Non-Hodgkin and Hodgkin Lymphomas Select for Overexpression of BCLW Clare M

Non-Hodgkin and Hodgkin Lymphomas Select for Overexpression of BCLW Clare M

Published OnlineFirst August 29, 2017; DOI: 10.1158/1078-0432.CCR-17-1144 Biology of Human Tumors Clinical Cancer Research Non-Hodgkin and Hodgkin Lymphomas Select for Overexpression of BCLW Clare M. Adams1, Ramkrishna Mitra1, Jerald Z. Gong2, and Christine M. Eischen1 Abstract Purpose: B-cell lymphomas must acquire resistance to apopto- follicular, mantle cell, marginal zone, and Hodgkin lymphomas. sis during their development. We recently discovered BCLW, an Notably, BCLW was preferentially overexpressed over that of antiapoptotic BCL2 family member thought only to contribute to BCL2 and negatively correlated with BCL2 in specific lymphomas. spermatogenesis, was overexpressed in diffuse large B-cell lym- Unexpectedly, BCLW was overexpressed as frequently as BCL2 in phoma (DLBCL) and Burkitt lymphoma. To gain insight into the follicular lymphoma. Evaluation of all five antiapoptotic BCL2 contribution of BCLW to B-cell lymphomas and its potential to family members in six types of B-cell lymphoma revealed that confer resistance to BCL2 inhibitors, we investigated the expres- BCL2, BCLW, and BCLX were consistently overexpressed, whereas sion of BCLW and the other antiapoptotic BCL2 family members MCL1 and A1 were not. In addition, individual lymphomas in six different B-cell lymphomas. frequently overexpressed more than one antiapoptotic BCL2 Experimental Design: We performed a large-scale gene family member. expression analysis of datasets comprising approximately Conclusions: Our comprehensive analysis indicates B-cell 2,300 lymphoma patient samples, including non-Hodgkin lymphomas commonly select for BCLW overexpression in andHodgkinlymphomasaswellasindolentandaggressive combination with or instead of other antiapoptotic BCL2 lymphomas. Data were validated experimentally with qRT- family members. Our results suggest BCLW may be equally as PCR and IHC. important in lymphomagenesis as BCL2 and that targeting Results: We report BCLW is significantly overexpressed in BCLW in lymphomas should be considered. Clin Cancer Res; aggressive and indolent lymphomas, including DLBCL, Burkitt, 23(22); 7119–29. Ó2017 AACR. Introduction lymphoma and DLBCL, Burkitt lymphoma, an aggressive lym- phoma, express low/undetectable levels of BCL2, which is part Lymphomas, as with all human cancers, select for alterations of its diagnostics (6). We recently discovered that Burkitt that inhibit apoptosis, allowing them to survive during trans- lymphomas frequently overexpress BCLW, an antiapoptotic formation (1). The BCL2 family of proteins consists of anti- BCL2 family member that was initially reported to only func- apoptotic (BCL2, BCLX/BCL2L1, BCLW/BCL2L2, MCL1, and tion in spermatogenesis (7–9). Targeting BCLW with shRNA or A1/BFL1) and proapoptotic proteins that regulate cell death pharmacologically with BH3-mimetics induced apoptosis in and have been linked to many human cancers, including Burkitt lymphoma cell lines, indicating BCLW was required for lymphomas (2). its survival (9). When overexpressed, BCLW conferred resis- BCL2 translocation to the immunoglobulin locus, leading to tance to BH3-mimetics (9). We also showed that DLBCL BCL2 overexpression, is a defining feature of the non-Hodgkin frequently overexpresses BCLW alone or in combination with indolent lymphoma follicular lymphoma (3). Diffuse large BCL2, and that increased levels of BCLW in patient samples B-cell lymphoma (DLBCL), an aggressive lymphoma, can also with low BCL2 expression correlated with reduced patient overexpress BCL2 (4). Thirty percent of de novo DLBCL have survival (9). Therefore, BCLW is a previously unappreciated, BCL2 translocations and/or increased protein expression (5), significant contributor to Burkitt lymphoma and DLBCL, but its correlating with reduced survival (4). In contrast with follicular involvement in other B-cell lymphomas is unknown. There are multiple different aggressive and indolent B-cell lymphoma subtypes, but the contribution of BCLW and other 1Department of Cancer Biology, Sidney Kimmel Cancer Center, Thomas Jeffer- son University, Philadelphia, Pennsylvania. 2Department of Pathology, Anatomy, antiapoptotic BCL2 family members to them is unclear. It is and Cell Biology, Thomas Jefferson University, Philadelphia, Pennsylvania. reported that there is increased expression of BCL2 and BCLX in a small subset of mantle cell lymphoma (an aggressive lympho- Note: Supplementary data for this article are available at Clinical Cancer Research Online (http://clincancerres.aacrjournals.org/). ma), whereas MCL1 expression is typically low (10). BCL2 levels can be elevated in marginal zone lymphomas, which are indolent C.M. Adams and R. Mitra contributed equally to the article. (4). Increased levels of BCLX were identified in the majority of Corresponding Author: Christine M. Eischen, Thomas Jefferson University, 233 Hodgkin lymphomas, but are not part of its diagnostics (11). South 10th Street, Bluemle Life Science Building, Philadelphia, PA 19107. Phone: Therefore, unlike follicular lymphoma and DLBCL, other B-cell 215-503-3712; Fax: 215-503-6109; E-mail: [email protected] lymphomas have not been linked to alterations in specific anti- doi: 10.1158/1078-0432.CCR-17-1144 apoptotic BCL2 family members, which may be due to the lack Ó2017 American Association for Cancer Research. of a comprehensive analysis of these genes/proteins in these www.aacrjournals.org 7119 Downloaded from clincancerres.aacrjournals.org on September 27, 2021. © 2017 American Association for Cancer Research. Published OnlineFirst August 29, 2017; DOI: 10.1158/1078-0432.CCR-17-1144 Adams et al. measured using unpaired, two-tailed t tests as indicated. All Translational Relevance analyses were carried out in R, version 3.2.3. With clinical trials on-going for BCL2-specific inhibitors for the treatment of lymphomas and BCLX- and MCL1- Survival analysis specific inhibitors being developed, there is a critical need Gene expression profiles and patient clinicopathologic infor- for increased knowledge of the expression of antiapoptotic mation for DLBCL were extracted from the GEO database BCL2 family members in lymphomas to identify those most (GSE10846 and GSE31312). Data were normalized and probe likely to respond to specific inhibitors. Our study, the first sets averaged as explained above. Patient samples were simulta- large-scale analysis of all antiapoptotic BCL2 family mem- neously stratified on the basis of the median expression of BCL2 bers in six types of B-cell lymphomas (non-Hodgkin and and BCLW into high or low expression groups for each gene. Then, Hodgkin), reveals B-cell lymphomas typically overexpress patients with low BCL2 expression were identified and Kaplan– more than one. Moreover, BCLW, a previously uncharacter- Meier overall survival curves plotted for the high and low BCLW ized antiapoptotic BCL2 family member, was frequently expression groups and compared using the log-rank test. overexpressed. Specific lymphomas preferentially selected for BCLW overexpression over that of BCL2. Notably, Patient sample acquisition BCLW was overexpressed in follicular lymphoma, indicat- Patient samples of formalin-fixed, paraffin-embedded (FFPE) ing it likely has a role in this lymphoma. Our results suggest sections were obtained from archival pathologic specimens targeting BCLW in B-cell lymphomas may be needed alone at Thomas Jefferson University with approval from the Institu- or in combination with other specific BCL2 family inhibi- tional Review Board. Thirty follicular lymphomas, 10 marginal tors, as targeting just one may lead to dependence on zone lymphomas, 14 mantle cell lymphomas, 26 Hodgkin another resulting in therapy resistance. lymphomas, and 12 normal lymph nodes were identified by a board-certified hematopathologist (J.Z. Gong) and processed as described below for evaluation. RNA isolation and quantitative real-time PCR lymphomas. Here, we evaluated gene expression profiling data- Total RNA was isolated from eight 10-mm sections of FFPE sets of six B-cell lymphomas for the expression of BCLW and the tissue using the RecoverAll Total Nucleic Acid Isolation Kit as other antiapoptotic BCL2 family members and validated the per the manufacturer's instructions (Thermo Fisher). cDNA results with quantitative real-time PCR (qRT-PCR) and immuno- was generated using SuperScript III First-Strand Synthesis histochemistry of patient samples. Our data show BCLW is (Thermo Fisher Scientific) and SybrGreen (SABiosciences) frequently overexpressed in all six B-cell lymphomas, suggesting assays were performed in triplicate to measure mRNA expres- BCLW has an equally important role in lymphomagenesis as sion as previously described (16). mRNA expression was ÀDDC BCL2. In addition, most of the lymphomas analyzed overex- normalized to b-ACTIN and presented as 2 t comparing pressed more than one antiapoptotic BCL2 family member. Our the mean expression of specific mRNA in lymphoma with the results suggest that B-cell lymphomas rely on more than one mean of this mRNA in the controls to determine fold-change. antiapoptotic BCL2 family member for their survival. With tar- We previously reported the primer sequences for BCLW, BCL2, geted therapies against antiapoptotic BCL2 family members cur- BCLX,andMCL1 (17). Primers for BCL2A1 are forward-50- rently being tested or developed and therapeutic resistance emerg- CCCGGATGTGGATACCTATAAGGAGA and reverse-50-GTCAT- ing, our data provide critical information that should have sig- CCAGCCAGATTTAGGTTCA. nificant clinical implications. IHC m Materials

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    12 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us