DOCSLIB.ORG

Aromatase (Cyp19) Expression Is Up-Regulated by Targeted Disruption of Dax1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Aromatase (Cyp19) Expression Is Up-Regulated by Targeted Disruption of Dax1 Aromatase (Cyp19) expression is up-regulated by targeted disruption of Dax1 Zhen J. Wang*, Baxter Jeffs*, Masafumi Ito*, John C. Achermann*, Richard N. Yu*, Dale B. Hales†, and J. Larry Jameson*‡ *Division of Endocrinology, Metabolism, and Molecular Medicine, Northwestern University Medical School, Chicago, IL 60611; and †University of Illinois, Chicago, IL 60612 Edited by Jean D. Wilson, University of Texas Southwestern Medical Center, Dallas, TX, and approved May 14, 2001 (received for review November 14, 2000) DAX-1 [dosage-sensitive sex reversal, adrenal hypoplasia con- nuclear receptors (6, 7). Consistent with this idea, DAX-1 genita (AHC) critical region on the X chromosome, gene 1] is an interacts directly with SF-1 and inhibits SF-1-mediated transac- orphan nuclear receptor that represses transcription by steroido- tivation (15, 16). genic factor-1 (SF-1), a factor that regulates expression of multiple Testicular Leydig cells express both Dax1 and Sf1 (7, 17) and steroidogenic enzymes and other genes involved in reproduction. constitute the major site of testosterone production in males Mutations in the human DAX1 gene (also known as AHC) cause the (17). Testosterone biosynthesis requires five steroidogenic pro- X-linked syndrome AHC, a disorder that is associated with hypogo- teins: steroidogenic acute regulatory protein (StAR), cholesterol nadotropic hypogonadism also. Characterization of Dax1-deficient side-chain cleavage enzyme (CYP11A), 3␤-hydroxysteroid de- male mice revealed primary testicular defects that included Leydig hydrogenase (3␤-HSD type II), 17␣-hydroxylase (CYP17), and cell hyperplasia (LCH) and progressive degeneration of the germi- 17␤-hydroxysteroid dehydrogenase (17␤-HSD type III). Testos- nal epithelium, leading to infertility. In this study, we investigated terone can be converted to estradiol by means of the nonrevers- the effect of Dax1 disruption on the expression profile of various ible action of aromatase (CYP19; ref. 17). Therefore, the relative steroidogenic enzyme genes in Leydig cells isolated from Dax1- amount of testosterone and estrogen in males is determined deficient male mice. Expression of the aromatase (Cyp19) gene, largely by the level and activity of aromatase in the testis and which encodes the enzyme that converts testosterone to estradiol, other peripheral tissues such as adipose tissue. was increased significantly in the Leydig cells isolated from mutant Dax1-deficient male mice are infertile and have small testes mice, whereas the expression of other proteins (e.g., StAR and (18). Serum levels of testosterone, gonadotropins, and adrenal Cyp11a) was not altered. In in vitro transfection studies, DAX-1 steroids are normal but have been examined only in a limited repressed the SF-1-mediated transactivation of the Cyp19 pro- number of physiologic states (18). In addition to the progressive moter but did not inhibit the StAR or Cyp11a promoters. Elevated degeneration of seminiferous tubules, the Dax1-deficient mice Cyp19 expression was accompanied by increased intratesticular exhibit Leydig cell hyperplasia (LCH; ref. 18). Although DAX-1 levels of estradiol. Administration of tamoxifen, a selective estro- has been shown to repress SF-1-mediated actions in vitro (15, 16), gen-receptor modulator, restored fertility to the Dax1-deficient its functional role in vivo remains poorly understood. In this male mice and partially corrected LCH, suggesting that estrogen report, we examined the expression level of steroidogenic en- excess contributes to LCH and infertility. Based on these in vivo and zyme genes in Leydig cells purified from the testes of wild-type in vitro analyses, aromatase seems to be a physiologic target of and Dax1-deficient mice. These analyses indicate that Dax-1 Dax-1 in Leydig cells, and increased Cyp19 expression may account, represses only a subset of SF-1-regulated genes, and that Cyp19 in part, for the infertility and LCH in Dax1-deficient mice. is a physiologic target gene for Dax-1 in Leydig cells. The overexpression of Cyp19 may account, in part, for the infertility AX-1 [dosage-sensitive sex reversal, adrenal hypoplasia and LCH that occurs in Dax1-deficient mice, and potentially in Dcongenita (AHC) critical region on the X chromosome, humans with AHC. gene 1] is an orphan member of the nuclear hormone receptor superfamily of transcription factors (1–3). Duplication of the Materials and Methods region on the X chromosome containing the DAX1 gene is Animals. The generation of Dax1 (Ahch)-deficient males has been associated with male-to-female sex reversal in XY individuals described (18). All mice were housed under controlled condi- (1). Loss-of-function mutations in DAX1 are responsible for tions of temperature (21–24°C) and light (12-h light͞dark cycle; X-linked AHC, a disorder characterized by primary adrenal 7 a.m.–7 p.m.) and maintained on normal mouse chow and water insufficiency. Affected individuals lack the permanent zone of ad libitum. All animal procedures were approved and performed the adrenal cortex and have low serum concentrations of min- in accordance with the policies of Northwestern University’s eralocorticoids and glucocorticoids. Hypogonadotropic hypogo- Animal Care and Use Committee. nadism is also a feature of the syndrome and reflects combined defects in the production of hypothalamic gonadotropin- Isolation and Culture of Leydig Cells. The method of Leydig cell releasing hormones and pituitary gonadotropins (4–6). isolation from mouse testis was adapted from Hales et al. (19). Consistent with the clinical features of AHC, Dax1 transcripts Twelve-week-old Dax1-deficient male mice and wild-type litter- are expressed in the hypothalamus, pituitary gonadotrope cells, mates were killed by cervical dislocation and their testes were adrenal glands, and gonads (6, 7). This pattern of expression is strikingly similar to that of another orphan nuclear receptor, steroidogenic factor-1 (SF-1; ref. 7). SF-1 orchestrates the This paper was submitted directly (Track II) to the PNAS office. expression of several steroidogenic enzyme genes and genes that Abbreviations: SF-1, steroidogenic factor-1; AHC, adrenal hypoplasia congenita; LCH, govern sex differentiation and reproduction (8–10). Sf1 knock- Leydig cell hyperplasia; MIS, Mu¨llerian-inhibiting substance; RT, reverse transcription. out mice lack adrenal glands and gonads and exhibit impaired ‡To whom reprint requests should be addressed at: Endocrinology, Metabolism, and Molecular Medicine, Northwestern University Medical School, 303 East Chicago Avenue, pituitary gonadotrope cell function (11–14). In addition, male Tarry Building 15-709, Chicago, IL 60611-3008. E-mail: [email protected]. knockout mice have XY sex reversal and persistent Mu¨llerian The publication costs of this article were defrayed in part by page charge payment. This structures (11–14). The colocalization of Sf1 and Dax1 led to the article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. suggestion of a functional interaction between these two orphan §1734 solely to indicate this fact. 7988–7993 ͉ PNAS ͉ July 3, 2001 ͉ vol. 98 ͉ no. 14 www.pnas.org͞cgi͞doi͞10.1073͞pnas.141543298 Downloaded by guest on September 26, 2021 Table 1. Primer sequences used in PCR Sequence of Primer (5Ј33Ј) Target mRNA Sense Antisense Dax1 CACTTGCTCCCAGCTGCTGC TTGATGAATCTCAGCAGGAA StAR CGCTCAGGACCTTGAAAGGC TACAGCGCACGCTCACGAAG Cyp11a AAGTGGCAGTCGTGGGGACA ACCCCAATGGGCCTCTGATA Cyp17 GCCTGACAGACATTCTG TCGTGATGCAGTGCCCAG 3␤-HSD type II ACTGCAGGAGGTCAGAGCT GCCAGTAACACACAGAATACC 17␤-HSD type III ATTTTACCAGAGAAGACATCT GGGGTCAGCACCTGAATAATG Cyp19 CACCCTTCCAAGTGACAGGA AAAAAAGTAAAGTTCTATGGGAA Gapdh CCCTTCATTGACCTCAACTA CCAAAGTTGTCATGGATGAC removed immediately. After decapsulation, each testis was di- cells from wild-type or mutant mice testes were plated in 12-well gested in M199 medium (GIBCO͞BRL) containing 0.75 mg͞ml culture dishes in serum-free DMEM͞F12 medium. The final collagenase (Worthington) for 10 min at 37°C under conditions concentration of androstenedione was 150 pmol͞ml, consisting of vigorous shaking. Interstitial cells were collected by centrif- of 50% [1␤-3H]androstenedione and 50% unlabeled andro- ugation at 600 ϫ g for 20 min and resuspended in M199 medium stenedione. Cells were incubated for 12, 24, or 36 h at 32°C. supplemented with 2.2 g/liter sodium bicarbonate͞10 mM Incubations were conducted in an identical fashion in the Hepes, pH 7.4͞500 ng/ml insulin͞100 units/ml penicillin͞100 absence of cells to establish background values. The incubation ␮g/ml streptomycin͞1 mg/ml BSA. Macrophages were removed was terminated by transferring 1 ml of medium to tubes con- by adherence to culture dishes for 25 min in a humidified taining 1 ml of ice-cold 30% (vol͞vol) trichloracetic acid. The atmosphere of 5% CO2 at 32°C. Leydig cells were purified from mixture was vortexed vigorously for 30 sec, and centrifuged at the nonadherent crude interstitial cells by centrifugation (Sorvall 2,000 ϫ g for 5 min at 4°C to remove precipitated protein. The HB-4 rotor, 57,000 rpm ϫ 5 min) through an 11–23% metriz- medium was extracted with 5 ml of chloroform. The aqueous amide density gradient and resuspended in serum-free DMEM͞ layer (1 ml) was removed and mixed with 1 ml of activated F12 medium supplemented with 2.2 g/liter sodium bicarbon- charcoal suspension (5%) containing Dextran (0.5%). The mix- MEDICAL SCIENCES ate͞10 mM Hepes, pH 7.4͞500 ng/ml insulin͞100 units/ml ture was vortexed well and centrifuged at 2,000 ϫ g for 20 min penicillin͞100 ␮g/ml streptomycin͞1 mg/ml BSA. Cells were at 4°C to remove the charcoal. An aliquot (1 ml) of the plated at a density of 1 ϫ 105 cells per cm2 and incubated in a supernatant was added to 15 ml of Scintisafe fluid (Research humidified atmosphere of 5% CO2 at 32°C. The Leydig cell Products International) in scintillation vials, vortexed, and as- preparations were determined to be Ϸ90% pure by using sayed for radioactivity. Blank values (incubation of dishes con- immunohistochemical staining for 3␤-HSD (20). taining medium without cells) were subtracted, and aromatase 3 6 activity was expressed as fmol H2O released per 10 cells per h. Reverse Transcription (RT)-PCR.
Load more

Recommended publications
  • Rep 467 Morrish & Sinclair
    Reproduction (2002) 124, 447–457 Review Vertebrate sex determination: many means to an end Bronwyn C. Morrish and Andrew H. Sinclair* Murdoch Children’s Research Institute, Royal Children’s Hospital, Flemington Rd, Melbourne, Victoria 3052, Australia The differentiation of a testis or ovary from a bipotential gonadal primordium is a develop- mental process common to mammals, birds and reptiles. Since the discovery of SRY, the Y-linked testis-determining gene in mammals, extensive efforts have failed to find its orthologue in other vertebrates, indicating evolutionary plasticity in the switch that triggers sex determination. Several other genes are known to be important for sex determination in mammals, such as SOX9, AMH, WT1, SF1, DAX1 and DMRT1. Analyses of these genes in humans with gonadal dysgenesis, mouse models and using in vitro cell culture assays have revealed that sex determination results from a complex interplay between the genes in this network. All of these genes are conserved in other vertebrates, such as chickens and alligators, and show gonad-specific expression in these species during the period of sex determination. Intriguingly, the sequence, sex specificity and timing of expression of some of these genes during sex determination differ among species. This finding indicates that the interplay between genes in the regulatory network leading to gonad development differs between vertebrates. However, despite this, the development of a testis or ovary from a bipotential gonad is remarkably similar across vertebrates. The existence of two sexes is nearly universal in the animal and alligators. Ectopic administration of oestrogen or kingdom and although gonadal morphogenesis is remark- inhibitors of oestrogen synthesis during a critical period of ably similar across vertebrates, the sex-determining mecha- gonadogenesis in chickens and alligators can feminize or nism varies considerably.
    [Show full text]
  • Genomic Approaches to Deconstruct Pluripotency
    GG12CH08-Daley ARI 26 July 2011 14:10 Genomic Approaches to Deconstruct Pluripotency Yuin-Han Loh,1,2,∗ Lin Yang,1,2,∗ Jimmy Chen Yang,1,2,∗∗ Hu Li,3,4,∗∗ James J. Collins,3,4,5 and George Q. Daley1,2,5,6,7 1Stem Cell Transplantation Program, Division of Pediatric Hematology/Oncology, Children’s Hospital Boston; Dana-Farber Cancer Institute; and Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, Massachusetts 02115; email: [email protected] 2Harvard Stem Cell Institute, Cambridge, Massachusetts 02115 3Department of Biomedical Engineering and Center for BioDynamics, Boston University, Boston, Massachusetts 02215 4Wyss Institute for Biologically Inspired Engineering, Harvard University, Boston, Massachusetts 02115 5Howard Hughes Medical Institute, Boston, Massachusetts 02115 6Division of Hematology, Brigham and Women’s Hospital, Boston, Massachusetts 02115 7Manton Center for Orphan Disease Research, Boston, Massachusetts 02115 Annu. Rev. Genomics Hum. Genet. 2011. Keywords 12:165–85 transcription regulation, epigenetics, histone modifications, DNA First published online as a Review in Advance on July 25, 2011 methylation, pluripotent stem cells The Annual Review of Genomics and Human Genetics Abstract is online at genom.annualreviews.org Embryonic stem cells (ESCs) first derived from the inner cell mass of by Boston University on 10/07/11. For personal use only. This article’s doi: 10.1146/annurev-genom-082410-101506 blastocyst-stage embryos have the unique capacity of indefinite self- renewal and potential to differentiate into all somatic cell types. Similar Copyright c 2011 by Annual Reviews. All rights reserved developmental potency can be achieved by reprogramming differen- tiated somatic cells into induced pluripotent stem cells (iPSCs).
    [Show full text]
  • Sex Determination: a 'Window' of DAX1 Activity
    Review TRENDS in Endocrinology and Metabolism Vol.15 No.3 April 2004 Sex determination: a ‘window’ of DAX1 activity Louisa M. Ludbrook and Vincent R. Harley Prince Henry’s Institute of Medical Research, PO Box 5152, Clayton, VIC 3168, Australia Traditionally, DAX1 was considered an ‘anti-testis’ gene that are probably important for male sex determination because DAX1 duplications in XY individuals cause have yet to be identified, because some 75% of sex reversal male-to-female sex reversal: dosage-sensitive sex rever- cases remain unexplained genetically [15]. Some progress sal (DSS). In DSS, two active DAX1 genes on one has been made in deciphering the roles and complex X chromosome can abrogate testis formation. By con- relationships of the known sex-determining genes during trast, mutations and deletions of DAX1 cause adrenal gonadogenesis. Here, we describe the emerging role of hypoplasia congenita (AHC). Although AHC patients DAX1 in male testis formation and discuss the possible develop testes, gonadal defects include disorganized molecular mechanisms through which DAX1 regulates testis cords and hypogonadotropic hypogonadism, this pathway. which is not completely restored with gonadotropin or androgen therapy. Recent evidence of XY sex reversal Expression of DAX1 in Dax1-deficient mice strongly supports a role for Dax1 DAX1 RNA expression is restricted to certain tissue types as a ‘pro-testis’ gene. Therefore, perhaps DAX1/Dax1 and is largely coexpressed with SF1, also crucial for both acts within a ‘window’ of activity, outside of which tes- adrenal and gonadal development [16–18]. Based on in tis formation does not occur. Here, we discuss the func- situ hybridization analyses, Sf1 and Dax1 are expressed in tion and possible mechanisms of DAX1 action in male both developing and adult adrenal, gonadal, hypothalamic gonadogenesis.
    [Show full text]
  • Molecular Basis Governing Primary Sex in Mammals
    Jpn J Human Genet 41, 363-379, 1996 Review Article MOLECULAR BASIS GOVERNING PRIMARY SEX IN MAMMALS Kozo NAGAI Department of Biochemistry, Tokyo Medical College, 6-1-1 Shinjuku, Shinjuku-ku, Tokyo 160, Japan Summary The function of Sry for inducing a male gonad was iden- tified due to a development of a transgenic XX male mouse with testes by introducing a single gene into an embryo. The intronless Sry encodes a putative transcriptional protein harboring an HMG motif. The sequence similarity within the HMG motif has been highly conserved despite less conservation in other domains. Hence, the HMG motif must play a critical role in the transcriptional regulation, leading to the development of a male gonad. However, a non HMG box C terminal domain of Sry protein may also be indispensable for inducing normal testicular develop- ment. Further, several autosomal genes, such as SF1, WT1, SOX and MIS, as well as a unique X chromosomal DAX1 were suggested to be associated with the development of gonadal sex in mammals. Therefore, the significance on the involvement of these genes in the molecular mechanism of mammalian sex determination should be also considered. Key Words sex determining gene, primary sex determination, mam- malian sex Introduction The clarification and understanding of the molecular mechanism responsible for mammalian sex determination is very interesting, because the presences of male and female sexes are not only surprising in its mysterious manifestations and graceful in its conception but also absolute benefits. In a mammalian system, the appearance of gonadal sex in a lineage of sex differentiation is most exciting, yet is still not sufficiently understood.
    [Show full text]
  • Obesity-Induced Excess of 17-Hydroxyprogesterone Promotes Hyperglycemia Through Activation of Glucocorticoid Receptor
    The Journal of Clinical Investigation RESEARCH ARTICLE Obesity-induced excess of 17-hydroxyprogesterone promotes hyperglycemia through activation of glucocorticoid receptor Yan Lu,1 E Wang,1 Ying Chen,1 Bing Zhou,1 Jiejie Zhao,1 Liping Xiang,1 Yiling Qian,1 Jingjing Jiang,1 Lin Zhao,1 Xuelian Xiong,1 Zhiqiang Lu,1 Duojiao Wu,2 Bin Liu,1,3 Jing Yan,4 Rong Zhang,4,5 Huijie Zhang,6 Cheng Hu,4,5,7 and Xiaoying Li1 1Key Laboratory of Metabolism and Molecular Medicine, Ministry of Education and Department of Endocrinology and Metabolism, and 2Institute of Clinical Science, Shanghai Institute of Clinical Bioinformatics, Zhongshan Hospital, Fudan University, Shanghai, China. 3Jiangsu Key Laboratory of Marine Pharmaceutical Compound Screening, College of Pharmacy, Jiangsu Ocean University, Lianyungang, China. 4Department of Endocrinology and Metabolism, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, and 5Shanghai Diabetes Institute, Shanghai Key Laboratory of Diabetes Mellitus, Shanghai Clinical Center for Diabetes, Shanghai, China. 6Department of Endocrinology and Metabolism, Nanfang Hospital, Southern Medical University, Guangzhou, China. 7Institute for Metabolic Disease, Fengxian Central Hospital, Southern Medical University, Shanghai, China. Type 2 diabetes mellitus (T2DM) has become an expanding global public health problem. Although the glucocorticoid receptor (GR) is an important regulator of glucose metabolism, the relationship between circulating glucocorticoids (GCs) and the features of T2DM remains controversial. Here, we show that 17-hydroxyprogesterone (17-OHP), an intermediate steroid in the biosynthetic pathway that converts cholesterol to cortisol, binds to and stimulates the transcriptional activity of GR. Hepatic 17-OHP concentrations are increased in diabetic mice and patients due to aberrantly increased expression of Cyp17A1.
    [Show full text]
  • The Role of Orphan Nuclear Receptor DAX-1 (NR0B1)
    The University of San Francisco USF Scholarship: a digital repository @ Gleeson Library | Geschke Center Master's Theses Theses, Dissertations, Capstones and Projects Fall 12-12-2017 The oler of orphan nuclear receptor DAX-1 (NR0B1) in human breast cancer cells: expression, proliferation and metastasis Erin Dishington [email protected] Follow this and additional works at: https://repository.usfca.edu/thes Part of the Biology Commons, and the Genetics Commons Recommended Citation Dishington, Erin, "The or le of orphan nuclear receptor DAX-1 (NR0B1) in human breast cancer cells: expression, proliferation and metastasis" (2017). Master's Theses. 269. https://repository.usfca.edu/thes/269 This Thesis is brought to you for free and open access by the Theses, Dissertations, Capstones and Projects at USF Scholarship: a digital repository @ Gleeson Library | Geschke Center. It has been accepted for inclusion in Master's Theses by an authorized administrator of USF Scholarship: a digital repository @ Gleeson Library | Geschke Center. For more information, please contact [email protected]. Abstract The orphan nuclear hormone receptor DAX-1 (Dosage Sensitive Sex Reversal, Adrenal Hypoplasia Congenita on the X Chromosome, gene 1) plays an important role in the development of adrenal and gonadal tissues and functions as a global negative-regulator of steroidogenesis. In addition, it is known to be involved in several diseases including some cancers. Herein, we describe our examination of the role of DAX-1 in breast cancer, specifically its influence on proliferation and metastasis and its expression during progressive stages of disease. In an effort to understand how DAX-1 influences breast cancer cell proliferation and metastasis, we used MCF7 breast cancer cells and MCF10A normal breast cells and manipulated their DAX-1 expression to increase DAX-1 expression by adenovirus infection in MCF7 cells, or knockdown expression of DAX-1 through the use of RNAi in MCF10A cells.
    [Show full text]
  • Sex Determination
    Sex Determination • Most animal species are dioecious – 2 sexes with different gonads • Females: produce eggs in ovaries • Males: produce sperm in testes • Exception • Hermaphrodites: have both types of gonads • Many animals also differ in secondary traits What Determines Sex? • Individual differentiates into male or female • Causes – Genetic factors (sex chromosomes) – occur at fertilization – Environmental factors – occur after fertilization How Do Vertebrate Gonads Develop? • Gonad differentiation – first morphological difference between males and females • Gonads develop from intermediate mesoderm • Paired structures What is a Bipotential Gonad? • Indifferent gonad develops – 4-6 wks in human = “bipotential stage” – genital ridge forms next to developing kidney (mesonephric ridge) Structure of the Indifferent Gonad • Sex cords form – Columns of epithelial cells penetrate mesenchyme – Primordial germ cells migrate from posterior endoderm – Become surrounded by sex cords What is the Fate of the Sex Cords? • Initially in central area (medulla, medullary) – Will develop in male – Proliferate • In outer area (cortex, cortical) – Develop in female • Normally binary choice Differentiation of the Gonad • Into testes or ovaries – primary sex determination – does not involve hormones network of internal sex cords (at new cortical sex cords puberty: --> seminiferous tubules, cluster around each germ cell Sertoli cells Male Differentiation • Male sex cords or testis cords proliferate and cortex becomes thick layer of extracellular matrix • Male
    [Show full text]
  • Molecular Mechanisms of DAX1 Action
    Molecular Genetics and Metabolism 83 (2004) 60–73 www.elsevier.com/locate/ymgme Minireview Molecular mechanisms of DAX1 action Anita K. Iyera, Edward R.B. McCabea,b,c,d,e,¤ a Department of Human Genetics, David GeVen School of Medicine at UCLA, Los Angeles, CA, USA b Department of Pediatrics, David GeVen School of Medicine at UCLA, Los Angeles, CA, USA c UCLA Molecular Biology Institute, Los Angeles, CA, USA d Mattel Children’s Hospital at UCLA, Los Angeles, CA, USA e UCLA Center for Society, The Individual and Genetics, Los Angeles, CA, USA Received 25 May 2004; received in revised form 12 July 2004; accepted 13 July 2004 Abstract DAX1 (dosage sensitive sex reversal (DSS), adrenal hypoplasia congenita (AHC) critical region on the X chromosome, gene 1) encoded by the gene NR0B1, is an unusual orphan nuclear receptor that when mutated causes AHC with associated hypogonadotro- pic hypogonadism (HH), and when duplicated causes DSS. DAX1 expression has been shown in all regions of the hypothalamic– pituitary–adrenal–gonadal (HPAG) axis during development and in adult tissues, suggesting a critical role for DAX1 in the normal development and function of this axis. Steroidogenic factor 1 (SF1, NR5A1) knockout mice show similar developmental defects as AHC and HH patients, but paradoxically, DAX1 is a negative coregulator of SF1 transactivation. The function of DAX1 as an antagonist of SF1 in gonadal development is consistent with the fact that in humans, duplication of the region of the X chromosome containing DAX1 causes a similar phenotype as mutations in SF1. However, how disruption of DAX1 leads to adrenal, hypotha- lamic, and pituitary developmental defects similar to SF1 disruption remains to be clariWed.
    [Show full text]
  • Nuclear Receptor TLX Prevents Retinal Dystrophy and Recruits the Corepressor Atrophin1
    Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Nuclear receptor TLX prevents retinal dystrophy and recruits the corepressor atrophin1 Chun-Li Zhang,1,2 Yuhua Zou,2 Ruth T. Yu,2 Fred H. Gage,3 and Ronald M. Evans1,2,4 1Howard Hughes Medical Institute, 2Gene Expression Laboratory, and 3Laboratory of Genetics, The Salk Institute for Biological Studies, La Jolla, California 92037, USA During mammalian embryogenesis, precise coordination of progenitor cell proliferation and differentiation is essential for proper organ size and function. The involvement of TLX (NR2E1), an orphan nuclear receptor, has been implicated in ocular development, as Tlx−/− mice exhibit visual impairment. Using genetic and biochemical approaches, we show that TLX modulates retinal progenitor cell proliferation and cell cycle re-entry by directly regulating the expression of Pten and its target cyclin D1. Additionally, TLX finely tunes the progenitor differentiation program by modulating the phospholipase C and mitogen-activated protein kinase (MAPK) pathways and the expression of an array of cell type-specific transcriptional regulators. Consequently, Tlx−/− mice have a dramatic reduction in retina thickness and enhanced generation of S-cones, and develop severe early onset retinal dystrophy. Furthermore, TLX interacts with atrophin1 (Atn1), a corepressor that is involved in human neurodegenerative dentatorubral-pallidoluysian atrophy (DRPLA) and that is essential for development of multiple tissues. Together, these results reveal a molecular strategy by which an orphan nuclear receptor can precisely orchestrate tissue-specific proliferation and differentiation programs to prevent retinal malformation and degeneration. [Keywords: Nuclear receptor; TLX; retinal dystrophy; PTEN; atrophin; neurodegeneration] Supplemental material is available at http://www.genesdev.org.
    [Show full text]
  • DAX1 and X-Linked Adrenal Hypoplasia Congenita
    European Journal of Endocrinology (2006) 154 685–689 ISSN 0804-4643 CLINICAL STUDY DAX1 and X-linked adrenal hypoplasia congenita: clinical and molecular analysis in five patients Giovanna Mantovani1, Ernesto De Menis2, Giorgio Borretta3, Giorgio Radetti4, Sara Bondioni1, Anna Spada1, Luca Persani1,5 and Paolo Beck-Peccoz1 1Institute of Endocrine Sciences, University of Milan, Padiglione Granelli, Ospedale Maggiore IRCCS, Via F. Sforza 35, 20122 Milan, Italy, 2 I Divisione Medica, Ospedale Generale, Treviso, Italy, 3 Endocrinology Unit, Ospedale S. Croce e Carle, Cuneo, Italy, 4 Department of Pediatrics, Ospedale Generale Regionale, Bolzano, Italy and 5 Laboratory of Endocrinological Research, Istituto Auxologico Italiano IRCCS, Milan, Italy (Correspondence should be addressed to G Mantovani; Email: [email protected]) Abstract Objective: Mutations in the gene coding for the orphan nuclear receptor DAX1 cause X-linked adrenal hypoplasia congenita (AHC). Affected boys usually present with primary adrenal failure in early infancy or childhood. Impaired sexual development due to hypogonadotropic hypogonadism becomes manifest at the time of puberty. Moreover, evidence from Dax1 knockout mice and a limited number of patients with AHC, suggests that mutations in DAX1 may directly cause abnormalities in spermato- genesis. The aim of this study was to characterize clinically and genetically five patients with AHC. Design: DNA sequencing analysis, endocrine testing, testicular ultrasound and semen analysis with 1- year follow-up after gonadotropin treatment. Methods: We report on five men with classic AHC manifestations. Genomic DNA was extracted from patients’ peripheral blood leukocytes and the coding region, splice sites, and promoter (2240 bp) region of DAX1 were directly sequenced. Results: Three known and two novel mutations were detected in the DAX1 coding sequence in these patients.
    [Show full text]
  • A Novel Mutation in DAX1 Causes Delayed-Onset Adrenal Insufficiency and Incomplete Hypogonadotropic Hypogonadism
    A novel mutation in DAX1 causes delayed-onset adrenal insufficiency and incomplete hypogonadotropic hypogonadism Antoine Tabarin, … , J. Larry Jameson, Philippe Bouchard J Clin Invest. 2000;105(3):321-328. https://doi.org/10.1172/JCI7212. Article Mutations in the DAX1 gene cause X-linked adrenal hypoplasia congenita (AHC) and hypogonadotropic hypogonadism (HHG). In affected boys, primary adrenal insufficiency occurs soon after birth or during early childhood; HHG is recognized at the expected time of puberty. In this report, we describe the novel phenotype of a man who presented with apparently isolated adrenal insufficiency at 28 years of age. Examination revealed partial pubertal development and undiagnosed incomplete HHG. Gonadotropin therapy did not improve his marked oligospermia, suggesting a concomitant primary testicular abnormality. Genomic analysis revealed a novel missense mutation, I439S, in DAX1. The mutant DAX-1 protein was studied for its ability to function as a transcriptional repressor of target genes. Consistent with the patient’s mild clinical phenotype, the I439S mutation conferred intermediate levels of repressor activity of DAX-1 when compared with mutations associated with classic AHC. This unique case extends the clinical spectrum of AHC to include delayed- onset primary adrenal insufficiency in adulthood and milder forms of HHG. Furthermore, in accordance with findings in Ahch (Dax1) knockout mice, the clinical features in this patient suggest that DAX-1 function is required for spermatogenesis in humans, independent of its known effects on gonadotropin production. Find the latest version: https://jci.me/7212/pdf A novel mutation in DAX1 causes delayed-onset adrenal insufficiency and incomplete hypogonadotropic hypogonadism Antoine Tabarin,1 John C.
    [Show full text]
  • Nuclear Receptors and Development of Marine Invertebrates Angelica Miglioli 1,2, Laura Canesi 2, Isa D
    G C A T T A C G G C A T genes Review NuclearReview Receptors and Development of Marine Invertebrates Nuclear Receptors and Development of Marine Invertebrates Angelica Miglioli 1,2, Laura Canesi 2, Isa D. L. Gomes 1, Michael Schubert 1 and Rémi Dumollard 1,* Angelica Miglioli 1,2 , Laura Canesi 2 , Isa D. L. Gomes 1, Michael Schubert 1 and Rémi Dumollard 1,* 1 Laboratoire de Biologie du Développement de Villefranche-sur-Mer (LBDV), Institut de la Mer de Ville- franche, Sorbonne Université, CNRS, 181 Chemin du Lazaret, 06230 Villefranche-sur-Mer, France; miglio- 1 Laboratoire de Biologie du Développement de Villefranche-sur-Mer (LBDV), Institut de la Mer de Villefranche, [email protected] (A.M.); [email protected] (I.D.L.G.); [email protected] (M.S.) Sorbonne Université, CNRS, 181 Chemin du Lazaret, 06230 Villefranche-sur-Mer, France; 2 Dipartimento di Scienze della Terra, dell’Ambiente e della Vita (DISTAV), Università degli Studi di Genova, [email protected] (A.M.); [email protected] (I.D.L.G.); [email protected] (M.S.) Corso Europa 26, 16132 Genova, Italy; [email protected] 2 Dipartimento di Scienze della Terra, dell’Ambiente e della Vita (DISTAV), Università degli Studi di Genova, * Correspondence: [email protected] Corso Europa 26, 16132 Genova, Italy; [email protected] * Correspondence: [email protected] Abstract: Nuclear Receptors (NRs) are a superfamily of transcription factors specific to metazoans that have the unique ability to directly translate the message of a signaling molecule into a tran- Abstract: Nuclear Receptors (NRs) are a superfamily of transcription factors specific to metazoans scriptional response.
    [Show full text]