INCIDENCE and CHARACTERIZATION of MAJOR FUNGAL PATHOGENS of STRAWBERRY DISEASES NASIR MEHMOOD 06-Arid-109

INCIDENCE AND CHARACTERIZATION OF MAJOR FUNGAL PATHOGENS OF STRAWBERRY DISEASES

NASIR MEHMOOD

06-arid-109

Department of Plant Pathology Faculty of Crop and Food Sciences Pir Mehr Ali Shah Arid Agriculture University Rawalpindi Pakistan 2018

INCIDENCE AND CHARACTERIZATION OF MAJOR FUNGAL PATHOGENS OF STRAWBERRY DISEASES

NASIR MEHMOOD

(06-arid-109)

A thesis submitted in the partial fulfillment of

the requirements for the degree of

Doctor of Philosophy

Plant Pathology

Department of Plant Pathology Faculty of Crop and Food Sciences Pir Mehr Ali Shah Arid Agriculture University Rawalpindi Pakistan 2018

ivi

vii

viiiii

“IN THE NAME OF ALLAH, THE MOST BENEFICENT AND MERCIFUL”

DEDICATION

This Humble Effort Is Dedicated To

“My Affectionate and Loving Parents”

Who always Sacrifice For Me In Every Moment Of

Their Life

My Loving & Friendly

“Brothers, Sister, Nephews and Nieces”

Who Are Always A Source Of Happiness, Supports

And Backup For Me to achieve my goals.

“May Their Hands Ever Praying for Me

These Hands may never fall down”

CONTENTS

List of Tables v

List of Figures vi

List of Abbreviations viii

Acknowledgements x

ABSTRACT 1

1. INTRODUCTION 3

2. REVIEW OF LITERATURE 10

2.1 STRAWBERRY HISTROY AND IMPORTANCE 10

2.2 MAJOR STRAWBERRY FUNGAL PATHOGENS 11

2.3 Botrytis cinerea (BOTRYTIS FRUIT ROT) 11

2.4 Colletotrichum acutatum AND C. gloeosporioides 15 (ANTHRACNOSE FRUIT ROT) 2.5 Alternaria alternata (ALTERNARIA LEAF SPOT) 19

2.6 Fusarium solani (FUSARIUM FRUIT ROT) 22

2.7 MOLECULAR TOOLS 25

3. MATERIALS AND METHODS 28

3.1 DISEASE SURVEY AND ASSESMENT 28

3.1.1 Survey of Strawberry Fields 28

3.1.2 Field Based Diseases Assessments and Sample Collection 29

3.2 ISOLATION AND PURIFICATION OF PATHOGENS 30

3.3 PRESERVATION OF PURIFIED FUNGAL ISOLATES 31

3.4 PATHOGENICITY TEST 34

3.5 MORPHOLOGICAL CHARACTERIZATION OF FUNGAL 35

ISOLATES

3.6 MOLECULAR CHARACTERIZATION 36

3.6.1 Genomic DNA Extraction from Fungal Pathogens 36

3.6.2 Polymerase Chain Reaction (PCR) Assay 37

3.6.2.1 Amplification of different gene regions 37

3.6.2.2 PCR reaction mixture 40

3.6.2.3 PCR conditions 40

3.6.3 Agarose Gel Electrophoresis 40

3.6.4 PCR Product Purification 42

3.7 DNA SEQUENCING 42

3.7.1 Sequence Processing and Submission 42

4. RESULTS AND DISCUSSION 44

4.1 DISEASE SURVEY AND ASSESSMENT 44

4.1.1 Prevalence Percentages of Major Diseases 44

4.1.2 Incidence Percentages of Major Diseases 53

4.2 COLLECTION OF DISEASED SAMPLES 61

4.3 ISOLATION, IDENTIFICATION AND PATHOGENICITY 61

4.4 PRESERVATION OF FUNGAL ISOLATES 62

4.5 MORPHO-MOLECULAR CHARACTERIZATION OF 67

FUNGAL PATHOGENS

4.6 MORPHO-MOLECULAR CHARACTERIZATION OF 69 Alternaria alternata 4.6.1 Cultural and Morphological Characterization 69

4.6.1.1 Colony color 69

4.6.1.2 Growth habit 69

4.6.1.3 Colony margins and color 69

4.6.1.4 Concentric rings 69

4.6.1.5 Conidia: color, shape and size 70

4.6.2 Molecular Characterization of A. alternata 79

4.7 MORPHO-MOLECULAR CHARACTERIZATION OF 82 Fusarium solani 4.7.1 Cultural and Morphological Characterization 82

4.7.1.1 Colony color 82

4.7.1.2 Growth habit 85

4.7.1.3 Pigmentation 85

4.7.1.4 Conidiophore and Phialide 85

4.7.1.5 Microconidia shape and size 86

4.7.1.6 Macroconidia shape and size 86

4.7.1.7 Macroconidia apical and basal cells shape 87

4.7.1.8 Macroconidia septation 87

4.7.1.9 Chlamydospores formation and size 88

4.7.2 Molecular Characterization of Fusarium solani 104

4.8 MORPHO-MOLECULAR CHARACTERIZATION OF 104

Colletotrichum spp.

4.8.1 Cultural and Morphological Characterization 104

4.8.1.1 Colony color 104

4.8.1.2 Growth habit 104

4.8.1.3 Pigmentation 105

vii

4.8.1.4 Conidia: shape, size and color 105

4.8.1.5 Appressoria: shape, size and color 106

4.8.1.6 Setae: shape, size and color 106

4.8.2 Molecular Characterization of Colletotrichum spp. 119

4.9 MORPHO-MOLECULAR CHARACTERIZATION OF 124

Botrytis cinerea

4.9.1 Cultural and Morphological Characterization 124

4.9.1.1 Colony color 124

4.9.1.2 Growth habit 124

4.9.1.3 Sclerotia color, diameter and formation 125

4.9.1.4 Conidiophore color and length 126

4.9.1.5 Shape, size and colour of conidia 127

4.9.2 Molecular Characterization of Botrytis cinerea 138

SUMMARY 144

LITERATURE CITED 150

viii

LIST OF TABLES

Table No. Page

3.1 Important strawberry growing area surveyed during crop seasons 33 2014-15 & 2015-16

3.2 Gene/Gene Region, Primers used with detail and PCR conditions 41 and references

4.1 Disease Prevalence Percentage of 4 major fungal diseases in 48 surveyed locations from 12 Districts during crop seasons 2014- 15 and 2015-16

4.2 Disease Incidence Percentage of 4 major fungal diseases in 56 surveyed locations from 12 Districts during crop seasons 2014- 15 and 2015-16

4.3 Alternaria alternata isolates ID with culture identification and 73 morphological characterization

4.4 Details of Alternaria alternata isolates and Accession number 83 with ITS and EndoPG primers used in molecular study

4.5 Fusarium solani isolates ID with culture identification and 91 morphological characterization

4.6 Details of Fusarium solani isolates and Accession number with 102 ITS and TEF-1α primers used in molecular study

4.7 Colletotrichum spp. isolates ID with culture identification and 110 morphological characterization

4.8 Details of Colletotrichum acutatum isolates and Accession 122 number with ITS and Bt primers used in molecular study

4.9 Details of Colletotrichum gloeosporioides isolates and 122 Accession number with ITS and Bt primers used in molecular study

4.10 Botrytis cinerea isolates ID with culture identification and 131 morphological characterization

4.11 Details of Botrytis cinerea isolates and Accession number with 142 ITS and G3PDH primers used in molecular study

LIST OF FIGURES

Fig. No. Page

3.1 Surveyed districts with number of fields visited for major 32 fungal diseases of strawberry (2014-15 & 2015-16)

3.2 Diagrammatic representation of Steps of DNA Extraction 38 using PrepMan Ultra Sample Preparation Reagent

3.3 Schematic diagrams indicating genes regions and the primer 39 positions (a) Inter transcribed space region (ITS), (b) Translation elongation factor (TEF-1α), (c) Beta-tubulin (BT) (d) endopolygalacturonase (endoPG) and (e) Glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH)

4.1 During survey across different districts: (a) Sialkot, (b) 45 Mardan, (c) Multan (d) Islamabad

4.2 Field samples collected during survey ofr fungal diseases: 63 (a) Alternaria leaf spot (ALS), (b) Fusarium fruit rot (FFR) (c) Anthracnose fruit rot (AFR) and (d) Botrytis fruit rot (BFR)

4.3 Pathogenicity test performed on the respective strawberry 64 plant part from where the fungal pathogen was isolate: (a) Alternaria alternata on leaf (b) Fusarium solani on fruit (c) Colletotrichum spp. on fruits (d) Botrytis cinerea on fruit

4.4 Preserved fungal cultures in skimmed milk and silica gel (a) 66 Glass vials (b) Eppendorf tubes

4.5 Revival of pure fungal colonies from preserved cultures in 66 silica gel

4.6 Alternaria alternata morphological characters: Colony 72 color and margins (a) Light brown, irregular (b) Dark brown, regular (c) Olivaceous black, regular (d) Reverse color (e) Spores showing longitudinal and transverse septation (d) Conidia in short chains

4.7 Molecular phylogenetic tree inferred by using Maximum 84 Likelihood analysis from (a) ITS and (b) EndoPG gene sequences of 12 representative A. alternata isolates

4.8 Fusarium solani Colony color and Growth habit (a) Cottony 89 & fluffy white (b) White & flat (c) Creamy white & compact; Pigmentation (d) Colorless, (e) Pale yellow

4.9 Fusarium solani morphological characters: (a) Long 90 Monophialides (b) Long & branched Monophialides (c) Microconidia (oval and reniform) and Macroconidia (Fusiform curved and sepatation) (d) Fusiform straight & septation; Formation of chlamydospores (e) Singly (f) Singly & paired

4.10 Molecular phylogenetic tree inferred by using Maximum 103 Likelihood analysis from (a) ITS and (b) TEF-1α gene sequences of 11 representative F. solani isolates

4.11 Colletotrichum acutatum cultural and morphological 108 characters: Colony color and Growth habit (a) Creamy white (b) Pale yellowish; Pigmentation (c) Reddish yellow (d) Salmon (e) Elliptic-fusiform conidia (f) Ovate appressoria

4.12 Colletotrichum gloeosporioides cultural & morphological 109 characters: Colony color and Growth habit (a) Gray & dense aerial mycelium (b) Grayish white; Pigmentation (c) Grayish (d) Pinkish (e) Oblong, obtuse ends conidia (f) Setae (g) Irregular appressoria

4.13 Molecular phylogenetic tree inferred by using Maximum 123 Likelihood analysis from (a) ITS and (b) BT gene sequences of 19 representative Colletotrichum spp.

4.14 Botrytis cinerea morphological characters: Colony color 130 and Growth habit (a) Dark grey (b) Cloudy white (c & d) Sclerotia formation (e) Conidiophore with conidia in grape bunch shape, (d) Conidia of lemon or pear shaped

4.15 Molecular phylogenetic tree inferred by using Maximum 143 Likelihood analysis from (a) ITS and (b) G3PDH gene sequences of 12 representative B. cinerea isolates

List of Abbreviations

% Percentage

@ At the rate

± Plus Minus

° Degree

°C Centigrade

µg Microgram

µL Micro Liter

AFR Anthracnose Fruit Rot

ALS Alternaria Leaf Spot

BFR Botrytis Fruit Rot

BLAST Basic Local Alignment Search Tool

Bp Base pairs

BS Boot Strape

BT/TUB2 Beta Tubulin

DNA Deoxyribose nucleic acid

PmoL Peco Mole

DEPC Diehtylpyrocarbonate

EDTA Ethylenediaminetetraacetic acid

EndoPG Endo-polygalacturonase et al., And others

FAO Food and Agriculture Organization

FFR Fusarium Fruit Rot

G3PDH Glyceraldehyde 3-phosphate dehydrogenase

xii

GM Gray Mold

Ha Hectare

ICT Islamabad Capital Territory

ITS Internal Transcribed Spacer Region ISU Iowa State University KPK Khyber Pakhtunkhwa

L Liter

M Molar

MgCl2 Magnesium Chloride

Mins Minutes

Mm Millimeter

NCBI National Center for Biotechnological Information

PCR Polymerase Chain Reaction

PDA Potato Dextrose Agar

PMAS-AAUR Pir Mehr Ali Shah Arid Agriculture University Rawalpindi PSI Pound-force per square inch rDNA Ribosomal DNA rpm Revolutions per minute spp. Species

TEF Translation Elongation Factor

Tris Hydroxymethyl aminomethane

UK United Kingdom

USA United States

xiii

ACKNOWLEDGEMENT

I would like to be thankful to Allah Almighty, the most Beneficent, the Kind and the Merciful, who blessed me with intellect, efficiency, capacity, kind teachers and loving parents to complete this piece of work. It is He alone, who banishes darkness from the human soul and illuminates it with His heavenly rays of knowledge. Countless salutations are upon the Holy Prophet Hazrat Muhammad

(Peace Be Upon Him), for enlightening with the essence of faith in Allah and guiding the mankind the true path of life.

Undertaking this PhD has been a truly life-changing experience for me and it would not have been possible to do without the support and guidance that I received from many people.

I express my deep sense of gratitude to my Supervisor, Associate Professor

Dr. Abid Riaz, Department of Plant Pathology, Pir Mehr Ali Shah University of Arid

Agriculture Rawalpindi. He is a perennial source of encouragement, guidance and help. He supervised my work and manuscript with unwearied zeal and unflagging academic excellence.

I am also very thankful to the members of my supervisory committee, Dr.

Farah Naz, Assistant Professor, Department of Plant Pathology and Dr. Imran

Hassan, Assistant Professor, Department of Horticulture, PMAS-Arid Agriculture

University Rawalpindi, for their cooperation and fruitful suggestions to me whenever

I needed.

I have an unpayable debt to my Mother and Father whose wish motivates me in striving for better education and for their prayers, patience and moral support.

xiv

My deepest affections for my loving sister, brothers, nephews and nieces whose hands always rose for my success and doing things for me that are out of the way.

I must express my gratitude to Professor Dr. Mark L. Gleason, Department of Plant Pathology and Microbiology, Iowa State University (ISU) for his continued support, encouragement and guidance during my research work in ISU. My thanks also go out to the support I received from Dr. Leonor F. Leandro, Dr. Hafizi Rosli,

Dr. Xiaoyu Zhang and Hayley M. Nelson at Department of Plant Pathology and

Microbiology, Iowa State University (USA).

I am heartily thankful to all my friends and special thanks to my dearest friends

Khurrum Shahzad, Ch. Jamshed Naveed, Azm Habib, Ahsan Raza, Sohaib Azhar,

Muhammad Umair and Late Syed Hamad Ali along with my colleagues and fellows especially Dr. Abdul Sattar, Muhammad Shahid, Dr. Najma Tabussum, Dr.

Salman Ghuffar, Aamir Bashir, Yasin, M. Kamran Aslam, Dr. Adnan Ahmed, Dr.

Amjad Shahzad, Dr. M. Fahim Abbas, Dr. Raees Ahmed and Dr. Sajjad Hyder for their supportive roles. I also appreciate Faiqa Ambreen for her cooperation and sharing with me some tough times during the course of present studies.

I also acknowledge Higher Education Commission for providing financial support under IRSIP due to which I have been able to conduct a part of my research work in ISU.

May Allah Almighty bless them all (Ameen).

NASIR MEHMOOD [email protected]

ABSTRACT

Strawberry (Fragaria x ananassa Duch.) is a member of family Rosaceae and is among the most widely consumed fruit throughout the world. Its fruit ripens in early spring which gives good economic returns to the farmers. Strawberry crop suffers from numerous diseases and among them, fungal diseases are highly destructive. As no systematic research, so far has been conducted in Pakistan regarding strawberry diseases, the present study was conducted to determine disease incidence and prevalence of important fungal diseases of the strawberry crop and the morpho-molecular characterization of associated fungal pathogens. For field-based disease assessment, a two year (2014-15 and 2015-16) disease survey of farmer fields was conducted in 12 important strawberry producing districts of Punjab

(Rawalpindi, Sargodha, Gujranwala, Sialkot, Narowal, Sheikhupura, Lahore and

Multan), Khyber Pakhtunkhwa (KPK) (Mardan, Charsadda and Swat) and important areas of Islamabad (ICT). On the basis of these surveys four major fungal diseases viz. Alternaira leaf spot (ALS), Fusarium fruit rot (FFR), Anthracnose

(Colletotrichum) fruit rot (AFR) and Bortyis fruit rot (BFR) or gray mold were found to be prevalent, with no prevalence in district Swat during both years in case of FFR while maximum of 100 % were observed in case of all fungal diseases. Disease incidence of ALS was recorded from 17.25 % to 55 %, followed by no disease to 59

% in case of FFR while 14.13% to 44.71 % of AFR and 17.13 to 48.88 % as of BFR.

Pathogens were identified on the basis of morpho-molecular characters. The morphological characterization was done on pathogenic isolates of 4 fungal pathogens viz. 82 isolates of Alternaria alternata, 77 isolates of Fusarium solani,

90 isolates of Colletotrichum spp. (68 isolates of C. acutatum and 21 isolates of C.

xvi

xvii3

gloeosporioides) and 92 isolates of Botrytis cinerea. These isolates were identified based on standard identification keys and results in identification of these pathogens.

A total of fifty four (54) highly virulent and representative isolates from each district were subjected to molecular characterization. Of these, 12 isolates were each of A. alternata and B. cinerea while 19 isolates were Colletotrichum spp. (12 of C. acutatum and 7 of C. gloeosporioides) and 11 isolates were F. solani. These isolates were amplified with ITS gene primers (ITS1/ITS4), endopolygalacturonase

(endoPG) gene primers (PG3/PG2b) for A. alternata, Beta (β)-tubulin (TUB2) primers (BT2a/BT2b) for Colletotrichum spp., translation elongation factor 1-alpha

(TEF-1α) primer (ef1/ef2) for F. solani and Glyceraldehyde-3-phosphate dehydrogenase (G3PDH) primers (G3PDH_for/G3PDH_rev) was for B. cinerea.

The nucleotide sequences further analyzed by phylogenetic software and resulted in genetic homology of current study isolates with previously reported isolates and hence confirmed the morphological identification. This research work provided the first comprehensive factual picture of fungal diseases of strawberry from Pakistan and proper morpho-molecular characterization of associated destructive pathogens and is expected to play a central function in future studies.

Chapter 1 INTRODUCTION Strawberry (Fragaria x ananassa Duch.) is known as the most delicious, most appetizing and very nutritive fruit. It is a member of the economically important family of flowering plants Rosaceae, subfamily Rosoideae and belongs to genus

Fragaria (Potter et al., 2007; Zheng et al., 2007. It is commonly known as Garden or cultivated strawberry and is among the most widely consumed fruits throughout the globe. Production of strawberry is two folds greater than of the total amount of all other berry crops worldwide and is adapted to a diverse range of climatic regions

(Stewart, 2011). Strawberry consumption is ranked 5th amongst fresh fruits after bananas, apples, oranges and grapes (Boriss et al., 2006).

Strawberry is native to both the northern and southern hemispheres. The first sketch of a strawberry plant was printed in 1484. A Roman senator, Cato used to mention strawberry between 234-149 BC. The first description of strawberry published accounts for its medicinal uses and no accounts were found related to its taste and as an attractive fruit (Liston et al., 2014). Carl Linneaus gave proper technical species name as Fragaria and later introduced it as edible fruit (Bender and

Harold, 1934; Sayers, 2009). Darrow (1966) reported that strawberry fruit is referred as Fragra or Fragrant in Latin literature. It is known as Fraise or Fragrant berry in

Italian, Spanish and Italian. The Narragansett Indians in North America called fruit as Heat berry or wuttahimneash.

According to the Food and Agriculture Organization of the United Nations

(FAO, 2016) statistics, strawberry is extensively cultivated small fruit crop and ranked amongst the top yielding fruit crop. It is produced in more than 75 countries worldwide and total land area under cultivation is about 237145.78 ha. Major

strawberry producing countries are USA, China, Spain, Turkey, Germany, Egypt,

New Zealand, Italy, Japan, Mexico, Morocco, Poland, Russia, Korea, Spain, United

Kingdom (UK) with estimated production of 8 million tons. United State of America

(USA) ranked top producer with 28% shares in world production and it ranked 4th most valuable fruit crop in terms production followed by grapes, oranges and apples.

In U.S, California produces about 75% of total strawberries followed by Florida. In

Florida, Plant City is famous and known as winter strawberry capital of world and hosts Florida strawberry festival.

Pakistan lies in the sub-tropical zone immediately above the tropic of cancer. It has four seasons and climate varies from tropical to temperate providing very suitable conditions for the strawberry cultivation (Asad, 1997). Wild strawberries are found on the hills of Azad Jammu Kashmir, Gilgit-Baltistan, Khyber Pakhtunkhwa and Murree (Khan and Nabi, 2016). The estimated area under crop in Pakistan is more than 1500 ha (Mehmood et al., 2017). Major strawberry production occurs in

Khyper Pakhtunkhwa, Punjab followed by Sindh, while Balochistan has a small share. The variety, Chandler is widely cultivated while Tufts, Corona, Douglas and

Pajaro are mostly cultivated for research purposes (Sara et al., 2013; Afridi et al.,

2009). However, its average yield per acre is very low compared to other strawberry producing countries due to lack of systematic research work, poor agronomic practices, Lack of pests and diseases management (Parveen et al., 2012).

In the recent years global strawberry commerce has grown many folds in both fresh and processed forms. According to statistical data by Trade Map Organization, worldwide business volume of strawberries surges 29% as compared to that of 2006.

Northern hemisphere produces approximately 98% of overall production (Hummer

and Hancock, 2009). Strawberry crop has become so important in commerce that it is now been listed in the Annex 1 of International Treaty on Plant Genetic Resources.

Strawberries are mainly valued for their tasty flavor and potential health benefits. It is well known as a medicinal fruit for centuries (Duchesne, 1766). It has abundant metabolites that strongly influence consumer’s mental and physical health

(Schwab et al., 2009). It is rich source of vitamin C, B complex, fiber, potassium, manganese, fluorine, copper, iron and iodine and phytochemical especially ellagic acid. It also contains ample variety of anthocyanins, phenolic compounds, anti- inflammatory and anti-carcinogenic properties that could improve associated oral maladies (Palacios et al., 2009; Davies, 2010; Giampieri et al., 2012). A handful of strawberries are sufficient to fulfill the vitamin C recommended daily allowance

(RDA) (Carr and Frei, 1999). It is found that strawberry extract increased the activity of antioxidant and oxidative stress repair enzymes (Zhang et al., 2008). Strawberries are widely used in making of smoothies, wine, stuffed chocolate, Cocktails, flavored milk, Juices, in variety of confectionery, cosmetic and hair related products and also in perfumes (Boriss et al., 2006). Its consumption in relation to human health and prevention of chronic diseases is an active research area as it is amongst top food items to have highest pesticide residues (Romandini et al., 2013).

Strawberry fruit has short shelf life of about 2 to 3 days at room temperature.

High perishability of fruit resulted in postharvest decay due to its biotic and abiotic factors (Zheng et al., 2007). Strawberry is vulnerable to a large and diverse number of pathogenic causal agents that includes of fungi, bacteria, viruses and nematodes etc. Among these, fungal pathogens cause major diseases. Fruit rots caused by fungal pathogens either in pre-harvest or post-harvest stages is of great economic

importance. Among them fungal pathogens such as Alternaria spp., Fusarium solani, Aspergillus spp., Botrytis cinerea, Rhizopus stolonifer, Rhizoctonia solani,

Phytophthora cactorum, Sclerotinia sclerotiorum, Colletotrichum spp.,

Mycosphaerella fragariae, Diplocarpon earlianum, Gnomonia comari, Alternaria spp. , Pestalotia longisetula and Podosphaera aphanis are reported to be associated with major diseases of strawberry (Khafagi, 1982; Tadrous, 1991; Mehmood et al.,

2017; 2018a &b; Zheng and Sutton, 1994; Wing et al., 1995; Smith, 2008; Maas,

1998; Braun et al., 2002; Tarek, 2004; Siefkes-Boer et al., 2009; Tao et al., 2010).

Diseases are responsible for major pre and post-harvest losses. The most common cause of pre and post-harvest decay is Botrytis cinerea, commonly known as gray mold. Botrytis species are among the most common plant pathogen (Jarvis,

1977). It is widely distributed and affecting more than 200 hosts of economic importance including dicots, vegetables, horticulture crops in temperate and subtropical regions. It can affect any part of the plant at any growth stages. Globally it causes losses of $100 billion. Botrytis fruit rot (BFR) is one of major disease infecting strawberries (Elad et al., 2007, Williamson et al., 2007). Humidity is of utmost important in the occurrence of gray mold. Frequent rain spells with high temperature results in high disease incidence. In Ohio, USA, gray mold resulted in

100% infection when coupled with 24h of wetness and optimum temperature (Bulger et al., 1987).

Fusarium root rot complex and fruit rot is common in strawberry plantings worldwide and different Fusarium species are recorded to be involved (Koike et al.,

2009, Mehmood et al., 2017). These species can occur singly or in combination and cause a variety of diseases, of which fruit rot and crown rot are the most damaging.

In Iran, several Fusarium spp. causes strawberry root and fruit rot but not easily identified and sometimes referred to several other pathogens (Ayoubi and Soleimani,

2016). Fusarium wilt on strawberry has been reported in Australia (Golzar et al.,

2007; Fang et al., 2011) and is a serious disease on strawberry in Korea (Kim et al.,

1982), China (Zhao et al., 2009), Spain (Arroyo et al., 2009) and the USA (Koike et al., 2009).

Strawberry leaf spot diseases are caused by number of pathogens among which Alternaria alternata (Fr.) Keissl is of great importance. Alternaria leaf spot caused by a distinct pathotypes of fungus and was first recorded in Japan during 1977 and later in Korea during 1980 (Watanabe and Umekawa, 1977; Chao and Moon,

1980). Symptoms are circular or irregular dark brown to black lesions, which are developed on upper surface of leaf and may have dark reddish or pale margins in some conditions. Cultivars differ in term of their susceptibility to Alternaria leaf spot; whereas sensitive cultivars are killed in case of severe attack (Cavanni et al.,

1993; Diekmann et al., 1994).

Colletotrichum is one of most important fungal pathogen associated with more than 1000 hosts ranging from tropic, subtropic woody and herbaceous plants.

It is considered as 8th most important group of plant pathogenic fungi around the globe (Hyde et al., 2009; Dean et al., 2012). Colletotrichum spp. are known to cause die-back, root rot, leaf spot, fruit rot, defoliation and blossom and seedling blight.

Three species of Colletotrichum were found to cause diseases of strawberry viz C. acutatum, C. fragariae and C. gloeosporioides. Each of these species produces symptoms which include crown rot, fruit rot and lesion on stolons and responsible for huge losses (Gunnell and Gubler, 1992). In China, it is reported that anthracnose

is involved in nearly 50% mortality at seedling stage while more than 40% yield losses in strawberry fields. For many years, the strawberry (Xie et al., 2010).

Management of fungal diseases is seriously hindered by difficulty in the detection and control during symptomless infection on strawberry leaves and unripe fruits (Guidarelli et al., 2011). Presently, the control of strawberry fungal diseases mostly depends on fungicides use. Residues of synthetic fungicide on fruit surface are difficult to decompose and become residues in the human body leads to serious health problems (Debode et al., 2009).

For the identification of the pathogens, traditional approaches like symptoms, morphological and pathogenic characteristics are widely used (Narayanasamy, 2011) however, identification solely based on the said characters has often proved inadequate for species level identification, therefore, modern molecular techniques like polymerase chain reaction (PCR) assay along with sequence analysis have been ascertained an effective tool for the diagnosis of fungal species (Mcdonald, 1997).

The internal transcribed spacer (ITS) region comprises of ITS2, 5.8S and ITS1 is highly conserved for the fungal kingdom which allows high amplification success using universal ITS1/4 primers in PCR (White et al., 1990).

The conserved ITS region provides reliable molecular evidence for some fungal pathogens but specific gene sequences are recommended for others i.e.

Alternaria sp., Fusarium sp., Colletotrichum sp., and Botrytis sp. Most commonly used genes include endo-polygalacturonase (Endo-PG), translation elongation factor

1-alpha (TEF-1α), beta tubulin (BT/TUB2) and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) (Andrew et al., 2009; Geiser et al., 2004; Glass &

Donaldson, 1995; Williamson et al., 2008).

Considering the commercial scale cultivation of strawberry in Pakistan and non- availability of literature on fungal diseases, there is a dire need of a comprehensive study and a detailed investigation for understanding the association of fungal pathogens and their species involved in strawberry diseases in Pakistan. Also remains the question about the relationship between morphological and genetic nautre of important fungal pathogens involved in these diseases. The present study, therefore, focuses on:-

• Determination of incidence of major fungal strawberry diseases in important

strawberry growing areas of Punjab, Khyber Pakhtunkhwa and Islamabad.

• Morphological and molecular characterization of important fungal pathogens.

Chapter 2

REVIEW OF LITERATURE

2.1 STRAWBERRY HISTORY AND IMPORTANCE

Strawberry (Fragaria x ananassa Duch.) is considered as an important berry

crop grown throughout the world belongs to the family Rosaceae and genus Fragaria

(Smith and Charter, 2010). Strawberries are unique with its highly desirable taste

and profound nutritional value. Technically, the strawberry is an aggregate accessory

fruit. Strawberry fruits are botanically comprised of many achenes (seeds) that are

embedded in fleshy receptacle tissue. In many strawberry producing regions, fruit is

produced during winter when days are short. This morphological combination is

common mostly in all species of Fragaria and seemed to be evolved in three parallel

times in Potentilleae tribe of family Rosaceae (Eriksson et al., 1998).

Fragaria x ananassa, which is also known as pineapple strawberry, was the

species name given by Duchesne to the natural hybrid of F. chiloensis subsp.

chiloensis and F. virginiana subsp. virginiana which evolved naturally in Europe

during early 1700s (Hancock, 1999). F. chiloensis subsp. chiloensis imported from

Chile to Europe during early 1700s was basis of natural hybridization with F.

virginiana subsp. virginiana from North America, evolved as F. ananassa subsp.

ananassa, now termed as hybrid of commerce or pineapple strawberry. Chiloensis

has been used as a source of winter hardiness, resistance to strawberry root infections

and resistance to viral diseases in various breeding programs (Staudt, 1999).

Duchesne (1766) was endorsed for publishing the best earliest taxonomic description

of strawberries (Hedrick, 1919; Staudt, 1962).

Now-a-days a large number of strawberry cultivars are available worldwide.

These cultivars differ from each other in terms of yield, fruit quality (colour, taste, firmness etc.) sowing time, harvesting time and disease and pest resistance (Kruger,

2012). The choice of cultivar also depends on the grower’s requirements and the environmental conditions. Therefore, one cultivar may tend to perform differentially in diverse regions or environments (Maas, 1984).

2.2 MAJOR STRAWBERRY FUNGAL DISEASES

All over the world strawberry crop faces a number of stresses either of biotic or abiotic nature (Sara et al., 2013). Among biotic, a wide array of fungal pathogens affects and are more crucial on strawberry crop not only affecting its yield but also market value. A variety of fungal pathogens targets the strawberry crop including soil borne fungal pathogens and many others. These diseases are of great importance because they cause visible and direct economic losses, not only in field but also during storage and transportation of fruits to market place. Fresh strawberries have a very short post-harvest life and cannot be stored for a longer period of time (Hong et al., 1998). Post-harvest losses are usually more severe, particularly because such conditions are favorable for development of disease where in some cases 80-100% of a crop may be lost (Larena et al., 2005). During storage and transportation, postharvest diseases may significantly lower the quality and market value of these strawberry fruits. Therefore, some very important fungal pathogens infecting strawberries are; Botrytis, Colletotrichum, Alternaria, Fusarium, Rhizopus, Mucor,

Phytopthora (Dignand, 2004).

2.3 Botrytis cinerea (GRAY MOLD)

Botrytis cinerea Pers. Fr. is an ascomycete that belongs to class

Leotiomycetes, order Helotiales, family Sclerotiniaceae and genus Botrytis. Perfect

or sexual stage of B. cinerea is Botryotinia fuckeliana (de Bary) Whetz. It is usually classified as cosmopolitan, filamentous and necrotrophic fungus (Jarvis, 1977;

Beever and Weeds, 2004; Elad et al., 2007 and Williamson et al., 2007). There are about 25 to 30 species in genus Botrytis, all of them are ranked as necrotrophic plant pathogens. As a result of sequenced based phylogeny in 2005 of 22 recognized species, several new special have been described. Present system of classification is widely based on morphological characteristics of the species and to some extend on host range and physiological properties. Botrytis species were grouped into two distinct phylogenetic clades (Staats et al., 2005). It is economically very important plant pathogen causing disease at both pre and post-harvest stages in at least 235 species of host plants. These include nursery plants, ornamentals, and crops, many of which are economically important such as beans, lettuce, cucumber, cabbage, and small fruits like grapes, blueberries, blackberries, and strawberries. B. cinerea can infect plant at any stage of development and on any part of plant i-e petioles, flowers, leaves and fruits (Staats et al., 2005; Wahab et al., 2010; Dean, 2012).

The fungus becomes very destructive on older tissues of the host, when it remains quiescent and latent infection progress without any visible symptoms until onset of conducive environment and change in host physiology. Genus Bortytis is of great economic importance with great phenotypic diversity and due to that it is subjected to number of studies ranges from taxonomy, ecology, molecular biology, control and prevention measures. Some variation had been reported among various isolates of Bortytis spp. in morphological characters and aggressiveness of the pathogen while various species shares similar morphology (Hutson and Mansfield,

1980; Giraud, 1999; Elad et al., 2007 and Chardonnet et al., 2000).

Pre and postharvest rotting of strawberry fruit are of vital significance because these not only cause fruit losses but also increases the cost of harvesting, packaging, cooling and transportation (Maas, 1998; Terry and Joyce, 2000) and of vital significance because not only caused fruit losses but also increase costs of harvesting, packaging, cooling and transportation. Gray mold disease can cause important fruit losses on strawberry plants and it is estimated that they can cause yield losses up to 25% for untreated strawberries (Williamson et al., 2007; Zhang et al., 2007). Botrytis fruit rot results in loss of quality frequently due to the onset of rots. In strawberry, the fungus can attack flowers, fruits and leaves, where Infection might occur in flower where it persists as latent until fruits mature and then grow profusely resulted in rotting complemented by abundant sporulation of fungi (Terry and Joyce, 2000; Kovach et al., 2000). Under field conditions, mycelia formed the conidiophores and conidia whereas sclerotia are produced in the necrotic tissues and debris of the plants during spring when temperature tends to raise (Stromeng et al.,

2009). Subjected to the susceptibility of strawberry cultivar, gray mold can cause more than 15% pre-harvest fruit loss (Legard and Chandler, 2000; Legard et al.,

2000) and overall 28-42% postharvest losses. According to study conducted by

Salami et al., 2010, the averages loss of strawberry fruits during post-harvest stages in Iran were found to be 28% whereas, Mehmood et al., 2018a also reported that

Botrytis fruit rot have 100% prevalence in major strawberry producing areas of

Pakistan. It infects strawberry plants more vigorously during flowering stage and then become inactive inside the fruit until favorable conditions came (Babalar et al.,

2007). When weather favors it proliferates during ripening and senescence by starting its necrotrophic activities (Prusky and Lichter, 2008). When shared with

water loss, softening and wounding of fruit during handling and transit, more than

40% may be losses before the fruit reaches market (Wright and Billeter, 1975). B. cinerea produced velvety gray growth on fruit surface. Under high humidity conditions it turned into white cottony growth with little or no spore. Braun and

Sutton (1987) has found that 90-99% of the fungus conidia are produced in the petioles and laminae of the dead strawberry leaves. Dampness is the major factor in the regulation of mold rot with optimum temperature of 15-20ºC and relative humidity more than 90%. Even though if these suitable conditions remained for more than 28hrs leads to the epidemics of the gray mold rot of strawberries.

Typical identification of B. cinerea is carried out by characteristics features of its cultural and morphological features. It produces grey, dark grey to greyish white colonies on PDA with production of aerial fluffy mycelium. One of major characteristics to distinguished Botrytis from other fungal pathogens is the production of conidia in microconidiogenous hyphae that resembles like grape bunch. Shape of conidia varied from ellipsoid, oval, pear to lemon shaped, unicellular, and usually non septate. Conidia color observed as white, pale brown to dark brown and measured 10.3-27.5 × 4.0-25.6 µm in diameter. Conidiophore formed as erect, septate structures and measured 650-3020 µm in length. Production of resting spores occurred on older culture, dark brownt o black in color and measurement ranged between 1-10mm in size (Ellis, 1971; Jarvis, 1977).

There is no single key for all available Botrytis species and identification of species on basis of traditional standards can be a challenging task. Furthermore, genetic variability has been recorded in the genus Botrytis and molecular tools showed significant variability among different species collected from numerous host

plants and geographical regions. Discrimination of fungi at species-level had been investigated using ITS rDNA test, but variation in the ITS region within Botrytis is low (Kerssies et al., 1997; Nielsen et al., 2001 and Dufresne, 2007) It is responsible for causing major disease commonly known as gray mold or Bortyis fruit rot in strawberry and grapes that leads to low quality of fruit and reduced quantity due to uselessness of fruit after infection (Elad et al., 2007).

Among all of fruit rot fungal pathogens, Botrytis cinerea and Colletotrichum spp., especially C. acutatum are the pathogens responsible for major fruit rot diseases of strawberry around the globe. Both pathogens cause huge losses to fruits and accounts for greatest quantity of fungicide use among strawberry producing nations, hence consequently increase the input cost (Mass, 1998). The New Zealand strawberry industry experiences losses due to fungal diseases that can cost up to $4.4 million per annum or 20% of the crop value. Appearance of noticeable symptoms of decay indicates end of strawberry acceptability (Timudo-Torrevilla et al., 2005;

Jabbar et al., 2010). For treatment of B. cinerea worldwide on all vulnerable crops, about €540 million has been consumed yearly that accounts for 10% of worlds total expenditure on fungicides. Spain is among top producers of strawberry in world and uses about €2m for using fungicides to protecting strawberry crop alone. Chemical control is only considered as a control measure for the management of gray mold (Li et al., 2012).

2.4 Colletotrichum acutatum AND C. gloeosporioides (ANTHRACNOSE

FRUIT ROT)

A number of fungal species belonging to genus Colletotrichum are associated with diseases of plants, commonly known to as anthracnose. It can affect a very wide

range of hosts and the pathogenic pathogens are characterized by a worldwide distribution. It is assumed that in virtual terms, every botanic family that is being cultivated is susceptible to one or more than one Colletotrichum species and among one of most widely studied phytopathogenic fungi. Amongst common host, strawberry is considered as one of most important (Prusky et al., 2000; Dean et al.,

2012). C. gloeosporioides is so far emerged as most important species and attacks more than 470 different hosts. Whereas, C. acutatum is considered as one of major pathogen of strawberry crop and also infects more than 34 host genera (Walkers,

1991; Cannon, 2008).

In strawberries, anthracnose symptoms may be present on leaves, petioles and in the form of small to large dark and sunken lesions on green as well as mature fruits, which in later stages develop into hard lesions and under highly relative humidity covered by abundant orange masses of conidia in a mucilaginous matrix on ripen fruit (Maas, 1998). Anthracnose fruit rot (AFR) is significant worldwide on strawberry after gray mold. Three species of the fungus from the genus

Colletotrichum have been described as causal agents of anthracnose in strawberry viz. C. acutatum, C. fragariae and C. gloeosporioides (Denoyes-Rothan, 2005).

Fungus infects strawberries under nursery conditions, field production or during harvest and post-harvest stage. All three species can be found on all parts of the plant

(Garrido et al., 2008), although C. fragariae and C. gloeosporioides are termed as primary pathogens of crown rot, whereas C. acutatum has been widely recognized as the principal pathogen involved in anthracnose fruit rot (Mertely and Legard,

2004).

The worldwide distribution of Colletotrichum species may vary. In US, two

species of Colletotrichum viz. C. gloeosporioides and C. fragariae have been reported to cause heavy damage, mainly in the south-east part (Florida), whereas C. acutatum is key species prevalent in the south-west region (California). However, in

Europe, anthracnose is most often caused by C. acutatum. Colletotrichum spp. comprises a diverse range of important phytopathogenic fungi that cause pre and postharvest crop losses worldwide. On berries pre-harvest yield losses due to both

Colletotrichum spp. were reported from 10-30% annually whereas, post-harvest losses can reach up to 100% as the fungus have tendency to become dormant and to cause latent infection (Milholland, 1995). In France, anthracnose contributes for more than 80% losses in unprotected crop, particularly in case of ever bearing strawberry cultivars (Denoyes and Baudry, 1991).

The strawberry anthracnose symptoms produced are similar and occur most commonly on runners, flowers and fruits. In the fruit, the fungus causes circular lesions, which are firm and sunken and become black spots on mature fruit

(Denoyes-Rothan, 2005; Garrido at al., 2008). Within the crown tissue,

Colletotrichum spp. cause red-brown discoloration and necrosis of the fruits (Smith,

2008) or even the wilting of infected plants during periods of moisture stress, such as early afternoon in the summer. Under environmental conditions that favor infection, this process may continue for several days until the crown infection is extensive and resulted in the wilting or death of whole plant. These fungal pathogens uses some specialized structures to develop infection of the host, these includes germ tubes, appresorria, intercellular hyphae and secondary necrotrophic hyphae. The infection process starts with the landing of conidia on plant surface which after germination produces germ tubes and then continue to form appresorria and later

these penetrate the cuticle of the plant directly (Curry et al., 2002). Initial production of conidia occurs in acervuli, yet C. acutatum is also capable of forming secondary conidia (Leandro et al., 2001).

The pathogen grows underneath the cuticle by developing a sub-cuticular internal complex grouping of hyphae prior to distribution all over the tissue. During infection process of C. gloeosporioides, the infection continues with the development of secondary necrotrophic hyphae, which results in death of plant cells by consuming cellular fragments as source of nutrients (Bailey et al., 1992).

Infection by C. acutatum can occur on nursery plantings and the disease can then be spread on plants from the nursery to the field (Freeman, 2004). Wright and Heaton,

1991 reported that C. acutatum causes losses ranged from 25 to 50% of celery crop in Queensland, Australia. In China for many years, the strawberry production area was affected by the disease. Management of this disease is greatly hindered by the difficulty in detection and control of this fungus during symptomless infections on strawberry leaves and unripe fruit (Guidarelli et al., 2011).

For morphological characterization of Colletotrichum spp. characteristics such as colony morphology, conidial shape, the presence or absence of setae and sclerotia, and appressorium shape and size have been used for differentiation of species in the genus Colletotrichum (Sutton, 1992). C. acutatum produces pale orange to orange colonies with aerial mycelium or suppressed mycelium. Few orange conidial masses are also produced around the centers. Salmon pink, pale brown to orange color conidia produced and observed as straight, fusiform and tapered from one or both ends having dimension of 7.5-17.8 × 2.5-7 µm and rarely production of setae occurs. While, in case of C. gloeosporioides produced pale grey, dark gray,

white to yellowish white zonate colonies with abundant orange color conidial masses at the center of the colony. The conidia size ranged from 6-20.7 × 3.5-6.4 µm with pale color conidia which can be greyish white to dark brown. Production of setae in acervuli observed in the fungi (Sutton, 1992; Smith and Black, 1990; Than et al.,

2008). Colletotrichum spp. on artificial media produces number of intermediary conidia and differs considerably in colony appearance (Cannon et al., 2000). Many of the morphological aspects of this genus are largely variable and relied on cultural and environmental conditions which are difficult to standardize (Sutton, 1992).

2.5 Alternaria alternata (ALTERNARIA LEAF SPOT)

Leaf spot is among one of the common diseases in plants. Different studies reported that leaf spot is caused by numerous fungal pathogens i.e. Alternaria,

Ceratocystis, Diplocarpon, Phoma etc. Alternaria belongs to phylum Ascomycota, family Pleoporaceae and order Pleosporales. It is a ubiquitous fungal genus present in saprophytic, endophytic and pathogenic forms. This genus is associated with wide range of substrate e.g. seeds, plants, human being and animals (Rotem, 1994). More than 1200 species have been reported since 1976, but Simmons (2007) classification accepted 300 species recently, Woudenberg et al. (2013) revised the genus and included 32 new combinations and proposed 10 new names on the basis of morpho- molecular characterization. Alternaria is responsible for causing 20 % losses but under favorable conditions losses can be high as 80 % and the genus ranked 10th among 2000 fungal genera. (Simmons, 1997, Thomma, 2003). Most of the Species of genus Alternaria are important phytopathogens (Lawrence et al., 2012). In

Alternaria genus, particularly the A. alternata (Fr.) Keissl. species group has broad host range and alone is recorded as causing leaf spots, rots and blight diseases on

over 100 host plants (pryor et al., 2002; Thomma, 2003). Among leaf spots, black leaf spot of strawberry is also one of the common and widespread foliar disease in strawberry prevailing around the world where ever the strawberry is grown. It is caused by number of Alternaria spp. but two most important spp. involved are A. alternata and A. tenuissima Cho and shin, 2004; Simmons, 2007).

Symptoms of the disease were usually light to dark brown or black in color also known as black spot, showed either on infected leaves and fruits. Usually leaf pots were observed as roundish-oval to irregular spots in shape having diameter ranged from 1-6 mm in initial stages. Under favorable conditions spots can coalesce and form enlarged blackish areas surrounded by yellowish halos on the strawberry leaves, often producing 'Shot hole' during severe infection. The spots with characteristic concentric circumference or target board-like appearance were occasionally found. The disease severity on foliage was more common during humid weather and the lesions got covered with brown-black bloom of fungal sporulation and symptoms were most pronounced on nutrient deficient leaves (Mehmood et al.,

2018b; Nagrale et al., 2012 & 2016). In the case of black leaf spot of fruits, the symptoms were tan to brown spot filled with blackish mass of fungal spores.

Alternaria leaf spots on strawberry was reported form different parts of the world i- e Pakistan where its incidence was found to be from 17-55 % during pre-harvest stage (Mehmood et al., 2018b). Plant leaves are essential part of plant food supply as they are primary sites of conversation of light into metabolic energy by the process of photosynthesis. Strawberry plant has small number of leaves and total leaf area of a plant is directly associated with the production of fruit (Mass, 1998).

Up till now, classification and identification of different species of genus

Alternaria have been basically done on cultural characters like colony color, growth pattern, growth rate and morphological observations of conidia shape, size, ornamentation and patterns of conidia catenation etc. Ellis (1971) and Simmons

(2007) while conducting studies on morphological characterization of A. alternata observed the colonies of the pathogen as velvety, oppressed, powdery and fluffy having gray, brown or dark olivaceous brown to dark blackish brown in color.

Further studies of microscopic characters revealed that the mycelium produced ranged from aerial to immersed while hyphae is branched and septate, initially colorless while turn brown to dark brown later having 1.5-7.5 µm in thickness. The conidia grow in chains pale, light to dark brown conidia and conidiophores. Conidia were cylindrical to oblong, muriform in shape having beaks having size from 20-70 by 9-30 µm in dimensions. Conidia were found to have transvers as well as longitudinal septation ranged from 2-7 and 0-4 respectively.

To date, broad morphological categories within Alternaria have been supported by phylogenetic analyses (Pryor and Gilbertson, 2000; Peever et al.,

2002). Phylogenetic studies have demonstrated a clear distinction between large and small-spored Alternaria species (Peever et al., 2002). Previous molecular phylogenies of this group have revealed little to no variation in the genetic loci commonly employed in fungal systematics. The sequence data of the nuclear ribosomal internal transcribed spacer (ITS) and the mitochondrial small subunit

(mtSSU) provided no resolution among these taxa (Pryor and Gilbertson, 2000; Chou and Wu, 2002; Kang et al., 2002; Pryor and Bigelow, 2003). The mitochondrial large subunit (mtLSU) ribosomal DNA, beta tubulin (bt/tub2), translation elongation factor alpha (TEF) also revealed no differentiation among members of this group

(Crous et al., 1999; Peever et al., 2002). To date, only an endopolygalacturonase

(endoPG) gene, and two anonymous loci have proven sufficiently variable to differentiate members of the alternata species-group (Andrew et al., 2009).

2.6 Fusarium solani (FUSARIUM FRUIT ROT)

Fusarium solani (Mart.) Sacc. was first described as a member of genus

Fusisporium in 1842 by Von Martius from rotted potato tubers. Later in 1881,

Saccardo assigned it to genus Fusarium. In the year 1941, Sander and Hansen revised F. solani and included it in a complex group of species that are widely distributed in soils and responsible for rots on number of plant parts (Desjardins,

2006). It is a diverse species and is categorized into the section Martiella (Booth,

1971). It can be classified into 50 sub specific lineages and most of them have not been further well defined properly (O’Donnell, 2000). It is considered as a common and well recognized plant pathogen, causing several types of infections with an extensive host range and there are estimated to be least 111 species of plants belonging to some 87 genera that are normally infected by the fungus, F. solani

(Kolattukudy and Gamble, 1995). F. solani is documented to cause crown and root rot of strawberry in Spain which is among the major producers of strawberry while recently been reported to cause strawberry fruit rot in Pakistan with disease incidence ranges from 15 to 56% (Pastrana et al., 2014; Mehmood et al., 2017). It infects number of plants i-e. Papaya, Marjoram, Mango, Sweet potato, Tomato, Potato,

Soybean, Phalaenopsis, Cymbidium and has achieved the status of economically important pathogen in regions of world like Europe, Australia, USA and Asia

(Quimio , 1976 ; Cho et al., 2001; Khanzada et al., 2004; Zaccardelli et al., 2008;

Laurence, 2016).

Strains of F. solani are also of world-wide occurrence as root rots but may also cause cankers of hardwood trees. A latest review of the plant disease list updated by the American Phytopathological Society (APS) showed that from a list that had a total of 100 economically important plants, more than 81 had at least one Fusarium species associated with each. The disease caused by the fungus have a diverse range in terms of the severity and part of plant infected e.g. may include root, stem and fruit rots, wilting, cankers and foliar diseases. Therefore, proper identification of the associated Fusarium strains in infected plant samples remains an essential task in various plant diagnostic laboratories (Leslie & Summerell, 2006).

Morphological identification is widely used for identification of the

Fusarium spp. and based on similarities and differences of these characters. Major characters used both primary characteristic of macroconidia and microconidia, production of chlamydospores, shape and secondary characters like culture characters including colony color, growth habit and pigmentation (Nelson et al.,

1994; Leslie and Summerell, 2006). Usually colony diameter ranged from 84.0 mm to 90 mm. On PDA pathogen showed good mycelial growth and abundant sporulation. The Pure colonies were cottony white, creamy white, floccus white in color having cottony raised, sparse to dense growth habit. The margins of colonies vary from smooth to irregular. The fungus F. solani produces two types of asexual spores viz. micro and macro conidia. Microconidia in this fungus are of reniform, kidney shape to oval while macroconidia were curved, tapered and pointed having

3-7 sepatation. The size of microconidia ranges from 6.60× 3.30 to 19.80 × 7.60 µm while macroconidia dimensions ranged from 20.67 × 3.1 to 58.85 × 7.4 µm. The observation of Phialides are consider important. Fusarium spp. produces two type of

Phialides i.e., monophialides and polyphialides. The types of phialides used basically for separation of isolates into groups but some species can be delimited based on the formation of polyphialides that differentiate among F. solani and F. oxysporum. The shape of apical and basal cell shapes of macroconidia were also considered good parameter to separate F. solani from other species. In culture, resting spore namely chlamydospores were produced after 7-15 days old cultures. Brown to black chlamydospores formed were relatively sparse to abundant in media plates usually one or two celled. Some species like F. verticilloides and F. proliferatum don’t produce chlamydospores (Booth, 1971; Nelson et al., 1993; Nelson et al., 1994;

Leslie & Summerell, 2006).

Morphological identification of Fusarium species is difficult, time consuming, requires experts and may not suffice for complete identification (Leslie

& Summerell 2006). Various genomic regions such as TEF-1α, α/β- tubulin and rDNA spacer regions have been evaluated as molecular diagnostic tools for identification of Fusarium isolates (Geiser et al., 2004). Hyde et al. (2014) suggested that the ITS region is less informative in Fusarium from both a barcoding and phylogenetic perspective at the species level, and as a result it has not been used extensively whereas, According to (Summerell et al., 2003; Geiser et al., 2004) translation elongation factor 1-alpha (TEF-1α) gene region becomes the marker of choice as it sequences are highly informative regarding closely related species by comparing the nucleotide sequences with FUSARIUM-ID database, that provides rapid and accurate identification of most pathogenic Fusarium species. F. oxysporum is also reported to cause severe infections and yield losses in a number of economically important crop plant species (Michielse and Rep, 2009).

2.7 MOLECULAR TOOLS

Polymerase chain reaction assay (PCR) is most important and sensitive technique at present accessible for the detection of plant pathogens. Latest advancements in PCR technology have unlocked alternate methodologies for the proper detection and accurate identification of fungal pathogens of strawberry crop, even on-site alternatives under field conditions, away from the laboratory, are now available, providing results quickly (Capote et al., 2012). New applications of polymerase chain reaction assay are being published at an increasing rate and it is evident that it will be used in many fields of basic and applied research. Due to

Quick, reliable, result oriented and simple techniques for finding the species make up of fungal communities established on sequencing particular regions of the fungal genome have proven a reliable substitute to traditional approaches. The evolution of

PCR towards real time PCR permits faster and more precise detection and quantification of pathogens in a computerized and automated reaction. Furthermore, it is not necessary to isolate the pathogen from the infected material, reducing the diagnosis time from weeks to hours, and allowing the detection and identification of non-culturable pathogens. This characteristic has been especially useful in the analysis of symptomless plants. However, the frequent presence of PCR inhibitors in plant tissues or soil can reduce considerably the sensitivity of the reactions and may even result in false-negative results. (Singh et al., 2008; Horton et al., 2001).

The optimization of an experimental PCR set-up focuses on three fundamental steps: (i) extraction of total community DNA/ RNA from the environmental sample; (ii) selection of a specific target region of the DNA/ RNA to identify the fungus; (iii) identification of the presence of the target DNA/RNA region

in the sample (Atkins and Clark, 2004; Capote et al., 2012). In recent years, many research studies have been published reporting improvements to each of the fundamental steps described above and working on some of the most serious fungal pathogens of strawberry, such as B. cinerea (Suarez et al., 2005), Colletotrichum acutatum, Colletotrichum gloeosporioides (Debode et al., 2009; Garrido et al.,

2009), Fusarium oxysporum (Lievens et al., 2003). Garrido et al. (2009) optimized a DNA extraction protocol that can be used for samples of strawberry plant material directly, or from fungal colonies removed from an agar plate. This method uses sample material physically ground using a grinding machine, in the presence of

CTAB (Cetyl Trimethyl Ammonium bromide) lysis buffer. Garrido et al. (2009) demonstrated that this method is very reliable for extracting DNA from any strawberry plant material. The sensitivity and accuracy of PCR protocols depends mainly on the instrumentation and technique used (i.e. conventional PCR versus real- time PCR), but in a high proportion of cases, this sensitivity depends on the quality of the total DNA/RNA extracted from the environmental samples.

Ribosomal genes and spacers regions within the fungal genome are good candidates for amplification via polymerase chain reaction because they are comprised of highly conserved tracts with heterogeneous regions in between. The conserved tracts are ideal for universal primer design that can allow for the amplification and sequencing of heterogeneous regions (Turenne et al., 2009). Most molecular fungal species identification relies on the amplification and sequencing of the internal transcribed spacer (ITS) region of the fungal genome, which is highly variable among species or even populations of the same species. This region lies between the small subunit (SSU) and the large subunit (LSU) ribosomal RNA

(rRNA) genes and contains two non-coding spacer regions (ITS-A and ITS-B) separated by the 5.8S rRNA gene. In fungi, the Inter transcribed spacer region is typically 600-650 bp in size, including the 5.8S gene and is usually amplified by the universal primer pair inter transcribe spacer region one (ITS 1) and inter transcribed spacer region four (ITS 4) designed by White et al. (1990).

Chapter 3

MATERIALS AND METHODS

The current research work is comprised surveys of strawberry fields, to evaluate disease prevalence and incidence of major fungal diseases and collection of diseased samples, as well as isolate and purify fungal pathogens. Morphological characterization, pathogenicity assays and preservation. The research was carried out at the Fungal Plant Pathology Laboratory, Department of Plant Pathology, PMAS-

Arid Agriculture University, Rawalpindi and Department of Plant Pathology and

Microbiology, School of Agricultural Sciences, Iowa State University, USA.

Molecular parameters related to research including DNA isolation, amplification of fungal DNA by ITS1/ITS4, EF1/EF2, Bt2a/Bt2b and PG2b/PG3 primers using PCR, nucleotide sequencing and sequence analysis was undertaken at Department of Plant

Pathology and Microbiology, School of Agricultural Sciences, Iowa State

University, USA. The following studies were undertaken to achieve research objectives as mentioned at the end of Chapter 1.

3.1 DISEASE SURVEY AND ASSESMENT

3.1.1 Survey of Strawberry Fields

Detailed and systematic surveys of farmer’s fields in important strawberry growing areas were conducted in the months of March and April for two consecutive years during 2014-2015 and 2015-16. Surveys were conducted in important strawberry growing districts of Rawalpindi (33.59°N; 73.04°E), Sargodha (32.08°N;

72.67°E), Gujranwala (32.15°N; 74.18°E) , Sialkot (32.49°N; 74.53°E) , Narowal

(32.09°N; 74.87°E), Sheikhupura (25.14°N; 85.86°E) and Multan (30.19°N;

71.46°E) in Punjab province, while Districts of Mardan (34.21°N; 72.05°E),

Charsadda (34.14°N; 71.74°E) and Swat (35.49°N; 72.52°E) in Khyber

Pakhtunkhwa and Islamabad, (Islamabad Capital Territory, 33.72°N; 73.09°E) (Fig.

3.1). Surveys were conducted for the purpose of data collection related to prevalence and incidence of major fungal diseases in the strawberry production areas to collect isolates of different pathogens for further studies and to determine relative distribution of major fungal diseases. During, 2 years surveys, total of 191 farmer fields were surveyed. Surveys of the fields were conducted at flowering and fruiting stage of strawberry crop. Major disease’s map of Punjab, Khyber Pakhtunkhwa and

Islamabad was developed on the basis of surveying farmer’s fields and documentation of disease incidence and prevalence. Prior to disease survey, necessary information on strawberry plantation in various districts and years were discussed with Dr. Khalid Qureshi (Ex-Senior Director, Horticulture Research

Institute, HRI) National Agriculture Research Centre NARC, Islamabad.

3.1.2 Field Based Disease Assessments and Sample Collection

A total of 192 strawberry fields belonging to local farmers were accessed.

Ninety one (91) fields during crop season 2014-15 while (eighty-six) 86 fields were surveyed during crop season 2015-16. Surveys of Punjab, Khyber Pakhtunkhwa and

Islamabad (Islamabad Capital Territory) were conducted during late March to first half of April in 2014-15 and 2015-16 crop season. Due to scattered and infrequent strawberry plantation, most of the fields from each of the districts were surveyed by travelling alongside of road. For observations regarding prevalence and incidence of major fungal diseases in each field, samples consisted of 30 plants were selected randomly across a diagonal were examined according to the hierarchical sampling methodology (McDonald and Martinez, 1990). The total number of plants and

infected plants were manually counted and data was recorded. These observations were then used to calculate percentage of disease incidence and prevalence in each of the fields by using following formulae:

Locations showing fungal diseases 푃푟푒푣푎푙푒푛푐푒% = × 100 Total locations examined

Number of infected strawberry plants Incidence % = × 100 Total number of strawberry plant Diseased plants with typical symptoms were selected and collected by careful observation on the basis of visible or phenotypic symptoms of typical fungal diseases

(Schuck et al., 2014). Sample size depends on size of fields and on average between

10-30 samples per field were collected. Samples were placed in paper bags and labeled with required data indicating date of collection, location or area etc. These samples were brought to the Fungal Plant Pathology Laboratory, Department of Plant

Pathology, PMAS-AAUR and stored in a refrigerator at 4oC until used for isolation and further studies.

3.2 ISOLATION AND PURIFICATION OF PATHOGENS

Isolation of the related fungal pathogens were done from the collected samples by following protocols of Schuck et al. (2014) on Potato Dextrose Agar

(PDA) (Starch= 20g, Dextrose= 20g, Agar= 20g in 1 liter of distilled water) medium

(Johnson and Curl, 1972). Portion of symptomatic leaf and fruit sample were excised into small segment about 3-5 mm2 at the lesion margin. The segments were surface disinfected with 2 % sodium hypochlorite for about 2-3 minutes. The disinfected segments were then rinsed thrice in sterilized distilled water and blotted dry on two folds of sterilized filter paper to remove excess moisture from the segment. These disinfected segments were then placed on Petri dishes (4-5 segments per dish)

containing potato dextrose agar (PDA) that was autoclaved at 121oC at 15 PSI for 20 minutes. The tools used in isolation procedure i-e. scissors, forceps and needles for cutting and transferring to media dishes were also first sterilized by using methylated spirit and flaming on spirit lamp at time of use. Scissors were used for cutting of leaf samples while sterile surgical blades were used for excising of infected fruit samples. Petri dishes with plated segments were incubated at 28 ± 2oC for about 3-7 days at 80-100% relative humidity. Dishes were checked regularly for fungal colonization. After successful colonization on plated segments with different fungal pathogens, each fungal pathogen was further sub-cultured on fresh PDA Petri dishes by using single spore technique or hyphal tip method (Tuite, 1969) till purified fungal cultures were obtained. Pure cultures of fungal pathogens were stored for short term in refrigerator.

3.3 PRESERVATION OF PURIFIED FUNGAL ISOLATES

For long term preservation of purified fungal isolates/cultures, Silica gel preservation method was used with minor modification (Tuite, 1969). Eppendorf tubes (1.5ml) and screw capped glass vials (30 ml) were filled 1/3rd or about 40-50

% according to eppendorf tube or glass vial. In a 500ml capped glass bottle, 25g of skimmed milk powder was added in 500 ml of distilled water and shaked well. Both tubes/vial with silica gel and skimmed milk suspension bottle were sterilized by autoclaving at 121 oC at 15 PSI for 15-20 mins. After autoclaving the materials skimmed milk were left to cool at room temperature whereas tube/vials of silica gel were instantly cooled in an ice bath before use. For preservation, conidial suspension was prepared by adding 2 ml of skimmed milk using micropipette in 9 mm petri dish having 3-5 days old purified culture of pathogen. Surgical blade was used to harvest

Fig. 3.1: Surveyed districts with number of fields visited for major fungal diseases of strawberry (2014-15 & 2015-16)

Coordinate System: GCS WGS 1984 Datum: WGS 184 Units: Degree

Table 3. 1: Important strawberry growing area surveyed during crop seasons 2014- 15 & 2015-16

Provinces District Surveyed locations Islamabad Islamabad National Agricultural Research Centre (NARC), (ICT)* Chak Shahzad Farms, Tarlai Farms, Rawat Punjab Rawalpindi Near Pahari Stop (Murree), Ghorakpur, Adeyala Road Farm, Mouza Tal Khalsa (Gujar Khan), Thatta Khalil (Taxila) Sargodha Pul Mangi, Kot Momin, Bhalwal, Chak 71 SB, Mangowal, Phularwan, Pind Makko, Chanab Nagar Road Farm Gujranwala Pandori (Nowshera Virkan), Nagri Abbas Shah (Kamoki), Aimenabad, Village Jaddah, Village Shah Jamal, Gagarke (Ali Pur Chatta), Rasul Pur Road Field, Kot Shah Muhammad (Qila Didar Singh) Sialkot Toti Chak, Kot Jandu, Old Sabzi Mandi Field, Chak Jhando, Alhar, Pindi Araian, Chawinda, Mirza Nagal Narowal Borwala, Khan Pur Bolar, Dahdu Chak, Bado Malii, Wallykey Chak Essar, Chak Nikka, Narowal-Shakargar Road field Sheikhupura Narang Mandi, Qayampur, Abdullah Farm (Sharaqpur), Attari, Burj wala, Saeed wala, Farooqabad, Damierkey Lahore Kot Abdul Malik, Faizpur, Burj Attari, Kot Araian, Lahore Farm, Bedian Rd Farm 1& 2 , Raiwand Farm Multan Head Muhammad Wala, Aroka, Band Bosan, Basti Muhammad Pur, Soraj Miani, Muzafarabad, Benda Sendella, Qasim bala Khyber Mardan Jandai, Dargai, Near Tablegi Markaz Field, Pakhtunkhwa Takht-i-Bahi Field 1 & 2, Bara Banda, Fazalabad, (KPK) Katlang Charsadda Sarkai, Sardheri, Tarnab , Shabqadar, Dargai, Manga Matta Mughal Khel, Rashakai Swat Fatehpur, Janoo, Chalyar, Drushkhela, Sakhra, Manglore, Faizagut, Madayen

* Islamabad Capital Territory

fungal growth and to make a concentrated conidial suspension.

Conidial/Spore suspension was pipetted out and dispensed across silica gel by using micropipette @ 1000 µL/glass vial and 100 µL/eppendorf tube. Glass vial and eppendorf tube were well vortexed and placed back into ice bath. This step was carried out to ensure that fungal spores were not killed, as addition of liquid to dried silica gel may kills spores. Caps were loosely tied and placed in incubator at 25 ± 2o

C for 5 to 7 days to facilitate some fungal growth and later caps were tightly closed.

Caps were covered with parafilm M and stored at 4oC till further use. For purpose of checking spores viability, few silica gel crystals were sprinkled on PDA medium and left for 3-5 days. Successful growth of fungal spores from crystals showed preservation process was smooth and viable.

3.4 PATHOGENICITY TEST

To fulfill Koch’s postulates, pathogenicity tests were performed. Fungal isolates as per their respective disease that were already identified and morphologically characterized were used. For confirmation of pathogenicity, three detached asymptomatic mature strawberry fruits and leaves were surface sterilized with 1% sodium hypochlorite and then pipetted 10 µL droplet single spore suspensions (106 conidia spores per milliliter) of each isolate. The spore concentration was measured by using haemocytometer. Fruits and leaves that were sprayed with sterile distilled water served as negative controls. The fruits and leaves were incubated at 25±2°C in humid chamber chambers at 70-100% relative humidity and the experiment was conducted thrice. Symptoms were recorded 2-5 days after inoculation and were consistent with those from samples collected originally from the infected plants, whereas no symptoms occurred on the negative control leaves.

The fungal pathogens were then reisolated from the artificially inoculated fruits and leaves on same artificial media used for original isolations. The cultural and morphological characters of emerged colonies were compared with mother cultures for confirmation that it is same pathogen. Among all tested isolates, only those recorded positive in pathogenicity testing were further used in morphological characterization, all non-pathogenic isolates were discarded.

3.5 MORPHOLOGICAL CHARACTERIZATION OF FUNGAL

ISOLATES

Isolated and purified fungal isolates were morphologically characterized.

Recovered isolates comprised of 4 major fungal pathogens (Alternaria alternata,

Fusarium solani, Colletotrichum acutatum/C. gloeosporioides and Botrytis cinerea) which were found associated with important diseases of strawberry crop viz.

Alternaria leaf spots (ALS), Fusarium fruit rot (FFR), Anthracnose fruit rot (AFR) and Botrytis fruit rot or Gray mold (BFR/GM) respectively. The characterization was done on the basis of their morphology by using respective pathogen identification manuals and criteria of Simmons (2007) for Alternaria alternata, Leslie and

Summerell (2006), Nelson et al. (1983) and Burgess et al., 1981 for Fusarium solani,

Simmonds (1965), Sutton (1992) and Gunnell and Gubler (1992) for Colletotrichum acutatum and Jarvis, (1977) and Elad et al., 2007 for Botrytis cinerea respectively.

By using a sterilized cork borer, mycelial plugs of 5 mm diameter were picked from the margin of the individual isolates. These plugs were placed at the center of 9cm perti dishes and incubated at 25 ± 2 oC. Each fungal isolate associated with related disease was examined microscopically. Temporary slide mounts of each fungal isolates were made in lactophenol blue solution and extensively examined

under Normasrski interference contrast microscopy (BH-2 compound microscope,

Olympus, Melville, New York, USA) and images were captured at 100x magnification using a Leica DFC295 camera and Leica application suite 3.6 ( Leica

Camera Inc., Allendale, New Jersey, USA) for characteristics observations in detail.

A number of morphological parameters related to each of 4 fungal pathogens were carefully observed and recorded i-e. colony color, reverse colony color, growth pattern, pigmentation if produced, shape and size of conidia and conidiophore, presence or absence of septation in conidia, diameter of chlamydospores, appressorium and setae presence or absence and size measurements.

3.6 MOLECULAR CHARACTERIZATION

For molecular characterization of pathogenically positive and morphologically identified isolates of each fungal pathogen, one representative isolate from each district of each disease was selected viz. 12 isolates of Alternaria alternata, Colletotrichum acutatum and Botrytis cinerea each and 11 isolates of

Fusarium solani. All of the isolates were subjected to sequencing by using Inter transcribed (ITS) spacer region of rDNA. Segment of an endopolygalacturonase

(endoPG) gene was amplified for Alternaria alternata. Beta (β)-tubulin (bt/tub2) gene for Colletotrichum acutatum was used. For Fusarium solani translation elongation factor 1-alpha (TEF-1α) was used as marker of choice while for Botrytis cinerea partially targets sequences of Glyceraldehyde-3-phosphate dehydrogenase gene was done.

3.6.1 Genomic DNA Extraction from Fungal Pathogens DNA was extracted from 2 days to 6 weeks old mycelium on Potato

Dextrose Agar (PDA) using the PrepMan Ultra Sample Preparation Reagent kit

(Applied BiosystemsTM, Foster City, CA) (Fig. 3.2). Aseptically dispensed 50 µL of

PrepMan Ultra extraction kit reagent into properly labeled microcentrifuge screw- capped tube by using sterile pipette and tips. From the margins of fungal colony, a minute amount of aerial mycelium was scratched and collected by using sterilized pipette tip. The scratched mycelial material was carefully suspended into microcentrifuge screw-capped tube containing 50 µL of the PrepMan Ultra extraction fluid. Sample tubes were tightly capped and vigorously vortexed for about

10 to 30 seconds. Tubes were then placed in a heat block for 10 minutes at 95o C to

100o C. Sample tubes were removed from heat block and allowed to cool for about

2-3 min at room temperature. Tubes were subjected to microcentrifuge at 16,000 rpm for two minutes. Supernatant was transferred to newly labeled tubes carefully and discard the remaining. DNA concentration and purity were accessed by measuring on Nanodrop spectrophotometer. The collected supernatant was ready to use DNA of the fungi and was also be stored at 4oC for one month or freeze at -20oC for indefinite time for long term storage and till further use.

3.6.2 Polymerase Chain Reaction (PCR) Assay

3.6.2.1 Amplification of different gene regions In this study, four different gene regions were implied in molecular identification of fungal pathogens. The inter transcribed space region, ITS (Fig.

3.3a), translation elongation factor 1-alpha, TEF-1α (Fig. 3.3b), Beta-tubulin, BT

(Fig. 3.3c) and segment of an endopolygalacturonase, endoPG (Fig. 3.3d) and

Glyceraldehyde-3-phosphate dehydrogenase, G3PDH (Fig. 3.3e) gene regions were amplified by PCR and partially targeted sequences of genes was done. Primers nucleotide sequences along with respective fungal pathogen to be amplified was given in Table 3.2.

From Fungal culture Plate

Revived fungal culture on media plate

Fig. 3.2. Diagrammatic representation of steps of DNA extraction using PrepMan Ultra Sample Preparation Reagent

(a)

(b)

(c)

(d)

(e) Fig. 3.3. Schematic diagrams indicating genes regions and the primer positions (a) Inter transcribed space region (ITS), (b) Translation elongation factor (TEF-1α), (c) Beta-tubulin (BT) (d) endopolygalacturonase (endoPG) and (e) Glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH)

3.6.2.2 PCR reaction mixture

PCR amplification was performed in a 25 μL reaction volume containing 1

μL of template DNA, 5 μL PCR reaction buffer (1X), 4 μL of MgCl2 (25 mM), 2.5

μL dNTPs (ADT, GDP, CDP, TDP) (10mM), 0.25 μL of each primer (20 PmoL) and

0.25 μL of DNA Taq polymerase (5 U/μL) and 11.25 μL of diehtylpyrocarbonate

(DEPC) treated water. A control or negative control reaction without DNA template was also included.

3.6.2.3 PCR conditions

The PCR mixture was subjected to denaturing, annealing and extensions steps. Each stage requires specific temperature and time depending on the gene being amplified with help of distinct primers. The details of each gene region and primers used were shown in Table 3.2.

3.6.3 Agarose Gel Electrophoresis

After amplification of DNA with primers using PCR, to check whether amplification is successful and to evaluate the quality of amplified product visualization of DNA fragments on agarose gel electrophoresis was done. 1.0 %

(w/v) agarose gel was used in electrophoresis and prepared by adding 0.5g of agarose powder into 100ml of 1×TAE (Tris-acetate-EDTA) ( 0.1 M Tris, 0.05 M boric acid and 0.001 M EDTA) buffer in a microwaveable flask. Flasks were microwaved for about 1-3 minutes until the solution boiled and agarose was completely dissolved.

The solution was cooled and poured into gel apparatus with combs. After solidification, combs were removed and added with 2-5µL samples and 2-5 µL of

1kb DNA ladder. The gel was run at 90V for about 30-40 minutes and stained with ethidium bromide at 0.5 mg/mL and after de-staining, gel was visualized under gel

Table 3. 2: Gene/Gene Region, Primers used with detail and PCR conditions and references

Gene/Gene Fungal Prime Primer Primer Design PCR Condition Reference region Pathogen Name Direction (Abbreviation) A. alternata 2 min at 95°C, 35 Inter Transcribed F. solani ITS1 Forward 5 GCCGTAGGTGAACCTGCGG 3 cycles at 95°C for 30 Spacer region Colletotrichum s,1min at 56°C, 1min White et al., 1990 ( ITS) spp. ITS4 Reverse 5 TCCTCCGCTTATTGATATGC 3 at 72°C and 10 min at B. cinerea 72°C 1min at 95°C, 35 Endopolygalactur Alternaria PG3 Forward 5 TACCATGGTTCTTTCCGA 3 cycles at 95°C for 30 Andrew et al., onase alternata s, 30s at 62°C, 30 s at 5 GAGAATTCRCARTCRTCYTGR 2009 ( EndoPG) PG2b Reverse 72°C and 7min at TT 3 72°C 5 ATGGGTAAGGA(A/G)GGACAA 4min at 94°C, 35 Translation EF1 Forward cycles at 1 min at Geiser et al., 2004 Fusarium solani GAC 3 Elongation Factor 95°C, 2 min at 53°C, O’Donnell et al., 5 GGA(G/A)GTACCAGT(G/C)ATC ( TEF-1α/EF-1α) EF2 Reverse 1 min at 72°C and 5 1998 ATGTT 3 min at 72°C 5 GGTAACCAAATGGTGCTGCTT 3 min at 94°C, 35 BT2a Forward TC 3 cycles at 30s at 94°C, Beta (β)-tubulin Colletotrichum Glass & 30 s at 52°C, 90 s at (BT) spp. BT2b 5 ACCCTCAGTGTAGTGACCCTT Donaldson, 1995 Reverse 72°C and 5 min at GGC 3 72°C Glyceraldehyde- G3PD 5 ATTGACATCGTCGCTGTCAAC 5 min at 94°C, 35 Forward 3- phosphate H_for GA 3 cycles at 30s at 94°C glyceraldehyde Botrytis cinerea 30s for 55°C, 90s at Staats et al., 2005 dehydrogenase G3PD Reverse 5 ATTGACATCGTCGCTGTCAAC 72°C for 90 s and 10 (G3PDH) H_rev GA 3 min at 72°C

documentation apparatus (BIO - RAD Molecular Imager, ChemiDOCTM XRS+ with image LabTM Software). One (1) kb ladder (1000bp) was used as a molecular size standard for comparing with the bands of DNA on gel.

3.6.4 PCR Product Purification

The amplified PCR products were further purified by using Illustra GFX PCR

DNA and Gel Band Purification Kit (GE Healthcare Bio-Sciences, Marlborough city, MA). For purification 4 steps were followed. In the 1st step capture buffer of type 3 was added to the sample which denatures the proteins. In second step, sample mix with capture buffer type 3 was applied to the illustra GFX Microspin column and the DNA binds to the membrane in the column. During 3rd step washing and drying was done by using washing buffer that removed salts and any other contaminants from the membrane bound DNA. During 4th and final step, purified samples were eluted with elution buffer of type 4 or 6. Elution buffer 4 (10mM Tris-

HCl, PH 8.0) was used for multiple downstream applications and long term storage of samples while elution buffer type 6 (sterile nuclease free water) was used for samples to be sequenced.

3.7 DNA SEQUENCING

For sequencing of PCR purified product, separate sample tubes or sequencing plate (96-wells) was loaded with 2 µL aliquots from the purified DNA of fungal pathogens with both forward and reverses primers in respective order. The sequencing was done from DNA facility at Iowa State University, USA.

3.7.1 Sequence Processing and Submission

Obtained sequences were modified and aligned from chromatogram

(forward and reverse directions) with sequence analysis program BioEdit version

7.2.6 (Hall, 1999). All the final aligned ITS, TEF, BT, EndoPG and G3PDH sequences were further confirmed and compared by using the suite for standard nucleotide on Basic Local Alignment Search Tools (BLASTn) serve at US National

Center for biotechnology Information (NCBI) GenBank database website

(https://blast.ncbi.nlm.nih.gov /Blast.cgi) for determination of fungal species of the isolates. Sequences of Fusarium solani were also compared with the sequences in the database serve of FUSARIUM-ID at (http://Fusarium.cbio.psu.edu) (Geiser et al., 2004). The sequences of all isolates based on ITS, TEF, BT, EndoPG and

G3PDH primers were deposited in NCBI GenBank database and respective accession numbers were acquired. Evolutionary history was inferred by using the

Maximum Likelihood method based on the Tamura-Nei model (Tamura and Nei,

1993). Initial tree(s) for the heuristic search was obtained by applying Neighbor-Join and matrix of pairwise distances was estimated using the Maximum Composite

Likelihood (Kumar et al., 2016).

Chapter 4

RESULTS AND DISCUSSION

4.1 DISEASE SURVEY AND ASSESSMENT

4.1.1 Prevalence Percentages of Major Diseases

Systematic surveys of two years (2014-15 & 2015-16) was conducted in major strawberry growing districts in Punjab province viz. Rawalpindi, Sargodha,

Gujranwala, Sialkot, Narowal, Sheikhupura, Lahore and Multan covering northern, central and southern Punjab whereas district Mardan, Charsadda and Swat in Khyber

Pakhtunkhwa (KPK) and Islamabad (Islamabad Capital Territory, ICT) were surveyed (Fig. 4.1. a, b, c and d). Data related to prevalence and incidence of major fungal diseases were calculated for each district. Total of 182 farms were visited during two years, from 91 localities distributed across 8 districts of Punjab, 3 districts of Khyber Pakhtunkhwa (KPK) and Islamabad (Islamabad Capital Territory).

District-wise prevalence percentage of 4 major fungal diseases for year 2014-

15 and 2015-16 are shown in (Table 4.1). During both surveys, the number of strawberry fields were not constant. During 2014-15 the total number of fields were

91 while in 2015-16, 86 fields were surveyed. This is due to the fact that during 2nd year of survey number of fields were reduced at some districts due to non-availably of crop in the same field.

District-wise data of 8 districts of Punjab with 61 localities showed overall

60% to 100% diseases prevalent among 4 major fungal pathogens viz. Alternaria leaf spots (ALS), Fusarium fruit rot (FFR), Anthracnose fruit rot (AFR) and Botrytis fruit rot (BFR). Except from Rawalpindi from where 5 localities were surveyed, however 8 localities were surveyed from seven other districts of Punjab.

(a) (b)

Fig. 4.1. During survey across different districts: (a) Sialkot, (b) Mardan,

(d) Islamabad

The prevalence of Alternaria leaf spots (ALS) and Botrytis fruit rot (BFR) were found 100 % in both years at all of the 8 surveyed districts. While in case of

Fusarium fruit rot (FFR) and Anthracnose fruit rot (AFR) some variation was seen in prevalence percentage of these diseases in both years. Lowest prevalence was shown of Fusarium fruit rot (FFR) in District Rawalpindi where out of 5 only 3 locations showed presence of disease in both years. These locations were in Murree and Rawalpindi where mean temperature in the month of March is low as compared to other districts of Punjab. In Sargodha and Multan districts, each was having 2014-

15 disease prevalence mean of 87.50%, where single locality from each districts showed no disease prevalence i-e. Chak 71 SB and Qasim bala respectively. This disease prevalence recorded was because that crop was sown first time in surveyed fields and farmer used plastic mulch. Previously wheat-rice cropping pattern was followed in particular fields. During year 2015-16, no crop was found in that particular field at Chak 71 SB while disease was observed in field of Qasim bala and no plastic mulch was seen in the field. Anthracnose fruit rot (AFR) was 100% prevalent in all districts of both years with exception of no disease prevalence in single location of Gujranwala (Rasul Pur road field) during 2014-15.

In Khyber Pakhtunkhwa province, prevalence (%) of 4 fungal diseases in 3 surveyed districts and 24 localities was not constant in case of Fusarium fruit rot

(FFR), Anthracnose fruit rot (AFR) and Botrytis fruit rot (BFR), whereas Alternaria leaf spot (ALS) was observed at all locations of 3 districts with 100% prevalence.

Maximum variation in mean FFR prevalence was observed at district Mardan with

87.50 % in 2014-15 while decreased to 75% in 2015-16 crop season while same declining trend was seen in case of AFR and BFR. The drop in prevalence % of these

diseases was attributed to low humidity with high temperatures in 2015-16 as compared to the previous year during survey time. District Charsadda showed 100% prevalence of fungal diseases in both years. District Swat showed zero mean disease prevalence % of Fusarium fruit rot (FFR) at 8 visited locations and none of locations showed presence of disease during both years (2014-15 & 2015-16), while AFR and

BFR was seen 87.50% and 75 % respectively in both years. The absence and low prevalence was due to low temperature and dry spell during survey time that accounted for low relative humidity. Due to non-fulfillment of important components (temperature and relative humidity) of disease triangle in Swat district overall diseases prevalence was seen lowest among all surveyed districts (Punjab,

Khyber Pakhtunkhwa and Islamabad).

Data from Islamabad (Islamabad Capital Territory) showed that 4 major fungal diseases (Alternaira leaf spots (ALS), Fusarium fruit rot (FFR), and

Anthracnose fruit rot (AFR) and Gray mold/Botrytis fruit rot (BFR) were quite prevalent. Over all disease prevalence percentage of 4 major fungal diseases at 6 strawberry farms situated at 4 localities during each of the survey year were found from 83.33% to 100%. Mean disease prevalence for both Alternaira leaf spots (ALS) and Botrytis fruit rot (BFR) were found to be 100% at all 6 localities, whereas

Fusarium fruit rot (FFR) and Anthracnose fruit rot (AFR) showed 83.33% mean disease prevalence respectively. In Islamabad the lowest prevalence (0%) of FFR and AFR was recorded at National Agricultural Research Centre (NARC) where both diseases were not observed during 2 year surveys. Major reason was that the area under strawberry was small and strawberry cultivation site was rotated in both years accompanied by good sanitary conditions and presence of low temperature.

Table 4. 1: Disease Prevalence Percentages of 4 major fungal diseases at surveyed locations from 12 Districts during crop seasons 2014-15 and 2015-16. (ALS = Alternaria Leaf Spot, FFR = Fusarium Fruit Rot, AFR = Anthracnose Fruit Rot and BFR = Botrytis Fruit Rot) Diseases Prevalence Percentage ( % ) 2014-15 & 2015-16 District Area/Location ALS ALS FFR FFR AFR AFR BFR BFR 2014-15 2015 -16 2014-15 2015-16 2014-15 2015-16 2014-15 2015-16 Islamabad NARC 100 100 0 0 0 0 100 100 Chak Shahzad Farm 1 100 100 100 100 100 100 100 100 Chak Shahzad Farm 2 100 100 100 100 100 100 100 100 Chak Shahzad Farm 3 100 100 100 100 100 100 100 100 Tarlai Farm 100 100 100 100 100 100 100 100 Rawat 100 100 100 100 100 100 100 100 100 100 83.33 83.33 83.33 83.33 100 100 Rawalpindi Near Pahari Stop 100 100 0 0 100 100 100 100 Ghorakpur 100 100 0 0 100 100 100 100 Adeyala Rd 100 100 100 100 100 100 100 100 Mouza Tal Khalsa 100 100 100 100 100 100 100 100 Thatta Khalil 100 100 100 100 100 100 100 100 100 100 60.00 60.00 100 100 100 100 Sargodha Pul Mangni 100 100 100 100 100 100 100 100 Kot Momin 100 100 100 100 100 100 100 100 Bhalwal 100 100 100 100 100 100 100 100 Chak 71 SB 100 - 0 - 100 - 100 - Mangowal 100 100 100 100 100 100 100 100 Continued….

Phularwan 100 100 100 100 100 100 100 100 Pind Makko 100 100 100 100 100 100 100 100 Chanab Nagar Rd Farm 100 - 100 - 100 - 100 - 100 75 87.50 75 100 75 100 75 Gujranwala Pandori 100 100 100 100 100 100 100 100 Nagri Abbas Shah 100 100 100 100 100 100 100 100 Aimenabad 100 100 100 100 100 100 100 100 Village Jaddah 100 100 100 100 100 100 100 100 Village Shah Jamal 100 100 100 100 100 100 100 100 Gagarke 100 100 100 100 100 100 100 100 Rasul Pur Road Field 100 - 100 - 0 - 100 - Kot Shah Muhammad 100 100 100 100 100 100 100 87.50 100 100 100 87.50 87.50 87.50 100 100 Sialkot Toti Chak 100 100 100 100 100 100 100 100 Kot Jandu 100 100 100 100 100 100 100 100 Old Sabzi Mandi Field 100 100 100 100 100 100 100 100 Chak Jhando 100 - 100 - 100 . 100 - Alhar 100 100 100 100 100 100 100 100 Pindi Araian 100 100 100 100 100 100 100 100 Chawinda 100 100 100 100 100 100 100 100 Mirza Nagal 100 - 100 . 100 . 100 - 100 100 100 75 100 75 100 75 Narowal Borwala 100 100 100 100 100 100 100 100 Khan Pur Bolar 100 100 100 100 100 100 100 100 Dahdu Chak 100 100 100 100 100 100 100 100 Continued….

Bado Malii 100 100 100 100 100 100 100 100 WallyKey 100 100 100 100 100 100 100 100 Chak Essar 100 100 100 100 100 100 100 100 Chak Nikka 100 100 100 100 100 100 100 100 Nar-Shakargr Rd Field 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 Sheikhupura Narang Mandi 100 100 100 100 100 100 100 100 Qayampur 100 100 100 100 100 100 100 100 Abdullah Farm 100 100 100 100 100 100 100 100 Attari 100 100 100 100 100 100 100 100 Burj wala 100 100 100 100 100 100 100 100 Saeed wala 100 100 100 100 100 100 100 100 Farooqabad 100 100 100 100 100 100 100 100 Damierkey 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 Lahore Kot Abdul Malik 100 100 100 100 100 100 100 100 Faizpur 100 100 100 100 100 100 100 100 Burj Attari 100 100 100 100 100 100 100 100 Kot Araian 100 100 100 100 100 100 100 100 Lahore Farm 100 100 100 100 100 100 100 100 Bedian Rd Farm 1 100 100 100 100 100 100 100 100 Bedian Rd Farm 2 100 100 100 100 100 100 100 100 Raiwand Farm 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 Multan Head Muhammad wala 100 100 100 100 100 100 100 100 Continued….

Aroka 100 100 100 100 100 100 100 100 Band Bosan 100 100 100 100 100 100 100 100 Basti Muhammad Pur 100 100 100 100 100 100 100 100 Soraj Miani 100 100 100 100 100 100 100 100 Muzafarabad 100 100 100 100 100 100 100 100 Benda Sendella 100 100 100 100 100 100 100 100 Qasim Bala 100 100 0 100 100 100 100 100 100 100 87.50 100 100 100 100 100 Mardan Jandai 100 100 100 100 100 100 100 100 Dargai 100 100 100 100 100 100 100 100 Tablegi Markaz Field 100 100 0 0 100 100 100 100 Takht-i-Bahi Field 1 100 100 100 100 100 100 100 100 Takht-i-Bahi Field 2 100 100 100 100 100 100 100 100 Bara Banda 100 100 100 0 100 0 100 0 Fazalabad 100 100 100 100 100 100 100 100 Dheri 100 100 100 100 100 100 100 100 100 100 87.50 75.00 100 87.50 100 87.50 Charsadda Sarkai 100 100 100 100 100 100 100 100 Sardheri 100 100 100 100 100 100 100 100 Tarnab 100 - 100 - 100 - 100 - Shabqadar 100 100 100 100 100 100 100 100 Dargai 100 100 100 100 100 100 100 100 Manga 100 100 100 100 100 100 100 100 Matta Mughal Khel 100 100 100 100 100 100 100 100 Rashakai 100 100 100 100 100 100 100 100 Continued….

100 87.50 100 87.50 100 87.50 100 87.50 Swat Fatehpur 100 100 0 0 100 100 0 0 Janoo 100 100 0 0 100 100 100 100 Chalyar 100 100 0 0 0 0 100 100 Drushkhela 100 100 0 0 100 100 0 0 Sakhra 100 100 0 0 100 100 100 100 Manglore 100 100 0 0 100 100 100 100 Faizagut 100 100 0 0 100 100 100 100 Madayen 100 100 0 0 100 100 100 100 100 100 0.00 0.00 87.50 87.50 75.00 75.00

4.1.2 Incidence Percentages of Major Diseases

Data related to incidence % of major fungal diseases in Punjab, Khyber

Pakhtunkhwa and Islamabad ranged from low to moderate high as shown in (Table

4.2). In district Rawalpindi, highest mean disease incidence was observed in case of

Botrytis fruit rot (BFR), where during 1st year of survey (28.60%) disease incidence while with slight increase (30%) during 2nd year was recorded. Alternaria leaf spots

(ALS), mean incidence % remains constant (28%) in both years with minimum incidence of 17% was recorded at Near Pahari stop (Murree) while maximum of 40%

Thatta Khalil (Taxila). Anthracnose fruit rot (AFR) with 23 % and least mean D.I of

18.30 % in Fusarium fruit rot (FFR). Mean incidence of all 4 fungal diseases was recorded higher at Taxila while lowest in Murree, where 0 % D.I of Fusarium fruit rot was found in both years.

In District Sargodha, BFR was found to more frequent with incidence of 45% and 43.17% during 1st and 2nd year, where highest percentage is 57 % followed by

53% was recorded in Pink Makko and Chak 71 SB respectively. ALS incidence for both years remains 40.93% and 41.67% respectively. Is case of FFR there is significant increase in the incidence from 34.13% to 43.33% during 2014-15 to 2015-

16 due to unusual spell of rainfall, which amounts for the high Relative humidity level couple with cloudy weather and high temperature. AFR incidence almost remains constant with 28.75% to 28.83% in 1st and 2nd year respectively.

In Punjab, from district Gujranwala to Multan, incidence percentage of all fungal diseases remained high as compared to Rawalpindi (Table 4.1 & Fig. 4.1).

These districts except Multan fall under central Punjab, where temperature remain from 28-40oC with rainfall spell that accounts for the medium relative humidity

levels that favors diseases. District Sheikhupura showed highest incidences of FFR in both survey years (52.50% and 59.50% with mean of 56%), whereas ALS has highest of 52.88% in all districts during year 2015-16. Overall incidence remains moderate in all district mentioned above with variation of 0.50 % to 8% in general.

District Narowal showed highest incidence of BFR among all other districts i.e.

47.38% in 2014-15 and 48.88% in 2015-16. District Multan falls under southern

Punjab region where some declines in incidence levels of all diseases were seen, as mean weather is hotter and dryer as compared to other districts of Punjab.

In Khyper Pakhtunkhwa province, district Swat showed lowest Incidence of all diseases thought out surveyed districts. Lowest incidence of 0% was found in all localities of swat during both year (2014-15 & 2015-16) for FFR followed by

AFR (14% and 16.67%), where lowest incidence of 0% was recorded during at

Drushkhela both years while highest of 30% was seen at Madayen in year 2015-16.

BFR with incidence of (17.17% and 19.50%) appeared major disease of swat followed by ALS (18.83% and 16.67%) during 1st year (2014-15) and 2nd year (2015-

16) respectively. ALS highest incidence of 30% and 23% was observed at Faizagut and Madayen while lowest of 7% and 10% at Mingora and Manglore respectively.

Lowest incidence level is due to low temperature in district swat during month of

April and low pathogen pressure in soil due to extreme cool weather in peak of winters, plus Swat is famous for production of nursery in Pakistan due to its unique geographical location.

District Mardan and Charsadda showed same the less similar diseases incidence pattern with slight varation (Table 4.1). ALS was most prevalent disease in districts with lowest incidence of 50.88 % in Charsadda and highest of 55% in

Mardan during year 2014-15 and 2015-16 respectively. FFR showed more incidence in 1st and 2nd year in Charsadda (35.88% and 39%), while Mardan showed nearly parallel pattern with 36.25% and 36.63% incidence. AFR and BFR showed almost same incidence pattern with variation of 1-3% during both years.

Incidence % of all 4 fungal diseases was found second lowest in Islamabad after District swat in Khyber Pakhtunkhwa and Rawalpindi in Punjab. ALS with

24.50% to 25% and BFR with 22.67% to 25.67% were found to have high incidence

%. AFR and FFR showed 0% disease incidence at NARC during both survey years.

Lowest incidence among all fungal diseases was in FFR, where lowest of 14.33% and highest of 17.67% was observed.

From the above mentioned results of 2 year survey, it is quite obvious that these major fungal diseases were found to be severely affecting strawberry crop throughout strawberry producing areas, with low to high prevalence and incidence of studied fungal diseases. These diseases were major limiting factor in healthy and profitable strawberry production. During survey it was noted that farmers used to spray broad spectrum fungicides like Ridomil Gold, Evisto and Rally for management of diseases without accurate knowledge of the fungal pathogen involved in the disease. During rainy and cloudy weather, the spray frequency reached maximum, with spray every week. Strawberry nurseries are generally produced in Mingora and Madayen areas of District Swat from where they are being transported throughout Pakistan. Strawberries are being cultivated in Punjab, Khyber

Pakhtunkhwa (KPK) and Islamabad (ICT). Within Punjab district Rawalpindi comes under rainfed area, whereas other district of central Punjab comes under medium rainfall areas. In Khyber Pakhtunkhwa, Swat comes under high rainfall area whereas

Table 4. 2: Disease Incidence Percentages of 4 major fungal diseases at surveyed locations from 12 Districts during crop seasons 2014-15 and 2015-16. (ALS = Alternaria Leaf Spot, FFR = Fusarium Fruit Rot, AFR = Anthracnose Fruit Rot and BFR = Botrytis Fruit Rot) Diseases Incidence Percentage ( % ) 2014-15 & 2015-16 District Area/Location ALS ALS FFR FFR AFR AFR BFR BFR 2014-15 2015-16 2014-15 2015-16 2014-15 2015-16 2014-15 2015-16 Islamabad NARC 23 20 0 0 0 0 13 17 Chak Shahzad Farm 1 17 20 13 20 17 23 20 23 Chak Shahzad Farm 2 20 23 13 13 20 23 23 27 Chak Shahzad Farm 3 30 27 20 23 27 30 20 27 Tarlai Farm 27 30 20 27 30 27 30 30 Rawat 30 30 20 23 23 20 30 30 24.50 25.00 14.33 17.67 19.50 20.50 22.67 25.67 Rawalpindi Near Pahari Stop 17 17 0 0 7 10 20 20 Ghorakpur 20 23 0 0 13 17 23 23 Adeyala Rd 33 37 23 27 23 27 30 37 Mouza Tal Khalsa 30 30 30 33 30 33 27 23 Thatta Khalil 40 33 33 37 37 33 43 47 28.00 28.00 17.20 19.40 22.00 24.00 28.60 30.00 Sargodha Pul Mangni 43 50 27 30 13 17 37 40 Kot Momin 47 47 30 33 23 30 43 50 Bhalwal 40 43 37 37 20 20 40 43 Chak 71 SB 43 - 0 - 27 - 53 - Mangowal 40 33 53 50 30 33 37 33 Phularwan 37 40 43 40 40 33 43 43 Continued….

Pind Makko 33 37 63 57 37 40 57 50 Chanab Nagar Rd Farm 40 - 20 - 40 - 50 - 40.93 41.67 34.13 41.17 28.75 28.83 45.00 43.17 Gujranwala Pandori 47 53 40 43 43 33 53 50 Nagri Abbas Shah 50 47 37 40 40 47 63 57 Aimenabad 53 50 37 33 47 50 50 53 Village Jaddah 50 47 40 43 37 33 37 40 Village Shah Jamal 47 47 30 33 40 43 33 30 Gagarke 53 57 40 37 50 53 43 40 Rasul Pur Road Field 50 - 33 - 0 - 50 - Kot Shah Muhammad 47 53 43 40 37 37 47 50 50.07 50.57 37.50 38.43 36.75 42.29 47.00 45.71 Sialkot Toti Chak 50 53 33 35 27 0 47 50 Kot Jandu 47 50 30 33 30 37 50 60 Old Sabzi Mandi Field 37 43 47 50 37 43 47 53 Chak Jhando 40 - 47 - 40 - 40 - Alhar 53 50 37 43 43 47 37 43 Pindi Araian 43 47 33 37 30 0 33 40 Chawinda 47 57 43 50 40 43 37 47 Mirza Nagal 37 40 40 - 33 - 33 - 46.27 48.57 40.83 42.60 35.25 34.00 43.33 48.60 Narowal Borwala 43 50 40 43 33 30 53 60 Khan Pur Bolar 50 50 50 53 37 40 50 50 Dahdu Chak 47 43 43 40 27 30 40 37 Bado Malii 57 60 37 47 40 50 43 47 WallyKey 43 53 33 40 40 47 43 50 Continued….

Chak Essar 47 43 30 33 47 47 47 50 Chak Nikka 50 53 33 40 33 40 50 47 Nar-Shakargr Rd Field 47 50 37 43 30 30 53 50 48.00 50.25 37.88 42.38 35.88 39.25 47.38 48.88 Sheikhupura Narang Mandi 60 53 66 70 53 57 47 50 Qayampur 50 50 53 60 33 37 43 47 Abdullah Farm 53 50 50 60 40 37 47 50 Attari 43 50 57 60 43 47 43 43 Burj wala 47 50 50 53 37 40 33 30 Saeed wala 50 57 47 57 40 43 40 43 Farooqabad 53 60 47 53 47 50 40 40 Damierkey 50 53 50 63 40 40 50 50 50.75 52.88 52.50 59.50 41.63 43.88 42.88 44.13 Lahore Kot Abdul Malik 40 53 43 50 40 43 40 40 Faizpur 53 57 40 40 43 50 40 47 Burj Attari 50 47 37 33 37 40 37 43 Kot Araian 53 57 57 60 40 40 43 50 Lahore Farm 47 50 47 53 37 40 50 43 Bedian Rd Farm 1 40 43 37 40 50 53 47 50 Bedian Rd Farm 1 53 50 37 40 43 43 40 40 Raiwand Farm 50 47 47 40 37 40 43 47 48.25 50.50 43.13 44.50 40.88 43.63 42.50 45.00 Multan Head Muhammad wala 33 43 37 40 30 30 40 37 Aroka 37 40 40 47 40 40 50 53 Band Bosan 27 27 47 40 30 37 43 47 Basti Muhammad Pur 30 30 37 40 37 33 40 53 Continued….

Soraj Miani 33 27 40 40 40 43 43 35 Muzafarabad 30 30 47 47 33 33 33 30 Benda Sendella 40 43 50 53 33 37 37 43 Qasim Bala 43 47 0 10 47 50 40 43 35.00 35.88 37.25 39.63 36.25 37.88 40.75 42.63 Mardan Jandai 63 60 50 63 50 57 40 47 Dargai 50 57 50 53 43 47 33 45 Tablegi Markaz Field 53 60 0 0 47 50 47 50 Takht-i-Bahi Field 1 57 53 30 37 50 60 50 60 Takht-i-Bahi Field 2 50 60 43 40 33 40 43 55 Bara Banda 47 47 30 0 33 0 33 0 Fazalabad 47 50 47 53 37 40 40 36 Dheri 50 53 40 47 40 53 47 50 52.13 55.00 36.25 36.63 41.63 43.38 41.63 42.88 Charsadda Sarkai 53 57 33 40 50 50 43 47 Sardheri 57 60 30 30 43 53 50 60 Tarnab 60 - 27 - 40 - 53 - Shabqadar 47 50 30 23 50 53 47 43 Dargai 47 53 40 43 43 40 40 40 Manga 50 50 37 40 33 37 37 43 Matta Mughal Khel 50 53 47 50 30 40 30 40 Rashakai 43 50 43 47 37 40 40 50 50.88 53.29 35.88 39.00 40.75 44.71 42.50 46.14 Swat Fatehpur 13 13 0 0 10 13 0 7 Janoo 17 13 0 0 10 13 23 27 Chalyar 20 20 0 0 0 0 27 23 Continued….

Drushkhela 13 13 0 0 20 27 0 0 Sakhra 17 13 0 0 13 13 20 23 Manglore 23 23 0 0 13 23 27 30 Faizagut 23 20 0 0 27 27 23 23 Madayen 20 23 0 0 20 17 17 23 18.25 17.25 0.00 0.00 14.13 16.63 17.13 19.50

rest is under medium rainfall areas. Islamabad also comes under rainfed area but usually receives medium to high rainfall. From the current study it was quite clear that the areas where there is high rainfall the incidences of fungal disease were not as high as in the areas of medium rainfall. In high rainfall areas the mean temperature is much less than those of medium rainfall areas, that why diseases incidences were seen relatively lower at low temperatures.

4.2 COLLECTION OF DISEASED SAMPLES

Suspected samples of diseased strawberry plants including leaves and fruits were collected on the basis of visible symptoms of fungal diseases. Prominent fruit rot and leave spot symptoms were seen during the collection. Leaves with black spots were distinguished from other nutrient deficiencies symptoms. On fruits three types of rots symptoms were found. Fruits showed grayish mass of mycelium on them, while on other whitish growth were recorded. Fruits with Anthracnose fruit rot symptoms showed distinct dark brown to black sunken spot on the surface of fruit.

Fig. 4.2 (a, b, c and d) show the samples of Alternaria leaf spot (ALS), Fusarium fruit rot (FFR), Anthracnose fruit rot (AFR) and Botrytis fruit rot (BFR) or gray mold respectively.

4.3 ISOLATION, IDENTIFICATION AND PATHOGENICITY TEST

All collected strawberry leaves and fruits samples that were showing typical symptoms of fungal infection underwent standard isolation and purification procedures for successful isolation of associate fungal pathogens in the Fungal Plant

Pathology, laboratory, PMAS-AAUR. The isolation and purification procedures revealed following pathogens were recovered from diseased samples collected from surveyed districts viz. Alternaria, Fusarium, Colletotrichum and Botrytis. These

results represent that the species of Alternaria, Fusarium, Colletotrichum and

Botrytis as the causal agents, responsible for Leaf spots and different fruit rot diseases damage. Overall frequency of Alternaria, Fusarium, Colletotrichum and

Botrytis isolates varied from various district to district. All these recovered isolates were subjected to pathogenicity test to confirm their pathogenic nature against each of the isolated fungal pathogen on respective part of the strawberry plant viz.

Alternaria on asymptomatic leaves, Fusarium, Colletotrichum and Botrytis on asymptomatic strawberry fruits before further study. The results of pathogenicity on strawberry leaves and fruits was shown in Fig. 4.3 (a, b, c and d) respectively. After pathogenicity testing, only those isolates that were recorded positive in testing and pathogenic in nature were preserved while, all other isolates that proved negative during pathogenicity testing were discarded from present study. A total of 337 pathogenic isolates of all four above mentioned fungal pathogens were subjected to further morphological and 54 to molecular characterization.

4.4 PRESERVATION OF FUNGAL ISOLATES

Silica gel technique was used for preservation of fungal isolates of

(Alternaria, Fusarium, Colletotrichum and Botrytis) in this research study. This technique allows storage of the different fungal pathogens in eppendorf tubes or glass vials up to 5-11 years and showed good results and minimum mutation on revival

(Fig. 4.4). Variability assay for recovery of standard fungal cultures preserved by using silica gel technique was performed about 5-6 days after addition of conidia on silica gel crystals. Variability was also checked before storing of isolates at 4±2oC in refrigerator and revealed 100% results. Morphology of fungal colony and spore characteristics were same for all fungal colonies on media plates from silica gel

(a) (b)

(c` (d) ) Fig. 4.2. Field samples collected during survey of fungal diseases: (a) Alternaria leaf spot (ALS), (b) Fusarium fruit rot (FFR) (c) Anthracnose fruit rot (AFR) and (d) Botrytis fruit rot (BFR)

(a) (b)

)

Fig. 4.3. Pathogenicity test performed on the respective strawberry plant part from where the fungal pathogen was isolate: (a) Alternaria alternata on leaf (b) Fusarium solani on fruit (c) Colletotrichum spp. on fruits (d) Botrytis cinerea on fruit

particles (Fig. 4.5). Results of silica gel preservation study were identical to those reported by Windel et al. (1998). Silica gel preservation technique provides effective results by producing high positive cultures survival rates and having no effect on the pathogenicity of isolates. Sharma et al. (2002) reported same finding in their study, in which they checked the survival, growth and pathogenicity of fungal isolates using various preservation techniques for 36 months in storage. Study findings showed that isolates depict best survival rate by using filter paper followed by Silica gel, mineral oil , sterile soil, distilled water and slants preservations techniques, respectively.

Survival of fungal isolates increased for quite a longer period of time by storing them in refrigerator at 4 ± 2o C (Trollope, 1975). This technique of preservation is reported and proved to be cheap and inexpensive, prompt and simpler to adopt for a wide range of fungal pathogens as well as other microorganism (Smith, 1993). This technique was originally developed by Perkins (1962) for preservation of fungus

Neurospora species. Perkins used to suspend the spores and mycelia of the fungus in sterilized skimmed milk suspension in water and adsorbed on crystals of silica gel.

One of important advantage of use of this method is that, it prevents growth of fungi and metabolism that helps in long term storage. This technique has also found useful for preservation of plant pathogenic bacteria (Sleesman and Leben, 1978). Similarly,

Trollope (1975) used silica gel preservation for long term storage of gram positive and gram negative bacteria. Long term preservation of fungal cultures are very important in advanced research studies and analysis. Meanwhile it depends on the suitability and viability of preserved fungi during the phase of preservation. Silica gel technique used for preservation of fungal cultures in this study proved to be cost- effective and easy with very good results. Revival of the fungal cultures can be done

Fig. 4.4. Preserved fungal cultures in skimmed milk and silica gel (a) Glass vials (b) Eppendorf tubes

Fig. 4.5. Revival of pure fungal colonies from preserved cultures in silica gel

from a single vial/tube with minimum likelihood of being contaminated or mutated.

Hence, Silica gel technique is preferred and further suggested for long term storage of fungal species that produced large number of conidia.

4.5 MORPHO-MOLECULAR CHARACTERIZATION OF FUNGAL

PATHOGENS

A total of 341 pathogenic isolates those belongs to 4 fungal pathogens were subjected to identification on the basis of morphological characters exhibited by each of them and following the identification criteria’s. Identification criteria of Simmons

(1992) and Simmons (2007) was used for morphological characterization of

Alternaria alternata followed by Leslie and Summerell (2006), Nelson et al. (1983) and Burgess et al., 1988 for Fusarium solani, Simmonds (1965), Sutton (1992) and

Gunnell and Gubler (1992) for Colletotrichum spp. (C. acutatum and C. gloeosporioides) and Jarvis, (1977) and Elad et al., 2007 for Botrytis cinerea respectively. After morphological characterization of 341 pathogenic isolates according to respective identification descriptions and manuals, 82 isolates were were identified as A. alternata, 77 as F. solani, 69 as C. acutatum, 21 C. gloeosporioides and 92 as B. cinerea respectively. The name codes with respect to geographical region of the isolate was provided to each pathogen. Microscopic observations and imaging for all pathogens was done with Normasrski interference contrast microscopy (BH-2 compound microscope, Olympus, Melville, New York,

USA) and images were captured at 40x and 100x magnification using a Leica

DFC295 camera and Leica application suite 3.6 (Leica Camera Inc., Allendale, New

Jersey, USA). The parameters used on basis of which isolates were characterized are distinctive for each pathogen and were discussed in detail as following.

Previously pathogenically and morphologically characterized isolates of 4 fungal pathogens (Alternaria alternata, Fusarium solani, Colletotrichum spp. (C. acutatum and C. gloeosporioides) and Botrytis cinerea) were further confirmed by molecular characterization. For molecular characterization a total of 54 representative and aggressive isolates were used. One representative isolates was selected from each of the district, which accounts for 12 isolates of Alternaria alternata, 11 isolates of Fusarium solani as not found in Swat district, 19 isolates of

Colletotrichum spp. where 12 and 7 isolates each of C. acutatum and C. gloeosporioides were selected respectively on the basis that C. acutatum was found in all 12 districts whereas C. gloeosporioides were recovered from 7 districts and 12 isolates of Botrytis cinerea respectively.

All 54 isolates were first subjected to amplification with Inter transcribed

Space (ITS) region and sequenced for all pathogens. In fungi, the inter transcribed spacer region is typically 600-650 bp in size with the help of universal primers ITS-

1 and ITS-4 in forward and reverse directions respectively (White et al., 1990). ITS gene region was used to tentative molecular confirmed and verified by amplification and sequencing of specific gene regions and primers for fungal pathogens to double confirm ITS based identification, genetic diversity among isolates of same fungi, differentiation of species if more than one species is involved in disease and to conduct phylogenetic analysis. For Alternaria alternata (Endopolygalacturonase

(EndoPG), for Fusarium solani (Translation Elongation Factor TEF-1α), for

Colletotrichum spp. i-e., (Beta Tubulin, BT) and Glyceraldehyde-3-Phosphate

Dehydrogenase (G3PDH) gene regions for Botrytis cinerea were also sequenced and analyzed.

4.6 MORPHO-MOLECULAR CHARACTERIZATION OF Alternaria alternata 4.6.1 Cultural and Morphological Characterization 4.6.1.1 Colony color Pure cultures of A. alternata under this study were found to have 3 distinct colony colors that were light brown, dark brown and olivaceous black (Fig. 4.6 a, b and c) respectively. From a total of eighty two isolates, majority of isolates viz. forty

(24.39 %) were recorded to have olivaceous black colonies on media plates, while twenty two isolates (26.82 %) showed dark brown colony color and rest of twenty isolates (24.39 %) have light brown colonies as shown in Table 4.3.

4.6.1.2 Growth habit

The growth habit of purified A. alternata isolates showed variation among different isolates. The growth patterns ranged from cottony subaerial to powdery subaerial. Total of sixty isolates (73.17 %) were observed with cottony and subaerial type of mycelium growth. While 22 isolates (26.82 %) showed powdery type growth habit where a large number of spore masses with mycelia was produced on culture media in subaerial manner (Table 4. 3).

4.6.1.3 Colony margins and color The margins of the pure colonies were observed for their texture. The margins appeared to be regular to irregular in all of 82 isolates with distinct zonation.

The zonations was seen at the margins of colonies. The zonation appeared to be of 2 colors viz. whitish and greyish (Table 4.). Fifty six (70.73%) of isolates were found to have whitish zonation at the margins of smooth colonies whereas greyish smooth margins were seen in 26 isolated (29.26%) (Fig. 4.6 a, b and c).

4.6.1.4 Concentric rings

The A. alternata aerial or subaerial mycelium usually produces ring like

patterns on media surface known as concentric rings. These alternative rings are of light and dark brown colors and sometimes of light creamy color. In this study out of 82 isolates, most of isolates (66, 80.48%) produces concentric rings having alternative combination of light and dark color mycelium growth. Sixteen isolates

(19.51%) showed no appearance of concentric rings (Table 4.3).

4.6.1.5 Conidia: color, shape and size

Conidia of the genus Alternaria are distinct and easy to recognize and separated. Conidia of A. alternata showed variation in color pattern by means of 2 color that are, pale to brown in all of the studies 82 isolates collected from different districts. In this study 17 isolates (20.73%) showed conidia of pale color while rest of 65 isolates (79.26%) showed conidia of brown color as shown in Table 4.3.

Genus Alternaria produced spores of distinct shape as compared to other fungi. The conidia generally were multicelled and have beaks which were either long or short as shown in Fig. 4.5(c). Conidia also exhibits in solitary formation while much more often were seen in form of short chains where on conidia is attached to adjacent conidia in top to bottom manner as shown in Fig. 4.6 (d). The conidia of

Alternaria observed were primarily obclavate to ellipsoid in shape. Majority of the

78.04 % of total isolates showed obclavate shape conidia while 21.95 % showed conidia of ellipsoid shape.

Among 82 isolates of the A. alternata, significant variation was observed in different isolates in terms of the size. The maximum size (L×W) of 60.0±10.96 ×

26.5±8.39 was recorded in isolate ALSP43 followed by 60.0±9.95 × 25.7±8.05 µm in isolate ALRP10 recovered from Sheikhupura and Rawalpindi. Whereas minimum size of 5.0±1.01 × 6.8±1.90 µm was found in isolate ALID5 followed by 6.9±1.34 ×

6.0±1.68 µm from Islamabad and Sargodha respectively. All other isolates showed size ranged in between maximum and minimum as shown in Table 4.3.

4.6.1.6 Conidial septation

The conidia of Alternaria produced septation within conidia in both longitudinal and transverse directions. The number of septation were counted for each of the isolate per spores that showed variation in numbers (Table 4.3 and Fig.

4.6 (e & f). The longitudinal sepatation ranged from 0 to 3 septa, where majority of isolates (48, 58.53%) were found to have 3 septation, 23 (28.04 %) isolates with 0 septation and 8 (9.75 %) with 1 septation. The transverse septation ranged from 1-6, where majority of 53 isolates (64.63 %) showed 4 septation followed by 5 septation in 14 isolates (17.07 %), 6 septation in 11 isolates (13.41 %) and 1 septa in 4 (4.87

%) isolates whereas no isolate was found to have 2 and 3 septation.

The fungus Alternaria alternata is classified under order Hyphales, class

Hyphomycetes and phylum Ascomycota, previously known as Deuteromycota.

(Waals et al., 2001). It is also categorizes as imperfect fungi or Deuteromycetes since the sexual stage of the fungus is not yet known. However, Stewart et al. (2013) concluded that some sub populations of A. alternata linked with citrus showed largely been recombined by para-sexual or cryptic cycle amongst the isolates belongs to same mating type, hence followed a non-meiotic way of recombination. As far as taxonomic classification of Alternaira is concerns, it go through a number of modifications since its establishment by Nees (1817) having A. tenuis as type species. Keissler in 1912, renamed the fungus as A. alternata till today.

In current study, a total of eighty two (82) pathogenic Alternaria isolates were recovered from the infected strawberry leaves. Each isolate was observed for

(a) (b)

(e) (f)

Fig. 4.6. Alternaria alternata morphological characters: Colony color and margins (a) Light brown, irregular (b) Dark brown, regular (c) Olivaceous black, regular (d) Reverse color (e) Spores showing longitudinal and transverse septation (d) Conidia in short chains

Table 4. 3: Alternaria alternata isolates ID with culture identification and morphological characterization (Under Colony Heading: CC = Colony Color, RCC = Reverse Colony Color, GH = Growth habit, CMC =Colony Margins & Color, CR = Concentric Ring. Under Conidia Heading: S= Size (L=Length, W= Width, SD= Standard Deviation), μm= Micro meter, TS = Transverse Septa, LS = Longitudinal Septa) S. Isolate Colony Conidia # ID CC RCC GH CMC CR Color Shape S (L±SD×W±SD) μm TS LS 1 ALID1 Light brown Brown Fluffy, Aerial Regular, Whitish Present Pale Obclavate 34.0±8.72×13.4±2.57 4±1.0 3±0.0 2 ALID2 Olivaceous-black Black Fluffy, Aerial Regular, Greyish Present Pale Obclavate 42.0±6.60×17.2±3.47 4±0.8 3±0.3 3 ALID3 Olivaceous-black Black Fluffy, Aerial Regular, Greyish Present Brown Obclavate 29.0±4.47×11.0±2.01 4±0.4 3±0.2 4 ALID4 Olivaceous-black Black Powdery Regular, Whitish Present Brown Ellipsoid 37.0±4.14×15.0±3.13 4±0.0 3±0.4 5 ALID5 Dark Brown Brown Fluffy, Aerial Irregular, Greyish Present Brown Obclavate 5.0±1.01×6.8±1.90 4±0.0 2±0.3 6 ALRP6 Dark Brown Brown Powdery Regular, Whitish Present Brown Ellipsoid 56.0±8.39×23.5±6.37 4±0.2 2±0.0 7 ALRP7 Olivaceous-black Black Fluffy, Aerial Regular, Whitish Present Brown Obclavate 31.0±4.58×12.0±3.91 1±0.0 0±0.0 8 ALRP8 Light brown Brown Fluffy, Aerial Irregular, Whitish Present Brown Obclavate 25.0±5.37×10.3±3.24 4±0.0 0±0.0 9 ALRP9 Olivaceous-black Black Fluffy, Aerial Regular, Whitish Absent Brown Obclavate 36.0±9.39×14.6±4.58 4±0.9 3±0.0 10 ALRP10 Light brown Brown Fluffy, Aerial Irregular, Greyish Absent Pale Ellipsoid 60.0±9.95×25.7±8.05 4±0.0 3±0.2 11 ALRP11 Light brown Brown Fluffy, Aerial Irregular, Whitish Present Brown Obclavate 55.0±7.60×24.0±7.04 4±1.0 3±0.3 12 ALSG12 Dark Brown Brown Powdery Irregular, Whitish Present Brown Obclavate 32.0±5.48×12.4±4.02 4±0.5 1±0.3 13 ALSG13 Olivaceous-black Black Powdery Irregular, Whitish Present Brown Obclavate 21.0±3.02×10.5±3.47 5±1.0 3±0.2 14 ALSG14 Olivaceous-black Black Fluffy, Aerial Regular, Greyish Present Brown Ellipsoid 15.0±3.58×8.6±2.68 5±0.2 3±0.8 15 ALSG15 Light brown Brown Fluffy, Aerial Regular, Greyish Present Brown Obclavate 11.0±1.84×7.5±2.12 5±0.6 0±0.0 16 ALSG16 Light brown Brown Fluffy, Aerial Regular, Greyish Present Pale Obclavate 6.9±1.34×6.0±1.68 6±0.6 3±1.0 17 ALSG17 Light brown Black Fluffy, Aerial Regular, Greyish Absent Brown Obclavate 50.0±8.16×21.1±7.71 6±1.0 2±0.4 Continued….

18 ALSG18 Olivaceous-black Black Fluffy, Aerial Regular, Greyish Absent Brown Obclavate 26.0±3.80×11.0±3.02 1±0.8 0±0.0 19 ALSG19 Dark Brown Brown Powdery Regular, Greyish Present Brown Obclavate 43.0±6.37×16.8±5.93 4±0.4 0±0.0 20 ALGW20 Olivaceous-black Black Fluffy, Aerial Irregular, Whitish Present Pale Obclavate 10.0±2.35×7.4 ± 3.80 4±0.0 3±0.2 21 ALGW21 Dark Brown Brown Powdery Regular, Greyish Present Brown Obclavate 41.0±9.39×15.3±7.49 4±0.6 3±0.3 22 ALGW22 Olivaceous-black Black Powdery Irregular, Greyish Present Brown Ellipsoid 37.0±7.38×15.2±6.93 4±0.8 3±0.0 23 ALGW23 Olivaceous-black Black Fluffy, Aerial Irregular, Greyish Present Brown Obclavate 23.0±3.91×11.3±3.02 4±0.9 2±0.5 24 ALGW24 Olivaceous-black Black Fluffy, Aerial Regular, Whitish Absent Brown Obclavate 54.0±9.95×20.8±6.48 5±0.4 3±0.2 25 ALGW25 Olivaceous-black Black Fluffy, Aerial Regular, Whitish Present Brown Obclavate 57.0±10.51×25.5±7.49 5±0.2 0±0.0 26 ALSK26 Light brown Black Fluffy, Aerial Regular, Whitish Present Brown Obclavate 14.0±2.35×10.0±5.03 5±1.0 0±0.0 27 ALSK27 Dark Brown Black Powdery Regular, Greyish Present Brown Obclavate 15.0±3.80×11.1±4.25 4±0.6 1±0.4 28 ALSK28 Light brown Black Fluffy, Aerial Regular, Whitish Present Brown Obclavate 36.0±7.04×13.8±5.03 4±0.3 0±0.0 29 ALSK29 Olivaceous-black Black Powdery Regular, Whitish Absent Pale Obclavate 18.0±3.91×12.4±3.91 4±0.8 0±0.0 30 ALSK30 Olivaceous-black Black Fluffy, Aerial Regular, Whitish Present Pale Obclavate 35.0±7.60×13.0±5.37 4±0.0 3±0.3 31 ALSK31 Olivaceous-black Black Fluffy, Aerial Regular, Whitish Present Pale Ellipsoid 47.0±8.72×18.2±5.93 4±0.8 0±0.0 32 ALSK32 Olivaceous-black Black Fluffy, Aerial Regular, Whitish Present Brown Obclavate 53.0±9.50×19.6±7.27 6±0.9 3±0.0 33 ALSK33 Olivaceous-black Black Powdery Regular, Whitish Present Brown Obclavate 34.0±4.81×13.2±3.02 6±0.5 3±0.6 34 ALNR34 Dark Brown Black Fluffy, Aerial Irregular, Greyish Present Brown Obclavate 46.0±8.83×17.7±5.93 6±0.8 3±0.2 35 ALNR35 Dark Brown Brown Fluffy, Aerial Irregular, Greyish Present Brown Obclavate 37.0±5.03×14.4±5.25 4±0.4 3±0.3 36 ALNR36 Olivaceous-black Black Cottony, Regular, Whitish Absent Pale Obclavate 9.0±0.61×6.9±2.80 4±0.7 3±0.0 Subaerial 37 ALNR37 Dark Brown Brown Powdery Regular, Whitish Present Brown Obclavate 51.0±9.28×21.9±8.05 4±0.4 2±0.2 38 ALNR38 Olivaceous-black Black Fluffy, Aerial Regular, Whitish Present Brown Obclavate 47.0±8.39×20.2±7.60 4±0.6 0±0.0 39 ALNR39 Olivaceous-black Black Fluffy, Aerial Regular, Whitish Present Brown Obclavate 10.0±2.35×8.1±2.68 4±0.3 3±0.5 Continued….

40 ALNR40 Olivaceous-black Black Fluffy, Aerial Regular, Whitish Present Brown Obclavate 53.0±9.95×20.5±7.71 4±0.8 3±0.0 41 ALNR41 Dark Brown Black Fluffy, Aerial Regular, Whitish Absent Brown Obclavate 23.0±4.81×10.6±5.03 4±0.0 3±0.4 42 ALSP42 Light brown Brown Fluffy, Aerial Regular, Whitish Absent Brown Obclavate 48.0±7.71×18.2±5.81 6±1.0 3±0.4 43 ALSP43 Light brown Brown Powdery Irregular, Greyish Present Brown Ellipsoid 60.0±10.96×26.5±8.39 6±0.5 0±0.0 44 ALSP44 Olivaceous-black Black Fluffy, Aerial Regular, Whitish Present Pale Ellipsoid 19.0±3.47×11.6±3.91 6±0.8 0±0.0 45 ALSP45 Olivaceous-black Black Fluffy, Aerial Regular, Whitish Present Brown Ellipsoid 31.0±5.81×10.5±3.24 6±0.6 0±0.0 46 ALSP46 Olivaceous-black Black Powdery Regular, Whitish Present Pale Obclavate 27.0±4.58×9.3±3.47 6±0.3 2±0.3 47 ALSP47 Olivaceous-black Black Fluffy, Aerial Regular, Whitish Present Brown Obclavate 48.0±9.39×16.3±6.04 4±0.4 2±0.3 48 ALSP48 Light brown Brown Cottony, Regular, Whitish Present Brown Obclavate 7.0±1.45×6.7±257 4±0.9 2±0.0 Subaerial 49 ALSP49 Olivaceous-black Brown Fluffy, Aerial Regular, Whitish Present Brown Obclavate 57.0±9.73×24.6±8.16 4±0.7 0±0.0 50 ALSP50 Light brown Brown Fluffy, Aerial Irregular, Whitish Present Brown Obclavate 38.0±7.94×13.0±6.26 4±0.6 3±0.2 51 ALSP51 Light brown Brown Fluffy, Aerial Regular, Greyish Present Brown Obclavate 50.0±9.50×20.1±7.60 5±0.0 3±0.3 52 ALLH52 Olivaceous-black Black Fluffy, Aerial Irregular, Whitish Present Pale Obclavate 27.0±4.70×8.2±2.68 4±0.6 3±0.4 53 ALLH53 Olivaceous-black Black Fluffy, Aerial Regular, Greyish Present Brown Ellipsoid 53.0±8.72×21.3±7.94 4±0.4 0±0.0 54 ALLH54 Dark Brown Brown Fluffy, Aerial Regular, Grayish Absent Brown Obclavate 48.0±9.50×18.5±7.27 5±0.5 0±0.0 55 ALLH55 Dark Brown Brown Powdery Regular, Grayish Present Brown Ellipsoid 37.0±8.83×14.4±4.02 5±0.0 3±0.0 56 ALLH56 Olivaceous-black Black Fluffy, Aerial Irregular, Whitish Present Brown Obclavate 52.0±7.84×22.3±7.60 4±0.0 3±0.4 57 ALLH57 Olivaceous-black Black Fluffy, Aerial Irregular, Whitish Present Brown Obclavate 20.0±4.70×7.1±1.90 5±1.0 3±0.0 58 ALLH58 Olivaceous-black Black Powdery Regular, Whitish Present Pale Obclavate 49.0±8.05×17.0±7.27 5±0.5 1±0.4 59 ALMT59 Dark Brown Brown Fluffy, Aerial Irregular, Whitish Present Pale Obclavate 50.0±7.71×18.5±7.83 4±0.0 3±0.5 60 ALMT60 Dark Brown Brown Powdery Regular, Grayish Present Pale Obclavate 57.0±10.51×25.3±4.72 4±0.0 3±0.0 Continued….

61 ALMT61 Dark Brown Brown Fluffy, Aerial Irregular, Whitish Absent Brown Ellipsoid 42.0±8.39×15.5±5.48 4±0.2 3±0.4 62 ALMT62 Olivaceous-black Black Powdery Irregular, Whitish Absent Brown Obclavate 33.0±7.71×12.3±4.25 4±0.0 1±0.3 63 ALMT63 Dark Brown Brown Fluffy, Aerial Irregular, Whitish Present Brown Obclavate 47.0±9.28×15.8±6.48 4±0.0 3±0.0 64 ALMT64 Dark Brown Brown Fluffy, Aerial Irregular, Whitish Present Brown Obclavate 39.0±8.39×13.2±5.03 1±0.0 3±0.2 65 ALMT65 Light brown Brown Fluffy, Aerial Regular, Grayish Present Brown Ellipsoid 21.0±3.80×8.4±2.35 4±0.6 1±0.1 66 ALMD66 Light brown Brown Powdery Irregular, Whitish Present Brown Obclavate 55.0±8.50×23.5±8.39 4±0.8 3±0.6 67 ALMD67 Dark Brown Brown Fluffy, Aerial Regular, Grayish Present Brown Obclavate 42.0±9.28×14.9±5.70 4±0.2 1±0.0 68 ALMD68 Light brown Brown Powdery Irregular, Whitish Present Brown Ellipsoid 38.0±7.49×12.6±5.14 5±0.0 0±0.0 69 ALMD69 Light brown Brown Powdery Regular, Grayish Present Brown Ellipsoid 53.0±10.17×21.4±7.60 4±0.4 3±0.3 70 ALMD70 Olivaceous-black Black Fluffy, Aerial Regular, Whitish Present Brown Obclavate 46.0±7.71×18.2±5.93 4±0.2 0±0.0 71 ALMD71 Dark Brown Brown Fluffy, Aerial Irregular, Whitish Absent Brown Obclavate 34.0±6.60×12.4±4.70 4±0.0 2±0.3 72 ALCS72 Olivaceous-black Black Fluffy, Aerial Regular, Whitish Present Brown Obclavate 17.0±4.81×10.1±2.68 1±0.0 2±0.9 73 ALCS73 Olivaceous-black Black Fluffy, Aerial Regular, Whitish Absent Brown Obclavate 48.0±9.17×17.7±5.14 4±0.4 3±0.4 74 ALCS74 Light brown Brown Fluffy, Aerial Irregular, Whitish Present Pale Obclavate 30.0±8.72×11.1±3.80 4±0.2 0±0.0 75 ALCS75 Dark Brown Brown Fluffy, Aerial Irregular, Whitish Present Brown Ellipsoid 52.0±9.95×22.6±7.71 6±0.0 0±0.0 76 ALCS76 Light brown Brown Powdery Regular, Grayish Present Brown Ellipsoid 47.0±9.28×16.2±5.37 4±0.0 3±0.8 77 ALSW77 Dark Brown Black Fluffy, Aerial Regular, Whitish Present Pale Obclavate 44.0±9.95×15.7±5.93 4±0.0 0±0.0 78 ALSW78 Olivaceous-black Black Powdery Regular, Whitish Present Brown Obclavate 39.0±4.36×13.3±4.92 5±0.0 3±0.2 79 ALSW79 Olivaceous-black Black Fluffy, Aerial Regular, Whitish Present Brown Ellipsoid 14.0±3.13×10.3±3.58 4±0.0 3±0.8 80 ALSW80 Dark Brown Brown Powdery Irregular, Whitish Absent Brown Obclavate 47.0±6.60×16.8±5.81 5±0.0 1±0.0 81 ALSW81 Olivaceous-black Black Powdery Irregular, Greyish Absent Brown Obclavate 55.0±7.27×24.7±8.39 4±0.4 3±0.0 82 ALSW82 Olivaceous-black Black Fluffy, Aerial Irregular, Greyish Present Brown Obclavate 21.0±4.14×12.8±5.37 4±0.4 0±0.0

distinct features both at cultural/macroscopic and microscopic levels. Based on the data obtained by morphological characterization the isolates were tentatively identified as A. alternata.

According to Simmons and Roberts (1993); Simmons (1999), traditionally,

Alternaira spp. has been identified by using a number of morphological characteristics that includes cultural aspects and morphology, conidial shape and size and the pattern of branching in the formation of conidial chains. Furthermore,

Andrew et al. (2009) suggested that based upon the above provided characteristics, it is possible to easily differentiate amongst Alternaria into major sections. However, due to presence of some level of variation and differences, these give rise to complexities in this approach particularly during identification in case of closely related species. Similarly, Simmons (1999) revised the taxonomic parameters of

Alternaria genus and concluded that still many complications lies in the identification of few Alternaria spp. as a result of their high variability but decreases in pure cultures. David (1991) suggested that morphological features of conidia and conidiophores along with association of host plant offers an important taxonomic measure for defining a fungal species. A. alternata showed significant morphological varation that attributes to the cultural conditions.

According to Simmons (1999 and 2007), A. alternata is a member of small spore Alternaria spp. group. A. alternata colonies on media were brown and olivaceous grey to black in color. The texture is of flat, circular nature. The margins of the colonies are regular to irregular. Mycelium is of cottony, superficial or subaerial, consisting of branched, septate, sub hyaline, smooth hyphae. Concentric rings were present in majority of the isolates while not observed in others. The conidiation

shape resembles to those of A. dumosa and A. citri but values of morphological features were different from them. The conidia of fungus were straight, either beaked or unbeaked. Conidia color was Pale to dark brown to olivaceous green, flat or punctuate whereas in this study, isolates exhibits the color that comes under the range of pale to brown. Conidia shape were obclavate to long ellipsoid having small to modest in size with sepatation that runs at transverse and longitudinal planes of conidia. Similarly Fan et al. (2013) reported dark gray to black brown and densely turdy growth behavior on PDA plates.

The conidial size ranged from 20-65 μm in length and 10-17 μm in width and are borne in chains or singly on conidiophores. According to a similar study conducted by Ramjegathesh and Ebenezar (2012), the conidial size of A. alternata were measured to be from 13.00 to 55.47 µm long while there width ranged from

11.9 to 17.37 µm. Whereas, Nolla (1927), reported significant variation in size of conidia from different Alternaria spp. He described the length of 105-320 × 12-24

µm in A. alli, 105-220 ×17.5-26 µm in A. pori respectively, while Rao (1974) reported that conidia of A. cepulicola length and width ranged from 58.8-184.8 × 21-

46.2 µm and 10.26-77.52 × 4.56-14.82 µm, which showed high varation and difference in size of A. alternata conidia as compared to other species which also correlated with the result of this study and also as described by Simmons (2007).

The A. alternata conidia shape in current study were found to be obclavate and ellipsoid and chains of conidial formation was also observed, the conidia contain septation of two type’s viz. longitudinal and transverse. Conidia have between 0-3 or rarely 4 longitudinal septa and 1-9 transverse septation whereas all isolates under current study falls in the described range. The transverse and longitudinal septation

ranged from 0-3 and 1-6 respectively, which are found to be consistent as described by Simmons (1999 and 2007), that the shape extends from obclavate to muriform whereas, A. solani conidia were ovoid and are longer as of A. alternata. Whereas according to Elliot (1917), the conidial shape was obclavate, ovate, cuneate and under suitable conditions they also form chains of conidia. Similarly, Cuervo-perra et al. (2012), reported the shape of A. alternata conidia as muriform while the septation were 0-5 and 1-9 whereas, A. palandui have value of 0-3 and 2-8.in case of transvers and longitudinal sepatation respectively. According to description of

David (1991), conidia of A. alternata are generally mentioned to as obclative, obpyriform and ovoid or ellipsoidal frequently with a short tapering or cylinder- shaped beak and have a pale brown wall. It is among the small spored species.

Conidia of A. alternata are of dark grey to pale or pale brown in color. Size of conidia ranged from 11-45 μm in length whereas 6-18 μm in width. Conidia formation occurs in simple, short or branched chains whereas also found to be as single conidia. While on the other hand conidia of A. solani are multi septate and muriform. Though, there is plentiful sub-aerial mycelium that is lighter in color than that of A. solani. The deviation in shape and size from the isolates under study, may be due to host or environmental aspects and therefore reflected to fall inside the described limits for

A. alternata specie (Simmons, 2007).

4.6.2 Molecular Characterization of A. alternata

From 82 morphological identified isolates of A. alternata, 12 representative isolates viz. ALID5, ALRP7, ALSG17, ALGW23, ALSK28, ALNR40, ALSP47,

ALLH55, ALMT61, ALMD69, ALCS75 and ALSW81 where each representing one district was selected for molecular characterization (Table 4.4). The Inter transcribed

spacer region (ITS) and endopolygalacturonase (endoPG) gene regions were amplified by using primers pairs ITS1/ITS4 and PG3/PG2b respectively (Table. 3.2).

The gel electrophoresis resulted in production of clear single bands of amplified product that further used for nucleotide sequencing. The amplified PCR product had fragments size of about 600-650 (ITS) and 450-500 bp (endoPG) and aligned sequences were submitted with isolates coding NAS-AA1 to NAS-AA12 to

Genbank to obtained accession numbers viz. MF966136-46 and KX768145 with ITS and MF964623-28, MF974541-45 and MF176337 with endoPG gene regions respectively (Table 4.4).

The genetic similarity of each of above mentioned isolates were analyzed with BLAST search for ITS and EndoPG gene regions. The results showed that all

12 isolates of A. alternata (NAS-AA1-11) with ITS gene region exhibits 100% genetic similarity with previously reported isolates of A. alternata (accession numbers, MF683080, KY609080, KX622106, KY026592, MH021686, MG025872,

EF025872, EF471931, KX463014, GU797144 and MH040863) expect NAS-AA12 showed 99% with KY609180. While with EndoPG gene region all isolates showed

100% genetic homology with previously reported isolates (accession nos.

KY923228, KP123996, KY699546, XM_018529333, EF504204, KF699391,

KU933188, KY468525, KP789545 and KP7894546).

Nucleotides Sequences of 12 A. alternata isolates (labelled with black squares) were undergone phylogenetic analysis with 12 reference sequences (non- labelled) for A. alternata that were retrieved from Genbank for each gene viz. ITS and EndoPG. All sequences were aligned and inspected and on the basis of these aligned sequences, phylogenetic trees were constructed with the Maximum

Likelihood (ML) method in Molecular Evolutionary Genetics Analysis (MEGA) software version 7.0 with 1000 bootstrap replicates (Kumar et al., 2016) as shown in

Fig. 4.10 (a and b). The analyses revealed adequate information resulted in distinguishing the representative isolates from current study into a single fungal species that were prevalent in various geographical locations surveyed. Also all of the representative isolates clusters with the previously reported isolates of A. alternata due to high genetic homology among these isolates hence confirms the results of the current studied isolates falls into various subtrees due to genetic diversity among themselves on the basis of nucleotide differences among and all belonging to a single Alternaira sp. viz. Alternaria alternata. Whereas all were found to be quite distinct from A. mali that was used as outgroup.

Identification of Alternaria species based on study of cultural/morphological aspects in combination with molecular tools proved more reliable and effective

(Simmons, 2007). Tulek and Dolar (2015) computed sequence analysis of four species of Alternaria viz. A. radicina, A. alternata, A. tenuissima and A. dauci from carrots in Turkey. ITS sequences of these isolates revealed 100% genetic homology with previous reported isolates of A. alternata and showed that ITS proved helpful in identification up to species level. Similarly, Kusaba and Tsuge (1995) reported that different species of Alternaria were clearly differentiated from one another on basis of varation among ITS r DNA. Whereas, Pryor and Gilbertson, 2000; Pryor and Michailides (2002) described that sequence analysis of ITS, mitochondrial small subunit (mtSSU) provided no accurate resolution among small and large spores taxas in genus Alternaria. Peever et al. (2002) reported that form sixty five fungal isolates recovered form citrus brown spot disease from USA, Australia, Turkey, South Africa

and Colombia were successfully identified as A. alternata and also confirmed the use of protein coding genes like EndoPG for estimating accurate phylogenies among closely related Alternaria species. The mentioned research was also considered pioneer study that uses endoPG gene for for molecular identification and phylogenetic study of Alternaria. Similarly, Peever et al. (2004); Andrew et al.

(2009) in their studies reported that to date only endopolygalacturonase (endoPG) gene proven best to differentiate among members of Alternaira species and groups.

Cultural and morphological characterization, along with pathogenicity testing on detached asymptomatic leaves of strawberry plant inferred the tentative identification of the leaf spot disease associated pathogen as A. alternata.

Furthermore, molecular identification with ITS and endoPG gene regions confirmed the morphological studies. The findings also proved to be primarily evidence of disease in Pakistan and resulted in first report of A. alternata as causal agent of strawberry leaf spot disease (Mehmood et al., 2018a).

4.7 MORPHO-MOLECULAR CHARACTERIZATION OF Fusarium solani 4.7.1 Cultural and Morphological Characterization 4.7.1.1 Colony color The aerial mycelium of purified isolates of F. solani above the media surface showed color varation. The difference in the color of colony helped in distinguishing and grouping between isolates. F. solani produced various types of white color. It varied from cottony white (42 isolates, 54.54 %), white (17 isolates, 22.07 %) to creamy white (18 isolates, 23.37%) among different isolates of pathogen as shown in Fig. 4.8 (a, b and c) respectively. The pathogen isolates viz. FRRP6 & 7, FRSG11 and 15, FRGW20, FRSK23, FRNR27 & 33, FRSP41, FRLH50, FRMD62 & 63 and

Table 4.4 Details of Alternaria alternata isolates and accession numbers with ITS and EndoPG primers used in molecular study

S. # Isolate ID District of Isolate ID Accession # Accession # origin on NCBI (ITS) (EndoPG) 1 ALID5 Islamabad NAS-AA1 MF966136 MF964623

2 ALRP7 Rawalpindi NAS-AA2 MF966137 MF964624

3 ALSG17 Sargodha NAS-AA3 MF966138 MF964625

4 ALGW23 Gujranwala NAS-AA4 MF966139 MF964626

5 ALSK28 Sialkot NAS-AA5 MF966140 MF964627

6 ALNR40 Narowal NAS-AA6 MF966141 MF964628

7 ALSP47 Sheikhupura NAS-AA7 MF966142 MF974541

8 ALLH55 Lahore NAS-AA8 MF966143 MF974542

9 ALMT61 Multan NAS-AA9 MF966144 MF974543

10 ALMD69 Mardan NAS-AA10 MF966145 MF974544

11 ALCS75 Charsadda NAS-AA11 MF966146 MF964545

12 ALSW81 Swat NAS-AA12 KX768145 MF176337

A. alternata A. alternata

A. mali A. mali (a) Acessions with ITS gene region (b) Acessions with endoPG gene region

FRSCS3 & 6 were found to have white colony color. The isolates viz. FRID4,

FRID3-4, FRSG12 & 15, FRGW22, FRSK31, FRNR34, 44, 46 & 48, FRSP52, 54,

56, 59 & 61 and FRMD82 found to have white colony color. The isolates viz. FRID4,

, FRID3-4, FRSG12 and FRGW22, FRSK31, FRNR34, 44, 46 & 48, FRSP52, 54,

56, 59 & 61 and FRMD82 were creamy white in color while the rest of isolates were cottony white.

4.7.1.2 Growth habit

F. solani produce mycelium over the artificial media surface showed a distinct growth pattern. This aerial mycelium of different isolates of fungus revealed distinctive fluffy, flat and compact mycelial growth pattern as shown in Fig. 4.8 a, b & c respectively. About forty nine (63.63%) isolates exhibits distinct fluffy growth

(4.8 a) pattern while fifteen (19.48%) were found having compact pattern (Fig. 4.8 c) of growth and rest of thirteen (16.88%) isolates were recorded to have flat growth habit (Fig. 4.8 b). (Table 4.5)

4.7.1.3 Pigmentation

Isolates of F. solani produced pigmentation in media plates after 7-10 days of incubation at 25± 2o C. In the identification of Fusarium species, pigmentation is considered as secondary character. Out of total 77 isolates, majority of isolates (58,

75.32 %) showed pale yellow pigmentation (Fig. 4.8 e), whereas 18 (22.07 %) isolates were observed without any pigmentation (Fig. 4.8 d). Details of isolates pigmentation were given in Table 4.5.

4.7.1.4 Conidiophore and Phialide

The conidiophores were observed as hyaline, septate and branched or unbranched. The conidiogenous cells produce conidia via an opening and the

numbers of such opening varies from cell to cell. They may be monophialides having single opening or may be polyphialides having more than one opening. The length of conidiogenous cells was long in case of all F. solani isolates. This long monophialides are characteristic feature for identification of F. solani from rest of

Fusarium species e.g. in case of F. oxysporum the monophialides are short. These cells may be brached or unbranched, this branching helps in distinguishing Fusarium spp. In present study all isolates exhibit monophialides whereas most the isolates: 48

(62.33%) showed long and branched monophialides (Fig. 4.9 b) and rest of 29 isolates (37.66%) showed only long monophialides shown in Fig. 4.9 a. Details of

Phialides and their characteristics in isolates were shown in Table 4.5.

4.7.1.5 Microconidia shape and size

Microconidia were produced and observed in pure cultures of all isolates.

They were found numerously in aerial mycelium in false heads on long monophialides. They tend to be somewhat wider, oval to reniform in shape and have thicker walls as shown in Fig 4.9 c with larger macrospores. The Microconidia cells in this study were observed in 44 isolates (57.14 %) as of oval shaped while rest of

32 isolates (41.55 %) reniform. Microconidia size in both dimensions (length and width) was measured 5 times randomly under microscope. Significant variation was seen in the microconidial size between different isolates. The minimum size dimensions (L±SD × W±SD) of 7.4±0.11 × 1.7±0.2 µm was recorded in isolate

FRSG15 whereas the maximum size dimensions (L±SD × W±SD) of 16.0±2.46 ×

4.8±0.6 µm was observed in isolate FRSK27 (Table 4.5).

4.7.1.6 Macroconidia shape and size

Septate and thin walled macroconidia were found under microscope in

current study. Macroconidia produced were sporodochia borne and were observed in pure cultures after 5-10 days of incubation. Macroconidia of 2 different shapes were observed i-e. Fusiform curved and straight. Majority of isolates, seventy three

(94.80 %) produced fusiform and curved shaped macroconidia (Fig.4.9 c). Only four

(5.19%) isolates viz. FRNR32, FRMT61, FRMD67 and FRCS73 produced fusiform and straight macroconidia as shown in Fig. 4.9 (d).

Macroconidia size was also measured five times randomly by using

Normasrski interference contrast microscopy at 100x magnifications (Fig. 4.7 c).

Significant variation was found in the size of macroconidia. Maximum macroconidia size of 45.1±6.82 ×7.6±0.67 was observed in isolate FRMT59 recovered from

Multan while minimum size of 25.2±4.81×3.1±0.22 were recorded in isolate FRID2 from Islamabad and all other isolates falls within these both ranges (Table 4.5)

4.7.1.7 Macroconidia apical and basal cells shape

The ends of F. solani macroconidia showed distinct shapes (Table 4.5).

Apical cells in majority of isolates (48, 62.33%) were found to be curved apical cells whereas rest of 29 isolates (37.66%) have slightly hooked shaped apical cells.

Similarly, 48 isolate (62.33%) were found to have pointed shape basal cells of macroconidia, while 29 isolates (37.66%) had distinct notch in the basal cells and were referred to as foot shaped basal cells (Fig. 4.9 c).

4.7.1.8 Macrocondial septation

The septation in macroconidia was noted for each isolate per spore. The resulted data depicts varation in the numbers of septation. Overall, the number of septation in spores ranged from a minimum of 3 to a maximum of 7. Macroconidia with 5 septation were observed in 27 isolates (35.06%) followed by 20 isolates

(25.97%) with 6 septation and 15 isolates (19.48%) with 4 septation. Six isolates

(7.79%) were found to have 6 septation in macroconidia cells while only 7 isolates

(9.09%) showed to have 7 septation (Table 4.5 and Fig. 4.9 c & d).

4.7.1.9 Chlamydospores formation and size

Chlamydospores are basically thick walled, swollen, storage and resting cell that may produce aerially or in microconidial sporodochia. Chlamydospores occurrence or absence play important role between differentiations of Fusarium species. In present study, data for Chlamydospores was observed after 10-15 days of incubation. The spores were found in all 77 isolates and in two different formations viz. (Fig. 4.9 e) singly, in pairs or mixed (Fig. 4.9 f). In 71 isolates (92.20 %) showed production of Chlamydospores in mixed form that consists of both single and in paired forms , while seven isolates (7.79 %) showed Chlamydospores production only in single form (Fig. 4.9 d). Chlamydospores size in term of diameter was recorded 5 five for each isolate in random manner. The diameter of spores showed certain variation among each other. The Chlamydospores diameter measured were ranged from 5µm to 11 µm, where both reading showed minimum and maximum respectively as shown in Table 4.5.

The morphological feature revealed some difference among the isolates but morphological studies of 77 isolates evident the tentative characterization into

Fusarium solani. Based on the study of morphological characterization, all isolates findings was supported by the previous reports, concepts and literature of different scientist i.e. Leslie and Summerell (2006), Burgess et al., 1988, Nelson et al. (1983),

Nelson and Toussoun (1983) and Booth 1977. Similarly, According to Booth (1977), the determined Fusarium species are closely related, given that they also shared

(a) (b)

(c)

(d) (e)

Figure 4.8. Fusarium solani Colony color and Growth habit (a) Cottony & fluffy white (b) White & flat (c) Creamy white & compact; Pigmentation (d) Colorless, (e) Pale yellow

(a) (b)

(e) (f) Fig. 4.9. Fusarium solani morphological characters: (a) Long Monophialides (b) Long & branched Monophialides (c) Microconidia (oval and reniform) and Macroconidia (Fusiform curved and sepatation) (d) Fusiform straight & septation; Formation of chlamydospores (e) Singly (f) Singly & paired

Table 4. 5: Fusarium solani isolates ID with culture identification and morphological characterization (CC = Colony Color, GH = Growth Habit, P = Pigmentation, S μm = Size in Micrometer, L±SD, Length ± Standard deviation, W±SD = Width ± Standard deviation, s= Septation, Ph. =Phialide)

Isolate Colony Macroconidia Microconidia Chlamydospores S. ID CC GH P S μm Shape S Apical Basal S μm Shape Ph. S μm Color Formation # (L±SD)× Cell Cell (L±SD)× (L±SD)× (W±SD) (W±SD) (W±SD) 1 FRID1 Cottony Fluffy Pale Yellow 28.6±3.58× Fusiform, 4 Curved Pointed 11.2±1.57× Reniform Long, Branched 7±2.2 Brown Singly, Pairs White 4.1±0.34 Curved 2.6±0.3 2 FRID2 Cottony Fluffy Pale Yellow 25.2±4.81× Fusiform, 3 Curved Pointed 8.9±1.01× Reniform Long, Branched 9±3.4 Brown Singly, Pairs White 3.1±0.22 Curved 1.6±0.1 3 FRID3 Creamy Flat Colorless 29.2±3.69× Fusiform, 5 Curved Pointed 10.6±2.24× Reniform Long, Branched 6±1.7 Brown Singly, Pairs White 3.8±0.34 Curved 3.2±0.4 4 FRID4 Creamy Fluffy Pale Yellow 30.4±5.37× Fusiform, 5 Curved Pointed 12.8±2.91× Oval Long, Branched 10±3.4 Brown Singly White 4.3±0.45 Curved 3.6±0.5 5 FRRP5 Cottony Flat Colorless 35.9±7.04× Fusiform, 5 Curved Pointed 9.4±0.34× Oval Long, Branched 7±2.3 Brown Singly, Pairs White 4.4±0.45 Curved 3.6±0.4 6 FRRP6 White Fluffy Pale Yellow 28.3±5.48× Fusiform, 6 Slightly Foot- 14.0±3.47× Oval Long 8±2.8 Brown Singly, Pairs 6.1±0.67 Curved hooked shaped 3.8±0.3 7 FRRP7 Cottony Fluffy Pale Yellow 32.5±4.81× Fusiform, 6 Slightly Foot- 15.3±2.68× Oval Long 5±1.6 Brown Singly, Pairs White 6.5±0.67 Curved hooked shaped 4.4±0.6 8 FRRP8 White Compact Colorless 34.9±5.48× Fusiform, 7 Slightly Foot- 12.4±1.45× Oval Long 6±1.8 Brown Pairs 7.0±0.78 Curved hooked shaped 4.2±0.4 9 FRRP9 Creamy Fluffy Pale Yellow 26.6±3.58× Fusiform, 5 Curved Pointed 10.1±0.94× Oval Long, Branched 15±5.6 Brown Singly, Pairs white 5.5±0.56 Curved 3.4±0.4 10 FRSG10 Cottony Fluffy Pale Yellow 29.5±3.24× Fusiform, 4 Curved Pointed 11.7±1.79× Oval Long, Branched 11±4.5 Brown Singly White 4.2±0.45 Curved 3.7±0.4 11 FRSG11 Creamy Fluffy Pale Yellow 26.4±3.91× Fusiform, 3 Curved Pointed 13.3±2.35× Oval Long, Branched 6±2.7 Brown Singly White 3.6±0.34 Curved 3.6±0.4 12 FRSG12 White Fluffy Pale 39.4±6.15× Fusiform, 6 Slightly Foot- 15.8±3.10× Oval Long 6±2.3 Brown Singly, Pairs 6.6±0.67 Curved hooked shaped 4.8±0.5 13 FRSG13 Cottony Flat Pale Yellow 32.8±5.03× Fusiform, 4 Curved Pointed 12.8±1.79× Oval Long, Branched 9±3.9 Brown Singly, Pairs White 4.5±0.45 Curved 1.7±0.2 14 FRSG14 Creamy Fluffy Pale 38.2±6.15× Fusiform, 5 Curved Pointed 9.5±0.34× Reniform Long, Branched 10±4.5 Brown Pairs White 4.7±0.45 Curved 3.2±0.3 Continued….

15 FRSG15 Cottony Fluffy Pale Yellow 28.2±4.70× Fusiform, 5 Curved Pointed 7.4±0.11× Reniform Long, Branched 5±2.2 Brown Singly, Pairs White 3.9±0.45 Curved 1.7±0.2 16 FRSG16 White Fluffy Pale 26.8±4.70× Fusiform, 6 Slightly Foot- 15.4±1.23× Oval Long 11±3.1 Brown Singly, Pairs 5.7±0.56 Curved hooked shaped 3.1±0.4 17 FRGW17 Cottony Fluffy Pale Yellow 39.4±6.48× Fusiform, 4 Curved Pointed 14.1±2.80× Reniform Long, Branched 11±3.4 Brown Singly, Pairs White 3.5±0.34 Curved 3.7±0.4 18 FRGW18 Creamy Fluffy Colorless 33.3±4.81× Fusiform, 5 Curved Pointed 11.7±1.99× Oval Long, Branched 7±2.8 Brown Singly, Pairs White 5.3±0.56 Curved 3.1±0.3 19 FRGW19 Cottony Compact Pale Yellow 29.8±4.36× Fusiform, 4 Curved Pointed 10.4±0.01× Oval Long, Branched 8±3.0 Brown Singly, Pairs White 4.1±0.45 Curved 3.2±0.3 20 FRGW20 Cottony Fluffy Pale Yellow 39.3±5.37× Fusiform, 4 Curved Pointed 14.4±3.35× Oval Long, Branched 6±2.6 Brown Singly, Pairs White 3.8±0.45 Curved 3.6±0.4 21 FRGW21 White Fluffy Colorless 36.9±5.93× Fusiform, 6 Slightly Foot- 16.3±3.13× Reniform Long 9±3.2 Brown Pairs 5.2±0.56 Curved hooked shaped 3.8±0.5 22 FRGW22 White Fluffy Pale Yellow 41.2±6.48× Fusiform, 6 Slightly Foot- 10.8±1.11× Oval Long 5±1.7 Brown Singly, Pairs 6.9±0.67 Curved hooked shaped 4.7±0.6 23 FRGW23 Cottony Fluffy Pale Yellow 35.8±5.93× Fusiform, 5 Curved Pointed 10.6±0.55× Reniform Long, Branched 8±2.3 Brown Singly, Pairs White 4.8±0.45 Curved 3.2±0.3 24 FRGW24 Cottony Flat Pale Yellow 37.2±4.81× Fusiform, 7 Slightly Foot- 12.4±1.38× Oval Long 10±2.8 Brown Singly, Pairs White 5.6±0.56 Curved hooked shaped 2.7±0.2 25 FRSK25 Creamy Fluffy Pale Yellow 33.7±4.36× Fusiform, 5 Curved Pointed 13.2±1.58× Oval Long, Branched 9±2.9 Brown Singly, Pairs White 4.9±0.56 Curved 3.5±0.3 26 FRSK26 White Compact Colorless 29.3±3.58× Fusiform, 4 Slightly Foot- 15.3±1.84× Oval Long 10±3.4 Brown Singly 4.7±0.45 Curved hooked shaped 3.3±0.2 27 FRSK27 Cottony Fluffy Colorless 38.3±3.58× Fusiform, 4 Curved Pointed 16.0±2.46× Oval Long, Branched 8±2.2 Brown Singly, Pairs White 5.3±0.56 Curved 4.8±0.6 28 FRSK28 Cottony Fluffy Pale Yellow 35.8±4.36× Fusiform, 3 Curved Pointed 8.8±0.67× Reniform Long, Branched 5±1.1 Brown Singly, Pairs White 6.8±0.67 Curved 3.8±0.4 29 FRSK29 Cottony Flat Pale Yellow 29.4±3.24× Fusiform, 5 Slightly Foot- 13.9±3.69× Oval Long 11±3.8 Brown Singly, Pairs White 6.6±0.67 Curved hooked shaped 3.6±0.4 30 FRNR30 White Fluffy Pale Yellow 40.5±6.60× Fusiform, 5 Slightly Foot- 10.5±2.46× Reniform Long 10±3.5 Brown Singly 6.9±0.67 Curved hooked shaped 2.8±0.2 31 FRNR31 Cottony Flat Pale Yellow 38.2±6.04× Fusiform, 5 Slightly Foot- 11.8±2.01× Reniform Long 6±1.6 Brown Singly, Pairs White 6.3±0.67 Curved hooked shaped 3.2±0.3 32 FRNR32 Creamy Compact Pale Yellow 33.7±5.48× Fusiform, 5 Curved Pointed 14.7±2.57× Oval Long, Branched 5±1.0 Brown Singly, Pairs White 6.4±0.67 Straight 3.1±0.3 Continued….

33 FRNR33 Creamy Fluffy Colorless 30.3±3.80× Fusiform, 5 Curved Pointed 14.6±1.79× Reniform Long, Branched 8±1.5 Brown Singly, Pairs White 4.3±0.45 Curved 3.6±0.4 34 FRNR34 Cottony Fluffy Colorless 29.6±3.47× Fusiform, 3 Curved Pointed 12.1±0.89× Reniform Long, Branched 6±1.2 Brown Singly, Pairs White 3.2±0.34 Curved 3.4±0.4 35 FRNR35 Creamy Fluffy Yellowish 34.6±4.02× Fusiform, 4 Curved Pointed 9.9±0.88× Oval Long, Branched 7±1.3 Brown Singly, Pairs White 5.3±0.56 Curved 3.7±0.4 36 FRNR36 White Compact Colorless 38.3±5.14× Fusiform, 6 Slightly Foot- 13.8±1.57× Oval Long 11±3.1 Brown Singly, Pairs 6.7±0.67 Curved hooked shaped 3.3±0.4 37 FRNR37 Creamy Flat Yellowish 40.8±5.93× Fusiform, 4 Curved Pointed 9.2±0.75× Reniform Long, Branched 8±3.5 Brown Singly, Pairs white 4.7±0.45 Curved 3.6±0.5 38 FRNR38 White Compact Pale Yellow 39.4±4.81× Fusiform, 4 Curved Pointed 12.7±1.01× Reniform Long 10±3.7 Brown Singly, Pairs 5.9±0.56 Curved 3.5±0.5 39 FRNR39 Creamy Compact Pale Yellow 35.2±4.36× Fusiform, 6 Slightly Foot- 14.2±1.45× Oval Long, Branched 9±3.4 Brown Singly, Pairs White 6.5±0.67 Curved hooked shaped 3.3±0.3 40 FRSP40 Cottony Fluffy Colorless 33.9±4.81× Fusiform, 5 Curved Pointed 7.7±0.78×4 Oval Long, Branched 8±3.0 Brown Singly, Pairs White 3.5±0.34 Curved .3±0.6 41 FRSP41 Creamy compact Pale Yellow 38.3±5.37× Fusiform, 5 Curved Pointed 15.8±1.68× Oval Long, Branched 7±2.9 Brown Singly, Pairs White 4.3±0.38 Curved 3.9±0.6 42 FRSP42 Cottony Fluffy Pale Yellow 42.8±5.93× Fusiform, 7 Slightly Foot- 11.2±1.79× Oval Long 10±3.6 Brown Singly, Pairs White 7.0±0.70 Curved hooked shaped 3.6±0.4 43 FRSP43 Creamy Flat Pale Yellow 39.4±5.25× Fusiform, 4 Curved Pointed 13.6±2.01× Reniform Long, Branched 9±3.4 Brown Singly, Pairs White 4.5±0.48 Curved 3.3±0.4 44 FRSP44 Cottony Fluffy Colorless 43.4±6.37× Fusiform, 6 Slightly Foot- 14.0±1.60× Reniform Long 11±3.9 Brown Singly, Pairs White 6.7±0.59 Curved hooked shaped 4.2±0.6 45 FRSP45 Creamy compact Pale Yellow 40.4±6.60× Fusiform, 3 Curved Pointed 7.3±1.34× Oval Long, Branched 7±2.8 Brown Singly, Pairs White 3.8±0.44 Curved 3.1±0.3 46 FRSP46 White Flat Pale Yellow 38.9±5.81× Fusiform, 6 Slightly Foot- 11.9±0.89× Reniform Long 10±3.8 Brown Singly, Pairs 6.3±0.63 Curved hooked shaped 3.2±0.5 47 FRSP47 Cottony compact Pale Yellow 36.4±4.81× Fusiform, 6 Curved Pointed 11.6±1.12× Oval Long, Branched 9±3.5 Brown Singly, Pairs White 4.7±0.45 Curved 3.4±0.4 48 FRSP48 Creamy Fluffy Pale Yellow 38.1±5.48× Fusiform, 4 Curved Pointed 12.2±0.09× Oval Long, Branched 8±2.8 Brown Singly, Pairs White 4.0±0.38 Curved 3.6±0.4 49 FRSP49 Cottony Fluffy Pale Yellow 29.6±3.80× Fusiform, 5 Curved Pointed 10.5±1.22× Reniform Long, Branched 7±2.2 Brown Singly, Pairs White 4.4±0.55 Curved 3.1±0.3 50 FRSP50 Creamy Compact Pale Yellow 28.2±3.24× Fusiform, 3 Curved Pointed 13.3±2.35× Reniform Long, Branched 9±2.8 Brown Singly, Pairs White 3.2±0.37 Curved 3.4±0.4 Continued….

51 FRSP51 Cottony Fluffy Pale Yellow 33.8±3.91× Fusiform, 6 Curved Pointed 11.1±1.90× Oval Long, Branched 11±3.9 Brown Singly, Pairs White 4.6±0.48 Curved 2.9±0.3 52 FRLH52 White Fluffy Pale Yellow 37.3±4.92× Fusiform, 7 Slightly Foot- 14.9±2.68× Reniform Long 9±2.3 Brown Pairs 6.8±0.72 Curved hooked shaped 4.3±0.6 53 FRLH53 Cottony Fluffy Pale Yellow 27.3±4.25× Fusiform, 5 Curved Pointed 15.6±3.02× Oval Long, Branched 6±1.7 Brown Singly White 4.1±0.55 Curved 3.7±0.5 54 FRLH54 Cottony Fluffy Pale Yellow 44.7±6.60× Fusiform, 7 Slightly Foot- 12.4±1.17× Oval Long 6±1.5 Brown Singly White 7.0±0.56 Curved hooked shaped 3.6±0.5 55 FRLH55 Cottony compact Pale Yellow 39.3±6.04× Fusiform, 6 Curved Pointed 12.7±1.50× Reniform Long, Branched 9±2.2 Brown Singly, Pairs White 4.9±0.61 Curved 3.2±0.3 56 FRLH56 White Fluffy Colorless 44.2±5.37× Fusiform, 7 Slightly Foot- 9.4±0.39×2 Oval Long 5±1.3 Brown Singly, Pairs 6.7±0.74 Curved hooked shaped .7±0.2 57 FRLH57 Cottony Fluffy Pale Yellow 37.3±4.81× Fusiform, 3 Curved Pointed 11.2±1.75× pyriform Long, Branched 10±3.1 Brown Singly, Pairs White 3.7±0.37 Curved 2.9±0.3 58 FRLH58 Cottony Fluffy Pale Yellow 43.8±4.58× Fusiform, 6 Slightly Foot- 11.6±1.19× Oval Long 10±3.5 Brown Singly, Pairs White 6.6±0.67 Curved hooked shaped 3.8±0.4 59 FRMT59 Cottony compact Pale Yellow 45.1±6.82× Fusiform, 5 Curved Pointed 11.9±2.15× Oval Long, Branched 6±1.3 Brown Pairs White 7.6±0.67 Curved 3.5±0.5 60 FRMT60 Cottony Flat Pale Yellow 29.1±3.47× Fusiform, 5 Slightly Foot- 16.2±3.02× Reniform Long 9±2.6 Brown Singly, Pairs White 6.4±0.67 Curved hooked shaped 3.4±0.4 61 FRMT61 Cottony Fluffy Pale Yellow 35.8±4.25× Fusiform, 6 Curved Pointed 13.6±1.57× Reniform Long, Branched 7±1.9 Brown Singly, Pairs White 4.8±0.56 Straight 4.1±0.6 62 FRMT62 Cottony Fluffy Pale Yellow 37.3±3.69× Fusiform, 6 Slightly Foot- 16.1±2.57× Reniform Long 9±2.3 Brown Singly, Pairs White 6.8±0.56 Curved hooked shaped 5.0±0.7 63 FRMT63 Cottony Flat Pale Yellow 41.3±5.93× Fusiform, 6 Slightly Foot- 10.8±0.78× Oval Long 5±1.1 Brown Singly, Pairs White 6.8±0.89 Curved hooked shaped 3.6±0.4 64 FRMT64 Cottony Fluffy Colorless 36.3±5.37× Fusiform, 5 Curved Pointed 8.3±0.88× Oval Long, Branched 10±2.8 Brown Singly White 6.5±0.67 Curved 4.1±0.5 65 FRMT65 Creamy Fluffy Colorless 32.3±4.25× Fusiform, 4 Curved Pointed 9.9±0.42×1 Reniform Long, Branched 8±2.5 Brown Singly, Pairs White 4.2±0.49 Curved .9±0.3 66 FRMD66 Cottony compact Colorless 37.5±4.70× Fusiform, 5 Curved Pointed 12.6±3.58× Reniform Long, Branched 9±3.5 Brown Singly, Pairs White 4.9±0.34 Curved 3.7±0.4 67 FRMD67 Cottony Fluffy Pale Yellow 36.3±5.37× Fusiform, 5 Curved Pointed 10.4±2.19× Oval Long, Branched 10±3.6 Brown Singly, Pairs White 4.7±0.56 Straight 3.7±0.4 68 FRMD68 White Fluffy Pale Yellow 38.3±4.81× Fusiform, 6 Slightly Foot- 15.5±1.64× Oval Long 5±2.0 Brown Singly, Pairs 6.7±0.56 Curved hooked shaped 5.0±0.6 Continued….

69 FRMD69 White Fluffy Pale Yellow 40.3±5.48× Fusiform, 7 Slightly Foot- 12.1±1.68× Reniform Long 11±4.1 Brown Singly, Pairs 6.9±0.74 Curved hooked shaped 4.8±0.6 70 FRMD70 Cottony Fluffy Pale Yellow 35.3±4.81× Fusiform, 5 Curved Pointed 8.3±0.34×3 Oval Long, Branched 8±1.7 Brown Singly, Pairs White 4.7±0.49 Curved .3±0.3 71 FRMD71 Cottony Fluffy Pale Yellow 38.8±4.58× Fusiform, 5 Slightly Foot- 11.7±1.44× Reniform Long 10±2.3 Brown Singly White 6.7±0.72 Curved hooked shaped 3.2±0.3 72 FRMD72 Cottony Compact Pale Yellow 36.8±5.03× Fusiform, 6 Curved Pointed 14.4±1.50× Reniform Long, Branched 9±2.1 Brown Singly, Pairs White 4.9±0.72 Curved 4.4±0.6 73 FRCS73 Cottony Flat Pale Yellow 29.8±3.58× Fusiform, 5 Curved Pointed 16.4±3.02× Reniform Long, Branched 17±5.6 Brown Singly, Pairs White 4.0±0.55 Straight 5.1±0.4 74 FRCS74 White Fluffy Colorless 39.3±4.70× Fusiform, 6 Slightly Foot- 7.8±1.23× Oval Long 7±2.7 Brown Singly, Pairs 6.7±0.69 Curved hooked shaped 3.6±0.5 75 FRCS75 Cottony Fluffy Pale Yellow 40.9±5.37× Fusiform, 6 Slightly Foot- 14.6±1.35× Oval Long 8±3.2 Brown Singly, Pairs White 6.9±0.85 Curved hooked shaped 2.2±0.4 76 FRCS76 Cottony Flat Pale Yellow 33.2±4.25× Fusiform, 5 Curved Pointed 12.7±2.13× Oval Long, Branched 8±3.4 Brown Singly, Pairs White 6.3±0.69 Curved 3.4±0.4 77 FRCS77 White Fluffy Pale Yellow 27.6±3.58× Fusiform, 4 Curved Pointed 8.5±0.75× Reniform Long, Branched 11±4.1 Brown Pairs 4.5±0.56 Curved 1.8±0.4

morphological characteristics. However, they have small differences, for example the microconidia of F. solani typically lack septa, but occasionally they may have up to one septa and originate from long conidiophores while those of F. oxysporum have one or two septa and originate form short conidiophores. Microconidia have thickened basal cells and tapered, rounded apical cells. Microconidia were oval or cylindrical, hyaline, and smooth. Some microconidia may be curved. The macro conidia produced by F. solani are slightly curved, hyaline, and broad. Typically the macroconidia of F.solani have 3-7 septa. Summerbell (2003). However, some F. solani isolates have pointed, rather than rounded, macroconidia.

Morphological identification is usually used for the purpose of tentative identification of Fusarium species. It is usually centered on the similarities and differences of various distinct diagnostic morphological characters that belong to a particular species. Early taxonomic literature on Fusarium was entirely based on morphological characteristics which involved both primary characters of microconidia, macroconidia, conidiophore, Phialide and Chlamydospores whereas secondary characterizes including pigmentation, growth habit of colony etc (Nelson et al., 1983; Leslie and Summerell, 2006).

F.solani is a distinct species having some distinguished morphological characters from the Fusarium genus. Amongst the significant characters that were used for the tentative identification characterization of F. solani isolates, is the distinctive feature of monophialides. A phialide is aerial mycelium that comprises of conidiogenous cells which produces conidia. It can be branched or unbranched

(Nelson et al., 1983). Fusarium species produces two types of phialides viz. monophialides and polyphialides. The presence of long monophialides in aerial

mycelium, which are found to be branched in some isolates while unbranched in others was observed in this study and also been reported by Leslie and Summerell

(2006), Seifert (2001) and Nelson et al. (1983) thus verifying the finding of this study. This considered as a distinguishing feature of F. solani that differentiates it from other species of Fusarium e.g. F. oxysporum monophialides were distinct short and plump while cross-shaped polyphialides has been commonly used to identify F. nelsonii. Likewise, in case of another important species viz. F. commune has long but both mono and polyphialides unlike F. solani where only long monophialides were recorded (Skovgaard et al., 2003). F. solani usually produced colonies ranged from white to cottony white and creamy white without developing pink or violet centers as compared to most of Fusarium species (Larone, 2011).

The concept of presence and absence of microconidia, Structure of monophialides bearing microconidia and its shape helps in identification of species and also all Fusarium species do not produce microconidia as reported by Leslie and

Summerell (2006). The presence of microspores was observed and found present in all isolates under this study. Similarly, production of microconidia in false heads on

Long monophialides. The shape of microconidia was observed as oval to reniform with thicker walls and all finding were strongly supported by the previous findings of Nelson et al. (1983), Burgess et al. (1989) and Leslie and Summerell (2006), in which they reported that F.solani can easily be differentiated from other Fusarium species particularly F. oxysporum by careful observation of Phialides that bears the microconidia and by the shape of microconidia itself. F. solani produces microconidia in false heads on long monophialides and not in chains has been important diagnostic feature for F. solani and distinguished it from F. oxysporum in

which short monophialides bearing microconidia has been observed. Moreover, microconidia of F. solani tends to be somewhat oval to reniform in shape, more wider with thicker walls then do the microconidia of F. oxysporum whereas in F. anthophilum microconidia of globose or pyriform shape were reported. The formation of microconidia in long and short chains was produced by Fusarium member of FFSC and Burgess et al. (1989) reported the formation of microconidia in short chains and false head in F. nygamai whereas F. solani has no such character.

The size (L×W) of microconidia measured showed a substantial varation among different isolates. In the same way, the study of Booth (1977) showed similar variation in conidial size of F. solani.

According to studies conducted by Nelson et al. (1983) and Toussoun and

Nelson (1976), Shape of macroconidia is considered as an important feature for distinguishing and identification of various species of genus Fusarium in the morphological characterization of Fusarium species. The macroconidia are consisted of apical cell having a distinct diagnostic hooked to tapering or notch like shape depending on the species under study. Moreover, significant variation was found in the size of the microconidia and macroconidia in current study has been reported by

Booth (1977).

Chlamydospores are generally resting structure with thick walls and were usually formed on artificial media under suboptimal conditions of growth. These are produced aerially or in sporodochial macroconidia. According to Nelson et al.

(1983), chlamydospores has been primarily produced singly, in pairs but infrequently in short chains or clumps on somatic hyphae and sometimes at the marginal. Several Fusarium species produces chlamydospores such as F. solani.

Fusarium species that falls in FFSC including F. proliferatum and F. verticilloides do not produce chlamydospores. Similar findings were found in this study where chlamydospores produced by F. solani isolates were seen as singly, in pairs and mostly in mixed form. Leslie and Summerell (2006), Seifert (2001) and Domsch et al. (1980) reported the same characteristics for F. solani chlamydospores. Certain variation was found in the diameter of chlamydospores (5-11μm) among different isolates of F. solani in the study, while the color of chlamydospores were observed as brown, which were also recorded in the isolates of F. solani in studies conducted chlamydospores produced by the F. solani were brown in color produced in abundant having diameter of 6-11μm. Also Zaacardelli et al., 2008 reported the absence of chlamydospores in isolates of F. solani from wheat, rice, melon, potato, tomato etc.

Secondary characteristics in addition to primary characteristics are also considered helpful in identification of Fusarium species. These characteristics include pigmentation, growth habit and color of colony etc. of isolates produced in perti plates and is generally employed for differentiating and identification among various species (Summerell et al., 2003; Leslie, Summerell, 2006 and Hafizi, 2013).

The colony color showed by various isolates of F. solani was observed as white, cottony white to creamy white and has also been reported by Leslie and Summerell

(2006). So, the isolates were characterized as F. solani. Similarly, presence of pale, yellowish to violet and colorless pigmentation with growth habit varies from fluffy, flat and compact as shown in Table 4.4 were observed and explained by Leslie and

Summerell (2006) and Hafizi (2013) helped in identification of F. solani colony.

4.7.2 Molecular Characterization of Fusarium solani

Sequences of F. solani genomic DNA were amplified by using Inter

transcribed spacer region (ITS) and Translation elongation factor 1-Alpha (TEF-1α) gene. PCR reaction was performed by using primers ITS1 and ITS4 for ITS and primers ef1 and ef2 for TEF-1α on 11 F. solani isolates (FRID2, ALRP5, ALSG15,

ALGW23, ALSK29, ALNR34, ALSP51, ALLH53, ALMT59, ALMD70 and

ALMCS74) and aligned sequences were submitted to GenBank with isolates IDs viz.

NAS-FS1 to NAS-11 to obtained accessions (MF972923-32 and KY307786 for

(ITS) and MF974546-55 and KY319172 for TEF-1α as shown in Table 4.6. In case of F. solani 11 isolates were selected because pathogen was recovered form 11 districts except Swat where no disease was observed (Table 4.6). These reactions resulted in a single fragment of DNA that is about 650 bp (ITS) and 700bp (TEF-1α) size in each of the studies isolates.

The ITS sequence of isolates NAS-FS1 to NAS-11 showed 100% genetic homology with previously reported isolates of F.solani (GenBank Accession nos.

MF6823355, MG9326644, KY939052, MF687297, AM412598, JN983017,

JN983003 and KX034335) and TEF-1α sequences of above mentioned isolates showed 99-100 % genetic homology with sequences of F. solani (GenBank

Accession nos. MF040645, KY94096, DQ247696, KF689008, MG202134,

KY785026, KT357549, KU507137, JX945169, KR021390 and DQ246854) in

NCBI database, while same isolates also revealed 99-100% genetic similarity when searched on FUSARIUM-ID database.

The phylogenetic analysis of ITS and TEF-1α gene regions provided good resolution and placed the isolates under consideration into different sub trees. The tree resulted in emergence of one basal branch that formed the rooted outgroup phylogeny consisted of F. oxysporum. The trees resulted into clustering of 11 isolates

each with ITS and TEF-1α from present study (labelled with black squares) with the reference isolates of F. solani that were retrieved from GenBank as shown in Fig.

4.10 (a & b) respectively. This also confirms that in all geographical locations only single species of Fusarium is responsible for causing fruit rot of strawberry.

Genus Fusarium is considered to have group of species that are highly diverse and complex among fungi. The characterization and identification of fungal species especially within the Fusarium species complexes on morphological characters is considered to be a difficult and time consuming. So, Identification based on DNA nucleotide sequences regarded as important and reliable (Summerell et al.,

2003; Leslie and Summerell, 2006). The ITS region is useful in systematic and taxonomic studies of Fusarium at species level (Park and Min, 2005). Study conducted by Wilson et al. (2004) reported that phylogenetic analysis using ITS region can differentiate Fusarium spp. The analysis results showed differentiation of two species in two groups as well as revealed genetic evidence for close genetic relationship among them. However, ITS region has limited used for several

Fusarium species such as species of FFSC because of ITS sequences are not much informative for these species (Leslie and Summerell, 2006). TEF-1α gene appears to be highly informative and shows good results to identify closely related species

(Geiser et al., 2004). A number of studies have used TEF-1α for accurate characterization of Fusarium species. Barik and Tayung (2012) group saprophytic, endophytic nad pathogenic Fusarium species separately in distinct clads using TEF-

1α sequences, similarly Nitschke et al. (2009) identified 65 Fusarium isolates e.g. F. solani, F. oxysporum, F. equiseti, F. proliferatum etc. on basis of TEF-1α gene sequences. Previously, F. solani was also reported to cause crown and root rot of strawberry

100

Table 4.6 Details of Fusarium solani isolates and accession numbers with ITS and TEF 1-α primers used in molecular study

S. # Isolate ID District of Isolate ID on Accession # Accession # origin NCBI (ITS) (TEF 1-α) 1 FRID2 Islamabad NAS-FS1 MF972923 MF974546

2 FRRP5 Rawalpindi NAS-FS2 MF972924 MF974547

3 FRSG15 Sargodha NAS-FS3 MF972925 MF974548

4 FRGW23 Gujranwala NAS-FS4 MF972926 MF974549

5 AFSK29 Sialkot NAS-FS5 MF972927 MF974550

6 FRNR34 Narowal NAS-FS6 MF972928 MF974551

7 FRSP51 Sheikhupura NAS-FS7 MF972929 MF974552

8 FRLH53 Lahore NAS-FS8 MF972930 MF974553

9 FRMT59 Multan NAS-FS9 MF972931 MF974554

10 FRMD70 Mardan NAS-FS10 MF972932 MF974555

11 FRCS74 Charsadda NAS-11 KY307786 KY319172

101

MF974550 MF972926 MF687303 MF974553 MF687293 MF974551 MF972928 KT357551 MF972923 KU507137 MF682355 KY379179 MF972927 MF974549 AM412598 KF689008

MF972925 MF974552 KX587573 KT357549 KR527137 KY486693 F. solani F. solani MF972933 MF974548 MF972924 DQ247696 KR527136 MF974547 JN983003 KX940968 JN983000 MF974554 KY307786 MF685323 JN983017 KR021390 MF972930 KX001802 KX034335 KY319172 MF972932 MF972929 MF974546 MF972931 MF040645

AM261761 F. oxysporum GQ848538 F. oxysporum (a) Acessions with ITS gene region (b) Acessions with TEF-1α gene region

102

in different regions of world, but this study reported F. solani associate with strawberry fruit rot pathogen (Mehmood et al., 2017).

4.8 MORPHO-MOLECULAR CHARACTERISTICS OF Colletotrichum spp.

4.8.1 Cultural and Morphological Characterization

4.8.1.1 Colony color

In fungal cultures mycelial growth over the growth media appeared to have variation in colony color and texture. This color appearance of the fungal isolates has been used as a character of identification in terms of macroscopic observations.

Colletotrichum species also produce different type of colony colors. In our study from a total of 90 isolates, two different species of Colletotrichum were recovered and were used for morphological characterization from which sixty nine (76.40%) isolates showed creamy white to pale yellowish color of colonies as shown in Fig.

4.11 (a & b). Amongst 69 isolates, 55 isolates (80.88%) showed pale yellowish colony color while 14 isolates (20.58 %) were observed with creamy white colonies, which was very close to the Colletotrichum acutatum that was later confirmed by molecular characterization of the isolates by using different molecular tools. On the other hand, twenty one isolates of Colletotrichum expressed grey to whitish grey colony color which indicate the isolates of Colletotrichum gloeosporioides (Fig. 4.12 a & b). Among 21 isolates, 7 (28.57 %) showed grey colonies while 14 (66.66 %) showed greyish white colony color. All isolates details were shown in Table 4.7.

4.8.1.2 Growth habit

Colletotrichum species are well known to spread their mycelia on media in number of fashions i.e. fluffy, slight fluffy to dense aerial growth habit. All

Colletotrichum isolates in this were identified as C. gloeosporioides and C.

103

acutatum. These both species showed variation in growth habit. C. acutatum showed fluffy to slight fluffy growth habit in all sixty eight isolates (Fig. 4.11 a & b) while

C. gloeosporioides showed only dense aerial growth habit in all studied twenty one isolates (Fig. 4.12 a & b). The details of all 90 isolates were shown in Table 4.7.

4.8.1.3 Pigmentation

In this study, isolates of Colletotrichum spp. viz. C. acutatum and C. gloeosporioides showed salmon to reddish yellow and Grayish to pinkish color on reverse side of petri dish respectively as shown in Table 4.7. All isolates of C. acutatum were observed with salmon to reddish yellow coloration at the bottom side of petri plate (Fig. 4.11 a & b) and C. gloeosporioides with greyish to pinkish pigmentation (Fig. 4.12 a & b).

4.8.1.4 Conidia: shape, size and color

All isolates belonging to both type of Colletotrichum species produce conidia after 7-10 days of incubation temperature at 25 degree centigrade. In Colletotrichum conidia are produced in specialized structures called acervuli which many times may consist of long pointed Setae. In our study, all of the 68 isolates that belongs to C. acutatum showed conidia of Elliptic-fusiform shape (Fig. 4.11 e) with maximum conidial size 16.0×5.0µm observed in isolate ARLH62 and minimum conidial size

5.9×2.7µm in ARMT66 isolate. In case of C .gloeosporioides, Oblong shaped conidia with obtuse ends conidia were observed in all twenty one studied isolates

(Fig. 4.12 e) and maximum conidial size 12.4±0.34 × 8.6±0.40 µm was observed in

ARNR42 isolate from Narowal and minimum conidial size 8.8×3.4 µm was observed in ARSK31 with average All other isolates falls between maximum and minimum size ranges. (Table 4.7)

104

4.8.1.5 Appressoria: shape, size and color

The appressorium is one of the important structures in pathogenic fungi and is used to infect the hosts by developing infection peg which may produce from spore or hyphal thread to start infection. Appressoria can be of different size and shapes along with number of special properties in different fungi. In Colletotrichum appresorria developed in both stages i.e. conidial and mycelial. In this study appressoria were studied in reference to their shape, size and color as in hyphal cells or mycelial appressoria by using slide culture method. In case of C. acutatum the appresorria were found to be of ovate or egg shaped in all 69 isolates with maximum size of 16.0±3.91 ×5.8±0.46 µm observed in ARLH62 isolate from Lahore and minimum size of appressoria 6.3±0.49×4.2±0.37 µm in ARSG15 isolate from

Sargodha while colour of all observed isolates found light brown as shown in Fig.

4.11 f. In case of C. gloeosporioides two types of appresorrial shape was observed i.e. irregular and clavate in all studied twenty one isolates where 15 isolates showed irregular and 6 with clavate appresorria. The maximum size of 10.5±0.95×7.3±0.65

µm in ARMT69 isolate from Multan whereas minimum sized appressorium of

6.3±0.29×4.1±0.31 µm was observed in FRSW87 isolate , furthermore all appressoria found to be of dark brown in color.

4.8.1.6 Setae: shape, size and color

Identification of Colletotrichum fungi is based on number of morphological structures and development of setae is one of the unique sign of identification. Setae are long horn like structures which mostly produced in fruiting body of fungi like acervuli but sometimes may develop from individual hyphae. In this study setae are only produced in 14 out of 21 C. gloeosporioides isolates while in case of C.

105

acutatum setae were not observed in any of the 69 isolates during morphological characterization (Table 4.7). In case of C. gloeosporioides setae (Fig. 4.12 g) found long cylindrical structures with variation in number of septa developed and size in term of length and width. The maximum size of setae, 123±23.48×4.2±1.34 was observed in ARID6 isolate from Islamabad while minimum size 62±14.53× 2.1±0.78 was observed in ARRP11 isolate from Rawalpindi. The maximum numbers of septa were observed as 3 in isolates ARSP51 and ARMT69 while minimum of 1 in isolates

ARID6, ARRP11, ARRP13, AESK31, ARNR38, ARSP47, ARMT70, ARSW87 and

ARSW90.

The Colletotrichum was first time reported by Tode during 1970 under genus

Vermicularia but Corda (1831), introduced the name Colletotrichum to describe C. lineloa from Czech Republic and is known to comprise eoelomycetes having

Glomerella as sexual stage. It belongs to phylum Ascomycota, Class,

Sordariomycetes, Family, Glomerellaceae and genus Colletotrichum. Traditional methods used to identification of species of genus Colletotrichum as well as other filamentous fungi have always relied on the study of morphological characteristics such as colony color, size and shape of conidia, presence and absence of setae and teleomorph stage and cultural criteria (Simmonds, 1965; Smith and Black; 1990;

Gunnel and Gulber, 1991, Sutton, 1992). Furthermore, morphological characterization alone cannot be used as accurate and reliable tool for proper identification of Colletotrichum spp. that falls under species complexes that usually share similar morphological but different genetic behavior (Cai et al., 2009).

However, at present, use of combination of both morphological and molecular tools are implied to study Colletotrichum spp. In the present study, a total of ninety (90)

106

(a) (b)

(e) (f) Fig. 4.11. Colletotrichum acutatum cultural and morphological characters: Colony color and Growth habit (a) Creamy white (b) Pale yellowish; Pigmentation (c) Reddish yellow (d) Salmon (e) Elliptic-fusiform conidia (f) Ovate appressoria

107

(a) (b)

(e) (f)

(g)

Fig. 4.12. Colletotrichum gloeosporioides cultural & morphological characters: Colony color and Growth habit (a) Gray & dense aerial mycelium (b) Grayish white; Pigmentation (c) Grayish (d) Pinkish (e) Oblong, obtuse ends conidia (f) Setae (g) Irregular appressoria

108

Table 4. 7: Colletotrichum spp. isolates ID with culture identification and morphological characterization (CC = Colony Color, GH = Growth Habit, RCC = Reverse Colony Color, S μm = Size in Micrometer, L±SD, Length ± Standard deviation, W±SD = Width ± Standard deviation, P/A, Present or Absent, S = Septation, C. spp. = Colletotrichum species, C. a = C.acutatum, C. g = C. gloeosporioides)

S. Isolate Colony Conidia Appressoria Setae # ID CC GH RCC S µm Shape Color S µm Shape Color P/A Shape S µm S Color C. spp. (L±SD× (L±SD× (L±SD× W±SD) W±SD) W±SD) 1 ARID1 Pale Fluffy Salmon 12.3±2.80 Elliptic- Guttulate, 7.5±0.75× Ovate Light Absent - - - - C. a yellowish ×6.3±0.89 fusiform Hyaline 5.2±0.11 brown 2 ARID2 Gray Dense, Grayish 10.3±2.01 Oblong, Orange 10.3±1.34 Irregular Dark Present Moderately 76±13.42× 2 Dark C. g aerial ×5.9±0.67 obtuse ends ×6.7±0.26 brown tapered 3.1±1.10 brown 3 ARID3 Gray Dense, Grayish 8.6±1.34 Oblong, Orange 7.2±0.61× Irregular Dark Absent - - - - C. g aerial ×6.1±1.01 obtuse ends 4.6±0.37 brown 4 ARID4 Pale Fluffy Salmon 14.8±3.13 Elliptic- Guttulate, 12.8±1.57 Ovate Light Absent - - - - C. a yellowish ×6.6±0.34 fusiform Hyaline ×6.5±0.31 brown 5 ARID5 Pale Fluffy Salmon 15.5±3.80 Elliptic- Guttulate, 10.5±1.23 Ovate Light Absent - - - - C. a yellowish ×7.2±1.17 fusiform Hyaline ×6.2±0.23 brown 6 ARID6 Grayish Dense, Pinkish 12.1±3.80 Oblong, Orange 7.9±0.88× Clavate Dark Present Moderately 123±23.48× 1 Dark C. g white aerial ×5.6±0.11 obtuse ends 5.4±0.23 brown tapered 4.2±1.34 brown 7 ARRP7 Pale Fluffy Salmon 10.6±2.46 Elliptic- Guttulate, 6.5±0.50× Ovate Light Absent - - - - C. a yellowish ×6±0.09 fusiform Hyaline 4.9±0.47 brown 8 ARRP8 Pale Fluffy Salmon 15.8±5.03 Elliptic- Guttulate, 11.3±1.12 Ovate Light Absent - - - - C. a yellowish ×7.0±1.06 fusiform Hyaline ×5.2±0.25 brown 9 ARRP9 Grayish Dense, Pinkish 11.8±4.58 Oblong, Orange 9.5±0.31× Clavate Dark Absent - - - - C. g white aerial ×6.6±0.87 obtuse ends 5.3±0.37 brown 10 ARRP10 Pale Fluffy Salmon 13.6±4.58 Elliptic- Guttulate, 6.5±0.38× Ovate Light Absent - - - - C. a yellowish ×8.4±1.34 fusiform Hyaline 4.5±0.20 brown 11 ARRP11 Grayish Dense, Pinkish 11.8±4.25 Oblong, Orange 10.3±1.38 Irregular Dark Present Moderately 62±14.53× 1 Dark C. g white aerial ×5.7±0.78 obtuse ends ×5.3±0.37 brown tapered 2.1±0.78 brown 12 ARRP12 Pale Fluffy Salmon 7.8±2.57 Elliptic- Guttulate, 9.3±1.10× Ovate Light Absent - - - - C. a yellowish ×6.3±0.63 fusiform Hyaline 6.1±0.41 brown 13 ARRP13 Grayish Dense, Pinkish 10.3±4.02 Oblong, Orange 8.2±0.86× Irregular Dark Present Moderately 94±16.77× 1 Dark C. g white aerial ×6.8±0.89 obtuse ends 4.3±0.23 brown tapered 3.8±0.85 brown Continued….

109

14 ARSG14 Pale Fluffy Salmon 15.1±12.1 Elliptic- Guttulate, 13.6±1.57 Ovate Light Absent - - - - C. a yellowish ×7.2±0.22 fusiform Hyaline ×7.3±0.50 brown 15 ARSG15 Pale Fluffy Salmon 14.6±5.48 Elliptic- Guttulate, 6.3±0.49× Ovate Light Absent - - - - C. a yellowish ×5.7±0.85 fusiform Hyaline 4.2±0.37 brown 16 ARSG16 Pale Fluffy Salmon 16.2±3.13 Elliptic- Guttulate, 10.6±1.07 Ovate Light Absent - - - - C. a yellowish ×5.2±0.48 fusiform Hyaline ×5.2±0.31 brown 17 ARSG17 Pale Fluffy Salmon 11.8±2.46 Elliptic- Guttulate, 8.8±0.97× Ovate Light Absent - - - - C. a yellowish ×5.9±0.11 fusiform Hyaline 4.9±0.36 brown 18 ARSG18 Pale Fluffy Salmon 8.5±1.57 Elliptic- Guttulate, 14.1±1.50 Ovate Light Absent - - - - C. a yellowish ×8.8±0.97 fusiform Hyaline ×8.2±0.56 brown 19 ARSG19 Creamy Slight Reddish 15.1±5.25 Elliptic- Guttulate, 10.7±1.25 Ovate Light Absent - - - - C. a white fluffy yellow ×6.7±0.77 fusiform Hyaline ×6.6±0.57 brown 20 ARSG20 Creamy Slight Reddish 9.8±3.02 Elliptic- Guttulate, 11.8±1.22 Ovate Light Absent - - - - C. a white fluffy yellow ×6.0±0.96 fusiform Hyaline ×5.3±0.44 brown 21 ARSG21 Creamy Slight Reddish 13.6±4.58 Elliptic- Guttulate, 9.7±1.06× Ovate Light Absent - - - - C. a white fluffy yellow ×8.1±1.45 fusiform Hyaline 4.9±0.47 brown 22 ARSG22 Pale Fluffy Salmon 10.4±3.13 Elliptic- Guttulate, 7.9±0.75× Ovate Light Absent - - - - C. a yellowish ×7.7±1.23 fusiform Hyaline 4.5±0.35 brown 23 ARGW23 Pale Fluffy Salmon 14.6±4.25 Elliptic- Guttulate, 12.6±1.16 Ovate Light Absent - - - - C. a yellowish ×5.2±0.22 fusiform Hyaline ×7.4±0.32 brown 24 ARGW24 Pale Fluffy Salmon 7.8±2.46 Elliptic- Guttulate, 9.5±0.98× Ovate Light Absent - - - - C. a yellowish ×5.4±0.67 fusiform Hyaline 6.3±0.60 brown 25 ARGW25 Pale Fluffy Salmon 12.7±4.02 Elliptic- Guttulate, 11.9±1.03 Ovate Light Absent - - - - C. a yellowish ×5.8±0.21 fusiform Hyaline ×5.6±0.48 brown 26 ARGW26 Pale Fluffy Salmon 9.9±2.68 Elliptic- Guttulate, 6.8±0.50× Ovate Light Absent - - - - C. a yellowish ×9.2±0.97 fusiform Hyaline 4.8±0.37 brown 27 ARGW27 Pale Fluffy Salmon 13.8±2.68 Elliptic- Guttulate, 13.8±1.30 Ovate Light Absent - - - - C. a yellowish ×6.0±0.76 fusiform Hyaline ×7.4±0.69 brown 28 ARGW28 Creamy Slight Reddish 7.6±1.45 Elliptic- Guttulate, 6.3±0.22× Ovate Light Absent - - .. - C. a white fluffy yellow ×7.1±0.74 fusiform Hyaline 2.7±0.54 brown 29 ARGW29 Pale Fluffy Salmon 11.3±1.34 Elliptic- Guttulate, 13.3±0.44 Ovate Light Absent - - .. - C. a yellowish ×7.1±1.14 fusiform Hyaline ×7.2±0.46 brown 30 ARGW30 Pale Fluffy Salmon 15.6±3.58 Elliptic- Guttulate, 7.6±0.28× Ovate Light Absent - - .. - C. a yellowish ×6.3±0.91 fusiform Hyaline 4.6±0.29 brown 31 ARSK31 Grayish Dense, Pinkish 8.8±1.68 Oblong, Orange 7.9±0.35× Irregular Dark Present Moderately 95±15.43× 1 Dark C. g white aerial ×6.0±0.10 obtuse ends 5.0±0.41 brown tapered 3.4±0.66 brown Continued….

110

32 ARSK32 Creamy Slight Reddish 14.8±3.02 Elliptic- Guttulate, 10.6±0.28 Ovate Light Absent - - - - C. a white fluffy yellow ×5.6±0.01 fusiform Hyaline ×5.8±0.29 brown 33 ARSK33 Creamy Slight Reddish 12.5±3.58 Elliptic- Guttulate, 14.2±0.66 Ovate Light Absent - - - - C. a white fluffy yellow ×5.5±0.45 fusiform Hyaline ×7.8±0.64 brown 34 ARSK34 Creamy Slight Reddish 7.9±0.89 Elliptic- Guttulate, 8.9±0.38× Ovate Light Absent - - - - C. a white fluffy yellow ×8.3±0.95 fusiform Hyaline 4.7±0.41 brown 35 ARSK35 Grayish Dense, Pinkish 10.5±3.13 Oblong, Orange 9.3±0.30× Irregular Dark Present - - - - C. g white aerial ×7.2±0.26 obtuse ends 6.4±0.47 brown 36 ARSK36 Pale Fluffy Salmon 14.6±3.58 Elliptic- Guttulate, 9.9±0.73× Ovate Light Absent - - - - C. a yellowish ×5.5±1.22 fusiform Hyaline 6.4±0.31 brown 37 ARSK37 Gray Dense, Grayish 12.0±3.02 Oblong, Orange 10.0±0.36 Irregular Dark Absent - - - - C. g aerial ×5.2±0.49 obtuse ends ×6.9±0.44 brown 38 ARNW38 Gray Dense, Grayish 9.4±2.46 Oblong, Orange 10.2±0.82 Clavate Dark Present Moderately 87±10.62× 1 Dark C. g aerial ×8.5±0.63 obtuse ends ×7.1±0.28 brown tapered 2.10±0.60 brown 39 ARNR39 Pale Fluffy Salmon 13.1±0.56 Elliptic- Guttulate, 13.1±1.57 Ovate Light Absent - - - - C. a yellowish ×7.4±0.88 fusiform Hyaline ×7.3±0.64 brown 40 ARNR40 Pale Fluffy Salmon 8.5±2.01 Elliptic- Guttulate, 8.5±0.72× Ovate Light Absent - - - - C. a yellowish ×5.0±0.48 fusiform Hyaline 2.5±0.36 brown 41 ARNR41 Pale Fluffy Salmon 15.1±3.58 Elliptic- Guttulate, 15.1±1.57 Ovate Light Absent - - - - C. a yellowish ×6.4±0.40 fusiform Hyaline ×4.6±0.30 brown 42 ARNR42 Gray Dense, Grayish 12.4±0.34 Oblong, Orange 9.8±0.50× Irregular Dark Absent - - - - C. g aerial ×8.6±0.40 obtuse ends 6.7±0.60 brown 43 ARNR43 Pale Fluffy Salmon 13.5±4.58 Elliptic- Guttulate, 13.5±1.41 Ovate Light Absent - - - - C. a yellowish ×5.3±0.86 fusiform Hyaline ×4.1±0.27 brown 44 ARNR44 Grayish Dense, Pinkish 9.9±3.13 Oblong, Orange 9.7±0.73× Clavate Dark Present Moderately 105±16.77× 1 Dark C. g white aerial ×5.6±0.22 obtuse ends 7.1±0.38 brown tapered 3.9±1.00 brown 45 ARNR45 Pale Fluffy Salmon 10.8±0.89 Elliptic- Guttulate, 10.8±0.97 Ovate Light Absent - - - - C. a yellowish ×6.8±0.56 fusiform Hyaline ×3.7±0.51 brown 46 ARNR46 Pale Fluffy Salmon 13.7±1.34 Elliptic- Guttulate, 13.7±1.44 Ovate Light Absent - - - - C. a yellowish ×6.3±0.48 fusiform Hyaline ×3.4±0.41 brown 47 ARSP47 Grayish Dense, Pinkish 11.6±2.01 Oblong, Orange 6.6±0.60× Irregular Dark Present Moderately 113±19.45× 1 Dark C. g white aerial ×5.6±0.85 obtuse ends 4.4±0.26 brown tapered 3.8±0.83 brown 48 ARSP48 Pale Fluffy Salmon 12.9±3.21 Elliptic- Guttulate, 12.9±0.88 Ovate Light Absent - - - - C. a yellowish ×5.2±0.73 fusiform Hyaline ×3.2±0.12 brown 49 ARSP49 Pale Fluffy Salmon 11.6±2.57 Elliptic- Guttulate, 10.4±0.73 Ovate Light Absent - - - - C. a yellowish ×8.0±1.22 fusiform Hyaline ×4.8±0.46 brown Continued….

111

50 ARSP50 Grayish Dense, Pinkish 8.9±1.57 Oblong, Orange 8.9±0.58× Irregular Dark Present - - - - C. g white aerial ×6.7±1.68 obtuse ends 4.7±0.31 brown 51 ARSP51 Grayish Dense, Pinkish 11.3±2.57 Oblong, Orange 6.2±0.23× Irregular Dark Present Moderately 81±10.62× 3 Dark C. g white aerial ×5.2±0.21 obtuse ends 4.0±0.48 brown tapered 2.9±0.38 brown 52 ARSP52 Pale Fluffy Salmon 13.1±4.23 Elliptic- Guttulate, 11.7±0.92 Ovate Light Absent - - - - C. a yellowish ×5.5±0.37 fusiform Hyaline ×5.4±0.42 brown 53 ARSP53 Creamy Slight Reddish 14.7±2.68 Elliptic- Guttulate, 6.9±0.70× Ovate Light Absent - - - - C. a white fluffy yellow ×6.6±0.66 fusiform Hyaline 4.5±0.57 brown 54 ARSP54 Pale Fluffy Salmon 15.8±5.03 Elliptic- Guttulate, 13.6±1.42 Ovate Light Absent - - - - C. a yellowish ×6.8±0.75 fusiform Hyaline ×7.4±0.69 brown 55 ARSP55 Creamy Slight Reddish 9.6±3.13 Elliptic- Guttulate, 9.2±0.60× Ovate Light Absent - - - - C. a white fluffy yellow ×5.8±0.37 fusiform Hyaline 5.1±0.42 brown 56 ARSP56 Creamy Slight Reddish 14.0±3.13 Elliptic- Guttulate, 14.4±0.97 Ovate Light Absent - - - - C. a white fluffy yellow ×7.4±0.97 fusiform Hyaline ×8.0±0.79 brown 57 ARLH57 Pale Fluffy Salmon 12.3±3.58 Elliptic- Guttulate, 10.3±0.97 Ovate Light Absent - - - - C. a yellowish ×6.1±0.01 fusiform Hyaline ×5.2±0.42 brown 58 ARLH58 Pale Fluffy Salmon 14.8±3.13 Elliptic- Guttulate, 12.1±1.12 Ovate Light Absent - - - - C. a yellowish ×7.6±0.64 fusiform Hyaline ×6.2±0.58 brown 59 ARLH59 Pale Fluffy Salmon 11.5±3.80 Elliptic- Guttulate, 8.5±0.59× Ovate Light Absent - - - - C. a yellowish ×7.1±0.32 fusiform Hyaline 4.6±0.50 brown 60 ARLH60 Pale Fluffy Salmon 7.8±2.57 Elliptic- Guttulate, 10.6±0.59 Ovate Light Absent - - - - C. a yellowish ×6.4±0.41 fusiform Hyaline ×5.0±0.36 brown 61 ARLH61 Pale Fluffy Salmon 13.3±2.57 Elliptic- Guttulate, 9.4±0.97× Ovate Light Absent - - - - C. a yellowish ×6.7±0.16 fusiform Hyaline 5.1±0.48 brown 62 ARLH62 Pale Fluffy Salmon 16.0±3.91 Elliptic- Guttulate, 7.9±0.58× Ovate Light Absent - - - - C. a yellowish ×5.8±0.46 fusiform Hyaline 4.6±0.57 brown 63 ARLH63 Pale Fluffy Salmon 10.5±4.70 Elliptic- Guttulate, 10.4±0.98 Ovate Light Absent - - - - C. a yellowish ×5.1±1.00 fusiform Hyaline ×5.5±0.32 brown 64 ARMT64 Grayish Dense, Pinkish 12.2±3.91 Oblong, Orange 9.8±0.78× Irregular Dark Present Moderately 107±20.12× 2 Dark C. g white aerial ×7.9±0.91 obtuse ends 6.7±0.58 brown tapered 3.3±0.77 brown 65 ARMT65 Pale Fluffy Salmon 12.7±3.24 Elliptic- Guttulate, 7.3±0.44× Ovate Lightbr Absent - - - - C. a yellowish ×6.5±1.68 fusiform Hyaline 4.3±0.42 own 66 ARMT66 Pale Fluffy Salmon 5.9±0.34 Elliptic- Guttulate, 8.4±0.60× Ovate Light Absent - - - - C. a yellowish ×7.7±0.88 fusiform Hyaline 4.7±0.32 brown 67 ARMT67 Pale Fluffy Salmon 15.2±0.89 Elliptic- Guttulate, 6.8±0.36× Ovate Light Absent - - - - C. a yellowish ×8.4±0.29 fusiform Hyaline 4.5±0.20 brown Continued….

112

68 ARMT68 Pale Fluffy Salmon 14.4±3.91 Elliptic- Guttulate, 9.0±0.56× Ovate Light Absent - - - - C. a yellowish ×5.8±0.42 fusiform Hyaline 5.1±0.29 brown 76 ARMT69 Grayish Dense, Pinkish 9.5±3.13 Oblong, Orange 10.5±0.95 Clavate Dark Present Moderately 89±18.22× 3 Dark C. g white aerial ×5.9±0.12 obtuse ends ×7.3±0.65 brown tapered 2.9±0.61 brown 70 ARMT70 Gray Dense, Grayish 11.6±3.02 Oblong, Orange 9.4±0.88× Irregular Dark Present Moderately 118±19.45× 1 Dark C. g aerial ×5.0±0.00 obtuse ends 6.2±0.42 brown tapered 3.4±0.44 brown 71 ARMT71 Pale Fluffy Salmon 13.3±0.34 Elliptic- Guttulate, 7.9±0.45× Ovate Light Absent - - - - C. a yellowish ×6.7±0.48 fusiform Hyaline 4.9±0.67 brown 72 ARMD72 Pale Fluffy Salmon 16.0±2.80 Elliptic- Guttulate, 8.1±0.42× Ovate Light Absent - - - - C. a yellowish ×6.5±0.39 fusiform Hyaline 6.4±0.54 brown 73 ARMD73 Creamy Slight Reddish 12.1±3.91 Elliptic- Guttulate, 12.7±1.54 Ovate Light Absent - - - - C. a white fluffy yellow ×9.5±1.45 fusiform Hyaline ×7.6±0.41 brown 74 ARMD74 Pale Fluffy Salmon 9.9±2.46 Elliptic- Guttulate, 10.3±1.24 Ovate Light Absent - - - - C. a yellowish ×6.5±0.73 fusiform Hyaline ×6.7±0.59 brown 75 ARMD75 Pale Fluffy Salmon 14.6±1.01 Elliptic- Guttulate, 7.4±0.61× Ovate Light Absent - - - - C. a yellowish ×6.9±0.79 fusiform Hyaline 5.1±0.31 brown 69 ARMD76 Pale Fluffy Salmon 10.8±1.79 Elliptic- Guttulate, 10.5±0.94 Ovate Light Absent - - - - C. a yellowish ×6.1±1.12 fusiform Hyaline ×6.3±0.28 brown 77 ARMD77 Pale Fluffy Salmon 11.8±1.79 Elliptic- Guttulate, 11.0±1.43 Ovate Light Absent - - - - C. a yellowish ×7.0±0.44 fusiform Hyaline ×6.9±0.69 brown 78 ARMD78 Creamy Slight Reddish 16.0±4.81× Elliptic- Guttulate, 10.3±0.94 Ovate Light Absent - - - - C. a white fluffy yellow 5.9±0.93 fusiform Hyaline ×6.7±0.61 brown 79 ARCS79 Creamy Slight Reddish 8.5±3.13 Elliptic- Guttulate, 6.9±0.29× Ovate Light Absent - - - - C. a white fluffy yellow ×6.4±0.78 fusiform Hyaline 4.5±0.38 brown 80 ARCS80 Pale Fluffy Salmon 16.4±4.14 Elliptic- Guttulate, 12.7±1.41 Ovate Light Absent - - - - C. a yellowish ×6.1±0.45 fusiform Hyaline ×6.9±0.63 brown 81 ARCS81 Pale Fluffy Salmon 13.7±3.13 Elliptic- Guttulate, 7.4±0.55× Ovate Light Absent - - - - C. a yellowish ×8.6±1.00 fusiform Hyaline 5.0±0.42 brown 82 ARCS82 Pale Fluffy Salmon 15.3±3.57 Elliptic- Guttulate, 11.4±1.43 Ovate Light Absent - - - - C. a yellowish ×6.4±0.96 fusiform Hyaline ×7.1±0.86 brown 83 ARCS83 Pale Fluffy Salmon 10.6±0.67 Elliptic- Guttulate, 9.6±0.94× Ovate Light Absent - - - - C. a yellowish ×7.4±0.22 fusiform Hyaline 5.3±0.79 brown 84 ARCS84 Creamy Slight Reddish 10.3±1.34 Elliptic- Guttulate, 8.2±0.66× Ovate Light Absent - - - - C. a white fluffy yellow ×6.4±0.97 fusiform Hyaline 5.1±0.48 brown 85 ARCS85 Pale Fluffy Salmon 5.9±0.34 Elliptic- Guttulate, 6.7±0.30× Ovate Light Absent - - - - C. a yellowish ×5.6±0.35 fusiform Hyaline 4.7±0.65 brown Continued….

113

86 ARSW86 Pale Fluffy Salmon 11.7±3.35 Fusiform & Guttulate, 9.4±1.12× Ovate Light Absent - - - - C. a yellowish ×6.3±0.57 pointed ends Hyaline 6.5±0.54 brown 87 ARSW87 Grayish Dense, Pinkish 12.2±0.89 Oblong, Orange 6.3±0.29× Irregular Dark Present Moderately 82±14.31× 1 Dark C. g white aerial ×8.3±1.04 obtuse ends 4.1±0.31 brown tapered 3.0±0.63 brown 88 ARSW88 Grayish Dense, Pinkish 10.7±1.79 Oblong, Orange 7.1±0.41× Irregular Dark Present - - - - C. g white aerial ×6.8±1.29 obtuse ends 4.5±0.60 brown 89 ARSW89 Pale Fluffy Salmon 14.7±4.02 Elliptic- Guttulate, 10.3±0.95 Ovate Light Absent - - - - C. a yellowish ×5.2±0.73 fusiform Hyaline ×7.6±0.97 brown 90 ARSW90 Gray Dense, Grayish 12.3±2.80 Oblong, Orange 9.9±0.65× Clavate Dark Present Moderately 102±19.57× 1 Dark C. g aerial ×6.3±0.89 obtuse ends 6.0±0.31 brown tapered 3.4±0.89 brown

114

Isolates of Colletotrichum spp. were studied for morphological characterization and showed variation in terms of cultural and morphological parameters. On the basis of morphological characters, from ninty isolates under study, 69 were characterized as

C. gloeosporioides while rest of 21 were identified as C. gloeosporioides.

According to Patel (2004), C. gloeosporioides isolated from Chilli produced light pale to dirty white and fluffy mycelium in culture while Smith and Black (1990) reported that colony color of C. gloeosporioides was whitish, pale white to dark gray and C. acutatum produced orange or pale yellow color colonies. Zakaria (1997) conducted detailed morphological studies on eleven isolates of C. gloeosporioides recovered from peninsular region of Malaysia and describe colony colour as white to grayish in all studied isolated which is same in our study found. Similarly, Davis et al. (1992) describe the cultural characteristics of C. gloeosporioides isolates recovered from different regions of Africa, Latin America and South-East Asia infecting Stylosanfhes spp. and describe the colonial color of all the recovered isolated ranging from whitish to grayish appearance. Zivkovic et al. (2010) described the morphology of C. acutatum isolates recovered from tomato and describe that all isolates showed colonies of colors ranging from white, orange to orange-white appearance and some may of pink colour while in our study same colonial colour was observed in isolates identified as C. acutatum. Similarly, Abera et al. (2016) studied morphological characteristics of Colletotrichum species associated with mango anthracnose and found C. acutatum also cause of this disease, author describe the colonial morphology of 38 isolates of the pathogen and noted that all the isolates showed pale to creamy white colonial colour when were cultured on PDA media, these findings are similar to our results as in this isolates also showed grayish

115

colonial color.

Colletotrichum species are well known to spread their mycelia on media number of fashions i.e. oppressed, scattered, dense fluffy and aerial growth habit.

All Colletotrichum isolates in this were identified as C. gloeosporioides and C. acutatum. These both species showed variation in growth habit. C. gloeosporioides showed only dense and aerial growth habit in all studied isolates while C. acutatum showed fl growth habit only in all sixty eight morphologically characterized isolates.

Findings of this study in term of growth habit of both pathogens are exactly explainable to the keys provided by Simmonds, 1965; Smith and Black; Sutton in

1992.

Conidial shape considered as a reliable character for differentiation among

Colletotrichum spp. This implied particularly to C. acutatum and C. gloeosporioides.

Conidia formed in C. gloeosporioides were oblong with obtuse ends and found to be generally shorter and broader as compared to conidia of C. fragariae and C. acutatum whereas, the conidia of C. acutatum were elliptic to fusiform (Sutton,

1992; Gunnell and Gubler, 1992; Freeman et al., 1998). Denoyes and Baudry (1995) suggested that conidial shape alone was an important and useful character to distinguish among Colletotrichum spp. pathogenic to strawberry crop. A comprehensive study on morphological characteristics of Colletotrichum species associated with anthracnose disease in Chiang Mai, Thailand was conducted by Than et al. (2008) in which twenty nine isolates of the Colletotrichum were studied on morphological and molecular basis from which all C. gloeosporioides isolates showed average 13.5×4.0 µm conidial size similarly in case of Colletotrichum acutatum 13.6×3.5µm was observed. According to Chattaoui et al. (2016), the

116

Colletotrichum species infecting olive in northern Tunisia first time in the area by characterizing 43 isolates from number of species of Colletotrichum including C. gloeosporioides and C. acutatum concluded that the average conidial size in case of

Colletotrichum gloeosporioides found 14×4.9µm while in case of C. acutatum

12.0×4.1µm conidial size was recorded. Similarly, studies conducted by Gunnell and

Gubler (1992); Damm et al. (2012) suggested that the size of conidia of C. acutatum was from 12.9-4.0 while C. gloeosporioides conidia ranged from 15-4.4. The findings of these conidial sizes justify findings of our study.

Than et al., (2008) in which comprehensive morphological study of different species of Colletotrichum in Thailand was done and it was reported that average appressoria size in all the isolates was around 9•0×6•5µm C. gloeosporioides while dark brown was the color observed, in case of C. acutatum average appressoria size observed around 7.5×5.5µm with dark brown in colour. Similarly, in another study conducted by Zakaria (2000) described morphological and cultural variations in different isolates of C. gloeosporioides obtained from tropical nurseries and elaborated the appresorrial size shape and colour. In his study he explained that all found appressoria were of dark brown colour with highly lobbed (Clavate) to irregular while in our study all twenty one isolates of C. gloeosporioides showed same type of shape and color. These results are evident in justifying our findings.

Setae are the characteristic structures which develops in Colletotrichum fungi and their presence or absence of setae has been considered helpful in identification of Colletotrichum spp. (Smith & Black, 1990; Gubler and Gunnell, 1992). In a series of studies of the three major Colletotrichum species, Smith and Black (1990) compared setae morphology of 24 Colletotrichum isolate and found that C. fragariae

117

and C. acutatum isolates did not produced the setae in culture while C. gloeosporioides isolates produced setae. According to study of C. acutatum species complex conducted by Damm et al. (2012) setae production was not observed on the studies isolate viz. ex-epitype strain CBS-112996. Similarly, Simmonds (1965) reported that setae formation in C. acutatum are very rare and mostly not occurred under normal culture conditions. Gautam (2014) described that C. gloeosporioides recovered from Mango, mulberry and vanilla plants under various studies in that

India, showed production of setae in cultures. However, the size of setae varied i-e mango 87-113×2-5 µm, mulberry 60-74×4-8 µm and vanilla 32-75×2-4.5 µm. These were emerged from the acervuli and appeared to be long and brownish to dark brownish in color. In a study conducted by Zakiria in 2000 describe the setae formation, variation in setal size shape and number in Colletotrichum fungi with variety of number range in terms of production was also observed. Size of the setae may vary from 52.80 µm to 79.84 µm. Further author observed only moderately tapered shaped setae in the studied isolates and Setae were found to be absent in some of the studies C. gloeosporioides isolates and all these findings are much supportive to our observation in this study.

4.8.2 Molecular Characterization of Colletotrichum spp.

A total of 90 pathogenic isolates of Colletotrichum spp. were identified on the basis of cultural and morphological characterization into two Colletotrichum spp. viz. 69 isolates of C. acutatum and 21 isolates of C. gloeosporioides. From 90 isolates, 19 isolates comprised of 12 C. acutatum (recovered from all 12 districts) and 7 C. gloeosporioides (recovered from 7 districts) isolates were subjected to molecular characterization (Table 4.8 & 4.9). Each was representative and highly

118

virulent isolates from a district and species. Multigene phylogeny was carried out for

Colletotrichum spp. that involved 2 gene regions viz. inter transcribed spacer region

(ITS) and beta- tubulin (BT).

The ITS and BT regions of 12 C. acutatum isolates viz. ARID1, ARRP12,

ARSG17, ARGW23, ARSK33, ARNR40, ARSP48, ARLH56, ARMT71,

ARMD77, ARCS82 and ARSW89, while 7 C. gloeosporioides isolates viz. ARID3,

ARRP9, ARSK35, ARNR44, ARSP50, ARMT64 and ARSW87 were amplified with

ITS1/ITS4 and BT2a/BT2b primers of ITS and BT gene regions respectively through

PCR assay. The amplicons were sequenced and submitted to NCBI, GenBank database under isolate IDs of NAS-AA1 to NAS-AA12 for C. acutatum against accession numbers MF972908-MF972919 and MH155146-MH155151 to

MH165291-MH165296 with ITS and BT gene regions respectively as shown in

Table 4.8. Submitted sequences of C. gloeosporioides had isolates IDs as NAS-CG1 to NAS-CG7 with associated accession numbers MH168105-MF168111 and

MH155139-MH155145 with ITS and BT gene regions respectively (Table 4.9).

The nucleotide BLAST search tool results of above mentioned isolates sequences with ITS and BT revealed 99-100% genetic homology with already available sequences of C. acutatum (accession nos. (ITS) AJ301964, MF972916,

MF124434, MF170676, LC062617, KU933355, KY342376, MG768913 and

KJ627843 while with (BT) KM893119, AF411750 AND DQ991681, MG561717,

KX069817, KU221358, KJ7314358, JQ24939, KU221357 and LT976515.

Likewise, same in case of C. gloeosporioides showed 99-100% similarity with previously reported isolates with ITS and BT genes (accession nos. (ITS)

KY962996, KP748204, DQ003086, AF451905, AFJ534466, AY266390 and

119

KY962996 while with (BT) LC009520, KY885140, GU994474, KY861315 and

KY620339.

Phylogenetic analysis of 19 isolates from current study (12 C. acutatum and

7 C. gloeosporioides) and two already published reference isolates of Colletotrichum

(C. acutatum AJ749670 (ITS) and KU221258 (BT) and C. gloeosporioides

MF554881 (ITS) and KT709259 (BT) resulted in a tree with two distinct clusters as shown in Fig. 4.12 (a and b). The clustering of C. acutatum and C. gloeosporioides isolates with their respective reference isolates was due to the high genetic homology among them while distinct clustering was due to genetic varation among both species.

Xie et al. (2010) studies 31 isolates of Colletotrichum spp. associate with strawberry anthracnose in Zhejiang province of China. This study identifies 11 isolates as C. acutatum, 10 as C. gloeosporioides and 10 as C. fragariae based on morphological and phylogenetic analysis of sequences based on rDNA ITS region.

Similar finding was reported by Ren et al. (2008) where a combination of morphological and rDNA ITS sequence analysis identified them as causal organism of strawberry anthracnose in Shanghai region of china as C. acutatum and C. gloeosporioides. Cannon et al. (2012) described that ITS has been propsed as fungal barcode marker and in case of Colletotrichum this gene is considered as evolutionary conservative to differentiate among most of the species in Colletotrichum complex.

Cai et al. (200) reported that a multiphase approach which includes multigene phylogeny, morphology and pathogenicity will be used for epitypification and accurate description of Colletotrichum spp. A number of studies emphasized that ribosomal ITS sequence data alone cannot be accurately distinguished species of

120

Table 4.8. Details of Colletotrichum acutatum isolates and accession numbers with ITS and Bt primers used in molecular study S. # Isolate ID District of Isolate ID Accession # Accession # origin on NCBI (ITS) (BT) 1 ARID1 Islamabad NAS-CA1 MF972908 MH155146

2 ARRP12 Rawalpindi NAS-CA2 MF972909 MH155147

3 ARSG17 Sargodha NAS-CA3 MF972910 MH155148

4 ARGW23 Gujranwala NAS-CA4 MF972911 MH155149

5 ARSK33 Sialkot NAS-CA5 MF972912 MH155150

6 ARNR40 Narowal NAS-CA6 MF972913 MH155151

7 ARSP48 Sheikhupura NAS-CA7 MF972914 MH165291

8 ARLH56 Lahore NAS-CA8 MF972915 MH165292

9 ARMT71 Multan NAS-CA9 MF972916 MH165293

10 ARMD77 Mardan NAS-CA10 MF972917 MH165294

11 ARCS82 Charsadda NAS-CA11 MF972918 MH165295

12 ARSW89 Swat NAS-CA12 MF972919 MH165296

Table 4.9. Details of Colletotrichum gloeosporioides isolates and accession number with ITS and Bt primers used in molecular study S. Isolate ID District of Isolate ID on Accession # Accession # # origin NCBI (ITS) (BT) 1 ARID3 Islamabad NAS-CG1 MH168105 MH155139

2 ARRP9 Rawalpindi NAS-CG2 MH168106 MH155140

3 ARSK35 Sialkot NAS-CG3 MH168107 MH155141

4 ARNR44 Narowal NAS-CG4 MH168108 MH155142

5 ARSP50 Sheikhupura NAS-CG5 MH168109 MH155143

6 ARMT64 Multan NAS-CG6 MH168110 MH155144

7 ARSW87 Swat NAS-CG7 MH168111 MH155145

121

MH155147 MF972918 MH165291 MH972916 MH165294 MF972908 MH165295 MF972911 MH155148 MF972910 MF972917 JQ950052 C. acutatum MF972915 C. acutatum MH165293 MF972913 MH155150 AJ749670 MH155151 MF972919 MH165292 MF972914 MH155149 MF972909 MH155146 MF972912 MH165296 MF168111 MH155142 MH168109 MH155144 MF168110 MH155143 C. gloeosporioides C. gloeosporioides MF554881 KR080297 MH168105 MH155145 MH168108 MH155140 MH168107 MH155139 MH168106 MH155141 EU732726 C. lini KM105520 C. lini (a) Accessions with ITS gene region (b) Accessions with BT gene region

122

Colletotrichum. Beta tubulin gene have been identified suitable for phylogenetic analysis (Crous et al., 1999). Tozze-Junior (2012) showed high variability among different Colletotrichum spp. associated with peach, passion fruit, mango and avocado based on ITS and TUB2 phylogenetic analysis. Similarly, Than et al. (2008) characterized Colletotrichum species associate with chilli anthracnose in Thailand.

Twenty nine isolates were identified based on morphological studies and use of ITS and BT gene regions for phylogenetic analysis that revealed 3 major clusters formation representing 3 species viz, C. acutatum, C, gloeosporioides and C. capsici.

The combination of pathogenicity, morpho-molecular characterization and multigene (ITS and BT) sequence analysis provided strong evidences and bases to confirm C. acutatum and C. gloeosporioides as causal agent of anthracnose fruit rot of strawberry in Pakistan.

4.9 MORPHO-MOLECULAR CHARACTERISTICS OF Botrytis cinerea

4.9.1 Cultural and Morphological Characterization

4.9.1.1 Colony color

In this study a total of ninety two (92) isolates were subjected to cultural/macroscopic and microscopic characteristics for identification of grey mold fungal pathogen. Fungal isolates showed dark grey to cloudy white in varation color.

From 92 isolates, 63 (68.47 %) showed dark grey color (Fig. 4.14 a) on artificial media plates whereas rest of 28 isolates (30.43 %) were observed to have cloudy white colony color (Fig. 4.14 b). The details related to colony colors were showed in

Table 4.10.

4.9.1.2 Growth habit

All of the 92 isolates (100%) of B. cinerea were subject to observation

123

regarding the growth habit. No variation was seen in growth pattern among isolates.

The mycelium grows upward and outward from the media in aerial fashion as shown in Fig. 4.14 a & b.

4.9.1.3 Sclerotia color, diameter and formation

Sclerotia found hard, dark resting structures which mainly consists of compact mass of fungal mycelium usually present in older cultures for long periods as survival structures in older cultures. In this study, the data of sclerotia was recorded after 10-15 days of incubation, which showed that all isolates showed presence of sclerotia in the culture plates as shown in Fig. 4.14 (c & d).

The sclerotia color was recorded as black or dark brown. From a total of 92

B. cinerea isolates, 69 (75 %) isolates showed the color of sclerotia as black while rest of 22 (25 %) isolates was observed having sclerotia of dark brown in color. The sclerotia were found to be all over the culture plate at random with no distinct pattern.

The diameter of sclerotia was recorded in old cultures after 10-15 days of incubation at 25±2o C. Diameter in 92 isolates showed varation was seen among the sclerotia diameter. The maximum diameter was recorded as 7 mm in 15 isolates

(16.85 %) isolates viz. BRSG17, BRSG18,BRGW24, BRGW25, BRSK30,

BRSK35, BRNR44, BRNR45, BRSP52, BRLH63, BRLH79, BRLH80,

BRLH81,BRSW88 and BRSW88 while minimum of 2 mm was recorded in 4 (4.49

%) isolates viz. BRID5, BRSG16, BRGW22 and BRCS83. Seven (7.86%) isolates were found to have 3mm diameter followed by 18 (20.22%) with 4mm, 18 (20.22%) with 5mm while rest of 25 (28.08 %) isolates were found to have 6mm diameter.

The shape of sclerotia among isolates were recorded from flat to slight irregular. Majority of isolates (73, 79.34 %) showed circular to slight irregular

124

sclerotia while rest of isolates (19, 20.65 %) were observed with flat sclerotia. The sclerotia was formed after incubation for a week and more than week at 25±2o C in all of the isolates. The days required to form sclerotia showed some variation among various isolates. Majority of isolates i.e. 33 isolates showed formation after 10 days of incubation followed by 31 isolates with 11 days of incubation, whereas 9 isolates showed formation after 8 days and 10 isolates were found to form sclerotia after incubation at 8 days. Minimum of 7 isolates were found to form sclerotia after 7 days and the earliest in all of the studied isolates (Table 4.10)

4.9.1.4 Conidiophore color and length Conidiophores (cp) in B. cinerea are usually formed from mycelium or sclerotium, typically produced in bunches. Conidiophores observed as erect, smooth- walled and were wider from the lower part and branched at their top margins or tips resulting in spherical to hemispherical swelling which has spore bearing projection on them which are known as sterigmata and conidia are of pear or lemon shaped

(Fig. 4.9 c and d). It was found to be more or less straight and dichotomously or trichotomously branched. Color variation was observed among different isolates under study. The variation ranged from hyaline to pale brown color of conidiophores

(Fig. 4.14 e). Among 92 isolates majority of isolates (65, 72.82 %) were found to have pale brown color conidiophores while rest of isolates (25, 27.17%) were recorded to have hyaline color conidiophores.

Length of conidiophores greatly varied among isolates. The length ranged from 730 µm to 2805 µm. The minimum length of 730±63.73 µm was seen in isolates

BRCS87 that was recovered from Charsadda in KPK province. The maximum length of 2805±366.72 µm was found in isolates BRID4 recovered from Islamabad, all other isolates sizes falls within this range as shown in Table 4.10.

125

4.9.1.5 Shape, size and color of conidia

Conidia are the asexual reproductive spores of fungal organisms including

Botrytis produced in the form of chains on the tips of specialized hyphae called conidiophores. Conidia are considered a characteristic feature of fungal pathogens for identification and morphological characterization. In this study conidia produced in ninety two cultures after 7-14 days of incubation were studied and it was observed that conidia were produced over the surface of the medium and formed in clusters on the top of branched conidiophores and look like a bunch of grape (Fig. 4.14 e).

Conidia were recorded to produce two distinct colors in isolates viz sub- hyaline and light brown (Fig. 4.14 f) having variable number of nuclei, which in mass showed gray color and became darker with the age. The shapes of conidial spores observed under the microscope were single celled, usually multinucleated and obovoidal to ellipsoidal. It was observed that conidia in all isolates found solitary and single celled with smooth surface texture. Maximum size of 16.7±1.78×8.7±1.68

µm was found in isolate BRSP50 recovered from Sheikhupura district of Punjab whereas, minimum of 11.2±3.5 × 5.0±0.40 µm in isolate BRNR41 recovered from

Narowal district of Punjab. All conidial studies were conducted under microscope at

100X (Table 4.10).

The fungus B. cinerea having teleomorph, Botryotinia fuckeliana is classified under phylum Ascomycota, order Helotiales, class Leotiomycetes, family

Sclerotiniaceae and genus Botryotinia (Jarvis, 1977; Yu et al., 2011). It is a necrotrophic pathogen which aggressively infects and kills host tissues after colonization and nourished on the dead cell. Generally, causes soft or watery rotting on infected strawberry fruits and result in production of abundant grey mycelium

126

typical of the disease. Beever and Weeds (2007) described that identification of

Botrytis spp. has generally based on the morphological characteristics, especially those of mycelia, dimensions (length and width) of conidiophores, conidia and sclerotia along with sclerotia structure and size. According to studies conducted by

Rigotti et al. (2002) and Yohalem (2003), Cultural and morphological identification tends to be influenced by the growth conditions which showed variation in taxonomic characters like colony color, size of the conidia, shape etc. but so far is considered important criteria for identification. Hennebert (1973); Ellis and Waller

(1974) and Jarvis (1977) concluded that Botrytis spp. to date have been carried out predominantly on morpho-cultural characters and showed good results when aided with specificity of the host. Its Apothecia are very rarely produced under field conditions whereas more frequently been observed in case of other Botrytis spp.

(Fereta et al., 1988).

In present study, a total of ninety two (92) Botrytis isolates were subjected to cultural and morphological characterization. All isolates were grown on PDA medium for identification. Potato dextrose agar medium produces maintained good colony growth and excellent sporulation of the fungi. It was also been reported as best media for B cinerea by various researchers i.e. Choi et al., 1990; Martinez et al., 2008 and Hosen et al., 2010. Based on the cultural and morphological characteristics data from this study, all isolates were tentatively identified as Botrytis cinerea and were confirmed by comparing with identification characters provided by Hennebert, 1973; Ellis, 1971; Ellis and Waller, 1974 and Jarvis, 1977; and also correlates current findings with other earlier studies.

According to studies conducted by Hennebert (1973) and Domsch (1980), B.

127

cinerea in culture appeared to be greyish with fluffy appearance. Culture was white or hyaline initially but later becomes grey to grayish brown with dark walled erect septate hyphae that developed in creeping pattern. Zhou et al. (2014) reported that

B. cinerea varies significantly from other Botrytis spp. on basis of colony morphology. B. cinerea produces grayish to grayish whitish colonies and B. sinoviticola gives whitish colonies. Similarly, Jarvis (1977) and Mirzaei et al. (2007) described colony color character of different Botrytis spp. viz. B. porri had yellowish white to grayish white colonies with compact mycelium, B. convoluta produces white aerial mycelia that grew over the perti plate and later turn to buff color, B. fabae produces hyaline color colony initially which turns grayish brown as colony grown older and B. pelargonii colonies were yellowish and later become gray, whereas B. cinerea produces grayish, white or cloudy white colonies. These findings were found to be consistent with the finding of current study, where isolates showed grayish colonies and colony color was found to be dark grey and cloudy white.

The study showed B. cinerea conidiophores were produced directly from mycelium or sclerotia. They were more or less straight septate, dichotomously or trichotomously branching tree like towards the apex conidiophores with hyaline and pale brown in color was found. They were more or less straight, septate found to be more or less straight having minimum length of 730±63.73 µm in isolate BRCS87 and maximum of 2805±366.72 µm in isolate BRID4. A number of previous studies confirmed current finding, Lu et al. (2014) reported that B. cinerea conidiophore were light brown to brown in color and exist in clusters or singly, mostly are branded but unbranched having length of 573 to 2507 µm. Jarvis (1977) whereas, Khazaeli et al. (2010) and Mirzaei et al. (2007) reported the length of conidiophore from 705

128

(a) (b)

(e) (f)

Fig. 4.14 Botrytis cinerea morphological characters: Colony color and growth habit (a) Dark grey (b) Cloudy white (c & d) Sclerotia formation (e) Conidiophore with conidia in grape bunch shape, (d) Conidia of lemon or pear shaped

129

Table 4. 10: Botrytis cinerea isolates ID with culture identification and morphological characterization (CC = Colony Color, RCC = Reverse Colony Color, GH = Growth Habit, S μm = Size in Micrometer, L±SD, Length ± Standard deviation, Dia. = Diameter, DF = Days to form)

S. # Isolate Colony Conidiophore Conidia Sclerotia ID CC RCC GH S μm Color S μm Shape Color Color Dia. DF Shape Pattern & L±SD L±SD× mm Density W±SD 1 BRID1 Dark Grey Greyish Aerial 1145±111.80 Pale Brown 13.7±2.01× Obovoid Sub-hyaline Black 5±0.35 11 Flat Scattered and white mycelium 6.3±0.89 Sparse 2 BRID2 Dark Grey Greyish Aerial 966±97.27 Hyaline 12.1±1.79× Obovoid Sub-hyaline Dark 5±0.42 11 Irregular Scattered and white mycelium 5.9±0.67 Brown Sparse 3 BRID3 Cloudy Greyish Aerial 1530±91.68 Pale Brown 14.5±2.80× Obovoid Light brown Black 5±0.35 10 Irregular Scattered and white white mycelium 6.1±1.01 Sparse 4 BRID4 Cloudy Greyish Aerial 2805±366.72 Pale Brown 12.3±1.18× Obovoid Light brown Black 4±0.45 9 Flat Scattered and white white mycelium 6.6±0.34 Sparse 5 BRID5 Cloudy Greyish Aerial 1209±114.04 Pale Brown 15.0±3.47× Obovoid Sub-hyaline Dark 4±0.11 7 Irregular Scattered and white white mycelium 7.2±1.17 Brown Sparse 6 BRRP6 Dark Grey Greyish Aerial 975±88.32 Pale Brown 12.2±1.87× Obovoid Light brown Black 4±0.74 8 Irregular Scattered and white mycelium 5.6±0.11 Sparse 7 BRRP7 Dark Grey Greyish Aerial 1367±165.47 Pale Brown 13.0±2.68× Ellipsoid Light brown Black 6±0.35 11 Irregular Scattered and white mycelium 6±0.09 Sparse 8 BRRP8 Dark Grey Greyish Aerial 780±38.01 Pale Brown 9.0±0.68× Ellipsoid Light brown Black 4±0.27 11 Irregular Scattered and white mycelium 7.0±1.06 Sparse 9 BRRP9 Dark Grey Greyish Aerial 1177±156.52 Pale Brown 14.5±4.81× Obovoid Light brown Dark 4±0.96 10 Flat Scattered and white mycelium 6.6±0.87 Brown Sparse 10 BRRP10 Dark Grey Greyish Aerial 2079±211.31 Pale Brown 10.4±3.13× Obovoid Light brown Dark 4±0.23 11 Irregular Scattered and white mycelium 8.4±1.34 Brown Sparse 11 BRRP11 Dark Grey Greyish Aerial 989±86.09 Pale Brown 16.3±5.14× Obovoid Sub-hyaline Black 4±0.57 10 Flat Scattered and white mycelium 5.7±0.78 Sparse 12 BRSG12 Dark Grey Greyish Aerial 1690±174.41 Hyaline 11.7±1.79× Obovoid Sub-hyaline Black 4±1.14 10 Irregular Scattered and white mycelium 6.3±0.63 Sparse 13 BRSG13 Dark Grey Greyish Aerial 888±61.49 Pale Brown 12.7±2.91× Obovoid Sub-hyaline Black 4±0.01 11 Irregular Scattered and white mycelium 6.8±0.89 Sparse 14 BRSG14 Dark Grey Greyish Aerial 2310±71.55 Pale Brown 13.0±7.6× Obovoid Pale brown Black 5±0.34 11 Irregular Scattered and white mycelium 7.2±0.22 Sparse Continued….

130

15 BRSG15 Cloudy Greyish Aerial 1288±139.75 Pale Brown 15.5±1.57× Obovoid Pale brown Dark 4±0.74 11 Irregular Scattered and white white mycelium 5.7±0.85 Brown Sparse 16 BRSG16 Dark Grey Greyish Aerial 2180±45.84 Pale Brown 9.9±2.35× Obovoid Pale brown Black 4±0.22 7 Irregular Scattered and white mycelium 5.2±0.48 Sparse 17 BRSG17 Dark Grey Greyish Aerial 1450±62.61 Hyaline 14.8±3.91× Obovoid Pale brown Dark 4±0.57 10 Irregular Scattered and white mycelium 5.9±0.11 Brown Sparse 18 BRSG18 Dark Grey Greyish Aerial 1365±21.24 Pale Brown 15.4±3.02× Ellipsoid Pale brown Dark 4±0.96 10 Irregular Scattered and white mycelium 8.8±0.97 Brown Sparse 19 BRSG19 Cloudy Greyish Aerial 1700±101.74 Pale Brown 13.6±3.47× Ellipsoid Pale brown Black 4±0.39 10 Irregular Scattered and white white mycelium 6.7±0.77 Sparse 20 BRGW20 Cloudy Greyish Aerial 833±114.04 Pale Brown 11.1±1.76× Ellipsoid Pale brown Black 4±0.00 10 Flat Scattered and white white mycelium 6.0±0.96 Sparse 21 BRGW21 Dark Grey Greyish Aerial 1080±68.20 Hyaline 14.3±2.3× Obovoid Pale brown Black 7±2.01 10 Irregular Scattered and white mycelium 8.1±1.45 Sparse 22 BRGW22 Dark Grey Greyish Aerial 1515±116.28 Hyaline 13.8±1.50× Obovoid Pale brown Black 4±0.27 9 Irregular Scattered and white mycelium 7.7±1.23 Sparse 23 BRGW23 Dark Grey Greyish Aerial 689±114.04 Pale Brown 9.9±0.8× Obovoid Sub-hyaline Black 4±1.00 9 Irregular Scattered and white mycelium 5.2±0.22 Sparse 24 BRGW24 Dark Grey Greyish Aerial 2007±228.08 Pale Brown 13.3±1.3× Obovoid Sub-hyaline Dark 4±0.94 11 Irregular Scattered and white mycelium 5.4±0.67 Brown Sparse 25 BRGW25 Dark Grey Greyish Aerial 1779±186.71 Pale Brown 12.6±2.7× Obovoid Pale brown Black 5±0.66 11 Irregular Scattered and white mycelium 5.8±0.21 Sparse 26 BRGW26 Dark Grey Greyish Aerial 1389±78.26 Pale Brown 15.5±3.5× Obovoid Pale brown Dark 4±0.45 11 Irregular Scattered and white mycelium 9.2±0.97 Brown Sparse 27 BRGW27 Cloudy Greyish Aerial 1877±112.92 Pale Brown 16.6±3.51× Obovoid Pale brown Black 5±0.56 11 Flat Scattered and white white mycelium 6.0±0.76 Sparse 28 BRGW28 Dark Grey Greyish Aerial 988±100.62 Pale Brown 10.9±1.0× Obovoid Pale brown Black 4±0.23 8 Irregular Scattered and white mycelium 7.1±0.74 Sparse 29 BRSK29 Dark Grey Greyish Aerial 1313±134.16 Hyaline 15.2±4.5× Obovoid Pale brown Black 4±0.13 8 Irregular Scattered and white mycelium 7.1±1.14 Sparse 30 BRSK30 Dark Grey Greyish Aerial 1100±39.13 Pale Brown 13.8±5.1× Ellipsoid Pale brown Black 4±0.35 11 Irregular Scattered and white mycelium 6.3±0.91 Sparse 31 BRSK31 Dark Grey Greyish Aerial 1402±69.15 Pale Brown 12.2±2.3× Ellipsoid Pale brown Black 4±0.42 11 Irregular Scattered and white mycelium 6.0±0.10 Sparse 32 BRSK32 Cloudy Greyish Aerial 1450±97.27 Pale Brown 12.9±3.1× Obovoid Sub-hyaline Dark 4±0.82 11 Flat Scattered and white white mycelium 5.6±0.01 Brown Sparse Continued….

131

33 BRSK33 Cloudy Greyish Aerial 735±65.96 Pale Brown 16.1±4.1× Obovoid Sub-hyaline Black 4±0.42 11 Irregular Scattered and white white mycelium 5.5±0.45 Sparse 34 BRSK34 Cloudy Greyish Aerial 1479±201.25 Hyaline 13.9±1.70× Obovoid Sub-hyaline Black 4±0.08 11 Flat Scattered and white white mycelium 8.3±0.95 Sparse 35 BRSK35 Grayish Greyish Aerial 2134±261.62 Pale Brown 11.6±1.57× Obovoid Pale brown Black 6±0.92 10 Irregular Scattered and white mycelium 7.2±0.26 Sparse 36 BRSK36 Dark Grey Greyish Aerial 1730±316.53 Pale Brown 13.5±1.50× Obovoid Pale brown Dark 5±1.01 10 Irregular Scattered and white mycelium 5.5±1.22 Brown Sparse 37 BRNR37 Dark Grey Greyish Aerial 735±69.05 Pale Brown 10.7±0.8× Ellipsoid Pale brown Black 7±0.76 9 Flat Scattered and white mycelium 5.2±0.49 Sparse 38 BRNR38 Dark Grey Greyish Aerial 1288±81.62 Pale Brown 15.3±4.31× Obovoid Pale brown Black 5±0.46 11 Irregular Scattered and white mycelium 8.5±0.63 Sparse 39 BRNR39 Dark Grey Greyish Aerial 1994±153.17 Hyaline 13.1±2.55× Obovoid Pale brown Black 5±0.42 11 Flat Scattered and white mycelium 7.4±0.88 Sparse 40 BRNR40 Dark Grey Greyish Aerial 845±102.86 Hyaline 8.7±1.2× Ellipsoid Pale brown Black 6±0.57 11 Flat Scattered and white mycelium 5.0±0.48 Sparse 41 BRNR41 Dark Grey Greyish Aerial 1871±314.80 Hyaline 11.2±3.5× Ellipsoid Sub-hyaline Black 6±0.22 7 Irregular Scattered and white mycelium 5.0±0.40 Sparse 42 BRNR42 Dark Grey Greyish Aerial 1299±186.71 Hyaline 12.5±1.08× Ellipsoid Pale brown Black 5±0.45 7 Irregular Scattered and white mycelium 8.6±0.40 Sparse 43 BRNR43 Cloudy Greyish Aerial 1359±209.07 Pale Brown 16.1±2.3× Obovoid Pale brown Dark 3±1.08 7 Irregular Scattered and white white mycelium 5.3±0.86 Brown Sparse 44 BRNR44 Dark Grey Greyish Aerial 1040±149.82 Pale Brown 14.5±2.9× Obovoid Pale brown Dark 5±0.75 10 Irregular Scattered and white mycelium 5.6±0.22 Brown Sparse 45 BRNR45 Grayish Greyish Aerial 756±100.62 Pale Brown 13.1±0.4× Obovoid Pale brown Black 7±0.84 10 Irregular Scattered and white white mycelium 6.8±0.56 Sparse 46 BRNR46 Grayish Greyish Aerial 1533±144.23 Pale Brown 12.9±2.31× Obovoid Pale brown Black 7±0.42 8 Irregular Scattered and white white mycelium 6.3±0.48 Sparse 47 BRNR47 Cloudy Greyish Aerial 1657±199.01 Pale Brown 12.0±3.58× Obovoid Sub-hyaline Dark 5±0.16 11 Irregular Scattered and white white mycelium 5.6±0.85 Brown Sparse 48 BRNR48 Dark Grey Greyish Aerial 791±84.97 Pale Brown 13.3±4.58× Obovoid Pale brown Black 6±0.74 11 Irregular Scattered and white mycelium 5.2±0.73 Sparse 49 BRSP49 Dark Grey Greyish Aerial 1832±257.15 Hyaline 12.9±3.47× Obovoid Sub-hyaline Black 5±0.13 10 Irregular Scattered and white mycelium 8.0±1.22 Sparse 50 BRSP50 Dark Grey Greyish Aerial 713±115.16 Hyaline 16.7±1.78× Ellipsoid Pale brown Black 6±1.57 9` Irregular Scattered and white mycelium 8.7±1.68 Sparse Continued….

132

51 BRSP51 Dark Grey Greyish Aerial 1972±346.59 Pale Brown 14.8 ±2.24× Obovoid Pale brown Black 6±0.11 11 Irregular Scattered and white mycelium 5.2±0.21 Sparse 52 BRSP52 Cloudy Greyish Aerial 1899±163.23 Pale Brown 12.2±2.24× Obovoid Pale brown Black 6±0.25 11 Flat Scattered and white white mycelium 5.5±0.37 Sparse 53 BRSP53 Dark Grey Greyish Aerial 1577±92.80 Hyaline 13.6±1.34× Ellipsoid Pale brown Black 6±0.10 9 Flat Scattered and white mycelium 6.6±0.66 Sparse 54 BRSP54 Cloudy Greyish Aerial 1250±114.04 Pale Brown 15.1±2.57× Ellipsoid Pale brown Dark 6±0.09 10 Irregular Scattered and white white mycelium 6.8±0.75 Brown Sparse 55 BRSP55 Dark Grey Greyish Aerial 1557±173.30 Pale Brown 11.7±3.47× Obovoid Sub-hyaline Dark 7±0.42 11 Irregular Scattered and white mycelium 5.8±0.37 Brown Sparse 56 BRSP56 Cloudy Greyish Aerial 893±105.10 Pale Brown 14.3±1.14× Obovoid Sub-hyaline Black 5±0.03 10 Irregular Scattered and white white mycelium 7.4±0.97 Sparse 57 BRSP57 Cloudy Greyish Aerial 2006±112.25 Pale Brown 12.9±3.02× Obovoid Pale brown Black 6±0.35 10 Flat Scattered and white white mycelium 6.1±0.01 Sparse 58 BRSP58 Dark Grey Greyish Aerial 1358±95.65 Pale Brown 2±0.70×7.6 Obovoid Sub-hyaline Black 4±0.09 8 Irregular Scattered and white mycelium ±0.64 Sparse 59 BRSP59 Dark Grey Greyish Aerial 1004±74.38 Hyaline 13.2±2.12× Ellipsoid Pale brown Black 6±1.04 11 Irregular Scattered and white mycelium 7.1±0.32 Sparse 60 BRLH60 Dark Grey Greyish Aerial 1711±224.72 Hyaline 14.4±2.91× Ellipsoid Sub-hyaline Black 3±0.16 10 Irregular Scattered and white mycelium 6.4±0.41 Sparse 61 BRLH61 Grayish Greyish Aerial 999±59.26 Hyaline 13.9±2.54× Ellipsoid Pale brown Black 6±1.34 7 Irregular Scattered and white white mycelium 6.7±0.16 Sparse 62 BRLH62 Cloudy Greyish Aerial 1498±186.71 Pale Brown 12.2±0.85× Ellipsoid Pale brown Dark 4±0.91 9 Irregular Scattered and white white mycelium 5.8±0.46 Brown Sparse 63 BRLH63 Cloudy Greyish Aerial 1630±148.70 Pale Brown 11.4±3.79× Obovoid Pale brown Black 4±0.35 10 Irregular Scattered and white white mycelium 5.1±1.00 Sparse 64 BRLH64 Dark Grey Greyish Aerial 1545±179.22 Pale Brown 13.2±0.87× Obovoid Pale brown Dark 2±0.12 11 Irregular Scattered and white mycelium 7.9±0.91 Brown Sparse 65 BRLH65 Dark Grey Greyish Aerial 1250±156.52 Pale Brown 12.9±3.80× Ellipsoid Pale brown Black 4±0.57 9 Irregular Scattered and white mycelium 6.5±1.68 Sparse 66 BRMT66 Dark Grey Greyish Aerial 1381±238.14 Pale Brown 16.0±1.09× Obovoid Pale brown Black 6±0.22 10 Irregular Scattered and white mycelium 7.7±0.88 Sparse 67 BRMT67 Dark Grey Greyish Aerial 2319±320.88 Pale Brown 13.3±1.11× Obovoid Pale brown Blak 5±0.45 10 Irregular Scattered and white mycelium 8.4±0.29 Sparse 68 BRMT68 Dark Grey Greyish Aerial 1647±99.87 Pale Brown 13.8±2.35× Ellipsoid Sub-hyaline Black 3±0.42 9 Irregular Scattered and white mycelium 5.8±0.42 Sparse Continued….

133

69 BRMT69 Dark Grey Greyish Aerial 1873±230.32 Pale Brown 16.4±1.45× Obovoid Pale brown Dark 5±0.42 10 Irregular Scattered and white mycelium 5.9±0.12 Brown Sparse 70 BRMT70 Cloudy Greyish Aerial 989±186.71 Hyaline 9.4±0.46×5.Obovoid Pale brown Black 3±0.00 10 Irregular Scattered and white white mycelium 0±0.00 Sparse 71 BRMT71 Dark Grey Greyish Aerial 2132±197.89 Pale Brown 15.5±4.02× Ellipsoid Pale brown Black 4±0.21 10 Irregular Scattered and white mycelium 6.7±0.48 Sparse 72 BRMT72 Dark Grey Greyish Aerial 897±132.66 Pale Brown 11.5±0.56× Obovoid Pale brown Black 4±0.67 10 Irregular Scattered and white mycelium 6.5±0.39 Sparse 73 BRMD73 Cloudy Greyish Aerial 1576±223.61 Pale Brown 14.0±2.35× Obovoid Pale brown Black 4±0.59 8 Irregular Scattered and white white mycelium 9.5±1.45 Sparse 74 BRMD74 Cloudy Greyish Aerial 1685±108.36 Pale Brown 13.7±3.41× Obovoid Pale brown Dark 6±0.29 8 Irregular Scattered and white white mycelium 6.5±0.73 Brown Sparse 75 BRMD75 Cloudy Greyish Aerial 657±72.67 Pale Brown 15.2±1.78× Obovoid Pale brown Black 6±0.91 10 Irregular Scattered and white white mycelium 6.9±0.79 Sparse 76 BRMD76 Dark Grey Greyish Aerial 1300±197.89 Hyaline 12.5±0.11× Obovoid Pale brown Black 6±0.45 10 Irregular Scattered and white mycelium 6.1±1.12 Sparse 77 BRMD77 Dark Grey Greyish Aerial 1549±145.34 Hyaline 13.1±1.79× Obovoid Sub-hyaline Black 2±0.59 9 Irregular Scattered and white mycelium 7.0±0.44 Sparse 78 BRMD78 Dark Grey Greyish Aerial 1919±187.83 Pale Brown 14.2±3.47× Obovoid Sub-hyaline Black 6±0.65 11 Irregular Scattered and white mycelium 5.9±0.93 Sparse 79 BRMD79 Cloudy Greyish Aerial 1199±162.11 Hyaline 13.2±3.02× Ellipsoid Pale brown Black 4±1.00 11 Flat Scattered and white white mycelium 6.4±0.78 Sparse 80 BRMD80 Dark Grey Greyish Aerial 735±135.28 Pale Brown 12.8±1.45× Obovoid Pale brown Black 5±0.56 10 Irregular Scattered and white mycelium 6.1±0.45 Sparse 81 BRCS81 Dark Grey Greyish Aerial 2456±226.96 Pale Brown 15.3±1.87× Obovoid Pale brown Black 5±0.89 10 Irregular Scattered and white mycelium 8.6±1.00 Sparse 82 BRCS82 Dark Grey Greyish Aerial 1300±136.40 Pale Brown 16.5±3.47× Obovoid Sub-hyaline Black 6±1.02 10 Irregular Scattered and white mycelium 6.4±0.96 Sparse 83 BRCS83 Dark Grey Greyish Aerial 1589±199.01 Pale Brown 16.0±1.54× Obovoid Sub-hyaline Dark 4±0.51 7 Irregular Scattered and white mycelium 7.4±0.22 Brown Sparse 84 BRCS84 Dark Grey Greyish Aerial 1289±257.15 Pale Brown 13.9±1.68× Obovoid Sub-hyaline Dark 7±1.01 10 Flat Scattered and white mycelium 6.4±0.97 Brown Sparse 85 BRCS85 Cloudy Greyish Aerial 1500±163.24 Pale Brown 12.9±0.67× Obovoid Pale brown Black 5±0.00 10 Irregular Scattered and white white mycelium 5.6±0.35 Sparse 86 BRCS86 Dark Grey Greyish Aerial 2539±234.79 Hyaline 13.3±2.68× Ellipsoid Pale brown Black 5±0.53 11 Irregular Scattered and white mycelium 6.3±0.57 Sparse Continued….

134

87 BRCS87 Dark Grey Greyish Aerial 730±63.73 Hyaline 16.2±2.24× Ellipsoid Sub-hyaline Black 3±0.12 8 Flat Scattered and white mycelium 8.3±1.04 Sparse 88 BRSW88 Cloudy Greyish Aerial 965±140.87 Hyaline 14.7±0.78× Ellipsoid Pale brown Black 6±0.71 10 Irregular Scattered and white white mycelium 6.8±1.29 Sparse 89 BRSW89 Dark Grey Greyish Aerial 1731±203.48 Pale Brown 12.4±1.06× Ellipsoid Sub-hyaline Black 6±0.78 11 Flat Scattered and white mycelium 5.2±0.73 Sparse 90 BRSW90 Dark Grey Greyish Aerial 1223±57.94 Hyaline 13.7±2.01× Ellipsoid Pale Black 7±0.24 10 Irregul Scattered and white mycelium 6.3±0.89 brown ar Sparse 91 BRSW91 Dark Grey Greyish Aerial 2129±45.38 Pale 12.1±1.79× Ellipsoid Pale Dark 6±0.44 9 Irregul Scattered and white mycelium Brown 5.9±0.67 brown Brown ar Sparse 92 BRSW92 Dark Grey Greyish Aerial 1548±84.51 Pale 14.5±2.80× Obovoid Sub- Dark 5±0.37 8 Flat Scattered and white mycelium Brown 6.1±1.01 hyaline Brown Sparse

135

to 2999 µm and 657 to 3123 µm respectively. Similarly, Zhou (2014) reported alternately branched conidiophore at top which become straight afterward and usually are septate, 734-2467 µm in length and slightly swallowed at apex. Domsch

(1980) described that conidiophores of B. gladiolorum were erect, 400-1400 µm in length with swollen basal cell and branched one or two times in alternate fashion at about one third height from the basal portion.

The appearance of Botrytis spp. conidia is distinct from other fungal pathogens. The mass of conidia that produced on the apex of conidiophore resembles grape bunch like appearance which is very important character to tentative identification of fungus from genus Bortyis. B. cinerea conidia were unicellular, multinucleated but rarely may be 1 or 2 septate. Their shape ranged from ovate, ellipsoidal, narrowly ellipsoidal, pyriform or sometimes globose to sub-globose.

Conidia were produced all over the culture. They were hyaline or pale brown, shen- grey, to brown in color with smooth surface. The size of B. cinerea conidia varied significantly and usually ranged from 16.7±1.78×8.7±1.68 to 11.2±3.5 × 5.0±0.40 in present study. The following conidial characteristics were similar to earlier reports of B. cinerea as described by Hennerbet (1973); Ellis and Waller (1974); Jarvis

(1977); Mirzaei et al. (2007). According to Zhou et al. (2014) conidia produced by

B. convoluta seemed thinner and contained villiform or very fine hair like projections as compared to conidia of B. cinerea, which are thick and have smooth surface.

According to Ellis and Waller (1974); Jarvis (1977) and Mirzaei et al. (2007), the presence or absence sclerotia, pattern of formation over the culture medium, size, color and shape of sclerotia varies from one Botrytis spp. to other and used as a good character in morphological characterization. Also, the sclerotia of B. cinerea showed

136

some level of variation among them on the basis of culture conditions. They described that B. cinerea produces large, sparse and scattered sclerotia or on edges of the petri plates. Sometimes also formed on concentric rings when culture is grown in alternate period of light and dark cycles and shape varies from roughly regular, scale-like, irregular with smooth or nodulous surface while Gao et al. (2011) recorded only flat shape sclerotia. May either exits singly or may be as aggregated form and color ranged from brown, dark brown to black or shiny black. Hennebert

(1973) reported that sclerotia of B. calthe formed within and bottom of media plates, whereas, Zhang (2006) described the sclerotia size of B. pelagonii and B. pseduocinerea ranged from 5-10 mm and 1-4 mm respectively and B. sinoviticola produce abundant, irregular to spherical small sclerotia (0.8-3.0 mm) contrary to B. cinerea that forms relatively large black and dark brown sclerotia (1-6 mm) sclerotia.

These reported parameters of sclerotia by were seen coinciding with current, where large (1-7 mm) and irregular scattered sclerotia were recorded in all of the isolates.

The color of sclerotia were found to be dark brown to black having flat and irregular in shape. Based on the detailed study of cultural and morphological characterization and comparison with published literature, the fungus was identified as B. cinerea

Pers.

4.9.2 Molecular Characterization of Botrytis cinerea

A total of 92 pathogenic isolates of B. cinerea were morphologically identified and from these 12 representative isolates and highly virulence (BRID5,

BRRP7, BRSG18, BRGW25, BRSK32, BRNR43, BRSP57, BRLH60, BRMT68,

BRMD75, BRCS80 and BRSW88) each from one district were used in molecular studies. The inter transcribed spacer region (ITS) and glyceraldehyde-3-phosphate

137

dehydrogenase (G3PDH) gene regions of representative isolates of B. cinerea were amplified by PCR using universal primers, ITS1 5′-GCCGTAGGTGAACC

TGCGG-3′, ITS4 5′-TCCTCCGCTTATTGATATGC -3′ and G3PDH primers,

G3PDH_for 5 -ATTGACATCGTCGCTGTCAACGA-3 and 5 ATTGACATCGTC

GCTGTCAACGA 3 G3PDH_rev in sense and antisense directions. Isolates sequences were aligned using BioEdit software version 7.0. The aligned sequences were submitted to GenBank database under isolate IDs as NAS-BC1-10, NAS-26 and NAS-34 and were allotted accession numbers against each isolate with ITS

(MF53833, MF959755-MF959762, MFKY311971 and MF140446) and G3PDH

(MF97456-MF974555 and MF139774-5) respectively as shown in Table 4.11.

Sequence analysis of 12 isolates performed using BLAST search utility revealed 99-100 % homology with previously reported B. cinerea isolates ITS having accession numbers viz. CP009808, AM90171, KX06143, MG560200, KY817366,

KY550356, MF925713, MG293235, KU234690, KT266232 and KJ937046 and while G3PDH gene regions showed 100% genetic homology with available isolates under accession number viz. XM_024697466, KX275256, KX817371, KR058341,

KY817367, MG714830, KY798122, KR076283, KX8984478 and KY201464 at

NCBI database.

Phylogenetic analysis of 12 obtained sequence that were recovered locally and labelled as black squares was done separately for ITS (Fig. 4.13a) and G3PDH

(Fig. 4.13b) clustered with reference isolates of B. cinerea downloaded from

GenBank due to high genetic homology among these isolates. Isolates were further splitted in subtrees based on the difference of more than 50 nucleotides among different isolates whereas B. elliptica was used as an out group and shows no

138

similarity with isolates of B. cinerea and placed separately at the bottom of the phylogenetic trees.

Alam et al. (2017) used morphological and ITS region of rDNA of B. cinerea using ITS1 and ITS4 primers to correctly characterize as pathogen of post harvests gray mold of strawberry in Pakistan. Similarly, Kwon et al. (2011) also reported post

B. cinerea as post-harvest pathogen of strawberry and blueberry in Korea. For characterization purpose used combination of morphological and molecular tools.

The identity of causal fungus was confirmed ITS rDNA gene regions of representative fungal isolate was amplified with ITS1/ITS4 primers and confirmed as B. cinerea. Phylogenetic analysis with reference isolates was also carried out and showed isolate was clustered with clade of reference isolate.

However, relationship among species of Botrytis could not be accurately resolved with ITS alone due to limited phylogenetic information at that region.

Xiepeng et al. (2012) reported G3PDH gene region provide good resolution to differentiate species. From 400 Botrytis isolates recovered from blackberry and strawberry field of Carolinas, USA and DNA amplification of these isolates with

G3PDH primers revealed that majority of isolates were B.cinerea while few isolates were identified as B. caroliniana. Furthermore, a number of studies used multigene alongside ITS to further confirm the identity of B. cinerea and to differentiate among various Botrytis spp. Staats et al. (2005) used ITS, G3PDH, RPB2 and HSP60 genes for identification of various Botrytis species including B. cinerea. Similar study was also conducted by Li et al. (2015) to identify B.cinerea from greenhouse grown fennel in china, Zhoun et al. (2013) for morpho-molecular identification of B. sinoviticola from gray mold of table grapes in China. So, two representative isolates

139

from this study viz. NAS-BC26 and NAS-BC34 were amplified with RNA polymerase subunit II (RPB2) and Heat shock protein 60 (HSP60) genes under accessions nos. MG188853-MG188854 and MG188855-MF188856 respectively.

BLAST analysis of these sequences showed 100% genetic homology with previously published accession numbers of RPB2 and HSP60 genes viz. KX89847-

KX266744 and DQ247786-KX266738 respectively, which further confirmed that all isolates of this study associated with pre-harvest gray modl of strawberry in Pakistan were B. cinerea.

140

Table 4.11. Details of Botrytis cinerea isolates and accession numbers with ITS and G3PDH primers used in molecular study

S. # Isolate District of Isolate ID Accession # Accession # ID origin on NCBI (ITS) (G3PDH) 1 BRRP7 Rawalpindi NAS-BC1 MF953833 MF964613

2 BRSG18 Sargodha NAS-BC2 MF959755 MF964614

3 BRGW25 Gujranwala NAS-BC3 MF959756 MF964615

4 BRSK32 Sialkot NAS-BC4 MF959757 MF964616

5 BRNR43 Narowal NAS-BC5 MF959758 MF964617

6 BRSP57 Sheikhupura NAS-BC6 MF959759 MF964618

7 BRLH60 Lahore NAS-BC7 MF959760 MF964619

8 BRMT68 Multan NAS-BC8 MF959761 MF964620

9 BRMD75 Mardan NAS-BC9 MF959762 MF964621

10 BRCS80 Charsadda NAS-BC10 MF959763 MF964622

11 BRSW88 Swat NAS-BC34 MF140446 MF139775

12 BRID5 Islamabad NAS-BC26 KY319171 MF139774

141

MF964615 MF953833 KT266260 KX766413 MF964619 KX061437 MF964622 KX822693 KX898478 MF959755 KF015587 MF959759 MF964613 MF140446 KX266732 KT266232 MF964617 MF959758 KY364367 KF859924 MF964614 MF959760 KR058341 MF925713 B. cinerea B. cinerea MF964616 MF959762 KY201469 KY319171 MF964620 KF533013 MF480679 KJ744343 MF964618 MF959756 KY201464 KX889115 MF139774 MF959761 KY798122 KU234690 MF139775 MF959763 KX266731 KJ937046 MF964621 MF959757 KR076783 KX783612 KR030053 B. elliptica KR055047 B. elliptica (a) Acessions with ITS gene region (b) Acessions with G3PDH gene region

SUMMARY

Strawberry (Fragaria × ananassa Duch.) is a commercial small fruit crop and is cultivated in more than 75 countries worldwide. In Pakistan, it is emerging as a high revenue generating commercial fruit crop. It is estimated to be grown on an area of 1500 hectare across Pakistan, where Punjab, Khyber Pakhtunkhwa, Sindh and Islamabad cover the majority of strawberry cultivation. Swat serves as the hub of the strawberry industry in Pakistan, where strawberry nursery is produced and transported to all over the Pakistan. In Pakistan, the yield of strawberry is much lower than other strawberry producing countries. This low yield and relative less area of cultivation is attributed to a number of factors which include, strawberry being considered a relative new crop in country, highly perishable fruit crop, cropping season coincide with the wheat, socioeconomic condition of the farmer, scarcity of good agronomic practices and cold storage facilities, susceptibility to diseases and lack of literature on these diseases.

As strawberry is highly perishable fruit crop with shelf life is about 2 days, it is highly vulnerable to a number of diseases at pre-harvest stages in field and at postharvest stages in transit and storage due to lack of detection while harvesting. Among diseases of strawberry crop, fungal diseases occupy a significant place and attack directly to the strawberry fruit resulting in immediate losses and rotting of the fruit and foliar parts especially leaves of the plant which indirectly affects yield due to reduction in active photosynthetic area available. Fungal diseases are responsible for causing fruit rots and leaf spot in strawberry and termed as destructive for strawberry production. These devastating fungal diseases are found in all strawberry growing areas of the world and are responsible for huge losses each year in world. According

142

to this study these are also inversely impact strawberry crop in Pakistan too.

Yet, there is scarcity and lack of important primarily literature and information regarding the occurrence, incidence, losses or yield reduction, impact on marketable value and species involved. Due to lack of data related to diseases, effective management options against the current major fungal diseases responsible for fruit rots and leaf spot are also lacking. Subsequently, comprehensive research study concerning to major fungal diseases of strawberry crop, their prevalence and incidence, identification of pathogens related to diseases and morpho-molecular characterization of pathogens is needed. Thus, the present study was undertaken to provide primarily data on diseases and also keeping in view the strawberry growers interests to avoid future losses due to such fungal diseases.

A two year (2014-15 and 2015-16) farmer’s field survey in Punjab, Khyber

Pakhtunkhwa (KPK) and Islamabad was carried out. A total of 12 districts were surveyed for diseases assessment and samples collection, where 8 districts

(Rawalpindi, Sargodha, Gujranwala, Sialkot, Narowal, Sheikhupura, Lahore and

Multan) of Punjab, 3 districts (Swat, Mardan and Charsadda) of Khyber

Pakhtunkhwa and important areas of Islamabad were surveyed. The survey followed by laboratory isolations revealed that 4 major fungal diseases are found to be most devastating during this first comprehensive research work on strawberry conducted in Pakistan. These fungal diseases are, Fusarium fruit rot (FFR), Alternaria leaf spot

(ALS), Anthracnose fruit rot (AFR) and Botrytis fruit rot (BFR) or gray mold. The field-based diseases assessment data showed that these all of the 4 diseases have prevalence of 0-100% in all of the 12 surveyed districts while Fusarium fruit rot

(FFR) was not found in district Swat. The incidence of these 4 fungal diseases varied

144

from district to district. Highest incidence of Alternaira leaf spot (ALS) was observed during both years followed by Bortytis fruit rot, Fusarium fruit rot and

Anthracnose fruit rot. The data suggested that Alternaria leaf spot (ALS) incidence ranged from 17.25 % to 55 %. The highest disease incidence percentage of 55% in district Mardan followed by 53.29 % in District Charsadda and 52.88% in district

Sheikhupura during 2015-16 whereas lowest of 17.25 % was recorded in district

Swat. Fusarium fruit rot (FFR) showed diseased incidence ranged from 0 to 59 %, where minimum of 0 % was recorded in district Swat during both years and maximum of 59% and 52.50% was recorded during year 2015-16 and 2014-15 in district Sheikhupura. Incidence percentage of Anthracnose fruit rot (AFR) was recorded lowest among all diseases. It ranged from highest of 44.71 % during 2015-

16 in district Charsadda followed by 43.88% in district Sheikhupura and 43.63 in district Lahore. The lowest of 14.13 to 16.63 % was found in district Swat followed by 19.50 to 20.50 % in Islamabad and 22 to 24 % in district Rawalpindi. In case of

Botrytis fruit rot (BFR) minimum of 17.13 to 19.50 % were observed in District Swat followed by 22.67 to 25.67 % in Islamabad and 28.60 to 30 % in district Rawalpindi.

The maximum incidence of 47.38 to 48.88% was found in district Narowal during both years respectively followed by 48.60 % during 2015-16 in district Sialkot and

45.71 to 47 % during year 2015-16 and 2014-15 in district Gujranwala.

Pathogenicity tests were conducted by inoculating isolates onto asymptomatic detached leaves and fruits for further selection of virulent isolates in further assessments. Cultural and morphological features like fungal culture color, reverse colony color and pigmentation, conidia sizes, shapes and color, conidiophore size and color, with presence and absence of specialized structures like,

145

chlamydospores, sclerotia, appresorria and setae etc. were used for morphological identification. After morphological characterization isolates were tentatively identified into four fungal pathogens viz. Fusarium solani, Alternaria alternata,

Colletotrichum spp. (including C. acutatum and C. gloeosporioides isolates) and

Botrytis cinerea.

Seventy-seven (77) isolates of F. solani were recovered and morphologically identified. It emerged as an important pathogen of strawberry in Pakistan. It is widely known to be the main cause of crown and root rot of strawberry in the world, but present study serves as primarily research work that revealed that F. solani also infects strawberry fruit and resulted in fruit rot. Alternaria leaf spot (ALS) of strawberry is caused by Alternaria alternata (Fr.) Keissl. and 82 isolates were recovered and morphologically identified in this study. Anthracnose fruit rot (AFR) of strawberry is caused by 2 Colletotrichum spp. as per findings of this study. In current study, 90 isolates were morphologically characterized where 69 belongs to

C. acutatum and 21 of C. gloeosporioides. Botrytis fruit rot (BFR) or gray mold of strawberry is caused mainly by Bortyis cinerea Pers. belonging to order Helotiales.

In present study, 92 isolates were morphologically identified. It causes serious economic losses both at pre-harvest and post-harvest stages of the crop.

After morphological characterization, a total of 54 representative and virulent isolates from each district were selected. In this 12 isolates each of A. alternata, B. cinerea while 19 isolates of Colletotrichum spp. (12 of C. acutatum and 7 of C. gloeosporioides) and 11 isolates of F. solani were subjected to molecular characterization initially with ITS gene primers (ITS1/ITS4). Segment of an endopolygalacturonase (EndoPG) gene was amplified for Alternaria alternata with

146

primers PG3 and PG2b. Beta (β)-tubulin gene specific primers BT2a and BT2b for

Colletotrichum spp. was used. For F. solani translation elongation factor 1-alpha

(TEF-1α) primer EF1 and EF2 was used as marker of choice, while for B. cinerea primers viz. G3PDH_for and G3PDH_rev was used which partially targets sequences of Glyceraldehyde-3-phosphate dehydrogenase gene. Molecular characterization with ITS and pathogen specific gene primers results in nucleotide sequencing which after BLAST analysis confirmed the pathogens. The data was subjected to phylogenetic analysis which showed genetic homology with previously reported isolates and fully justified the morphological characterization done before for these subjected isolates.

Present study revealed the current status of the major fungal diseases of strawberry in 12 strawberry producing districts across Punjab, Khyber Pakhtunkhwa and Islamabad. Results indicated the relative risk of any wide spread of the diseases in surveyed areas which can be avoided by applying the suitable management strategy. Study also highlighted that strawberry crop should be given attention as a profitable cash crop. Isolates were identified based on morphological and molecular characterization. Findings of this study related to polygenetic analysis suggested evolutionary relationship between the pathogenic isolates recovered from different districts of the study area. This molecular based information can be utilized by scientists on aspects of management and by others disciplines like breeders to develop resistant varieties against diseases.

147

LITERATURE CITED

Abdel-Wahab, H., N A. E. Aly and M. K. Ali. 2010. Improving detection means for

strawberry gray mold caused by Botrytis cinerea in Egypt. E. J. Phytopathol.,

38: 107-119.

Abera, A. F. Lemessa and G. Adugna. 2016. Prevalence and Intensity of Mango

(Mangifera indica L.) Anthracnose Caused by Colletotrichum spp. in South-

western of Ethiopia. Ethiop. J. Appl. Sci. Technol., 1: 1-10.

Afridi, G. S., M. Ishaq and S. Ahmad. 2009. Cost and Revenue Analysis of

Strawberry Production in the Subtropical Areas of NWFP, Pakistan. Pak. J.

L. Soc. Sci., 7: 59-65.

Andrew, M., T. L. Peever and B. M. Pryor. 2009. An expanded multilocus phylogeny

does not resolve morphological species within the small-spored Alternaria

species complex. Mycol., 101: 95-109.

Arroyo, F., Y. Llergo, A. Aguado and F. Romero. 2009. First report of Fusarium

wilt caused by Fusarium oxysporum on strawberry in Spain. Pl. Dis., 93: 323-

323.

Asad, K. 1997. Strawberry production & marketing potentials. Advisory leaflet of

Malakand Fruit and Vegetable Development Project (MFVDP), 30: 1-2.

Atkins, S. D. and I. M. Clark. 2004. Fungal molecular diagnostics: a mini review. J.

App. Gen., 45: 3-15.

Ayoubi, N. and M. J. Soleimani. 2016. Strawberry fruit rot caused by

Neopestalotiopsis iranensis sp. nov., and N. mesopotamica. Current

Microbio., 72: 329-336.

Babalar, M., M. Asghari, A. Talaei and A. Khosroshahi. 2007. Effect of pre and

148 148

postharvest salicylic acid treatment on ethylene production, fungal decay and

overall quality of selva strawberry fruit. Food Chem., 105: 449-453.

Beever, R. E and P. L. Weeds. 2004. Taxonomy and genetic variation of Botrytis and

Botryotinia. In: Y. Elad, B. Williamson, P. Tudzynski & N. Delen, (eds.),

Botrytis, Biology, Pathology and Controls. Kluwer Academic Publisher.

Netherland.

Bender, H. and H. Harold. 1934. English strawberry. A. J. Philo., 55: 71-74.

Booth, C. 1971. The Genus Fusarium. Common wealth. Common wealth

Mycological Institute. Kew, Surrey, UK., 1-237.

Booth, C. 1975. The present status of Fusarium taxonomy. Ann. Rev. Phytopathol.,

1: 83-93.

Booth, C. 1977. Fusarium. Laboratory guide to the identification of the major

species. Common wealth Mycological Institute. Kew, Surrey, UK., 1-58.

Boriss, H., H. Brunke and M. Kreith. 2006. Commodity Profile: Strawberries.

Agricultural marketing resource center. Agricultural Issues Center.

University of California, 3: 22-27.

Braun, P. G. and J. C. Sutton. 1987. Inoculum sources of Botrytis cinerea in fruit rot

of strawberry in Ontario. Can. J. Plant. Pathol., 9:1-5.

Braun, U., R. T. A. Cook, A. J. Inman and H. D. Shin. 2002. The taxonomy of the

powdery mildew fungi. The powdery mildews: A comprehensive treatise.

APS Press, St. Paul, MN. USA., 13-55.

Bulger, M. A., M. A. Ellis and L. V. Madden. 1987. Influence of temperature and

wetness duration on infection of strawberry flowers by Bortytis cinerea and

disease incidence of fruit originating from infected flowers. Phytopathol., 77:

149

1225-1230.

Burgess, L. W. 1981. General ecology of Fusaria. In: P. E. Nelson, T. A. Toussoun

and R. J. Cook, (eds.), Fusarium: Diseases, biology and taxonomy.

Pennsylvania, USA: Pennsylvania State University Press, 276-286.

Callejas, C. A. and R. G. Douglas. 2013. Fungal rhinosinusitis: what every allergist

should know. Clinic. Experiment. Aller., 8: 835-849.

Camili, E. C., M. Carbonari and N. L. Souza. 2002. Characterization of

Pestalotiopsis longisetula and its pathogenicity in strawberry. Phytopathol.,

28: 213-214.

Capote, N., A. M. Pastrana, A. Aguado and P. S. Torres. 2012. Molecular tools for

detection of plant pathogenic fungi and fungicide resistance. In: C. J.

Cumagun, (ed.), Agricultural and Biological Sciences. Plant Pathology.

Rijeka, InTech., 151-202.

Carr, A. C. and B. Frei. 1999. Toward a new recommended dietary allowance for

vitamin C based on antioxidant and health effects in humans. A. J. Clin.

Nutri., 69: 1086.

Cavanni, P., C. Monyuschi and I. Ponti. 1993. Alternariosi della fragola. L. Inf. Agr.,

26: 65-67.

Chardonnet, C. O., C. E. Sams, R. N. Trigiano and W. S. Conway. 2000. Variability

of three isolates of Botrytis cinerea affects the inhibitory effects of calcium

on this fungus. Phytopathol., 90: 769-774.

Chattaoui, M., M. C. Raya, M. Bouri, J. Moral, M. Perez‐Rodriguez, A. Trapero, M.

Msallem and A. Rhouma. 2016. Characterization of a Colletotrichum

population causing anthracnose disease on Olive in northern Tunisia. J. App.

150

Micro., 120: 1368-1381.

Chen, R. S., C. Chu., C.W. Cheng., W. Y. Chen and J. G. Tsay. 2008. Differentiation

of two Powdery mildews of sunflower (Helianthus annuus) by PCR mediated

method based on ITS sequences. Eur. J. Pl. Pathol., 121: 1-8.

Cho, J. H., J. C. Rupe., M. S. Cummings and E. E. Jr. Gbur. 2001. Isolation and

identification of Fusarium solani f. sp. glycines from soil on modified Nash

and Snyder’s medium. Pl. Dis., 85: 256-260.

Cho, J. T. and B. J. Moon. 1980. The occurrence of strawberry black leaf spot caused

by Alternaria alternata (Fr.) Kesissler in Korea. Kor. J. Pl. Prot., 19: 221-

226.

Cho, W. D. and H. D. Shin. 2004. List of plant diseases in Korea, Fourth edition.

The Korean Society of Plant Pathology. Suwon, Korea.

Chou, H. H., and W. S. Wu. 2002. Phylogenetic analysis of internal transcribed

spacer regions of the genus Alternaria, and the significance of filament-

beaked conidia. Myco. Res., 106: 164-169.

Cunningham, G. H. 1922. Some recent changes in the names of plant diseases. Part

II. Diseases of small fruits. Part III. Diseases of vegetables. N. Z. J. Agri., 24:

37- 45.

Curry, K. J., M. Abril, J. B. Avant and B. J. Smith. 2002. Strawberry anthracnose:

histopathology of Colletotrichum acutatum and C. fragariae. Phytopathol.,

92: 1055-1063.

Darrow, G. 1966. The Strawberry: history, breeding and physiology. Holt, Rinehart

and Winston, New York, Chicago, 447.

David, J. C. 1991. Alternaria bataticola. International Mycological Institute (IMI).

151

Descriptions of Fungi and Bacteria No. 1071. Mycopath., 116: 45-46.

Davies, N. M. 2010. Potential impact of strawberries on human health: a review of

the science. Crit. Rev. F. Sci. Nut., 44: 1-17.

Davis, R. D., R. M. Boland and C. J. Howitt. 1992. Colony descriptions, conidium

morphology and the effect of temperature on colony growth of

Colletotrichum gloeosporioides isolated from Stylosanfhes spp. growing in

several countries. Mycol. Res., 96: 128-134.

Dean, R., J. A. L. Van Kan, Z. A. Pretorius, K. E. Hammond-Kosack and A. Di-

Pietro. 2012. The top 10 fungal pathogens in molecular plant pathology. Mol.

Pl. Pathol., 13: 414-430.

Dean, R., J. A. L. Van-Kan, Z. A. Pretorius, K. E. Hammond‐Kosack, A. Di-Pietro,

P. D. Spanu, J. J. Rudd, M. Dickman, R. Kahmann and J. Ellis. 2012. The

Top 10 fungal pathogens in molecular plant pathology. Mol. Pl. Pathol., 13:

414-430.

Debode, J., W. Hemelrijck, S. Baeyen, P. Creemers, K. Heungens and M. Maes.

2009. Quantitative detection and monitoring of Colletotrichum acutatum in

strawberry leaves using real-time PCR. Pl. Pathol., 58: 504-514.

Denoyes, B. and A. Baudry. 1995. Species identification and pathogenicity study of

French Colletotrichum strains isolated from strawberry using morphological

and cultural characteristics. Phytopath., 85: 53-57.

Denoyes-Rothan, B., G. Guérin, E. Lerceteau-Köhler and G. Risser. 2005.

Inheritance of resistance to Colletotrichum acutatum in Fragaria× ananassa.

Phytopathol., 95: 405-412

Desjardins, A. E. 2006. Fusarium mycotoxins: chemistry, genetics and biology.

152

The American Phytopathological Society. St. Paul, Minnesota. APS Press,

USA., 184-185.

Diekmann, M., E. A. Frison and T. Putter. 1994. FAO/IPGRI Technical Guidelines

for the Safe Movement of Small Fruit Germplasm. FAO. International Plant

Genetic Resources Institute, Rome.

Dignand, M. 2004. Strawberry weed control guide. Agfact H3.3.4, second edition.

The State of New South Wales, NSW Agriculture.

Diolez, A., F. Marches, D. Fortini and Y. Brygoo. 1995. Boty, a long-terminal-repeat

retroelement in the phytopathogenic fungus Botrytis cinerea. App. Environ.

Micro., 61, 103-108.

Domsch, K. H., W. Gams and A. Traute-Heidi. 1980. Fusarium. Compendium of

Soil Fungi. London Academic Press, 333-337.

Duchesne, A. N. 1766. Histoire naturelle des fraisiers. Didot le jeune, Paris, France.

http://reader.digitale-sammlungen.de/resolve/display/bsb10301393.html.

Dufresne, M., A. Hua-Van, H. Abd-el-Wahab, H., S. M. Ben. C. Vasnier, L. Teysset,

G. H. J. Kema and M. J. Daboussi. 2007. Transposition of a fungal MITE

through the action of a Tc1-like transposase. Genet., 175: 441-445.

Elad, Y., B. Williamson, P. Tudzynsky and N. Delen, 2007, Botrytis: Biology,

Pathology and Control. Kluwer Academic Publisher. Netherland.

El-Gali, Z. I. 2014. Alternaria alternata isolated from lemons (Citrus lemon) in

Libya. Euro. J. Acad. Essay., 1: 20-23.

Ellis, M. B. 1971. Dematiaceous Hyphomycetes: Commonwealth Mycological Ins-

titute. Kew, UK.

Environmental working group. 2013. EWG’s 2013 Shopper’s guide to pesticides in

153

produce. Website http://www.ewg.org/foodnews/summary. php (accessed

as on 25 December 2017).

Eriksson, T., M. J. Donoghue and M. S. Hibbs. 1998. Phylogenetic analysis of

Potentilla using DNA sequences of nuclear ribosomal internal transcribed

spacers (ITS), and implications for the classification of Rosoideae

(Rosaceae). Pl. Sys. Evol., 211: 155-179.

Fang, X., D. Phillips, H. Li, K. Sivasithamparam and M. J. Barbetti. 2011.

Comparisons of virulence of pathogens associated with crown and root

diseases of strawberry in Western Australia with special reference to the

effect of temperature. Sci. Hort., 131: 39-48.

FAO, 2016. http://faostat.fao.org. Consulted as on December, 2016.

Freeman, S., D. Minz, I. Kolesnik, O. Barbul, A. Zveibil, M. Maymon, Y. Nitzani

and B. Hannum. 2004. Potential impact of strawberries on human health: A

review of the science. F. Sci. Nutr., 44: 1-17.

Garrido, C., M. Carbú, F. Fernández-Acero, G. J. Budge, I. Vallejo, A. Colyer and

J. M. Cantoral. 2008. Isolation and pathogenicity of Colletotrichum spp.

causing anthracnose of strawberry in south west Spain. Euro. J. Pl. Pathol.,

120: 409-415.

Geiser, D. M., M. Jiménez-Gasco, M. Del, S. Kang, I. Makalowska, N.

Veeraraghavan, T. J. Ward, N. Zhang, G. Kuldau and K. AO’Donnell. 2004.

FUSARIUM-ID v. 1.0: a DNA sequence database for identifying Fusarium.

Euro. J. Pl. Pathol., 110: 473-479.

Giampieri, F., S. Tulipani, J. M. Alverez-Suarez, J. L. Quiles, B. Mezzetti and M.

Battino. 2012. The strawberry: Composition, nutritional quality and impact

154

on human health. Nutr., 28: 9-19.

Giraud, T., D. Fortini, C. Levis, C. Lamarque, P. Leroux, K. Buglio and Y. Brygoo.

1999. Two sibling species of the Botrytis cinerea complex, transposa and

vacuma, are found in sympatry on numerous host plants. Phytopathol., 89:

967-973.

Glass, N. L., and G. C. Donaldson. 1995. Development of Primer Sets Designed for

Use with the PCR to Amplify Conserved Genes from Filamentous

Ascomycetes. App. Env. Microbio., 61: 1323-1330.

Golzar, H., D. Phillips and S. Mack. 2007. Occurrence of strawberry root and crown

rot in Western Australia. Austral. Pl. Dis. No., 2: 145-147.

Guidarelli M., F. Carbone, F. Mourgues, G. Perrotta, C. Rosati and P. Bertolini.

2011. Colletotrichum acutatum interactions with unripe and ripe strawberry

fruits and differential responses at histological and transcriptional levels. Pl.

Pathol., 60: 685-697.

Gunnell, P. S. and W. D. Gubler. 1992. Taxonomy and morphology of

Colletotrichum species pathogenic to strawberry. Mycol., 84: 157-165.

Hafizi, R., B. Salleh and Z. Latiffah. 2013. Morphological and Molecular

Characterization of F. Solani and F. Oxysporum Associated with Crown

Disease of Oil Palm. Bra. J. Microbiol., 44: 959-968.

Hancock, J. F. 1999. Strawberries. CAB International, Wallingford, UK.

Hennebert, G. L. 1973. Botrytis and botrytis-like genera. Persoon., 7:183-204.

Hinrikson, H. P., S. F. Hurst, L. De-aguirre and C. J. Morrison. 2005. Molecular

methods for the identification of Aspergillus species. Med. Mycol. Suppl.,

43: 129-137.

155

Hong, C. X., T. J. Michailides and B. A. Holtz. 1998. Effects of wounding, inoculum

density, and biological control agents on postharvest brown rot of stone

fruits. Pl. Dis., 82: 1210-1216.

Horton, T. R. and T. D. Burns. 2001. The molecular revolution in ectomycorrhizal

ecology: peeking into the black box. Mol. Ecol., 10: 1855-1871.

Howard, C. M. 1973. A strawberry fruit rot caused by Pestalotia longisetula.

Phytopathol., 63: 862-863.

Hummer K. E. and J. Hancock. 2009. Strawberry Genomics: Botanical History,

Cultivation, Traditional Breeding, and New Technologies. In: K. M. Folta,

S. E. Gardiner, (eds.), Genetics and Genomics of Rosaceae. Plant Genetics

and Genomics: Crops and Models. Springer, New York. 6: 413-435.

Hutson, R. A. and J. W. Mansfield. 1980. A genetical approach to the analysis of

mechanisms of pathogenicity in Botrytis/Vicia faba interaction. Physiolo. Pl.

Pathol., 17: 309-317.

Hyde, K. D., L. Cai, E. H. C. Mckenzie, Y.L. Yang, J. Z. Zhang and H. Prihastuti.

2009. Colletotrichum: a catalogue of confusion. Fung. Div., 39, 1-17

Hyde, K. D., R. H. Nilsson, S. A. Alias, H. A. Ariyawansa, J. E. Blair and L. Cai.

2014. One stop shop: backbones trees for important phytopathogenic genera.

Fung. Div., 67: 21-125.

Jabbar, A., A. R. East and C. Jenkins. 2010. Quality variability of strawberries in the

southern north island of New Zealand. Acta. Hort., 880: 447-453.

Jarvis, W. R. 1977. Botryotinia and Botrytis species: Taxonomy, physiology and

pathogenicitiy. Monograph no. 15, Canada Department of Agriculture,

Research Branch, Ottawa, Canada.

156

Josuttis, M., C. Carlen, P. Crespo, R. Nestby, T. B. Toldam-Andersen, H. Dietrich

and E. A. Krüger. 2012. Comparison of bioactive compounds of strawberry

fruit from Europe affected by genotype and latitude. J. Ber. Res., 2: 73-95.

Kang, S., J. E. Ayers, E. D. De-wolf, D. M. Geiser, G. Kuldau, G. W. Moorman, E.

Mullins, W. Uddin, J. C. Correll, G. Deckert, Y. H. Lee, Y. W. Lee, F. N.

Martin and K. Subbarao. 2002. The internet based fungal pathogen database:

a proposed model. Phytopath., 92: 232-236.

Keissler, K. V. 1912. Zur kenntnis der pilzflora krains. Beihefte zum Botanischen

Zentralblatt, 29: 395-440.

Kerssies A., A. Z. Bosker-Van, C. Wagemakers and J. Van-Kan. 1997. Variation in

pathogenicity and DNA polymorphism among Botrytis cinerea isolates

sampled inside and outside a glasshouse. Pl. Dis., 81: 781-786.

Khafagi, Y. S. 1982. Studies on fruit rot diseases of strawberry in ARE. M.Sc.

Thesis, Fac. of Agric., Moshtohor, Zagazig Univ. Benha Sector. 134.

Khan, A. D. and G. Nabi. 2016. Strawberry cultivation in Charsadda. A District of

CmpII in NWFP. Agriculture Research Tarnab Peshawar. Adv. Pl. Agric.

Res., 4: 298-300.

Khanzada, M. A., A. M. Lodhi and S. Shahzad. 2004. Pathogenicity of

Lasiodiplodia theobromae and Fusarium solani on Mango. Pak. J. Bot., 36:

181-189.

Kim, C., H. Seo, W. Cho and S. Kim. 1982. Studies on varietal resistance and

chemical control to the wilt of strawberry caused by Fusarium oxysporum.

Kor. J. Pl. Protect., 21: 61-67.

Koike, S., S. Kirkpatrick and T. Gordon. 2009. Fusarium wilt of strawberry caused

157

by Fusarium oxysporum in California. Pl. Dis., 93: 1077.

Kolattukudy, P. E. and D. L. Gamble. 1995. Nectria haematococca: pathogenesis

and host specificity in plant diseases. In: K. Kohmoto, U. S. Singh & R. P.

Singh, (eds.), Plant Pathogenic Fungi and Nematodes, Pathogenesis and Host

Specificity. Pergamon, Eukaryotes. UK., 2: 83-102.

Koley, S. and S. S. Mahapatra. 2015. Evaluation of Culture Media for Growth

Characteristics of Alternaria solani, Causing Early Blight of Tomato. J. Plant

Pathol. Microbiol., S1: 005.

Kovach, J., R. Petzoldt and G. E. Harman. 2000. Use of honey bees and bumble bees

to disseminate Trichoderma harzianum to strawberries for Botrytis control.

Bio. Cont., 18: 235-242.

Langford, G. and M. Walter. 2005. Present status of strawberry fruit rot diseases in

New Zealand. N. Z. Pl. Prot., 58: 74-79.

Larena, I., R. Torres, A. De Cal, M. Liñan, P. Melgarejo and P. Domenichini. 2005.

Biological control of postharvest brown rot (Monilinia spp.) of peaches by

field applications of Epicoccum nigrum. Biolog. Cont., 32: 305-310.

Larone, D. H. 2011. Thermally Monomorphic Moulds. Medically Important Fungi:

A Guide to Identification (Print). Washington. ASM Press, 305.

Laurence, M. H., C. Howard, B. A. Summerell and E. C. Y. Liew. 2016.

Identification of Fusarium solani f. sp. phalaenopsis in Australia. Aus. Pl.

Dis. No., 11: 15.

Lawrence, D. P., M. S. Park and B. M. Pryor. 2012. Nimbya and Embellisia revisited,

with nov. comb toxins on the basis of varation in internal transcribed spacers

of ribosomal DNA. Curr. Gen., 28: 491-498.

158

Leandro, L. F. S., M. L. Gleason, F. W. Nutter, S. N. Wegulo and P. M. Dixon. 2001.

Germination and sporulation of Colletotrichum acutatum on symptomless

strawberry leaves. Phytopath., 91: 659-664.

Legard, D. E. and C. K. Chandler. 2000. Evaluation of fungicides to control Botrytis

fruit rot of strawberry. Fungic. Nemati. Test., 55: 124-125.

Legard, D. E., C. L. Xiao, J. C. Mertely and C. K. Chandler. 2000. Effects of plant

spacing and cultivar on incidence of Botrytis fruit rot in annual strawberry.

Pl. Dis., 84, 531-538.

Leslie, J. F. and B. A. Summerell. 2006. The Fusarium Laboratory Manual.

Blackwell Publishing, London.

Li, X., D. Fernández-Ortuño, W. Chai, F. Wang and G. Schnabel. 2012.

Identification and prevalence of Botrytis spp. from blackberry and strawberry

fields of the Carolinas. Pl. Dis., 96: 1634-1637.

Lievens, B., P. M. Houterman and M. Rep. 2009. Effector gene screening allows

unambiguous identification of Fusarium oxysporum f. sp. lycopersici races

and discrimination from other formae speciales. FEMS. Micro. Letters, 300:

201-215.

Linnaeus, C. 1738. Classes plantarum. LeidenC. Wishoff. 66.

Linnaeus, C. 1753. Species Plantarum Exhibitentes Plantas Rite Cognitas ad Genera

Relatas, cum Differentiis Specificis, Nominibus Trivialibus, Synonymis

Selectis, et Locis Natalibus, Secundum Systema Sexuale Digestas.

Stockholm, Sweden. Publication No. 140 and 142. The Ray Society, London,

UK.

Liston, A., R. Cronn and A. Tia-Lynn. 2014. Fragaria: A genus with deep historical

159

roots and ripe for evolutionary and ecological insights. Am. J. Bot., 101:

1686-1699.

Maas, J. L. 1998. Compendium of Strawberry Diseases, 2nd edn. APS Press, St.

Paul, Minnesota, 38-39.

Mehmood, N., A. Riaz, F. Naz, I. Hassan, S. Ghuffar, A. Sattar, S. Zafar, and S.

Anwaar. 2018a. First report of pre-harvest fruit rot of strawberry caused by

Botrytis cinerea in Khyber Pakhtunkhwa Province and Islamabad (Pakistan).

Pl. Dis., 102:450.

Mehmood, N., A. Riaz, F. Naz, I. Hassan, N. Jaabeen, S. Anwaar, H. Rosli, and M.

L. Gleason. 2018b. First report of strawberry leaf spot caused by Alternaria

alternata in Pakistan. Pl. Dis., 102: 820.

Mehmood, N., A. Riaz, N. Jabeen, S. Anwaar, S. Z. Hussain, M. F. Abbas, X. Zhang,

H. Rosli and M. L. Gleason. 2017. First Report of Fusarium solani Causing

Fruit Rot of Strawberry in Pakistan. Pl. Dis., 101: 1681.

Mertely, J. C. and D. E. Legard. 2000. A freezing technique to detect latent infections

of Colletotrichum spp. on strawberry. (Abstr.) Phytopathol., 90: S53.

Michielse, C. B. and M. Rep. 2009. Pathogen profile update: Fusarium oxysporum.

Mol. Pl. Pathol., 10: 311-324.

Mirkova, E. and P. Konstantinova. 2003. First report of Alternaria leaf spot on

gerbera (Gerbera jamesonii H. Bolux ex J. D. Hook) in Bulgaria. J.

Phytopathol., 151: 323-328.

Nagrale, D.T., L. Sharma, S. Kumar and S. P. Gawande. 2016. Recent Diagnostics

and Detection Tools: Implications for Plant Pathogenic Alternaria and Their

Disease Management. In: P. Kumar. V. Gupta, A. Tiwari and M. Kamle.

160

(eds.), Current Trends in Plant Disease Diagnostics and Management

Practices. Fungal Biology. Springer.

Nagrale, D. T., A. P. Gaikwad, S. Goswami and L. Sharma. 2012. Fungicidal

management of Alternaria alternata (Fr.) Keissler causing blight of gerbera

(Gerbera jamesonii H. Bolus ex J.D. Hook). J. Appl. Nat. Sci., 4:220-227.

Nees, V-E. C. G. 1817. Das system der pilze und schwämme. Stahelfchen. 2: 1-420.

Nelson, P. E, T. A. Toussoun and W. F. O. Marasas. 1983. Fusarium species: An

illustrated manual for identification. Pennsylvania, USA: Pennsylvania State

University Press.

Nielsen, K., A. F. Justesen, D. F. Jensen and D. S. Yohalem. 2001. Universally

primed polymerase chain reaction alleles and ITS polymorphisms distinguish

two sub-groups in Botrytis aclada distinct from B. byssoidea. Phytopathol.,

91: 527-533.

O’Donnell, K., H. C. Kistler, E. Cigelnik and R. C. Ploetz. 1998. Multiple

evolutionary origins of the fungus causing Panama disease of banana:

Concordant evidence from nuclear and mitochondrial gene genealogies.

Proceedings of the N. A. S. of the USA., 95: 2044-2049.

Palacios, C., K. Joshipura and W. Willett. 2009. Nutrition and health: guidelines for

dental practitioners. Oral Dis., 15: 369-381.

Parveen, S., A. Din, M. Asghar, M. R. Khan and M. Nadeem. 2012. Value addition

in strawberry: A tool for long term storage. A review. Pak. J. F. Sci., 22:

206-208.

Pastrana A. M., N. Capote, B. De-los-Santos, F. Romero and M. J. Basallote-Ureba.

2014. First report of Fusarium solani causing crown and root rot on

161

strawberry crops in southwestern Spain. Pl. Dis., 98: 161.

Peever, T. L., A. Ibanez, K. Akimitsu and L. W. Timmer. 2002. Worldwide

phylogeography of the citrus brown spot pathogen, Alternaria alternata.

Phytopath., 92:794-802.

Perkins, D. D. 1962. Preservation of Neurospora stock cultures with anhydrous silica

gel. Can. J. Microbiol., 8: 591.

Potter, D., T. Eriksson, R. C. Evans RC, S. Oh, J. E. Smedmark, D. R. Morgan, M.

Kerr, K. R. Robertson, M. Arsenault, T. A. Dickinson and C. S. Campbell.

2007. Phylogeny and classification of Rosaceae. Pl. Syst. Evol., 266: 5-43

Prusky, D. A. and D. Lichter. 2007. Activation of quiescent infections by postharvest

pathogens during transition from the biotrophic to the necrotrophic stage.

FEMS. Microbiol. Lett., 268: 1-8.

Pryor, B. M. and R. L. Gilbertson. 2001. A PCR-based assay for detection of

Alternaria radicina on carrot seed. Pl. Dis., 85: 18-23.

Pryor, B. M. and D. M. Bigelow. 2003. Molecular phylogenetic relationships

amongst molecular characterization of Embellisia and Nimbya spp. and their

relationship to Alternaria, Ulocladium and Stemphylium. Mycol., 95: 1141-

1154.

Pryor, B. M. and T. J. Michailides, T.J. 2002. Morphological, pathogenic, and

molecular characterization of Alternaria isolates associated with Alternaria

late blight of pistachio. Phytopathol., 92: 406-416.

Quimio, T. H. 1976. Pathogenicity and cultural characteristics of Fusarium solani

from papaya, Kalikasan. Phil. J. Biol., 5: 241-250.

Rigotti, S., K. Gindro, H. Richter and O. Viret. 2002. Characterization of molecular

162

markers for specific and sensitive detection of Botrytis cinerea Pers. Fr. in

strawberry using PCR. FEMS Microbiol. Lett., 209: 169-174.

Romandini, S., L. Mazzoni, F. Fiampieri, S. Tulipani, M. Gasparrini, N.

Locorotondo, B. Mezzetti and S. Bompadre. 2013. Effects of an acute

strawberry (Fragaria × ananassa) consumption on the plasma antioxidant

status of healthy subjects. J. Ber. Res., 3: 169-179.

Rotem, J. 1994. The genus Alternaria: biology, epidemiology, and pathogenicity.

American Phytopathological Society.

Salami, P., H. Ahmadi and A. Keyhani. 2010. Estimating the equivalent energy for

single super phosphate production in Iran. J. Sc. Rev., 2: 1-10.

Sara, K., K. M. Qureshi, I. A. Hafiz, K. S. Khan and U. S. Qureshi. 2013. Effect of

organic amendments on vegetative growth, fruit and yield quality of

strawberry. Pak. J. Agric. Res., 26: 104-112.

Sayers, W. 2009. The Etymology of Strawberry. Moderna sprak. 2 : 15-17.

Schwab, W., J. G. Schaart and C. Rosati. 2009. Functional molecular biology

research in Fragaria. Genetics and genomics of Rosaceae. Springer, 457-486.

Seifert, K. A. 2001. Fusarium and anamorph generic concepts. In Fusarium: Paul E.

Nelson Memorial Symposium. APS., St. Paul, MN. USA.

Shitole, D. M., U. R. Patil and N. B. Pawar. 2000. In vitro evaluation of chemicals

and antibiotics against important fruit rotting of strawberry. J. Maharash.

Agric. Univ., 25: 179-181.

Siefkes-Boer, H., K. Boyd-wilson, M. Petley, M. Walter and S. Zydenbos. 2009.

Influence of cold-storage temperatures on strawberry leak caused by

Rhizopus spp. N. Z. Pl. Prot., 62: 243-249.

163

Simmonds, J. H. 1965. A study of the species of Colletotrichum causing ripe fruit

rots in Queensland. Q. J. Agr. Sci., 22 :437-459.

Simmons, E. G. 1997. Alternaria themes and variations. Mycotax., 65:1-91.

Simmons, E. G. 1999. Alternaria themes and variations (236-243): Host-specific

toxin producers. Mycotax., 70:325-369.

Simmons, E. G. 2007. Alternaria: an identification manual: fully illustrated and with

catalogue raisonné 1796-2007. CBS Fungal Biodiversity Centre, Utrecht.

The Netherlands.

Simmons, E. G. and R. G Roberts. 1993. Morphology and toxigenicity of Alternaria

associated with black spot disease of Japanese pear. Mycotax., 48: 109-140.

Singh, R. P., J. P. T. Valkonen, S. M. Gray, N. Boonham, R. A. C. Jones, C.

Kerlanand and J. Schubert. 2008. The naming of Potato virus Y strains

infecting potato. Arch. Virol., 153: 1-13.

Skovgaard, K., S. Rosendahl, K. O'Donnell and H. I. Nirenberg. 2003. Fusarium

commune is a new species identified by morphological and molecular

phylogenetic data. Mycol., 95:630-636.

Sleesman, J. P. and C. Leben. 1978. Canker fungus of aspen. Phytopath., 46: 34-36.

Smith, B. J. 2008. Epidemiology and Pathology of Strawberry Anthracnose: A North

American Perspective. Hort. Sci., 43:69-73.

Smith, B. J. and L. L. Black. 1990. Morphological, cultural, and pathogenic variation

among Colletotrichum species isolated from strawberry. Pl. Dis., 74: 69-76.

Smith, C. 1993. Long-term preservation of test strains (fungus). Int. Biodeterior.

Biodegrad., 31, 227-230.

Staats, M., V. Baarlen, and J. A. L. Van-Kan. 2005. Molecular phylogeny of the

164

plant pathogenic genus Botrytis and the evolution of host specificity. Mol.

Biol. Evol., 22: 333-346.

Stewart, J. E., K. A. Thomas, C. B. Lawrence, H. Dang, B. M. Pryor, L. M. Timmer

and T. L. Peever. 2013. Signatures of recombination in clonal lineages of the

citrus brown spot pathogen, Alternaria alternata sensu lato. Phytopath., 103:

741-749.

Stewart, P. J. 2011. Fragaria history and breeding. In K. M. Folta and Kole [eds.],

Genetics, genomics and breeding of berries. Science Publishers, Enfield,

New Hampshire, USA., 114-137.

Stromeng, G. M., L. G. Hjeljord and A. Stensvand. 2009. Relative contribution of

various sources of Botrytis cinerea inoculum in strawberry fields in Norway.

Pl. Dis., 93: 1305-1310.

Suarez, M. B., K. Walsh, N. Boonham, T. O’Neill, S. Pearson and I. Barker. 2005.

Development of RT PCR (TaqMan®) assays for the detection and quantification

of Botrytis cinerea in planta. Pl. Physio. Biochemi., 43: 890-899.

Summerbell, R. 2003. Ascomycetes: Aspergillus, Fusarium, Sporothrix, Piedraia,

and their Relatives. In: H. Howard & H. Dexter, (eds.), Pathogenic Fungi in

Humans and Animals, New York. Marcel Dekker, 400-425.

Summerell B. A., B. Salleh and J. F. Leslie. 2003. A utilitarian approach to

identifying Fusarium species. Pl. Dis., 87: 117-128.

Sutton, B. C. 1992. The genus Glomerella and its anamorph Colletotrichum. In: J.

A. Bailey and M. J. Jeger (eds.), Colletotrichum: Biology, Pathology and

Control. Wallingford, UK., CABI., 1-26.

Tadrous, A. Z. 1991. Pathological studies on strawberry fruit rots. M.Sc. Thesis,

165

Fac. Agric., Suez Canal Univ., 116.

Tamura, K. and M. Nei. 1993. Estimation of the number of nucleotide substitutions

in the control region of mitochondrial DNA in humans and chimpanzees.

Mol. Biol. Evo., 10: 512-526.

Tao, S., S. Zhang, R. Tso, M. T. Charles, R. Yang and S. Khanizadeh. 2010. In vitro

antifungal activity and mode of action of selected polyphenolic antioxidants

on Botrytis cinerea. Arch. Phytopathol. Pl. Prot., 43: 1564-1578.

Tarek, S. S. 2004. Integrated control for minimizing postharvest diseases of

strawberry. MSc. Thesis, Fac. of Agric., Ain Shams Univ., 165.

Terry, L. A. and D. C. Joyce. 2000. Suppression of grey mold on strawberry fruit

with the chemical plant activator acibenzolar. Pest Manag. Sci., 56: 989-992.

Than, P. P., R. Jeewon, K. D. Hyde, S. Pongsupasamit, O. Mongkolporn, and P. W.

J. Taylor. 2008. Characterization and pathogenicity of Colletotrichum

species associated with anthracnose on chilli (Capsicum spp.) in Thailand.

Pl. Pathol., 57: 562-572.

Thomma, B. P. 2003. Alternaria spp. from general saprophyte to specific parasite.

Mol. Pl. Path., 4: 225-236.

Timudo-Torrevilla, O. E., K. R. Everett, N. W. Waipara, W. Boyd, P. Weeds, G. I.

Langford and M. Walter. 2005. Present status of strawberry fruit rot diseases

in New Zealand. N. Z. Pl. Prot., 58:74-79.

Tuite, J. 1969. Plant Pathological methods, Fungi and Bacteria. Burgess Publ. Co.

Minneapolis, Minnesota. USA. 239.

Turenne, C. Y., S. E. Sanche, D. J. Hoban, J. A. Karlowsky and A. M. Kabani. 2009.

Rapid identification of fungi by using the ITS2 genetic region and an

166

automated fluorescent capillary electrophoresis system. J. Clin. Microbiol.,

37: 1846-1851.

Waals, J. E., V. D. Korsten and T. A. S. Aveling . 2001. A review of early blight of

potato. Af.. Pl. Prot., 7: 91-102.

Wada, H., P. Cavanni, R. Bugiani, M. Kodama, H. Otani and K. Kohmoto. 1996.

Occurrence of the strawberry pathotype of Alternaria alternate in Italy. Pl.

Dis., 80: 372-374.

Watanabe, T. 2011. Anamorphic Fungi. Pictorial Atlas of Soil and Seed Fungi (3rd

ed.). Boca Raton: CRC Press, 185.

Watanabe, Y. and M. Umekawa. 1977. On a new black leaf spot of strawberry.

(Abstr. In Japenese). Ann. Phypathol. Soc. Jpn., 44:463.

White, T. J., T. Bruns, S. Lee and J. Taylor. 1990. Amplification and direct

sequencing of fungal ribosomal RNA genes for phylogenetics. PCR

protocols. Academic Press. San Diego, CA. USA., 315-322.

Williamson, B. B., P. Tudzynski and J. A. L. Van-kan. 2007. Botrytis cinerea the

cause of grey mold disease. Mol. Pl. Pathol., 8: 561-580.

Wing, K. B., M. P. Pritts and W. F. Wilcox. 1995. Field resistance of 20 strawberry

cultivars to black root rot. F. Var. J., 49: 94-98.

Woudenberg, J. H. C., J. Z. Groenewald, M. Binder and P. W. Crous. 2013.

Alternaria redefined. Stud. Mycol., 75: 171-212.

Wright, D. G. and J. B. Heaton. 1991. Susceptibility of celery cultivars to leaf curl

caused by Colletotrichum acutatum. Aust. Pl. Pathol., 20: 155-156.

Wright, W. R. and B. A. Billeter. 1975. Marketing losses in selected fruits and

vegetables at wholesale, retail, and consumer levels in the Chicago area.

167

USDA Marketing Research Report No., 1017.

Xie, L., J. Zhang, Y. Wan and H. Dong-wei. 2010. Identification of Colletotrichum

spp. Isolated from Strawberry in Zhejiang Province and Shanghai City,

China. J. Zhejiang Uni. Sci. B., 11: 61-70.

Yohalem, D. S., K. Neilson and M. Nicolaisen. 2003. Taxonomic and nomenclatural

clarification of the onion neck rotting Botrytis species. Mycotax., 85: 175-

182.

Zaccardelli, M., S. Vitale, L. Luongo, M. Merighi and L. Corazza. 2008.

Morphological and Molecular Characterization of Fusarium solani Isolates.

J. Phytopath., 156: 534-541.

Zakaria, M. and J. A Bailey. 2000. Morphology and cultural variation among

Colletotrichum isolates obtained from tropical forest nurseries. J. Trop. F.

Sci., 1-20.

Zakaria, M., J. Bailey and C. Nash, C. 2003. Molecular diversity of Colletotrichum

isolates from tropical forest tree species and their relationship with other

known Colletotrichum species. J. Trop. F. Sci., 176-189.

Zhang, H., L. Wang, Y. Dong, S. Jiang, J. Cao and R. Meng. 2007. Postharvest

biological control of gray mold decay of strawberry with Rhodotorula

glutinis. Biol. Cont., 40: 287-292.

Zhang, Y., N. P. Seeram, R. Lee, L. Feng and D. Heber. 2008. Isolation and

identification of strawberry phenolics with antioxidant and human cancer cell

anti-proliferative properties. J. Agri. F. Chem., 56: 670-675.

Zhao, X., W. Zhen, Y. Qi, X. Liu and B. Yin. 2009. Coordinated effects of root

autotoxic substances and Fusarium oxysporum Schl. f. sp. fragariae on the

168

growth and replant disease of strawberry. Front. Agri. China. 3: 34-39.

Zheng, J. and J. C. Sutton. 1994. Inoculum concentration, leaf age, wetness duration,

and temperature in relation to infection of strawberry leave by Diplocarpon

earlianum. Can. J. Pl. Pathol., 16: 177-186.

Zivkovic, S., S. Stojanovic, Z. Ivanovi, C, V. Gavrilovic, T. Popovic and J. Balaž.

2010. Screening of antagonistic activity of microorganisms against

Colletotrichum acutatum and Colletotrichum gloeosporioides. Arch. Biol.

Sci., 62: 611-623.