Neuron-Glial Interaction in the Developing Peripheral Nervous

Everything great that ever happened in this world happened first in somebody’s imagination Astrid Lindgren

List of Papers

This thesis is based on the following papers, which are referred to in the text by their Roman numerals.

I Brännvall K. Corell M. Forsberg-Nilsson K. and Fex Sven- ningsen Å. (2008) Environmental cues for CNS, PNS and ENS cells regulate CNS progenitor differentiation. NeuroReport, 19(13):1283–1289 II Corell, M., Wicher G., Fannon, A. M., Colman, D. R., Fex Svenningsen, Å. (2010) Spatiotemporal Distribution and Function of N-cadherin in Postnatal Schwann Cells: a Matter of Adhesion? Journal of Neuroscience Research, 88(11):2338- 2349 III Corell, M., Wicher G., Radomska, K., Trier Kjær M., Dağlıkoca, E. D., Fredriksson, R., Fex Svenningsen, Å. The function of GABA and its B receptor in Schwann cell development. (Manuscript)

Reprints were made with permission from the respective publishers.

Contents

Introduction ...... 11 Cell communication ...... 11 Development of the nervous system ...... 12 Development of the central nervous system ...... 12 Development of the peripheral nervous system ...... 13 Glial cells of the nervous system ...... 14 Glial cells of the central nervous system ...... 14 Glial cells of the peripheral nervous system ...... 15 Stem cells ...... 19 Neural stem cells ...... 19 Stem cell plasticity ...... 20 Transdifferential potency of NSCs and PNS progenitor cells ...... 21 Cell adhesion ...... 22 The cadherin superfamily ...... 22 N-cadherin ...... 23 GABA and GABA receptors ...... 25 GABAA receptor ...... 25 GABAB receptor ...... 26 GABA and GABAB receptors in PNS ...... 27 GABAB receptor function in Schwann cells ...... 28 Aims ...... 29 Materials and methods ...... 30 Animals ...... 30 Dissection and cell cultures ...... 30 NSC co-cultures ...... 30 Schwann cell development in DRG primary cultures ...... 31 Western blot ...... 31 Immunochemistry ...... 32 Paper I ...... 32 Papers II and III ...... 33 Quantifications and cell culture analysis ...... 34 Paper I ...... 34 Paper II ...... 34 Paper III ...... 34

mRNA expression analysis ...... 35 Reference genes ...... 35 Results and discussion ...... 37 Paper I: ...... 37 Paper II: ...... 38 Paper III ...... 40 Future perspectives ...... 43 Paper I: ...... 43 Paper II: ...... 44 Paper III: ...... 45 Acknowledgements ...... 46 References ...... 48

Abbreviations

AC Adenylate cyclase bACT β-actin bFGF Basic fibroblast growth factor BMP Bone morphigenic protein BrdU Bromodeoxyuridine Brn3a Brain-specific homeobox/POU domain protein 3A bTUB β-tubulin CAM Cell adhesion molecule cAMP Cyclic adenosine monophosphate cDNA Complementary DNA CNP 2',3'-cyclic nucleotide 3' phosphodiesterase CNS Central nervous system CNTF Cilary neurotophic factor CREB cAMP-responsive element binding protein CYCLO Cyclophilin DAPI 4',6-diamidino-2-phenylindole DRG Dorsal root ganglia EGF Epidermal growth factor EGFP Endogenous green fluorescent protein ES Embryonic stem FGF Fibroblast growth factor GABA Gamma aminobutyric acid GAD Glutamate decarboxylase GAPDH Glyceraldehyde 3-phosphate dehydrogenase GCPR G-protein coupled receptor GFAP Glial fibrillary acidic protein GOI Gene of interest H3b Histone protein 3 HKG Housekeeping gene IGF Insulin-like growth factor LIF Leukemia inhibitory factor MAG Myelin-associated glycoprotein MAPK Mitogen-activated protein kinase MBP Myelin basic protein NF-κB Nuclear factor-κB NG2 Chondroitin sulphate proteoglycan

NRG1 Neuregulin 1 NSC Neural stem cell NSCP Neural stem/precursor P0 Protein zero PCR Polymerase chain reaction PDGF Platelet-derived growth factor PI3K Phosphatidylinositol 3-kinase PKA Protein kinase A PMP22 Peripheral myelin protein 22 qPCR Quantitative PCR RA Retinoic acid RPL19 Ribosomal protein 19 SCP Schwann cell precursor SDCA Succinate dehydrogenase complex, subunit A Shh Sonic hedgehog SVZ Subventricular zone T3 Tyroid hormone triiodothyronin TGFβ Transforming growth factor beta

Introduction

Cell communication is fundamental for the development and maintenance of multicellular organisms. The nervous system, including the brain is, without doubt, the most sophisticated organ in the mammalian body. Cell communication governs most developmental processes as stem cell fate determination, migration, differentiation, synapse formation, myelination and the maintenance of a steady state in the fully developed mature organism. Many of these events are critical, and small errors can lead to growth retardation, malformations or diseases. Understanding the normal progress of nervous system development may help the discovery of new treatments for such disorders.

Cell communication Cells communicate with several hundreds of different signalling molecules, including proteins, small peptides, amino acids, nucleotides, steriods, retin- oids, fatty acid derivatives, and gases such as nitric oxide and carbon oxide. These molecules are commonly secreted by signalling cells either by exocy- tosis or by diffusion through the cell membrane. The signalling molecule binds to receptors on target cells which in turn activate an intrinsic signalling cascade that alters the behaviour of these cells (Alberts et al., 2002). These signals can either be soluble factors that are excreted to the surroundings or stay as membrane-bound molecules that mediate their signals by direct contact (Fig. 1). Soluble factors that are released to the surroundings can be carried over large distances to influence target cells. This type of signalling is called endocrine signalling. Other molecules only reach over short distances to affect neighbouring cells. This is called paracrine signalling, or autocrine signalling if the molecules are affecting the cells that emit the molecules (Lodish et al., 2004). Membrane-bound molecules can only affect other cells that are in direct contact. Such molecules are important for migration and assembly of distinct tissues and organs i.e. cell-cell adhesion (Lod- ish et al., 2004).

11 A B

1 2 3

Figure 1. The major types of cell signalling. A: Soluble factors are released and mediate autocrine signalling (1), paracrine signalling (2) or molecules that are transported long distances to reach peripheral cells via blood vessels (3). B: In membrane-bound signalling molecules are anchored in the cell membrane.

Development of the nervous system During gastrulation of the fertilized mammalian egg, three germ layers are formed: endoderm, mesoderm and ectoderm that generate the whole embryo. The endoderm gives rise to the lining of many internal organs, and the mesoderm becomes muscle and bone, while the ectoderm develops the skin and the nervous system. Neurulation is the stage when a large sheet of ectoder- mal cells forms the neural plate, which in turn folds and develops into the neural tube. During neurulation some cells of the neural plate are pinched off and give rinse to the neural crest (Fig. 2). This change is called the epithelial-mesenchymal transition. The neural tube develops into the brain and spinal cord i.e. central nervous system (CNS), while the neural crest gives rise to all the nerve tissue in the rest of the body i.e. peripheral nervous system (PNS) (Kandel et al., 2000).

Development of the central nervous system For proper development of the brain, the precursor cells of the neural tube must establish identity along the dorsal-ventral, anterior-posterior and left- right axis. This positional identity is acquired by various morphogens that are secreted from adjacent tissues (Fig. 2). The anterior-posterior axis is specified by factors such as basic fibroblast growth factor (bFGF) (Lamb and Harland, 1995), Wnt (McGrew et al., 1995) and retinoic acid (RA) (Papa- lopulu and Kintner, 1996), while the dorsal-ventral axis is specified by antagonistic signalling of bone morphogenic protein (BMP) and sonic hedgehog (Shh). This patterning results in the anterior part of the neural tube forming the brain, and the posterior part forming the spinal cord (Panchision and McKay, 2002).

12 Dorsal

BMPs Anterior NC

NT Right Left

bFGF Wnt RA Shh RA Posterior Ventral Figure 2. Establishment of the positional identity of the cells in the neural tube (NT). Dorsally migrating neural crest (NC) cells give rise to the peripheral nervous system.

Once the cells of the neural tube are specified they migrate and develop into different parts of the nervous system. The most complex migration process is found in the region where the cerebral cortex is formed (Nadarajah and Parnavelas, 2002). The cortical cell layers are built from the inside out, where young neurons migrate from the subventricular zone (SVZ) and turn into different types of mature neurons (Fig. 3). These migrating neurons are guided by so-called radial glial cells which are in contact with both the ventricular zone and the pial surface of the developing cortex (Rakic et al., 1974; Nadarajah and Parnavelas, 2002). The SVZ is also the origin of the glial cells of the CNS i.e. oligodendrocytes and astrocytes (Kandel et al., 2000).

Pial surface

Young neurons

Radial glia VZ Ventricle

Figure 3. The radial glial cells guide the migrating young neurons in the developing cortex.

Development of the peripheral nervous system The neural crest cells that arise from the dorsal part of the neural tube migrate along three different pathways in the periphery (Kandel et al., 2000).

13 Cells that migrate along the superficial pathway develop into pigment cells of the skin. Those that take the intermediate pathway via the somites form sensory ganglia and the ones taking a more medial pathway develop into sympathetic ganglia and the cells of the adrenal medulla. Neural crest cells thus give rise to all neurons and glial cell in the periphery; sensory, sympathetic and parasympathetic neurons, satellite cells, myelinating and nonmyelinating Schwann cells, and enteric neurons and glia and also smooth muscle cells and melanocytes of the skin (Kandel et al., 2000).

Glial cells of the nervous system Glial cells are essential for the nervous system to develop, function and communicate. Rudolf Wirchow, a German anatomist. first described this new cell type in the mid-nineteenth century and called it glia, believing that these cells provided a form of glue for the nervous system (Webster and Aström, 2009). Today’s knowledge about glial cells is of course far more refined. Neurons are dependent on their association with glia, not only for their physical support, supply of nutrients and clearance of extracellular molecules but also for enhancement and modulation of signal transmission (Fields and Stevens-Graham, 2002; Perea and Araque, 2010). In fact, every neuron is ensheathed by some kind of glial cell (Russell, 1990). The glial cells are divided into several cell types depending on localization and function.

Glial cells of the central nervous system The two major glial cell types present in the CNS are astrocytes and oligodendrocytes. Astrocytes are the most numerous glial subtype and are in constant contact with most other cell types in the CNS. They are irregular and star-shaped with long processes (Kandel et al., 2000) (Fig. 4A). Astro- cytes bring nutrients to the neurons. They are also associated with synapses where they have an important role in maintaining the homeostasis in the extracellular space between the nerve terminals by effectively take up the excess of potassium ions and neurotransmitters after neuronal firing (Kandel et al., 2000). Moreover, astrocytes are an important part of the blood-brain- barrier, which protects the brain from unwanted substances. Oligodendrocytes originate from migrating oligodendrocyte precursors in the SVZ and populate the white matter in the brain (Orentas and Miller, 1998). The oligodendrocytes, together with the Schwann cells of the PNS, form the most specialized cellular structure in the body, the myelin sheath (Kandel et al., 2000). This is a multilayered roll of cell membrane that insu- lates axons. The myelin sheath increases speed of nerve conductance, by making the electrical signal jump between nodes (saltatory conduction), and

14 functions as a physical barrier at the same time (Kandel et al., 2000). An oligodendrocyte makes an average of fifteen myelin internodes and can myelinate several axons simultaneously (Fig. 4C). A B C

Figure 4. The major glial cell types of the CNS. Astrocyte (A), microglia (B) and myelinating oligodendrocyte (C).

The CNS also contains microglia, but this cell type is not related to oligodendrocytes and astrocytes (Fig. 4B). Microglia are resident macrophage- like cells originating from blood monocytes and are associated with the immune system. This cell type functions as the brain’s immune cells and screens the local environment for any sign of pathogen intrusion (Kandel et al., 2000).

Glial cells of the peripheral nervous system The major type of glial cells in the PNS are the Schwann cells. They ensheath all axons and exists in two subtypes; myelinating and nonmyelinating Schwan cells. The myelinating Schwann cells form the insulation sheath around axons similar to oligodendrocytes, but in a 1:1 relationship of large calibre axons, whereas the nonmyeliating Schwann cells ensheath multiple thin calibre axons in so called Remak bundles (Fig. 5).

Figure 5. Schwann cells of the PNS. A myelinating Schwann cell (A) enwrap a segment of a large calibre axon while a nonmyelinating Schwann cell ensheath several thin calibre axons simultaneously (B).

Satellite cells are specialized glial cells that form a tight envelope around the neurons of the peripheral ganglia. Apart from their morphology, they share many properties with astrocytes of the CNS, supporting neurons with

15 essential molecules for neural transmission and clearance of extracellular neurotransmitters (Hanani, 2005). In response to injury satellite cells act with an upregulation of glial fibrillary acidic protein (GFAP), and may have a neuroprotective role (Hanani, 2010). Extensive research of satellite cell function indicates that these cells may be involved in pain modulation (Dubový et al., 2010; Jasmin et al., 2010; Villa et al., 2010). Another type of PNS glia is found in the enteric nervous system (ENS). These cells are relatively unknown but ensheath axons and neural cell bodies, just like Schwann cells and satellite cells, without producing myelin. Protein marker expression and morphology is more similar to that of astrocytes (Rühl et al., 2004). The enteric glial cells are a crucial part in the net- work of neurons, epithelial cells, mesenchymal cells and immune cells, all of which are essential for a functional intestine (Rühl et al., 2004).

Schwann cell development Schwann cells undergo three major transition stages to mature. First from neural crest stem cells to Schwann cell precursors (SCP), then SCPs develop into immature Schwann cells and finally these cells diverge into either myelinating or nonmyelinating Schwann cells. These different transition stages are characterized by different cell morphology and specific pattern of gene expression (Jessen and Mirsky, 2005) (Fig. 6). The SCPs that originate from the migrating neural crest stem cells are dependent on the activation of the transcription factor Sox10 (Britsch et al., 2001). When SCPs proliferate and migrate along the developing peripheral axons on embryonic day 14 (E14) in rat, the axon-derived protein neuregulin 1 (NRG1) is necessary for cell survival and proliferation (Dong et al., 1995). Two days later (E16) the SCPs develop into immature Schwann cells, a transition that is accelerated by receptors sensitive to fibroblast growth factor 2 (FGF2) and Notch proteins (Dong et al., 1999; Morrison et al., 2000).

Figure 6. The three major transition stages in Schwann cell development. Reprinted by permission from Macmillan Publishers Ltd: Nature Reviews Neuroscience (Jessen and Mirsky, 2005), copyright (2005).

16 Schwann cell proliferation Both SCPs and immature Schwann cells proliferate extensively during development. This proliferation is dependent of an axon-Schwann cell interactions, with the axon molecule neuregulin 1 (NRG1) type II as a signal ligand (Dong et al., 1995; Morrissey et al., 1995; Dong et al., 1999; Maurel and Salzer, 2000). The primary receptor for NRG1 is a heterodimer composed of the transmembrane tyrosine kinases ErbB2 and ErbB3 (Morrissey et al., 1995; Vartanian et al., 1997; Buonanno and Fischbach, 2001), which induce two known intracellular signal cascades: phosphatidylinositol 3-kinase (PI3K) pathway and mitogen-activated protein kinase (MAPK) pathway. Both of these pathways are involved in Schwann cell proliferation (Kim et al., 1997; Maurel and Salzer, 2000; He et al., 2011; Newbern et al., 2011). The protein kinase A (PKA) pathway is also associated with Schwan cell proliferation. The PKA pathway is commonly utilized in vitro, where adenylate cyclase (AC) can be activated by forskolin or cholera toxin. This, in turn increases the activity of cyclic adenosine monophosphate (cAMP) and thus the PKA pathway (Raff et al., 1978; Sobue et al., 1986). PKA phos- phorylates the transcription factor cAMP-responsive element binding protein (CREB) which leads to gene expression (Gonzalez et al., 1989). Another signal pathway associated with PKA has also been found. PKA can enhance the action of NRG1 type II, by the phosphorylation of the Erb2/3 receptor (Monje et al., 2008). This increases MAPK activity (Kim et al., 1997). Other factors that are implicated in Schwann cell proliferation, at least in vitro, either alone or together with cAMP analogs, are FGF2, transforming growth factor beta (TGFβ), platelet-derived growth factor (PDGF) and insulin-like growth factor (IGF) (Davis and Stroobant, 1990; Eccleston et al., 1990; Schumacher et al., 1993; Guénard et al., 1995; Fex Svenningsen and Kanje, 1996; Stewart et al., 1996).

Myelination The divergence of immature Schwann cells into the two mature Schwann cell types has been extensively studied, particularly the myelinating process. In rats, Schwann cells start the myelination process around birth, postnatal day 0 (P0) and the neurons of the PNS are fully myelinated at P30 (Brown and Asbury, 1981; Arroyo et al., 1998). The axonal thickness was believed to be the sole determining factor for Schwann cells myelination for decades. It was not until recently that NRG1 type III was found to be the key molecule regulating myelination (Michailov et al., 2004; Taveggia et al., 2005). Similar to Schwann cell proliferation, the NRG1 type III is expressed on the axon surface (Fig. 7) and acts via Erb2 and 3 receptors on the Schwann cells (Brinkmann et al., 2008). Here, the downstream signalling may be mediated by the PI3K/Akt pathway thus activating the transcription factor NF-κB (Limpert and Carter, 2010).

17 NRG1 type III may also regulate the formation of nonmyelinating Schwann cells and the formation of Remak bundles. When the Nrg1 gene was conditionally ablated in small unmyelinated sensory C-fibres and thinly myelinated A-δ fibres, the Remak bundles became abnormally large (Fricker et al., 2009).

Figure 7. The level of neuregulin 1 type III expressed on the axons determin if Schwann cells will myelinate or not. Reprinted by permission from Macmillan Publishers Ltd: Nature Neuroscience (Nave and Schwab, 2005), copyright (2005).

Elevation of cAMP is implicated in Schwann cell differentiation during non-proliferative conditions (Morgan et al., 1991), and in several other studies activation of cAMP in cultured Schwann cells has lead to an induction of myelin proteins such as galactocerebroside (Gal-C), 04 antigen, periaxin, Krox-20, NF-κB, protein zero (P0) and myelin basic protein (MBP) (Sobue and Pleasure, 1984; Lemke and Chao, 1988; Monuki et al., 1989; Mirsky et al., 1990; Morgan et al., 1991; Parkinson et al., 2003; Magnaghi et al., 2004; Yoon et al., 2008; Monje et al., 2009). Downstream of cAMP, PKA phos- phorylates the p65 subunit of the transcription factor NF-κB, which is necessary for myelination in Schwann cell/neuron co-cultures, while NRG1 type III activates NF-κB during myelination (Nickols et al., 2003; Yoon et al., 2008; Limpert and Carter, 2010). Both the cAMP/PKA pathway and the PI3K/Akt pathway converge by phosphorylating and activating NF-κB. A

18 recent study shows that activating the cAMP/PKA pathway with forskolin while adding NRG1 type III increased the expression of myelin markers remarkably in Schwann cell cultures (Arthur-Farraj et al. 2011).

Stem cells Stem cells are immature cells that either self-renew i.e. undergo symmetric division, or divide asymmetrically to form one new stem cell and one differentiated cell. Stem cells are subdivided into different groups according to their differential potential; totipotent, pluripotent and multipotent (Baizabal et al., 2003) (Fig. 8). The fertilized egg is a totipotent stem cell of that forms the entire embryo including the placenta. After a number of cell divisions, the egg enters the developmental stage blastula. Here, the inner cell mass of the blastula consists of embryonic stem (ES) cells. These cells are completely undifferentiated. The ES cells develop into the whole embryo, except the placenta, and are referred to as pluripotent (Smith, 2001.). As the embryo develops, stem cells undergo asymmetric cell divisions and different cell lineages are formed. These are the kind of stem cells that can be isolated from different parts from the developing or adult body and are referred to as somatic stem cells (from the Greek word ‘soma’ meaning body). They are multipotent and are defined by being able to differentiate into two or more different mature progenies, but must still produce identical copies of them selves (Knoblich, 2001).

Fertilised egg Blastula Embryonic somatic Adult somatic stem cells stem cells

Totipotent Pluripotent Multipotent Multipotent

Figure 8. The different types of stem cells.

Neural stem cells During early embryonic CNS development, neural stem cells (NSCs; also referred as neural stem/precursor cells, NSPCs) are the major cell type in the neural tube. However the number declines rapidly as the neural stem cells divide and differentiate to supply the developing brain with neurons and glia (Temple, 2001). The NSPCs are located to the ventricular zone of the brain

19 and spinal cord. Initially they form neurons but switch gradually over to produce different types of glia (Temple, 2001). Neurogenesis occurs only in discrete areas such as in the SVZ or the den- tal gyrus of the hippocampus (Altman and Das, 1965; Eriksson et al., 1998; Gould et al., 2001). These are also the two regions from which NSPCs can be isolated. In paper I, NSPCs were isolated from the fetal SVZ. In vivo, the fate choice of NSPCs is highly regulated with different signals, intrinsic as well as extrinsic. The timing of these regulatory factors is also crucial for proper development. In vitro as in vivo, fibroblast growth factor 2 (FGF2) and epidermal growth factor (EGF) are required for NSCs self-renewal proliferation (Johe et al., 1996; Panchision and McKay, 2002). The withdrawal of these mitogens leads to spontaneous differentiation into neurons and glia and addition of PDGF increases the neuronal differentiation (Johe et al. 1996). Other potent mitogens that regulate fate determination are cilary neurotophic factor (CNTF), bone morphogenic proteins (BMP) and leukemia inhibitory factor (LIF), which are involved in the formation of astrocytes (Gross et al., 1996; Johe et al., 1996; Mehler et al., 2000), and tyroid hormone triiodothyronin (T3) that increases the proportion of oligodendrocytes (Johe et al., 1996) (Fig 9).

FGF2 NSPC EGF

T3 - FGF2 CNTF - EGF BMPs PDGF LIF

Figure 9. The fate determination of NSPCs. Different mitogens direct the differentiation of NSPCs into neurons (N), astrocytes (A) or oligodendrocytes (O) of the CNS.

Stem cell plasticity Until recently most scientists believed that the differentiation of stem cell lineages was restricted to their organotypic fate. However, several recent reports indicate that somatic stem cells have a much broader repertoire (Björklund and Svendsen, 2001). For example, progenitor cells isolated from the adult bone marrow can transdifferentiate into brain cells, muscle cells or liver cells (Ferrari et al., 1998; Petersen et al., 1999; Alison et al., 2000;

20 Brazelton et al., 2000; Mezey et al., 2000). Adult neural stem cells can also become blood cells, muscle cells or give rise to the cell types of the three germ layers (Bjornson et al., 1999; Clarke et al., 2000; Galli et al., 2000). These findings indicate that somatic stem cell lineages can be dedifferentiat- ed and reprogrammed when subjected to the appropriate local environment. A new example of this is fibroblasts that are reprogrammed into functional NSPCs with the ability to differentiate into neurons, astrocytes and oligodendrocytes (Tokumoto et al., 2010; Kim et al., 2011; Ogawa et al., 2011; Wang et al., 2011). Other studies contradict the transdifferentiation hypothesis and suggest that the change of cell fate is instead a result of cell fusion (Terada et al., 2002; n.d.). These studies show that coculturing somatic stem cells with ES cells may result in cell fusion with tetraploid cells expressing specific cell markers for both cell types. However, in most tissues cell fusions are ex- tremely rare, but when studying transdifferentiation of cell types that normally fuse, such as muscle cells or liver cells, special care must be taken. (Tsai et al., 2002).

Transdifferential potency of NSCs and PNS progenitor cells The strict cell fates of the stem cell lineages of CNS and PNS-derived cells are currently disputed. In spinal cord lesions, demyelinated axons are often spontaneously remyelinated by Schwann cell-like cells. It has been assumed that these cells are PNS-derived Schwann cells that migrate into the spinal cord after the demyelination has occurred. It has been demonstrated, however, that such Schwann cell-like cells may have a CNS origin (Blakemore, 2005). Also, CNS precursors that are grafted into similar demyeliated lesions will spontaneously generate myelinating Schwann cell-like cells as well as astrocytes and oligodendrocytes, but only in astrocyte-free areas (Keirstead et al., 1999; Akiyama et al., 2001). There are also several reports showing that CNS stem cells have the ability to differentiate into cells of the PNS in vitro. NSCs generated from rat embryonic spinal cord or embryonic and adult cortices, can differentiate into peripheral neurons, Schwann cells and smooth muscle cells (Mujtaba et al., 1998; Sailer et al., 2005). Multipotential progenitor cells found in dorsal root ganglia are also able to transdifferentiate into CNS-like neurons, astrocytes and oligodendrocytes (Fex Svennings- en et al., 2004; Dromard et al., 2007). This suggests that a common progenitor may exist within the CNS and the PNS. These cells are most likely part of the satellite cell population of the dorsal root ganglia (DRG) (Åsa Fex- Svenningsen’s unpublished observation). Another multipotential cell population is boundary cap cells, which also originate from the neural crest, and give rise to Schwann cells and satellite glia. These cells arrest transiently at the dorsal root entry zone for sensory neurons and the ventral root exit point for motor neurons (Maro et al., 2004). In vitro studies show that boundary

21 cap cells can generate both astrocytes and oligodendrocytes (Zujovic et al., 2010; 2011). Recently, it was shown that embryonic neural crest stem cells transplanted into the embryonic or adult mouse CNS have the ability to differentiate into cells of the oligodendrocyte lineage and can contribute to myelin repair in shiverer mice (Binder et al., 2011). It is likely that both soluble environmental factors and membrane-bound molecules drive the differentiation, though only few of these factors are known.

Cell adhesion Practically all cells in the body are arranged together into tissues and organs. This strict arrangement would not be possible without cell adhesion. Cells adhere either directly with cell-cell adhesion molecules or indirectly with cell-matrix adhesion molecules. The molecules responsible for these properties are the cell adhesion molecules (CAMs). These can be divided into four different superfamilies; cadherins, immunoglobulins, integrins and selectins (Lodish et al., 2004). The CAMs are composed of an extracellular domain, which has several repeated sequences, a transmembrane domain that anchors the molecule in the plasma membrane, and an intracellular domain that either is bound to elements of the cytoskeleton or to mediate intracellular signalling. The cadherins form homophilic interactions, while the immuno- globulin-superfamily can form both homophilic and heterophilic interactions. Selectins bind to extra cellular matrix components, such as fibronectin, and recognize special sugar components on glycoproteins or glycolipids on adjacent cells (Lodish et al., 2004).

The cadherin superfamily The cadherin superfamily consists of a large number of related molecules (Hulpiau and van Roy, 2009). Their common feature is that their homophilic interaction is Ca2+-dependant and fundamental in establishing and maintaining multicellular structures, especially in embryonic stages of vertebrate development (Takeichi, 1990). Cadherins share two regions of common amino acid sequences, one in the cytoplasmic domain and the other in the extracellular domain. The cytoplastic domain is found to be associated with cytoskeletal components (Hirano et al., 1987; Hatta et al., 1988; Hulpiau and van Roy, 2009) and the extracellular domain is arranged into two or more tandem repeats of Ca2+-binding motifs (Takeichi, 1990) (Fig. 10). Cadherins can be divided into seven subfamilies: classical cadherins (type I and type II), fat-like cadherins, sevenpass transmembrane cadherins, DCad102F-like cadherins, Protein kinase cadherins, desmosomal cadherins and the most recently identified subfamily, protocadherins (Tepass et al., 2000; Frank and

22 Kemler, 2002; Goodwin and Yap, 2004; Yin and Green, 2004; Tanoue and Takeichi, 2005; Takeichi, 2007).

Extra cellular domain Ca2+

actin Intracellular signalling

Figure 10. N-cadherin is composed of five extra cellular domains, a transmembrane domain and an intracellular domain. For proper function calcium must be present. The intracellular domain interacts with actin cytoskeleton or mediate intracellular signals.

There are five known classical type I cadherins that all share five repeated tandem motifs where the outermost tandem repeat has a conserved amino acid sequence, His-Ala-Val (HAV), responsible for the homophilic interaction (Blaschuk et al., 1990; Takeichi, 1990; Stemmler, 2008; Hulpiau and van Roy, 2009). The cadherins are named after the tissues where they were first identified: neural, epithelial, retinal and vascular-endothelial cadherins (Stemmler, 2008; Hulpiau and van Roy, 2009). The type II cadherins are similar to that of type I, but lack the HAV-binding motif (Stemmler, 2008; Hulpiau and van Roy, 2009). The second paper of this thesis will focus on the classical cadherin type I neural cadherin (N-cadherin).

N-cadherin N-cadherin is predominantly expressed in the nervous system and is implicated in several essential developmental events. N-cadherin expression dis- appears during the epithelial-mesenchymal transition in the neural tube at the time when the neural crest cells start to migrate into the periphery (Akitaya and Bronner-Fraser, 1992). At the end of this migration period, N-cadherin expression increases in re-aggregating cells, just before the formation of the dorsal root and the sympathetic ganglia (Akitaya and Bronner-Fraser, 1992; Nakagawa and Takeichi, 1998). These data suggest that N-cadherin is in-

23 volved in migratory control (Akitaya and Bronner-Fraser, 1992; Xu et al., 2001). In the neural tube, N-cadherin is abundantly expressed by neuroepi- thelial cells in the ventricular zone and may be responsible for CNS progenitor cells retaining their position (Duband et al., 2009; Yagita et al., 2009). In CNS, N-cadherin is also expressed in synaptic junctions and implicated in synaptic strength and stability (Fannon and Colman, 1996; Mysore et al., 2008). N-cadherin has been extensively studied in the process of axonal growth and guidance in vitro, in both the CNS and the PNS (Tomaselli et al., 1988; Letourneau et al., 1990). In CNS, astrocytes that express N-cadherin mediate axon outgrowth and guidance of CNS neurons (Tomaselli et al., 1988). Oli- godendrocytes also express N-cadherin at all developmental stages in contact with other oligodendrocytes, astrocytes or neurons. However, the expression decreases with development and is concentrated on the major processes emerging from the soma in mature oligodendrocytes (Payne et al., 1996; Schnädelbach et al., 2001). N-cadherin is also implicated in oligodendrocyte precursor migration, axon-oligodendrocyte contact and myelination (Schnädelbach et al., 2000; 2001). N-cadherin has been widely investigated in early PNS development. N- cadherin is involved in neurite outgrowth (Bixby and Zhang, 1990) and in cocultures of Schwann cells and DRG neurons: growth cones rapidly mi- grates on top of the Schwann cells (Letourneau et al., 1990), analogous to astrocytes in the CNS previously described by Tomaselli et al. (Tomaselli et al., 1988). This Schwann cell-axon interaction ceases when the cells are subjected to low calcium conditions or by using specific blocking antibodies or peptides (Letourneau et al., 1990; Wanner and Wood, 2002; Wanner et al., 2006; Gess et al., 2008). N-cadherin is also expressed in Schwann cell precursors during the prenatal development of the sciatic nerve (Wanner et al., 2006). The expression is focused at the areas where the cells associate with axonal growth cones and decreases as the precursors develop into mature Schwann cells (Wanner et al., 2006). N-cadherin has also been implicated in Schwann cell proliferation, were blocking of N-cadherin decreased the axon- Schwan cell interaction and thereby the axon-induced Schwann cell proliferation (Gess et al., 2008). N-cadherin expression persists in Schwann cells of the adult sciatic nerve but to a lesser extent (Cifuentes-Diaz et al., 1994; Wanner and Wood, 2002). In the adult sciatic nerve, N-cadherin may be localized to both myelinating Schwann cells and nonmyelinating Schwann cells (Cifuentes-Diaz et al., 1994; Shibuya et al., 1995; Dolapchieva et al., 2001). In Paper II we describe a new morphology of nonmyelinating Schwan cells that not only encapsulate thin calibre axons but also hold on to myelinating Schwann cells.

24 GABA and GABA receptors The amino acids glutamate, aspartic acid, gamma aminobutyric acid (GABA) and glycine are the major neurotransmitters of CNS. Glutamate and aspartic acid are excitatory neurotransmitters while GABA and glycine are inhibitory. GABA is the predominant inhibitory neurotransmitter in adult mammalian CNS. In the brain about 25%-40% of the synapses use GABA while in the PNS the presence of GABA is more restricted (Li and Xu, 2008). GABA is synthesized by glutamate decarboxylase (GAD) 65 and 67 (Kaufman et al., 1986; Martin and Rimvall, 1993). GAD65 is associated with the membrane and believed to be responsible for synthesis of vesicular GABA, important for neural transmission, while GAD67 is more widely distributed in the cytoplasm where GABA is used for general metabolic activity (Soghomonian and Martin, 1998). When the GABAergic neurons are active, GABA is released from their nerve terminals into the synaptic cleft and binds to GABA receptors located presynaptically or postsynaptically on adjacent neurons. GABA activates two types of receptors; the ionotropic receptors GABAA and GABAA-ρ (previously known as GABAC), and the metabotropic G-protein coupled GABAB receptor (Dunlap and Fischbach, 1978; Bowery et al., 2002; Bettler et al., 2004; Nicoll 1988). In addition to being a neurotransmitter GABA can act as a neurohormone, a paracrine signalling molecule, a metabolic intermediate, and a trophic factor in many organs such as heart, liver, lungs, intestine, urinary bladder, adrenal, testis and ovary (Ong and Kerr, 1990; Gladkevich et al., 2006; Hayasaki et al., 2006). During the early development of the CNS, GABA also acts as a non-synaptic differentiation factor, regulating proliferation and migration of, for example, cortical neurons (Owens and Kriegstein, 2002; Lujan et al., 2005). Later in development, when synapses have been formed, GABA acts as an excitatory neurotransmitter (Lin et al., 1994; Ganguly et al., 2001). With time, at about P9, GABA switches from excitatory transmitter to inhibitory transmitter (Li and Xu, 2008).

GABAA receptor

The GABAA receptor is a fast ionotropic receptor. These receptors are mem- bers of the ligand-gated ion channel family and are composed of five subunits; α1-6, β1-3, γ1-3, δ, ε, π, and θ for GABAA and ρ1-3 for GABAA-ρ (Whiting et al., 1997; Olsen and Sieghart, 2008). The GABAA receptor can be blocked by the specific antagonists bicuculline and picrotoxin and stimulated by benzodiazepines, barbiturates, a variety of general anaesthetics and neuroactive steroids (Belelli and Lambert, 2005; Olsen and Sieghart, 2008). Many of these compounds are commonly used in clinics. Activation of the GABAA and GABAA-ρ receptors leads to an increase in chloride ion conductance, which in turn leads to a rapid hyperpolarization of the neuron and an inhibition of action potentials (Olsen and Sieghart, 2008).

25 The GABAA receptor is widely distributed in the adult mammalian CNS, in neurons as well as in astrocytes (Berger et al., 1992; Hösli et al., 1997; Kang et al., 1998; Sieghart and Sperk, 2002; Israel et al., 2003) and in certain oligodendrocyte progenitor cells (Gilbert et al., 1984; Kirchhoff and Kettenmann, 1992). In the PNS, sensory neurons, both myelinated and unmyelinated fibres posses GABAA receptors (Brown and Marsh, 1978; Brown et al., 1979; Morris et al., 1983). Schwann cells of the sciatic nerve and in culture express GABAA receptors (Magnaghi et al., 2006).

+ 2+ K channel+ Ca channel + K 2+ K + Adenylyl Ca GABAB R + K 2+ K GABAB R Ca cyclase Ca2+

i/o i/o i/o B1 B2 cAMP ATP

Figure 11. The GABAB receptor and its effector molecules. The GABAB receptor is assembled with the B1 and B2 subunits as a hetereodimer. When GABA binds to the receptor it activates the G proteins. Gγβ modulate potassium channels positively and calcium channels negatively, while Giα and G0α inhibit the adenylyl cyclase activity from further downstream signalling. Reprinted from Advances in Pharmacology, 58, Padgett, C.L. and Slesinger P.A., GABAB Re- ceptor Coupling to G-proteins and Ion Channels, 123-147, Copyright (2010), with permission from Elsevier.

GABAB receptor

The metabotropic, GABAB receptor is a G-protein coupled receptor (GPCR) that transduces signals mainly via Giα and G0α and mediates a slower and more prolonged physiological effect. The G-proteins open calcium and potassium ion channels or inactivate adenylyl cyclase and thus inhibit the cAMP pathway (Kaupmann et al., 1998; Kuner et al., 1999; Bowery et al., 2002; Bettler et al., 2004; Bettler and Tiao, 2006; Taniura et al., 2006; Rait- eri, 2008) (Fig. 11). The GABAB receptor shares the family class C of G-protein coupled receptors with metabotrophic glutamate receptors, calcium sensing receptors, taste receptors and a family of orphan receptors (Bettler et al., 2004). The GABAB receptor is composed of two seven-transmembrane domain subunits which must be assembled into a heterodimer to be active (Bowery et al., 2002). The GABAB1 receptor subunit is primarily responsible for agonist binding, whereas the GABAB2 receptor subunit is essential for trafficking of the heterodimer complex to the cell surface (Calver et al., 2000; Charles, Deuchars, et al., 2003a). The GABAB1 receptor subunit exists in two splice

26 variants; B1a and B1b (Bowery et al., 2002) The GABAB receptor is widely distributed throughout the CNS, though primarily localized to the thalamic nuclei, the molecular layer of the cerebellum, the cerebral cortex, the hippocampus, the interpeduncular nucleus and the dorsal horn of the spinal cord (Charles et al., 2001; Bowery et al., 2002; Chu et al., 1990). The GABAB receptors modulate GABAergic synapses, and glutamatergic synapses in particular by inhibiting neural transmission presynaptically and postsynaptically (Kornau, 2006). In CNS, GABAB receptors are implicated in various brain diseases, such as spasticity, pain (Balerio and Rubio, 2002), epilepsy (Prosser et al., 2001; Schuler et al., 2001), anxiety and depression (Mom- bereau et al., 2004), schizophrenia (Mizukami et al., 2000) and drug addic- tion (Tao and Auerbach, 2002). In the spinal cord, GABAB receptors are involved in primary afferent transmission (Fox et al., 1978) and GABA agonists can modulate nociceptive signalling inhibiting the release of the neurotransmitters substance P and glutamate (Patel et al., 2001). Treatments using GABA agonist and antagonists are limited. Only a few agonists have reached the drug market and they all have side effects (Leo, 2005; Magsalin and Khan, 2010). Although the agonist baclofen is clinically used as a muscle relaxant of spastic movement disorders and to treat spinal cord injuries, multiple sclerosis, amyotrophic lateral sclerosis, peripheral neuropathies and alcohol withdrawal (Addolorato, 2002; Rizzo et al., 2004). Many glial cells possess GABAB receptors. GABAB receptors in astrocytes potentiate inhibitory synaptic transmission in the hippocampus and regulate adenylyl cyclase (Kang et al., 1998; Oka et al., 2006). In microglia the GABAB receptor modulates the immune response upon activation (Kuhn et al., 2004). GABAB receptor stimulation also increases migration and proliferation in oligodendrocyte precursors (Luyt et al., 2007), though this is not the case in mature oligodendrocytes that lack this receptor type (Charles, Calver, et al., 2003b; Luyt et al., 2007).

GABA and GABAB receptors in PNS In the DRG, small nociceptive neurons with myelinated A-δ fibres and unmyelinated C-fibres possess GABAB receptors (Désarmenien et al., 1984; Poorkhalkali et al., 2000; Towers et al., 2000; Charles et al., 2001). The GABAB receptor is expressed in the soma but is also transported to the nerve terminals where it inhibits neurotransmitter release in the spinal cord (Poorkhalkali et al., 2000; Towers et al., 2000; Yang et al., 2001). Some DRG neurons also produce GABA (Szabat et al., 1992; Stoyanova et al., 1998; unpublished observations), though it is not clear whether it functions as a neurotransmitter or is released in primary afferent terminals. GABA in the PNS is implicated in pain modulation in the dorsal horn of the spinal cord (McCarson and Enna, 1999; Enna and McCarson, 2006), although a recent study contradicts this hypothesis (Gangadharan et al., 2009).

27 Satellite cells, the glia present in DRGs, store large quantities of GABA and have a high affinity for GABA up-take from the extracellular space (Young et al., 1973; Schon and Kelly, 1974; Hösli and Hösli, 1978; unpublished data). The satellite cells provide a barrier between the neurons and the extracellular matrix which prevents the neurons from accumulating GABA (Hösli and Hösli, 1978).

GABAB receptor function in Schwann cells

GABAB receptors have been found in both satellite cells and Schwann cells of the sciatic nerve and DRG (Poorkhalkali et al., 2000; Magnaghi et al., 2004). The function of the GABAB receptors has primarily been studied in neonatal Schwann cells in vitro. Such Schwann cells display both GABAA and GABAB receptors and generate GABA (Magnaghi et al., 2004; 2010). The involvement of GABAB receptors in both proliferation and myelination has also primarily been investigated in vitro, The GABAB receptor agonist baclofen reduced the forskolin-stimulated proliferation in Schwann cells (Magnaghi et al., 2004). Adding the GABAB receptor antagonists CGP55499A, GCP62349 or CGP55485 to the cultured Schwann cells, increased the cAMP induced proliferation. A prolonged treatment of baclofen in pure Schwann cell cultures decreased the synthesis of the myelin proteins myelin-associated glycoprotein (MAG), peripheral myelin protein 22 (PMP22) and P0 (Magnaghi et al., 2004). In paper III we have investigated the GABAB receptor involvement in proliferation and myelination in fetal dissociated DRG cultures. Interesting- ly, Schwann cell proliferation in such cultures is not dependent on GABAB receptor stimulation. However, stimulation of the GABAB receptors may be involved in the myelination process.

28 Aims

Paper I: To investigate if the fate determination of NSPCs is influenced by environmental factors from the CNS, PNS and ENS feeder cultures and to determine if molecules responsible are soluble or contact mediated.

Paper II: To study the function of N-cadherin in postnatal developing and adult peripheral nerve by studying the distribution and function of this protein in vivo and in vitro.

Paper III: To investigate the function and distribution of the GABAB receptor in adult sciatic nerve and DRG in vivo and in vitro.

29 Materials and methods

This section briefly presents and discusses the experimental procedures used in this thesis. Detailed information can be found in the respective paper.

Animals To investigate the nature of glial cell development, the studies in this thesis are based on cells and tissues from rats and mice. All procedures were ap- proved by the local ethical committees (Uppsala, Sweden; Montreal, Cana- da; Odense, Denmark). Wild-type Sprague-Dawley rats were used for prepa- ration of primary cell cultures and tissue analysis (Paper II and III). In paper I, heterozygous embryos from C57BL/6-β-actin-EGFP transgenic mice (Jackson Laboratories, Bar Habour, Maine, USA) (Okabe et al., 1997), were used. In these animals all cells express the endogenous green fluorescent protein (EGFP) driven by the actin promoter. This property is used to study the differentiation of NSPCs in co-culture with littermate wild-type cells.

Dissection and cell cultures NSPC co-cultures Cerebral cortices were dissected from E14.5 EGFP mice, and dissociated cells were cultured as neurospheres. Medium was changed at the passages, every 4-5 days. Care was taken to sustain small neurospheres and maintain as high a proportion of immature cells within the neurospheres as possible (Suslov et al., 2002). Primary cultures from E14.5 cerebellum, DRG and intestine were dissected and plated on Lab-Tek Chamber slides at a density of 100 000 cells/ml. Some DRG cultures were treated with the antimitotic agent 5-fluoro-2´-deoxyuridine to remove proliferating glia. Medium was changed twice a week and the conditioned media was collected and frozen for later use. Then dissociated EGFP-positive NSPCs were added to the primary feeder cultures or grown with the conditioned media from respective feeder culture. Cultures were fixed after 5 days or 4 weeks using 4% para- formaldehyde.

30 Schwann cell development in DRG primary cultures Schwann cell development can be studied in detail in dissociated fetal DRG cell cultures. Within days the Schwann cells proliferate, make contact with neurons and axons and start to myelinate. This model system is therefore unique when studying neuron-glial interaction in PNS development and re- flects the natural occurring processes seen in vivo. Nevertheless many studies of the Schwann cell’s biology have been made with pure Schwann cell cultures, without the presence of neurons. The advantage of pure Schwann cell cultures prepared from neonatal sciatic nerve or brachial nerve (Brockes et al., 1979), is that they can be easily expanded and the reproducibility is high. However, the drawback is that these Schwann cells may lose their natural behaviour when cultured without neurons for so long. Because of these issues the DRG primary cultures are used in this thesis. In papers II and III comparisons of Schwann cell development in these two types of culture systems are made regarding the expression and function of the proteins N- cadherin and GABAB receptor. The functional studies were performed by treating the DRG cultures with antagonists and agonist for the two proteins. In Paper II, N-cadherin was blocked by adding 130 µM of INPISGQ every second day. The cultures were then subjected to immunocytochemistry and analysed under a microscope. In short-term cultures the Schwann cell- axon and Schwann cell-Schwann cell contacts were investigated and in long- term cultures the myelination process was observed. In Paper III the GABAB receptor was investigated in DRG cultures treated with 100 µM baclofen or 10 µM CGP55485. The proliferation and differentiation were studied. In the proliferation assay, bromodeoxyuridine (5- bromo-2'-deoxyuridine, BrdU) was added for the last 2 hours to get incorporated in the DNA of dividing cells. The cultures were then subjected to immunochemistry and analysed under a microscope. To examine the GABAB receptors’ function during Schwann cell differentiation and myelination, DRG cultures received a prolonged treatment with baclofen or CGP55845. After four weeks, when Schwann cells were myelinating axons the cultures were harvested for RNA isolation and subsequent quantitative real-time PCR.

Western blot Standard protein measurement was made to study the developmental changes of protein levels (Paper II and III). Lysates from rat sciatic nerves from P1, P5, P10, P15 and P20 were resolved under reducing conditions on a 4- 12% Bis-Tris polyacrylamide gradient gel. A lysate from the cerebellum served as a positive control. Proteins were blotted onto a nitrocellulose membrane and blocked in 5% bovine serum albumin followed by incubation

31 with either monoclonal anti-N-cadherin (1:2000), in Paper II, or with rabbit anti-GABAB1 receptor (1:1000), guinea pig anti-GABAB2 receptor (1:1000) and rabbit anti-GABA (1:1000) in Paper III, overnight at 4°C. After washes, the membrane was incubated for 1 hour at room temperature with horserad- ish peroxidase-labelled donkey anti-mouse immunoglobulins (1:5000). Bands were visualized with chemiluminescent substrate and developed on photo film. To show that equal amounts of protein were loaded the membrane was stripped and labelled against β-actin (1:5000).

Immunochemistry Fixed tissues were cryoprotected overnight and stored in the freezer until sectioning on a cryostat. The sections as well as cultures were pre-incubated with blocking solution for 1 hour and then incubated overnight at 4°C with primary antibodies (Table 1) diluted in blocking solution. After washing, the slides were incubated with appropriate secondary antibodies for 2 hours at room temperature. The slides were then rinsed and analysed in a fluorescence microscope.

Paper I Investigating and comparing cells of CNS and PNS using antibodies is difficult since many antibodies that are specific for PNS also label cells of the CNS and vice versa. Most neuronal markers label neuronal populations in both the CNS and PNS. The same is true for glial markers, with the excep- tion of the makers P0 and PMP22 that are specific for myelinating Schwann cells, and PDGF alpha receptor, GalC and PLP which are specific for oligodendrocytes. However these antibodies could not be utilized for examin- ing the differentiation of NSPC since the experiments were too short for the development of myelin sheaths and some antibodies are not commercially available or not reliable enough. Because of these problems, it is very important to complement immuno-labelling with morphological observations, as we have done in Paper I. Neurons may sometimes be difficult to distin- guish between the CNS and PNS but a general rule is that CNS neurons have dendrites while PNS and ENS neurons do not. However, PNS and ENS neurons are often bipolar and multipolar. Oligodendrocytes and astrocytes have distinctly different morphology in comparison to Schwann cells or enteric glia. Brn3a and p75 were used as general peripheral markers, and were previously used by us (Brännvall et al., 2006). We also tested if these markers were present in the cerebellar cultures or after spontaneous differentiation of NSPCs in normal medium without FGF2 and EGF but they were not.

32 Table 1. Primary antibodies for immunochemistry Antigen Antibody Species Dilution Source α-internexin polyclonal rabbit 1:200 Millipore β-III-tubulin monoclonal mouse 1:500 BabCO β -III-tubulin polyclonal rabbit 1:200 Sigma-Aldrich BrdU-FITC polyclonal rat 1:75 BioSite Brn3a Monoclonal mouse 1:500 Millipore Caspr1 Polyclonal Rabbit 1:1000 Dr. Colmans laboratory, New York, USA CNP Monoclonal mouse 1:500 Sigma-Aldrich CNP Monoclonal mouse 1:500 Sternberger Monoclonals GABA monoclonal mouse 1:400 Sigma-Aldrich GABAB1-R polyclonal guinea pig 1:400 Millipore GABAB2-R polyclonal guinea pig 1:400 Millipore GABAB2-R polyclonal rabbit 1:200 Abcam GAD65/67 polyclonal rabbit 1:500 Abcam GFAP monoclonal mouse 1:200 Sigma-Aldrich GFAP polyclonal rabbit 1:250 Dako GFAP monoclonal mouse 1:1000 Sigma-Aldrich GFAP polyclonal rabbit 1:1000 Sigma-Aldrich L1 polyclonal rabbit 1:500 Millipore Mash1 monoclonal mouse 1:100 Becton-Dickinson Math monoclonal mouse 1:200 Developmental studies hybridoma bank MBP polyclonal rabbit 1:1000 Dr. Colmans laboratory, New York, USA MBP monoclonal mouse 1:1000 Sternberger Monoclonals N-cadherin monoclonal mouse 1:400 BD transduction labs N-cadherin polyclonal rabbit 1:1000 Abcam Nestin monoclonal mouse 1:200 Millipore Neurofilament polyclonal rabbit 1:1000 Sigma-Aldrich Neurofilament polyclonal chicken 1:1000 Abcam NG2 polyclonal rabbit 1:500 Millipore p75 polyclonal rabbit 1:500 Sigma-Aldrich Peripherin polyclonal rabbit 1:500 Millipore Rip monoclonal mouse 1:1000 Developmental studies hybridoma bank, S100 polyclonal rabbit 1:200 Dako S100β monoclonal mouse 1:250 Millipore SMA monoclonal mouse 1:1000 Millipore

Papers II and III The primary antibodies used in Paper II and Paper III were selected by their usage in previous studies and their commercial availability. In Paper II, the antibodies for N-cadherin have previously been used in many labs (Wanner and Wood, 2002; Fairless et al., 2005; Wanner et al., 2006; Crawford et al., 2008; Gess et al., 2008) The GABAB receptor antibodies have also been used by others (Magnaghi et al., 2004). To determine the cellular distribution of these proteins in tissue preparations and cell cultures, co-labelling of the cell type is essential. For co-staining of peripheral neurons, neurofilament 100kD and peripherlin, was used to label most DRG neurons and the axons of the sciatic nerve. The glial cell can be divided into nonmyelinating Schwann cells and satellite glia that express GFAP, and myelinating glia were co- labelled with the early myelin markers CNP and Rip and the late myelin marker MBP. Both proteins of interest, N-cadherin and GABAB receptor, are membrane-bound when active and were expected to be visible in the cell membranes. Therefore markers for specific organells were not needed.

33 To quantify Schwann cell behaviours in culture Green CellTracker was used in Paper II instead of a specific glial marker. This made it easier to label and count the Schwann cells in culture than normal immuno-labelling. Similar was done in Paper III, where proliferating cells were co-labelled with the common nuclei staining DAPI. Counting neurons by mistake would lead to a systemic error but is unlikely to affect the result since the neurons does not divide and the glial cells greatly outnumber the neurons.

Quantifications and cell culture analysis Paper I For quantification of NSPCs that have chosen neural crest fate, Brn3a and p75 expression was analysed. Pictures were taken with a × 20 objective on a Zeiss Axioplan2 microscope in 7-10 randomly chosen fields and counted blindly. The ratio of Brn3a and p75 positive NSPCs was calculated in the 13 days old co-cultures and 6 days old NSPC cultures that had received conditioned medium.

Paper II Images were taken with Zeiss LSM 510 META confocal microscope. The slides with sections and cultures were analysed using an Olympus fluorescent microscope. Quantification of cultured Schwann cells with or without contact with other Schwann cells or axons was performed using Volocity software. Three pictures taken at random from each culture chamber, with six cultures chambers for each group, were analysed. A ratio between the number of unattached Schwann cells and the total number of Schwann cells was calculated for each culture chamber. The number of attached Schwann cells on axons was counted and divided by the number of axons in each culture chamber. The difference between the mean values of treated cultures compared to controls was statistically analysed (unpaired t-test, two-tailed distribution).

Paper III An identical setup of microscopes to the one in Paper II was used. To quantify the proliferation rate in DRG cultures treated with baclofen and CGP55485, eight pictures taken at random were analysed from each culture chamber. A mean value of the ratio BrdU labelled cell/total number of cells was calculated for each eight wells for every treatment group. The difference between the mean values of treated cultures compared to controls was statistically analysed (unpaired t-test, two-tailed distribution).

34 mRNA expression analysis Studying protein expression is the final proof of a gene transcription. How- ever a combination of the small number of cells and a lack of myelin markers for western blot for the primary DRG cultures made us use mRNA expression analysis (Paper III). With real-time PCR (RT-PCR; also called quantitative PCR) several mRNA transcripts could be examined from the same sample. The technique is based on PCR and during amplification a fluorescent dye (SYBR green) is incorporated into the DNA in each cycle. The fluorescence is detected when the DNA gets double stranded and the signal intensity increases with number of cycles, in real-time. The cycle at which the signal reaches a certain threshold value may then be used to calcu- late the original concentration. After RNA extraction of four weeks old DRG cultures, treated with baclofen or CGP55485 and DMSO controls, reverse transcriptase (RT) was used to transcribe mRNA into complementary DNA (cDNA). In this reaction random hexamers were used as primers allowing all RNA to be transcribed into cDNA. The cDNA was then subjected to RT-PCR with specially de- signed primers that would amplify only the segments of the genes of interest (GOI; table 2).

Table 2. Primers for qPCR Transcript Accession Forward primer Reverse primer Reference (housekeeping) genes βACT NM_031144 cactgccgcatcctcttcct aaccgctcattgccgatagtg βTUB NM_173102 cggaaggaggcggagagc agggtgcccatgccagagc CYCLO NM_19533 gagcgttttgggtccaggaat aatgcccgcaagtcaaagaaa GAPDH X02231 acatgccgcctggagaaacct gcccaggatgccctttagtgg H3b NM_053985 attcgcaagctcccctttcag tggaagcgcaggtctgttttg RPL19 NM_031103 tcgccaatgccaactctcgtc agcccgggaatggacagtcac SDCA NM_130428 gggagtgccgtggtgtcattg ttcgcccatagcccccagtag Genes of interest CNP NM_012809 tgctcagtaacaggacct gggattaacacgatttatttcagt GFAP NM_017009 atgactatcgccgccaactgc tcctggtaactcgccgactcc MAG NM_017190 agaagccagaccatccaa ctgattccgctccaagtg MBP NM_017026 cgcatcttgttaatccgttctaat gagggtttgtttctggaagtttc P0 NM_001007728 aacctagactacag aagacatagagcgt PMP22 NM_017037 tgtaccacatccgccttg cctggacagactgaagcc

Reference genes To correct for variation in the total amount of cDNA due to differences in cell numbers, RNA extractions, reverse transcription reactions or pipetting errors, it was essential to use an internal reference. Seven reference genes or housekeeping genes were used in this thesis (table 2). The GeNorm protocol described by Vandesompele et al. was used for identifying the most stable HKGs out of a set of seven tested for each sample (Vandesompele et al., 2002). The GOIs were subsequently normalized to the geometric means of these HKGs. The delta-Ct method was used to transform Ct values into rela-

35 tive quantities with SD, and the highest expression for each primer pair was set to 100 (Vandesompele et al., 2002). Differences in gene expression between groups were analysed using one-way analysis of variance (ANOVA) followed by Dunnett’s post-hoc test.

36 Results and discussion

For pictures please see individual papers.

Paper I: Environmental factors are of great importance for the fate choice of stem cells (Brüstle et al., 1995; Kitazawa and Shimizu, 2005). Earlier experiments grafting EGFP positive NSPCs into intact or injured DRG show that the surrounding cells influenced the EGFP-positive cells and that the NSPCs had the capacity to develop into neurons and glia with a PNS morphology, but to a limited extent (Brännvall et al., 2006). In this paper, the NSPCs fate determination was studied in vitro, by culturing fetal mouse NSPCs together with CNS, PNS or ENS fetal primary mouse cell cultures, or with conditioned media collected from these cultures. NSPC differentiation was investigated by analysing their morphology and expression of peripheral markers. In the CNS environment, most EGFP-expressing NSPCs cocultured with cerebellar cultures remained immature, while the feeder culture showed clear signs of maturation. Only a small amount of the EGFP-positive NSPCs developed into neurons, astrocytes or oligodendrocytes. However, no CNPase-positive oligodendrocytes were found, even after 14 days of coculture. This developmental delay may be attributed to the presence of endogenous progenitor cells in the feeder culture, which possibly produce factors to maintain an immature cellular state. One such factor could be PDGF-BB (Erlandsson et al., 2006). NSPCs were then cocultured with PNS or ENS primary cultures. In these cocultures the EGFP-positive cells differentiated rapidly into neurons and glia with a peripheral or enteric morphology respectively, indicating that the NSPCs had chosen a PNS-like or ENS-like cell fate. In the PNS cocultures, the majority of EGFP-positive cells turned into Schwann cell-like bipolar cells expressing both S100 and GFAP. A number of these Schwann cells also aligned with axons in a one-to-one manner as if they were ready to start to myelinate. Some NSPCs had differentiated into neurons resembling endogenous DRG neurons. In the ENS environment, the EGFP-positive cells differentiated into stellate shaped GFAP-positive cells and small peripheral neurons with extended processes, both strikingly similar to the endogenous

37 enteric glia and neurons. In the enteric cultures a large number of the NSPCs had also become SMA-positive smooth muscle-like cells. This was not surprising since ENS cultures, which are made of dissociated complete intestine, contain a majority of smooth muscle cells. Apparently these influence fate choice in the NSPCs population. In both PNS and ENS cocultures a few oligodendrocytes were found. This could be a result of an incomplete environmental control of the NSPCs. Interestingly, when NSPCs were cocultured with DRGs devoid of glia, the stem cells remained morphologically immature, demonstrating that the Schwann cells are important for NSPC differentiation. This characteristic has also been seen in other studies. CNS precursors differentiate into Schwann cell-like cells instead of oligodendrocytes when astrocytes are absent in spinal cord lesions (Blakemore, 2005) and astrocytes also secrete factors important for the formation of hippocampal neurons (Song et al., 2002). To determine whether the differentiation of NSPCs into PNS-like and ENS-like cells depends on soluble factors or if this process is contact mediated, the stem cells were cultured with conditioned media from all the feeder cultures; CNS, PNS and ENS. In conditioned medium from CNS cultures, most of the EGFP-positive cells remained undifferentiated and nestin- positive, while control cultures, cultured in fresh medium, differentiated into more mature cells. This indicates that the molecules keeping the NSPCs undifferentiated are primarily soluble factors. In cultures with PNS and ENS conditioned media the NSPCs differentiated readily. The EGFP-positive cells differentiated into neurons and glia with PNS or ENS morphology respectively. These data indicate that soluble factors secreted from the PNS and ENS feeder cultures into the medium influenced differentiation and fate determination of NSPCs, but to a lesser extent than when NSPCs were cultured with the feeder cultures. The decrease in the number of NSPCs displaying peripheral characteristics in response to the conditioned media may imply that direct contact is needed for NSPC fate choice or that the important soluble factors in our conditioned media were depleted before new conditioned medium were added to the cultures.

Paper II: Adhesion properties are essential for all kinds of tissue development, especially during cell proliferation, migration and differentiation. The adhesion molecule N-cadherin is important in both development and maintenance of the nervous system but its direct function in these events is not completely clear. In PNS, N-cadherin is expressed by Schwann cell precursors and associated with axonal growth cones (Letourneau et al., 1991; Wanner and Wood, 2002). When the Schwann cell precursors matured the N-cadherin

38 expression level decreased. However, it never completely disappeared and N-cadherin persists in the adult sciatic nerve (Cifuentes-Diaz et al., 1994; Wanner and Wood, 2002). In this paper the spatio-temporal pattern of N- cadherin was investigated in postnatal and adult rat sciatic nerve, DRG and intestine. N-cadherin was expressed in neuron-glial and glial-glial adhesion in all tissues investigated; satellite cells envelop neural cell bodies of peripheral ganglia, nonmyelinating Schwann cells ensheath thin calibre axons and enteric glia ensheath, adhere and encapsulate both neurons and axons of the intestine. The cellular distribution of N-cadherin in satellite cells of the DRG as well as in the nonmyelinating Schwann cells of the sciatic nerve changed in postnatal development. At P1, the cells expressed N-cadherin diffusely over the cell membrane, an expression pattern previously described in Schwann cell precursors (Wanner et al., 2006). Five days later, a distinct change in N- cadherin distribution had occurred. It was restricted to glial-glial or axon- glial contacts and the pattern observed appeared to be stable throughout life. This reorganization coincides with the decrease of N-cadherin seen in the western blot analysis of protein homogenates of sciatic nerves from different postnatal ages. This distributional change may implicate a functional shift from proliferation and migration to that of adhesion. The change may be analogous to the one observed in the dorsal neural tube where N-cadherin expression diminishes in migrating neural crest cells but reappears when the migration ends and the dorsal roots are being formed (Akitaya and Bronner- Fraser, 1992). Nonmyelinating Schwann cells in the adult sciatic nerve were strongly N- cadherin positive, corroborating previous findings in adult sciatic nerve from chickens and rats (Cifuentes-Diaz et al., 1994; Shibuya et al., 1995; Dolap- chieva et al., 2001). Some of these cells were also highly branched and en- veloped myelinating Schwann cells as well as multiple thin calibre axons, a morphology that has not previously been described. These data may imply that nonmyelinating Schwann cells form a stable tubular structure in the peripheral nerve. Not only do these these cells encapsulate thin calibre axons but also, at the same time, they provide support and hold on to myelinating Schwann cells. To further investigate the cellular localization of N-cadherin, dissociated E17 DRG cultures were examined. Such cultures contain neurons and endogenous Schwann cells that develop similarly to what is seen in vivo, concerning proliferation, migration, alignment and myelination of Schwann cells (Fex Svenningsen et al., 2003). In freshly plated cultures, most Schwann cells expressed N-cadherin when in contact with other glial cells or axons. After a few days, when the Schwann cells had aligned with the axons, N-cadherin was accumulated at the axon-glial contacts. Whether this axon- glial expression is at the actual contact points between the attaching

39 Schwann cell and the adjacent axon, or if it is the enveloping Schwann cell that adheres to itself, is not clear. Expression of N-cadherin in neurons or axons without the glial contact was not detected, although other studies show that sensory neurons may express N-cadherin (Wanner et al., 2006). Interest- ingly, after 7 to 14 days of culture, the expression of N-cadherin decreased in the Schwann cells that had started their myelin program. Some myelinating Schwann cells expressed N-cadherin on the outer loop of the myelin sheath when in contact with other glial cells. The function of N-cadherin in these cultures was investigated next. Both pure Schwan cells and dissociated DRG cultures were treated with the potent N-cadherin blocking peptide INPISGQ (Williams et al., 2000). After 48 hours of culture the initial Schwann cell-Schwann cell interactions decreased in both types of cultures, in agreement with previous findings (Letourneau et al., 1991; Wanner and Wood, 2002; Wanner et al., 2006; Gess et al., 2008). No difference in the number of Schwann cells attached to axons was found comparing cultures treated with INPISGQ and controls. This antagonist had no impact on the myelination in similar cultures compared to control. The distribution of N-cadherin during development together with the data concerning functional adhesion indicates that initial adhesion of Schwann cell attachment to axons and subsequent myelination is not affected by N- cadherin blocking. The adhesion between glial cells is clearly affected by the INPISGQ treatment. In conclusion, the main function of N-cadherin in the postnatal PNS is that of glial adhesion; to stabilize the structure of the ganglia, the intestine and the sciatic nerve as coordinated cellular arrangements. The relatively high expression of N-cadherin maintains the integrity of the growing sciatic nerve. In the adult sciatic nerve the nonmyelinating Schwann cells use N- cadherin-mediated adhesion to form a tubular structure, encapsulating thin calibre axons, at the same time providing support and holding onto myelinating Schwann cells. N-cadherin is thus a crucial adhesive molecule binding the components of the nerve tightly together as one unit.

Paper III

GABAB receptors normally operate as an inhibitory neurotransmitter in neurons but have recently been found to be involved in Schwann cell development (Magnaghi et al., 2004). In Paper III, protein localization of GABA, GAD65/67 and the GABAB receptor was studied in the adult sciatic nerve and in developing DRG cultures. During development of the sciatic nerve the protein levels of GABAB receptor subunit 1, 2 and GAD65/67 decreased. This decrease coincides with an increase in myelination, suggesting that Schwann cells that start their myelin program downregulate the expression of these proteins. The adult sciatic nerve was then investigated using im-

40 munohistochemistry. All nonmyelinating Schwann cells expressed GABAB receptors, GABA and GAD65/67, while GABA and its B receptor were vir- tually absent in the majority of the myelinating Schwann cells. Surprisingly, a small population of myelinated fibers displayed GABAB receptors as well as GABA and GAD65/67 at the node of Ranvier. The fibres surrounded by these Schwann cells were labelled primarily with neurofilament, but also contained a population that was labelled with peripherin. All the fibres origi- nated from sensory neurons of the DRG. The neurofilament labelling indicates that the population may not be one including pain fibres but rather α and/or β fibres. The nodal distribution of the GABAB receptor did not overlap with that of GAD65/67 and GABA. The GABAB receptor was present on the glial side of the node, while GAD65/67 was localized to the axon. The localization of GABA was somewhat difficult to interpret but may be restricted to the microvilli of the Schwann cell covering the node of Ranvier. These data imply that this population of myelinating Schwann cells can both act on and store GABA which is generated locally on the axonal side of the node. It has previously been shown that Schwann cells in culture possess functional GABAB receptors and generate GABA (Magnaghi et al., 2004; 2010). These experiments were performed in pure Schwann cell cultures where neurons were absent. In such cultures the endogenous supply of GABA, as well as other factors important for proliferation and differentiation, cannot be provided by neurons. Proliferation is induced by forskolin, a potent activator of the cAMP/PKA pathway (Raff et al., 1978; Porter et al., 1986; Sobue et al., 1986; Jessen et al., 1991). To better mimic the environment of the PNS, we instead investigated the GABAB receptor mediated actions of GABA in primary fetal DRG cultures that contain a mixture of sensory neurons and Schwann cells. The Schwann cells in these cultures develop and differentiate with time, without the addition of growth promoting agents (Fex Svennings- en et al., 2003). The distribution of GABAB receptors in the Schwann cells of the primary DRG cultures correlated well with the western blots and the immunohistochemical results from the sciatic nerve; premyelinating and nonmyelinating Schwann cells all possessed both GABAB receptor subunits. When the Schwann cells started their myelin program, the GABAB receptor was down- regulated and in complete compacted myelin sheaths the expression was very low or absent. GABA as well as GAD65/67 also decreased with development and thus myelination. These data show that premyelinating and nonmyelinating Schwann cells not only have the ability to generate GABA, but may also act on this protein. In pure Schwann cell cultures, both the proliferation and the expression of myelin proteins are affected by the activation of the GABAB receptor using the GABA agonist baclofen (Magnaghi et al., 2004). Similar experiments were performed using our DRG primary cultures. Surprisingly, neither the

41 GABAB receptor agonist baclofen nor the GABAB receptor antagonist CGP55485 had an effect on Schwann cell proliferation. These results suggest that the initial Schwann cell proliferation seen in DRG cultures is independent of the cAMP/PKA signalling pathway and thus the inhibiting activity of cAMP by the GABAB receptor. The effect of baclofen and CGP55485 on myelination in the DRG cultures was also investigated. The mRNA levels of myelin markers MAG, PMP22 and P0 decreased in the presence of baclofen, indicating a functional GABAB receptor which signals downstream and affects transcription of myelin proteins. These data confirm previous studies in pure Schwann cell cultures (Magnaghi et al., 2004). The mRNA level of GFAP instead increased in response to baclofen demonstrating that the glial cells in the culture stayed in a nonmyelinating state. CGP55485 had a reverse effect in the myelinating cultures and instead showed a slight increase of MAG, PMP22 and P0 mRNA. In analogy with these findings the mRNA level of GFAP decreased. It has previously been shown that GABAB1 receptor deficient mice have irregularities of the myelin sheaths and an increased expression of myelin markers PMP22 and P0 (Magnaghi et al., 2008). These findings also strengthen the hypothesis that the GABAB receptor is involved in the myelination process. Interestingly, these mice are not particularly affected by the lack of the GABAB1 subunit. Only a small number of myelinated axons actu- ally show a decrease in the myelin thickness. Could this population of axons be the same as in our data that display GABAB receptors at the glial com- partment of the node of Ranvier? These glial cells may for some reason be more dependent on GABA’s direct actions via their B-receptors and thus be more vulnerable in a mouse lacking the GABAB1 receptor subunit.

42 Future perspectives

Paper I: The cellular environment most likely controls NSPCs using different soluble molecules. These molecules are apparently different, depending on what part of the nervous system that the NSPCs encounter. NSPCs are plastic and have the capacity to differentiate as a result of such environmental cues. Some of these molecules are identified (Sailer et al., 2005), though not all. Molecule identification is a difficult task but an investigation would nevertheless be interesting. In an attempt to do this, we separated the conditioned medium from ENS cultures into five different molecular weight groups (<10 kDa, 10- 30 kDa, 30-50 kDa, 50-100 kDa and >100 kDa). NSPCs were then cultured in complete ENS conditioned medium and with the different fractions for ten days in order to differentiate. Unfortunately the experiment was not feasible due to several unsuccessful pilot experiments and a lack of time. The idea was to analyse the mRNA expression of the NSPCs with real-time PCRs, investigating CNS and ENS specific mRNAs. Using this method we hoped to find one or several fractions that have a fate determining effect on the NSPCs, together or by themselves. The fractions of interest could then be analysed using 2D gel electrophoresis-separation of proteins and mass spec- trometry. Yet, another research group have studied the NSPCs differentiation potential in ENS environment and found that the generated ENS-like neurons shared several characteristics of the classical ENS neurons, indicating that the differentiation into ENS neurons was complete (Kulkarni et al., 2011). It has been suggested that stem/progenitor cells derived from neural crest also can differentiate to CNS cells. In cultures of fetal rat and mouse DRG, multipotential cells, with the capacity to become both PNS Schwann cells, CNS astrocytes and oligodendrocytes, have previously been found (Fex Svenningsen et al., 2004). Similarly, Dromard et al. (Dromard et al., 2007) reported that cells from the fetal DRG have the capacity to develop into CNS cells when exposed to FGF2 and EGF in vitro (Dromard et al., 2007). We are currently investigating if PNS and ENS stem/progenitor cells have the ability to become CNS cells. With an improved protocol for isolating and culturing ENS stem/progenitor cells we can study these cells with the same methods previously used for NSPCs.

43 A better understanding of what signals determine the differentiation of neural stem cells may contribute to the development of strategies for stem cell based cell therapy for a number of neurological diseases or lesions. Cells taken from the more easily accessible PNS or a piece of the intestine of a patient, may be cultured in vitro to acquire neural stem cells, be multiplied and subsequently differentiated into a larger number of a desired cell type. These cells could then be grafted into the injured or demyelinated CNS of the same patient and, hopefully, develop into mature healthy neurons or glia. The use of auto-transplantation utilizing autologous cells would have the major advantage of immunological compatibility and completely abolish the need of fetal stem cells.

Paper II: To further investigate the function of N-cadherin in Schwann cells development complementary functional analysis should be done. This could be done by, for example, an siRNA transfection of Schwann cell cultures to block the effect of N-cadherin. In fact we have attempted to do so, but with poor results. We have used several different transfection methods, both electro- poration and chemical based transfections. The primary DRG cultures used in our experiments were very fragile and after transfection the viability was reduced dramatically with a combination of a low transfection rate in general. Another method that may be more successful is to use retroviral lenti viruses as carriers for transfections with siRNA (Lewallen et al., 2011). The postnatal relocalization of N-cadherin from the cytoplasm to the cell membrane should also be further studied. Such reorganizations of proteins are often a sign of cell polarization and a change of cell function. There are numerous polarization events in glial cell development (Etienne-Manneville, 2008). An example of such an event is the axonal radial sorting and myelination of Schwann cells (Chan, 2007). Such polarization events can also be observed with N-cadherin. Since N-cadherin appears to be important to cell adhesion, it is possible that migration requires a change in the distribution of this protein. This can also be seen in Schwann cell precursors that deposit N- cadherin in the cytoplasm while migrating. When the migration ceases and the cells develop into more mature cells, N-cadherin is once again relocated to the plasma membrane for adhesion purposes (Akitaya and Bronner-Fraser, 1992; Nakagawa and Takeichi, 1998). In a recent study, N-cadherin has been found to colocalize with partition- ing defective protein 3 (PAR-3). This molecule is involved in the establishment cell polarity (Lewallen et al., 2011). A knockdown of N-cadherin in mice led to a disruption to the N-cadherin/PAR-3 complex. This. however, only delayed the onset of myelination without leaving any detectable myelination defects in these mice.

44 Paper III:

Can the GABAB receptor control the myelination of Schwann cells? Does its activity prevent the nonmyelinating Schwann cells from myelinating? To answer these questions I would like to investigate the GABAB receptor’s role in the downstream signalling of the cAMP/PKA pathway and how it effects Schwann cell differentiation. As described in the introduction, two signalling pathways are important for the induction of myelin proteins: the PI3K/Akt pathway activated by NRG1 type III, and the cAMP/PKA pathway. Both of these pathways converge and phosphorylate NF-κB. A recent study show that activating cAMP/PKA pathway while adding NRG1 type III generates a stronger expression of myelin markers in Schwann cell cultures (Arthur- Farraj et al., 2011). If I can show that the activation of the GABAB receptor generates a reduction of phosphorylated of NF-κB, this would confirm that the same pathway is used in Schwann cells. This would also connect GABA as a key signal in preventing Schwann cell differentiation. During my thesis project investigating the function of GABAB receptors we also found that many DRG neurons expressed both GAD65/67 and vesicular inhibitory amino acid transporter (VIAAT) that store and transport GABA and glycine. This implies that GABA is produced in these neurons and transported to nerve terminals for signalling. Further studies in our lab have shown that some of these neurons co-express vesicular glutamate transporter 2 (VGlut2) and VGlut3 (unpublished data). This data is somewhat surprising since GABA and glutamate have opposing actions in the adult mammalian nervous system. In the CNS, GABA and glutamate have been found to be generated by the same neurons, but in most cases this co-expression is transient during development and is important for synaptic organization and strengthening (Gutiér- rez et al., 2003; Seal and Edwards, 2006; Noh et al., 2010). In very few in- stances the co-expression is stable in adult animals, as in the case of glutamatergic granule cells in the dentate gyrus, that release GABA after high frequency firing that occurs in epilepsy (Lehmann et al., 1996; Nadler, 2003). This type of co-transmission of both an excitatory and an inhibitory neurotransmitter is very rare. For this reason we would like to investigate the function and the impact of this finding on transmission in the PNS.

45 Acknowledgements

First of all I would like to thank my supervisor Åsa Fex Svennigsen for being the excellent tutor, the sympathetic employer, the brilliant working part- ner and the lovely friend who cares about every part of my life. It was your prodigious enthusiasm for research that pulled me into neuroscience research. I am grateful for that, since brain research is such an intriguing area. I feel lucky to have you as my supervisor. I have never felt alone with my projects. You have always been nearby to discuss ideas. Even though you moved to Odense you have only been an SMS or a Skype-call away. With your generous support I could not have brought this thesis to harbour. I would also like to thank Grzegorz Wicher who has brought great knowledge and expertise to the group and me. Grzegorz has taught and helped me a lot in the lab. A special thank you to my co-supervisor Klas Kullander for letting me stay in your lab and to Helgi Schiöth for being sup- portive co-supervisor#2. I would also like to thank my collaborator Karin Holmqvist for excellent work. She has brought me into the world of stem cells. Thank you all students and project workers who have contributed directly and indirectly during the past six years in the lab: Susanne Dreborg and Pia Stefansson for happy times at Rudbeck lab, Daniel Berg for starting up the GABAB-project and, Michael Livingstone for excellent immunos of enteric glia, Anne-Li Lind for never-ending good spirit, Liselotte Fransson, Charlotte Hellgren, Sofi Rosendahl, Johannes Mollander, David Hobér, Jo- hanna Malmgren, Theodora Kallak, Christina Atterby for excellent work and fun time in the lab, Tobias Bergström for your persistent (or should I say stubborn) work with transfection prototypes from Cellectricon, Marcus Sjöblom for being the nice guy and Katarzyna Radomska for the overcrowd- ed freezer with tissue samples, cultures and immunos, you have contributed a great deal of this work. I would like to acknowledge Åsas colleges in Odense, Randi Godskesen and Karen Rich who have contributed to new improved results, Eirikur Ben- edikz for precious advice in protein isolation. Also, Åsas students Marcel Trier Kjær and Rachel Faiella, Emelie Perland and our collaborator in Istan- bul, Duygu Dağlıkoca, for new immuno images. I would like to thank my colleges in Kullander group, Anders Enjin, An- ders Eriksson, Chetan Nagaraja, Christiane Peukert, Fatima Mimic, Hanna Wootz, Kali Patra, Katarzyna Rogoz, Kia Leao, Lina Emilsson, Malin La- gerström, Martin Larhammar, Richardson Leao and colleges in Åsa Mac-

46 kenzie group, Carolina Birgner, Casey Smith, Emma Arvidsson and Karin Nordenankar. Also Björn Reinius, you are pretty much a Kullander member. Former colleges in the lab, Henrik Bengtsson, Henrik Gezelius, Lucas Nils- son and Nadine Bernhardt. Thank you all for having fun in the lab! A thank you to Helgi lab for letting me use the qPCR equipment and Robert Fredriksson for your invaluable advice. Also, Josefin Jacobsson, Karl Nordström, Maria Hägglund, Mattias Rask-Andersen, Pavel Olszevski, Smitha Sreedharan for helping with protocols and finding stuff in the Helgi lab. Johan Alsiö, so nice to have a ‘sångarbroder’ close. Thanks fellow colleges Christina Bergqvist, Daniel Ocampo-Daza, Görel Sundström and Hel- ena Fällmar for spending many cheerful lunches together. Nicole Metzen- dorf and Greta Hultqvist for being such lovely friends. Charlotte Israelsson for your embracing empathy and our endless discussions about heaven and earth. Thank you Ted Ebendal and Annika Jordell-Kylberg for letting me use your cell lab during all those years. A big hug to Birgitta Hägerbaum who is maintaining Neuro with clean glassware, sorting mail and keeping track of stuff at the department. The administration, for all you help, especially Ulla Jonsson, Emma Andersson, Maria Larsson and Lena Karlsson, but also my colleges at the student office, Gunno Nilsson, Marita Berg and Birgitta Klang, and everyone at the Department of Neuroscience, you have brought a lot of joy. During the years in Uppsala I have appreciated the lunch dates with Ola Philipsson and Frank Hammar. You and Daniel Vestman are my dearest friends from the studies. A special thank to Joanna Fransson for proofreading this thesis. I would like to thank Elisabeth and Maria who have supported me in my work throughout. Maria, you have been my model and supported me during my time as a postgraduate. It was fun to have a close friend at BMC, easy to drop in for a chat when energy-levels were low. Cousin Elisabeth, you have given me the self-confidence and energy to write this thesis. I want to take this opportunity to thank Sebastian, Sofia and Sara at Månstrålen who have looked after Tore and Elsa even when they have been under the weather. Thank you to all the grandparents who have looked after the children when they have been unable to go to Månstrålen and for all the baby-sitting when there just hasn’t been enough time for everything. As well as baby-sitting my parents Kersti and Simon and my parents-in-law Eva and Nisse have supported me throughout my studies. Your involvement as kept me on an even keel. Thank you brother Christian for all the encouraging conversations and the business ideas just waiting to be realised.

Finally I would like to give my eternal thanks to my wife Hanna who has been at my side all the time. You have supported me, put up with me and together we have got the best we can share in our lives, Tore and Elsa.

47 References

Addolorato, G., 2002. Baclofen efficiacy in reducing alcohol craving and intake: A preliminary double-blind randomized controlled study. Alco- hol and Alcoholism 37, 504–508. Akitaya, T., Bronner-Fraser, M., 1992. Expression of cell adhesion molecules during initiation and cessation of neural crest cell migration. Dev Dyn 194, 12–20. Akiyama, Y., Honmou, O., Kato, T., Uede, T., Hashi, K., Kocsis, J.D., 2001. Transplantation of clonal neural precursor cells derived from adult human brain establishes functional peripheral myelin in the rat spinal cord. Exp Neurol 167, 27–39. Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., Walter, P., 2002. Molecular Biology of the Cell, Fourth Edition, 4th ed. Garland Science. Alison, M.R., Poulsom, R., Jeffery, R., Dhillon, A.P., Quaglia, A., Jacob, J., Novelli, M., Prentice, G., Williamson, J., Wright, N.A., 2000. Hepato- cytes from non-hepatic adult stem cells. Nature 406, 257. Altman, J., Das, G.D., 1965. Autoradiographic and histological evidence of postnatal hippocampal neurogenesis in rats. J Comp Neurol 124, 319– 335. Arroyo, E.J., Bermingham, J.R., Rosenfeld, M.G., Scherer, S.S., 1998. Pro- myelinating Schwann cells express Tst-1/SCIP/Oct-6. J Neurosci 18, 7891–7902. Arthur-Farraj, P., Wanek, K., Hantke, J., Davis, C.M., Jayakar, A., Parkin- son, D.B., Mirsky, R., Jessen, K.R., 2011. Mouse schwann cells need both NRG1 and cyclic AMP to myelinate. Glia 59, 720–733. Baizabal, J.-M., Furlan-Magaril, M., Santa-Olalla, J., Covarrubias, L., 2003. Neural stem cells in development and regenerative medicine. Arch. Med. Res. 34, 572–588. Balerio, G.N., Rubio, M.C., 2002. Baclofen analgesia: involvement of the GABAergic system. Pharmacol Res 46, 281–286. Belelli, D., Lambert, J.J., 2005. Neurosteroids: endogenous regulators of the GABA(A) receptor. Nat Rev Neurosci 6, 565–575. Berger, T., Walz, W., Schnitzer, J., Kettenmann, H., 1992. GABA- and glutamate-activated currents in glial cells of the mouse corpus callosum slice. J Neurosci Res 31, 21–27. Bettler, B., Kaupmann, K., Mosbacher, J., Gassmann, M., 2004. Molecular structure and physiological functions of GABA(B) receptors. Physiol Rev 84, 835–867.

48 Bettler, B., Tiao, J.Y.-H., 2006. Molecular diversity, trafficking and subcel- lular localization of GABAB receptors. Pharmacol Ther 110, 533–543. Binder, E., Rukavina, M., Hassani, H., Weber, M., Nakatani, H., Reiff, T., Parras, C., Taylor, V., Rohrer, H., 2011. Peripheral nervous system progenitors can be reprogrammed to produce myelinating oligodendrocytes and repair brain lesions. J Neurosci 31, 6379–6391. Bixby, J.L., Zhang, R., 1990. Purified N-cadherin is a potent substrate for the rapid induction of neurite outgrowth. J Cell Biol 110, 1253–1260. Bjornson, C.R., Rietze, R.L., Reynolds, B.A., Magli, M.C., Vescovi, A.L., 1999. Turning brain into blood: a hematopoietic fate adopted by adult neural stem cells in vivo. Science 283, 534–537. Björklund, A., Svendsen, C.N., 2001. Chimeric stem cells. Trends Mol Med 7, 144–146. Blakemore, W.F., 2005. The case for a central nervous system (CNS) origin for the Schwann cells that remyelinate CNS axons following concurrent loss of oligodendrocytes and astrocytes. Neuropathol Appl Neurobiol 31, 1–10. Blaschuk, O.W., Sullivan, R., David, S., Pouliot, Y., 1990. Identification of a cadherin cell adhesion recognition sequence. Dev Biol 139, 227–229. Bowery, N.G., Bettler, B., Froestl, W., Gallagher, J.P., Marshall, F., Raiteri, M., Bonner, T.I., Enna, S.J., 2002. International Union of Pharmacolo- gy. XXXIII. Mammalian gamma-aminobutyric acid(B) receptors: structure and function. Pharmacol Rev 54, 247–264. Brazelton, T.R., Rossi, F.M., Keshet, G.I., Blau, H.M., 2000. From marrow to brain: expression of neuronal phenotypes in adult mice. Science 290, 1775–1779. Brännvall, K., Sandelin, M., Wallenquist, U., Forsberg-Nilsson, K., Aldsko- gius, H., Kozlova, E.N., 2006. Central nervous system stem/progenitor cells form neurons and peripheral glia after transplantation to the dorsal root ganglion. Neuroreport 17, 623–628. Brinkmann, B.G., Agarwal, A., Sereda, M.W., Garratt, A.N., Müller, T., Wende, H., Stassart, R.M., Nawaz, S., Humml, C., Velanac, V., Radyu- shkin, K., Goebbels, S., Fischer, T.M., Franklin, R.J., Lai, C., Ehren- reich, H., Birchmeier, C., Schwab, M.H., Nave, K.-A., 2008. Neuregu- lin-1/ErbB signaling serves distinct functions in myelination of the peripheral and central nervous system. Neuron 59, 581–595. Britsch, S., Goerich, D.E., Riethmacher, D., Peirano, R.I., Rossner, M., Nave, K.A., Birchmeier, C., Wegner, M., 2001. The transcription factor Sox10 is a key regulator of peripheral glial development. Genes Dev 15, 66–78. Brockes, J.P., Fields, K.L., Raff, M.C., 1979. Studies on cultured rat Schwann cells. I. Establishment of purified populations from cultures of peripheral nerve. Brain Res 165, 105–118. Brown, D.A., Adams, P.R., Higgins, A.J., Marsh, S., 1979. Distribution of gaba-receptors and gaba-carriers in the mammalian nervous system. J

49 Physiol (Paris) 75, 667–671. Brown, D.A., Marsh, S., 1978. Axonal GABA-receptors in mammalian peripheral nerve trunks. Brain Res 156, 187–191. Brown, M.J., Asbury, A.K., 1981. Schwann cell proliferation in the postnatal mouse: timing and topography. Exp Neurol 74, 170–186. Brüstle, O., Maskos, U., McKay, R.D., 1995. Host-guided migration allows targeted introduction of neurons into the embryonic brain. Neuron 15, 1275–1285. Buonanno, A., Fischbach, G.D., 2001. Neuregulin and ErbB receptor signaling pathways in the nervous system. Curr Opin Neurobiol 11, 287–296. Calver, A.R., Medhurst, A.D., Robbins, M.J., Charles, K.J., Evans, M.L., Harrison, D.C., Stammers, M., Hughes, S.A., Hervieu, G., Couve, A., Moss, S.J., Middlemiss, D.N., Pangalos, M.N., 2000. The expression of GABA(B1) and GABA(B2) receptor subunits in the cNS differs from that in peripheral tissues. Neuroscience 100, 155–170. Chan, J.R., 2007. Myelination: all about Rac “n” roll. J Cell Biol 177, 953– 955. Charles, K.J., Evans, M.L., Robbins, M.J., Calver, A.R., Leslie, R.A., Pan- galos, M.N., 2001. Comparative immunohistochemical localisation of GABA(B1a), GABA(B1b) and GABA(B2) subunits in rat brain, spinal cord and dorsal root ganglion. Neuroscience 106, 447–467. Charles, K.J., Deuchars, J., Davies, C.H., Pangalos, M.N., 2003a. GABA B receptor subunit expression in glia. Mol Cell Neurosci 24, 214–223. Charles, K.J., Calver, A.R., Jourdain, S., Pangalos, M.N., 2003b. Distribu- tion of a GABAB-like receptor protein in the rat central nervous system. Brain Res 989, 135–146. Chu, D.C., Albin, R.L., Young, A.B., Penney, J.B., 1990. Distribution and kinetics of GABAB binding sites in rat central nervous system: a quantitative autoradiographic study. Neuroscience 34, 341–357. Cifuentes-Diaz, C., Nicolet, M., Goudou, D., Rieger, F., Mege, R.M., 1994. N-cadherin expression in developing, adult and denervated chicken neuromuscular system: accumulations at both the neuromuscular junction and the node of Ranvier. Development 120, 1–11. Clarke, D.L., Johansson, C.B., Wilbertz, J., Veress, B., Nilsson, E., Karlström, H., Lendahl, U., Frisén, J., 2000. Generalized potential of adult neural stem cells. Science 288, 1660–1663. Crawford, A.T., Desai, D., Gokina, P., Basak, S., Kim, H.A., 2008. E- cadherin expression in postnatal Schwann cells is regulated by the cAMP-dependent protein kinase a pathway. Glia 56, 1637–1647. Davis, J.B., Stroobant, P., 1990. Platelet-derived growth factors and fibroblast growth factors are mitogens for rat Schwann cells. J Cell Biol 110, 1353–1360. Désarmenien, M., Feltz, P., Occhipinti, G., Santangelo, F., Schlichter, R., 1984. Coexistence of GABAA and GABAB receptors on A delta and C primary afferents. Br J Pharmacol 81, 327–333.

50 Dolapchieva, S., Eggers, R., Kuhnel, W., 2001. N- and R-cadherins expression in the rat sciatic nerve demonstrated by postembedding immuno- gold method on semi-thin sections. Ann. Anat. 183, 405–411. Dong, Z., Brennan, A., Liu, N., Yarden, Y., Lefkowitz, G., Mirsky, R., Jessen, K.R., 1995. Neu differentiation factor is a neuron-glia signal and regulates survival, proliferation, and maturation of rat Schwann cell precursors. Neuron 15, 585–596. Dong, Z., Sinanan, A., Parkinson, D., Parmantier, E., Mirsky, R., Jessen, K.R., 1999. Schwann cell development in embryonic mouse nerves. J Neurosci Res 56, 334–348. Dromard, C., Bartolami, S., Deleyrolle, L., Takebayashi, H., Ripoll, C., Si- monneau, L., Prome, S., Puech, S., Tran, V.B.C., Duperray, C., Valmier, J., Privat, A., Hugnot, J.-P., 2007. NG2 and Olig2 expression provides evidence for phenotypic deregulation of cultured central nervous system and peripheral nervous system neural precursor cells. Stem Cells 25, 340–353. Duband, J.-L., Blavet, C., Jarov, A., Fournier-Thibault, C., 2009. Spatio- temporal control of neural epithelial cell migration and epithelium-to- mesenchyme transition during avian neural tube development. Dev Growth Differ 51, 25–44. Dubový, P., Klusáková, I., Svíženská, I., Brázda, V., 2010. Satellite glial cells express IL-6 and corresponding signal-transducing receptors in the dorsal root ganglia of rat neuropathic pain model. Neuron Glia Biol 6, 73–83. Dunlap, K., Fischbach, G.D., 1978. Neurotransmitters decrease the calcium ocmponent of sensory neurone action potentials. Nature 276, 837–839. Eccleston, P.A., Collarini, E.J., Jessen, K.R., Mirsky, R., Richardson, W.D., 1990. Schwann Cells Secrete a PDGF-like Factor: Evidence for an Au- tocrine Growth Mechanism involving PDGF. Eur J Neurosci 2, 985– 992. Enna, S.J., McCarson, K.E., 2006. The role of GABA in the mediation and perception of pain. GABAb Receptor Pharmacology: A Tribute to Nor- man Bowery 54, 1–27. Eriksson, P.S., Perfilieva, E., Björk-Eriksson, T., Alborn, A.M., Nordborg, C., Peterson, D.A., Gage, F.H., 1998. Neurogenesis in the adult human hippocampus. Nat Med 4, 1313–1317. Erlandsson, A., Brännvall, K., Gustafsdottir, S., Westermark, B., Forsberg- Nilsson, K., 2006. Autocrine/paracrine platelet-derived growth factor regulates proliferation of neural progenitor cells. Cancer Res 66, 8042– 8048. Etienne-Manneville, S., 2008. Polarity proteins in glial cell functions. Curr Opin Neurobiol 18, 488–494. Fairless, R., Frame, M.C., Barnett, S.C., 2005. N-cadherin differentially determines Schwann cell and olfactory ensheathing cell adhesion and migration responses upon contact with astrocytes. Mol Cell Neurosci

51 28, 253–263. Fannon, A.M., Colman, D.R., 1996. A model for central synaptic junctional complex formation based on the differential adhesive specificities of the cadherins. Neuron 17, 423–434. Ferrari, G., Cusella-De Angelis, G., Coletta, M., Paolucci, E., Stornaiuolo, A., Cossu, G., Mavilio, F., 1998. Muscle regeneration by bone marrow- derived myogenic progenitors. Science 279, 1528–1530. Fex Svenningsen, A., Shan, W.-S., Colman, D.R., Pedraza, L., 2003. Rapid method for culturing embryonic neuron-glial cell cocultures. J Neurosci Res 72, 565–573. Fex Svenningsen, A., Colman, D.R., Pedraza, L., 2004. Satellite cells of dorsal root ganglia are multipotential glial precursors. Neuron Glia Biol 1, 85–93. Fex Svenningsen, A., Kanje, M., 1996. Insulin and the insulin-like growth factors I and II are mitogenic to cultured rat sciatic nerve segments and stimulate [3H]thymidine incorporation through their respective receptors. Glia 18, 68–72. Fields, R.D., Stevens-Graham, B., 2002. New insights into neuron-glia communication. Science 298, 556–562. Fox, S., Krnjević, K., Morris, M.E., Puil, E., Werman, R., 1978. Action of baclofen on mammalian synaptic transmission. Neuroscience 3, 495– 515. Frank, M., Kemler, R., 2002. Protocadherins. Curr Opin Cell Biol 14, 557– 562. Fricker, F.R., Zhu, N., Tsantoulas, C., Abrahamsen, B., Nassar, M.A., Thakur, M., Garratt, A.N., Birchmeier, C., McMahon, S.B., Wood, J.N., Bennett, D.L.H., 2009. Sensory axon-derived neuregulin-1 is required for axoglial signaling and normal sensory function but not for long-term axon maintenance. J Neurosci 29, 7667–7678. Galli, R., Borello, U., Gritti, A., Minasi, M.G., Bjornson, C., Coletta, M., Mora, M., de Angelis, M.G., Fiocco, R., Cossu, G., Vescovi, A.L., 2000. Skeletal myogenic potential of human and mouse neural stem cells. Nat Neurosci 3, 986–991. Gangadharan, V., Agarwal, N., Brugger, S., Tegeder, I., Bettler, B., Kuner, R., Kurejova, M., 2009. Conditional gene deletion reveals functional re- dundancy of GABAB receptors in peripheral nociceptors in vivo. Mol Pain 5, 68. Ganguly, K., Schinder, A.F., Wong, S.T., Poo, M., 2001. GABA itself promotes the developmental switch of neuronal GABAergic responses from excitation to inhibition. Cell 105, 521–532. Gess, B., Halfter, H., Kleffner, I., Monje, P., Athauda, G., Wood, P.M., Young, P., Wanner, I.B., 2008. Inhibition of N-cadherin and beta- catenin function reduces axon-induced Schwann cell proliferation. J Neurosci Res 86, 797–812. Gilbert, P., Kettenmann, H., Schachner, M., 1984. gamma-Aminobutyric

52 acid directly depolarizes cultured oligodendrocytes. J Neurosci 4, 561– 569. Gladkevich, A., Korf, J., Hakobyan, V.P., Melkonyan, K.V., 2006. The peripheral GABAergic system as a target in endocrine disorders. Auton Neurosci 124, 1–8. Gonzalez, G.A., Yamamoto, K.K., Fischer, W.H., Karr, D., Menzel, P., Biggs, W., Vale, W.W., Montminy, M.R., 1989. A cluster of phosphorylation sites on the cyclic AMP-regulated nuclear factor CREB predicted by its sequence. Nature 337, 749–752. Goodwin, M., Yap, A.S., 2004. Classical cadherin adhesion molecules: co- ordinating cell adhesion, signaling and the cytoskeleton. J Mol Histol 35, 839–844. Gould, E., Vail, N., Wagers, M., Gross, C.G., 2001. Adult-generated hippocampal and neocortical neurons in macaques have a transient existence. Proc Natl Acad Sci USA 98, 10910–10917. Gross, R.E., Mehler, M.F., Mabie, P.C., Zang, Z., Santschi, L., Kessler, J.A., 1996. Bone morphogenetic proteins promote astroglial lineage commit- ment by mammalian subventricular zone progenitor cells. Neuron 17, 595–606. Guénard, V., Rosenbaum, T., Gwynn, L.A., Doetschman, T., Ratner, N., Wood, P.M., 1995. Effect of transforming growth factor-beta 1 and - beta 2 on Schwann cell proliferation on neurites. Glia 13, 309–318. Gutiérrez, R., Romo-Parra, H., Maqueda, J., Vivar, C., Ramìrez, M., Mo- rales, M.A., Lamas, M., 2003. Plasticity of the GABAergic phenotype of the “glutamatergic” granule cells of the rat dentate gyrus. J Neurosci 23, 5594–5598. Hanani, M., 2005. Satellite glial cells in sensory ganglia: from form to function. Brain Res Brain Res Rev 48, 457–476. Hanani, M., 2010. Satellite glial cells in sympathetic and parasympathetic ganglia: in search of function. Brain Research Reviews 64, 304–327. Hatta, K., Nose, A., Nagafuchi, A., Takeichi, M., 1988. Cloning and expression of cDNA encoding a neural calcium-dependent cell adhesion molecule: its identity in the cadherin gene family. J Cell Biol 106, 873–881. Hayasaki, H., Sohma, Y., Kanbara, K., Maemura, K., Kubota, T., Watanabe, M., 2006. A local GABAergic system within rat trigeminal ganglion cells. Eur J Neurosci 23, 745–757. He, B., Liu, S.-Q., Chen, Q., Li, H.-H., Ding, W.-J., Deng, M., 2011. Car- boxymethylated chitosan stimulates proliferation of Schwann cells in vitro via the activation of the ERK and Akt signaling pathways. Eur J Pharmacol. Hirano, S., Nose, A., Hatta, K., Kawakami, A., Takeichi, M., 1987. Calcium- dependent cell-cell adhesion molecules (cadherins): subclass specificities and possible involvement of actin bundles. J Cell Biol 105, 2501– 2510. Hösli, E., Otten, U., Hösli, L., 1997. Expression of GABA(A) receptors by

53 reactive astrocytes in explant and primary cultures of rat CNS. Int J Dev Neurosci 15, 949–960. Hösli, E., Hösli, L., 1978. Autoradiographic localization of the uptake of [(3)H]- GABA and [(3)H]L-glutamic acid in neurones and glial cells of cultured dorsal root ganglia. Neurosci Lett 7, 173–176. Hulpiau, P., van Roy, F., 2009. Molecular evolution of the cadherin superfamily. Int J Biochem Cell Biol 41, 349–369. Israel, J.-M., Schipke, C.G., Ohlemeyer, C., Theodosis, D.T., Kettenmann, H., 2003. GABAA receptor-expressing astrocytes in the supraoptic nucleus lack glutamate uptake and receptor currents. Glia 44, 102–110. Jasmin, L., Vit, J.-P., Bhargava, A., Ohara, P.T., 2010. Can satellite glial cells be therapeutic targets for pain control? Neuron Glia Biol 6, 63–71. Jessen, K.R., Mirsky, R., Morgan, L., 1991. Role of cyclic AMP and proliferation controls in Schwann cell differentiation. Ann N Y Acad Sci 633, 78–89. Jessen, K.R., Mirsky, R., 2005. The origin and development of glial cells in peripheral nerves. Nat Rev Neurosci 6, 671–682. Johe, K.K., Hazel, T.G., Muller, T., Dugich-Djordjevic, M.M., McKay, R.D., 1996. Single factors direct the differentiation of stem cells from the fetal and adult central nervous system. Genes Dev 10, 3129–3140. Kandel, E., Schwartz, J., Jessell, T., 2000. Principles of Neural Science, 4th ed. McGraw-Hill Medical. Kang, J., Jiang, L., Goldman, S.A., Nedergaard, M., 1998. Astrocyte- mediated potentiation of inhibitory synaptic transmission. Nat Neurosci 1, 683–692. Kaufman, D.L., McGinnis, J.F., Krieger, N.R., Tobin, A.J., 1986. Brain glutamate decarboxylase cloned in lambda gt-11: fusion protein produces gamma-aminobutyric acid. Science 232, 1138–1140. Kaupmann, K., Malitschek, B., Schuler, V., Heid, J., Froestl, W., Beck, P., Mosbacher, J., Bischoff, S., Kulik, A., Shigemoto, R., Karschin, A., Bettler, B., 1998. GABA(B)-receptor subtypes assemble into functional heteromeric complexes. Nature 396, 683–687. Keirstead, H.S., Morgan, S.V., Wilby, M.J., Fawcett, J.W., 1999. Enhanced axonal regeneration following combined demyelination plus schwann cell transplantation therapy in the injured adult spinal cord. Exp Neurol 159, 225–236. Kim, H.A., DeClue, J.E., Ratner, N., 1997. cAMP-dependent protein kinase A is required for Schwann cell growth: interactions between the cAMP and neuregulin/tyrosine kinase pathways. J Neurosci Res 49, 236–247. Kim, J., Efe, J.A., Zhu, S., Talantova, M., Yuan, X., Wang, S., Lipton, S.A., Zhang, K., Ding, S., 2011. Direct reprogramming of mouse fibroblasts to neural progenitors. Proc Natl Acad Sci USA 108, 7838–7843. Kirchhoff, F., Kettenmann, H., 1992. GABA Triggers a [Ca2+]i Increase in Murine Precursor Cells of the Oligodendrocyte Lineage. Eur J Neurosci 4, 1049–1058.

54 Kitazawa, A., Shimizu, N., 2005. Differentiation of mouse embryonic stem cells into neurons using conditioned medium of dorsal root ganglia. J Biosci Bioeng 100, 94–99. Knoblich, J.A., 2001. Asymmetric cell division during animal development. Nat Rev Mol Cell Biol 2, 11–20. Kornau, H.-C., 2006. GABA(B) receptors and synaptic modulation. Cell Tissue Res 326, 517–533. Kuhn, S.A., van Landeghem, F.K.H., Zacharias, R., Färber, K., Rappert, A., Pavlovic, S., Hoffmann, A., Nolte, C., Kettenmann, H., 2004. Microglia express GABA(B) receptors to modulate interleukin release. Mol Cell Neurosci 25, 312–322. Kulkarni, S., Zou, B., Hanson, J., Micci, M.-A., Tiwari, G., Becker, L., Kai- ser, M., Xie, X.S., Pasricha, P.J., 2011. Gut-derived factors promote neurogenesis of CNS-neural stem cells and nudge their differentiation to an enteric-like neuronal phenotype. Am J Physiol Gastrointest Liver Physiol. Kuner, R., Köhr, G., Grünewald, S., Eisenhardt, G., Bach, A., Kornau, H.C., 1999. Role of heteromer formation in GABAB receptor function. Sci- ence 283, 74–77. Lamb, T.M., Harland, R.M., 1995. Fibroblast growth factor is a direct neural inducer, which combined with noggin generates anterior-posterior neural pattern. Development 121, 3627–3636. Lehmann, H., Ebert, U., Löscher, W., 1996. Immunocytochemical localization of GABA immunoreactivity in dentate granule cells of normal and kindled rats. Neurosci Lett 212, 41–44. Lemke, G., Chao, M., 1988. Axons regulate Schwann cell expression of the major myelin and NGF receptor genes. Development 102, 499–504. Leo, R.J., 2005. Delirium Associated With Baclofen Withdrawal: A Review of Common Presentations and Management Strategies. Psychosomatics 46, 503–507. Letourneau, P.C., Shattuck, T.A., Roche, F.K., Takeichi, M., Lemmon, V., 1990. Nerve growth cone migration onto Schwann cells involves the calcium-dependent adhesion molecule, N-cadherin. Dev Biol 138, 430– 442. Letourneau, P.C., Roche, F.K., Shattuck, T.A., Lemmon, V., Takeichi, M., 1991. Interactions of Schwann cells with neurites and with other Schwann cells involve the calcium-dependent adhesion molecule, N- cadherin. J Neurobiol 22, 707–720. Lewallen, K.A., Shen, Y.-A.A., la Torre, De, A.R., Ng, B.K., Meijer, D., Chan, J.R., 2011. Assessing the role of the cadherin/catenin complex at the Schwann cell-axon interface and in the initiation of myelination. J Neurosci 31, 3032–3043. Li, K., Xu, E., 2008. The role and the mechanism of γ-aminobutyric acid during central nervous system development. Neurosci. Bull. 24, 195– 200.

55 Limpert, A.S., Carter, B.D., 2010. Axonal neuregulin 1 type III activates NF-kappaB in Schwann cells during myelin formation. J Biol Chem 285, 16614–16622. Lin, M.H., Takahashi, M.P., Takahashi, Y., Tsumoto, T., 1994. Intracellular calcium increase induced by GABA in visual cortex of fetal and neonatal rats and its disappearance with development. Neurosci. Res. 20, 85– 94. Lodish, H., Berk, A., Matsudaira, P., Kaiser, C.A., Krieger, M., Scott, M.P., Zipursky, L., Darnell, J., 2004. Molecular Cell Biology, 5th ed. WHFreeman. Lujan, R., Shigemoto, R., Lopez-Bendito, G., 2005. Glutamate and GABA receptor signalling in the developing brain. Neuroscience 130, 567–580. Luyt, K., Slade, T.P., Dorward, J.J., Durant, C.F., Wu, Y., Shigemoto, R., Mundell, S.J., Váradi, A., Molnár, E., 2007. Developing oligodendrocytes express functional GABA(B) receptors that stimulate cell proliferation and migration. J Neurochem 100, 822–840. Magnaghi, V., Ballabio, M., Cavarretta, I.T.R., Froestl, W., Lambert, J.J., Zucchi, I., Melcangi, R.C., 2004. GABAB receptors in Schwann cells influence proliferation and myelin protein expression. Eur J Neurosci 19, 2641–2649. Magnaghi, V., Ballabio, M., Consoli, A., Lambert, J.J., Roglio, I., Melcangi, R.C., 2006. GABA receptor-mediated effects in the peripheral nervous system: A cross-interaction with neuroactive steroids. J Mol Neurosci 28, 89–102. Magnaghi, V., Ballabio, M., Camozzi, F., Colleoni, M., Consoli, A., Gassmann, M., Lauria, G., Motta, M., Procacci, P., Trovato, A.E., Bet- tler, B., 2008. Altered peripheral myelination in mice lacking GABAB receptors. Mol Cell Neurosci 37, 599–609. Magnaghi, V., Parducz, A., Frasca, A., Ballabio, M., Procacci, P., Racagni, G., Bonanno, G., Fumagalli, F., 2010. GABA synthesis in Schwann cells is induced by the neuroactive steroid allopregnanolone. J Neuro- chem 112, 980–990. Magsalin, R.M.M., Khan, A.Y., 2010. Withdrawal symptoms after Internet purchase of phenibut (β-phenyl-γ-aminobutyric acid HCl). J Clin Psy- chopharmacol 30, 648–649. Maro, G.S., Vermeren, M., Voiculescu, O., Melton, L., Cohen, J., Charnay, P., Topilko, P., 2004. Neural crest boundary cap cells constitute a source of neuronal and glial cells of the PNS. Nat Neurosci 7, 930–938. Martin, D.L., Rimvall, K., 1993. Regulation of gamma-aminobutyric acid synthesis in the brain. J Neurochem 60, 395–407. Maurel, P., Salzer, J.L., 2000. Axonal regulation of Schwann cell proliferation and survival and the initial events of myelination requires PI 3- kinase activity. J Neurosci 20, 4635–4645. McCarson, K.E., Enna, S.J., 1999. Nociceptive regulation of GABA(B) receptor gene expression in rat spinal cord. Neuropharmacology 38,

56 1767–1773. McGrew, L.L., Lai, C.J., Moon, R.T., 1995. Specification of the anteroposterior neural axis through synergistic interaction of the Wnt signaling cascade with noggin and follistatin. Dev Biol 172, 337–342. Mehler, M.F., Mabie, P.C., Zhu, G., Gokhan, S., Kessler, J.A., 2000. Devel- opmental changes in progenitor cell responsiveness to bone morphogenetic proteins differentially modulate progressive CNS lineage fate. Dev Neurosci 22, 74–85. Mezey, E., Chandross, K.J., Harta, G., Maki, R.A., McKercher, S.R., 2000. Turning blood into brain: cells bearing neuronal antigens generated in vivo from bone marrow. Science 290, 1779–1782. Michailov, G.V., Sereda, M.W., Brinkmann, B.G., Fischer, T.M., Haug, B., Birchmeier, C., Role, L., Lai, C., Schwab, M.H., Nave, K.-A., 2004. Axonal neuregulin-1 regulates myelin sheath thickness. Science 304, 700–703. Mirsky, R., Dubois, C., Morgan, L., Jessen, K.R., 1990. 04 and A007- sulfatide antibodies bind to embryonic Schwann cells prior to the appearance of galactocerebroside; regulation of the antigen by axon- Schwann cell signals and cyclic AMP. Development 109, 105–116. Mizukami, K., Sasaki, M., Ishikawa, M., Iwakiri, M., Hidaka, S., Shiraishi, H., Iritani, S., 2000. Immunohistochemical localization of gamma- aminobutyric acid(B) receptor in the hippocampus of subjects with schizophrenia. Neurosci Lett 283, 101–104. Mombereau, C., Kaupmann, K., Froestl, W., Sansig, G., van der Putten, H., Cryan, J.F., 2004. Genetic and pharmacological evidence of a role for GABA(B) receptors in the modulation of anxiety- and antidepressant- like behavior. Neuropsychopharmacology 29, 1050–1062. Monje, P.V., Athauda, G., Wood, P.M., 2008. Protein kinase A-mediated gating of neuregulin-dependent ErbB2-ErbB3 activation underlies the synergistic action of cAMP on Schwann cell proliferation. J Biol Chem 283, 34087–34100. Monje, P.V., Rendon, S., Athauda, G., Bates, M., Wood, P.M., Bunge, M.B., 2009. Non-antagonistic relationship between mitogenic factors and cAMP in adult Schwann cell re-differentiation. Glia 57, 947–961. Monuki, E.S., Weinmaster, G., Kuhn, R., Lemke, G., 1989. SCIP: a glial POU domain gene regulated by cyclic AMP. Neuron 3, 783–793. Morgan, L., Jessen, K.R., Mirsky, R., 1991. The effects of cAMP on differentiation of cultured Schwann cells: progression from an early phenotype (04+) to a myelin phenotype (P0+, GFAP-, N-CAM-, NGF- receptor-) depends on growth inhibition. J Cell Biol 112, 457–467. Morris, M.E., Di Costanzo, G.A., Fox, S., Werman, R., 1983. Depolarizing action of GABA (gamma-aminobutyric acid) on myelinated fibers of peripheral nerves. Brain Res 278, 117–126. Morrison, S.J., Perez, S.E., Qiao, Z., Verdi, J.M., Hicks, C., Weinmaster, G., Anderson, D.J., 2000. Transient Notch activation initiates an irreversible

57 switch from neurogenesis to gliogenesis by neural crest stem cells. Cell 101, 499–510. Morrissey, T.K., Levi, A.D., Nuijens, A., Sliwkowski, M.X., Bunge, R.P., 1995. Axon-induced mitogenesis of human Schwann cells involves her- egulin and p185erbB2. Proc Natl Acad Sci USA 92, 1431–1435. Mujtaba, T., Mayer-Proschel, M., Rao, M.S., 1998. A common neural progenitor for the CNS and PNS. Dev Biol 200, 1–15. Mysore, S.P., Tai, C.-Y., Schuman, E.M., 2008. N-cadherin, spine dynamics, and synaptic function. Frontiers in neuroscience 2, 168–175. Nadarajah, B., Parnavelas, J.G., 2002. Modes of neuronal migration in the developing cerebral cortex. Nat Rev Neurosci 3, 423–432. Nadler, J.V., 2003. The recurrent mossy fiber pathway of the epileptic brain. Neurochem Res 28, 1649–1658. Nakagawa, S., Takeichi, M., 1998. Neural crest emigration from the neural tube depends on regulated cadherin expression. Development 125, 2963–2971. Newbern, J.M., Li, X., Shoemaker, S.E., Zhou, J., Zhong, J., Wu, Y., Bonder, D., Hollenback, S., Coppola, G., Geschwind, D.H., Landreth, G.E., Snider, W.D., 2011. Specific functions for ERK/MAPK signaling during PNS development. Neuron 69, 91–105. Nickols, J.C., Valentine, W., Kanwal, S., Carter, B.D., 2003. Activation of the transcription factor NF-kappaB in Schwann cells is required for peripheral myelin formation. Nat Neurosci 6, 161–167. Nicoll, R.A., 1988. The coupling of neurotransmitter receptors to ion channels in the brain. Science 241, 545–551. Noh, J., Seal, R.P., Garver, J.A., Edwards, R.H., Kandler, K., 2010. Gluta- mate co-release at GABA/glycinergic synapses is crucial for the refine- ment of an inhibitory map. Nat Neurosci 13, 232–238. Ogawa, S.-I., Tokumoto, Y., Miyake, J., Nagamune, T., 2011. Induction of oligodendrocyte differentiation from adult human fibroblast-derived induced pluripotent stem cells. In Vitro Cell. Dev. Biol. Anim. 47, 464– 469. Oka, M., Wada, M., Wu, Q., Yamamoto, A., Fujita, T., 2006. Functional expression of metabotropic GABAB receptors in primary cultures of astrocytes from rat cerebral cortex. Biochem Biophys Res Commun 341, 874–881. Okabe, M., Ikawa, M., Kominami, K., Nakanishi, T., Nishimune, Y., 1997. “Green mice” as a source of ubiquitous green cells. FEBS Lett 407, 313–319. Olsen, R.W., Sieghart, W., 2008. International Union of Pharmacology. LXX. Subtypes of -Aminobutyric AcidA Receptors: Classification on the Basis of Subunit Composition, Pharmacology, and Function. Up- date. Pharmacol Rev 60, 243–260. Ong, J., Kerr, D.I., 1990. GABA-receptors in peripheral tissues. Life Sci 46, 1489–1501.

58 Orentas, D., Miller, R., 1998. Regulation of oligodendrocyte development. Mol Neurobiol 18, 247–259. Owens, D.F., Kriegstein, A.R., 2002. Is there more to GABA than synaptic inhibition? Nat Rev Neurosci 3, 715–727. Panchision, D.M., McKay, R.D.G., 2002. The control of neural stem cells by morphogenic signals. Curr Opin Genet Dev 12, 478–487. Papalopulu, N., Kintner, C., 1996. A posteriorising factor, retinoic acid, reveals that anteroposterior patterning controls the timing of neuronal differentiation in Xenopus neuroectoderm. Development 122, 3409–3418. Parkinson, D.B., Dickinson, S., Bhaskaran, A., Kinsella, M.T., Brophy, P.J., Sherman, D.L., Sharghi-Namini, S., Duran Alonso, M.B., Mirsky, R., Jessen, K.R., 2003. Regulation of the myelin gene periaxin provides evidence for Krox-20-independent myelin-related signalling in Schwann cells. Mol Cell Neurosci 23, 13–27. Patel, S., Naeem, S., Kesingland, A., Froestl, W., Capogna, M., Urban, L., Fox, A., 2001. The effects of GABAB agonists and gabapentin on me- chanical hyperalgesia in models of neuropathic and inflammatory pain in the rat. Pain 90, 217–226. Payne, H.R., Hemperly, J.J., Lemmon, V., 1996. N-cadherin expression and function in cultured oligodendrocytes. Brain Res Dev Brain Res 97, 9– 15. Perea, G., Araque, A., 2010. GLIA modulates synaptic transmission. Brain Research Reviews 63, 93–102. Petersen, B.E., Bowen, W.C., Patrene, K.D., Mars, W.M., Sullivan, A.K., Murase, N., Boggs, S.S., Greenberger, J.S., Goff, J.P., 1999. Bone marrow as a potential source of hepatic oval cells. Science 284, 1168–1170. Poorkhalkali, N., Juneblad, K., Jönsson, A.C., Lindberg, M., Karlsson, O., Wallbrandt, P., Ekstrand, J., Lehmann, A., 2000. Immunocytochemical distribution of the GABA(B) receptor splice variants GABA(B) R1a and R1b in the rat CNS and dorsal root ganglia. Anat Embryol 201, 1–13. Porter, S., Clark, M.B., Glaser, L., Bunge, R.P., 1986. Schwann cells stimulated to proliferate in the absence of neurons retain full functional capa- bility. J Neurosci 6, 3070–3078. Prosser, H.M., Gill, C.H., Hirst, W.D., Grau, E., Robbins, M., Calver, A., Soffin, E.M., Farmer, C.E., Lanneau, C., Gray, J., Schenck, E., Warmerdam, B.S., Clapham, C., Reavill, C., Rogers, D.C., Stean, T., Upton, N., Humphreys, K., Randall, A., Geppert, M., Davies, C.H., Pangalos, M.N., 2001. Epileptogenesis and enhanced prepulse inhibition in GABA(B1)-deficient mice. Mol Cell Neurosci 17, 1059–1070. Raff, M.C., Hornby-Smith, A., Brockes, J.P., 1978. Cyclic AMP as a mitogenic signal for cultured rat Schwann cells. Nature 273, 672–673. Raiteri, M., 2008. Presynaptic metabotropic glutamate and GABAB receptors. Handb Exp Pharmacol 373–407. Rakic, P., Stensas, L.J., Sayre, E., Sidman, R.L., 1974. Computer-aided three-dimensional reconstruction and quantitative analysis of cells from

59 serial electron microscopic montages of foetal monkey brain. Nature 250, 31–34. Rizzo, M., Hadjimichael, O., Preiningerova, J., Vollmer, T., 2004. Preva- lence and treatment of spasticity reported by multiple sclerosis patients. mult scler 10, 589–595. Russell, P., 1990. The Brain Book. Penguin (Non-Classics). Rühl, A., Nasser, Y., Sharkey, K.A., 2004. Enteric glia. Neurogastroenterol Motil 16 Suppl 1, 44–49. Sailer, M.H.M., Hazel, T.G., Panchision, D.M., Hoeppner, D.J., Schwab, M.E., McKay, R.D.G., 2005. BMP2 and FGF2 cooperate to induce neural-crest-like fates from fetal and adult CNS stem cells. J Cell Sci 118, 5849–5860. Schnädelbach, O., Blaschuk, O.W., Symonds, M., Gour, B.J., Doherty, P., Fawcett, J.W., 2000. N-cadherin influences migration of oligodendrocytes on astrocyte monolayers. Mol Cell Neurosci 15, 288–302. Schnädelbach, O., Ozen, I., Blaschuk, O.W., Meyer, R.L., Fawcett, J.W., 2001. N-cadherin is involved in axon-oligodendrocyte contact and myelination. Mol Cell Neurosci 17, 1084–1093. Schon, F., Kelly, J.S., 1974. AUTORADIOGRAPHIC. Brain Res 275–288. Schuler, V., Lüscher, C., Blanchet, C., Klix, N., Sansig, G., Klebs, K., Schmutz, M., Heid, J., Gentry, C., Urban, L., Fox, A., Spooren, W., Ja- ton, A.L., Vigouret, J., Pozza, M., Kelly, P.H., Mosbacher, J., Froestl, W., Käslin, E., Korn, R., Bischoff, S., Kaupmann, K., van der Putten, H., Bettler, B., 2001. Epilepsy, hyperalgesia, impaired memory, and loss of pre- and postsynaptic GABA(B) responses in mice lacking GABA(B(1)). Neuron 31, 47–58. Schumacher, M., Jung-Testas, I., Robel, P., Baulieu, E.E., 1993. Insulin-like growth factor I: a mitogen for rat Schwann cells in the presence of ele- vated levels of cyclic AMP. Glia 8, 232–240. Seal, R.P., Edwards, R.H., 2006. Functional implications of neurotransmitter co-release: glutamate and GABA share the load. Curr Opin Pharmacol 6, 114–119. Shibuya, Y., Mizoguchi, A., Takeichi, M., Shimada, K., Ide, C., 1995. Lo- calization of N-cadherin in the normal and regenerating nerve fibers of the chicken peripheral nervous system. Neuroscience 67, 253–261. Sieghart, W., Sperk, G., 2002. Subunit composition, distribution and function of GABA(A) receptor subtypes. Curr Top Med Chem 2, 795–816. Smith, A.G., 2001. Embryo-derived stem cells: of mice and men. Annu Rev Cell Dev Biol 17, 435–462. Sobue, G., Shuman, S., Pleasure, D., 1986. Schwann cell responses to cyclic AMP: proliferation, change in shape, and appearance of surface galactocerebroside. Brain Res 362, 23–32. Sobue, G., Pleasure, D., 1984. Schwann cell galactocerebroside induced by derivatives of adenosine 3“,5-”monophosphate. Science 224, 72–74. Soghomonian, J.J., Martin, D.L., 1998. Two isoforms of glutamate decar-

60 boxylase: why? Trends Pharmacol Sci 19, 500–505. Song, H., Stevens, C.F., Gage, F.H., 2002. Astroglia induce neurogenesis from adult neural stem cells. Nature 417, 39–44. Stemmler, M.P., 2008. Cadherins in development and cancer. Mol Biosyst 4, 835–850. Stewart, H.J., Bradke, F., Tabernero, A., Morrell, D., Jessen, K.R., Mirsky, R., 1996. Regulation of rat Schwann cell Po expression and DNA synthesis by insulin-like growth factors in vitro. Eur J Neurosci 8, 553–564. Stoyanova, I., Dandov, A., Lazarov, N., Chouchkov, C., 1998. GABA- and glutamate-immunoreactivity in sensory ganglia of cat: a quantitative analysis. Arch Physiol Biochem 106, 362–369. Suslov, O.N., Kukekov, V.G., Ignatova, T.N., Steindler, D.A., 2002. Neural stem cell heterogeneity demonstrated by molecular phenotyping of clonal neurospheres. Proc Natl Acad Sci USA 99, 14506–14511. Szabat, E., Soinila, S., Happola, O., Linnala, A., Virtanen, I., 1992. A new monoclonal antibody against the GABA-protein conjugate shows immunoreactivity in sensory neurons of the rat. Neuroscience 47, 409–420. Takeichi, M., 1990. Cadherins: a molecular family important in selective cell-cell adhesion. Annu Rev Biochem 59, 237–252. Takeichi, M., 2007. The cadherin superfamily in neuronal connections and interactions. Nat Rev Neurosci 8, 11–20. Taniura, H., Sanada, N., Kuramoto, N., Yoneda, Y., 2006. A metabotropic glutamate receptor family gene in Dictyostelium discoideum. J Biol Chem 281, 12336–12343. Tanoue, T., Takeichi, M., 2005. New insights into Fat cadherins. J Cell Sci 118, 2347–2353. Tao, R., Auerbach, S.B., 2002. GABAergic and glutamatergic afferents in the dorsal raphe nucleus mediate morphine-induced increases in seroto- nin efflux in the rat central nervous system. J Pharmacol Exp Ther 303, 704–710. Taveggia, C., Zanazzi, G., Petrylak, A., Yano, H., Rosenbluth, J., Einheber, S., Xu, X., Esper, R.M., Loeb, J.A., Shrager, P., Chao, M.V., Falls, D.L., Role, L., Salzer, J.L., 2005. Neuregulin-1 type III determines the ensheathment fate of axons. Neuron 47, 681–694. Temple, S., 2001. The development of neural stem cells. Nature 414, 112– 117. Tepass, U., Truong, K., Godt, D., Ikura, M., Peifer, M., 2000. Cadherins in embryonic and neural morphogenesis. Nat Rev Mol Cell Biol 1, 91– 100. Terada, N., Hamazaki, T., Oka, M., Hoki, M., Mastalerz, D.M., Nakano, Y., Meyer, E.M., Morel, L., Petersen, B.E., Scott, E.W., 2002. Bone marrow cells adopt the phenotype of other cells by spontaneous cell fusion. Nature 416, 542–545. Tokumoto, Y., Ogawa, S., Nagamune, T., Miyake, J., 2010. Comparison of efficiency of terminal differentiation of oligodendrocytes from induced

61 pluripotent stem cells versus embryonic stem cells in vitro. J Biosci Bi- oeng 109, 622–628. Tomaselli, K.J., Neugebauer, K.M., Bixby, J.L., Lilien, J., Reichardt, L.F., 1988. N-cadherin and integrins: two receptor systems that mediate neuronal process outgrowth on astrocyte surfaces. Neuron 1, 33–43. Towers, S., Princivalle, A., Billinton, A., Edmunds, M., Bettler, B., Urban, L., Castro-Lopes, J., Bowery, N., 2000. GABAB receptor protein and mRNA distribution in rat spinal cord and dorsal root ganglia. Eur J Neu- rosci 12, 3201–3210. Tsai, R.Y.L., Kittappa, R., McKay, R.D.G., 2002. Plasticity, niches, and the use of stem cells. Dev Cell 2, 707–712. Vandesompele, J., de Preter, K., Pattyn, F., Poppe, B., van Roy, N., de Paepe, A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology 3, research0034.1–research0034. Vartanian, T., Goodearl, A., Viehöver, A., Fischbach, G., 1997. Axonal neuregulin signals cells of the oligodendrocyte lineage through activation of HER4 and Schwann cells through HER2 and HER3. J Cell Biol 137, 211–220. Villa, G., Fumagalli, M., Verderio, C., Abbracchio, M.P., Ceruti, S., 2010. Expression and contribution of satellite glial cells purinoceptors to pain transmission in sensory ganglia: an update. Neuron Glia Biol 6, 31–42. Wang, Z., Sugano, E., Isago, H., Hiroi, T., Tamai, M., Tomita, H., 2011. Differentiation of neuronal cells from NIH/3T3 fibroblasts under defined conditions. Dev Growth Differ, Neuronal differentiation from NIH/3T3 53, 357–365. Wanner, I.B., Guerra, N.K., Mahoney, J., Kumar, A., Wood, P.M., Mirsky, R., Jessen, K.R., 2006. Role of N-cadherin in Schwann cell precursors of growing nerves. Glia 54, 439–459. Wanner, I.B., Wood, P.M., 2002. N-cadherin mediates axon-aligned process growth and cell-cell interaction in rat Schwann cells. J Neurosci 22, 4066–4079. Webster, H.D., Aström, K.E., 2009. Gliogenesis: historical perspectives, 1839-1985. Adv Anat Embryol Cell Biol 202, 1–109. Whiting, P.J., McAllister, G., Vassilatis, D., Bonnert, T.P., Heavens, R.P., Smith, D.W., Hewson, L., O'Donnell, R., Rigby, M.R., Sirinathsinghji, D.J., Marshall, G., Thompson, S.A., Wafford, K.A., Vasilatis, D., 1997. Neuronally restricted RNA splicing regulates the expression of a novel GABAA receptor subunit conferring atypical functional properties [cor- rected; erratum to be published]. J Neurosci 17, 5027–5037. Williams, E.J., Williams, G., Gour, B., Blaschuk, O., Doherty, P., 2000. INP, a novel N-cadherin antagonist targeted to the amino acids that flank the HAV motif. Mol Cell Neurosci 15, 456–464. Xu, X., Li, W.E., Huang, G.Y., Meyer, R., Chen, T., Luo, Y., Thomas, M.P., Radice, G.L., Lo, C.W., 2001. Modulation of mouse neural crest cell

62 motility by N-cadherin and connexin 43 gap junctions. J Cell Biol 154, 217–230. Yagita, Y., Sakurai, T., Tanaka, H., Kitagawa, K., Colman, D.R., Shan, W., 2009. N-cadherin mediates interaction between precursor cells in the subventricular zone and regulates further differentiation. J Neurosci Res 87, 3331–3342. Yang, K., Wang, D., Li, Y.Q., 2001. Distribution and depression of the GABA(B) receptor in the spinal dorsal horn of adult rat. Brain Res Bull 55, 479–485. Yin, T., Green, K.J., 2004. Regulation of desmosome assembly and adhesion. Semin Cell Dev Biol 15, 665–677. Yoon, C., Korade, Z., Carter, B.D., 2008. Protein kinase A-induced phosphorylation of the p65 subunit of nuclear factor-kappaB promotes Schwann cell differentiation into a myelinating phenotype. J Neurosci 28, 3738–3746. Young, J.A., Brown, D.A., Kelly, J.S., Schon, F., 1973. Autoradiographic localization of sites of (3H)gamma-aminobutyric acid accumulation in peripheral autonomic ganglia. Brain Res 63, 479–486. Zujovic, V., Thibaud, J., Bachelin, C., Vidal, M., Coulpier, F., Charnay, P., Topilko, P., Baron-Van Evercooren, A., 2010. Boundary cap cells are highly competitive for CNS remyelination: fast migration and efficient differentiation in PNS and CNS myelin-forming cells. Stem Cells 28, 470–479. Zujovic, V., Thibaud, J., Bachelin, C., Vidal, M., Deboux, C., Coulpier, F., Stadler, N., Charnay, P., Topilko, P., Baron-Van Evercooren, A., 2011. Boundary cap cells are peripheral nervous system stem cells that can be redirected into central nervous system lineages. Proc Natl Acad Sci USA 108, 10714–10719.