DOCSLIB.ORG

Non-Hodgkin and Hodgkin Lymphomas Select for Overexpression of BCLW Clare M

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Non-Hodgkin and Hodgkin Lymphomas Select for Overexpression of BCLW Clare M Published OnlineFirst August 29, 2017; DOI: 10.1158/1078-0432.CCR-17-1144 Biology of Human Tumors Clinical Cancer Research Non-Hodgkin and Hodgkin Lymphomas Select for Overexpression of BCLW Clare M. Adams1, Ramkrishna Mitra1, Jerald Z. Gong2, and Christine M. Eischen1 Abstract Purpose: B-cell lymphomas must acquire resistance to apopto- follicular, mantle cell, marginal zone, and Hodgkin lymphomas. sis during their development. We recently discovered BCLW, an Notably, BCLW was preferentially overexpressed over that of antiapoptotic BCL2 family member thought only to contribute to BCL2 and negatively correlated with BCL2 in specific lymphomas. spermatogenesis, was overexpressed in diffuse large B-cell lym- Unexpectedly, BCLW was overexpressed as frequently as BCL2 in phoma (DLBCL) and Burkitt lymphoma. To gain insight into the follicular lymphoma. Evaluation of all five antiapoptotic BCL2 contribution of BCLW to B-cell lymphomas and its potential to family members in six types of B-cell lymphoma revealed that confer resistance to BCL2 inhibitors, we investigated the expres- BCL2, BCLW, and BCLX were consistently overexpressed, whereas sion of BCLW and the other antiapoptotic BCL2 family members MCL1 and A1 were not. In addition, individual lymphomas in six different B-cell lymphomas. frequently overexpressed more than one antiapoptotic BCL2 Experimental Design: We performed a large-scale gene family member. expression analysis of datasets comprising approximately Conclusions: Our comprehensive analysis indicates B-cell 2,300 lymphoma patient samples, including non-Hodgkin lymphomas commonly select for BCLW overexpression in andHodgkinlymphomasaswellasindolentandaggressive combination with or instead of other antiapoptotic BCL2 lymphomas. Data were validated experimentally with qRT- family members. Our results suggest BCLW may be equally as PCR and IHC. important in lymphomagenesis as BCL2 and that targeting Results: We report BCLW is significantly overexpressed in BCLW in lymphomas should be considered. Clin Cancer Res; aggressive and indolent lymphomas, including DLBCL, Burkitt, 23(22); 7119–29. Ó2017 AACR. Introduction lymphoma and DLBCL, Burkitt lymphoma, an aggressive lym- phoma, express low/undetectable levels of BCL2, which is part Lymphomas, as with all human cancers, select for alterations of its diagnostics (6). We recently discovered that Burkitt that inhibit apoptosis, allowing them to survive during trans- lymphomas frequently overexpress BCLW, an antiapoptotic formation (1). The BCL2 family of proteins consists of anti- BCL2 family member that was initially reported to only func- apoptotic (BCL2, BCLX/BCL2L1, BCLW/BCL2L2, MCL1, and tion in spermatogenesis (7–9). Targeting BCLW with shRNA or A1/BFL1) and proapoptotic proteins that regulate cell death pharmacologically with BH3-mimetics induced apoptosis in and have been linked to many human cancers, including Burkitt lymphoma cell lines, indicating BCLW was required for lymphomas (2). its survival (9). When overexpressed, BCLW conferred resis- BCL2 translocation to the immunoglobulin locus, leading to tance to BH3-mimetics (9). We also showed that DLBCL BCL2 overexpression, is a defining feature of the non-Hodgkin frequently overexpresses BCLW alone or in combination with indolent lymphoma follicular lymphoma (3). Diffuse large BCL2, and that increased levels of BCLW in patient samples B-cell lymphoma (DLBCL), an aggressive lymphoma, can also with low BCL2 expression correlated with reduced patient overexpress BCL2 (4). Thirty percent of de novo DLBCL have survival (9). Therefore, BCLW is a previously unappreciated, BCL2 translocations and/or increased protein expression (5), significant contributor to Burkitt lymphoma and DLBCL, but its correlating with reduced survival (4). In contrast with follicular involvement in other B-cell lymphomas is unknown. There are multiple different aggressive and indolent B-cell lymphoma subtypes, but the contribution of BCLW and other 1Department of Cancer Biology, Sidney Kimmel Cancer Center, Thomas Jeffer- son University, Philadelphia, Pennsylvania. 2Department of Pathology, Anatomy, antiapoptotic BCL2 family members to them is unclear. It is and Cell Biology, Thomas Jefferson University, Philadelphia, Pennsylvania. reported that there is increased expression of BCL2 and BCLX in a small subset of mantle cell lymphoma (an aggressive lympho- Note: Supplementary data for this article are available at Clinical Cancer Research Online (http://clincancerres.aacrjournals.org/). ma), whereas MCL1 expression is typically low (10). BCL2 levels can be elevated in marginal zone lymphomas, which are indolent C.M. Adams and R. Mitra contributed equally to the article. (4). Increased levels of BCLX were identified in the majority of Corresponding Author: Christine M. Eischen, Thomas Jefferson University, 233 Hodgkin lymphomas, but are not part of its diagnostics (11). South 10th Street, Bluemle Life Science Building, Philadelphia, PA 19107. Phone: Therefore, unlike follicular lymphoma and DLBCL, other B-cell 215-503-3712; Fax: 215-503-6109; E-mail: [email protected] lymphomas have not been linked to alterations in specific anti- doi: 10.1158/1078-0432.CCR-17-1144 apoptotic BCL2 family members, which may be due to the lack Ó2017 American Association for Cancer Research. of a comprehensive analysis of these genes/proteins in these www.aacrjournals.org 7119 Downloaded from clincancerres.aacrjournals.org on September 27, 2021. © 2017 American Association for Cancer Research. Published OnlineFirst August 29, 2017; DOI: 10.1158/1078-0432.CCR-17-1144 Adams et al. measured using unpaired, two-tailed t tests as indicated. All Translational Relevance analyses were carried out in R, version 3.2.3. With clinical trials on-going for BCL2-specific inhibitors for the treatment of lymphomas and BCLX- and MCL1- Survival analysis specific inhibitors being developed, there is a critical need Gene expression profiles and patient clinicopathologic infor- for increased knowledge of the expression of antiapoptotic mation for DLBCL were extracted from the GEO database BCL2 family members in lymphomas to identify those most (GSE10846 and GSE31312). Data were normalized and probe likely to respond to specific inhibitors. Our study, the first sets averaged as explained above. Patient samples were simulta- large-scale analysis of all antiapoptotic BCL2 family mem- neously stratified on the basis of the median expression of BCL2 bers in six types of B-cell lymphomas (non-Hodgkin and and BCLW into high or low expression groups for each gene. Then, Hodgkin), reveals B-cell lymphomas typically overexpress patients with low BCL2 expression were identified and Kaplan– more than one. Moreover, BCLW, a previously uncharacter- Meier overall survival curves plotted for the high and low BCLW ized antiapoptotic BCL2 family member, was frequently expression groups and compared using the log-rank test. overexpressed. Specific lymphomas preferentially selected for BCLW overexpression over that of BCL2. Notably, Patient sample acquisition BCLW was overexpressed in follicular lymphoma, indicat- Patient samples of formalin-fixed, paraffin-embedded (FFPE) ing it likely has a role in this lymphoma. Our results suggest sections were obtained from archival pathologic specimens targeting BCLW in B-cell lymphomas may be needed alone at Thomas Jefferson University with approval from the Institu- or in combination with other specific BCL2 family inhibi- tional Review Board. Thirty follicular lymphomas, 10 marginal tors, as targeting just one may lead to dependence on zone lymphomas, 14 mantle cell lymphomas, 26 Hodgkin another resulting in therapy resistance. lymphomas, and 12 normal lymph nodes were identified by a board-certified hematopathologist (J.Z. Gong) and processed as described below for evaluation. RNA isolation and quantitative real-time PCR lymphomas. Here, we evaluated gene expression profiling data- Total RNA was isolated from eight 10-mm sections of FFPE sets of six B-cell lymphomas for the expression of BCLW and the tissue using the RecoverAll Total Nucleic Acid Isolation Kit as other antiapoptotic BCL2 family members and validated the per the manufacturer's instructions (Thermo Fisher). cDNA results with quantitative real-time PCR (qRT-PCR) and immuno- was generated using SuperScript III First-Strand Synthesis histochemistry of patient samples. Our data show BCLW is (Thermo Fisher Scientific) and SybrGreen (SABiosciences) frequently overexpressed in all six B-cell lymphomas, suggesting assays were performed in triplicate to measure mRNA expres- BCLW has an equally important role in lymphomagenesis as sion as previously described (16). mRNA expression was ÀDDC BCL2. In addition, most of the lymphomas analyzed overex- normalized to b-ACTIN and presented as 2 t comparing pressed more than one antiapoptotic BCL2 family member. Our the mean expression of specific mRNA in lymphoma with the results suggest that B-cell lymphomas rely on more than one mean of this mRNA in the controls to determine fold-change. antiapoptotic BCL2 family member for their survival. With tar- We previously reported the primer sequences for BCLW, BCL2, geted therapies against antiapoptotic BCL2 family members cur- BCLX,andMCL1 (17). Primers for BCL2A1 are forward-50- rently being tested or developed and therapeutic resistance emerg- CCCGGATGTGGATACCTATAAGGAGA and reverse-50-GTCAT- ing, our data provide critical information that should have sig- CCAGCCAGATTTAGGTTCA. nificant clinical implications. IHC m Materials
Load more

Recommended publications
  • IRF4/DUSP22 Gene Rearrangement by FISH
    IRF4/DUSP22 Gene Rearrangement by FISH The IRF4/DUSP22 locus is rearranged in a newly recognized subtype of non-Hodgkin lymphoma, large B-cell lymphoma with IRF4 rearrangement. These lymphomas are uncommon, but are clinically distinct from morphologically similar lymphomas, Tests to Consider including diffuse large B-cell lymphoma, high-grade follicular lymphoma, and pediatric- type follicular lymphoma. The IRF4/DUSP22 locus is also rearranged in a subset of ALK- IRF4/DUSP22 (6p25) Gene Rearrangement negative anaplastic large cell lymphomas (ALCL), where this rearrangement is associated by FISH 3001568 with a signicantly better prognosis. Method: Fluorescence in situ Hybridization (FISH) Test is useful in identifying ALK-negative anaplastic large cell lymphomas and large B- Disease Overview cell lymphoma with IRF4 rearrangement The rearrangement is associated with an improved prognosis Incidence See Related Tests Large B-cell lymphoma with IRF4 rearrangement accounts for <1% of all non-Hodgkin B-cell lymphomas overall More common in younger patients, with an incidence of 5-6% under age 18 IRF4/DUSP22 rearrangement is found in 30% of ALK-negative ALCLs Symptoms/Findings Large B-cell lymphoma with IRF4 rearrangement typically presents with limited stage disease in the head and neck, while the presentation of ALK-negative ALCLs is variable. Disease-Oriented Information Patients with large B-cell lymphoma with IRF4 rearrangement typically have a favorable outcome after treatment. Rearrangement of the IRF4/DUSP22 locus in ALK-negative ALCL is associated with a better prognosis than ALK-negative ALCL without this rearrangement. Test Interpretation Analytical Sensitivity The limit of detection (LOD) for the IRF4/DUSP22 probe was established by calculating the upper limit of the abnormal signal pattern in normal cells using the Microsoft Excel BETAINV function.
    [Show full text]
  • Follicular Lymphoma
    Follicular Lymphoma What is follicular lymphoma? Let us explain it to you. www.anticancerfund.org www.esmo.org ESMO/ACF Patient Guide Series based on the ESMO Clinical Practice Guidelines FOLLICULAR LYMPHOMA: A GUIDE FOR PATIENTS PATIENT INFORMATION BASED ON ESMO CLINICAL PRACTICE GUIDELINES This guide for patients has been prepared by the Anticancer Fund as a service to patients, to help patients and their relatives better understand the nature of follicular lymphoma and appreciate the best treatment choices available according to the subtype of follicular lymphoma. We recommend that patients ask their doctors about what tests or types of treatments are needed for their type and stage of disease. The medical information described in this document is based on the clinical practice guidelines of the European Society for Medical Oncology (ESMO) for the management of newly diagnosed and relapsed follicular lymphoma. This guide for patients has been produced in collaboration with ESMO and is disseminated with the permission of ESMO. It has been written by a medical doctor and reviewed by two oncologists from ESMO including the lead author of the clinical practice guidelines for professionals, as well as two oncology nurses from the European Oncology Nursing Society (EONS). It has also been reviewed by patient representatives from ESMO’s Cancer Patient Working Group. More information about the Anticancer Fund: www.anticancerfund.org More information about the European Society for Medical Oncology: www.esmo.org For words marked with an asterisk, a definition is provided at the end of the document. Follicular Lymphoma: a guide for patients - Information based on ESMO Clinical Practice Guidelines – v.2014.1 Page 1 This document is provided by the Anticancer Fund with the permission of ESMO.
    [Show full text]
  • The Lymphoma and Multiple Myeloma Center
    The Lymphoma and Multiple Myeloma Center What Sets Us Apart We provide multidisciplinary • Experienced, nationally and internationally recognized physicians dedicated exclusively to treating patients with lymphoid treatment for optimal survival or plasma cell malignancies and quality of life for patients • Cellular therapies such as Chimeric Antigen T-Cell (CAR T) therapy for relapsed/refractory disease with all types and stages of • Specialized diagnostic laboratories—flow cytometry, cytogenetics, and molecular diagnostic facilities—focusing on the latest testing lymphoma, chronic lymphocytic that identifies patients with high-risk lymphoid malignancies or plasma cell dyscrasias, which require more aggresive treatment leukemia, multiple myeloma and • Novel targeted therapies or intensified regimens based on the other plasma cell disorders. cancer’s genetic and molecular profile • Transplant & Cellular Therapy program ranked among the top 10% nationally in patient outcomes for allogeneic transplant • Clinical trials that offer tomorrow’s treatments today www.roswellpark.org/partners-in-practice Partners In Practice medical information for physicians by physicians We want to give every patient their very best chance for cure, and that means choosing Roswell Park Pathology—Taking the best and Diagnosis to a New Level “ optimal front-line Lymphoma and myeloma are a diverse and heterogeneous group of treatment.” malignancies. Lymphoid malignancy classification currently includes nearly 60 different variants, each with distinct pathophysiology, clinical behavior, response to treatment and prognosis. Our diagnostic approach in hematopathology includes the comprehensive examination of lymph node, bone marrow, blood and other extranodal and extramedullary tissue samples, and integrates clinical and diagnostic information, using a complex array of diagnostics from the following support laboratories: • Bone marrow laboratory — Francisco J.
    [Show full text]
  • Quantitative Analysis of Bcl-2 Expression in Normal and Leukemic Human B-Cell Differentiation
    Leukemia (2004) 18, 491–498 & 2004 Nature Publishing Group All rights reserved 0887-6924/04 $25.00 www.nature.com/leu Quantitative analysis of bcl-2 expression in normal and leukemic human B-cell differentiation P Menendez1,2, A Vargas3, C Bueno1,2, S Barrena1,2, J Almeida1,2 M de Santiago1,2,ALo´pez1,2, S Roa2, JF San Miguel2,4 and A Orfao1,2 1Servicio General de Citometrı´a, Universidad de Salamanca, Salamanca, Spain; 2Departamento de Medicina and Centro de Investigacio´n del Ca´ncer, Universidad de Salamanca, Salamanca, Spain; 3Servicio de Inmunodiagno´stico, Departamento de Patologı´a Clı´nica, Hospital Nacional Edgardo Rebagliati Martins, Lima, Peru´, ; and 4Servicio de Hematologı´a, Hospital Universitario, Salamanca, Spain Lack of apoptosis has been linked to prolonged survival of results in the overexpression of the bcl-2 protein and it malignant B cells expressing bcl-2. The aim of the present represented the first clear example of a common step in study was to analyze the amount of bcl-2 protein expressed 9,10 along normal human B-cell maturation and to establish the oncogenesis mediated by decreased cell death. Currently, frequency of aberrant bcl-2 expression in B-cell malignancies. the exact antiapoptotic pathways through which bcl-2 exerts its In normal bone marrow (n ¼ 11), bcl-2 expression obtained by role are only partially understood, involving decreased mito- quantitative multiparametric flow cytometry was highly vari- chondrial release of cytochrome c, which in turn is required for þ À able: very low in both CD34 and CD34 B-cell precursors, high the activation of procaspase-9 and the subsequent initiation of in mature B-lymphocytes and very high in plasma cells.
    [Show full text]
  • The Lymphoma Guide Information for Patients and Caregivers
    The Lymphoma Guide Information for Patients and Caregivers Ashton, lymphoma survivor This publication was supported by Revised 2016 Publication Update The Lymphoma Guide: Information for Patients and Caregivers The Leukemia & Lymphoma Society wants you to have the most up-to-date information about blood cancer treatment. See below for important new information that was not available at the time this publication was printed. In November 2017, the Food and Drug Administration (FDA) approved obinutuzumab (Gazyva®) in combination with chemotherapy, followed by Gazyva alone in those who responded, for people with previously untreated advanced follicular lymphoma (stage II bulky, III or IV). In November 2017, the Food and Drug Administration (FDA) approved brentuximab vedotin (Adcetris®) for treatment of adult patients with primary cutaneous anaplastic large cell lymphoma (pcALCL) or CD30- expressing mycosis fungoides (MF) who have received prior systemic therapy. In October 2017, the Food and Drug Administration (FDA) approved acalabrutinib (CalquenceTM) for the treatment of adults with mantle cell lymphoma who have received at least one prior therapy. In October 2017, the Food and Drug Administration (FDA) approved axicabtagene ciloleucel (Yescarta™) for the treatment of adult patients with relapsed or refractory large B-cell lymphoma after two or more lines of systemic therapy, including diffuse large B-cell lymphoma (DLBCL) not otherwise specified, primary mediastinal large B-cell lymphoma, high-grade B-cell lymphoma, and DLBCL arising from follicular lymphoma. Yescarta is a CD19-directed genetically modified autologous T cell immunotherapy FDA approved. Yescarta is not indicated for the treatment of patients with primary central nervous system lymphoma. In September 2017, the Food and Drug Administration (FDA) approved copanlisib (AliqopaTM) for the treatment of adult patients with relapsed follicular lymphoma (FL) who have received at least two prior systemic therapies.
    [Show full text]
  • SNF Mobility Model: ICD-10 HCC Crosswalk, V. 3.0.1
    The mapping below corresponds to NQF #2634 and NQF #2636. HCC # ICD-10 Code ICD-10 Code Category This is a filter ceThis is a filter cellThis is a filter cell 3 A0101 Typhoid meningitis 3 A0221 Salmonella meningitis 3 A066 Amebic brain abscess 3 A170 Tuberculous meningitis 3 A171 Meningeal tuberculoma 3 A1781 Tuberculoma of brain and spinal cord 3 A1782 Tuberculous meningoencephalitis 3 A1783 Tuberculous neuritis 3 A1789 Other tuberculosis of nervous system 3 A179 Tuberculosis of nervous system, unspecified 3 A203 Plague meningitis 3 A2781 Aseptic meningitis in leptospirosis 3 A3211 Listerial meningitis 3 A3212 Listerial meningoencephalitis 3 A34 Obstetrical tetanus 3 A35 Other tetanus 3 A390 Meningococcal meningitis 3 A3981 Meningococcal encephalitis 3 A4281 Actinomycotic meningitis 3 A4282 Actinomycotic encephalitis 3 A5040 Late congenital neurosyphilis, unspecified 3 A5041 Late congenital syphilitic meningitis 3 A5042 Late congenital syphilitic encephalitis 3 A5043 Late congenital syphilitic polyneuropathy 3 A5044 Late congenital syphilitic optic nerve atrophy 3 A5045 Juvenile general paresis 3 A5049 Other late congenital neurosyphilis 3 A5141 Secondary syphilitic meningitis 3 A5210 Symptomatic neurosyphilis, unspecified 3 A5211 Tabes dorsalis 3 A5212 Other cerebrospinal syphilis 3 A5213 Late syphilitic meningitis 3 A5214 Late syphilitic encephalitis 3 A5215 Late syphilitic neuropathy 3 A5216 Charcot's arthropathy (tabetic) 3 A5217 General paresis 3 A5219 Other symptomatic neurosyphilis 3 A522 Asymptomatic neurosyphilis 3 A523 Neurosyphilis,
    [Show full text]
  • Lymphoproliferative Disorders
    Lymphoproliferative disorders Objectives: • To understand the general features of lymphoproliferative disorders (LPD) • To understand some benign causes of LPD such as infectious mononucleosis • To understand the general classification of malignant LPD Important. • To understand the clinicopathological features of chronic lymphoid leukemia Extra. • To understand the general features of the most common Notes (LPD) (Burkitt lymphoma, Follicular • lymphoma, multiple myeloma and Hodgkin lymphoma). Success is the result of perfection, hard work, learning Powellfrom failure, loyalty, and persistence. Colin References: Editing file 435 teamwork slides 6 girls & boys slides Do you have any suggestions? Please contact us! @haematology436 E-mail: [email protected] or simply use this form Definitions Lymphoma (20min) Lymphoproliferative disorders: Several clinical conditions in which lymphocytes are produced in excessive quantities (Lymphocytosis) increase in lymphocytes that are not normal Lymphoma: Malignant lymphoid mass involving the lymphoid tissues. (± other tissues e.g: skin, GIT, CNS ..) The main deference between Lymphoma & Leukemia is that the Lymphoma proliferate primarily in Lymphoid Tissue and cause Mass , While Leukemia proliferate mainly in BM& Peripheral blood Lymphoid leukemia: Malignant proliferation of lymphoid cells in Bone marrow and peripheral blood. (± other tissues e.g: lymph nodes, spleen, skin, GIT, CNS ..) BCL is an anti-apoptotic (prevent apoptosis) Lymphocytosis (causes) 1- Viral infection: 2- Some* bacterial
    [Show full text]
  • Non-Hodgkin Lymphoma
    Non-Hodgkin Lymphoma Rick, non-Hodgkin lymphoma survivor This publication was supported in part by grants from Revised 2013 A Message From John Walter President and CEO of The Leukemia & Lymphoma Society The Leukemia & Lymphoma Society (LLS) believes we are living at an extraordinary moment. LLS is committed to bringing you the most up-to-date blood cancer information. We know how important it is for you to have an accurate understanding of your diagnosis, treatment and support options. An important part of our mission is bringing you the latest information about advances in treatment for non-Hodgkin lymphoma, so you can work with your healthcare team to determine the best options for the best outcomes. Our vision is that one day the great majority of people who have been diagnosed with non-Hodgkin lymphoma will be cured or will be able to manage their disease with a good quality of life. We hope that the information in this publication will help you along your journey. LLS is the world’s largest voluntary health organization dedicated to funding blood cancer research, education and patient services. Since 1954, LLS has been a driving force behind almost every treatment breakthrough for patients with blood cancers, and we have awarded almost $1 billion to fund blood cancer research. Our commitment to pioneering science has contributed to an unprecedented rise in survival rates for people with many different blood cancers. Until there is a cure, LLS will continue to invest in research, patient support programs and services that improve the quality of life for patients and families.
    [Show full text]
  • Transformation of Follicular Lymphoma to Acute Lymphoblastic Leukemia
    Transformation of Follicular Lymphoma to Acute Lymphoblastic Leukemia Xiaoping Sun, MD, PhD; Leo I. Gordon, MD; LoAnn C. Peterson, MD n March 1994, a 56-year-old man underwent lobectomy sies showed a single paratrabecular lymphoid aggregate I of the upper lobe of the right lung and lymph node that suggested involvement by the follicular lymphoma. dissection for poorly differentiated adenocarcinoma. Ma- During the next 6 years, the patient underwent 2 biopsies lignant lymphoma, follicular, small cleaved was identi®ed and 2 ®ne-needle aspiration biopsies of lymph nodes from in multiple paratracheal and hilar lymph nodes. Hema- different sites, and the results of all of these biopsies were toxylin-eosin±stained sections of the lymph nodes showed consistent with the initial diagnosis. Flow cytometric im- a follicular pattern and a predominance of small cleaved munophenotyping was performed on 3 of the lymph node lymphoma cells (Figure, A). Bilateral bone marrow biop- specimens, and all contained CD101 and CD52 clonal B cells (CD191 and CD201) with l surface immunoglobulin light chain restriction. In August of 1999, 5 years after the Accepted for publication March 1, 2002. initial diagnosis, repeated bilateral bone marrow biopsies From the Department of Pathology, Northwestern University Medical School, Chicago, Ill. showed a normocellular bone marrow with 2 nonparatra- Reprints: LoAnn C. Peterson, MD, Department of Pathology, North- becular lymphoid aggregates; these ®ndings were not di- western University Medical School, Feinberg Pavilion, Room 7-344, agnostic for lymphoma. Flow cytometry studies of the 251 East Huron St, Chicago, IL 60611 (e-mail: [email protected]). bone marrow showed no evidence of B-cell clonality.
    [Show full text]
  • The Cytogenetics of Hematologic Neoplasms 1 5
    The Cytogenetics of Hematologic Neoplasms 1 5 Aurelia Meloni-Ehrig that errors during cell division were the basis for neoplastic Introduction growth was most likely the determining factor that inspired early researchers to take a better look at the genetics of the The knowledge that cancer is a malignant form of uncon- cell itself. Thus, the need to have cell preparations good trolled growth has existed for over a century. Several biologi- enough to be able to understand the mechanism of cell cal, chemical, and physical agents have been implicated in division became of critical importance. cancer causation. However, the mechanisms responsible for About 50 years after Boveri’s chromosome theory, the this uninhibited proliferation, following the initial insult(s), fi rst manuscripts on the chromosome makeup in normal are still object of intense investigation. human cells and in genetic disorders started to appear, fol- The fi rst documented studies of cancer were performed lowed by those describing chromosome changes in neoplas- over a century ago on domestic animals. At that time, the tic cells. A milestone of this investigation occurred in 1960 lack of both theoretical and technological knowledge with the publication of the fi rst article by Nowell and impaired the formulations of conclusions about cancer, other Hungerford on the association of chronic myelogenous leu- than the visible presence of new growth, thus the term neo- kemia with a small size chromosome, known today as the plasm (from the Greek neo = new and plasma = growth). In Philadelphia (Ph) chromosome, to honor the city where it the early 1900s, the fundamental role of chromosomes in was discovered (see also Chap.
    [Show full text]
  • Mature B-Cell Neoplasms
    PEARLS OF LABORATORY MEDICINE Mature B-cell Neoplasms Michael Moravek, MD Kamran M. Mirza, MD, PhD Loyola University Chicago Stritch School of Medicine DOI: 10.15428/CCTC.2018.287706 © Clinical Chemistry The Lymphoid System Bone Marrow Stem Cell • Mature B-cell lymphomas comprise approximately 75% of all lymphoid neoplasms • Genetic alterations lead to deregulation of cell T cell Immature NK cell proliferation or apoptosis B cell • Low-grade lymphomas typically present as painless B cell lymphadenopathy, hepatosplenomegaly, or incidental lymphocytosis • High-grade lymphomas typically present with a rapidly enlarging mass and “B” symptoms (fever, weight loss, night sweats) Plasma cell 2 B-Cell Maturation antigen Naïve B cell Post- Germinal Center Germinal Center Marginal Zone DLBCL (some) FL, BL, some DLBCL, CLL/SLL Mantle Cell Hodgkin lymphoma MZL MALT Lymphoma Plasma cell myeloma CD5 + CD10 + CD5/CD10 Neg 3 Frequency among mature B-cell neoplasms DLBCL 27.6% CLL/SLL 19.4% Mature B-cell neoplasms Chronic lymphocytic leukemia/small lymphocytic lymphoma Primary cutaneous follicle center lymphoma Follicular Lymphoma -Monoclonal B-12.2%cell lymphocytosis Mantle cell lymphoma Marginal Zone LymphomaB-cell prolymphocytic 3.7% leukemia -Leukemic non-nodal mantle cell lymphoma Splenic marginal zone lymphoma -In situ mantle cell neoplasia Mantle Cell LymphomaHairy cell leukemia1.9% Diffuse large B-cell lymphoma (DLBCL), NOS Splenic B-cell lymphoma/leukemia, unclassifiable -Germinal center B-cell type Burkitt Lymphoma -Splenic diffuse1.3% red pulp
    [Show full text]
  • Burkitt Lymphoma
    Board Review- Part 2B: Malignant HemePath 4/25/2018 Small Lymphocytic Lymphoma SLL: epidemiology SLL: 6.7% of non-Hodgkin lymphoma. Majority of patients >50 y/o (median 65). M:F ratio 2:1. Morphology • Lymph nodes – Effacement of architecture, pseudofollicular pattern of pale areas of large cells in a dark background of small cells. Occasionally is interfollicular. – The predominant cell is a small lymphocyte with clumped chromatin, round nucleus, ocassionally a nucleolus. – Mitotic activity usually very low. Morphology - Pseudofollicles or proliferation centers contain small, medium and large cells. - Prolymphocytes are medium-sized with dispersed chromatin and small nucleoli. - Paraimmunoblasts are medium to large cells with round to oval nuclei, dispersed chromatin, central eosinophilic nucleoli and slightly basophilic cytoplasm. Small Lymphocytic Lymphoma Pseudo-follicle Small Lymphocytic Lymphoma Prolymphocyte Paraimmunoblast Immunophenotype Express weak or dim surface IgM or IgM and IgD, CD5, CD19, CD20 (weak), CD22 (weak), CD79a, CD23, CD43, CD11c (weak). CD10-, cyclin D1-. FMC7 and CD79b negative or weak. Immunophenotype Cases with unmutated Ig variable region genes are reported to be CD38+ and ZAP70+. Immunophenotype Cytoplasmic Ig is detectable in about 5% of the cases. CD5 and CD23 are useful in distinguishing from MCL. Rarely CLL is CD23-. Rarely MCL is CD23+. Perform Cyclin D1 in CD5+/CD23- cases. Some cases with typical CLL morphology may have a different profile (CD5- or CD23-, FMC7+ or CD11c+, or strong sIg, or CD79b+). Genetics Antigen receptor genes: Ig heavy and light chain genes are rearranged. Suggestion of 2 distinct types of SLL defined by the mutational status of the IgVH genes: 40-50% show no somatic mutations of their variable region genes (naïve cells, unmutated).
    [Show full text]