in contrast, is dependent on the tests (cf. FIG. 2) to a greatly increased production ofisopule 55 Stereoconfiguration of the Substrate and forms, as well as gol (2) starting from citronellal (1). isopulegol I, mainly isopulegol II from R(+)-citronellal and almost exclusively isopulegol III from S(-)-citronellal. Based on these results, in further experiments the impor tance of the amino acid residues at position 486 was investi 60 gated more closely. For this, by means of mutagenesis, the phenylalanine residue was exchanged against each further OH amino acid and the activity of the various muteins was tested with citronellal as substrate (for sequences see FIGS. 1a and b). It was found that some amino acids at this position not only 65 improve the conversion of citronellal by the enzyme, but (1) (2) additionally lead to higher product specificity in the reaction, so that fewer isomers ofisopulegol are produced (see FIG.3). US 8,932,839 B2 59 60 Exchange for arginine, proline and lysine leads to a loss in b) Squalene activity with respect to citronellal. The amounts of product Clear changes in activity after mutation at position F486 determined also occur, in the same distribution, as contami are also seen with squalene as Substrate. Interestingly, in this nation in the negative control (K see FIG. 3). The highest case the exchange of phenylalanine for tyrosine produces activity was observed after exchange for valine, threonine, almost a doubling of the conversion (see FIG. 4). cysteine, isoleucine and alanine. Overall, the altered product Example 3: Activity Tests with Mutants of Other Squalene spectrum of some muteins is notable. Not all show the for Hopene Cyclases mation of three isopulegol peaks as the wildtype as well as the The influence of various single mutations, produced quantitative distribution differs. according to example 1, in the sequence position correspond There are altogether 2 isopulegol isomers: 10 ing to F486 on the cyclase activity of various other SHCs was determined for various citronellal substrates (in each case 20 mM overnight incubation): The mutants are as follows: 15 Ap-SHC: F481C, B-SHC: F447C, Sc-SHC: F449C, A, OH 'OH Zm SHC-2: F438C The phenylalanine residues are located in positions that are analogous to the F486 of Zm-SHC-1 (SEQID NO:2). The results can be seen in FIG. 5 (citronellal racemate as (1R, 3R,6S) (1S, 3S,6R) substrate), FIG. 6 (R(+)-citronellal as substrate), and FIG. 7 Isopulegol (S(-)-citronellal as substrate). The control was a charge with (Isopulegol I) out active biocatalyst. 25 It can be seen that the wild-type enzymes, through muta tion at the stated position corresponding to F486 (of Zm SHC-1), can now cyclize citronellal to isopulegol and more over convert the R(+) form with increased selectivity com '. OH OH pared with the S(-) form. 30 Example 4: Conversion of Compounds of Formula IV These substances were converted under conditions corre sponding to those employed for the conversion of citronellal (1S,3R,6S) (1R, 3S,6R) as described above. neo-Isopulegol Example 5: Isolation and Characterization of the Squalene (Isopulegol II) 35 Hopene Cyclase from Zymomonas mobilis (Zm-SHC) International application PCT/EP2010/057696, hereby incorporated by reference, describes how, using specific oli gonucleotides, the Zm-SHC gene from the genomic DNA of 40 Zymomonas mobilis was amplified and expressed in Escheri OH Ol'OH chia coli. a) Material and Methods: Addressed below are only materials and methods not men (1S, 3R,6R) (1S, 3S,6S) tioned in this form in international application PCT/EP2010/ 45 057696. iso-Isopulegol (ep-Isopulegol) b) Strains, Plasmids and Culture Conditions: (Isopulegol III) The E. coli strain DH5C, the E. coli strain BL21 (DE3) pIysS (Novagen) and the E. coli Rosetta strain were used. The plasmid plT16b (Novagen) was used for cloning. For the 50 overexpression of the SHC, moreover, the plasmid plys RAR62 was additionally transformed for the adaptation of , the codon usage to E. coli. Furthermore, the plasmid pHE+ 'OH OH ZmSHC-1 from E. coli Lu 15568 was used (international application PCT/EP2010/057696). The strains were grown 55 using LB medium at 30° C. c) Chemicals: (1S, 3R,6R) (1R, 3S,6S) Squalene, (+/-)-citronellal, (+)-R-citronellal and (-)-S- neo-iso-Isopulegol citronellal were purchased from Sigma (Sigma-Aldrich Che (Isopulegol IV) mie GmbH, Munich). Restriction enzymes, T4 ligase, and 60 DNA polymerase came from New England Biolabs (New England Biolabs GmbH, Frankfurt). Until now, the main product (isopulegol I) has been d) Isolation of DNA and Transformation: assigned to the enantiomeric pair (1R,3R,6S)-isopulegol or Plasmids were isolated from E. coli using the Qiaprep Spin (1S,3S,6R)-isopulegol. Miniprep Kits from Qiagen (Qiagen, GmbH, Hilden). Forgel The highest yield ofisopulegol with the least by-products 65 extractions or PCR purifications, the Qiaquick Gel Extraction (consisting of further isomers) accompanied by high enzyme Kit from Qiagen was used. All of the E. coli strains used were activity is displayed by the Zm-SHC-1 F486C mutant. transformed using the CaCl2 method. US 8,932,839 B2 61 62 e) PCR and Sequencing: h) GC Measurements: The DNA from Zymomonas mobilis subspec. mobilis CP4 The gas-chromatographic measurements took place on an was provided by Prof. Sprenger (Institute of Microbiology. Agilent 7890A gas chromatograph with flame ionization University of Stuttgart). The PCR was carried out using Prime detector. The column used was a DB-5 (Agilent Technolo Star Polymerase. The following primers were used for syn gies) with a length of 20 m, a diameter of 0.1 mm and 0.25uM thesizing the squalene-hopene cyclase gene from Zymomo coating. Substances were identified by comparison of the nas mobilis: retention times with available standard solutions. For verification, the samples were analyzed in parallel on a Shimadzu Gas chromatograph with mass spectrometer. SHC 1: 10 SHC- for Using the column FS Supreme with a length of 30 m, an (SEO ID NO: 387) internal diameter of 0.25 mm and a coating of 0.25 um, the TATGCATATGGGTATTGACAGAAT retention times were again compared with standard Solutions, SHC-rew and the respective mass spectra of the Substances present (SEQ ID NO: 388) 15 were analyzed. CCGGATCCT CAATTATTCAAATCAATC With the aid of a standard, the diastereomer identified The correctness of the cloned genes was verified by means below as isopulegol I was assigned to (1R,3R,6S) or (1S,3S, of sequencing by the company GATC Biotech. Sequence 6R) isopulegol, whereas no assignment was possible for the analyses were carried out using the program Clone Manager isomers identified as isopulegol II and isopulegol III. 7.0. After restriction of the corresponding amplificates, they i) Results of the Activity Assays: were cloned in-frame into the pET16b vector using N-termi Test la: (comparative) (controls i.e. results with boiled-off nally encoded His-tag. The plasmids were Subsequently protein, with empty vector and without protein) transformed first in E. coli DH5C. and thereafter in E. coli BL21 (DE3)plysS and E. coli Rosetta. Forbetter expression, 25 the plasmid plysRAR62 was transformed into the E. coli pH pH pH pH Rosetta strains in addition to the pET16b constructs. Corre 4.0 pH 4.5 5.0 pH 5.5 6.0 pH 6.5 7.0 sponding clonings with empty vectors were carried out in Citronellal 85.4 85.4 86.0 85.6 84.4 84.7 85.1 Isopulegol I 10.8 10.8 10.4 10.8 11.7 11.5 11.2 parallel. In addition, the plasmid pHE+ZmSHC 1 (corre Isopulegol II 3.8 3.8 3.6 3.6 3.9 3.8 3.7 sponding to SHC 1 with codon usage adapted to E. coli) was 30 Isopulegol III O O O O O O O transformed in E. coli BL21 (DE3)plysS. f) Expression and Cell Digestion: The corresponding E. coli B121 (DE3) plysS and E. coli In the information below concerning the Substrate rac Rosetta transformants were cultured in LB medium with citronellal, take place with the amounts ofisopulegol found in ampicillin and chloramphenicol (100 ug/ml and 32 g/ml. 35 the controls having already been deducted. respectively) at 30°C. The synthesis of the squalene-hopene 2. Test 1b: Comparison of the two overexpressed SHC 1 cyclases was induced by addition of 0.5-1 mMIPTG or 0.1% proteins (from pHE and pET16b vector and influence of rhamnose (when using the pHE derivatives) with an ODoo the His-tag on activity at pH 4.5) of 0.4-0.6. The cells were allowed to grow further for 4-6 hours, and Subsequently harvested. This was done by centri 40 fuging off the cells and taking them up in 5 ml/g wet weight pDHE pET16b of 25 mM Tris/HCl with 40% glycerol. If the cells were not Citronellal 95.2 95.2 used further immediately, they were stored at -20° C. For Isopulegol I 0.7 O.8 digestion of the cells, they were each subjected 2x to a French Isopulegol II 1.7 1.6 Press and used, either directly or following removal of the cell 45 Isopulegol III 2.4 2.4 debris by centrifugation, for the activity assays. Alternatively, cell digestion took place using ultrasound. Following cen trifugation, the SHC proteins were subsequently dissolved 3. Test 1c: pH dependence with solubilization buffer (50 mM Tris/HCl pH 8, 10 mM MgCl, 1% Triton X-100) to remove the cell debris, and 50 hence partially enriched. pH pH pH pH g) Activity Assays: 4.0 pH 4.5 5.0 pH 5.5 6.0 pH 6.5 7.0 Each batch for determining the activity of the squalene Citronellal 95.9 94.9 94.7 94.4 95.1 98.7 98.8 Isopulegol I 0.4 O.8 O.8 1.O 1.1 O.8 O.S hopene cyclases had a final Volume of 1 ml. This was made up Isopulegol II 1.1 2.4 2.1 2.1 1.6 O.S 0.7 of 600 ul of cells digested by French Press (alternatively 800 55 Isopulegol III 2.6 1.9 2.4 2.5 2.2 O O ul after solubilization from the cell membrane), 100 mM Na citrate buffer with different pH levels (pH 4.0 to pH 8.0 were used for testing) and 10 mM substrate solution (+/-)citronel 4. Test 1d: Influence of salts at pH 4.5 lal, (+)-R-citronellal and (-)-S-citronellal. In addition to the Substrate and H2O, the Substrate Solution also comprised 60 Triton X-100, which was present in each of the activity Ole BaCl2 CaCl2 MgCl2 batches at a concentration of 0.2%. Citronellal 94.9 95.2 94.9 95.0 The batches were incubated with shaking for 6 hours to 24 Isopulegol I 0.7 O.8 1.O O.9 hours at temperatures of 22° C., 30° C. and 37° C. The Isopulegol II 2.5 2.4 2.4 2.5 substrate and possible products were extracted with one vol 65 Isopulegol III 1.9 1.6 1.7 1.6 ume of chloroform hexane/propanol in a ratio of 2:3. The extract was used directly for analysis by gas chromatography. US 8,932,839 B2 63 64 5. Test le: influence of temperature at pH 4.5 and there was no longer any measurable cyclization to isop ulegol. Zm-SHC-1 is therefore able to cyclize citronellal, but not citronellol, to isopulegol. It is very likely that unspecific 22° C. 30° C. 37o C. 5 dehydrogenases are responsible for the reduction reaction. Citronellal 95.3 94.9 95.4 In order to rule out a chemical reaction being responsible Isopulegol I O.8 1.O O.8 Isopulegol II 1.8 2.2 1.6 for the cyclization, boiled-off cell extracts were used. In these Isopulegol III 2.1 1.9 2.2 controls and in controls with cell extracts from cultivation with empty vectors, however, no corresponding conversion 6. Test 2: S(-)-Citronellal as substrate was found (cf. Test 1a).

pH 4.0 CTRL pH 4.5 CTRL pH 5.0 CTRL pH 5.5 CTRL

Citronellal 90.8 95.5 90.8 95.7 91.7 96.2 92.4 96.2 Isopulegol I 4.9 4.5 4.7 4.3 4.4 3.8 4.1 3.8 Isopulegol II O O O O O O O Isopulegol III 4.3 O 4.5 O 3.9 O 3.5 O pH 6.0 CTRL pH 6.5 CTRL pH 7.0 CTRL

Citronellal 94.1 96.6 96.4 96.5 96.5 96.4 Isopulegol I 3.8 3.4 3.6 3.5 3.5 3.6 Isopulegol II O O O O O O Isopulegol III 2.1 O O O O O

7. Test 3: R-(+)-Citronellal as substrate

pH 4.0 CTRL pH 4.5 CTRL pH 5.0 CTRL pH 5.5 CTRL

Citronellal 8O.O 84.2 78.4 83.8 81.1 85.6 81.7 86.8 Isopulegol I 15.9 15.8 16.O 16.2 14.1 14.4 13.5 13.2 Isopulegol II 4.1 O S.6 O 4.8 O 4.8 O Isopulegol III 4.3 O 4.5 O 3.9 O 3.5 O pH 6.0 CTRL pH 6.5 CTRL pH 7.0 CTRL

Citronellal 81 85.5 80.8 85.8 81.4 86.2 Isopulegol I 14.3 14.5 14.5 14.2 14.0 13.8 Isopulegol II 4.7 O 4.7 O 4.6 O Isopulegol III 2.1 O O O O O

40 j) Summary of the Results: With (+/-)-citronellal as the substrate it was possible, fol The squalene-hopene cyclase from Zymomonas mobilis lowing the reaction, to detect various isomers ofisopulegol, was prepared recombinantly in E. coli. The enzyme is able to which have not yet been precisely identified (cf. Tests 2 and convert citronellal to isopulegol. 3). In order to verify whether these isomers originated from Here, the two overproduced Zm-SHC-1 proteins, once 45 the different isomers of the starting substrate or if only one without and once with N-terminally appended His-tag. isomer was accepted as the Substrate and was differently showed no differences in their activity under the conditions converted, the same studies were carried out with (+)-R- tested (cf. Test 1b). citronellal and (-)-S-citronellal. Here it was found that, This reaction was verified after 12 hours with the tech 50 depending on the Substrate, different isopulegol isomers are niques described. The dependence of the reaction on the pH formed. Interestingly, the conversion of (+)-R-citronellal level was low. In a pH range from pH 4 to pH 6, conversion took place from a pH of 4 to a pH of 7 without substantial rates totaling about 5% were measured for different isopule differences, at a rate of about 5%. The enantiomer, incontrast, gol isomers after 20-hour incubation. 55 was converted with conversion rates of approximately 4.5% Here it was not critical whether the batches were incubated only up to a pH level of pH 6. Here as well, the conversion rate at RT, 30° C. or 37°C. The conversion was also not increased showed virtually no fluctuation in terms of the individual pH by addition of divalentions. Such as MgCl, for example (cf. levels between pH 4 and pH 6. Test 1d). What was critical, however, was that the cell Sequences: 60 extracts, in the case of measurements above a pH of pH 5. SEQID NO: 1-326 nucleic acid/amino acid sequences of either were dialyzed before the substrate was added, or EDTA various SHC genes SEQID NO:327-388 PCR primers was added to the batches, in order to suppress reduction of the citronellal substrate to citronellol by enzymes of the host. No The disclosure of the publications cited herein is expressly referred to. effect of this treatment on the activity of the Zm-SHC-1 was 65 found. Where this treatment was not carried out, the substrate There follows a listing of SHC enzyme sequences which was reduced almost completely to citronellol within 20 hours, can be used in accordance with the invention: