Integrin-Induced E-Cadherin–Actin Complexes 545

Research Article 543 Integrin-mediated functional polarization of Caco-2 cells through E-cadherin–actin complexes

Cyrille Schreider, Gregory Peignon, Sophie Thenet, Jean Chambaz and Martine Pinçon-Raymond* INSERM U505, Université Pierre et Marie Curie, EPHE, 15 rue de l’Ecole de Médecine, 75006 Paris, France Author for correspondence (e-mail: [email protected])

Accepted 25 October 2001 Journal of Cell Science 115, 543-552 (2002) © The Company of Biologists Ltd

Summary Enterocyte differentiation is a dynamic process during type IV collagen or laminin 2, which suggests a common which reinforcement of cell-cell adhesion favours migration pathway of induction through integrin receptors. Indeed, along the crypt-to-villus axis. Functional polarization of these effects were antagonized by blocking anti-β1- and Caco-2 cells, the most commonly used model to study anti-α6-integrin antibodies and directly induced by a intestinal differentiation, is assessed by dome formation stimulating anti-β1-integrin antibody. These results and tightness of the monolayer and is under the control demonstrate that integrin-dependent cell to ECM adhesion of the extracellular matrix (ECM). Furthermore, our reinforces E-cadherin-dependent cell-cell adhesion in biochemical and confocal microscopy data demonstrate Caco-2 cells and further support the notion that enterocyte that the ECM dramatically reinforces E-cadherin targeting differentiation is supported by a molecular crosstalk to the upper lateral membrane, formation of the apical between the two adhesion systems of the cell. actin cytoskeleton and its colocalization with E-cadherin in functional complexes. In our model, these effects were Key words: Caco-2 cells, β1 integrin, E-cadherin, Extracellular produced by native laminin-5-enriched ECM as well as by matrix, Actin cytoskeleton

Introduction developing kidney (Klein et al., 1990). Similarly, the addition The epithelium forms a barrier made of polarized cells joined of laminin boosts the formation of polarized alveoles in various by a complex set of cell-cell junctions. The assembly of types of epithelial cells, including mouse mammary (Li et al., adherens junctions through the interaction of E-cadherin of 1987), human salivary (Hoffman et al., 1996) and rat lung adjacent cells initiates this process (Gumbiner, 1996; Kemler, (Matter and Laurie, 1994) cells in culture. ECM-integrin 1992). The importance of cell-cell adhesion in differentiation interactions have either been demonstrated to be directly and in the maintenance of the differentiated phenotype is well involved in ECM control of cell functions or found to be established in epithelial cells (Braga et al., 1999). In addition, aberrant in embryos or animals carrying mutations in integrin epithelial cells are separated from the underlying connective genes (Wang et al., 1999). tissue by a basement membrane that is composed of a variety Both cell-ECM and cell-cell adhesion systems are connected of extracellular matrix (ECM) molecules that control cell to the cytoskeleton, which controls cell polarization. Numerous differentiation in many tissues through interactions with their studies have established that the interaction between ECM and cellular receptors, for example, with integrins (Boudreau and integrin results in cytoskeletal rearrangements (Larjava et Bissell, 1998). al., 1990; Wang et al., 1999). Integrins are heterodimeric The basement membrane is mostly composed of type IV transmembrane receptors composed of α and β subunits collagen, different types of laminins, entactin and heparan associated in a noncovalent manner (Hynes, 1987; Yamada and sulfate proteoglycan (Beaulieu, 1997). ECM molecules, Miyamoto, 1995). Integrin initiates, through its β1 cytoplasmic originating from both epithelial and underlying mesenchymal domain, the assembly of specialized cytoskeletal and signaling cells, create a framework that is essential for maintaining tissue protein complexes at the contacting membrane (Gimond et integrity (Simon-Assmann and Kedinger, 1993). Besides this al., 1999). In the same way, epithelial cells forming strong cell- structural role, ECM proteins are involved in the control of cell junctions assemble a subcortical actin skeleton instead of adhesion, migration, proliferation, differentiation and gene focal adhesion and actin stress fibers (Larjava et al., 1990). expression of adjacent cells, which emphasizes the dynamic Cadherins are also dependent on cytoskeletal organization reciprocity between epithelial and mesenchymal cells (Bissell (Tsukita et al., 1992); correct function of the E-cadherin– et al., 1982). Additionally, ECM is able to control the effects catenin complex requires association with the cytoskeleton of trophic factors by sequestration outside of the cell (Simon- (Skoudy et al., 1996). In epithelial cells, about one half of Assmann et al., 1998) and by crosstalk between their signaling plasma membrane E-cadherin is connected to the actin pathways (Yamada and Geiger, 1997). It is admitted that cell cytokeleton: the rest is free within the membrane (Sako et al., adhesion to the ECM contributes to the apical-to-basal axis of 1998). The linkage between E-cadherin and the F-actin polarity, in vivo as well as in vitro. Appearance of polarized cytoskeleton is mediated through direct binding of the cells coincides with the expression of laminin 1 (LN1) in the cytoplasmic domain of E-cadherin to β-catenin, which binds 544 Journal of Cell Science 115 (3) to α-catenin (Aberle et al., 1994; Jou et al., 1995) in a 1:1:1 of methotrexate (Lesuffleur et al., 1990) and cultured without the drug stochiometry. Crosstalk between the two adhesion systems has and named HT29-MTX (9th passage) were cultured at 37°C with 10% also been demonstrated in mammary epithelial cells through CO2 in Dulbecco’s minimal essential medium (DMEM), 25 mM the integrin signaling pathway. In these cells, integrins promote glucose (Gibco), pen/strept (50 µg/ml) and non-essential amino acid the formation of morphologically differentiated acini-like (1%) (Gibco) supplemented with 5% foetal calf serum (Boehringer). structures, which involves the assembly of adherens junctions Mesenchymal intestinal cells C9, C11, C20 obtained from M. Kedinger (Fritsch et al., 1999) (28th, 29th and 14th passages, through the relocalization of E-cadherin at the lateral side of respectively) were cultured at 37°C with 7.5% CO2 in RPMI 1640 the cells (Weaver et al., 1997). medium, pen/strept (50 µg/ml) (Gibco), supplemented with 10% The mammalian intestinal epithelium is peculiar in that it is foetal calf serum (Boehringer). Muscle 129CB3 cells were cultured a constantly renewing monocellular epithelium, which as described (Pinçon-Raymond et al., 1991) to form contracting migrates ‘en cohorte’ along the basement membrane from the myotubes and secrete a large amount of ECM. proliferative undifferentiated compartment in the crypts to the tips of the villi. Enterocytes can probably glide over the basement membrane through loose adhesion, through them Extracellular matrix preparation and coating being tied to each other by strong cell-cell junctions. Whereas Native ECM was prepared from 129CB3 myotubes, mesenchymal type IV collagen is constantly present in the basement C9, C11, C20 cells (at confluence), HT29-MTX cells (3 days post- confluence) or Caco-2 cells (12d post-confluence) as described membrane, LN2 is preferentially found in the proliferative previously (Le Beyec et al., 1997). Coating of plastic petri dishes compartment, LN5 in the villus and LN1 at the junction of the was performed by overnight incubation with poly-D-lysine, 5 two compartments (Vachon et al., 1993; Lorentz et al., 1997). µg/cm2, collagen type IV, 10 µg/cm2 and merosin LN2, 8.4 µg/cm2 Similarly, villus and crypt epithelial cells display a different at 4°C. pattern of integrins, β1-containing integrins being more abundant in the villi than in the crypts. Furthermore, β1 is mainly associated with α2 in the crypt and with α3 integrins Perturbation experiments in the villus (Beaulieu, 1992). Whereas α2β1 integrin Caco-2 cells were seeded at 125,000 cells/cm2 (pre-confluence) in preferentially binds to collagen IV but also to LN1 and LN2, 24-well plates coated or not with native ECM or ECM components. α β At the time of plating, cells were mixed with control mouse IgG or 3 1 integrin binds to both collagen IV and LN5 (Beaulieu, β α α β anti- 1-integrin monoclonal blocking antibody (6S6) or anti- 6- 1999; Rousselle and Garrone, 1998). Integrin 6 4 binds to integrin used to block β4 integrin (CD49F) or anti-E-cadherin both LN1 and LN5 (Fleischmajer et al., 1998). This differential monoclonal blocking antibody (HECD-1) at the indicated dilutions. pattern of expression of ECM proteins and their receptors Under these conditions, control cells were confluent within 24 hours. along the crypt-to-villus axis parallels the differentiation For each kinetics experiment, triplicate wells were observed using process of epithelial cells. One can wonder whether changes in a phase contrast microscope. Confluence was evaluated, and ECM-integrin interactions at the crypt to villus junction are counting triplicate wells on a phase contrast microscope numerated accompanied by changes in cell-cell adhesion, which allow cell the domes. migration to the tip of the villus. The colon cancer Caco-2 cell line in culture mimics Ribonuclease protection assay enterocyte differentiation. We previously showed that ECM was A specific 400 bp cDNA encoding the human apoA-IV gene was required for the expression of the apoA-IV gene, an intestinal obtained by RT-PCR using the coding oligonucleotide HindIII- differentiation marker (Le Beyec et al., 1997). Here, we observed AIV (5′-CTGGAGAAGCTT+149ACACTTACGCAGGTGACCTG- that the functional polarization of Caco-2 cells, assessed by CAG+171-3′) and the noncoding oligonucleotide Xba-AIV (5′-CT- dome formation and permeability of the monolayer, is under the GCAGTCTAGA+550AGGGCGTAAGGCGTCCCTTGA+530-3′). The control of integrin-mediated adhesion to ECM. Furthermore, we PCR product was digested using XbaI and HindIII, and ligated into demonstrate that integrin activation by ECM reinforces cell-cell the XbaI/HindIII-digested PSK vector to obtain the pAIV-RPA adhesion by targeting E-cadherin at the lateral membrane in plasmid. For E-cadherin mRNA analysis, a specific 407 bp cDNA functional complexes with actin cytoskeleton. encoding the human E-cadherin gene was obtained using the coding oligonucleotide (5′-+2660GACCAGGACTATGACTACTTG- AACG+2684-3′) and the noncoding oligonucleotide (5′-+3067ATC- TGCAAGGTGCTGGGTGAACCTT+3043-3′) inserted into PCR 2.1 Materials and Methods vector. An antisense AIV RNA probe (445 bp) was generated by in Antibodies and products vitro transcription of the HindIII-digested pAIV-RPA plasmid using Antibodies used included monoclonal anti-β1 (6S6) and anti-α6 [α-32P]UTP and T3 RNA polymerase (Promega). An antisense (NKI-GoH3) human integrins with a blocking activity and anti-β1- E-cadherin RNA probe (523 bp) was generated by in vitro integrin (B3B11) with a stimulating activity and purified control transcription of the Kpn1-digested E-cadherin-PCR2.1 plasmid mouse anti-IgG (Chemicon); polyclonal anti-human E-cadherin using [α-32P]UTP and T7 RNA polymerase (Promega). An antisense (HECD-1) (Zymed); monoclonal anti-β-catenin (clone 14) β-actin RNA probe (Human Internal Standards kit, Ambion Inc.) (Transduction Laboratories); FITC-labeled antibodies (Sigma) and was synthesized with T3 as an internal control. Total RNA was RITC-labeled antibodies (Boehringer). TRITC- or FITC-labeled extracted from cells using an RNAzol kit (Bioprobe Systems). Equal phalloidin (Sigma) was used to visualize the actin cytoskeleton. We amounts (6 µg) of total RNA samples were subjected to the RNase also used human merosin LN2 (Gibco) and mouse collagen type IV protection assay using the RPAII kit (Ambion Inc) following the and synthetic poly-D-lysine (Becton-Dickinson). manufacturer’s recommendations. The protected A-IV RNA (400 bp), E-cadherin RNA (407 bp) and β-actin RNA (245 bp) probes were separated on a 5% denaturing polyacrylamide-urea gel in Tris Cell culture borate-EDTA buffer. The gel was dried and exposed to X-ray film Caco-2 cells (43rd to 50th passage) and HT29 cells adapted to 10–5 M at –80°C. Integrin-induced E-cadherin–actin complexes 545

Table 1. ECM components produced by mesenchymal and epithelial cells used in this study LN1 LN2 LN5 LN10 (α1β1γ1) (α2β1γ1) (α3β3γ2) (α5β1γ1) Col IV C9 no α1 [1]a α2 + [1]a γ2 + [1]a α5 ++ [2]a + [1]c C11 no α1 [1]a α2 + [1]a γ2 + [1]a α5 ++ [2]a + [1]c C20 no α1 [1]a α2 + [1]a γ2 + [1]a α5 ++ [2]a + [1]c 129CB3* α1 + [7,8]a α2 + [7,8]c α3 – [7]c α5 + [7]c + [6]c HT29MTX no α1 RNAa nd α3 ++ [3]b,d α5 + [2]a,d nd no protein [2]d β3 ++ [3]d γ2 ++ [3]b,d Caco-2 α1 RNA +a α2 + [2]a α3 – [3]b α5 + [2]a,b α5 + [9]c no protein [5]b β3 – [3]d [5]d γ2 + [3]b,d Fig. 1. Native ECM differentially increases expression of the The nature of ECM components produced by mesenchymal (C9; C11; differentiation marker apoA-IV in Caco-2 cells. The Caco-2 cells C20) or epithelial cells from intestine (HT29-MTX; Caco-2) was determined were grown until confluence on plastic or on different native ECM by RT-PCR (a), Western blot (b), IF (c), or IP (d) by (Fritsch et al., 1999) [1], previously secreted and deposited by mesenchymal cells from the Simon-Assmann et al. (personal communication) [2], (Orian-Rousseau et al., intestine (C9; C11; C20) or the muscle (129CB3), or by colon 1998) [3], (De Arcangelis et al., 1996) [4], (Velling et al., 1999) [5]. *The tumour epithelial cells (HT29-MTX; Caco-2 at 12 day post composition of the native ECM secreted and deposited by mesenchymal confluence). Composition of these ECMs is described in Table 1. muscle cells (129CB3) is deduced from studies on similar cell lines (G8; Total RNA was isolated, and the abundance of apoA-IV transcripts C2C12) from mouse skeletal muscle by (Rao et al., 1985) [6], (Patton et al., was assayed by RNAse Protection Assay, using β actin mRNA as an 1997) [7], (Vachon et al., 1996) [8] (Beaulieu, 1997) [9]. nd=not determined. internal control. The mRNA ratio of apoA-IV:β actin (mean±s.e.m. of three independent cultures performed in triplicate) is expressed as Cell surface biotinylation a percentage of the value obtained from Caco-2 on plastic. * and ** differ from the control at P<0.05 and P<0.01 (t-test), respectively. Caco-2 cells were seeded on plastic coated or uncoated dishes with Note that LN5-rich ECM deposited from HT29 MTX cells is the native ECM or ECM components and grown for 6 days. All most effective ECM to induce apoA-IV expression in Caco-2 cells. manipulations were performed at 4°C according to Sander et al. (Sander et al., 1998). Briefly, cells were incubated for 15 minutes in phosphate-buffered saline (supplemented with 1 mM MgCl2 and 0.5 mM CaCl2) containing 500 µg/ml sulfo-NHS-biotin (Pierce Chemical was performed sequentially to avoid crossreactions. Anti-β1-integrin Co.), washed three times in phosphate-buffered saline containing 50 (6S6) primary antibodies diluted in the blocking solution were mM glycine, pH 7.4, lysed in RIPA buffer (50 mM Tris-HCl, pH 7.5, incubated for 1 hour 30 minutes, followed by a 1 hour 30 minute 150 mM NaCl, 1% Nonidet P40, 0.5% sodium deoxycholate, 0.1% incubation with RITC-labeled secondary antibodies, followed by SDS, protease inhibitors, 10% glycerol, 1 mM EDTA, 3 mM MgCl2, overnight incubation at 4°C with an anti-E-cadherin antibody (HECD- 1 mM dithiothreitol) and centrifuged for 15 minutes at 13,000 g. The 1). These antibodies were visualized with FITC-labeled secondary supernatant was incubated with avidin-coated agarose beads (Sigma antibodies after a 1 hour 30 minute incubation. Images were acquired Chemical Co.) for 1 hour. Immunoprecipitates of biotinylated surface with a Zeiss LSM-510 laser-scanning confocal microscope (Carl proteins bound to avidin-agarose were washed five times in RIPA Zeiss, Oberkochen, Germany) equiped with Zeiss Axiovert 100M buffer and analysed for E-cadherin (HECD-1) by western blotting. (plan Apochromat 63×1.40 NA oil immersion objective). The contrast and brightness settings were constant during the course of image acquisition. The E-cadherin/actin colocalization visualized by Western blotting confocal analysis was quantified using a program from Zeiss LSM The protein concentration of Caco-2 lysates, biotinylated or not, was 510 confocal. The data were recorded from cells in the upper half of assessed by the Biorad ‘Dc’ protein assay. A 20 µg aliquot of each the cell in six random fields from three independent experiments. sample mixed with Laëmmli buffer was boiled and submitted to 7% SDS polyacrylamide gel electrophoresis. Samples were then transferred onto nitrocellulose and blocked in 1% non-fat milk Results overnight at 4°C. After a 2 hour incubation with the primary antibody Native ECM induces the expression of a differentiation in the blocking solution at room temperature, blots were washed in PBS 1× pH 7.4, incubated with appropriate HRP-conjugated marker gene and cell polarity secondary antibody and washed again. The blots were visualized by Of the criteria for epithelial cell differentiation, modifications chemiluminescence (Amersham ECL system). Signals were scanned in cell shape (polarization) and gene expression are those most (Umax vistaScan S6E) from chemiluminescence into Adobe often reported. We have previously reported that the expression Photoshop. of a differentiation marker gene of enterocytes, apolipoprotein A-IV (apoA-IV), was induced in human colon carcinoma Caco- Immunofluorescence studies 2 cells when they were grown on filters coated with a native extracellular matrix (ECM) (Le Beyec et al., 1997). To Caco-2 cells were grown on Lab-Tek chambered borosilicate coverglasses (Nunc), coated or not with native ECM or ECM determine whether this effect was due either to ECM-cell components. At the indicated time, cells were fixed in 4% adhesion or to cell polarization, which would be induced paraformaldhehyde in phosphate-buffer saline, then permeabilised in independently by culturing cells on a filter, we grew Caco-2 0.1% Triton X-100 during all incubations. Non-specific antigens were cells on native ECM deposited on a plastic support. Fig. 1 blocked for 30 minutes in 3% bovine serum albumin. Double labeling clearly shows that ECM is able to induce apoA-IV expression 546 Journal of Cell Science 115 (3)

Fig. 2. Native LN5-rich ECM reinforces cell-cell interactions 2 Fig. 3. Native LN5-rich ECM induces E-cadherin targeting to the between Caco-2 cells. Caco-2 cells were plated at 20,000 cells/cm 2 on plastic (ᮀ) or on native LN5-rich ECM (᭿) deposited by HT29- lateral membrane. Caco-2 cells were plated at 20,000 cells/cm on MTX cells. (A) Phase contrast micrography (X 25; bar, 200 µm) glass or on native LN5-rich-ECM deposited by HT29-MTX cells, shows that domes appear on cultures grown on ECM 2 days earlier and RNA and proteins were prepared for further analysis. than on plastic support. (B) shows the confluence rates observed by (A) RNase Protection Assay of apoA-IV and E-cadherin mRNA, using β actin mRNA as a control. The ratio of apoA-IV or E- phase microscopy. (C) At the indicated times, domes were counted. β Values represent mean ±s.m.d. from triplicate wells from three cadherin to actin mRNA on LN5-rich ECM was compared to that independent cultures. (D) shows a 3D confocal reconstruction of the measured in Caco-2 cells grown on glass and expressed as a diffusion of FITC-conjugated biotin added at the apical side of Caco- percentage. Note that ECM increases apoA-IV but not E-cadherin 2 cultures grown on plastic (a) or on LN5-rich ECM (b). (bar, 10 mRNA levels. (B) Western blot analysis of the total amount of µ E-cadherin and β-catenin. Note that the total amount of either m). Note that the presence of ECM restricts biotin diffusion at the β apical compartment, which indicates a reinforcement of cell-cell E-cadherin or -catenin proteins does not vary. (C) Western blot interactions as compared to cultures grown on plastic without ECM. analysis of E-cadherin after immunoprecipipation of biotinylated The result is representative of three independent experiments. membrane-associated proteins. Total E-cadherin (a,c) and biotinylated E-cadherin (b,d) amounts of E-cadherin in cells grown on plastic without ECM (a,b) or LN5-rich ECM (c,d). Note the independently of the polarization effect of the filter. increase in E-cadherin localized at the cell surface in cultures Furthermore, the level of induction varies according to the grown on ECM. The data are means ±s.e.m. of three independent origin of the different ECM tested. Table 1 summarizes cultures performed in triplicate. * differs from the control at available data on the production of ECM components by the P<0.05. Integrin-induced E-cadherin–actin complexes 547

Fig. 4. Effect of ECM on cell-cell interactions, E-cadherin and actin subcellular localization. (A) Caco-2 cells were plated at 20,000 cells/cm2 on glass (a) or on native LN5-rich ECM (b), processed for immunofluorescence with anti E-cadherin at confluence and analysed by confocal microscopy. Note that E-cadherin is mostly located at the cell-cell junction membrane on domes formed by cells grown on ECM. 3D confocal reconstruction (XZ) shows an E-cadherin signal at the basal side of the Caco-2 cells grown on glass (c), which disappears in cells grown on ECM (d) where the localization of E- cadherin aggregation (i.e. 25 µm from the basal side out of a 30 µm total height) is compatible with the position adherens junction (bar, 10 µm). (B) Caco-2 cells were plated at 50,000 cells/cm2 on glass (a,a’), polylysine (b,b’), native LN5-rich ECM (c,c’) type IV collagen (d,d’), or LN2 (e,e’), processed for immunofluorescence with anti-E-cadherin and FITC (green) and TRITC-conjugated phalloidin (red) after 72 hours of culture and analysed by confocal microscopy. Note that ECM increases E-cadherin-actin colocalization (yellow merge signal) and allows the formation of cortical actin cytoskeleton (bar, 10 µm). (C) Actin labelling in cells grown (72 hours) on glass in presence of the β1-integrin-activating antibody (bar, 10 µm). The results are representative of three independent experiments.

domes 2 days earlier than cells grown on the plastic support, and the ECM-grown domes were larger (Fig. 2A). It is known that, at confluence, epithelial cells grown on a non-porous support such as plastic are elevated by the fluid accumulated under the monolayer and form domes (Pinto et al., 1983). Comparison, every 2 days for 14 days, of Caco-2 cells grown on native ECM or on plastic shows that this dramatic increase in domes formed by Caco-2 cells on native LN5-rich ECM (Fig. 2C) does not rely on the confluence rate of the cells (Fig. 2B), which is the same under both conditions. The permeability of the monolayer was further assessed by the use of FITC- biotin, an outside marker to which cells are impermeable. Fig. 2D confirms an overall inductive effect of ECM on the tightness of cell-cell junctions and functionality of tight junctions by displaying the ability of FITC-labelled biotin to penetrate between adjacent cells within the monolayer. Clearly, this molecule remained apical on the monolayer grown on ECM substrate (Fig. 2Db) whereas it penetrated much deeper between cells grown on plastic without ECM (a) or on polylysine (not shown), an artificial substrate which does not binds to integrins (Machesky and Hall, 1997). In contrast to the purpose of the experiment, which was to differentiate between the effects of ECM and filter-induced cell various mesenchymal and epithelial cell types used to deposit polarization, it suggests that functional polarization of Caco-2 native ECM on the plastic support. Most of these data were cells, as assessed by dome formation and permeability of the obtained by measuring mRNA levels by RT-PCR, which is monolayer, is under the control of ECM. insufficient to predict the amount of laminin synthesized and deposed by the cells. Indeed discrepancies between mRNA and protein measurements were reported for α1 laminin in HT29- Native ECM triggers E-cadherin accumulation at the MTX and Caco-2 cells. Furthermore, C9, C11 and C20 lateral membrane and colocalization with actin intestinal mesenchymal cells have been reported to express cytoskeleton laminin chain mRNA in the same range. Nevertheless, the The aggregation of E-cadherin molecules at the adherens native ECM deposited by C20 cells was much more efficient junctions is the primary event, which organizes the formation in inducing apoA-IV gene expression than that from the other of the other cell-cell junctions, that is gap, desmosome, and clones. However, Fig. 1 indicates that the most effective ECM tight junctions, which ensure the formation of an impermeable to induce apoA-IV expression is the native LN5-rich ECM from polarized epithelium (Cereijido et al., 2000; Fujimoto et al., HT29 cells adapted to 10–5 M methotrexate. 1997; Jongen et al., 1991; Lampe et al., 1998). We therefore Observation of Caco-2 cells during these experiments studied the expression of E-cadherin in our system. We saw revealed that cells grown on native LN5-rich ECM formed that native LN5-rich ECM induced a threefold increase in 548 Journal of Cell Science 115 (3) ECM (Fig. 4Ab) compared with cells grown on an inert support (Fig. 4Aa). In addition, confocal 3D analysis shows that E- cadherin was clearly visible at the base of cells, which form a flat monolayer on an inert support (Fig. 4Ac), whereas the signal almost disappeared from the base of cells forming domes on ECM and concentrated in focal spots in the upper third of the lateral membrane (Fig. 4Ad). Fig. 4B (c,d,e) shows that purified ECM components such as type IV collagen and laminin 2 were as efficient as native ECM in inducing E- cadherin targeting to the lateral membrane of cells that do not form domes. Since E-cadherin localized to adherens junctions is intimately associated with actin cytoskeleton in polarized epithelial cells, we also investigated by confocal analysis the actin cytoskeleton and its association with E-cadherin. In addition, culturing cells on ECM components reinforced the formation of the apical actin cytoskeleton and its colocalization with E-cadherin at the upper part of the lateral membrane (Fig. 4Bc’,d’,e’), as revealed by the merge yellow signal, as compared to an inert support (Fig. 4Ba’). Similar observations were made using a stimulating anti-β1-integrin antibody in Caco-2 cells grown on an inert support, resulting in the formation of a cortical network of actin at the apical side of the cell (Fig. 4C). Altogether, these results favour a role of native ECM or of its components in the accumulation of E- cadherin at the lateral membrane in functional complexes anchored to the apical actin cytoskeleton. Fig. 5. Dome formation is under the control of both E-cadherin and β1 integrin expressions. Caco-2 cells were plated at 125,000 β 2 ᭹ ᭿ E-cadherin targeting to the lateral membrane involves 1 cells/cm on plastic ( ) or on native LN5-rich ECM ( ) in the integrin presence of 10 µg/ml mouse non-specific IgG (᭛), 10 µg/ml (᭺) or 2.5µg/ml (ٗ) anti-β1-integrin blocking antibody. (A) shows the ECM components interact at the cell surface with their receptor appearance of domes as a function of time. Note that anti-β1-integrin integrins, which are mainly α3β1 and α6β4 for LN5, in antibody dose dependently decreases the number of domes formed differentiated intestinal epithelial cells. In order to see whether on ECM substrate as early as 2 days in culture. These perturbations ECM induced modification in integrin distribution in Caco-2 are not correlated with the confluence rate. (B) shows the confluence cells, we performed confocal analysis after double labeling rate of Caco-2 cells. The presence of β1-integrin antibody or plastic against β1 or β4 integrin and E-cadherin. As expected, we support delays confluence, which is reached 2 days later than in observed that β1 integrin colocalized with E-cadherin at the untreated cells grown on ECM or in the presence of control IgG lateral membrane of cells forming domes, mostly when cells antibody. were grown on ECM, a condition in which domes are much more numerous than in cells grown on an inert support (data apoA-IV gene expression. At the same time, the total amount not shown). We also verified that β4 integrin was only found of E-cadherin protein (Fig. 3B) and mRNA (Fig. 3A) remained at the basal membrane of cells forming domes on ECM but not in the same range, as did that of β-catenin protein, a partner of on an inert support (data not shown). E-cadherin required for an efficient exit from endoplasmic To further establish the role of ECM on Caco-2 cell reticulum in MDCK cells (Chen et al., 1999). The amount of polarization and E-cadherin targeting to the membrane, we E-cadherin associated with the membrane was obtained after performed perturbation experiments using functional blocking surface biotinylation in the presence of 0.5 mM Ca2+, a antibodies against β1 integrin, the β chain of the major integrin concentration resulting in a slight loosening of tight junctions receptor for laminins and type IV collagen. Indeed, dome but still too high for inducing the disruption of adherens formation in cells grown on ECM was drastically impaired by junctions, which occurs under 0.1 mM Ca2+ (Cereijido et al. the anti-β1-integrin blocking antibody, in a dose dependent 2001; Braga et al., 1997) (Fig. 3C). Similar to the observation manner, and it was reduced to the range observed in cells by Sander et al. in MDCK cells expressing Tiam1/Rac (Sander grown on plastic support (Fig. 5A). Similarly, upon treatment et al. 1998), Figure 3C shows that the association of E-cadherin with antibodies, cells grown on ECM reached confluence 1 day with the membrane was increased fourfold in cells grown on later than those not treated, at a time similar to that observed ECM compared with those grown on plastic without ECM, with cells grown on plastic. The effect of anti-β1 antibody on although ECM did not influence the total amount of E- dome formation was observed when cells were at confluence cadherin–β-catenin. whereas non-specific mouse IgG displayed no effect (Fig. 5B). The targeting of E-cadherin to the membrane induced by Under these conditions, we investigated the effects of anti- ECM was further characterized by confocal analysis. The β1 or anti-α6 blocking antibodies on E-cadherin accumulation signal detected by indirect immunofluorescence was stronger at the lateral membrane and anchoring to the cortical actin and cell-cell junctions were better delineated in cells grown on cytoskeleton. Colocalization of E-cadherin and actin at the Integrin-induced E-cadherin–actin complexes 549 apical-lateral side of cells was estimated by computer analysis electrolytes and water and a decrease in adherence to the of confocal stack series. Pixel count and pixel intensity substrate. The formation of domes, while occurring measurements gave the same results. Fig. 6A shows that Col spontaneously on plastic support (Pinto et al., 1983), has been IV and LN2 increased the amount of colocalization of E- shown to be enhanced by differentiation inducers such as cadherin and actin signals up to 30% as compared to cells dimethyl sulfoxide (DMSO) or 8-Br-cAMPC in LA7 epithelial grown on plastic. Thus, either ECM component could be used cells (Zucchi et al., 1998). Here, time of dome formation, their in the experiments. Confocal 3D reconstruction of cells grown number and size and monolayer tightness specifically depend on Col IV reveals double, cortical and basal rows of actin on cell-ECM interactions, as FITC-labelled biotin penetrated cytoskeleton with an important level of E-cadherin and actin much deeper between Caco-2 cells grown on plastic or colocalization (Fig. 6Ba). The addition of anti-β1-integrin polylysine as compared to cells grown on native ECM. It blocking antibody resulted in dramatic disorganization of the should be emphasized that the time for the delayed formation cortical row of the actin cytoskeleton and, in parallel, a of domes by Caco-2 cells grown on plastic was compatible reduction in E-cadherin and actin colocalization (Fig. 6Bb). with the time necessary for the deposition of ECM material The blockade of either of the β1 integrins in cells grown produced by Caco-2 cells themselves (Vachon and Beaulieu, on LN2 (Fig. 6C) or α6β4 integrin in cells grown on native 1995). ECM (Fig. 6D) resulted in a significant reduction in the Assembly of tight junctions, as well as gap and desmosomal colocalization of E-cadherin and actin at the apical lateral side junctions, depends on E-cadherin recruitment at adherens of Caco-2 cells. Altogether, these results demonstrate that junctions (Cereijido et al., 2000; Jongen et al., 1991; Matsuzaki ECM, by interacting with its receptor integrins, influences the et al., 1990; Mege et al., 1988; Fujimoto et al., 1997; Green et association of E-cadherin and actin at the level of adherens al., 1987; Gumbiner et al., 1988; van Hengel et al., 1997). junction as functional complexes responsible for Caco-2 cell Therefore, we investigated E-cadherin status in our cells. polarization. Native ECM did not affect the total amount of E-cadherin and of β-catenin protein, as shown by biochemical analysis and confocal microscopy, but we demonstrated that ECM Discussion dramatically increases E-cadherin localization to the plasma Enterocyte differentiation is a dynamic process that takes place membrane. Confocal microscopy revealed that, in cells grown within a polarized epithelium migrating ‘en cohorte’ from the on native LN5-rich ECM, the E-cadherin signal focused at the proliferative compartment located in the crypt. Proliferative cell-cell junction domain in the upper third of the lateral cells arise by successive asymmetric divisions from stem membrane, where adherens junctions are known to be cells, which themselves are part of the polarized intestinal localized. Furthermore, the observation that ECM induced epithelium, the integrity of which is essential for its barrier an increase in E-cadherin–actin colocalization suggests function. The localization of stem cells at a fixed position a reinforcement of E-cadherin anchoring to the actin within the crypt, the gradual loss of stem cell properties in the cytoskeleton and a better organization of the subcortical upwardly migrating cells and changes in cell adhesion to the network of actin by ECM. It is well established that tethering ECM during cell migration toward the villus indicate that the of E-cadherin to the actin cytoskeleton underlies strong cell- cell environment may control differentiation through different cell adhesion and is loosened in weak adhesion (Adams and attachment properties (Booth and Potten, 2000). The Nelson, 1998; Kaibuchi et al., 1999b). The lateral membrane composition of ECM varies, as does the integrin repertoire targeting of E-cadherin is produced not only by a native LN5- expressed by enterocytes (Potten et al., 1997). At the same rich ECM but also by Col IV alone, which is a common time, E-cadherin is mostly localized at the apical junctional component of all native ECMs (Rousselle and Garrone, 1998). complexes in the villus, contrary to the crypt (Hermiston et al., In our model, the coordinated reorganization of cell-cell 1996). Altogether, these changes might allow enterocytes to adhesion and the F-actin cytoskeleton was produced by native glide over the basement membrane through a looser type of laminin-5-enriched ECM as well as by type IV collagen or adhesion and might reinforce cell-cell junctions to perform the laminin 2, suggesting a common pathway of induction. We driving force. therefore questioned the role of ECM receptors expressed in In the present paper, we show in vitro that cell-ECM Caco-2 cells (i.e. α3β1 and α6β4 integrins). Blocking adhesion improves cell-cell adhesion through the experiments with anti-β1-integrin or anti-α6-integrin reinforcement of E-cadherin–actin complexes at the level of antibodies in Caco-2 cells grown on ECM substrates resulted adherens junctions in Caco-2 cells. This effect is specific for in a phenotype similar to that obtained on an inert support: a cell-ECM adhesion as it is antagonized by function-blocking random distribution of E-cadherin along the basolateral anti-integrin antibodies. membrane, a looser organisation of the F-actin network and a In vitro, epithelial cells form polarized monolayers at reduction in the merge signal from E-cadherin and F-actin confluence, even though full differentiation is not reached. cytoskeleton. These results demonstrate that recruitment of Studying the influence of native ECM on the expression of the integrin receptors by their external ligands results in the apoA-IV gene, an enterocytic marker, in Caco-2 cells we reinforcement of E-cadherin–actin functional complexes. But, observed that the ECM boosted the formation of domes by the upon ligand binding, integrin linkage to the F-actin monolayer. Formation of domes by confluent epithelial cells cytoskeleton is known to be reinforced (Calderwood et al., cultured on a non-porous support signals the formation of an 2000). This apparent contradiction might be explained by the impermeable monolayer, which rises owing to the fluid existence of distinct pools of F-actin forming functional accumulated underneath. This requires the setting of complexes with E-cadherin and integrin. Alternatively, intercellular tight junctions, the activation of pumps for translocation of regulatory proteins from E-cadherin to integrin 550 Journal of Cell Science 115 (3)

Fig. 6. β1 integrin mediates the effects of ECM on E-cadherin targeting to the lateral membrane. Caco-2 cells were plated at 125,000 cells/cm2 on plastic, native LN5-rich ECM, type IV collagen or LN2 in the presence or absence of either anti-β1- or anti-α6- integrin blocking antibodies. Cells were then processed for immunofluorescence with anti-E-cadherin and FITC (green) or TRITC-conjugated phalloidin (red) and analysed by confocal microscopy. Colocalization (yellow merge signal) of E-cadherin and actin at the apical-lateral side of cells was estimated by computer analysis of confocal stack series. (A) shows that ECM components increase the colocalization of E-cadherin and actin as compared to plastic without ECM, as expressed in arbitrary units. (B) 3D reconstruction of cells grown on type IV collagen in the absence (a) or in the presence (b) of anti-β1-integrin blocking antibody (bar, 10µm). The result is representative of three independent experiments. (C) Effect of anti-β1-integrin blocking antibody on the colocalization of E-cadherin and actin in cells grown on LN2. (D) Effect of anti-α6- integrin blocking antibody on the colocalization of E-cadherin and actin in cells grown on native LN5-rich ECM. Note that anti-β1 antibody treatment results in delocalization of the E-cadherin-actin in cells grown on native ECM, type IV collagen and LN2. Data, expressed as the percentage of control in absence of blocking antibody, are means ±s.e.m. of three independent cultures performed in triplicate. *, **, and *** differ from the control at P<0.05, P<0.01 and P<0.001, respectively.

shown in kidney epithelial cells that E-cadherin–catenin complexes at cell-cell junctions were not sufficient to maintain the subcortical F-actin cytoskeleton in the absence of α3β1 integrin (Wang et al., 1999). Similarly, laminin-5-activated α3β1 integrin has been demonstrated to promote gap junctional communication in keratinocytes (Lampe et al., 1998). In contrast, expression of β1 integrin splice variants in β1- deficient epithelium-like cells resulted in downregulation of cadherin function, disruption of cell-cell adhesion and induction of cell scattering (Gimond et al., 1999), all of which underlie the cell-type specificity of cadherin localization (Braga et al., 1999). The extrinsic spatial cues mediated by cell-cell and cell- substratum adhesions and trophic factor signaling need to be coordinated to ensure a differentiated phenotype. The Rho family GTPases (Rho, Rac and Cdc42) are good candidates for a central role in coordinating adhesion systems. Rho GTPases have been demonstrated to intervene in the inside-outside control of cell-substrate adhesion (Calderwood et al., 2000). Reciprocally, Rho, Rac1 and Cdc42 play roles in parallel and complexes has been proposed to mediate crosstalk between convergent signaling pathways triggered by cell adhesion to an N-cadherin and β1 integrin in neural retina explants (Arregui ECM substrate (Clark et al., 1998). The control of E-cadherin- et al., 2000). Both hypotheses are challenged by the mediated cell-cell adhesion by the Rho family GTPases and colocalization of E-cadherin and β1 or β4 integrin that we their modulators has been recently characterized in the context observed by confocal microscopy in the lateral membrane of of epithelial-mesenchymal transition, where the loss of cell- Caco-2 cells grown on ECM, whereas no colocalization was cell junctions promotes cell migration (Braga et al., 1997; found on an inert support. Such a colocalization of β1 integrin Hordijk et al., 1997; Takaishi et al., 1997; Kuroda et al., 1998; and E-cadherin has already been reported at cell-cell junctions Braga et al., 1999; Fukata et al., 1999). At the same time, it in keratinocytes (Braga et al., 1997), although keratinocytes was established that Rho GTPases play a key role in the control form a different system in which integrin loses contact with of actin polymerization, cell shape and motility (Kaibuchi et ECM while migrating towards the superficial layers of this al., 1999a). stratified epithelium, where E-cadherin finally downregulates Our findings lend support to the notion that enterocyte integrin expression (Hodivala and Watt, 1994). differentiation is an active process supported by molecular Our results favour cooperation between ligand-bound crosstalk involving cell-ECM and cell-cell adhesions integrin and E-cadherin in the organization of the subcortical (Hermiston and Gordon, 1995). We report for the first time that F-actin cytoskeleton. In accordance with our results, it has been integrin-dependent cell-ECM adhesion reinforces E-cadherin- Integrin-induced E-cadherin–actin complexes 551 dependent cell-cell adhesion in epithelial cells (see Note in the E-cadherin/beta-catenin complex to efficient endoplasmic reticulum exit Proof). This reinforcement most probably allows cell migration and basal-lateral membrane targeting of E-cadherin in polarized MDCK along the crypt to the villus of the intestinal epithelium cells. J. Cell Biol. 144, 687-699. Clark, E. A., King, W. G., Brugge, J. S., Symons, M. and Hynes, R. O. (Hermiston et al., 1996). By contrast, it is well documented (1998). Integrin-mediated signals regulated by members of the rho family that cell migration is promoted by the loss of cell-cell junctions of GTPases. J. Cell Biol. 142, 573-586. during the epithelial-mesenchymal transition of epithelial cells. De Arcangelis, A., Neuville, P., Boukamel, R., Lefebvre, O., Kedinger, M. Our results supports the hypothesis that crosstalk between and Simon-Assmann, P. (1996). Inhibition of laminin alpha 1-chain expression leads to alteration of basement membrane assembly and cell integrin and cadherin, as well as regulation of E-cadherin differentiation. J. Cell Biol. 133, 417-430. localization and function, depends on the cell fate (Braga et al., Fleischmajer, R., Utani, A., MacDonald, E. D., Perlish, J. S., Pan, T. C., 1999). The identification of the Rho GTPase and its partners Chu, M. L., Nomizu, M., Ninomiya, Y. and Yamada, Y. (1998). Initiation that are involved in the network will contribute to the of skin basement membrane formation at the epidermo-dermal interface understanding of the mechanisms set up at the crypt-to-villus involves assembly of laminins through binding to cell membrane receptors. J. Cell Sci. 111, 1929-1940. transition checkpoint. Coordinated changes in ECM Fritsch, C., Orian-Rousseaul, V., Lefebvre, O., Simon-Assmann, P., components, integrin repertoire and E-cadherin localization Reimund, J. M., Duclos, B. and Kedinger, M. (1999). Characterization of might also result in migration of differentiating enterocytes human intestinal stromal cell lines: response to cytokines and interactions along the crypt-to-villus axis. with epithelial cells. Exp. Cell Res. 248, 391-406. Fujimoto, K., Nagafuchi, A., Tsukita, S., Kuraoka, A., Ohokuma, A. and Shibata, Y. (1997). Dynamics of connexins, E-cadherin and alpha-catenin on cell membranes during gap junction formation. J. Cell Sci. 110, 311-322. Note in Proof Fukata, M., Nakagawa, M., Kuroda, S. and Kaibuchi, K. (1999). Cell A similar conclusion was drawn from experiments performed adhesion and Rho small GTPases. J. Cell Sci. 112, 4491-4500. in fibroblasts and recently published in this journal (Whittard Gimond, C., van Der Flier, A., van Delft, S., Brakebusch, C., Kuikman, I., Collard, J. G., Fassler, R. and Sonnenberg, A. (1999). Induction of cell and Akiyama, 2001a; Whittard and Akiyama, 2001b). scattering by expression of beta1 integrins in beta1-deficient epithelial cells requires activation of members of the rho family of GTPases and We would like to acknowledge financial support from Université downregulation of cadherin and catenin function. J. Cell Biol. 147, 1325- Paris VI, INSERM and CNRS. This work was performed using IFR 1340. 58 facilities. Cyrille Schreider is recipient of a fellowship from MRT Green, K. J., Geiger, B., Jones, J. C., Talian, J. C. and Goldman, R. D. then FRM (Fondation pour la Recherche Médicale). We would like to (1987). The relationship between intermediate filaments and microfilaments thank Christophe Klein (IFR 58) for excellent technical assistance. before and during the formation of desmosomes and adherens-type junctions in mouse epidermal keratinocytes. J. Cell Biol. 104, 1389-1402. Gumbiner, B., Stevenson, B. and Grimaldi, A. (1988). The role of the cell adhesion molecule uvomorulin in the formation and maintenance of the References epithelial junctional complex. J. Cell Biol. 107, 1575-1587. Aberle, H., Butz, S., Stappert, J., Weissig, H., Kemler, R. and Hoschuetzky, Gumbiner, B. M. (1996). Cell adhesion: the molecular basis of tissue H. (1994). Assembly of the cadherin-catenin complex in vitro with architecture and morphogenesis. Cell 84, 345-357. recombinant proteins. J. Cell Sci. 107, 3655-3663. Hermiston, M. L. and Gordon, J. I. (1995). In vivo analysis of cadherin Adams, C. L. and Nelson, W. J. (1998). Cytomechanics of cadherin-mediated function in the mouse intestinal epithelium: essential roles in adhesion, cell-cell adhesion. Curr. Opin. Cell Biol. 10, 572-577. maintenance of differentiation, and regulation of programmed cell death. J. Arregui, C., Pathre, P., Lilien, J. and Balsamo, J. (2000). The nonreceptor Cell Biol. 129, 489-506. tyrosine kinase fer mediates cross-talk between N-cadherin and beta1- Hermiston, M. L., Wong, M. H. and Gordon, J. I. (1996). Forced expression integrins. J. Cell Biol. 149, 1263-1274. of E-cadherin in the mouse intestinal epithelium slows cell migration and Beaulieu, J. F. (1992). Differential expression of the VLA family of integrins provides evidence for nonautonomous regulation of cell fate in a self- along the crypt-villus axis in the human small intestine. J. Cell Sci. 102, renewing system. Genes Dev. 10, 985-996. 427-36. Hodivala, K. J. and Watt, F. M. (1994). Evidence that cadherins play a role Beaulieu, J. F. (1997). Extracellular matrix components and integrins in in the downregulation of integrin expression that occurs during keratinocyte relationship to human intestinal epithelial cell differentiation. Prog. terminal differentiation. J. Cell Biol. 124, 589-600. Histochem. Cytochem. 31, 1-78. Hoffman, M. P., Kibbey, M. C., Letterio, J. J. and Kleinman, H. K. (1996). Beaulieu, J. F. (1999). Integrins and human intestinal cell functions. Front. Role of laminin-1 and TGF-beta 3 in acinar differentiation of a human Biosci. 4, D310-D321. submandibular gland cell line (HSG). J. Cell Sci. 109, 2013-2021. Bissell, M. J., Hall, H. G. and Parry, G. (1982). How does the extracellular Hordijk, P. L., ten Klooster, J. P., van der Kammen, R. A., Michiels, F., matrix direct gene expression? J. Theor. Biol. 99, 31-68. Oomen, L. C. and Collard, J. G. (1997). Inhibition of invasion of epithelial Booth, C. and Potten, C. S. (2000). Gut instincts: thoughts on intestinal cells by Tiam1-Rac signaling. Science 278, 1464-1466. epithelial stem cells. J. Clin. Invest. 105, 1493-1499. Hynes, R. O. (1987). Integrins: a family of cell surface receptors. Cell 48, Boudreau, N. and Bissell, M. J. (1998). Extracellular matrix signaling: 549-554. integration of form and function in normal and malignant cells. Curr. Opin. Jongen, W. M., Fitzgerald, D. J., Asamoto, M., Piccoli, C., Slaga, T. Cell Biol. 10, 640-646. J., Gros, D., Takeichi, M. and Yamasaki, H. (1991). Regulation of Braga, V. M., Machesky, L. M., Hall, A. and Hotchin, N. A. (1997). The connexin 43-mediated gap junctional intercellular communication by Ca2+ small GTPases Rho and Rac are required for the establishment of cadherin- in mouse epidermal cells is controlled by E-cadherin. J. Cell Biol. 114, dependent cell-cell contacts. J. Cell Biol. 137, 1421-1431. 545-555. Braga, V. M., Del Maschio, A., Machesky, L. and Dejana, E. (1999). Jou, T. S., Stewart, D. B., Stappert, J., Nelson, W. J. and Marrs, J. A. Regulation of cadherin function by Rho and Rac: modulation by junction (1995). Genetic and biochemical dissection of protein linkages in the maturation and cellular context. Mol. Biol. Cell 10, 9-22. cadherin-catenin complex. Proc. Natl. Acad. Sci. USA 92, 5067-5071. Calderwood, D. A., Shattil, S. J. and Ginsberg, M. H. (2000). Integrins and Kaibuchi, K., Kuroda, S. and Amano, M. (1999a). Regulation of the actin filaments: reciprocal regulation of cell adhesion and signaling. J. Biol. cytoskeleton and cell adhesion by the Rho family GTPases in mammalian Chem. 275, 22607-22610. cells. Annu. Rev. Biochem. 68, 459-486. Cereijido, M., Shoshani, L. and Contreras, R. G. (2000). Molecular Kaibuchi, K., Kuroda, S., Fukata, M. and Nakagawa, M. (1999b). physiology and pathophysiology of tight junctions. I. Biogenesis of tight Regulation of cadherin-mediated cell-cell adhesion by the Rho family junctions and epithelial polarity. Am. J. Physiol. Gastrointest. Liver Physiol. GTPases. Curr. Opin. Cell Biol. 11, 591-596. 279, G477-G482. Kemler, R. (1992). Classical cadherins. Semin. Cell Biol. 3, 149-155. Chen, Y. T., Stewart, D. B. and Nelson, W. J. (1999). Coupling assembly of Klein, G., Ekblom, M., Fecker, L., Timpl, R. and Ekblom, P. (1990). 552 Journal of Cell Science 115 (3)

Differential expression of laminin A and B chains during development of (ECM) synthesis in muscle cell cultures: quantitative and qualitative studies embryonic mouse organs. Development 110, 823-837. during myogenesis. Biochem. Biophys. Res. Commun. 130, 440-446. Kuroda, S., Fukata, M., Nakagawa, M., Fujii, K., Nakamura, T., Ookubo, Rousselle, P. and Garrone, R. (1998). [Collagen and laminin: which T., Izawa, I., Nagase, T., Nomura, N., Tani, H. et al. (1998). Role of messages for which cells?]. Pathol Biol (Paris) 46, 543-554. IQGAP1, a target of the small GTPases Cdc42 and Rac1, in regulation of Sako, Y., Nagafuchi, A., Tsukita, S., Takeichi, M. and Kusumi, A. (1998). E-cadherin- mediated cell-cell adhesion. Science 281, 832-835. Cytoplasmic regulation of the movement of E-cadherin on the free cell Lampe, P. D., Nguyen, B. P., Gil, S., Usui, M., Olerud, J., Takada, Y. and surface as studied by optical tweezers and single particle tracking: corralling Carter, W. G. (1998). Cellular interaction of integrin alpha3beta1 with and tethering by the membrane skeleton. J. Cell Biol. 140, 1227-1240. laminin 5 promotes gap junctional communication. J. Cell Biol. 143, 1735- Sander, E. E., van Delft, S., ten Klooster, J. P., Reid, T., van der Kammen, 1747. R. A., Michiels, F. and Collard, J. G. (1998). Matrix-dependent Tiam1/Rac Larjava, H., Peltonen, J., Akiyama, S. K., Yamada, S. S., Gralnick, H. R., signaling in epithelial cells promotes either cell-cell adhesion or cell Uitto, J. and Yamada, K. M. (1990). Novel function for beta 1 integrins migration and is regulated by phosphatidylinositol 3-kinase. J. Cell Biol. in keratinocyte cell-cell interactions. J. Cell Biol. 110, 803-815. 143, 1385-1398. Le Beyec, J., Delers, F., Jourdant, F., Schreider, C., Chambaz, J., Cardot, Simon-Assmann, P. and Kedinger, M. (1993). Heterotypic cellular P. and Pincon-Raymond, M. (1997). A complete epithelial organization of cooperation in gut morphogenesis and differentiation. Semin. Cell Biol. 4, Caco-2 cells induces I-FABP and potentializes apolipoprotein gene 221-230. expression. Exp. Cell Res. 236, 311-320. Simon-Assmann, P., Lefebvre, O., Bellissent-Waydelich, A., Olsen, J., Lesuffleur, T., Barbat, A., Dussaulx, E. and Zweibaum, A. (1990). Growth Orian-Rousseau, V. and De Arcangelis, A. (1998). The laminins: role in adaptation to methotrexate of HT-29 human colon carcinoma cells is intestinal morphogenesis and differentiation. Ann. N Y Acad. Sci. 859, 46- associated with their ability to differentiate into columnar absorptive and 64. mucus-secreting cells. Cancer Res. 50, 6334-6343. Skoudy, A., Llosas, M. D. and Garcia de Herreros, A. (1996). Intestinal HT- Li, M. L., Aggeler, J., Farson, D. A., Hatier, C., Hassell, J. and Bissell, M. 29 cells with dysfunction of E-cadherin show increased pp60src activity and J. (1987). Influence of a reconstituted basement membrane and its tyrosine phosphorylation of p120-catenin. Biochem. J. 317, 279-284. components on casein gene expression and secretion in mouse mammary Takaishi, K., Sasaki, T., Kotani, H., Nishioka, H. and Takai, Y. (1997). epithelial cells. Proc. Natl. Acad. Sci. USA 84, 136-140. Regulation of cell-cell adhesion by rac and rho small G proteins in MDCK Lorentz, O., Duluc, I., Arcangelis, A. D., Simon-Assmann, P., Kedinger, cells. J. Cell Biol. 139, 1047-1059. M. and Freund, J. N. (1997). Key role of the Cdx2 homeobox gene in Tsukita, S., Nagafuchi, A. and Yonemura, S. (1992). Molecular linkage extracellular matrix-mediated intestinal cell differentiation. J. Cell Biol. 139, between cadherins and actin filaments in cell-cell adherens junctions. Curr. 1553-1565. Opin. Cell Biol. 4, 834-839. Machesky, L. M. and Hall, A. (1997). Role of actin polymerization and Vachon, P. H. and Beaulieu, J. F. (1995). Extracellular heterotrimeric laminin adhesion to extracellular matrix in Rac- and Rho-induced cytoskeletal promotes differentiation in human enterocytes. Am. J. Physiol. 268, G857- reorganization. J. Cell Biol. 138, 913-926. G867. Matsuzaki, F., Mege, R. M., Jaffe, S. H., Friedlander, D. R., Gallin, W. J., Vachon, P. H., Durand, J. and Beaulieu, J. F. (1993). Basement membrane Goldberg, J. I., Cunningham, B. A. and Edelman, G. M. (1990). cDNAs formation and re-distribution of the beta 1 integrins in a human intestinal of cell adhesion molecules of different specificity induce changes in cell co-culture system. Anat. Rec. 235, 567-576. shape and border formation in cultured S180 cells. J. Cell Biol. 110, 1239- Vachon, P. H., Loechel, F., Xu, H., Wewer, U. M. and Engvall, E. (1996). 1252. Merosin and laminin in myogenesis; specific requirement for merosin in Matter, M. L. and Laurie, G. W. (1994). A novel laminin E8 cell adhesion myotube stability and survival. J. Cell Biol. 134, 1483-1497. site required for lung alveolar formation in vitro. J. Cell Biol. 124, 1083- van Hengel, J., Gohon, L., Bruyneel, E., Vermeulen, S., Cornelissen, M., 1090. Mareel, M. and von Roy, F. (1997). Protein kinase C activation upregulates Mege, R. M., Matsuzaki, F., Gallin, W. J., Goldberg, J. I., Cunningham, intercellular adhesion of alpha-catenin-negative human colon cancer cell B. A. and Edelman, G. M. (1988). Construction of epithelioid sheets by variants via induction of desmosomes. J. Cell Biol. 137, 1103-1116. transfection of mouse sarcoma cells with cDNAs for chicken cell adhesion Velling, T., Tiger, C. F., Ekblom, P. and Gullberg, D. (1999). Laminin alpha molecules. Proc. Natl. Acad. Sci. USA 85, 7274-7278. chains in colon carcinoma cell lines: detection of a truncated laminin alpha1 Orian-Rousseau, V., Aberdam, D., Rousselle, P., Messent, A., Gavrilovic, mRNA in Caco-2 cells. Exp. Cell Res. 248, 627-633. J., Meneguzzi, G., Kedinger, M. and Simon-Assmann, P. (1998). Human Wang, Z., Symons, J. M., Goldstein, S. L., McDonald, A., Miner, J. H. and colonic cancer cells synthesize and adhere to laminin-5. Their adhesion to Kreidberg, J. A. (1999). (Alpha)3(beta)1 integrin regulates epithelial laminin-5 involves multiple receptors among which is integrin alpha2beta1. cytoskeletal organization. J. Cell Sci. 112, 2925-2935. J. Cell Sci. 111, 1993-2004. Weaver, V. M., Petersen, O. W., Wang, F., Larabell, C. A., Briand, P., Patton, B. L., Miner, J. H., Chiu, A. Y. and Sanes, J. R. (1997). Distribution Damsky, C. and Bissell, M. J. (1997). Reversion of the malignant and function of laminins in the neuromuscular system of developing, adult, phenotype of human breast cells in three-dimensional culture and in vivo by and mutant mice. J. Cell Biol. 139, 1507-1521. integrin blocking antibodies. J. Cell Biol. 137, 231-245. Pincon-Raymond, M., Vicart, P., Bois, P., Chassande, O., Romey, G., Whittard, J. D. and Akiyama, S. K. (2001a). Activation of beta1 integrins Varadi, G., Li, Z. L., Lazdunski, M., Rieger, F. and Paulin, D. (1991). induces cell-cell adhesion. Exp. Cell Res. 263, 65-76. Conditional immortalization of normal and dysgenic mouse muscle cells by Whittard, J. D. and Akiyama, S. K. (2001b). Positive regulation of cell-cell the SV40 large T antigen under the vimentin promoter control. Dev. Biol. and cell-substrate adhesion by protein kinase A. J. Cell Sci. 114, 3265-3272. 148, 517-528. Yamada, K. M. and Geiger, B. (1997). Molecular interactions in cell adhesion Pinto, M., Robine-Leon, S., Appay, M. D., Kedinger, M., Triadou, N., complexes. Curr. Opin. Cell Biol. 9, 76-85. Dussaulx, E., Lacroix, B., Simon-Assmann, P., Haffen, K., Fogh, J. et al. Yamada, K. M. and Miyamoto, S. (1995). Integrin transmembrane signaling (1983). Enterocyte-like differentiation and polarization of the human colon and cytoskeletal control. Curr. Opin. Cell Biol. 7, 681-689. carcinoma cell line Caco-2 in culture. Biol. Cell 47, 323-330. Zucchi, I., Montagna, C., Susani, L., Vezzoni, P. and Dulbecco, R. (1998). Potten, C. S., Booth, C. and Pritchard, D. M. (1997). The intestinal epithelial The rat gene homologous to the human gene 9-27 is involved in the stem cell: the mucosal governor. Int. J. Exp. Pathol. 78, 219-243. development of the mammary gland. Proc. Natl. Acad. Sci. USA 95, 1079- Rao, J. S., Beach, R. L. and Festoff, B. W. (1985). Extracellular matrix 1084.