Drosophila Cuticle Protein Gene* (Insertion Mutation/Promoter Mutation/T-A-T-A Box/Repeated Sequence) MICHAEL P
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Mechanical Forces Induce an Asthma Gene Signature in Healthy Airway Epithelial Cells Ayşe Kılıç1,10, Asher Ameli1,2,10, Jin-Ah Park3,10, Alvin T
www.nature.com/scientificreports OPEN Mechanical forces induce an asthma gene signature in healthy airway epithelial cells Ayşe Kılıç1,10, Asher Ameli1,2,10, Jin-Ah Park3,10, Alvin T. Kho4, Kelan Tantisira1, Marc Santolini 1,5, Feixiong Cheng6,7,8, Jennifer A. Mitchel3, Maureen McGill3, Michael J. O’Sullivan3, Margherita De Marzio1,3, Amitabh Sharma1, Scott H. Randell9, Jefrey M. Drazen3, Jefrey J. Fredberg3 & Scott T. Weiss1,3* Bronchospasm compresses the bronchial epithelium, and this compressive stress has been implicated in asthma pathogenesis. However, the molecular mechanisms by which this compressive stress alters pathways relevant to disease are not well understood. Using air-liquid interface cultures of primary human bronchial epithelial cells derived from non-asthmatic donors and asthmatic donors, we applied a compressive stress and then used a network approach to map resulting changes in the molecular interactome. In cells from non-asthmatic donors, compression by itself was sufcient to induce infammatory, late repair, and fbrotic pathways. Remarkably, this molecular profle of non-asthmatic cells after compression recapitulated the profle of asthmatic cells before compression. Together, these results show that even in the absence of any infammatory stimulus, mechanical compression alone is sufcient to induce an asthma-like molecular signature. Bronchial epithelial cells (BECs) form a physical barrier that protects pulmonary airways from inhaled irritants and invading pathogens1,2. Moreover, environmental stimuli such as allergens, pollutants and viruses can induce constriction of the airways3 and thereby expose the bronchial epithelium to compressive mechanical stress. In BECs, this compressive stress induces structural, biophysical, as well as molecular changes4,5, that interact with nearby mesenchyme6 to cause epithelial layer unjamming1, shedding of soluble factors, production of matrix proteins, and activation matrix modifying enzymes, which then act to coordinate infammatory and remodeling processes4,7–10. -
Genome-Wide Copy Number Variant Analysis For
An et al. BMC Medical Genomics (2016) 9:2 DOI 10.1186/s12920-015-0163-4 RESEARCH ARTICLE Open Access Genome-wide copy number variant analysis for congenital ventricular septal defects in Chinese Han population Yu An1,2,4, Wenyuan Duan3, Guoying Huang4, Xiaoli Chen5,LiLi5, Chenxia Nie6, Jia Hou4, Yonghao Gui4, Yiming Wu1, Feng Zhang2, Yiping Shen7, Bailin Wu1,4,7* and Hongyan Wang8* Abstract Background: Ventricular septal defects (VSDs) constitute the most prevalent congenital heart disease (CHD), occurs either in isolation (isolated VSD) or in combination with other cardiac defects (complex VSD). Copy number variation (CNV) has been highlighted as a possible contributing factor to the etiology of many congenital diseases. However, little is known concerning the involvement of CNVs in either isolated or complex VSDs. Methods: We analyzed 154 unrelated Chinese individuals with VSD by chromosomal microarray analysis. The subjects were recruited from four hospitals across China. Each case underwent clinical assessment to define the type of VSD, either isolated or complex VSD. CNVs detected were categorized into syndrom related CNVs, recurrent CNVs and rare CNVs. Genes encompassed by the CNVs were analyzed using enrichment and pathway analysis. Results: Among 154 probands, we identified 29 rare CNVs in 26 VSD patients (16.9 %, 26/154) and 8 syndrome-related CNVs in 8 VSD patients (5.2 %, 8/154). 12 of the detected 29 rare CNVs (41.3 %) were recurrently reported in DECIPHER or ISCA database as associated with either VSD or general heart disease. Fifteen genes (5 %, 15/285) within CNVs were associated with a broad spectrum of complicated CHD. -
Role of RUNX1 in Aberrant Retinal Angiogenesis Jonathan D
Page 1 of 25 Diabetes Identification of RUNX1 as a mediator of aberrant retinal angiogenesis Short Title: Role of RUNX1 in aberrant retinal angiogenesis Jonathan D. Lam,†1 Daniel J. Oh,†1 Lindsay L. Wong,1 Dhanesh Amarnani,1 Cindy Park- Windhol,1 Angie V. Sanchez,1 Jonathan Cardona-Velez,1,2 Declan McGuone,3 Anat O. Stemmer- Rachamimov,3 Dean Eliott,4 Diane R. Bielenberg,5 Tave van Zyl,4 Lishuang Shen,1 Xiaowu Gai,6 Patricia A. D’Amore*,1,7 Leo A. Kim*,1,4 Joseph F. Arboleda-Velasquez*1 Author affiliations: 1Schepens Eye Research Institute/Massachusetts Eye and Ear, Department of Ophthalmology, Harvard Medical School, 20 Staniford St., Boston, MA 02114 2Universidad Pontificia Bolivariana, Medellin, Colombia, #68- a, Cq. 1 #68305, Medellín, Antioquia, Colombia 3C.S. Kubik Laboratory for Neuropathology, Massachusetts General Hospital, 55 Fruit St., Boston, MA 02114 4Retina Service, Massachusetts Eye and Ear Infirmary, Department of Ophthalmology, Harvard Medical School, 243 Charles St., Boston, MA 02114 5Vascular Biology Program, Boston Children’s Hospital, Department of Surgery, Harvard Medical School, 300 Longwood Ave., Boston, MA 02115 6Center for Personalized Medicine, Children’s Hospital Los Angeles, Los Angeles, 4650 Sunset Blvd, Los Angeles, CA 90027, USA 7Department of Pathology, Harvard Medical School, 25 Shattuck St., Boston, MA 02115 Corresponding authors: Joseph F. Arboleda-Velasquez: [email protected] Ph: (617) 912-2517 Leo Kim: [email protected] Ph: (617) 912-2562 Patricia D’Amore: [email protected] Ph: (617) 912-2559 Fax: (617) 912-0128 20 Staniford St. Boston MA, 02114 † These authors contributed equally to this manuscript Word Count: 1905 Tables and Figures: 4 Diabetes Publish Ahead of Print, published online April 11, 2017 Diabetes Page 2 of 25 Abstract Proliferative diabetic retinopathy (PDR) is a common cause of blindness in the developed world’s working adult population, and affects those with type 1 and type 2 diabetes mellitus. -
September 1997 Volume 24
Volume 1 - Number 1 May - September 1997 Volume 24 - Number 6 June 2020 Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST-CNRS Scope The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases. It is made for and by: clinicians and researchers in cytogenetics, molecular biology, oncology, haematology, and pathology. One main scope of the Atlas is to conjugate the scientific information provided by cytogenetics/molecular genetics to the clinical setting (diagnostics, prognostics and therapeutic design), another is to provide an encyclopedic knowledge in cancer genetics. The Atlas deals with cancer research and genomics. It is at the crossroads of research, virtual medical university (university and post-university e-learning), and telemedicine. It contributes to "meta-medicine", this mediation, using information technology, between the increasing amount of knowledge and the individual, having to use the information. Towards a personalized medicine of cancer. It presents structured review articles ("cards") on: 1- Genes, 2- Leukemias, 3- Solid tumors, 4- Cancer-prone diseases, and also 5- "Deep insights": more traditional review articles on the above subjects and on surrounding topics. It also present 6- Case reports in hematology and 7- Educational items in the various related topics for students in Medicine and in Sciences. The Atlas of Genetics and -
Supplementary Data
Supplementary Fig. 1 A B Responder_Xenograft_ Responder_Xenograft_ NON- NON- Lu7336, Vehicle vs Lu7466, Vehicle vs Responder_Xenograft_ Responder_Xenograft_ Sagopilone, Welch- Sagopilone, Welch- Lu7187, Vehicle vs Lu7406, Vehicle vs Test: 638 Test: 600 Sagopilone, Welch- Sagopilone, Welch- Test: 468 Test: 482 Responder_Xenograft_ NON- Lu7860, Vehicle vs Responder_Xenograft_ Sagopilone, Welch - Lu7558, Vehicle vs Test: 605 Sagopilone, Welch- Test: 333 Supplementary Fig. 2 Supplementary Fig. 3 Supplementary Figure S1. Venn diagrams comparing probe sets regulated by Sagopilone treatment (10mg/kg for 24h) between individual models (Welsh Test ellipse p-value<0.001 or 5-fold change). A Sagopilone responder models, B Sagopilone non-responder models. Supplementary Figure S2. Pathway analysis of genes regulated by Sagopilone treatment in responder xenograft models 24h after Sagopilone treatment by GeneGo Metacore; the most significant pathway map representing cell cycle/spindle assembly and chromosome separation is shown, genes upregulated by Sagopilone treatment are marked with red thermometers. Supplementary Figure S3. GeneGo Metacore pathway analysis of genes differentially expressed between Sagopilone Responder and Non-Responder models displaying –log(p-Values) of most significant pathway maps. Supplementary Tables Supplementary Table 1. Response and activity in 22 non-small-cell lung cancer (NSCLC) xenograft models after treatment with Sagopilone and other cytotoxic agents commonly used in the management of NSCLC Tumor Model Response type -
Supp Table 6.Pdf
Supplementary Table 6. Processes associated to the 2037 SCL candidate target genes ID Symbol Entrez Gene Name Process NM_178114 AMIGO2 adhesion molecule with Ig-like domain 2 adhesion NM_033474 ARVCF armadillo repeat gene deletes in velocardiofacial syndrome adhesion NM_027060 BTBD9 BTB (POZ) domain containing 9 adhesion NM_001039149 CD226 CD226 molecule adhesion NM_010581 CD47 CD47 molecule adhesion NM_023370 CDH23 cadherin-like 23 adhesion NM_207298 CERCAM cerebral endothelial cell adhesion molecule adhesion NM_021719 CLDN15 claudin 15 adhesion NM_009902 CLDN3 claudin 3 adhesion NM_008779 CNTN3 contactin 3 (plasmacytoma associated) adhesion NM_015734 COL5A1 collagen, type V, alpha 1 adhesion NM_007803 CTTN cortactin adhesion NM_009142 CX3CL1 chemokine (C-X3-C motif) ligand 1 adhesion NM_031174 DSCAM Down syndrome cell adhesion molecule adhesion NM_145158 EMILIN2 elastin microfibril interfacer 2 adhesion NM_001081286 FAT1 FAT tumor suppressor homolog 1 (Drosophila) adhesion NM_001080814 FAT3 FAT tumor suppressor homolog 3 (Drosophila) adhesion NM_153795 FERMT3 fermitin family homolog 3 (Drosophila) adhesion NM_010494 ICAM2 intercellular adhesion molecule 2 adhesion NM_023892 ICAM4 (includes EG:3386) intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)adhesion NM_001001979 MEGF10 multiple EGF-like-domains 10 adhesion NM_172522 MEGF11 multiple EGF-like-domains 11 adhesion NM_010739 MUC13 mucin 13, cell surface associated adhesion NM_013610 NINJ1 ninjurin 1 adhesion NM_016718 NINJ2 ninjurin 2 adhesion NM_172932 NLGN3 neuroligin -
Characterization of Chronic Lymphocytic Leukemia by Acgh/MLPA
UNIVERSIDADE DE LISBOA FACULDADE DE CIÊNCIAS DEPARTAMENTO DE BIOLOGIA VEGETAL Characterization of Chronic Lymphocytic Leukemia by aCGH/MLPA Diana Cristina Antunes Candeias Adão Mestrado em Biologia Molecular e Genética Dissertação orientada por: Professora Doutora Isabel Maria Marques Carreira Professor Doutor Manuel Carmo Gomes 2018 Agradecimentos Começo por agradecer ao CIMAGO e à ACIMAGO por todo o apoio prestado no âmbito do desenvolvimento deste trabalho, tanto a nível logístico como financeiro. Agradeço também ao Laboratório de Citogenética e Genómica e ao Laboratório de Oncologia e Hematologia da FMUC, pelo fornecimento dos equipamentos e bens necessários à realização deste projeto. À Professora Doutora Isabel Marques Carreira, muito obrigada por me permitir desenvolver o meu projeto de tese de mestrado no Laboratório de Citogenética e Genómica da FMUC e por orientar este trabalho. Agradeço tudo o que me ensinou, o apoio e, acima de tudo, o exemplo que é como profissional na área da Genética Humana, que em muito contribuiu para o meu desenvolvimento e crescimento a nível académico e profissional. Ao Professor Doutor Manuel Carmo Gomes, pela sempre célere e incondicional orientação durante este ano. Mostrou-se sempre disponível para responder às minhas dúvidas e questões, e por isso demonstro o meu agradecimento. À Professora Doutora Ana Bela Sarmento Ribeiro, pela proposta que me apresentou para trabalhar no âmbito da Leucemia Linfocítica Crónica, pelo apoio nas correções necessárias, e pela possibilidade que me deu de realizar alguns passos do meu trabalho nas instalações do Laboratório de Oncologia e Hematologia da FMUC. Ao Miguel Pires, por todos os ensinamentos ao nível do trabalho laboratorial, pela enorme disponibilidade e apoio na realização desta tese, bem como pela amizade e conselhos que me deu. -
Chromosomal Microarray Analysis in Turkish Patients with Unexplained Developmental Delay and Intellectual Developmental Disorders
177 Arch Neuropsychitry 2020;57:177−191 RESEARCH ARTICLE https://doi.org/10.29399/npa.24890 Chromosomal Microarray Analysis in Turkish Patients with Unexplained Developmental Delay and Intellectual Developmental Disorders Hakan GÜRKAN1 , Emine İkbal ATLI1 , Engin ATLI1 , Leyla BOZATLI2 , Mengühan ARAZ ALTAY2 , Sinem YALÇINTEPE1 , Yasemin ÖZEN1 , Damla EKER1 , Çisem AKURUT1 , Selma DEMİR1 , Işık GÖRKER2 1Faculty of Medicine, Department of Medical Genetics, Edirne, Trakya University, Edirne, Turkey 2Faculty of Medicine, Department of Child and Adolescent Psychiatry, Trakya University, Edirne, Turkey ABSTRACT Introduction: Aneuploids, copy number variations (CNVs), and single in 39 (39/123=31.7%) patients. Twelve CNV variant of unknown nucleotide variants in specific genes are the main genetic causes of significance (VUS) (9.75%) patients and 7 CNV benign (5.69%) patients developmental delay (DD) and intellectual disability disorder (IDD). were reported. In 6 patients, one or more pathogenic CNVs were These genetic changes can be detected using chromosome analysis, determined. Therefore, the diagnostic efficiency of CMA was found to chromosomal microarray (CMA), and next-generation DNA sequencing be 31.7% (39/123). techniques. Therefore; In this study, we aimed to investigate the Conclusion: Today, genetic analysis is still not part of the routine in the importance of CMA in determining the genomic etiology of unexplained evaluation of IDD patients who present to psychiatry clinics. A genetic DD and IDD in 123 patients. diagnosis from CMA can eliminate genetic question marks and thus Method: For 123 patients, chromosome analysis, DNA fragment analysis alter the clinical management of patients. Approximately one-third and microarray were performed. Conventional G-band karyotype of the positive CMA findings are clinically intervenable. -
Patient-Derived Organoids and Orthotopic Xenografts of Primary and Recurrent Gliomas Represent Relevant Patient Avatars for Precision Oncology
Henry Ford Health System Henry Ford Health System Scholarly Commons Neurosurgery Articles Neurosurgery 12-1-2020 Patient-derived organoids and orthotopic xenografts of primary and recurrent gliomas represent relevant patient avatars for precision oncology Anna Golebiewska Ann-Christin Hau Anaïs Oudin Daniel Stieber Yahaya A. Yabo See next page for additional authors Follow this and additional works at: https://scholarlycommons.henryford.com/neurosurgery_articles Authors Anna Golebiewska, Ann-Christin Hau, Anaïs Oudin, Daniel Stieber, Yahaya A. Yabo, Virginie Baus, Vanessa Barthelemy, Eliane Klein, Sébastien Bougnaud, Olivier Keunen, May Wantz, Alessandro Michelucci, Virginie Neirinckx, Arnaud Muller, Tony Kaoma, Petr V. Nazarov, Francisco Azuaje, Alfonso De Falco, Ben Flies, Lorraine Richart, Suresh Poovathingal, Thais Arns, Kamil Grzyb, Andreas Mock, Christel Herold-Mende, Anne Steino, Dennis Brown, Patrick May, Hrvoje Miletic, Tathiane M. Malta, Houtan Noushmehr, Yong-Jun Kwon, Winnie Jahn, Barbara Klink, Georgette Tanner, Lucy F. Stead, Michel Mittelbronn, Alexander Skupin, Frank Hertel, Rolf Bjerkvig, and Simone P. Niclou Acta Neuropathologica (2020) 140:919–949 https://doi.org/10.1007/s00401-020-02226-7 ORIGINAL PAPER Patient‑derived organoids and orthotopic xenografts of primary and recurrent gliomas represent relevant patient avatars for precision oncology Anna Golebiewska1 · Ann‑Christin Hau1 · Anaïs Oudin1 · Daniel Stieber1,2 · Yahaya A. Yabo1,3 · Virginie Baus1 · Vanessa Barthelemy1 · Eliane Klein1 · Sébastien Bougnaud1 · Olivier Keunen1,4 · May Wantz1 · Alessandro Michelucci1,5,6 · Virginie Neirinckx1 · Arnaud Muller4 · Tony Kaoma4 · Petr V. Nazarov4 · Francisco Azuaje4 · Alfonso De Falco2,3,7 · Ben Flies2 · Lorraine Richart3,7,8,9 · Suresh Poovathingal6 · Thais Arns6 · Kamil Grzyb6 · Andreas Mock10,11,12,13 · Christel Herold‑Mende10 · Anne Steino14,15 · Dennis Brown14,15 · Patrick May6 · Hrvoje Miletic16,17 · Tathiane M. -
Plastin L (LCP1) (NM 002298) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC201670 Plastin L (LCP1) (NM_002298) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Plastin L (LCP1) (NM_002298) Human Tagged ORF Clone Tag: Myc-DDK Symbol: LCP1 Synonyms: CP64; HEL-S-37; L-PLASTIN; LC64P; LPL; PLS2 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 Plastin L (LCP1) (NM_002298) Human Tagged ORF Clone – RC201670 ORF Nucleotide >RC201670 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCAGAGGATCAGTGTCCGATGAGGAAATGATGGAGCTCAGAGAAGCTTTTGCCAAAGTTGATACTG ATGGCAATGGATACATCAGCTTCAATGAGTTGAATGACTTGTTCAAGGCTGCTTGCTTGCCTTTGCCTGG GTATAGAGTACGAGAAATTACAGAAAACCTGATGGCTACAGGTGATCTGGACCAAGATGGAAGGATCAGC TTTGATGAGTTTATCAAGATTTTCCATGGCCTAAAAAGCACAGATGTTGCCAAGACCTTTAGAAAAGCAA TCAATAAGAAGGAAGGGATTTGTGCAATCGGTGGTACTTCAGAGCAGTCTAGCGTTGGCACCCAACACTC CTATTCAGAGGAAGAAAAGTATGCCTTTGTCAACTGGATAAACAAAGCCCTGGAAAATGATCCTGATTGT CGGCATGTCATCCCAATGAACCCAAACACGAATGATCTCTTTAATGCTGTTGGAGATGGCATTGTCCTTT GTAAAATGATCAACCTGTCAGTGCCAGACACAATTGATGAAAGAACAATCAACAAAAAGAAGCTAACCCC -
Genetic Analysis of 400 Patients Refines Understanding And
BASIC RESEARCH www.jasn.org Genetic Analysis of 400 Patients Refines Understanding and Implicates a New Gene in Atypical Hemolytic Uremic Syndrome Fengxiao Bu,1,2 Yuzhou Zhang,2 Kai Wang,3 Nicolo Ghiringhelli Borsa,2 Michael B. Jones,2 Amanda O. Taylor,2 Erika Takanami,2 Nicole C. Meyer,2 Kathy Frees,2 Christie P. Thomas,4 Carla Nester,2,4,5 and Richard J.H. Smith2,4,5 1Medical Genetics Center, Southwest Hospital, Chongqing, China; and 2Molecular Otolaryngology and Renal Research Laboratories, 3College of Public Health, 4Division of Nephrology, Department of Internal Medicine, Carver College of Medicine, and 5Department of Pediatrics, Carver College of Medicine, University of Iowa, Iowa City, Iowa ABSTRACT Background Genetic variation in complement genes is a predisposing factor for atypical hemolytic uremic syndrome (aHUS), a life-threatening thrombotic microangiopathy, however interpreting the effects of genetic variants is challenging and often ambiguous. Methods We analyzed 93 complement and coagulation genes in 400 patients with aHUS, using as controls 600 healthy individuals from Iowa and 63,345 non-Finnish European individuals from the Genome Aggre- gation Database. After adjusting for population stratification, we then applied the Fisher exact, modified Poisson exact, and optimal unified sequence kernel association tests to assess gene-based variant burden. We also applied a sliding-window analysis to define the frequency range over which variant burden was significant. Results We found that patients with aHUS are enriched for ultrarare coding variants in the CFH, C3, CD46, CFI, DGKE,andVTN genes. The majority of the significance is contributed by variants with a minor allele frequency of ,0.1%. -
LCP1 Preferentially Binds Clasped Αmβ2 Integrin and Attenuates Leukocyte Adhesion Under Flow Hui-Yuan Tseng1, Anna V
© 2018. Published by The Company of Biologists Ltd | Journal of Cell Science (2018) 131, jcs218214. doi:10.1242/jcs.218214 RESEARCH ARTICLE LCP1 preferentially binds clasped αMβ2 integrin and attenuates leukocyte adhesion under flow Hui-yuan Tseng1, Anna V. Samarelli1, Patricia Kammerer1, Sarah Scholze1, Tilman Ziegler1, Roland Immler3, Roy Zent4,5, Markus Sperandio3, Charles R. Sanders6, Reinhard Fässler1,2 and Ralph T. Böttcher1,2,* ABSTRACT which bind to specific sites in the β integrin cytoplasmic domain and Integrins are α/β heterodimers that interconvert between inactive and to lipids of the nearby plasma membrane. The consequence of talin active states. In the active state the α/β cytoplasmic domains recruit and kindlin binding is the dissociation of the transmembrane and α β integrin-activating proteins and separate the transmembrane and cytoplasmic (TMcyto) domains of the and subunits, leading to α β cytoplasmic (TMcyto) domains (unclasped TMcyto). Conversely, in the separation (unclasping) of the proximal legs of the / integrin the inactive state the α/β TMcyto domains bind integrin-inactivating ectodomain, followed by a conformational change in the proteins, resulting in the association of the TMcyto domains (clasped extracellular domain that allows high-affinity ligand binding TMcyto). Here, we report the isolation of integrin cytoplasmic tail (Campbell and Humphries, 2011; Kim et al., 2011; Shattil et al., interactors using either lipid bicelle-incorporated integrin TMcyto 2010). Although it is evident that the high-affinity conformation can domains (α5, αM, αIIb, β1, β2 and β3 integrin TMcyto) or a clasped, be reversed, it is not entirely clear how this is achieved at the lipid bicelle-incorporated αMβ2 TMcyto.