Crassula Peduncularis and C. Saginoides (Crassulaceae), Newly Naturalized in Japan, and Their Genetic Differences from C

ISSN 1346-7565 Acta Phytotax. Geobot. 70 (2): 119–127 (2019) doi: 10.18942/apg.201818

Crassula peduncularis and C. saginoides (Crassulaceae), Newly Naturalized in Japan, and their Genetic Differences from C. aquatica

1,* 2 3 3 Shinji Fujii , Tadashi Yamashiro , Sachiko Horie and Masayuki Maki

1Department of Environmental Science, University of Human Environments, Okazaki, Aichi, 444-3505, Japan. * [email protected] (author for correspondence); 2Division of Bioscience and Bioindustry, Graduate School of Technology, Industrial and Social Sciences, Tokushima University, Tokushima 770-8513, Japan; 3Botanical Gardens, Tohoku University, Sendai, Miyagi 980-0862, Japan

Recently, we found two species of Crassula newly introduced into central Japan. Based on their morphology, we identified them asCrassula peduncularis and C. saginoides, native to the New World. They closely resemble C. aquatica, which is indigenous to Japan. Here, we describe the morphological distinc- tions among the three species in detail. In addition, we examined genetic differences among the three species based on sequence variations in the nuclear ribosomal ITS region and three chloroplast intergenic regions. Although C. saginoides was considered to be an inland form of C. aquatica and had been treated as a synonym of C. aquatica, the degree of genetic differentiation was relatively large, suggesting that these two taxa should be considered to be independent species.

Key words: Crassula aquatica, Crassula peduncularis, Crassula saginoides, genetic differentiation, morphology, naturalized

Crassula L. (Crassulaceae) is a large genus of guished from C. aquatica by the pedicels of the mostly terrestrial succulent plants, but also con- former that tend to elongate in fruit while those of tains annual, aquatic or semi-aquatic species the latter remain less than 1 mm long. Crassula with a worldwide distribution. In Japan, only C. solieri differs from C. aquatica also has elongat- aquatica is indigenous (Ohba 2001), but Crassula ed pedicels in fruit, as in C. saginoides, but is tillaea Lester-Garland (Tillaea muscosa L.), unique in the smooth, shiny surface cells of the which is native to Europe, was recently recorded seeds. Moran (1994, 2009), however, considered (Katsuyama et al. 2005). Although some species C. saginoides to be only an inland phenotype of of Crassula, such as C. aquatica and C. tillaea, C. aquatica, under which he treated it as a syn- have been treated as species of the genus Tillaea onym. (e.g., Borisova 1939, Kunjun 2001, Ohba 2001, In 2015, one of us (Fujii) discovered plants of Katsuyama et al. 2005), a recent molecular phylo- Crassula on Honshu that had not been reported genetic study indicated that Tillaea was polyphy- previously from Japan. Although they were simi- letically embedded within Crassula and was in- lar to C. aquatica, we found differences between cluded within Crassula by Mort et al. (2009). In them in certain morphological traits. Hereafter, revising Crassula in the New World, Bywater & we refer to the unknowns as “C. aquatica-like Wickens (1984) pointed out that C. saginoides plants.” In this study, we examined the morphol- (Maxim.) Bywater & Wickens and C. solieri ogy of “C. aquatica-like plant,” and sequenced (Gay) Meigen are morphologically similar to C. the nuclear ribosomal ITS (nrITS) region and aquatica. Crassula saginoides can be distin- three chloroplast intergenic regions to compare 120 Acta Phytotax. Geobot. Vol. 70 with Crassula aquatica. Based on morphological μM of each of the two primers, 0.1 mM of each and genetic studies we clarified the identity of the dNTP, 10 mM Tris–HCl (pH 8.3), 50 mM KCl, 2

C. aquatica-like plants. mM MgCl2, and 0.25 U of Taq polymerase (Am- plicon Inc., Irvine, CA). The reactions for all four regions were initiated with initial denaturation at Materials and Methods 95 °C for 5 minutes followed by 30 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 60 s, and Morphological observations a final extension at 72 °C for 10 minutes on an Plants collected in the field and deposited in ABI GeneAmp 9700 thermal cycler (Applied herbaria were examined for morphological char- Biosystems, Foster City, CA). The purified PCR acteristics and for details of their collection (loca- products were sequenced using a BigDye termi- tion and year of collection). Field surveys to lo- nator v.3.1 Cycle Sequencing Kit (Applied Bio- cate additional plants were conducted throughout systems) on an ABI 3100 Genetic Analyzer (Ap- Japan: Hokkaido, Honshu, Shikoku and Kyushu, plied Biosystems). The sequences were aligned and specimens in the herbaria: INM, KYO, with BioEdit v.7.0.5 (Hall 1999). A haplotype net- MAK, OSA, TI, TNS, TUS, Gunma Museum of work based on mutational steps in three chloro- Natural History, the herbarium of Niigata City. plast gene regions was created using TCS 1.21 (Clement et al. 2000) to evaluate possible genetic Seed morphology using scanning electron mi- relationships among haplotypes under the 95% croscopy statistical parsimony criterion. All sequences The seed coats of the Crassula aquatica-like newly determined here were deposited in Gen- plants (populations ZYO and KDZ in Table 1) Bank (DDBJ). and of C. aquatica (populations SZK and TBS in Table 1) were examined using a JSM-6010PLUS/ LA scanning electron microscope (SEM; JEOL, Results and Discussion Tokyo, Japan) in low vacuum mode (50 Pa) at 10 kV. Morphological observations Crassula aquatica and the C. aquatica-like DNA sequencing plants were erect, up to 7 cm tall, had branched For DNA sequencing, one individual per pop- stems (unbranched in small plants); leaves 1.5–7 ulation from three populations of the Crassula mm long, solitary flowers, four petals and acute, aquatica-like plants and nine populations of the many-seeded carpels. We distinguished three native C. aquatica (Table 1) were examined. types (I, II and III) based on morphological fea- Whole plants were collected and placed in plastic tures. Type I plants, which occurred throughout bags with a zip fastener and refrigerated until Japan (Hokkaido, Honshu, Shikoku and Kyushu, DNA extraction. Fig. 3A), were green in the spring fruiting season, We sequenced the nrITS regions and three had obtuse (or sometimes acute) leaves, fruiting chloroplast gene regions: trnHGUG-psbA, trnCGCA- capsules sessile or subsessile, carpels ascending rpoB, and 3’trnVUAC-ndhC. The primer pairs fol- or almost patent (or sometimes erect) at maturity lowed White et al. (1990) for nrITS, Shaw et al. (Fig. 1A) and rugulose-striate seed surface (Fig. (2005) for trnHGUG-psbA and trnCGCA-rpoB, and 2A). These features are characteristic of C. aquat- Shaw et al. (2007) for 3’trnVUAC-ndhC. Total DNA ica. was extracted from a shoot of each sample ac- The type II plants, found only in the Kinki cording to the cetyltrimethylammonium bromide District, Honshu (Fig. 3B), were often purple dur- (CTAB) method of Doyle & Doyle (1990). PCR ing the spring fruiting season, the leaves were amplifications were conducted in a final volume acute, the capsules were sessile or on pedicels to of 10 μl using 10–20 ng of template DNA, 0.15 15 mm long (varying even within the same plant, June 2019 Fujii & al. – Taxonomy of Exotic Crassula in Japan 121

Table 1. Populations examined in molecular phylogenetic analyses.

Population Geographic 1) 2) Locality Voucher (herbarium acronym) Ribotype Chlorotype code coordinate TYPE I (Crassula aquatica) Fujii 17198 BHR Onsui pond, Bihoro, Hokkaido 43.787, 144.163 B B (KYO, MAK, TNS, TUS) Uchi-numa, Kurihara, Sugiyama, Kasai & Emi 8558 UCN 38.713, 141.082 A A Miyagi Pref. (TUS) Morinji, Tatebayashi, 3) TBS 36.226, 139.529 Aoki 17337 (GMNH ) B B Gunma Pref. Otama pond, Hakone, HKN 35.206, 139.041 Fujii 16999 (KYO, TUS) B B Kanagawa Pref. Nishikan-ku, Niigata, NGT 37.748, 138.890 Fujii 13969 (KYO, OSA) B B Niigata Pref. Aoi-ku, Shizuoka, SZK 35.014, 138.394 Fujii 17354 (KYO, OSA, TUS) B B Shizuoka Pref. HMJ Shigo, Himeji, Hyogo Pref. 34.815, 134.711 Fujii 16991 (KYO) A A MIE Sugari, Owase, Mie Pref. 34.094, 136.295 Fujii & Yamamoto 13206 (OSA) B B Fujii 16735 TOK Ohtsu, Naruto, Tokushima Pref. 34.161, 134.580 B B (KYO, MAK, TNS, TUS) TYPE II (Crassula peduncularis) Uji (Yodo) River, Yawata, Fujii 16952 YOD 34.894, 135.700 C C Kyoto Pref. (KYO, OSA, TNS, TUS) Fujii 16951 ZYO Tomino, Zyoyo, Kyoto Pref. 34.859, 135.774 C C (KYO, OSA, TNS, TUS) TYPE III (Crassula saginoides) Fujii & Maki 17313 KDZ Kiso River, Kaidzu, Gifu Pref. 35.233, 136.675 C D (KYO, OSA, TNS, TUS) 1) See Table 3. 2) See Table 4. 3) Gunma Museum of Natural History. with pedicel usually longest on the lower portion roplast gene regions, while type I had an indel of the shoot), carpels erect at maturity (Fig. 1B), variation among populations in 224–281 bp (Ta- each cell of the striate seed surface with 2–5 pa- bles 1 & 3). Figure 4 shows the TCS haplotype pillae (Fig. 2B). network based on mutations in the chloroplast The type III plants, found only at one locality gene regions, indicating a genetic gap between (KDZ) along the Kiso River in Honshu (Fig. 3B), types I, II and III, and also between types II and were similar to the type II plants in color, leaves III. The genetic evidence supports the recogni- and carpels, but differed in that the fruiting cap- tion of the three taxa in spite of their similar mor- sules were usually sessile or sometimes on pedi- phology. Because of a general lack of good mor- cels to 15 mm long (Fig. 1C) and the seeds were phological characters for distinguishing among striate-rugulose but lacked the papillae (Fig. 2C). C. aquatica and allied taxa in subgenus Dispolo- carpa, (Bywater & Wickens 1984), genetic infor- Genetic differentiation mation may be more informative. These tiny We found genetic distinctness in the sequenc- plants often show high plasticity in their habitats es of the nrITS region and the three chloroplast and morphology and are difficult to identify. Fur- DNA intergenic regions from the three species. ther molecular studies should be encouraged. Within the 670 bp of the nrITS region two substitutions between the type I (Crassula aquatica) Identification of the C. aquatica-like plants (types and the two C. aquatica-like plants (types II and II and III) III) were found, although type I had a variation Based on the treatment by Bywater & Wick- among populations in 36 bp (Tables 1 & 2). There ens (1984), we tried to identify the three types of were five substitutions between types I and II and plants. Type I was identified as Crassula aquati- seven substitutions and one indel between types I ca based on the sessile or subsessile flowers (Fig. and III out of a total of 1,033 bp of the three chlo- 1A) and the striate-rugulose seed surface (Fig. 122 Acta Phytotax. Geobot. Vol. 70

Fig. 1. Mature fruits and pedicels. A: ascending carpels of Crassula aquatica (Fujii 17354), B: erect carpels of C. peduncularis (Fujii 16951). C: erect carpels of C. saginoides, KDZ (Fujii 17313). Scale bars show 1 mm. See table 1 for KDZ and vouchers.

Fig. 2. SEM images of seeds (above) and seed surfaces (below). A: Crassula aquatica (Fujii 17354), B: C. peduncularis (Fujii 16951), C: C. saginoides, KDZ (Fujii 17313). Scale bars show 100 μm (above) and 20 μm (below). See table 1 for KDZ and vouchers. June 2019 Fujii & al. – Taxonomy of Exotic Crassula in Japan 123

Fig. 3. Distribution of Crassula species in Japan. A: C. aquatica, B: C. peduncularis and C. saginoides, arrow shows KDZ, C. saginoides; solid circles show C. peduncularis. See table 1 for KDZ.

2A). The sessile capsules or with pedicels elon- This is the first report of bothCrassula peduncu- gating to 15 mm (Fig. 1B) and the striate seed sur- laris and C. saginoides in Japan1). face with 2–5 papillae per cell (Fig. 2B) were identical to Crassula peduncularis (Sm.) Meigen. History of Naturalization of Crassula peduncu- Plants of types I and III shared the minutely rugu- laris and C. saginoides in Japan lose surface of the seeds (Fig. 2A & C), but the Specimens of Crassula peduncularis and C. type III plants differed from type I in that they saginoides have been collected in Japan only were often purple during the spring fruiting sea- since 2000, whereas C. aquatica has been col- son, has acute leaves, sessile capsules or fruiting lected throughout the 20th century (Table 4). The pedicels elongating to 15 mm and erect carpels. localities of C. peduncularis and C. saginoides Crassula aquatica is usually green, has obtuse are restricted to the Kinki District and the Kiso leaves, sessile or subsessile capsules, and ascend- River in central Honshu (Fig. 3B) where the two ing carpels. Crassula aquatica, C. saginoides species usually grow as weeds in extremely dis- and C. solieri are difficult to distinguish because turbed, damp places, such as in nurseries where of distinguishing microscopic characteristics. aquarium plants are grown, in rice paddies and in Crassula aquatica and C. saginoides have seeds river beds. The findings strongly suggest that the with a rugulose surface, but the seeds of C. sol- two species have become naturalized in Japan ieri have a smooth, shining surface (Bywater & and are in the early stages of invasion. Wickens 1984). Crassula saginoides has minutely rugulose seeds (Fig. 2C) different from those Notes on Crassula aquatica and C. saginoides of C. solieri. Crassula aquatica and C. saginoi- Some taxonomists (i.e. Moran 2009) treat des are similar, but the fruiting pedicels of C. Crassula saginoides as a synonym of C. aquati- saginoides are elongate at maturity. Consequent- ca, and there has been controversy regarding ly, we identified type III asC. saginoides because whether C. aquatica and C. saginoides should be its elongated pedicels were up to 15 mm long. treated as separate species. Bywater & Wickens 124 Acta Phytotax. Geobot. Vol. 70

Table 2. Ribotypes and variable sites in nrITS. Sequence position (bp) Ribotype 36 549 636 Accession No. A G T T LC379228 B A T T LC379229 C A G G LC379230

Table 3. Chlorotypes and variable sites in three cpDNA intergenic spacers. Sequence position (bp) trnHGUG-psbA1) (305bp) trnCGCA -rpoB2) (525bp) 3’trnVUAC-ndhC3) (203bp) Chlorotype 57–81 145 156 199 53 56 105 224–281 74 187 4) 5) A N25 T A C C A C N58 C C 4) B N25 T A C C A C - C C 4) C N25 G A A C C C - A T 4) D I25 G G A A A T - A T 1) Accession Number: LC379231 (Chlorotype A and B), LC379232 (Chlorotype C), LC379233 (Chlorotype D). 2) Accession Number: LC379234 (Chlorotype A), LC379235 (Chlorotype B), LC379236 (Chlorotype C), LC379237 (Chlorotype D). 3) Accession Number: LC379238 (Chlorotype A and B), LC379239 (Chlorotype C and D). 4) N25= GAACTCTTGATATATCAAGAGGGTG, I25 = inversion of N25 = CACCCTCTTGATATATCAAGAGTTC. 5) N58=AATAACAATAACATAATAAATTAACAATTGATACATAACTAATTTATATTAATTCGTT

(1984) advocated that the two species are differ- Basionym. Tillaea peduncularis Sm. in Rees ent by emphasizing the pedicel length at maturi- Cyclop. 35: Tillaea 4 (1819), holotype: Uruguay, ty. They also noted that Crassula aquatica occurs Montevideo, Commerson s.n. (LINN). in coastal salt marshes, while C. saginoides grows in wet places inland. Moran (2009), how- Similar to C. aquatica and C. saginoides, but seeds with 2–5 papillae on each cell of the striate seed surface. Dis- ever, regarded C. saginoides as a mere inland tinguishable from C. aquatica in the following characters phenotypic phase of C. aquatica because their (but C. saginoides shares same characters): plants often habitats are not clearly distinct. purple (green in C. aquatica) in fruit: leaves always acute Our morphological observations revealed ad- (obtuse, but sometimes acute in C. aquatica), 2–5 mm ditional differences between Crassula aquatica long (3–7 mm long in C. aquatica): pedicels on lower part of shoots often elongate to 15 mm at maturity (capsule and C. saginoides are summarized in Table 5. sessile or subsessile in C. aquatica): carpels always erect Molecular data also support recognition of two at maturity (ascending to nearly patent or sometimes taxa (Fig.4). Crassula aquatica sometimes oc- erect in C. aquatica). curs inland in Japan (Fig. 3), although it usually grows in coastal areas (i.e. Fujii & Kinoshita Flowers. April to May, usually earlier than C. 2011, Kasai 2013), which is not consistent with aquatica. the statements by Bywater & Wickens (1984) and Distribution. South America; naturalized in Moran (2009). This strongly suggests that the Japan (Honshu, Kinki District). morphological differences are not due to pheno- Habitat. Wet, muddy places; rice paddies, typic adaptation to the habitat, but are genetically nurseries of aquatic plants, river beds. fixed traits. We therefore agree with Bywater & Japanese name. Nagae-azumatsumekusa. Wickens (1984) in concluding that the two taxa See Bywater & Wickens (1984) for more in- are independent species. formation. Notes. Recognized as C. aquatica (Kimura Taxonomic Notes 2007); recently colonizing areas around Yodo Crassula peduncularis (Sm.) Meigen in Bot. River in Osaka and Kyoto prefectures, Japan. Jahrb. Syst. 17: 239 (1893) and 18: 417 (1894). June 2019 Fujii & al. – Taxonomy of Exotic Crassula in Japan 125

ga 4175 (OSA), 4947 (OSA), 4979 (OSA), S. Fujii 16953 (KYO, TUS), 16955 (KYO, TNS, TUS), 16956 (KYO, TUS). Nara Pref.: Hase River, K. Seto 61508 (OSA); Tenri-shi, N. Morimoto 13397 (KYO, OSA); Yamato Riv- er, May 6, 2006, K. Gondo s.n. (OSA).

Crassula saginoides (Maxim.) Bywater & Wick- ens in Kew Bulletin 39(4): 708–710 (1984). Basionym. Tillaea saginoides Maxm. in Bull. Acad. Imp. Sci. Saint-Pétersbourg 26: 473 (1880), holotype: Mongolia, Irtysh, Potanin s.n. (LE).

Similar to C. peduncularis but different in seeds with rugulose-striate seed surface. Although C. aquatica shares Fig. 4. TCS network of chlorotypes in Crassula populations the same seed morphology, C. saginoides differs in the examined. See tables 1 and 4 for chlorotypes and their plants often purple (green in C. aquatica) during fruiting details. period: leaves always acute (obtuse, but sometimes acute in C. aquatica), 1.5–4 mm long (3–7 mm long in C. Specimens examined. Kyoto Pref.: Jyoyo-shi, S. Fujii aquatica): pedicels on lower part of shoots often elongat- 16949 (KYO, OSA, TNS, TUS), 16951 (KYO, OSA, TNS, ing to 15 mm in KDZ population (to 19 mm in Bywater & TUS); Yawata-shi, M. Kimura 2668 (OSA), 2674 (OSA), Wickens 1984) at maturity (capsules sessile or subsessile 2676 (OSA), 2706 (OSA); Yodo (Uji) River, S. Fujii 16952 in C. aquatica): carpels always erect at maturity (ascend- (KYO, OSA, TNS, TUS). Osaka Pref.: Hirakata-shi, M. ing to almost patent or sometimes erect in C. aquatica). Kimura 3149 (OSA); Yodo River, M. Kimura 1100 (OSA), 1524 (OSA), 1533 (OSA), 2237 (OSA), 2264 (OSA), 2267 Distribution. Central Asia (Mongolia), North (OSA), 2275 (OSA), M. Tanaka 3797 (KYO, OSA), T. Shi-

1) Table 4. Number of specimens and collected years in herbaria . Collected year TYPE I TYPE II & III sterile (Crassula aquatica) (C. peduncularis and C. saginoides) condition before 1900 5 0 0 1900–1919 5 0 0 1920–1939 19 0 1 1940–1959 13 0 0 1960–1979 11 0 0 1980–1999 10 0 0 2000–2015 31 18 2 1) INM, KYO, MAK, OSA, TI, TNS, TUS, Gunma Museum of Natural History, Herbarium of Niigata City.

Table 5. Morphological characters of three Crassula species. Crassula aquatica C. pedancularis C. saginoides plant color green in spring fruiting season purple in spring fruiting season purple in spring fruiting season leaves obtuse (sometimes acute) acute acute fruiting pedicels sessile or subsessile 5.5–19 mm* 2–19 mm* (up to 15 mm in our materials) (up to 15 mm in our materials) carpels ascending or patent erect erect (sometimes erect) surface of seeds rugulose 2–5 papillate on each cell rugulose *Bywater & Wickens (1984) 126 Acta Phytotax. Geobot. Vol. 70

America, South America; naturalized in Portugal conducting the DNA experiments. We also thank the her- (reported as Tillaea bonariensis) and Japan (Hon- barium staffs of INM, KYO, MAK, OSA, TI, TNS, TUS, Gunma Museum of Natural History and Herbarium of Ni- shu, Kiso River). igata City. This study was partly supported by JSPS KA- Habitat. Wet, muddy places. KENHI (26281051, 16H04733). Japanese name. Azumatsumekusa-modoki. See Bywater & Wickens (1984) for more information.

Notes. Crassula saginoides was described References from a specimen collected in Mongolia. It has been treated as a synonym of both C. aquatica L. Borisova, A. G. 1939. Crassulaceae. In: Yuzepchuk, S. V. in North America (Moran 2009) and C. vaillantii (ed.), Fl. U.S.S.R. vol. 9 Rosales and Sarraceniales, pp. 8–105. Izdatel’stvo Akademii Nauk USSR, Mosk- Willd. in Russia (Borisova 1939), but has not va-Leningrad (translated from Russian in 1971). been reported from Europe (Webb 1993), China Bywater, M. & G. E. Wickens. 1984. New World species (Kunjun 2001), or Japan (Ohba 2001). Crassula of the genus Crassula. Kew Bull. 39: 699-728. saginoides is clearly distinguishable from C. vail- Clement, M., D. Posada & K. Crandal. 2000. TCS: a com- lantii, the morphology of which is as follows; puter program to estimate gene genealogies. Molev. Ecol. 9: 1657–1660 leaves obtuse (acute in C. saginoides) and 1–2 Doyle, J. J. & J. L. Doyle. 1990. Isolation of plant DNA mm long (1.5–4 mm in C. saginoides) and flow- from fresh tissue. Focus 12: 13–15. ers in cymes (solitary in C. saginoides). Although Fujii, S. & S. Kinoshita. 2011. New records of Tillaea Bywater & Wickens (1984) showed differences in aquatica (Crassulaceae) from Shikoku district. Bun- pedicel length between C. saginoides and C. rui 11: 49–52 (in Japanese). Hall, T. A. 1999. BioEdit: a user-friendly biological se- aquatica, C. saginoides shows large variation in quence alignment editor and analysis program for pedicel length, even within the same plant, with Windows 95/98/NT. Nucl. Acid Symp. 41: 95–98. the longest pedicels usually on the lower part of Kasai, H. 2013. The status of rare plants from mid-Sep- the stems. The upper pedicels are usually shorter, tember in 2012 to October in 2013 in the tsunami in- or the capsules are sessile. This morphologic undation areas after the Great East Japan Earthquake in 2011. Bull. Bot. Soc. Tohoku 17: 43–53 (in Japa- plasticity was probably responsible for its confu- nese). sion with C. aquatica. Here, we showed that these Katsuyama, T., H. Ohta & M. Matsumoto. 2005. Three two taxa have distinctly different genetic profiles naturalized plants collected from Mie Prefecture. despite their morphological similarities. Because Bull. Kanagawa Pref. Mus. (Nat. Sci.) 34: 65–68. we examined only one population of C. saginoi- Kimura, M. 2007. Yodogawade azumatsumekusano seii- kuwo kakunin. [Tillaea aquatica was found at Yodo des, further surveys of this species from a wider River] Nature Study 53: 120 (in Japanese). area are needed. Kunjun, F. K. 2001. Tillaea. In: Zhengyi, W. & P. H. Ra- ven (eds.), Fl. China, vol. 8 Brassicaceae through Specimens examined. Gifu Pref.: Kiso River, S. Fujii Saxifragaceae, pp. 201–208. Science Press Beijing & & Maki 17313 (KYO, OSA, TNS, TUS). Missouri Bot. Gard. Press, St. Louis. Moran, R. V. 1994. Crassulaceae, Stonecrop Family. J. Arizona-Nevada Acad. Sci. 27: 190–194. Moran, R. V. 2009. Crassula. In: Flora of North America 1) Katsuyama reported two newly naturalized Crassula Editorial Committee (ed.), Fl. North America North species, C. decumbens and C. peducularis, in Flora of Mexico vol. 8 Magnoliophyta: Paeoniaceae to Erica- Kanagawa 2018, 719–721 pp, Odawara, published on Dec. ceae, pp. 150–155. Oxford Univ. Press, New York. 10, 2018. Mort, M. E., C. P. Randle, P. Burgoyne, G. Smith, E. Jaarsveld & S. D. Hopper. 2009. Analysis of cpDNA matK sequence data place Tillaea (Crassulaceae) We would like to thank Drs. T. Katsuyama, T. Ohmori, within Crassula. Pl. Syst. Evol. 283: 211–217. and A. Shirosaka, Messrs. S. Kinoshita, T. Umehara, K. Ohba, H. 2001. Crassulaceae. In: Iwatsuki, K, D. E. Bouf- Yamamoto, M. Kimura, and T. Fujii for information re- ford & H. Ohba (eds.), Fl. Japan. Volume IIb. pp. 10– garding the plants in this study, and Mr. D. Nakazawa for 31. Kodansha, Tokyo. June 2019 Fujii & al. – Taxonomy of Exotic Crassula in Japan 127

Shaw, J., E. B. Lickey, J. T. Beck, S. B. Farmer, W. Liu, J. es, A. O. Chater, J. R. Edmondson, V. H. Heywood, Miller, K. C. Siripun, C. T. Winder, E. E. Schiling & D. M. Moore, D. H. Valentine, S. M. Walters & D. A. R. L. Small. 2005. The tortoise and the hare II: Rela- Webb (eds.), Flora Europaea vol. 1: Psilotaceae to tive utility of 21 noncoding chloroplast DNA se- Platanaceae second edition, pp. 422–423. Cambridge quences for phylogenetic analysis. Amer. J. Bot. 92: Univ. Press, Cambridge. 142–166. White, T. J, T. Bruns, S. Lee & J. Taylor. 1990. Amplifica- Shaw, J., E. B. Lickey, E. E. Schiling & R. L. Small. 2007. tion and direct sequencing of fungal ribosomal RNA Comparison of whole chloroplast genome sequences genes for phylogenetics. In: Innis, M. A., D. H. Gel- to choose noncoding regions for phylogenetic studies fand, J. J. Sninsky & T. J. White (eds.), PCR Proto- in angiosperms: the tortoise and the hare III. Amer. J. cols: A Guide to Methods and Applications. pp. 315– Bot. 94: 275–288. 322. Academic Press, New York. Webb, D. A. 1993. Crassula. In: Tutin, T. G., N. A. Burg-

Received May 8, 2018; accepted September 7, 2018