USOO7235375B2

(12) United States Patent (10) Patent No.: US 7,235,375 B2 Kirchgessner et al. (45) Date of Patent: Jun. 26, 2007

(54) ORGANIC ANION TRANSPORT PROTEINS NCBI Entrez. Accession No. P46721 (gi: 1171882), Kullak-Ublick, et al., May 1, 2005. (75) Inventors: Todd G. Kirchgessner, North Wales, NCBI Entrez. Accession No.T55488 (gi:657349), Hillier, et al., Feb. PA (US); Bonnie Hsiang, Trenton, NJ 6, 1995. (US); Yingjie Zhu, Killingworth, CT NCBI Entrez. Accession No. U21943 (gi:885.977), Kullak-Ublick, et al., Feb. 16, 1996. (US); Yuli Wu, Newtown, PA (US); NCBI Entrez Accession No. T73863 (gi:690538), Wilson, R.K., Zhaoging Wang, Piscataway, NJ (US); Mar. 2, 1995. Jean S. Lynch, Ringoes, NJ (US); Xin NCBI Entrez Accession No. AIO2785.0 (gi:3246549), Strausberg, Huang, Cranbury, NJ (US); Wen-Pin R., Oct. 30, 1998. Yang, Princeton, NJ (US) Chen, et al. “Identification of two hERR2-related novel nuclear receptors utilizing bioinformatics and inverse PCR”. Gene, vol. 228, (73) Assignee: Bristol-Myers Squibb Company, pp. 101-109 (1999). Princeton, NJ (US) Hagenbuch, B., et al., Proc. Natl. Acad. Sci., vol. 88, Dec. 1991 pp. 10629-10633. (*) Notice: Subject to any disclaimer, the term of this Hagenbuch.B., et al., The American Society for Clinical Investiga tion, Inc. vol. 93, Mar. 1994, pp. 1326-1331. patent is extended or adjusted under 35 Meier, P.J., et al., Hepatology vol. 26, No. 6, 1997, pp. 1667-1677. U.S.C. 154(b) by 213 days. Jacquemin, E., et al., Proc. Natl. Acad. Sci., vol. 91, Jan. 1994, pp. 133-137. (21) Appl. No.: 10/736,936 Noe, B.A., et al., Proc. Nat; Acad. Sci., vol. 94, Sep. 1997, pp. 10346-103.50. (22) Filed: Dec. 16, 2003 Abe, T., et al. . J. Biol. Chem. vol. 273, No. 18, (1998), pp. 11395-11401. (65) Prior Publication Data Bossuyt. X., et al., J. Pharmacol. Exp. Ther. vol. 276, (1996), pp. 891-896. US 2004/O132135 A1 Jul. 8, 2004 Bossuyt. X., et al., J. Hepatol. vol. 25. (1996) pp. 733–738. Kanai, N., et al., Am. J. Physiol. vol. 270, (1996) pp. F319-F325. Related U.S. Application Data Kanai, N., et al., Am. J. Physiol. vol. 270, (1996), pp. F326-F331. (62) Division of application No. 09/575,081, filed on May Kontaxi, M., et al., J. Pharmacol. Exp. Ther. vol. 279, (1996), pp. 1507-1513. 19, 2000, now Pat. No. 6,692,934. Li, L., et al., J. Biol. Chem. vol. 273, No. 26, (1998), pp. 16184 (60) Provisional application No. 60/135,081, filed on May 16191. 20, 1999. Kullak-Ublick, G.A., et al., Gastroenterology vol. 109, No. 4. (1995), pp. 1274-1282. (51) Int. Cl. Kullak-Ublick, G.A., et al., Hepatology vol. 20, No. 2, (1994), pp. GOIN 33/567 (2006.01) 441-416. Kullak-Ublick, G.A., et al., FEBS Lett., vol. 424. (1998), pp. GOIN 33/53 (2006.01) 173-176. A6 IK 49/00 (2006.01) Wolkoff, A.W., Semin. Liver Dis., vol. 16, No. 2, (1996), pp. A6 IB IO/00 (2006.01) 121-127. COIP 2 1/06 (2006.01) Abe, T., et al., J. Biol. Chem., vol. 273, No. 35 (1998), pp. CO7K I/OO (2006.01) 22395-22401. (52) U.S. Cl...... 435/7.21: 435/7.2:435/7.8; Primary Examiner Olga N. Chernyshev 435/455; 435/69.1; 436/503; 424/9.2: 424/9.6; (74) Attorney, Agent, or Firm—Bristol-Myers Squibb Patent 530/350 Department (58) Field of Classification Search ...... None See application file for complete search history. (57) ABSTRACT (56) References Cited The current invention discloses nucleic acid and amino acid FOREIGN PATENT DOCUMENTS sequences for novel organic anion transfer proteins (“OATPs'). The invention encompasses the OATPs WO WO9517.905 7, 1995 described herein, together with vectors containing the cDNA WO WO9731111 8, 1997 sequences, host cells containing the vectors and polypep OTHER PUBLICATIONS tides having all or part of an OATP. Also encompasses are NCBI Entrez. Accession No. L19031 (gi:410310), Jacquemin, et al., uses for OATPs for targeting drugs to specific organs and for Mar. 4, 1994. modulating the concentration of endogenous Substrates. NCBI Entrez. Accession No. P46720 (gi: 1171883), Jacquemin, et al., May 1, 2005. 1 Claim, 8 Drawing Sheets U.S. Patent Jun. 26, 2007 Sheet 1 of 8 US 7,235,375 B2

OATP2 OATP-RP1 Rnk Smily LP BiH Big Sio TPI Ty S KSTYLE.B. Hall C.S.O.LPI

9.5 7.5 4.4

OATP-RP2 OATP-RP4 Pn KSmLv P B H B C SiO T Pry S Pn KSmLv L. P B H B C Sio T PrTys

9.5 7.5 4.4

2.4 1.4

OATP-RP5 Pn KSm Lv L. P B H B C Sio T PrTys

9.5 7.5 4.4

2.4 4.

Tissue Key H: heart S: spleen B: brain Ty: thymus P: placenta Pr: prostate l: lung : testis LV: liver O: Ovary Sm: skeletal Si: Small intestine muscle C: Colon K: kidney Bl: peripheral blood leukocytes Pn: pancreas

FIG. 1 U.S. Patent Jun. 26, 2007 Sheet 2 of 8 US 7,235,375 B2

- to Hote:

cy CN r C C (6u/uupeoud) Cd eye).dn vil-gz)

MOCK S OATP2 c5 3 s S s CSsys 3. co (6u/uufeloud) eyedn ele|Oujoone)-(Hcl

DHEAS N6 (U) O pravastatin CC ON

DHEAS

C O pravastatin

Sy Se CO co ch CN co

U.S. Patent Jun. 26, 2007 Sheet 5 of 8 US 7,235,375 B2

EnBurestroo zd?eo, ç??eox TXI-JEVOJI T??eoI ?JEVOVI SnBÚIÐSUOSO

US 7,235,375 B2 1. 2 ORGANIC ANON TRANSPORT PROTEINS reported the first cloning and identification of a member of the OATP transporter family, namely the rat oatp1. The first This application is a Divisional of application Ser. No. cloning and identification of a human OATP was reported in 09/575,081, filed May 19, 2000, now U.S. Pat. No. 6,692, Kulak-Ublick, G. A., et al., (1995) Gastroenterology, 109: 934 which claims priority from provisional U.S. application 5 1274-1282. Its expression was found in liver, kidney brain Ser. No. 60/135,081, filed May 20, 1999, the disclosures of and other organs. The authors concluded, based on Substrate which are hereby incorporated herein by reference in their specificities, that it was not the human orthologue of rat oatp entirety. 1. Substrate specificities of rat oatp1 are discussed in Kul FIELD OF THE INVENTION 10 lak-Ublick, G. A. et al., (1994) Hepatology, 20:411-416, while substrate specificities of human OATP are discussed in The invention claims isolated nucleic acid encoding all or Bossuyt, X., et al., (1996) J. Hepatol., 25:733–738. a portion of novel members of the organic anion transport Data was later discovered showing that rat oatp1 is protein (“OATP) designated OATP2, OATP-RP1, OATP involved in the transport of steroids (Bossuyt, X., et al., RP2, OATP-RP3, OATP-RP4 and OATP-RP5. Also claimed 15 (1996) J. Pharmacol. Exp. Ther. 276:891-896), and that are vectors containing the nucleic acid sequences, host cells human OATP acts as a transporter for the psychoactive containing the vectors and polypeptides having all or part of hormone DHEAS (Kullak-Ublick, G. A., et al., (1998) FEBS the amino acid sequence of OATP2, OATP-RP1, OATP Lett., 424:173-176). For a review of the OATP family and RP2, OATP-RP3, OATP-RP4 and OATP-RP5. Tissue organic anoin transport in the liver, see Wolkoff, A. W., expression of the transporter is described as well as Some of 20 (1996) Semin. Liver Dis., 16:121-127. its substrates. Also claimed are uses for these novel OATPs, A third rat OATP isoform that was shown to transport including for targeting drugs to specific tissues, for modu thyroid hormones T3 and T4 was cloned and reported in lating the concentration of endogenous Substrates, and for Abe, T., et al., (1998).J. Biol. Chem., 273:22395-22401. identifying a substrate capable of being transported by a All references cited herein, whether supra or infra, are novel OATP of the invention. 25 hereby incorporated by reference in their entirety. BACKGROUND OF THE INVENTION SUMMARY OF THE INVENTION The liver functions in the clearance of a large variety of The present invention encompasses novel organic anion metabolic products, drugs and other Xenobiotics by trans- 30 transport proteins (“OATP) and polynucleotides encoding porting them across the sinusoidal membrane into the hepa said OATPs. The OATPs disclosed herein are designated tocyte. Several classes of transport systems have been OATP2, OATP-RP2, OATP-RP3, OATP-RP4, OATP-RP5 described that mediate these processes including the Na+/ and OATP-RP 1. A polynucleotide sequence of each OATP taurocholate cotransporter polypeptide, NTCP in rat and is disclosed herein, along with the deduced amino acid human liver (Hagenbuch, B., et al. (1991) Proc. Natl. Acad. 35 sequence. The cDNAs encoding the OATPs of the present Sci. USA 88:10629-33; Hagenbuch, B. et al., (1994).J. Clin. invention have been deposited with the American Type Invest. 93:1326-31) and a family of organic anion transport Culture Collection and given Accession Numbers ATCC ing polypeptides (OATPs) that are principally expressed in 207213 (OATP2), ATCC 207212 (OATP-RP2), ATCC liver, kidney and brain, and transport a broad spectrum of 207209 (OATP-RP3), ATCC 207210 (OATP-RP4), ATCC Substrates in a Sodium-independent manner (Meier, P. J., et 40 207211 (OATP-RP5), and ATCC 207214 (OATP-RP1). al., (1997) Hepatology 26:1667-77; Wolkoff, A. W., (1996) The present inventors sequenced the cDNAs encoding the Semin. Liver Dis. 16:121-127). The distribution of this latter novel OATPs and determined the primary sequence of the family of transporters in liver, kidney and choroid plexus in deduced proteins. Disclosed herein are the nucleic acid the brain is thought to reflect common physiological require sequence (SEQID NO: 1) and amino acid sequence (SEQID ments of these organs for the clearance of a multitude of 45 NO:2) of OATP2: the nucleic acid sequence (SEQID NO:3) organic anions. There are three OATP isoforms in the rat: and amino acid sequence (SEQID NO:4) of OATP-RP2; the roatp1 (Jacquemin, E., et al., (1994) Proc. Natl. Acad. Sci. nucleic acid sequence (SEQ ID NO:5) and amino acid USA 91:133-37); roatp2 (Noe, B. A., et al., (1997) Proc. sequence (SEQ ID NO:6) of OATP-RP3; the nucleic acid Natl. Acad. Sci. USA 94:10346–50; and roatp3 (Abe, T., et sequence (SEQID NO:7) and amino acid sequence (SEQID al., (1998).J. Biol. Chem. 273:11395-401). In addition to bile 50 NO:8) of OATP-RP4; the nucleic acid sequence (SEQ ID acids, OATPs are known to transport a variety of other NO:9) and amino acid sequence (SEQID NO:10) of OATP compounds. These include, depending on the transporter, RP5; and the nucleic acid sequence (SEQ ID NO:11) and unconjugated and conjugated Steroids such as estrone Sul amino acid sequence (SEQ ID NO:12) of OATP-RP1. fate, estradiol-17B-glucuronide, aldosterone, and cardiac The OATPs of the present invention can be produced by: glycosides (Boussuyt, X., et al., (1996) J. Pharmacol. Exp. 55 (1) inserting the cDNA of a disclosed OATP into an appro Ther. 276:891-6: Boussuyt, X. (1996).J. Hepatol. 25:733-8: priate expression vector; (2) transfecting the expression Kanai, N., et al., (1996) Am. J. Physiol. 270:F319-F325: vector into an appropriate transfection host(s); (3) growing Kanai, N., et al., (1996) Am. J. Physiol. 270:F326-F331; the transfected host(s) in appropriate culture media; and (4) Noe, B. A., et al., (1997) Proc. Natl. Acad. Sci. USA assaying the transport activity in the transfected cells. 94:10346–50). Bromosulfophthalien (Jacquemin, E., et al., 60 The present invention therefore provides a purified and (1994) Proc. Natl. Acad. Sci. USA 91:133-7); mycotoxin isolated nucleic acid molecule, preferably a DNA molecule, (Kontaxi, M., et al., (1996) J. Pharmacol. Exp. Ther. 279: having a sequence which codes for an OATP, or an oligo 1507-13); leukotriene C (Li, L., et al., (1998).J. Biol. Chem. nucleotide fragment of the nucleic acid molecule which is 273:16184-91); and thyroid hormone (Abe, T., et al., (1998) unique to an OATP of the invention. In a preferred embodi J. Biol. Chem. 273:11395) are additional substrates. 65 ment of the invention, the purified and isolated nucleic acid Several proteins have been identified. Jacquemin, E., et molecule has the sequence as shown in SEQ ID NO:1 al., (1994) Proc. Natl. Acad. Sci. U.S.A., 91:133-137 (OATP2). In another preferred embodiment, the purified and US 7,235,375 B2 3 4 isolated nucleic acid molecule has the sequence as shown in ing polynucleotides under stringent conditions may be car SEQ ID NO:3 (OATP-RP2). In still another preferred ried out according to the method described in Nature, embodiment the purified and isolated nucleic acid molecule 313:402-404 (1985). Polynucleotide sequences capable of has the sequence as shown in SEQ ID NO:5 (OATP-RP3). hybridizing under stringent conditions with the polynucle In still another preferred embodiment of the present inven otides of the present invention may be, for example, allelic tion the purified and isolated nucleic acid molecule has the variants of the disclosed DNA sequences, or may be derived nucleotide sequence as shown in SEQ ID NO:7 (OATP from other sources. General techniques of nucleic acid RP4). In still another preferred embodiment the purified and hybridization are disclosed by Sambrook et al., “Molecular isolated nucleic acid molecule has the sequence as shown in Cloning: A Laboratory Manual, 2nd Ed., Cold Spring SEQ ID NO:9 (OATP-RP5). In still another preferred 10 Harbor Laboratory, Cold Spring Harbor, N.Y. (1984); and by embodiment of the present invention the purified and iso Haymes et al., “Nucleic Acid Hybridization: A Practical lated nucleic acid molecule has the nucleotide sequence as Approach”. IRL Press, Washington, D.C. (1985), which shown in SEQ ID NO:11 (OATP-RP1). references are incorporated herein by reference. The invention also contemplates a double stranded The present invention provides in another embodiment: nucleic acid molecule comprising a nucleic acid molecule of 15 (a) an isolated and purified nucleic acid molecule compris the invention or an oligonucleotide fragment thereof hydro ing a sequence encoding all or a portion of a protein having gen bonded to a complementary nucleotide base sequence. the amino acid sequence as shown in SEQID NO:4 (OATP The terms "isolated and purified nucleic acid, “isolated RP2); (b) nucleic acid sequences complementary to (a); (c) and purified polynucleotide”, “substantially pure nucleic nucleic acid sequences which are at least 80%, more pref acid', and “substantially pure polynucleotide', e.g., Substan erably at least 90%, more preferably at least 95%, and most tially pure DNA, refer to a nucleic acid molecule which is preferably at least 98% sequence identity to (a); or (d) a one or both of the following: (1) not immediately contiguous fragment of (a) or (b) that is at least 18 bases and which will with either one or both of the sequences, e.g., coding hybridize to (a) or (b) under stringent conditions. sequences, with which it is immediately contiguous (i.e., one The present invention provides in another embodiment: at the 5' end and one at the 3'end) in the naturally occurring 25 (a) an isolated and purified nucleic acid molecule compris genome of the organism from which the nucleic acid is ing a sequence encoding all or a portion of a protein having derived; or (2) which is substantially free of a nucleic acid the amino acid sequence as shown in SEQID NO:6 (OATP sequence with which it occurs in the organism from which RP3); (b) nucleic acid sequences complementary to (a); (c) the nucleic acid is derived. The term includes, for example, nucleic acid sequences which are at least 80%, more pref a recombinant DNA which is incorporated into a vector, e.g., 30 erably at least 90%, more preferably at least 95%, and most into an autonomously replicating plasmid or virus, or into preferably at least 98% sequence identity to (a); or (d) a the genomic DNA of a prokaryote or eukaryote, or which fragment of (a) or (b) that is at least 18 bases and which will exists as a separate molecule (e.g., a cDNA or a genomic hybridize to (a) or (b) under stringent conditions. DNA fragment produced by PCR or restriction endonuclease The present invention provides in another embodiment: treatment) independent of other DNA sequences. Substan 35 (a) an isolated and purified nucleic acid molecule compris tially pure or isolated and purified DNA also includes a ing a sequence encoding all or a portion of a protein having recombinant DNA which is part of a hybrid gene encoding the amino acid sequence as shown in SEQID NO:8 (OATP additional OATP sequence. RP4); (b) nucleic acid sequences complementary to (a); (c) The present invention provides in one embodiment: (a) an nucleic acid sequences which are at least 80%, more pref isolated and purified nucleic acid molecule comprising a 40 erably at least 90%, more preferably at least 95%, and most sequence encoding all or a portion of a protein having the preferably at least 98% sequence identity to (a); or (d) a amino acid sequence as shown in SEQ ID NO:2 (OATP2); fragment of (a) or (b) that is at least 18 bases and which will (b) nucleic acid sequences complementary to (a); (c) nucleic hybridize to (a) or (b) under stringent conditions. acid sequences which exhibit at least 80%, more preferably The present invention provides in another embodiment: at least 90%, more preferably at least 95%, and most 45 (a) an isolated and purified nucleic acid molecule compris preferably at least 98% sequence identity to (a); or (d) a ing a sequence encoding all or a portion of a protein having fragment of (a) or (b) that is at least 18 bases and which will the amino acid sequence as shown in SEQ ID NO:10 hybridize to (a) or (b) under stringent conditions. (OATP-RP5); (b) nucleic acid sequences complementary to The degree of homology (percent sequence identity) (a); (c) nucleic acid sequences which are at least 80%, more between two sequences may be determined, for example, by 50 preferably at least 90%, more preferably at least 95%, and comparing the two sequences using computer programs most preferably at least 98% sequence identity to (a); or (d) commonly employed for this purpose. One Suitable program a fragment of (a) or (b) that is at least 18 bases and which is the GAP computer program described by Devereux et al., will hybridize to (a) or (b) under stringent conditions. (1984) Nucl. Acids Res. 12:387. The GAP program utilizes The present invention provides in another embodiment: the alignment method of Needleman and Wunsch (1970).J. 55 (a) an isolated and purified nucleic acid molecule compris Mol. Biol. 48:433, as revised by Smith and Waterman (1981) ing a sequence encoding all or a portion of a protein having Adv. Appl. Math. 2:482. Briefly, the GAP program defines the amino acid sequence as shown in SEQ ID NO:12 percent identity as the number of aligned symbols (i.e., (OATP-RP1); (b) nucleic acid sequences complementary to nucleotides or amino acids) which are identical, divided by (a); (c) nucleic acid sequences which are at least 80%, more the total number of symbols in the shorter of the two 60 preferably at least 90%, more preferably at least 95%, and Sequences. most preferably at least 98% sequence identity to (a); or (d) As used herein the term "stringent conditions' encom a fragment of (a) or (b) that is at least 18 bases and which passes conditions known in the art under which a nucleotide will hybridize to (a) or (b) under stringent conditions. sequence will hybridize to: (a) an isolated and purified The present invention also provides: (a) a purified and nucleic acid molecule comprising a sequence encoding a 65 isolated nucleic acid molecule comprising a sequence as protein having the amino acid sequence as shown herein, or shown in SEQ ID NO:1 (OATP2); (b) nucleic acid to (b) a nucleic acid sequence complementary to (a). Screen sequences complementary to (a); (c) nucleic acid sequences US 7,235,375 B2 5 6 having at least 80%, more preferably at least 90%, more presses a gene encoding an OATP of the present invention. preferably at least 95%, and most preferably at least 98% The cell preparation can consist of human or non-human sequence identity to (a); or (d) a fragment of (a) or (b) that cells, e.g., rodent cells, e.g., mouse or rat cells, rabbit cells, is at least 18 bases and which will hybridize to (a) or (b) non-human primate cells, or pig cells. In preferred embodi under stringent conditions. ments, the cell or cells include an OATP transgene, e.g., a The present invention further provides: (a) a purified and heterologous form of an OATP gene, e.g., a gene derived isolated nucleic acid molecule comprising a sequence as from humans (in the case of a non-human cell). The OATP shown in SEQ ID NO:3 (OATP-RP2); (b) nucleic acid transgene can be misexpressed, e.g., overexpressed or sequences complementary to (a); (c) nucleic acid sequences underexpressed. In other preferred embodiments, the cell or having at least 80%, more preferably at least 90%, more 10 cells include a gene which misexpresses an endogenous preferably at least 95%, and most preferably at least 98% OATP gene, e.g., a gene that expression of which is dis sequence identity to (a); or (d) a fragment of (a) or (b) that rupted, e.g., a knockout. Such cells can serve as a model for is at least 18 bases and which will hybridize to (a) or (b) studying disorders which are related to mutated or misex under stringent conditions. pressed OATP alleles for use in drug screening. The present invention further provides: (a) a purified and 15 Still further, the invention provides plasmids which com isolated nucleic acid molecule comprising a sequence as prise the nucleic acid molecules of the invention. Also shown in SEQ ID NO:5 (OATP-RP3); (b) nucleic acid encompassed within the invention are vectors comprising sequences complementary to (a); (c) nucleic acid sequences the nucleic acid sequences disclosed herein, as well as host having at least 80%, more preferably at least 90%, more cells comprising said vectors. preferably at least 95%, and most preferably at least 98% The present invention also includes a novel OATP of the sequence identity to (a); or (d) a fragment of (a) or (b) that present invention, or an active part thereof. A biologically is at least 18 bases and which will hybridize to (a) or (b) competent or active form of the protein or part thereof is also under stringent conditions. referred to herein as an “active OATP or part thereof. The present invention further provides: (a) a purified and The invention further contemplates antibodies having isolated nucleic acid molecule comprising a sequence as 25 specificity against an epitope of an OATP of the present shown in SEQ ID NO:7 (OATP-RP4); (b) nucleic acid invention or part of the protein. These antibodies may be sequences complementary to (a); (c) nucleic acid sequences polyclonal or monoclonal. The antibodies may be labeled having at least 80%, more preferably at least 90%, more with a detectable substance and they may be used, for preferably at least 95%, and most preferably at least 98% example, to detect a novel OATP of the invention in tissue sequence identity to (a); or (d) a fragment of (a) or (b) that 30 and cells. Additionally, the antibodies of the present inven is at least 18 bases and which will hybridize to (a) or (b) tion, or portions thereof, may be used to make targeted under stringent conditions. antibodies that destroy OATP expressing cells (e.g., anti The present invention further provides: (a) a purified and body-toxin fusion proteins, or radiolabelled antibodies). isolated nucleic acid molecule comprising a sequence as The invention also permits the construction of nucleotide shown in SEQ ID NO:9 (OATP-RP5); (b) nucleic acid 35 probes which encode part or all of a novel OATP protein of sequences complementary to (a); (c) nucleic acid sequences the invention or a part of the protein. Thus, the invention having at least 80%, more preferably at least 90%, more also relates to a probe comprising a nucleotide sequence preferably at least 95%, and most preferably at least 98% coding for a protein, which displays the properties of a novel sequence identity to (a); or (d) a fragment of (a) or (b) that OATP of the invention or a peptide unique to the protein. is at least 18 bases and which will hybridize to (a) or (b) 40 The probe may be labeled, for example, with a detectable under stringent conditions. (e.g., radioactive) Substance and it may be used to select The present invention further provides: (a) a purified and from a mixture of nucleotide sequences a nucleotide isolated nucleic acid molecule comprising a sequence as sequence coding for a protein which displays the properties shown in SEQ ID NO:11 (OATP-RP1); (b) nucleic acid of a novel OATP of the invention. sequences complementary to (a); (c) nucleic acid sequences 45 The present invention also provides a transgenic non having at least 80%, more preferably at least 90%, more human animal (e.g., a rodent, e.g., a mouse or a rat, a rabbit preferably at least 95%, and most preferably at least 98% or a pig) or embryo all of whose germ cells and somatic cells sequence identity to (a); or (d) a fragment of (a) or (b) that contain a recombinant molecule of the invention, preferably is at least 18 bases and which will hybridize to (a) or (b) a recombinant molecule comprising a nucleic acid molecule under stringent conditions. 50 of the present invention encoding an OATP of the invention The present invention additionally covers polynucleotides or part thereof. The recombinant molecule may comprise a and amino acid sequences of the present invention having nucleic acid sequence encoding an OATP of the present one or more structural mutations including replacement, invention with a structural mutation, or may comprise a deletion or insertion mutations. For example, a signal pep nucleic acid sequence encoding an OATP of the invention or tide may be deleted, or conservative amino acid substitu 55 part thereof and one or more regulatory elements which tions may be made to generate a protein that is still biologi differ from the regulatory elements that drive expression of cally competent or active. the native protein. In another preferred embodiment, the The invention further contemplates a recombinant mol animal has an OATP gene which is misexpressed or not ecule comprising a nucleic acid molecule of the present expressed, e.g., a knockout. Such transgenic animals can invention or an oligonucleotide fragment thereof and an 60 serve as a model for studying disorders that are related to expression control sequence operatively linked to the mutated or misexpressed OATPs of the present invention. nucleic acid molecule or oligonucleotide fragment. A trans The invention still further provides a method for identi formant host cell including a recombinant molecule of the fying a substance which is capable of binding a novel OATP invention is also provided. of the invention, comprising reacting a novel OATP of the In another aspect, the invention features a cell or purified 65 invention or part of the protein under conditions which preparation of cells which include a novel gene encoding an permit the formation of a complex between the substance OATP of the present invention, or which otherwise misex and a novel OATP protein or part of the protein, and US 7,235,375 B2 7 8 assaying for Substance-OATP complexes, for free Substance, novel OATPs, fusion proteins comprising a portion of the for non-complexed OATP, or for activation of an OATP. OATP protein of the present invention, and agonists and/or An embodiment of the invention provides a method for antagonists of the novel OATPs as described above. identifying Substrates which are capable of binding to a novel OATP protein of the invention, isoforms thereof, or 5 BRIEF DESCRIPTION OF THE FIGURES part of the protein, said method comprising reacting a novel OATP protein of the invention, isoforms thereof, or part of FIG. 1 is a Northern blot showing the mRNA tissue the protein, with at least one substrate which potentially is distribution of OATP2, OATP-RP1, OATP-RP2, OATP capable of binding to the protein, isoform, or part of the RP4, and OATP-RP5. The tissues corresponding to the protein, under conditions which permit the formation of 10 abbreviations above the lanes are indicated below. Substrate-transporter protein complexes, and assaying for FIG. 2 shows that OATP2 transports pravastatin, dehy Substrate-transporter protein complexes, for free substrate, droepiandosterone sulfate (DHEAS), taurocholate and thy for non-complexed OATP protein, or for activation of an roid hormone (T). FIG. 2A shows specific uptake of H OATP. In a preferred embodiment of the method, substrates pravastatin and H-DHEAS. FIG. 2B shows specific are identified which are capable of binding to and being 15 uptake of H-taurocholate. Panel 2C shows specific uptake transported by a novel OATP protein of the invention, of ''Il-thyroid hormone (T4). The uptake of radiolabeled isoforms thereof, or part of the protein. substrate for 5 minutes into cells transfected with pCE The invention also provides methods for screening poten POATP-RP 1 or empty vector (MOCK) was determined in tially useful pharmacological agonists or antagonists of the the absence (Solid bars) and presence (open bars) of excess OATPs of the present invention. The method comprises unlabeled substrate. testing potential agents by adding the agent to be tested to a FIG. 3 shows a sequence alignment of OATP family cell expressing a novel OATP of the present invention in the members. The protein sequences of human OATP2 (SEQID presence of a compound known to be transported by an NO:2), OATP-RP1 (SEQ ID NO:12), OATP-RP2 (SEQ ID OATP of the invention, and measuring the augmentation or NO:4), OATP-RP3 (SEQ ID NO:6), OATP-RP4 (SEQ ID inhibition of transport of the known compound. 25 NO:8), and OATP-RP5 (SEQ ID NO:10) are aligned with An OATP of the present invention is also useful to the following other known OATP family members: roatp2 identify compounds that may be transported into an organ, (SEQ ID NO:23), roatp3 (SEQID NO:24), rCAT-K1 (SEQ e.g., the liver. Compounds that are found to be actively ID NO:25); roatp1 (SEQ ID NO:26); hoATP (SEQ ID transported into the liver are useful as carriers for other NO:27); and hPGT (SEQ ID NO:28). Also shown is a therapeutics targeting the liver. 30 concensus sequence in bold (SEQ ID NO:29). A concensus Also included within the scope of the present invention is is indicated if at least 6 out of the 12 sequences are identical a composition which includes an OATP of the present at a given position. A residue is capitalized if it agrees with invention, a fragment thereof (or a nucleic acid encoding the concensus. said OATP or fragment thereof) and one or more additional components, e.g., a carrier, diluent or solvent. The additional 35 DETAILED DESCRIPTION OF THE component can be one that renders the composition useful INVENTION for in vitro, in vivo, pharmaceutical or veterinary use. Encompassed within the present invention are agonists The following definitions apply to the terms used through and antagonists of an OATP of the present invention. Phar out this specification, unless otherwise defined in specific macological agonists or antagonists are useful to increase or 40 instances: decrease the flow of compounds transported by an OATP of "cloning isolation of a particular gene from genetic the present invention. Said agonists and/or antagonists of the material, for example a genome, genomic library, or present invention are preferably administered with an cDNA library into a plasmid or other vector; acceptable carrier, diluent or solvent. "coding region' the region of a nucleic acid sequence In another aspect, the present invention relates to a 45 that codes for an active protein; method of treating a mammal, e.g., a human, at risk for a “OATP organic anion transport protein; disorder, e.g., a disorder characterized by aberrant or 'stringent conditions” (as used concerning nucleic acid unwanted level or biological activity of an OATP of the hybridization)—Southern blotting washed in 0.1xSSC present invention. Additionally, encompassed within the and 0.1% SDS at a temperature of at least about 65°C. invention is a method of treating a mammal, e.g., a human, 50 See Maniatis et al., Molecular Cloning: A Laboratory at risk for disorders of the liver. Since OATP2 is expressed Manual, Cold Spring Harbor Laboratory, Cold Spring exclusively in the liver, compounds that are optimized for Harbor, N.Y. (1982); one skilled in the relevant art OATP2 are useful to target hepatic delivery. These com would recognize that less stringent conditions (e.g., lx pounds in themselves may be useful therapeutics, or may be or 2xSSC, 0.1% SDS) may be employed in using the useful to chaperone other therapeutic compounds to the 55 novel sequences disclosed herein to identify nucleic liver. In addition, blocking OATP2-compound interactions acid sequences encoding novel OATPs. could provide benefit by decreasing its first-pass extraction “Northern blotting a method of identifying particular by the liver and, thus, increasing plasma concentrations and RNA fragments by hybridization with a complemen prolonging the systemic half-life of a drug. tary nucleic acid, typically a cDNA or an oligonucle Also within the scope of the present invention are fusion 60 otide; proteins comprising all or a portion of an OATP of the “open reading frame' or “ORF' a DNA sequence con present invention. taining a series of nucleotide triplets coding for amino The primary object of the present invention is the iden acids and lacking any termination codes; tification of new human OATPs, as identified by the nucleic "plasmid' -cytoplasmic, autonomously replicating DNA acid and amino acid sequences disclosed herein. Additional 65 elements found in microorganisms; objects of the invention are the methods of using the cDNA, “promoter a region on DNA at which RNA polymerase the OATP proteins, monoclonal antibodies specific for the binds and initiates transcription; and US 7,235,375 B2 10 “Southern blotting a method of identifying particular cell lines, and antibodies. All of these are useful in assays for DNA fragments by hybridization with a complementary identification of OATP positive and negative modulators nucleic acid, typically a cDNA or an oligonucleotide; (i.e., agonists and/or antagonists) and OATP carriers. The “transport'—the movement of a Substance across a bio term “positive modulator” as used herein refers to an agent logical membrane as determined by measuring the 5 or compound that increases the rate or amount of transport redistribution of Such a Substance across the membrane of a compound into an organ, e.g., the liver, or an agent or upon exposure to a transporter. compound that decreases the rate or amount of transport of For definitions of other terms in this specification, see F. a compound into an organ. The term “negative modulator Sherman et al., Laboratory Course Manual for Methods in refers to a compound that is joined to a second compound to Yeast Genetics, Cold Spring Harbor Laboratory, Cold Spring 10 prevent the second compounds transport into or out of cells. Harbor, N.Y. (1987) and Lewin, B., Genes IV, Oxford The term “carrier as used herein refers to an agent or University Press, Oxford (1990). For the definitions of compound that is transported by an OATP of the present abbreviations, see Aldrichimica Acta, Vol. 17, No. 1 (1984). invention and that is capable of being joined to or associated Use and Utility 15 with another compound to chaperone that other compound The amino acid sequences of the novel organic anion into an organ, e.g., the liver. A carrier includes an agent that transport proteins of the present invention are aligned with is used to transport a compound into an organ that is known transporters of this family in FIG. 3. The degree of otherwise not transported into said organ, and includes an sequence homology between the sequences of the present agent that increases the transport of a compound into an invention and known organic anion transporters indicates organ that is capable of being transported by an OATP. that the proteins of the present invention are organic anion One can administer OATP modulators and carriers to transporters. various mammalian species, such as monkeys, dogs, cats, It is believed by those skilled in the art that OATP proteins mice, rats, humans, etc. By known methods, persons skilled may be involved in the transport of compounds into the liver. in the pharmaceutical art can incorporate OATP modulators Persons of ordinary skill in the art can use the OATP proteins 25 and carriers in a conventional systemic dosage form, such as of the present invention to assay for agents that may increase a tablet, capsule, elixir or injectable formulation. The above or decrease the rate of transport of compounds into the liver, dosage forms will also include any necessary physiologi or for compounds that are transported by the OATPs of the cally acceptable carrier material, excipient, lubricant, buffer, present invention that are useful as carriers for other com antibacterial, bulking agent (such as mannitol), anti-oxidants pounds that are desired to be carried to a specific organ (e.g., 30 the liver). (ascorbic acid or sodium bisulfite) or the like. Therefore, agents that increase or decrease the rate of Process of preparation substrate transport by the OATPs of the present invention, or In general agents identified as carriers, are useful in the treatment of This specification describes the cloning and functional liver disease. 35 expression of full-length human cDNA clones of OATPs. Because some of the OATPs of the present invention are preferably the nucleic acid sequence of OATP2 (SEQ ID organ specific/selective (e.g., OATP2 liver; OATP-RP4— NO:1), the amino acid sequence of OATP2 (SEQ ID NO:2), heart and skeletal muscle, and OATP-RP5—brain and tes the nucleic acid sequence of OATP-RP2 (SEQID NO:3), the tis), compound specificity is built into any specific Substrate amino acid sequence of OATP-RP2 (SEQ ID NO:4), the of these OATPs and into molecular carriers transported by 40 nucleic acid sequence of OATP-RP3 (SEQ ID NO:5), the these OATPs. An agent transported by the above OATPs of amino acid sequence of OATP-RP3 (SEQ ID NO:6), the the present invention would thus be delivered to the tissues nucleic acid sequence of OATP-RP4 (SEQ ID NO:7), the in which they are expressed and not to tissues lacking the amino acid sequence of OATP-RP4 (SEQ ID NO:8), the above OATPs, thereby achieving tissue specific targeting. nucleic acid sequence of OATP-RP5 (SEQ ID NO:9), the The OATP nucleic acids of the present invention, or 45 amino acid sequence of OATP-RP5 (SEQ ID NO:10), the antisense nucleic acids, may be useful therapeutic or diag nucleic acid sequence of OATP-RP1 (SEQ ID NO:11), and nostic agents. For such gene therapy, the nucleic acids may the amino acid sequence of OATP-RP1 (SEQ ID NO:12). be incorporated into vectors and/or formulated as described DNA clones comprising nucleotide sequences encoding below and in further detail in the art. the OATPs described above were deposited with the Ameri The present invention also provides a basis for diagnostic 50 can Type Culture Collection (“ATCC) (10801 University genetic screens for predicting response to drugs. At least one Blvd., Manassas, Va. 20110-2209) on Apr. 20, 1999, and of the transporters disclosed and claimed herein is a trans given the following ATCC Accession Numbers: 207209 porter of a known drug (i.e., OATP2 transports pravastatin (OATP-RP3), 207210 (OATP-RP4), 207211 (OATP-RP5), into hepatocytes). Other transporters disclosed herein may 207212 (OATP-RP2), 207213 (OATP2), and 207214 similarly transport additional drugs into tissues. Persons 55 (OATP-RP1). The deposit(s) referred to herein will be skilled in the art can: (1) Screen the transporter genes for maintained under the terms of the Budapest Treaty on the allelic variants (genotypes) in the general population by International Recognition of the Deposit of Microorganisms various sequencing methods; and (2) determine the associa for purposes of Patent Procedure. These deposits are pro tion of these transporter genotypes in patients with response vided merely as convenience to those of skill in the art and to the transported drug in clinical trials. Particular allelic 60 are not an admission that a deposit is required under 35 variants may be more or less effective in transporting a drug, U.S.C. S 112. The sequence of the polynucleotides contained which would be related to drug efficacy. Thus, genotyping of in the deposited materials, as well as the amino acid the claimed transporters could form the basis of a clinical sequence of the of the polypeptides encoded thereby, are diagnostic test to predict a patient’s response to drug incorporated herein by reference and are controlling in the therapy. 65 event of any conflict with any description of sequences Persons skilled in the art can use the polypeptides and herein. A license may be required to make, use or sell the nucleic acids of this invention to prepare vectors, cells or deposited materials, and no such license is hereby granted. US 7,235,375 B2 11 12 Nucleic Acids chain reaction (PCR) from primers; (5) expression cloning; With the disclosed OATP gene sequences in hand, one and (6) subtractive cDNA cloning. skilled in the art can obtain OATP nucleic acids of this invention by known methods. Such methods include: (1) Preferred nucleic acid sequences of the present invention Southern and Northern blotting; (2) Western immunoblot- 5 include the following (preferably the coding sequences as ting; (3) chemical synthesis; (4) synthesis by polymerase shown below):

OATP2 (SEQ ID NOS : 1 and 2): CGGACGCGTG GGCGGACGCG, TGGGTCGCCC ACGCGTCCGA CTTGTTGCAG 5 O

TTGCTGTAGG ATTCTAAATC CAGGTGATTG TTTCAAACTG AGCATCAACA 1 OO

ACAAAAACAT TTGTATGATA TCTATATTTC AATC ATG GAC CAA AAT CAA 149

CAT TTG AAT AAA ACA GCA GAG GCA CAA CCT, TCA GAG AAT AAG 191 H L N K T A. E A. Q P S E N K

AAA ACA AGA TAC TGC AAT GGA TTG AAG ATG TTC TTG GCA GCT 233 K T R Y C N G L K M F L A. A.

CTG TCA CTC AGC TTT ATT GCT. AAG ACA CTA GGT, GCA ATT ATT 275

ATG AAA AGT, TCC ATC ATT CAT ATA GAA CGG AGA TTT GAG ATA 317

TCC. TCT, TCT. CTT GTT GGT TTT ATT GAC GGA AGC TTT GAA ATT 359

GGA AAT TTG. CTT, GTG ATT GTA TTT GTG. AGT TAC TTT GGA TCC 401

AAA CTA CAT AGA CCA AAG TTA ATT GGA ATC GGT TGT, TTC ATT 4 43

ATG GGA AT G.G.A. GGT GTT TG ACT, GCT TTG CCA CAT TTC TTC 485

ATG GGA TAT TAC AGG TAT TCT AAA GAA. ACT AAT ATC GAT TCA 527

TCA GAA AAT TCA ACA TCG ACC TTA. TCC ACT TGT, TTA ATT. AAT 569

CAA ATT TTA. TCA CTC AAT AGA, GCA TCA, CCT GAG ATA GTG GGA 611

AAA GGT TGT, TTA. AAG GAA TCT GGG TCA. TAC ATG TGG ATA TAT 653

GTG TTC ATG GGT AAT ATG CTT, CGT GGA ATA GGG GAG ACT CCC 695

ATA GTA CCA TTG. GGG CTT, TCT TAC ATT GAT GAT TTC GCT. AAA 737

GAA GGA CAT TCT, TCT, TTG TAT TTA. GGT ATA TTG AAT GCA ATA 779

GCA ATG ATT GGT CCA ATC ATT GGC TTT ACC CTG GGA TCT CTG 821

TTT TCT AAA ATG TAC GTG GAT ATT GGA TAT GTA GAT CTA AGC 863

ACT ATC AGG ATA ACT CCT ACT GAT TCT, CGA TGG GTT GGA GCT 9 O5

TGG TGG. CTT. AAT TTC CTT, GTG TCT GGA CTA TTC TCC ATT ATT 947

TCT TCC ATA CCA TTC TTT TTC TTG CCC CAA ACT CCA AAT AAA 989

CCA CAA AAA GAA. AGA AAA GCT, TCA CTG TCT, TTG CAT GTG. CTG 1031 P Q K E R K A. S L S L H W L

US 7,235,375 B2 39 40

- continued P G P I A.

ATC GAC AAG GCC TGT. CTG CTG TGG CAG GAC CAG TGT. GGG CAG 2098

CAG GGC. TCC TGC TTG. GTG TAC CAG AAT TCG GCC ATG AGC CGC 21 4 0 N S

TAC ATA CTC ATC ATG GGG CTC CTG TAC AAG GTC 2182 L L Y K

CTC TTC TTT GCC ATA GCC TGC TTC TTA TAC AAG CCC. CTG TCG 2224 C F L Y

GAG TCT TCA GAT GGC CTG GAA. ACT TGT. CTG CCC AGC CAG TCC 2266 S S D G L E T C L P S Q

TCA GCC CCT GAC AGT, GCC ACA GAT AGC CAG CTC CAG AGC AGC 2308 A. P D S A. T D S Q L Q S

GTC TGA, CCACCGCCCG CGCCCACCCG GCCACGGCGG, GCACTCAGCA 2354 W

TTTCCTGATG ACAGAACAGT, GCCGTTGGGT GATGCAATCA CACGGGAACT 2404

TCTATTGAC CTGCAACCTT CTACTTAACC TGGGTTTAA AGTCGGCTGT 2.454

GACCTCCTGT CCCCAGAGCT GTACGGCCCT, GCAGTGGGTG GGAGGAACTT 25 O4

GCATAAATAT, ATATTTATGG ACACACAGTT TGCATCAGAA CGTGTTTATA 2554

GAATGTGTTT TATACCCGAT CGTGTGTGGT, GTGCGTGAGG ACAAACTCCG 2604

CAGGGGCTGT, GAATCCCACT GGGAGGGCGG CGGGCCTGCA GCCCGAGGAA 2654

GGCTTGTGTG TCCTCAGTTA AAACTGTGCA. TATCGAAATA TATTTTGTTA 2O4.

TTTAAGCCTG CGAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA 2754

AAAAAAAAA 2763 35 Persons skilled in the art can also modify the nucleic acids NO:7, SEQ ID NO:9, or SEQ ID NO:11; preferred is a coding for the OATPs of the present invention to prepare nucleotide sequence encoding an OATP as shown above useful mutations. For example, one may modify the (i.e., the coding region). sequence to provide additional restriction endonuclease rec 40 Expression vectors are usually plasmids, but the invention ognition sites in the nucleic acid. Such mutations may be includes other vector forms that serve equivalent functions silent or may change the amino acid encoded by the mutated and become known in the art Subsequently hereto. A person codon. One can prepare these modified nucleic acids, for skilled in the art might also stably integrate a sequence example, by mutating the nucleic acid coding for an OATP encoding an OATP into the chromosome of an appropriate of the present invention to result in deletion, substitution, 45 host cell. insertion, inversion or addition of one or more amino acids Expression vectors typically contain regulatory elements in the encoded polypeptide. For methods of site-directed capable of affecting expression of an OATP. These regula mutagenesis, see Taylor, J. W. et al. (1985), Nucl. Acids Res. tory elements can be heterologous or native OATP elements. 13, 8749-64 and Kunkel, J. A. (1985), Proc. Natl. Acad. Sci. Typically, a vector contains an origin of replication, a USA82: 482-92. In addition, kits for site-directed mutagen 50 promoter, and a transcription termination sequence. The esis are available from commercial vendors (e.g., BioRad vector may also include other regulatory sequences, includ Laboratories, Richmond, Calif.; Amersham Corp., Arlington ing mRNA stability sequences, which provide for stability of Heights, Ill.). For disruption, deletion and truncation meth the expression product; secretory leader sequences, which ods, see Sayers, J. R. et al. (1988), Nucl. Acids Res. 16: provide for secretion of the expression product; environ 791-800. 55 mental feedback sequences, which allow expression of the This invention also comprises modified nucleic acids, structural gene to be modulated (e.g., by the presence or including (1) alternative splice exon variants; (2) allelic absence of nutrients or other inducers in the growth variants; and (3) chimeric proteins in which the fusion medium); marking sequences, which are capable of provid construct comprises an OATP or fragment thereof. Such ing phenotypic selection in transformed host cells; restric modified nucleic acids can be obtained by persons of ordi 60 tion sites, which provide sites for cleavage by restriction nary skill in the art when armed with the present disclosure. endonucleases; and sequences which allow expression in Expression Vectors various types of hosts, including prokaryotes, yeasts, fungi, This invention further concerns expression vectors com plants and higher eukaryotes. prising a nucleotide sequence encoding an OATP of the An expression vector of this invention is at least capable present invention. Preferably, the expression vectors com 65 of directing the replication, and preferably the expression, of prise all or a portion of the nucleic acid sequence as shown the nucleic acids and protein of this invention. Suitable in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID origins of replication include, for example, the Col E1, the US 7,235,375 B2 41 42 SV40 viral, Epstein Barr viral, and the M13 origins of screen for compounds that bind to or otherwise modulate or replication. Suitable promoters include, for example, the regulate the function of an OATP of the present invention, cytomegalovirus promoter, the lacZ promoter, the gal10 which would be useful for modulation, for example activa promoter and the Autographa Californica multiple nuclear tion or inactivation, of OATP2, OATP-RP2, OATP-RP3, polyhedrosis virus (AcMNPV) polyhedral promoter. Suit OATP-RP4, OATP-RP5 or OATP-RP1 activity; to study able termination sequences include, for example, the bovine signal transduction mechanisms and protein-protein interac growth hormone, SV40, lacZ and AcMNPV polyhedral tions; and to prepare OATP for the uses described below. polyadenylation signals. Examples of selectable markers Not all expression vectors and DNA regulatory sequences include neomycin, amplicillin, and hygromycin resistance will function equally well to express the DNA sequences of and the like. 10 this invention. Neither will all host cells function equally Persons skilled in the art may insert DNA encoding An well with the same expression system. However, one of OATP of the present invention into several commercially ordinary skill in the art may make a selection among available vectors. Examples include vectors compatible with expression vectors, DNA regulatory sequences, and host mammalian cells, such as pcDNA3 or pCEP4; baculovirus cells using the guidance provided herein without undue vectors such as pBlueBac; prokaryotic vectors such as 15 experimentation and without departing from the scope of the pcDNA2; and yeast vectors such as pYes2. For vector invention. modification techniques, see Sambrook et al. (1989), Polypeptides Molecular Cloning. A Laboratory Manual, Second Edition, This invention further concerns polypeptides comprising Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. all or a portion of the amino acid sequences of OATPs of the Host Cells present invention. The inventors prefer polypeptides com This invention additionally concerns host cells containing prising all or a portion of the amino acid sequences shown an expression vector that comprises a sequence encoding an as in SEQID NO:2 (OATP2), SEQ ID NO:4 (OATP-RP2), OATP preferably the OATP2, OATP-RP2, OATP-RP3, SEQ ID NO:6 (OATP-RP3), SEQ ID NO:8 (OATP-RP4), OATP-RP4, OATP-RP5 or OATP-RP1 of the present inven SEQ ID NO:10 (OATP-RP5) or SEQ ID NO:12 (OATP tion. The host cells preferably contain an expression vector 25 RP1). Where a portion of an OATP of the present invention which comprises all or part of the DNA sequence having the is used, preferably the portion exhibits the same biological nucleotide sequence substantially as shown in SEQ ID activity of the OATP from which the portion is derived. For NO:1, SEQID NO:3, SEQID NO:5, SEQID NO:7, SEQID example, and within the scope of the invention, are polypep NO:9, or SEQ ID NO:11, particularly the coding regions tides that comprise all or a portion of OATP2, OATP-RP2, thereof. Suitable host cells include both prokaryotic cells 30 OATP-RP3, OATP-RP4, OATP-RP5 or OATP-RP1 that (e.g., E. coli strains HB101, DH5a, XL1 Blue, Y1090 and exhibit transport activity. The portions may contain one or JM101) and eukaryotic cells (e.g., Spodoptera frugiperda more mutations so that the protein(s) fail(s) to exhibit insect cells, CHO cells, COS-7 cells, HEK 293 cells, human transport activity, but that can be used to Screen for com skin fibroblasts, and S. cerevisiae cells). pounds that will modulate or bind to the protein or portion Persons skilled in the art may introduce expression vec 35 thereof. tors into host cells by various methods known in the art. Persons having ordinary skill in the art may prepare these Exemplary methods are transfection by calcium phosphate polypeptides by methods known in the art. For example, one precipitation, electroporation, liposomal fusion, nuclear may use chemical synthesis, Such as the Solid phase proce injection, and viral or phage infection. One may then culture dure described by Houghton et al. (1985), Proc. Natl. Acad. the host cell under conditions permitting expression of large 40 Sci. 82: 513.1-5. Another method is in vitro translation of amounts of OATP mRNA. One may also produce the polypeptides in the One may identify such modified host cells by any of five above-described host cells, which is the preferred method. general approaches: For example, one may synthesize DNA comprising all or a (a) DNA-DNA hybridization with probes complementary portion of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, to the sequence encoding an OATP (Southern blotting). 45 SEQID NO:7, SEQID NO:9, or SEQID NO:11 by PCR as (b) detection of marker gene functions, such as thymidine described above, insert the synthesized DNA into an expres kinase activity, resistance to antibiotics, and the like. A sion vector, transform a host cell with the expression vector, marker gene can be placed in the same plasmid as an OATP and culture the host cell to produce the desired polypeptides. sequence under the regulation of the same or a different Persons skilled in the art can isolate and purify such promoter. 50 polypeptides by any one of several known techniques; for (c) detection of mRNA transcripts by hybridization assays example, ion exchange chromatography, gel filtration chro (e.g., Northern blotting or a nuclease protection assay using matography and affinity chromatography. Such techniques a probe complementary to the RNA sequence). may require modification of the protein. For example, one (d) immunodetection of gene expression (e.g., by Western may add a histidine tag to the protein to enable purification blotting with antibody to OATP). 55 on a nickel column. (e) PCR with primers homologous to expression vector Persons skilled in the art can use the polypeptides of the sequences or sequences encoding OATP. The PCR produces invention in a wide variety of ways. For example, one may a DNA fragment of predicted length, indicating incorpora use them to generate polyclonal or monoclonal antibodies. tion of the expression system in the host cell. One may then use Such antibodies for immunodetection Persons skilled in the art may determine DNA sequences 60 (e.g., radioimmunoassay, enzyme immunoassay, or immu by various known methods. See, for example, the dideoxy nocytochemistry), immunopurification (e.g., affinity chro chain termination method in Sanger et al. (1977), Proc. Natl. matography) of polypeptides from various sources, or Acad. Sci. USA 74:5463-7 and the Maxam-Gilbert method immunotherapy. in Maxam-Gilbert (1977), Proc. Natl. Acad. Sci. USA 74: Persons skilled in the art may make modified OATP 560-4. 65 polypeptides by known techniques. Such modifications may One may use the host cells of this invention in a variety cause higher or lower activity, permit higher levels of of ways that are now apparent. One may use the cells to protein production, or simplify purification of the protein. US 7,235,375 B2 43 44 Such modifications may help identify specific OATP amino the aforementioned polypeptides (e.g., having N-terminal acids involved in binding, which in turn may help rational Substituents such as methionine, N-formylmethionine and drug design of OATP modulators. One can make amino acid leader sequences). The invention includes all Such varia Substitutions based on similarity in polarity, charge, solubil tions. ity, hydrophobicity, hydrophilicity and/or the amphipathic Method for Detecting Nucleic Acids nature of the residues involved. For example, negatively The present invention further concerns a method for charged amino acids include aspartic acid and glutamic acid; detecting nucleic acids encoding OATP proteins. In this positively charged amino acids include lysine and arginine; method, a person of ordinary skill in the art (a) contacts amino acids with uncharged polar head groups or nonpolar nucleic acids of unknown sequence with a nucleic acid head groups having similar hydrophilicity values include the 10 having a sequence complementary to a known coding following: leucine, isoleucine, Valine, glycine, alanine; sequence (e.g., a sequence of at least about 10 nucleotides asparagine, glutamine; serine, threonine; phenylalanine, from, e.g., SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, tyrosine. All such modified polypeptides are included within SEQ ID NO:7, SEQ ID NO:9, or SEQ ID NO:11, particu the scope of the invention. larly the coding regions thereof), wherein the latter nucleic Preferred analogs include proteins that differ from the 15 acid has a detectable marker, and (b) determines the pres novel OATPs of the present invention (or biologically active ence of marker bound to any of the nucleic acids of unknown fragments thereof) by one or more conservative amino acid sequence. The presence of bound marker indicates the Substitutions or by one or more non-conservative amino acid presence of the desired nucleic acids. One can apply this substitutions, deletions or insertions which do not abolish method to detect OATP nucleic acids from other tissues the biological activity of the analog. Conservative substitu (which may have different regulatory elements) and nucleic tions typically include the Substitution of one amino acid for acids from other species (e.g., monkey). another with similar characteristics, e.g., Substitutions Persons of ordinary skill in the art generally know how to within the following groups: valine, glycine; glycine, ala obtain nucleic acids to be analyzed in this method. For nine; Valine, isoleucine, leucine; aspartic acid, glutamic genomic DNA, one can rapidly freeze tissue, crush the tissue acid; asparagine, glutamine; serine, threonine; lysine, argi 25 into readily digestible pieces, and incubate the crushed tissue in proteinase K and SDS to degrade most cellular nine; and phenylalanine, tyrosine. Other conservative amino proteins. One can then deproteinize the genomic DNA by acid substitutions can be taken from the table below. Successive phenol/chloroform/isoamyl alcohol extractions, TABLE 1. recover DNA by ethanol precipitation, dry it and resuspend 30 it in buffer. For RNA, one can lyse cultured cells in 4M Conservative amino acid replacements guanidinium solution, draw the lysate through a 20-gauge needle, pellet the RNA through a cesium chloride step For Amino Acid Code Replace with any of: gradient, and remove the Supernatant. The pellet should Alanine A. D-Ala., Gly, beta-Ala, L-Cys, D-Cys contain purified RNA. Arginine R D-Arg, Lys, D-Lys, homo-Arg, D-homo-Arg, 35 The detectable marker may be a radioactive ion linked to Met, Ile, D-Met, D-Ile, Orn, D-Orn one of the nucleotides of the complementary nucleic acid. Asparagine N D-ASn, Asp, D-Asp, Glu, D-Glu, Gln, D-Gln Aspartic Acid D D-Asp, D-ASn, ASn, Glu, D-Glu, Gln, D-Gln Common radioactive labels are P and S, although one Cysteine C D-Cys, S-Me-Cys, Met, D-Met, Thr, D-Thr may also use other labels such as biotin. Persons skilled in Glutamine Q D-Gln, ASn, D-ASn, Glu, D-Glu, Asp, D-Asp the art are aware of various methods to attach the labels to Glutamic Acid E D-Glu, D-Asp, Asp, ASn, D-ASn, Gln, D-Gln 40 the complementary nucleic acid (e.g., the random primer Glycine G Ala, D-Ala, Pro, D-Pro, B-Ala., Acp Isoleucine D-Ile, Val, D-Val, Leu, D-Leu, Met, D-Met method for attachment of 'P or S). Leucine D-Leu, Val, D-Val, Met, D-Met Persons of ordinary skill in the art generally know how to Lysine K D-Lys, Arg, D-Arg, homo-Arg, D-homo-Arg, carry out Such a method of detecting nucleic acids. For Met, D-Met, Ile, D-Ile, Orn, D-Orn example, one may perform a Southern or northern blot using Methionine M D-Met, S-Me-Cys, Ile, D-Ile, Leu, D-Leu, Val, D-Wal 45 a radiolabeled OATP complementary oligonucleotide probe. Phenylalanine D-Phe, Tyr, D-Thr, L-Dopa, His, D-His, Trp, One can then detect hybridization by autoradiography. D-Trp, Trans-3,4, or 5-phenylproline, Depending on the marker, one may also use other detection cis-34, or 5-phenylproline methods (e.g., spectrophotometry). Proline C D-Pro, L-1-thioazolidine-4-carboxylic acid, D- or L-1-oxazolidine-4-carboxylic acid Methods for Detecting OATP Modulators and Com Serine S D-Ser, Thr, D-Thr, allo-Thr, Met, D-Met, 50 pounds Transported by the OATPs of the Present Invention Met(O), D-Met(O), L-Cys, D-Cys This invention further concerns methods for detecting Threonine T D-Thr, Ser, D-Ser, allo-Thr, Met, D-Met, modulators of the OATPs of the present invention, as well as Met(O), D-Met(O), Val, D-Val Tyrosine Y D-Tyr, Phe, D-Phe, L-Dopa, His, D-His methods for detecting compounds that are transported by the Valine V D-Val, Leu, D-Leu, Ile, D-Ile, Met, D-Met OATPs of the present invention (e.g., compounds that are 55 transported into the liver that may be used as carriers for other compounds). A screen for OATP modulators entails Other analogs within the invention are those with modi detecting binding of molecules (e.g., polypeptides, natural fications which increase protein or peptide stability. Such products, synthetic compounds) in cells expressing OATP analogs may contain, for example, one or more non-peptide protein. Alternatively, a screen for OATP positive modula bonds (which replace the peptide bonds) in the protein or 60 tors and/or negative modulators entails detecting the aug peptide sequence. Also included are analogs that include mentation and/or inhibition of transport of a known com residues other than naturally occurring L-amino acids, e.g., pound. A screen for OATP-transported compounds entails D-amino acids or non-naturally occurring or synthetic amino detecting the transport of molecules (e.g., polypeptides, acids, e.g., for Y amino acids. natural products, synthetic compounds) by an OATP. The inventors contemplate a number of other variations of 65 Cloning and sequencing of the OATPs of the present the above-described polypeptides. Such variations include invention enables construction of cells useful in Screening salts and esters of the polypeptides, as well as precursors of for natural products and synthetic compounds that bind to, US 7,235,375 B2 45 46 modulate, and/or are transported by OATP activity. A pro from the circulation, a competitive or non-competitive cess for detecting OATP modulators requires transforming a OATP2 inhibitor could elevate plasma levels of said sub suitable vector into compatible host cells as described pre stance. As an example, DHEAS is an adrenal androgen that viously herein. One treats such transformed cells with test declines with age and on the basis of some animal data, it has Substances (e.g., synthetic compounds or natural products), 5 been suggested that replacement of DHEAS deficiency may and then measures activity in the presence and absence of stimulate age-related immune deficiencies, increase cogni the test Substance. tive function and insulin sensitivity, and maintain bone mass. Inhibiting the hepatic clearance of endogenous OATP Assay DHEAS through blocking its interactions with OATP2 could An assay for the measurement of OATP activity is per result in elevated hormone levels in the absence of hormone formed as follows: HEK293 cells are plated in Dulbeccos 10 Modified Eagles Medium (DMEM) plus 10% fetal bovine Supplementation. serum plus penicillin and Streptomycin, in poly-d-lysine With the information provided herein, one skilled in the coated dishes and co-transfected with OATP transporter art is able to identify molecules, both naturally occurring and expression plasmids using Lipofectamine Plus (Life Tech synthetic (including therapeutic drugs), that are transported nologies, Inc.). The cells and media are assayed for Substrate by the OATPs, e.g., OATP2, disclosed herein. OATPs as a transport 24 hours later. Alternatively, cell lines engineered 15 class generally exhibit broad substrate specificity (“polyspe to stably express OATPs could be plated and assayed cific' transporters). Thus, it is anticipated that many addi directly without transfection. To measure transport, media is tional substrates of these transporters will be identified. removed and monolayers are assayed in triplicate by wash Gene Therapy ing once in serum-free DMEM and adding the same medium Persons skilled in the art can also use sense and antisense containing H-substrate alone or in the presence of various nucleic acid molecules as therapeutic agents for OATP concentrations of unlabeled test compounds. For OATP2, related indications. One may construct vectors that direct the the H-substrate could be H-pravastatin, H-taurocho synthesis of the desired DNA or RNA or formulate the late, or Hi-dehydroepiandrosterone sulfate, or 'I'-thy nucleic acid as described in the art. roid hormone (T4). Monolayers are incubated at room Several references describe the usefulness of antisense temperature for 5 to 10 minutes depending on the trans 25 molecule. See Toulme and Helene (1988), Gene 72: 51-8; porter. Then the cells are rapidly washed once with ice cold Inouye (1988), Gene, 72: 25-34; Uhlmann and Peyman DMEM containing 5% BSA, twice with DMEM plus 0.1% (1990), Chemical Reviews 90: 543-584: Biotechnology BSA and once with DMEM alone. Cells are lysed in 0.1 N Newswatch (Jan. 15, 1996), p. 4: Robertson, Nature Bio NaOH and a fraction of the lysate is used to determine technology 15: 209 (1997); Gibbons and Dzau (1996), radiolabel incorporation by liquid Scintillation counting, and 30 Science 272: 689-93. One can design them based on another is used to determine protein concentration in the genomic DNA and/or cDNA, 5' and 3’ flanking control lysate using the Bradford assay with BSA as a standard. The regions, other flanking sequences, intron sequences, and transport activity is expressed as moles of Substrate trans nonclassic Watson and Crick base pairing sequences used in ported into cells/mg of cell protein/minute. formation of triplex DNA. Such antisense molecules include Drug Targeting antisense oligodeoxyribonucleotides, oligoribonucleotides, Also included within the present invention is tissue 35 oligonucleotide analogues, and the like, and may comprise expression of an OATP of the present invention. The OATPs at least about 15 to 25 bases. of the present invention are also useful for targeting drugs to Antisense molecules may bind noncovalently or certain organs that express an OATP described herein (e.g., covalently to the OATP DNA or RNA. Such binding could, the liver), and for modulating the concentration of endog for example, cleave or facilitate cleavage of OATP DNA or enous Substrates. 40 RNA, increase degradation of nuclear or cytoplasmic For example, the novel organic anion transporter dis mRNA, or inhibit transcription, translation, binding of trans closed herein, OATP2, represents a potential therapeutic activating factors, or pre-mRNA splicing or processing. target due to its ability to modulate the cellular uptake and Antisense molecules may also contain additional function potential Secretion of a several biologically important alities that increase stability, transport into and out of cells, organic anions, including bile acids and the androgen hor 45 binding affinity, cleavage of the target molecule, and the like. mone dehydroepiandrosterone sulfate (DHEAS). Further All of these effects would decrease expression of OATP more, since OATP2 transports at least one drug (i.e. prav protein and thus make the antisense molecules useful as astatin), and other members of this family are known to OATP modulators. transport a variety of other Xenobiotics, this transporter could be exploited to optimize the delivery of drugs into 50 EXAMPLES liver and away from other tissues. OATP2 is unique among the OATP family, in that it is the only known organic anion transporter that is expressed The following examples are included for understanding exclusively in the liver. Thus, drugs optimized for this the present invention and are not intended to limit the scope transporter could be targeted for hepatic delivery with of Applicants invention, which is defined solely by the greater selectivity than with any other known transporter. To 55 claims. generalize this approach, it may be possible to identify a Example 1 small molecule “adaptor' that is efficiently recognized and transported by OATP2 (an OATP2-transported compound) that could be appended to other drugs for hepatic targeting Isolation of OATP2, OATP-RP1, OATP-RP2, even if the parent compound is not transported by OATP2. 60 OATP-RP3, OATP-RP4 and OATP-RP5 Full Alternatively, if a therapeutic compound is taken up into Length cDNAs and Cloning into Mammalian the liver entirely or substantially by OATP2, one could Expression Vectors inhibit hepatic clearance and thereby elevate circulating concentrations, or increase the compounds half-life in the Human OATP2 was identified by searching the public periphery, by adding a functionality to said compound that 65 EST databases for sequences homologous to human OATP. disallows transport by OATP2. Likewise, if an endogenous One EST sequence, Genbank accession number T73863, substance utilizes OATP2 for liver uptake and clearance encoded a partial cDNA with significant sequence identity US 7,235,375 B2 47 48 with OATP. EST sequences encoding partial cDNAs for Two polymorphic positions were identified when OATP-RP1, OATP-RP2, OATP-RP3, OATP-RP4, and sequencing multiple OATP-RP4 cDNA clones. Thus, nucle OATP-RP5 were identified by searching the public EST otide number 713 of SEQ ID NO:7 can be either a C, databases and the Incyte, Inc. EST database for sequences encoding Leu in SEQ ID NO:8, or a T, encoding a Phe in homologous to human OATP. The EST clone IDs corre SEQ ID NO:8. Similarly, nucleotide number 2397 of SEQ sponding to OATP-RP1 are 8201 17, 2668489, 1610706, ID NO:7 can be either a G, encoding a Gly in SEQID NO:8, 29725 18, and 588148. These clones represent a contig or a T, encoding a Val in SEQ ID NO:8. encoding only part of the full length cDNA. The Incyte EST For expression studies, OATP2 cl DNA was cloned into the clone IDs corresponding to OATP-RP2 are 1664737 and expression vector pCEP4? 3R, a modified form of pCEP4 2641944. These clones represent a contig encoding only part 10 (Invitrogen, Inc.) in which the CMV promoter-driven of the full length cDNA. The Incyte EST clone IDs corre expression cassette has been inverted, and used in transient sponding to OATP-RP3 are 2493241, 2497845, and transfections. To accomplish this, OATP2 cl DNA in pCM 2664024. These clones represent a contig encoding only part VSport2, correponding to nucleotides 59 through 2361 of of the full length cDNA. The Incyte EST clone IDs corre SEQID NO:1, was excised by digestion with KpnI and NotI. sponding to OATP-RP4 are 1494683 and 1685219. These 15 This fragment was cloned into KpnI-NotI digested clones represent a contig encoding only part of the full pCEP4 BR. This clone, pCEP-OATP2 was used for transient length cDNA. The Incyte EST clone ID corresponding to transfection expression studies. OATP-RP5 is 925716. This clone encodes only part of the full length cDNA. Full length clones for each of the above Example 2 genes were obtained using the Gene Trapper cDNA Positive Selection System (LifeTechnologies, Inc.). In this proce Tissue and Cellular Distribution of OATP2, dure, a single or multiple oligonucleotides complementary OATP-RP1, OATP-RP2, OATP-RP4, and to each of the EST contigs or individual EST sequences, OATP-RP5 were biotinylated at the 3'-end and used to hybridize to a single-stranded human clNA library constructed in pCM 25 The tissue distribution of OATP2, OATP-RP1, OATP VSport2 (LifeTechnologies, Inc.). The sequence of oligo RP2, OATP-RP4, and OATP-RP5 expression was deter nucleotides used for each gene as well as the tissue source mined by Northern blotting of poly A+ RNA from a variety of the libraries screened are shown in Table 2. of human tissues (FIG. 1). Transporters of this family

TABLE 2 Oligonucleotides used to screen for OATP Full length cDNAs using Gene-Trapper Selection Seq ID number Human cDNA of library Gene Biotinylated capture oligonucleotide(s) used oligonucleotide screened OATP2 S-ACCCTGTCTAGCAGGTTGCA-3' 13 liver OATP-RP1 S-CTGTCGGAGTCTTCAGATG-3' 14 brain OATP-RP2 S-TCCATCACAGCCTCCTACGC-3' 15 liver OATP-RP3 S-TGCCTCTACTCTGACCCTAG-3' 16 heart OATP-RP4 S-GGAGCAGTCATTGACACCAC-3' 17 heart S-TGCTGGGAGTACAACGTGACG-3' 18 5'-ACAAGGAGGATGGACTGCAG-3' 19 OATP-RPS S-CAGGAATCCCAGCTCCAGTG-3' 2O brain S-GCTACAACCCAACTACTGGC-3' 21 S-GGGACTAACTGTGATACTGG-3' 22

Hybrids between the biotinylated oligonucleotides and previously described in the literature, namely human OATP, single-stranded cDNA were captured on Streptavidin-coated rat oatp1, rat oatp2 and rat oatp3, are all expressed in liver, paramagnetic beads. After washing, the captured single 50 kidney and brain. All of the above transport bile acids as well stranded cDNA targets was released from the biotinylated as a variety of other substrates that are specific for subsets oligonucleotides and converted to dsDNA by DNA poly of these transporters. In contrast, the expression of OATP2, merase using the corresponding unbiotinylated oligonucle which also transports bile acids, is very hepato-specific; a otide. Following transformation and plating, several positive 55 major 3.2 kb and several minor hybridizing bands were observed only in RNA from liver and no other tissue. The clones for each gene were identified by PCR analysis. specific cell types that express this transporter were exam Full-length cDNA clones were identified by sequencing. In ined by in situ hybridization of OATP2 riboprobe to human the case of OATP-RP1, a partial cDNA was obtained by the liver samples. Strong hybridization signal was seen local above technique (pSP-RP1A). Another cDNA clone that was 60 ized to hepatocytes throughout the liver lobule with no part of the OATP-RP1 contig was identified by searching the significant difference in signal intensity among centrilobular, public EST databases (Genbank accession number midZonal or periportal regions. No signal was observed in AI027850). An EcoRI-NotI fragment of this clone contain bile ducts, Kupffer cells, or blood vessels, nor in any cell ing the first 477 nucleotides of OATP-RP1 (SEQID NO:11) types from human lung (data not shown). (obtained from Research Genetics, Inc.) was ligated to 65 OATP-RP1 is expressed in nearly all tissues tested with EcoRI-Not I digested pSP-RP1A to generate the full length highest abundance in skeletal muscle, lung, placenta, and Sequence. heart. OATP-RP2 is ubiquitously expressed in all tissues US 7,235,375 B2 49 50 tested. OATP-RP4 has a much more restricted pattern of expression vector pCEP-OATP2, or the pCEP4 vector alone expression with abundant transcipts in skeletal muscle and (MOCK) and the transport of H-labeled substrates was heart and much less in prostate and thymus. The expression determined 24 hours later. FIG. 2A shows specific uptake of of OATP-RP5 is likewise tissue specific, with brain and H-pravastatin and H-DHEAS. FIGS. 2B and 2C show testes being the only sites where transcripts were detected. 5 the specific uptake of H-taurocholate and 125II-thyroid hormone (T4), respectively. The uptake of radiolabeled Example 3 substrate for 5 minutes into cells transfected with pCEP OATP2 or empty vector (MOCK) was determined in the Expression of OATP2 in Transfected Cells absence (Solid bars) and presence (open bars) of excess 10 unlabeled substrate. Thus, OATP2 is a liver specific human 293EBNA cells (Invitrogen, Inc.), an HEK293 cell transporter of at least some HMG CoA reductase inhibitors, derivative, were transiently transfected with the OATP2 bile acids, adrenal Steroids, and thyroid hormone.

SEQUENCE LISTING

<160> NUMBER OF SEQ ID NOS: 22 <210> SEQ ID NO 1 &2 11s LENGTH 2830 &212> TYPE DNA <213> ORGANISM: Homo sapiens <400 SEQUENCE: 1

cggacgc.gtg ggcggacgc.g tgggtogcc.c acgc.gtc.cga cittgttgcag ttgctgtagg 60

attctaaatc. caggtgattg tttcaaactg agcatcaa.ca acaaaaa.cat ttgtatgata 120

totatattitc aatcatggac caaaatcaac atttgaataa aacago agag go acaaccitt 18O

cagagaataa gaaaacaaga tactgcaatg gattgaagat gttcttggca gctotgtcac 240 tdagcttitat tgctaag aca citaggtogcaa ttattatgaa aagttccatc attcatatag 3OO aacggagatt tgagatato c tottctattg ttggitttitat tgacggaagc tittgaaattg 360

gaaatttgct tgtgattgta tttgttgagtt actittggatc caaactacat agaccaaagt 420 taattggaat cg gttgtttc attatgggaa ttggaggtgt tttgactgct ttgccacatt 480

tottcatggg at attacagg tattotaaag aalactaatat cg attcatca gaaaattcaa 540

catcg accitt atccacttgt ttaattaatc aaattittatc. actcaataga gCatcaccitg 600 agatagtggg aaaaggttgt ttaaaggaat citgggtoata catgtggata tatgtgttca 660

tgggtaatat gottcgtgga at aggggaga citcc catagt accattgggg ctittcttaca 720 ttgatgattit cgctaaagaa gg acattctt citttgtattt aggtatattgaatgcaatag 78O

caatgattgg to caatcatt ggctttaccc tgggatctot gttittctaaa atgtacgtgg 840 atattggata tgtag atcta agcactato a ggataactcc tact gattot cqatgg gttg 9 OO

gag Cttggtg gcttaattitc cittgttgttctg gactattotc cattatttct tccataccat 96.O

totttitt citt gcc.ccaaact ccaaataaac cacaaaaaga aagaaaagct tcactgtc.tt O20 tgcatctgct ggaaacaaat gatgaaaagg atcaaacago taatttgacc aatcaaggaa O8O

aaaatattac caaaaatgtg actggitttitt to cagtctitt taaaag catc ctitactaatc 1 4 0 ccctgitatgt tatgtttgttg cittittgacgt tgttacaagt aag cagotat attggtgctt 200

ttactitatgt cittcaaaitac gtagagcaac agtatgg to a gcc titcatct aaggctaa.ca 260

tottattggg agtcatalacc attacctatitt ttgcaagtgg aatgtttitta ggaggatata 320

toattaaaaa. attcaaactg aacaccgttg gaattgccala attctoatgt tttactgctg 38O

tgatgtcatt gtccttttac citattatatt ttitt catact citgttgaaaac aaatcagttg 4 40

ccggactaac catgaccitat gatggaaata atccagtgac atctoataga gatgtaccac 5 OO

tttcttattg caacticagac tgcaattgtg atgaaagttca atgg galacca gtctgtggaa 560 US 7,235,375 B2 51 52

-continued acaatggaat aacttacatc. to accotgtc tag caggttg caaatctitca agtggcaata 1620 aaaag.ccitat agtgttttac aactgcagtt gtttggaagt aactggtotc cagaacagaa 1680 attacticago ccatttgggit gaatgcc.caa gagatgatgc ttgtaca agg aaattittact 1740 ttitttgttgc aatacaagtc ttgaattitat ttittctatgc actitggaggc accitcacatg 1800 tdatgctgat tgttaaaatt gttcaacctg aattgaaatc actitgcactg ggtttccact 1860 caatggittat acgagcacta ggaggaattc tagctccaat atattittggg gctctgattg 1920 atacaacgtg tataaagtgg to caccaa.ca actgtgg cac acgtggg to a tgtaggacat 1980 attaatticcac atcattitt.ca agggtotact tgggcttgtc ttcaatgtta agagt citcat 20 40 cacttgttitt attatattata ttaattitatg ccatgaagaa aaaatat cala gagaaagata 2100 tdaatgcatc agaaaatgga agtgtcatgg atgaa.gcaaa cittagaatcc ttaaataaaa. 216 O ataalacattt tgtc.ccttct gctggggcag atagtgaaac acattgttaa ggggagaaaa 2220 aaagcc actt citgcttctgt gtttccaaac agcattgcat tgatticagta agatgttatt 228O tittgaggagt toctaggtoct ttcactalaga attitccacat cittittatggit ggaagtataa 234. O ataagccitat gaacttataa taaaacaaac tgtaggtaga aaaaatgaga gtactcattg 24 OO ttacattata gctacatatt tgtggittaag gttagacitat atgatccata caaattaaag 2460 tgagagacat ggittactgtg taataaaaga aaaaatacitt gttcaggtaa ttctaattict 252O taataaaa.ca aatgagtatc atacagg tag aggittaaaaa ggaggagcta gattcatato 258O

Ctaagtaaag agaaatgcct agtgtctatt ttattaaa.ca aaaaaa.ca gagtttgaac 264 O tataatacta aggcctgaag totagottgg atatatgcta caataatlatc tgttacticac 27 OO ataaaattat a tattt caca gactittatca atgtataatt aacaattatc ttgtttaagt 276 O. aaatttagaa tacatttaag tattgttggaa gaaataaaga cattccalata tittgcaaaaa 282O aaaaaaaaaa. 2830

<210> SEQ ID NO 2 &2 11s LENGTH 691 &212> TYPE PRT <213> ORGANISM: Homo sapiens <400 SEQUENCE: 2

Met Asp Glin Asn Gln His Lieu. Asn Lys Thr Ala Glu Ala Glin Pro Ser 5 10 15

Glu Asn Lys Lys Thr Arg Tyr Cys Asn Gly Lieu Met Phe Leu Ala

Ala Leu Ser Leu Ser Phe Ile Ala Lys Thr Lieu Gly Ala Ile Ile Met 35 40 45

Lys Ser Ser Ile Ile His Ile Glu Arg Arg Phe Glu Ile Ser Ser Ser 5 O 55 60

Leu Val Gly Phe Ile Asp Gly Ser Phe Glu Ile Gly Asn Telu Leu Wall 65 70 75

Ile Wall Phe Val Ser Tyr Phe Gly Ser Lys Lieu His Arg Pro Lys Lieu 85 90 95

Ile Gly Ile Gly Cys Phe Ile Met Gly Ile Gly Gly Wall Telu Thr Ala 100 105 110

Leu Pro His Phe Phe Met Gly Tyr Ser Lys Glu Thr Asn 115 120 125

Ile Asp Ser Ser Glu Asn. Ser Thr Ser Thr Leu Ser Thr Lieu. Ile 130 135 1 4 0 US 7,235,375 B2 53 54

-continued

Asn Glin Ile Telu Ser Teu Asn Ala Ser Pro Glu Ile Wall Gly Lys 145 15 O 155 160

Gly Cys Telu Lys Glu Ser Gly Ser Tyr Met Trp Ile Tyr Wall Phe Met 1.65 170 175

Gly Asn Met Telu Gly Ile Gly Glu Thr Pro Ile Wall Pro Telu Gly 18O 185 19 O

Teu Ser Tyr Ile Asp Phe Ala Lys Glu Gly His Ser Ser Telu 195 200

Teu Gly Ile Telu Asn Ala Ile Ala Met Ile Gly Pro Ile Ile Gly Phe 210 215 220

Thr Telu Gly Ser Teu Phe Ser Lys Met Tyr Wall Asp Ile Gly Tyr Wall 225 230 235 240

Asp Telu Ser Thr Ile Arg Ile Thr Pro Thr Asp Ser Arg Trp Wall Gly 245 250 255

Ala Trp Trp Telu Asn Phe Teu Wall Ser Gly Teu Phe Ser Ile Ile Ser 260 265 27 O

Ser Ile Pro Phe Phe Phe Teu Pro Glin Thr Pro Asn Lys Pro Glin 275 280 285

Glu Arg Ala Ser Teu Ser Telu His Wall Teu Glu Thr Asn Asp Glu 29 O 295

Lys Asp Glin Thr Ala Asn Teu Thr Asn Glin Gly Lys Asn Ile Thr Lys 305 310 315 320

Asn Wall Thr Gly Phe Phe Glin Ser Phe Lys Ser Ile Teu Thr Asn Pro 325 330 335

Teu Wall Met Phe Wall Teu Telu Thr Telu Teu Glin Wall Ser Ser 340 345 35 O

Ile Gly Ala Phe Thr Tyr Wall Phe Lys Wall Glu Glin Glin Gly 355 360 365

Glin Pro Ser Ser Lys Ala Asn Ile Telu Telu Gly Wall Ile Thr Pro 370 375

Ile Phe Ala Ser Gly Met Phe Telu Gly Gly Tyr Ile Ile Phe 385 390 395 400

Telu Asn Thr Wall Gly Ile Ala Lys Phe Ser Phe Thr Ala Wall 405 410 415

Met Ser Telu Ser Phe Tyr Teu Telu Tyr Phe Phe Ile Teu Cys Glu Asn 420 425 43 O

Ser Wall Ala Gly Teu Thr Met Thr Tyr Asp Gly Asn Asn Pro Wall 435 4 40 4 45

Thr Ser His Arg Asp Wall Pro Telu Ser Tyr Asn Ser Asp Asn 450 455 460

Cys Asp Glu Ser Glin Trp Glu Pro Wall Gly Asn Asn Gly Ile Thr 465 470 475 480

Ile Ser Pro Cys Teu Ala Gly Cys Lys Ser Ser Ser Gly Asn 485 490 495

Pro Ile Wall Phe Tyr Asn Cys Ser Cys Teu Glu Wall Thr Gly Telu 5 OO 505

Glin Asn Arg Asn Tyr Ser Ala His Telu Gly Glu Pro Arg Asp Asp 515 525

Ala Cys Thr Lys Phe Tyr Phe Phe Wall Ala Ile Glin Wall Telu Asn 530 535 540

Teu Phe Phe Ser Ala Teu Gly Gly Thr Ser His Wall Met Telu Ile Wall 545 550 555 560

US 7,235,375 B2 57 58

-contin ued catcacagoc toctacgc.ca acctgctdat cggct gccitc toottocott cgg to atcgt. gggcatcgtg gtgggtgg.cg to citggtoaa gc ggctocac citgggcc citg tgggatgcgg 4 40 tg.ccctittgc Ctgctgggga tgctgctgtg cotcittctitc. agcct gcc.gc tottctititat 5 OO cggctgcticc agccaccaga ttgcgggcat cacacaccag accagtgcc.c accotgggct 560 ggagctgtct ccaagctgca tggaggcCtg citcctg.ccca ttggacggct tta accotgt citgc gacccc agc acticgtg tggaatacat cacaccotgc cacgcaggct gctcaagctg 680 ggtggtcCag gatgctctgg acaa.cago.ca ggittittctac accaactgca gctg.cgtggit 740 ggagggcaac cc.cgtgctgg caggatcc to cgacticaacg tgcago catc tggtggtgCC 800 cittcctgcto citgg to agcc tgggCtcggC cctggcc tot citcacccaca cacccticcitt 860 catgctcatc Ctalagaggag tgaagaaaga agacaag act ttggctgtgg gcatccagtt 920 catgttcctg aggattittgg cctggatgcc cago.ccc.gtg atccacggca gc gcc atcga caccacctgt gtgcactggg ccctdagctg gctgtctgtc gctactacaa 20 40 taatgacctg citc.cgaalacc ggttcatcgg cctccagttc ttcttcaaaa. caggttctgt 2100 gatctgctitc gccittagttt tggctgtc.ct gaggcagcag gacaaagagg caaggaccala 216 O agagag Caga to cagocctg cc.gtagagca gcaattgcta gtgtcggggc Cagggaagaa 2220 gccagaggat toccgagtgt gagctgtc.tt ggggcCCCaC citggccalaga gtag cagc.ca 228O cagoagtacc toctotgagt cctittgcc.ca agattgggtg totalaga.gc.cc tgttgttccat 234. O totggctoct ccactaaatt gctgttgttgac ttcaggcaaa aaaaaaaaaa. aaaaaaaaaa. 24 OO aaaaaaaaaa. aaaaaaaaaa. aaaaaaaaaa. aaaaaaaaaa. a.a. 2442

SEQ ID NO 4 LENGTH 687 TYPE PRT ORGANISM: Homo sapiens <400 SEQUENCE: 4

Met Gly Thr Glu Asn Thr Pro Gly Gly Lys Ala Ser Pro Asp Pro Glin 5 10 15

Asp Wall Arg Pro Ser W al Phe His Asn. Ile Leu Phe Wall Lieu. Cys 25 3O

His Ser Telu Leu Gln L. eu Ala Glin Leu Met Ile Ser Gly Tyr Lieu Lys 35 40 45

Ser Ser Ile Ser Thr W al Glu Lys Arg Phe Gly Teu Ser Ser Glin Thr 5 O 55 60

Ser Gly Telu Leu Ala S er Phe Asn Glu Wall Gly Asn. Thir Ala Lieu. Ile 65 70 75 8O

Wall Phe Wall Ser Tyr Phe Gly Ser Arg Val His Arg Pro Arg Met Ile 85 90 95

Gly Gly Ala Ile L. eu Wall Ala Leu Ala Gly Teu Lleu Met Thir Leu 100 105 110

Pro His Phe Ile Ser G lu Pro Tyr Arg Tyr Asp Asn. Thir Ser Pro Glu 115 120 125

Asp Met Pro Glin Asp Phe Lys Ala Ser Lieu Leu Pro Thr Thir Ser 130 135 1 4 0

Ala Pro Ala Ser Ala P ro Ser Asn Gly Asn Cys Ser Ser Tyr Thr Glu 145 1 50 155 160

Thr Glin His Leu Ser W all Val Gly Ile Met Phe Wall Ala Glin Thir Leu 1.65 170 175 US 7,235,375 B2 59 60

-continued

Teu Gly Wall Gly Gly Wall Pro Ile Glin Pro Phe Gly Ile Ser Tyr Ile 18O 185 19 O

Wall Asp Phe Ala His Asn Ser Asn Ser Pro Teu Tyr Teu Gly Ile Telu 195 200

Phe Ala Wall Thr Met Met Gly Pro Gly Telu Ala Phe Gly Telu Gly Ser 210 215 220

Teu Met Lel Arg Teu Tyr Wall Asp Ile Asn Glin Met Pro Glu Gly Gly 225 230 235 240

Ile Ser Lel Thr Ile Lys Pro Trp Wall Gly Ala Trp Trp Telu 245 250 255

Gly Phe Lel Ile Ala Ala Gly Ala Wall Ala Teu Ala Ala Ile Pro 260 265 27 O

Phe Phe Phe Pro Lys Glu Met Pro Lys Glu Arg Glu Telu Glin Phe 275 280 285

Arg Arg Wall Teu Ala Wall Thr Ser Pro Ala Arg Gly Lys 29 O 295

Asp Ser Ser Lys Glin Ser Pro Gly Glu Ser Thr Glin Asp 305 310 315 320

Gly Telu Wall Glin Ile Ala Pro Asn Telu Thr Wall Ile Glin Phe Ile 325 330 335

Wall Phe Pro Arg Wall Teu Teu Glin Thr Telu Arg His Pro Ile Phe Telu 340 345 35 O

Teu Wall Wall Telu Ser Glin Wall Cys Telu Ser Ser Met Ala Ala Gly Met 355 360 365

Ala Thr Phe Telu Pro Lys Phe Telu Glu Arg Glin Phe Ser Ile Thr Ala 370 375

Ser Ala Asn Teu Teu Ile Gly Cys Telu Ser Phe Pro Ser Wall Ile 385 390 395 400

Wall Gly Ile Wall Wall Gly Gly Wall Telu Wall Arg Teu His Telu Gly 405 410 415

Pro Wall Gly Cys Gly Ala Teu Cys Telu Telu Gly Met Teu Telu Telu 420 425 43 O

Phe Phe Ser Telu Pro Teu Phe Phe Ile Gly Cys Ser Ser His Glin Ile 435 4 40 4 45

Ala Gly Ile Thr His Glin Thr Ser Ala His Pro Gly Teu Glu Telu Ser 450 455 460

Pro Ser Met Glu Ala Cys Ser Cys Pro Teu Asp Gly Phe Asn Pro 465 470 475 480

Wall Asp Pro Ser Thr Wall Glu Tyr Ile Thr Pro His Ala 485 490 495

Gly Ser Ser Trp Wall Wall Glin Asp Ala Teu Asp Asn Ser Glin Wall 5 OO 505

Phe Thr Asn Cys Ser Cys Wall Wall Glu Gly Asn Pro Wall Telu Ala 515 525

Gly Ser Asp Ser Thr Cys Ser His Telu Wall Wall Pro Phe Telu Telu 530 535 540

Teu Wall Ser Telu Gly Ser Ala Telu Ala Teu Thr His Thr Pro Ser 545 550 555 560

Phe Met Telu Ile Teu Arg Gly Wall Lys Lys Glu Asp Thr Telu Ala 565 570 575

Wall Gly Ile Glin Phe Met Phe Telu Arg Ile Teu Ala Trp Met Pro Ser 585 59 O

Pro Wall Ile His Gly Ser Ala Ile Asp Thr Thr Wall His Trp Ala

US 7,235,375 B2 63

-continued caaaccgatt cottcacticc agtgttgttggg gcagatggca to accitacct gttctgcc to c 1680 tittgctggct gcaa.ca.gcac gaatctoacg ggctgtgcgt gccitcaccac cqtcc cit gct 1740 gagaac.gcaa cc.gtggttcc toggaaaatgc cccagtcc to ggtgccaaga ggcct tcctic 1800 acttitccitct gtgtgatgtg tatctgcago citgatcggtg ccatogcaca gacacccitca 1860 gtoatcatcc toatcaggac agt cagocct galacticaagt cittacgctitt goggagttctt 1920 tittctoctoc titcgtttgtt g g gcttcatc cctocaccoc to atctitcg g g g citggcatc 1980 gacticcacct gcc togttctg gag cacgttctgtggggagc aaggc.gc.ct g c gtcc to tac 20 40 gacaatgtgg totacic gata cotgitatgtc. agcatc.gc.ca togc.gcticaa atcctitcgc.c 2100 ttcatcctgt acaccaccac gtggcagtgc ctdaggaaaa actataaacg citacatcaaa 216 O alaccac gagg gcgggctgag caccagtgag ttctttgcct citactctgac cottagacaac 2220 citggggaggg accotgtgcc cqcaaaccag acacatagga caaagttitat citata acctg 228O galagaccatg agtggtgtga aaa.catggag toc gttittat agtgactaaa gagggctda 234. O actctgtatt agtaatccaa gogg to attitt tttcttaaaa aaagaaaaaa aggttccaaa 24 OO aaaaac caaa acticagtaca cacacacagg cacagatgca cacacacgca gacagacaca 2460 cc.gacitttgt cotttittcto agcatcagag ccagacagga titcagaataa goaga gaatg 252O acatcgtgcg gcaggg to cit ggaggccact c gogcggcto ggccacagag totactittga 258O aggcacctica toggttittcag gatgctgaca gctgcaa.gca acagg cact g c caaatticag 264 O ggaacagtgg toggccagott gaggatgga catttctgga tacacataca catacaaaac 27 OO agaaaacatt ttittaaaaga agtttccitaa aataaaaaaa ataaaaaaaa aaaaaaa 2757

<210> SEQ ID NO 6 &2 11s LENGTH 10 &212> TYPE PRT <213> ORGANISM: Homo sapiens <400 SEQUENCE: 6 Met Glin Gly Lys Lys Pro Gly Gly Ser Ser Gly Gly Gly Arg Ser Gly 1 5 10 15 Glu Lieu Glin Gly Asp Glu Ala Glin Arg Asn Lys Lys Lys Lys Lys Lys 2O 25 3O Val Ser Cys Phe Ser Asn Ile Lys Ile Phe Leu Val Ser Glu Cys Ala 35 40 45 Leu Met Leu Ala Glin Gly. Thr Val Gly Ala Tyr Leu Val Ser Val Leu 5 O 55 60 Thir Thr Lieu Glu Arg Arg Phe Asn Lieu Glin Ser Ala Asp Val Gly Val 65 70 75 8O Ile Ala Ser Ser Phe Glu Ile Gly Asn Lieu Ala Lieu. Ile Leu Phe Val 85 90 95 Ser Tyr Phe Gly Ala Arg Gly His Arg Pro Arg Lieu. Ile Gly Cys Gly 100 105 110 Gly Ile Val Met Ala Lieu Gly Ala Lieu Lleu Ser Ala Lieu Pro Glu Phe 115 120 125 Lieu. Thir His Glin Tyr Lys Tyr Glu Ala Gly Glu Ile Arg Trp Gly Ala 130 135 1 4 0 Glu Gly Arg Asp Val Cys Ala Ala Asn Gly Ser Gly Gly Asp Glu Gly 145 15 O 155 160 Pro Asp Pro Asp Lieu. Ile Cys Arg Asn Arg Thr Ala Thr Asn Met Met 1.65 170 175 US 7,235,375 B2 65 66

-continued

Telu Telu Telu Ile Gly Ala Glin Wall Telu Teu Gly Ile Gly Ala Thr 18O 185 19 O

Pro Wall Glin Pro Teu Gly Wall Ser Tyr Ile Asp Asp His Wall Arg Arg 195 200

Asp Ser Ser Teu Tyr Ile Gly Ile Telu Phe Thr Met Telu Wall Phe 210 215 220

Gly Pro Ala Gly Phe Ile Telu Gly Ser Phe Thr Ile Tyr 225 230 235 240

Wall Asp Ala Wall Phe Ile Thr Ser Asn Teu Asp Ile Thr Pro Asp 245 250 255

Asp Pro Arg Trp Ile Gly Ala Trp Trp Gly Gly Phe Teu Telu Gly 260 265 27 O

Ala Telu Telu Phe Phe Ser Ser Telu Telu Met Phe Gly Phe Pro Glin Ser 275 280 285

Teu Pro Pro His Ser Asp Pro Ala Met Glu Ser Glu Glin Ala Met Telu 29 O 295

Ser Glu Arg Glu Tyr Glu Arg Pro Lys Pro Ser Asn Gly Wall Telu Arg 305 310 315 320

His Pro Telu Glu Pro Asp Ser Ser Ala Ser Phe Glin Glin Telu Arg 325 330 335

Wall Ile Pro Lys Wall Thr Lys His Telu Telu Ser Asn Pro Wall Phe Thr 340 345 35 O

Ile Ile Telu Ala Ala Cys Met Glu Ile Ala Wall Wall Ala Gly Phe 355 360 365

Ala Ala Phe Telu Gly Lys Tyr Telu Glu Glin Glin Phe Asn Telu Thr Thr 370 375

Ser Ser Ala Asn Glin Teu Teu Gly Met Thr Ala Ile Pro Ala Cys 385 390 395 400

Teu Gly Ile Phe Teu Gly Gly Telu Telu Wall Teu Ser Telu Ser 405 410 415

Ala Telu Gly Ala Ile Met Ala Met Telu Wall Asn Teu Wall Ser Thr 420 425 43 O

Ala Tyr Wall Ser Phe Teu Phe Telu Gly Cys Asp Thr Gly Pro Wall 435 4 40 4 45

Ala Gly Wall Thr Wall Pro Tyr Gly Asn Ser Thr Ala Pro Gly Ser Ala 450 455 460

Teu Asp Pro Ser Pro Cys Asn Asn Asn Cys Glu Glin Thr Asp 465 470 475 480

Ser Phe Thr Pro Wall Cys Gly Ala Asp Gly Ile Thr Telu Ser Ala 485 490 495

Phe Ala Gly Cys Asn Ser Thr Asn Telu Thr Gly Ala Telu 5 OO 505

Thr Thr Wall Pro Ala Glu Asn Ala Thr Wall Wall Pro Gly Pro 515 525

Ser Pro Gly Cys Glin Glu Ala Phe Telu Thr Phe Teu Wall Met 530 535 540

Ile Ser Telu Ile Gly Ala Met Ala Glin Thr Pro Ser Wall Ile Ile 545 550 555 560

Teu Ile Arg Thr Wall Ser Pro Glu Telu Lys Ser Ala Telu Gly Wall 565 570 575

Teu Phe Telu Telu Teu Teu Telu Gly Phe Ile Pro Pro Pro Telu Ile 585 59 O

Phe Gly Ala Gly Ile Ser Thr Cys Telu Phe Trp Ser Thr Phe

US 7,235,375 B2 71

-continued gaatttgtct caactatoca atttgattgg aaaaatgitat gtgcago atg ttacatttac 3660 tittcacggaa taaag.cagat atgtttctga aa 3692

<210 SEQ ID NO 8 &2 11s LENGTH 848 &212> TYPE PRT <213> ORGANISM: Homo sapiens &220s FEATURE <221 NAME/KEY: PEPTIDE <222> LOCATION: (33) &223> OTHER INFORMATION Xaa Leu or Phe &220s FEATURE <221 NAME/KEY: PEPTIDE <222> LOCATION: (.594) &223> OTHER INFORMATION Xaa Gly or Val <400 SEQUENCE: 8 Met Asp Glu Gly Thr Gly Lieu Gln Pro Gly Ala Gly Glu Glin Leu Glu 1 5 10 15 Ala Pro Ala Thr Ala Glu Ala Val Glin Glu Arg Cys Glu Pro Glu Thr 2O 25 3O Xaa Arg Ser Lys Ser Lieu Pro Val Lieu Ser Ser Ala Ser Cys Arg Pro 35 40 45 Ser Leu Ser Pro Thr Ser Gly Asp Ala Asn Pro Ala Phe Gly Cys Val 5 O 55 60 Asp Ser Ser Gly His Glin Glu Lieu Lys Glin Gly Pro Asn Pro Leu Ala 65 70 75 8O Pro Ser Pro Ser Ala Pro Ser Thr Ser Ala Gly Leu Gly Asp Cys Asn 85 90 95 His Arg Val Asp Leu Ser Lys Thr Phe Ser Val Ser Ser Ala Lieu Ala 100 105 110 Met Leu Glin Glu Arg Arg Cys Lieu. Tyr Val Val Lieu. Thir Asp Ser Arg 115 120 125 Cys Phe Leu Val Cys Met Cys Phe Leu Thr Phe Ile Glin Ala Leu Met 130 135 1 4 0 Val Ser Gly Tyr Leu Ser Ser Val Ile Thr Thr Ile Glu Arg Arg Tyr 145 15 O 155 160 Ser Lieu Lys Ser Ser Glu Ser Gly Lieu Lieu Val Ser Cys Phe Asp Ile 1.65 170 175 Gly Asn Leu Val Val Val Val Phe Val Ser Tyr Phe Gly Gly Arg Gly 18O 185 19 O Arg Arg Pro Leu Trp Lieu Ala Val Gly Gly Lieu Lieu. Ile Ala Phe Gly 195 200 2O5 Ala Ala Leu Phe Ala Leu Pro His Phe Ile Ser Pro Pro Tyr Glin Ile 210 215 220 Glin Glu Lieu. Asn Ala Ser Ala Pro Asn Asp Gly Lieu. Cys Glin Gly Gly 225 230 235 240 Asn Ser Thr Ala Thr Lieu Glu Pro Pro Ala Cys Pro Lys Asp Ser Gly 245 250 255 Gly Asn. Asn His Trp Val Tyr Lieu Ala Lieu Phe Ile Cys Ala Glin Ile 260 265 27 O Leu Ile Gly Met Gly Ser Thr Pro Ile Tyr Thr Leu Gly Pro Thr Tyr 275 280 285 Leu Asp Asp Asn. Wall Lys Lys Glu Asn. Ser Ser Leu Tyr Lieu Ala Ile 29 O 295 3OO Met Tyr Val Met Gly Ala Leu Gly Pro Ala Val Gly Tyr Leu Leu Gly US 7,235,375 B2 73 74

-continued

305 310 315 320

Gly Telu Telu Ile Gly Phe Wall Asp Pro Arg Asn Pro Wall His Telu 325 330 335

Asp Glin Asn Asp Pro Phe Ile Gly Asn Trp Trp Ser Gly Phe Telu 340 345 35 O

Teu Ala Ile Ala Met Phe Telu Wall Ile Phe Pro Met Phe Thr Phe 355 360 365

Pro Lys Telu Pro Pro Arg His Lys Lys Phe 370 375

Ser Wall Asp Ala Wall Ser Asp Asp Asp Wall Teu Glu Ser Asn 385 390 395 400

Asn Ser Glu Glin Ala Asp Lys Wall Ser Ser Met Gly Phe Gly Lys 405 410 415

Asp Wall Arg Asp Teu Pro Arg Ala Ala Wall Arg Ile Teu Ser Asn Met 420 425 43 O

Thr Phe Telu Phe Wall Ser Teu Ser Tyr Thr Ala Glu Ser Ala Ile Wall 435 4 40 4 45

Thr Ala Phe Ile Thr Phe Ile Pro Lys Phe Ile Glu Ser Glin Phe Gly 450 455 460

Ile Pro Ala Ser Asn Ala Ser Ile Tyr Thr Gly Wall Ile Ile Wall Pro 465 470 475 480

Ser Ala Gly Wall Gly Ile Wall Telu Gly Gly Tyr Ile Ile Lys Telu 485 490 495

Telu Gly Ala Arg Glu Ser Ala Lys Telu Ala Met Ile Cys Ser Gly 5 OO 505

Wall Ser Telu Telu Cys Phe Ser Thr Telu Phe Ile Wall Gly Cys Glu Ser 515 525

Ile Asn Telu Gly Gly Ile Asn Ile Pro Thr Thr Gly Pro Ser Telu 530 535 540

Thr Met Pro His Asn Teu Thr Gly Ser Cys Asn Wall Asn Gly 545 550 555 560

Ile His Glu Tyr Glu Pro Wall Cys Gly Ser Asp Gly Ile Thr 565 570 575

Phe Asn Pro Cys Teu Ala Gly Cys Wall Asn Ser Gly Asn Telu Ser 585 59 O

Thr Xaa Ile Arg Asn Tyr Thr Glu Cys Thr Wall Glin Ser Arg Glin 595 600 605

Wall Ile Thr Pro Pro Thr Wall Gly Glin Arg Ser Glin Teu Arg Wall Wall 610 615

Ile Wall Thr Tyr Teu Asn Glu Asn Gly Tyr Ala Wall Ser Gly Lys 625 630 635 640

Arg Thr Cys Asn Thr Telu Ile Pro Phe Teu Wall Phe Telu Phe 645 650 655

Ile Wall Thr Phe Ile Thr Ala Cys Ala Glin Pro Ser Ala Ile Ile Wall 660 665 67 O

Thr Telu Arg Ser Wall Glu Asp Glu Glu Arg Pro Phe Ala Telu Gly Met 675 680 685

Glin Phe Wall Telu Teu Thr Telu Ala Ile Pro Thr Pro Ile 69 O. 695 7 OO

Phe Gly Ala Wall Ile Asp Thr Thr Cys Met Teu Trp Glin Glin Glu Cys 705 710 715 720

Gly Wall Glin Gly Ser Cys Trp Glu Tyr Asn Wall Thr Ser Phe Arg Phe 725 730 735 US 7,235,375 B2 75 76

-contin ued

Val Tyr Phe Gly Lieu Ala Ala Gly Lieu Lys Phe Val Gly Phe Ile Phe 740 745 750

Ile Phe Leu Ala Trp Tyr Ser Ile Lys Tyr Lys Glu Asp Gly Leu Glin 755 760 765

Arg Arg Arg Glin Arg Glu Phe Pro Leu Ser Thr Wal Ser Glu Arg Val 770 775 78O

Gly His Pro Asp Asn Ala Arg Thr Arg Ser Cys Pro Ala Phe Ser Thr 785 790 795 8OO Glin Gly Glu Phe His Glu Glu Thr Gly Lieu Glin Lys Gly Ile Glin Cys 805 810 815

Ala Ala Glin Thr Tyr Pro Gly Pro Phe Pro Glu Ala Ile Ser Ser Ser 820 825

Ala Asp Pro Gly Lieu Glu Glu Ser Pro Ala Ala Leu Glu Pro Pro Ser 835 840 845

<210 SEQ ID NO 9 &2 11s LENGTH 3381 &212> TYPE DNA <213> ORGANISM: Homo sapiens <400 SEQUENCE: 9 cgcaaagaaa tggctoaaaa gcttcagotc tittctgtgcc Ctgggagctg agatgcacgt. 60 cagtggccitt gcc agcgtgg ccalattctot gctgact gcc agaaaaaaga ggcCaggaag 120 aaagaggaaa gagalagagat cgctcagggg tgagaccatg ccott Catct titt cittittoc 18O citaatctoct citgcttgttgt coaccacao totcc.ccacc tggcaaaatt gttcaaaatt 240 gctgtggagt ttacctcagt titcc tott to agtctgtggit gtgtggtoca tactcittgct gag cacattg aaaggaactg gctatotttg atctott cost ccagatcaga gtoaaggaat 360 gtgtttataa tggacactitc atccaaagaa aat atccagt tgttctgcaa aactticagtg 420 caac citgttg gaaggcct to ttittaaaa.ca gaatatocct cct caga aga aaagcaacca 480 tgctgtggtg aactaaaggit gttcttgttgt gccttgttctt ttgtttactt tgccaaag.ca 540 ttgg Cagaag gctatotgaa gag caccatc acticagatag agaga aggtt tgatatocct 600 tottcactgg tgggagittat tgatgg tagt tittgaaattg ggaatctott agittataa.ca 660 tttgttagct actittggagc caaactitcac aggccaaaaa taattggagc agggtgtgta 720 atcatgggag ttggalacact gct cattgca atgccitcagt tottcatgga gcagtacaaa tatgagagat attotoctitc. citccalatt.cc. actictoag.ca totctocqtg totcc tagag 840 toaa.gcagtc aattaccagt ttcagttatg gaaaaatcaa aatccaaaat aagtaac gala 9 OO tgttgaagtgg acactagotc titc catgtgg atttatgttt to citgggcaa. tottctitcgt 96.O ggaataggag aaactic coat tdag cctttg ggcattgcct acctggatga ttittgccagt O20 galagacaatg cagotttcta tattgggtgt gtgcagacgg ttgcaattat aggaccaatc tittggitttcc tgttaggotc attatgttgcc aaactatatg ttgacattgg citttgtaaac 14 O citagat caca talaccattac cc caaaagat CCC cagtggg taggagcctg gtggCttggc 200 tatctaatag caggaatcat aagttcttctt gcagotgtgc citttctggta tttaccaaag 260 agtttaccala gatcc.caaag tagagaggat totaatticitt ccitctgagaa atccaagttt 320 attatagatg atcacacaga citaccalaa.ca CCC Cagg gag aaaatgcaaa aataatggaa atggcaa.gag attittctitcc. atc actogaag aatctttittg gaaac coagt a tact tcc ta. 4 40 tatttatgta caag cactgt tdagttcaat totctgttcg gcatggtgac gtacaaacca 5 OO US 7,235,375 B2 77 78

-continued aagtacattg agcago agta tggacagtica to citcCaggg ccaactttgt gatcgggctic 1560 atcaa.cattc. CagcagtggC ccittggaata ttctotgggg ggatagittat gaaaaaattic 1620 agaatcagtg tgttgtggagc tgcaaaactc tacttgg gat catctgtctt tggittacctc 1680 citatittctitt ccctgtttgc actgggctgt gaaaattctg atgtggCagg actaactgtc 1740 toctaccaag galaccaaacc tgtctottat catgaac gag citc.tottt to agattgcaac 1800 to aagatgca aatgttcaga gacaaaatgg galacc catgt gCggtgaaaa tggaatcaca 1860 tatgtatcag cittgttcttgc tggttgttcaa accitccaa.ca ggagtggaala aaatattata 1920 titttacaact gcacttgttgt gggaattgca gcttctaaat cc.ggaaattic citcaggcata 1980 gtgggalagat gtoagaaaga caatggatgt ccccaaatgt ttctgtattt ccttgtaatt 20 40 tdag to atca catccitatac tittatcc.cta ggtgg catac citggatacat attacittctg 2100 aggtgcatta agccacagot taagttcttitt gcc ttgggta totacacatt agcaataaga 216 O gttcttgcag gaatcc cago tdcagtgitat tittggagittt tgattgatac ttcatgcctc 2220 aaatggggat ttaaaagatg tggaagtaga ggatcatgca gattatatga ttcaaatgtc 228O ttcaga cata tatatttggg actaactgtg atactgggca cagtgtcaat totcctaagc 234. O attgcagtac titt to attitt aaagaaaaat tatgtttcaa aacacagaag ttittatalacc 24 OO alaga.gaga aa gaacaatggit gtotacaaga titccaaaagg aaaattacac tacaagtgat 2460 catctgctac aac Coalacta CtggcCaggC aaggaaactc aactittagaa acatgatgac 252O tggaagitcat gtottctaat tggttgacat tittgcaaaca aataaattgt aatcaaaaga 258O gctctaaatt tgtaatttct titotoctitto aaaaaatgtc tactttgttt tggtoctagg 264 O cattaggtaa tataactgat aatatact ga aatatataat ggalagatgca gatgataaaa 27 OO ctaattittga actittittaat ttatatalaat tattittatat catttactita titt cactitta 276 O. ttittgctttg tgctcattga tatatattag citgtacticct agaagaacaa ttgttctotat 282O tgtcacacat ggittatattt aaagtaattit citgaactgtg taatgtgtct agagtaagca 2880 aatact gcta acaattalact cataccttgg gttccittcaa gtattacticc tatag tattt 2.940 totcccatag citgtcttcat citgtgitatitt taataatgat cittaggatgg agcagaacat ggagaggaag attitCattitt aagctcctcc tttitccttga aatacaataa. tittatataga 3060 aatgttgtagc agcaaattat attggggatt agaattittga attaatagot citcc tactat 312 O taatttacat gtgctttittg tgtgg.cgcta taagtgacta tggttgtaaa gtaataaaat 318O tgatgttaac atgcccaatt attgttctitt tatgaattca atgaatttaa aactattgtt 324 O aaatataata ctg.ccccact ttaatatatg taagcaactt cc tactitata cacgacgtgt toctaaaa.ca tgtttgaaag gtgaatttct gaaagtc.tcc cataaatgta ggtgttacaa 3360 caggaaaaaa aaaaaaaaaa. a. 3381

<210> SEQ ID NO 10 &2 11s LENGTH 712 &212> TYPE PRT <213> ORGANISM: Homo sapiens <400 SEQUENCE: 10 Met Asp Thr Ser Ser Lys Glu Asn Ile Gln Leu Phe Cys Lys Thr Ser 1 5 10 15 Val Glin Pro Val Gly Arg Pro Ser Phe Lys Thr Glu Tyr Pro Ser Ser 25 US 7,235,375 B2 79 80

-continued

Glu Glu Lys Glin Pro Cys Cys Gly Glu Telu Wall Phe Telu Cys Ala 35 40 45

Teu Ser Phe Wall Tyr Phe Ala Lys Ala Telu Ala Glu Gly Tyr Telu 5 O 55 60

Ser Thr Ile Thr Glin Ile Glu Phe Asp Ile Pro Ser Ser Telu 65 70 75

Wall Gly Wall Ile Asp Gly Ser Phe Glu Ile Gly Asn Teu Telu Wall Ile 85 90 95

Thr Phe Wall Ser Tyr Phe Gly Ala Lys Telu His Arg Pro Lys Ile Ile 100 105 110

Gly Ala Gly Cys Wall Ile Met Gly Wall Gly Thr Teu Teu Ile Ala Met 115 120 125

Pro Glin Phe Phe Met Glu Glin Tyr Lys Glu Arg Ser Pro Ser 130 135 1 4 0

Ser Asn Ser Thr Teu Ser Ile Ser Pro Teu Teu Ser Ser Ser 145 15 O 155 160

Glin Telu Pro Wall Ser Wall Met Glu Lys Ser Ser Ile Ser Asn 1.65 170 175

Glu Glu Wall Asp Thr Ser Ser Ser Met Trp Ile Wall Phe Telu 18O 185 19 O

Gly Asn Telu Telu Gly Ile Gly Glu Thr Pro Ile Glin Pro Telu Gly 195 200

Ile Ala Telu Asp Asp Phe Ala Ser Glu Asp Asn Ala Ala Phe 210 215 220

Ile Gly Cys Wall Glin Thr Wall Ala Ile Ile Gly Pro Ile Phe Gly Phe 225 230 235 240

Teu Telu Gly Ser Teu Ala Lys Telu Tyr Wall Asp Ile Gly Phe Wall 245 250 255

Asn Telu Asp His Ile Thr Ile Thr Pro Asp Pro Glin Trp Wall Gly 260 265 27 O

Ala Trp Trp Telu Gly Tyr Teu Ile Ala Gly Ile Ile Ser Telu Telu Ala 275 280 285

Ala Wall Pro Phe Trp Teu Pro Lys Ser Teu Pro Arg Ser Glin Ser 29 O 295

Arg Glu Asp Ser Asn Ser Ser Ser Glu Ser Phe Ile Ile Asp 305 310 315 320

Asp His Thr Asp Tyr Glin Thr Pro Glin Gly Glu Asn Ala Ile Met 325 330 335

Glu Met Ala Arg Asp Phe Teu Pro Ser Telu Asn Teu Phe Gly Asn 340 345 35 O

Pro Wall Tyr Phe Teu Teu Cys Thr Ser Wall Glin Phe Asn Ser 355 360 365

Teu Phe Gly Met Wall Thr Tyr Lys Pro Ile Glu Glin Glin 370 375

Gly Glin Ser Ser Ser Arg Ala Asn Phe Wall Ile Gly Teu Ile Asn Ile 385 390 395 400

Pro Ala Wall Ala Teu Gly Ile Phe Ser Gly Gly Ile Wall Met Lys 405 410 415

Phe Arg Ile Ser Wall Cys Gly Ala Ala Teu Teu Gly Ser Ser 420 425 43 O

Wall Phe Gly Tyr Teu Teu Phe Telu Ser Telu Phe Ala Teu Gly Glu 435 4 40 4 45

Asn Ser Asp Wall Ala Gly Teu Thr Wall Ser Glin Gly Thr Pro US 7,235,375 B2 81 82

-continued

450 455 460

Val Ser Tyr His Glu Arg Ala Lieu Phe Ser Asp Cys Asn Ser Arg Cys 465 470 475 480

Lys Cys Ser Glu Thir Lys Trp Glu Pro Met Cys Gly Glu Asn Gly Ile 485 490 495

Thr Tyr Val Ser Ala Cys Lieu Ala Gly Cys Glin Thr Ser Asn Arg Ser 5 OO 505

Gly Lys Asn Ile Ile Phe Tyr Asn Cys Thr Cys Wall Gly Ile Ala Ala 515 525

Ser Lys Ser Gly Asn. Ser Ser Gly Ile Wall Gly Arg Glin 530 535 540

Asn Gly Cys Pro Gln Met Phe Leu Tyr Phe Teu Wall Ile Ser Wall Ile 545 550 555 560

Thir Ser Tyr Thir Lieu Ser Leu Gly Gly Ile Pro Gly Tyr Ile Telu Telu 565 570 575

Leu Arg Cys Ile Lys Pro Glin Lieu Lys Ser Phe Ala Teu Gly Ile Tyr 585 59 O

Thir Leu Ala Ile Arg Val Lieu Ala Gly Ile Pro Ala Pro Wall 595 600 605

Gly Val Lieu Ile Asp Thr Ser Cys Lieu Lys Trp Gly Phe Arg Cys 610 615

Gly Ser Arg Gly Ser Cys Arg Lieu Tyr Asp Ser Asn Wall Phe Arg His 625 630 635 640

Ile Tyr Leu Gly Leu Thr Val Ile Leu Gly Thr Wall Ser Ile Telu Telu 645 650 655

Ser Ile Ala Wall Leu Phe Ile Leu Lys Lys Asn Wall Ser Lys His 660 665 67 O

Arg Ser Phe Ile Thr Lys Arg Glu Arg Thr Met Wall Ser Thr Arg Phe 675 680 685

Glin Lys Glu Asn Tyr Thr Thr Ser Asp His Teu Teu Glin Pro Asn Tyr 69 O. 695 7 OO Trp Pro Gly Lys Glu Thr Glin Lieu 705 710

<210> SEQ ID NO 11 &2 11s LENGTH 2763 &212> TYPE DNA <213> ORGANISM: Homo sapiens <400 SEQUENCE: 11 ggCacgaggc gctg.cgcggC gCggcggcc.g ggCCCtc gag acggggacgg acacaccago 60 cc citcggata ccacttggcc acticcc.gctg aggcc actoc cactg.cgtgg citgaa.gc.ctic 120 gagg to acca gg.cggaggcg CggagatgcC cctgcatcag Ctgggggaca agcc.gct cac 18O cittccc.cago cc caactcag ccatggaaaa cgggcttgac cacao occac C Cagcaggag 240 ggcatc.ccc.g ggcacacccc tgagcc.ccgg gtoccitcc.gc atagocccct ggacaccago aag cago.ccc totgccagot CtgggCC gag aag catggCg CCC gggggac 360 ccatgaggtg cggtacgt.ct Cggc.cgggca gag.cgtggcg tgcggctggit gggcc titc.gc 420 accgc.cgtgc citgcaggtoc totalacacgcc caagggcatc citgttctitcc tgttgttgcggC 480 cgcattcctg Caggggatga citgtgaatgg cittcatcaac acagt catca cct coct gga 540 gc gcc.gctat gacctgcaca gctaccagag cgggctdatc gcc agcticct acgacattgc 600 cgcctgccitc tgcctdacct togtoagcta Cttcgggggc to agggcaca 660

US 7,235,375 B2 85 86

-continued <400 SEQUENCE: 12

Met Pro Leu. His Glin Teu Gly Lys Pro Teu Thr Phe Pro Ser Pro 1 5 10 15

Asn Ser Ala Met Glu Asn Gly Telu Asp His Thr Pro Pro Ser Arg Arg 25

Ala Ser Pro Gly Thr Pro Teu Ser Pro Gly Ser Teu Arg Ser Ala Ala 35 40 45

His Ser Pro Telu Asp Thr Ser Lys Glin Pro Teu Cys Glin Telu Trp Ala 5 O 55 60

Glu His Gly Ala Arg Gly Thr His Glu Wall Arg Wall Ser Ala 65 70 75

Gly Glin Ser Wall Ala Cys Gly Trp Trp Ala Phe Ala Pro Pro Cys Telu 85 90 95

Glin Wall Telu Asn Thr Pro Lys Gly Ile Telu Phe Phe Teu Cys Ala Ala 100 105 110

Ala Phe Telu Glin Gly Met Thr Wall Asn Gly Phe Ile Asn Thr Wall Ile 115 120 125

Thr Ser Telu Glu Tyr Asp Telu His Ser Tyr Glin Ser Gly Telu 130 135 1 4 0

Ile Ala Ser Ser Tyr Asp Ile Ala Ala Teu Teu Thr Phe Wall 145 15 O 155 160

Ser Phe Gly Gly Ser Gly His Lys Pro Arg Trp Teu Gly Trp Gly 1.65 170 175

Wall Telu Telu Met Gly Thr Gly Ser Telu Wall Phe Ala Teu Pro His Phe 18O 185 19 O

Thr Ala Gly Arg Tyr Glu Wall Glu Telu Asp Ala Gly Wall Arg Thr 195 200

Pro Ala Asn Pro Gly Ala Wall Cys Ala Asp Ser Thr Ser Gly Telu Ser 210 215 220

Arg Glin Telu Wall Phe Met Telu Gly Glin Phe Teu His Gly Wall Gly 225 230 235 240

Ala Thr Pro Telu Tyr Thr Teu Gly Wall Thr Teu Asp Glu Asn Wall 245 250 255

Ser Ser Cys Ser Pro Wall Tyr Ile Ala Ile Phe Thr Ala Ala 260 265 27 O

Ile Telu Gly Pro Ala Ala Gly Tyr Telu Ile Gly Gly Ala Telu Telu Asn 275 280 285

Ile Tyr Thr Glu Met Gly Arg Arg Thr Glu Teu Thr Thr Glu Ser Pro 29 O 295

Teu Trp Wall Gly Ala Trp Trp Wall Gly Phe Teu Gly Ser Gly Ala Ala 305 310 315 320

Ala Phe Phe Thr Ala Wall Pro Ile Telu Gly Tyr Pro Arg Glin Telu Pro 325 330 335

Gly Ser Glin Arg Tyr Ala Wall Met Arg Ala Ala Glu Met His Glin Telu 340 345 35 O

Asp Ser Ser Gly Glu Ala Ser Asn Pro Asp Phe Gly Thr 355 360 365

Ile Arg Asp Telu Pro Teu Ser Ile Trp Telu Teu Teu Asn Pro Thr 370 375

Phe Ile Telu Telu Cys Teu Ala Gly Ala Thr Glu Ala Thr Telu Ile Thr 385 390 395 400

Gly Met Ser Thr Phe Ser Pro Lys Phe Telu Glu Ser Glin Phe Ser Telu 405 410 415 US 7,235,375 B2 87

-continued

Ser Ala Ser Glu Ala Ala Thr Leu Phe Gly Tyr Leu Val Val Pro Ala 420 425 43 O Gly Gly Gly Gly Thr Phe Leu Gly Gly Phe Phe Val Asn Lys Lieu Arg 435 4 40 4 45 Leu Arg Gly Ser Ala Val Ile Llys Phe Cys Leu Phe Cys Thr Val Val 450 455 460 Ser Leu Leu Gly Ile Leu Val Phe Ser Leu. His Cys Pro Ser Val Pro 465 470 475 480 Met Ala Gly Val Thr Ala Ser Tyr Gly Gly Ser Leu Leu Pro Glu Gly 485 490 495 His Lieu. Asn Lieu. Thr Ala Pro Cys Asn Ala Ala Cys Ser Cys Glin Pro 5 OO 505 51O. Glu His Tyr Ser Pro Val Cys Gly Ser Asp Gly Leu Met Tyr Phe Ser 515 52O 525 Lieu. Cys His Ala Gly Cys Pro Ala Ala Thr Glu Thr Asn. Wall Asp Gly 530 535 540 Glin Lys Val Tyr Arg Asp Cys Ser Cys Ile Pro Glin Asn Lieu Ser Ser 545 550 555 560 Gly Phe Gly His Ala Thr Ala Gly Lys Cys Thr Ser Thr Cys Glin Arg 565 570 575 Lys Pro Leu Leu Leu Val Phe Ile Phe Val Val Ile Phe Phe Thr Phe 58O 585 59 O Leu Ser Ser Ile Pro Ala Lieu. Thir Ala Thr Lieu Arg Cys Val Arg Asp 595 600 605 Pro Glin Arg Ser Phe Ala Leu Gly Ile Glin Trp Ile Val Val Arg Ile 610 615 62O Leu Gly Gly Ile Pro Gly Pro Ile Ala Phe Gly Trp Val Ile Asp Lys 625 630 635 640 Ala Cys Lieu Lleu Trp Glin Asp Glin Cys Gly Glin Glin Gly Ser Cys Lieu 645 650 655 Val Tyr Glin Asn Ser Ala Met Ser Arg Tyr Ile Leu Ile Met Gly Leu 660 665 67 O Leu Tyr Lys Val Lieu Gly Val Lieu Phe Phe Ala Ile Ala Cys Phe Lieu 675 680 685 Tyr Lys Pro Leu Ser Glu Ser Ser Asp Gly Lieu Glu Thir Cys Lieu Pro 69 O. 695 7 OO Ser Glin Ser Ser Ala Pro Asp Ser Ala Thr Asp Ser Glin Leu Glin Ser 705 710 715 720

Ser Wall

<210> SEQ ID NO 13 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Homo sapiens <400 SEQUENCE: 13 accotgtcta gcaggttgca

<210> SEQ ID NO 14 &2 11s LENGTH 19 &212> TYPE DNA <213> ORGANISM: Homo sapiens <400 SEQUENCE: 14 citgtcggagt cittcagatg US 7,235,375 B2 89 90

-continued

<210 SEQ ID NO 15 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Homo sapiens

<400 SEQUENCE: 15 to catcacag cotcctacgc 20

<210> SEQ ID NO 16 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Homo sapiens

<400 SEQUENCE: 16 tgccitctact citg accotag 20

<210 SEQ ID NO 17 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Homo sapiens

<400 SEQUENCE: 17 ggag cagtica ttgacaccac 20

<210> SEQ ID NO 18 <211 LENGTH 21 &212> TYPE DNA <213> ORGANISM: Homo sapiens

<400 SEQUENCE: 18 tgctgggagt acaacgtgac g 21

<210 SEQ ID NO 19 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Homo sapiens

<400 SEQUENCE: 19 acaaggagga tigactgcag 20

<210> SEQ ID NO 20 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Homo sapiens

<400 SEQUENCE: 20 caggaatc.cc agotccagtg 20

<210> SEQ ID NO 21 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Homo sapiens

<400 SEQUENCE: 21 gctaca acco alactactggc 20

<210> SEQ ID NO 22 &2 11s LENGTH 2.0 US 7,235,375 B2 91 92

-continued

&212> TYPE DNA <213> ORGANISM: Homo sapiens <400 SEQUENCE: 22 gggactaact gtgatactgg 20

10 We claim: (c) determining the presence of said compound inside the 1. A method of identifying a compound that is transported cell expressing OATP2 protein and inside the cell that by an OATP2 (organic anion transport protein 2) protein lacks OATP2 protein, comprising the amino acid sequence of SEQID NO: 2, said wherein the presence or a greater quantity of said com method comprising the steps of 15 (a) contacting a cell expressing OATP2 protein with said pound inside the cell expressing OATP2 protein as compound, under conditions which permit the move compared to the cell that lacks OATP2 protein indicates ment of said compound across the cell membrane; said compound is transported by OATP2. (b) contacting a control cell that lacks OATP2 protein with said compound, under said conditions of step (a): and