DOCSLIB.ORG

Embryonic Lethality Is Not Sufficient to Explain Hourglass-Like Conservation of Vertebrate Embryos

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Embryonic Lethality Is Not Sufficient to Explain Hourglass-Like Conservation of Vertebrate Embryos Uchida et al. EvoDevo (2018) 9:7 https://doi.org/10.1186/s13227-018-0095-0 EvoDevo RESEARCH Open Access Embryonic lethality is not sufcient to explain hourglass‑like conservation of vertebrate embryos Yui Uchida1* , Masahiro Uesaka1, Takayoshi Yamamoto1, Hiroyuki Takeda1,2 and Naoki Irie1,2* Abstract Background: Understanding the general trends in developmental changes during animal evolution, which are often associated with morphological diversifcation, has long been a central issue in evolutionary developmental biology. Recent comparative transcriptomic studies revealed that gene expression profles of mid-embryonic period tend to be more evolutionarily conserved than those in earlier or later periods. While the hourglass-like divergence of devel- opmental processes has been demonstrated in a variety of animal groups such as vertebrates, arthropods, and nema- todes, the exact mechanism leading to this mid-embryonic conservation remains to be clarifed. One possibility is that the mid-embryonic period (pharyngula period in vertebrates) is highly prone to embryonic lethality, and the resulting negative selections lead to evolutionary conservation of this phase. Here, we tested this “mid-embryonic lethality hypothesis” by measuring the rate of lethal phenotypes of three diferent species of vertebrate embryos subjected to two kinds of perturbations: transient perturbations and genetic mutations. Results: By subjecting zebrafsh (Danio rerio), African clawed frog (Xenopus laevis), and chicken (Gallus gallus) embryos to transient perturbations, namely heat shock and inhibitor treatments during three developmental periods [early (represented by blastula and gastrula), pharyngula, and late], we found that the early stages showed the highest rate of lethal phenotypes in all three species. This result was corroborated by perturbation with genetic mutations. By tracking the survival rate of wild-type embryos and embryos with genetic mutations induced by UV irradiation in zebrafsh and African clawed frogs, we found that the highest decrease in survival rate was at the early stages particu- larly around gastrulation in both these species. Conclusion: In opposition to the “mid-embryonic lethality hypothesis,” our results consistently showed that the stage with the highest lethality was not around the conserved pharyngula period, but rather around the early period in all the vertebrate species tested. These results suggest that negative selection by embryonic lethality could not explain hourglass-like conservation of animal embryos. This highlights the potential contribution of alternative mechanisms such as the diversifying efect of positive selections against earlier and later stages, and developmental constraints which lead to conservation of mid-embryonic stages. Keywords: Developmental conservation, Hourglass model, Phylotypic period, Lethality, Pharyngula period Background been one of the major issues in the feld of EvoDevo. As Morphological novelty is realized through the alteration attempts to formulate the relationship between develop- of developmental programs during evolution [1], and ment and evolution, early studies predicted that the earli- general tendency of the embryonic evolution has long est developmental processes would tend to be conserved through evolution, because they establish fundamental *Correspondence: [email protected]‑tokyo.ac.jp; [email protected]‑tokyo.ac.jp information required for later developmental processes 1 Department of Biological Sciences, University of Tokyo, 7‑3‑1 Hongo, [2–4]. Tis idea was formulated independently in the Bunkyo‑ku, Tokyo 113‑0033, Japan “stepping stone model” [2], “developmental burden,” [3] Full list of author information is available at the end of the article © The Author(s) 2018. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/ publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Uchida et al. EvoDevo (2018) 9:7 Page 2 of 11 and “generative entrenchment” [4]. In contrast, the highly does not preclude a possibility that negative selections similar morphological features of the mid-embryonic contributed to the hourglass-like divergence of animal period in vertebrates have been recognized since the embryos. Given these, it is thus worth exploring other nineteenth century [5], and the “developmental hourglass mechanisms, such as negative selection by embryonic model” [6, 7] predicts that the mid-embryonic phase is lethality which might contribute to the transcriptomic the most conserved stage in embryogenesis. It has also conservation of the mid-embryonic period. been predicted that anatomical patterns shared in this Here, we asked whether strong negative selection by conserved mid-embryonic phase defne a body plan for embryonic lethality acts on the conserved mid-embry- each animal phylum, and thus this phase has been named onic period of vertebrates (pharyngula period [18–21]). the phylotypic period [6–10]. Tough no consensus has In pioneering research, Galis and Metz [33] paved the been reached as to which period is the most conserved way to evaluating the contribution of negative selec- in morphological perspective [11–14], recent transcrip- tions by measuring prenatal death and abnormalities of tomic studies support hourglass-like divergence pat- embryos. By performing a meta-analysis of the suscep- terns in embryogenesis in a variety of animal groups: tibility of various developmental stages to teratogens in Te highest conservation has been reported in the mid- rodent embryos, they reported that teratogen-induced embryonic periods in vertebrates [15–22], arthropods death and abnormalities were highest during the phar- (Drosophila species and Anopheles gambiae) [21, 23, 24], yngula period, implying that strong negative selections nematodes [25], and molluscs and annelids [26]. Further- act on this period [33]. However, embryonic death dur- more, conserved molecular features of genes expressed ing early developmental periods could have been under- in mid-developmental phases have also been reported estimated, since the papers assessed by this report used in other multi-cellular organisms such as plants (Arabi- one of the eutherian group, namely rodents, and techni- dopsis thaliana) [27] and fungi (Coprinopsis cinerea) [28]. cal problems associated with estimation of prenatal death However, the exact mechanisms that make embryos fol- in eutherians have been identifed [34]. To measure the low hourglass-like divergence remain to be clarifed. embryonic lethality throughout embryogenesis, we uti- One possible evolutionary mechanism for hourglass- lized three non-eutherian vertebrate species in which we like conservation at transcriptomic level is that less-posi- can reliably detect early death [zebrafsh (Danio rerio), tive selections act on embryos during the mid-embryonic African clawed frog (Xenopus laevis), and chicken (Gal- period than during earlier or later periods. For example, lus gallus)]. We frst measured their embryonic lethal- Slack et al. [29] referred to variability of earlier periods ity following transient perturbations (i.e., inhibition of caused by adaptation to reproductive strategies or to the transcription, translation, and heat shock) and evalu- demands of embryonic nutrition. Similarly, Kalinka and ated stage-specifc lethality. Since genetic mutations are Tomancak [9] proposed that diversifcations of earlier important sources of changes in embryogenesis in evo- and later periods can be attributed to adaptations to eco- lutionary processes, we also measured embryonic death logical niches. However, the absence of positive selections rate under a condition expected to generate genetic toward mid-embryonic period may not be sufcient to mutations. explain the hourglass-like divergence. For example, with- out negative selections, rapid neutral evolution [30, 31] Methods could diversify the mid-embryonic period. Accordingly, Animal care and embryo sampling Raf hypothesized that because the molecular signals Riken wild-type (RW) zebrafsh were maintained at in mid-embryos consist of complex inductive interac- 28.5 °C on a 14 h light: 10 h dark cycle. Embryos were tions among organ primordia, changes in the develop- obtained by natural mating and incubated at the same mental processes during this period would likely cause temperature as adults in 1/3 Ringer’s solution. Te lethal phenotypes, and thus there would be strong nega- embryos were staged according to standard criteria out- tive selection to conserve the mid-embryonic period [7]. lined previously [35]. Female African clawed frogs were Another possibility is that smaller phenotypic deviation purchased from a local breeder (Watanabe Zoshoku, is produced in the mid-embryonic period: A recent study Hyogo, Japan), and males were purchased from another has shown smaller transcriptomic deviation in the con- local breeder (Zenopasu Yoshoku Kyozai, Ibaraki, Japan). served mid-embryonic period of nematode strains that Te eggs were artifcially fertilized, dejellied in 2% w/v were established under the condition of near-absence l-cysteine-HCl (pH 7.8), and reared
Load more

Recommended publications
  • The Phylum Vertebrata: a Case for Zoological Recognition Naoki Irie1,2* , Noriyuki Satoh3 and Shigeru Kuratani4
    Irie et al. Zoological Letters (2018) 4:32 https://doi.org/10.1186/s40851-018-0114-y REVIEW Open Access The phylum Vertebrata: a case for zoological recognition Naoki Irie1,2* , Noriyuki Satoh3 and Shigeru Kuratani4 Abstract The group Vertebrata is currently placed as a subphylum in the phylum Chordata, together with two other subphyla, Cephalochordata (lancelets) and Urochordata (ascidians). The past three decades, have seen extraordinary advances in zoological taxonomy and the time is now ripe for reassessing whether the subphylum position is truly appropriate for vertebrates, particularly in light of recent advances in molecular phylogeny, comparative genomics, and evolutionary developmental biology. Four lines of current research are discussed here. First, molecular phylogeny has demonstrated that Deuterostomia comprises Ambulacraria (Echinodermata and Hemichordata) and Chordata (Cephalochordata, Urochordata, and Vertebrata), each clade being recognized as a mutually comparable phylum. Second, comparative genomic studies show that vertebrates alone have experienced two rounds of whole-genome duplication, which makes the composition of their gene family unique. Third, comparative gene-expression profiling of vertebrate embryos favors an hourglass pattern of development, the most conserved stage of which is recognized as a phylotypic period characterized by the establishment of a body plan definitively associated with a phylum. This mid-embryonic conservation is supported robustly in vertebrates, but only weakly in chordates. Fourth, certain complex patterns of body plan formation (especially of the head, pharynx, and somites) are recognized throughout the vertebrates, but not in any other animal groups. For these reasons, we suggest that it is more appropriate to recognize vertebrates as an independent phylum, not as a subphylum of the phylum Chordata.
    [Show full text]
  • Rapid Effects of Sex Steroids on PGF2 Approach Response in Zebrafish
    Rapid effects of sex steroids on PGF2� approach response in zebrafish (Danio rerio) Student Researcher: Leah B. Kratochvil, Advisor: Richmond R. Thompson Bowdoin College Department of Neuroscience Abstract Steroids are molecular messengers that regulate a variety of bodily functions, including behaviors and sexual motivation. Steroids have long been known to induce behavioral effects in days or weeks, but more recently have been discovered to effect these changes within seconds. Research surrounding these so-called “rapid” effects of steroids on sensory systems is lacking. I took advantage of the sophisticated sex pheromone system in zebrafish to study this system, and the male zebrafish approach response to the pre-ovulatory pheromone prostaglandin F2� (PGF2�). Sexually mature male zebrafish were treated with vehicle, T, or 11-ketotestosterone (11-KT) for 40 minutes, and then immediately evaluated for time spent near vehicle or PGF2� administered to their test tank. Initial data suggests that T-treated fish spent more time near the pheromone, indicating that T may rapidly modulate this response in zebrafish. There were no significant differences between treatments. Further investigation, with higher steroid and pheromone concentrations and a slightly different experimental design, is underway to confirm how T and/or 11-KT modulate(s) the male zebrafish approach response to PGF2�. Project Objectives Classically, steroids have been thought to act in the body by binding to intracellular receptors and inducing gene transcription, protein translation and ultimately behavioral responses. However, because this process – termed the “genomic” mechanism due to its interactions with the genome – takes time, these genomic behavioral effects usually take days or weeks to appear.
    [Show full text]
  • The Effect of Fluoxetine on Self-Control in Betta Splendens
    University of Montana ScholarWorks at University of Montana Graduate Student Theses, Dissertations, & Professional Papers Graduate School 2014 The effect of fluoxetine on self-control in betta splendens Kathryn Gwen Lamp The University of Montana Follow this and additional works at: https://scholarworks.umt.edu/etd Let us know how access to this document benefits ou.y Recommended Citation Lamp, Kathryn Gwen, "The effect of fluoxetine on self-control in betta splendens" (2014). Graduate Student Theses, Dissertations, & Professional Papers. 10770. https://scholarworks.umt.edu/etd/10770 This Dissertation is brought to you for free and open access by the Graduate School at ScholarWorks at University of Montana. It has been accepted for inclusion in Graduate Student Theses, Dissertations, & Professional Papers by an authorized administrator of ScholarWorks at University of Montana. For more information, please contact [email protected]. THE EFFECT OF FLUOXETINE ON SELF-CONTROL IN BETTA SPLENDENS by KATHRYN GWEN LAMP Bachelor of Arts, Christopher Newport University, Newport News, VA, 2008 Master of Arts, The University of Montana, Missoula, MT, 2012 Dissertation presented in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Experimental Psychology The University of Montana Missoula, MT June 2014 Approved by: Dr. Allen Szalda-Petree, Chair Department of Psychology Dr. Nabil Haddad Department of Psychology Dr. Stuart Hall Department of Psychology Dr. Jerry Smith Department of Biomedical and Pharmaceutical Sciences Dr. Keith Parker Department of Biomedical and Pharmaceutical Sciences UMI Number: 3628951 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.
    [Show full text]
  • Disease and Clinical Signs Poster
    African Clawed Frog Xenopus laevis Diseases and Clinical Signs in Photographs Therese Jones-Green University Biomedical Services Abstract Reported clinical signs associated with ill health and Clinical signs found between 2016 to 2018 Many diseases of Xenopus laevis frogs have been described in the • Opened in 2005, the biofacility can hold up to 900 female and 240 disease Clinical signs found between 2016 to 2018 male frogs in a Marine Biotech (now serviced by MBK Installations Ltd.) • 80 recirculating aquatic system. • Buoyancy problems 70 bridge this gap using photographs taken of frogs with clinical signs. The system monitors parameters such as: temperature, pH, • • Changes in activity e.g. lethargy or easily startled. My aims are: conductivity, and Total Gas Pressure. 60 • Unusual amount of skin shedding. 2018 • To share my experiences, via images, to help improve the welfare and • Frogs are maintained on mains fed water with a 20% water exchange. 50 ases • Weight loss, or failure to feed correctly. c husbandry of this species. • 2017 • Coelomic (body cavity) distention. 40 • To stimulate a dialogue which results in further sharing of ideas and 2016 Whole body bloat. 30 information. • Frogs are held under a 12 hour light/dark cycle. • Number of • Each tank has a PVC enrichment tube (30cm x 10cm), with smoothed • Fungal strands/tufts. 20 Introduction cut edges. • Sores or tremors at extremities (forearms and toes). 10 Between January 2016 and October 2018, cases of ill health and disease • Frogs are fed three times a week with a commercial trout pellet. • Redness or red spots. 0 Oedema Red leg Red leg (bad Red leg Gas bubble Sores on forearm Opaque cornea Skeletal Growth (cartilage Scar Cabletie Missing claws Eggbound in a colony of Xenopus laevis frogs housed by the University Biological hormone) (nematodes) disease deformity under skin) • The focus of the research undertaken in the biofacility is embryonic and • Excessive slime/mucous production or not enough (dry dull skin).
    [Show full text]
  • Table S1. Nakharuthai and Srisapoome (2020)
    Primer name Nucleotide sequence (5’→3’) Purpose CXC-1F New TGAACCCTGAGCTGAAGGCCGTGA Real-time PCR CXC-1R New TGAAGGTCTGATGAGTTTGTCGTC Real-time PCR CXC-1R CCTTCAGCTCAGGGTTCAAGC Genomic PCR CXC-2F New GCTTGAACCCCGAGCTGAAAAACG Real-time PCR CXC-2R New GTTCAGAGGTCGTATGAGGTGCTT Real-time PCR CXC-2F CAAGCAGGACAACAGTGTCTGTGT 3’RACE CXC-2AR GTTGCATGATTTGGATGCTGGGTAG 5’RACE CXC-1FSB AACATATGTCTCCCAGGCCCAACTCAAAC Southern blot CXC-1RSB CTCGAGTTATTTTGCACTGATGTGCAA Southern blot CXC1Exon1F CAAAGTGTTTCTGCTCCTGG Genomic PCR On-CXC1FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC1ROverEx CTCGAGTTTTGCACTGATGTGCAATTTCAA Overexpression On-CXC2FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC2ROverEx CTCGAGCATGGCAGCTGTGGAGGGTTCCAC Overexpression β-actinrealtimeF ACAGGATGCAGAAGGAGATCACAG Real-time PCR β-actinrealtimeR GTACTCCTGCTTGCTGATCCACAT Real-time PCR M13F AAAACGACGGCCAG Nucleotide sequencing M13R AACAGCTATGACCATG Nucleotide sequencing UPM-long (0.4 µM) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE PCR UPM-short (2 µM) CTAATAC GACTCACTATA GGGC RACE PCR Table S1. Nakharuthai and Srisapoome (2020) On-CXC1 Nucleotide (%) Amino acid (%) On-CXC2 Nucleotide (%) Amino acid (%) Versus identity identity similarity Versus identity identity Similarity Teleost fish 1. Rock bream, Oplegnathus fasciatus (AB703273) 64.5 49.1 68.1 O. fasciatus 70.7 57.7 75.4 2. Mandarin fish, Siniperca chuatsi (AAY79282) 63.2 48.1 68.9 S. chuatsi 70.5 54.0 78.8 3. Atlantic halibut, Hippoglossus hippoglossus (ACY54778) 52.0 39.3 51.1 H. hippoglossus 64.5 46.3 63.9 4. Common carp IL-8, Cyprinus carpio (ABE47600) 44.9 19.1 34.1 C. carpio 49.4 21.9 42.6 5. Rainbow trout IL-8, Oncorhynchus mykiss (CAC33585) 44.0 21.3 36.3 O. mykiss 47.3 23.7 44.4 6. Japanese flounder IL-8, Paralichthys olivaceus (AAL05442) 48.4 25.4 45.9 P.
    [Show full text]
  • Housing, Husbandry and Welfare of a “Classic” Fish Model, the Paradise Fish (Macropodus Opercularis)
    animals Article Housing, Husbandry and Welfare of a “Classic” Fish Model, the Paradise Fish (Macropodus opercularis) Anita Rácz 1,* ,Gábor Adorján 2, Erika Fodor 1, Boglárka Sellyei 3, Mohammed Tolba 4, Ádám Miklósi 5 and Máté Varga 1,* 1 Department of Genetics, ELTE Eötvös Loránd University, Pázmány Péter stny. 1C, 1117 Budapest, Hungary; [email protected] 2 Budapest Zoo, Állatkerti krt. 6-12, H-1146 Budapest, Hungary; [email protected] 3 Fish Pathology and Parasitology Team, Institute for Veterinary Medical Research, Centre for Agricultural Research, Hungária krt. 21, 1143 Budapest, Hungary; [email protected] 4 Department of Zoology, Faculty of Science, Helwan University, Helwan 11795, Egypt; [email protected] 5 Department of Ethology, ELTE Eötvös Loránd University, Pázmány Péter stny. 1C, 1117 Budapest, Hungary; [email protected] * Correspondence: [email protected] (A.R.); [email protected] (M.V.) Simple Summary: Paradise fish (Macropodus opercularis) has been a favored subject of behavioral research during the last decades of the 20th century. Lately, however, with a massively expanding genetic toolkit and a well annotated, fully sequenced genome, zebrafish (Danio rerio) became a central model of recent behavioral research. But, as the zebrafish behavioral repertoire is less complex than that of the paradise fish, the focus on zebrafish is a compromise. With the advent of novel methodologies, we think it is time to bring back paradise fish and develop it into a modern model of Citation: Rácz, A.; Adorján, G.; behavioral and evolutionary developmental biology (evo-devo) studies. The first step is to define the Fodor, E.; Sellyei, B.; Tolba, M.; housing and husbandry conditions that can make a paradise fish a relevant and trustworthy model.
    [Show full text]
  • There Is No Highly Conserved Embryonic Stage in the Vertebrates: Implications for Current Theories of Evolution and Development
    Anat Embryol (1997) 196:91–106 © Springer-Verlag 1997 REVIEW ARTICLE &roles:Michael K. Richardson · James Hanken Mayoni L. Gooneratne · Claude Pieau Albert Raynaud · Lynne Selwood · Glenda M. Wright There is no highly conserved embryonic stage in the vertebrates: implications for current theories of evolution and development &misc:Accepted: 5 April 1997 &p.1:Abstract Embryos of different species of vertebrate tal biology, and especially in the conservation of devel- share a common organisation and often look similar. opmental mechanisms, re-examination of the extent of Adult differences among species become more apparent variation in vertebrate embryos is long overdue. We pres- through divergence at later stages. Some authors have ent here the first review of the external morphology of suggested that members of most or all vertebrate clades tailbud embryos, illustrated with original specimens pass through a virtually identical, conserved stage. This from a wide range of vertebrate groups. We find that em- idea was promoted by Haeckel, and has recently been re- bryos at the tailbud stage – thought to correspond to a vived in the context of claims regarding the universality conserved stage – show variations in form due to allome- of developmental mechanisms. Thus embryonic resem- try, heterochrony, and differences in body plan and blance at the tailbud stage has been linked with a con- somite number. These variations foreshadow important served pattern of developmental gene expression – the differences in adult body form. Contrary to recent claims zootype. Haeckel’s drawings of the external morphology that all vertebrate embryos pass through a stage when of various vertebrates remain the most comprehensive they are the same size, we find a greater than 10-fold comparative data purporting to show a conserved stage.
    [Show full text]
  • Zebrafish Embryos and Bioinformatics: Useful and Marketable Exercises for Students Enrolled in Upper-Level Undergraduate Courses
    2019 Eastern Biologist Special Issue 1 Zebrafish as a Model System for Research and Teaching A. Davis, H. Nguyen, and J. Qian 2019 Eastern Biologist Special Issue 1:47–63 Zebrafish Embryos and Bioinformatics: Useful and Marketable Exercises for Students Enrolled in Upper-Level Undergraduate Courses Adam Davis1*, Hong Nguyen1, and Jo Qian1 Abstract - The zebrafish (Danio rerio) is a widely used vertebrate model system in several branches of biological research, including molecular biology, developmental biology, and evolutionary biology. The rapid and transparent development of embryos outside of the mother allows for real- time observation of embryonic development of different types of organ systems. However, the types of wet-lab exercises involving zebrafish embryos that undergraduate students can perform during a 2-3 hour laboratory period are limited. Recent advances in bioinformatics applications and the availability of genomic sequence data from zebrafish and other evolutionarily divergent vertebrates, including human, allow students to be actively involved in semester-long molecular, evolutionary, and developmental biology projects that can be performed both in and out of the laboratory. In this paper, we report several exercises that can be used in upper level undergraduate biology courses that include a 2-3 hour weekly laboratory session. These exercises include amino acid and genomic DNA sequence alignment and gene expression analysis of Hoxa2, a developmental regulatory gene that is highly characterized in its expression and function. All exercises make use of standard operating procedures for training students on new techniques. The exercises presented will provide several learning outcomes for students, including the identification of conserved protein domains and cis- regulatory elements and how mutations to these motifs can lead to evolutionary diversity as well as the development of homeostatic imbalances in humans.
    [Show full text]
  • Lower Organisms As Alternatives for Toxicity Testing in Rodents with a Focus on Ceanorhabditis Elegans and the Zebrafish (Danio Rerio)
    Report 340720003/2009 L.T.M. van der Ven Lower organisms as alternatives for toxicity testing in rodents With a focus on Ceanorhabditis elegans and the zebrafish (Danio rerio) RIVM report 340720003/2009 Lower organisms as alternatives for toxicity testing in rodents With a focus on Caenorhabditis elegans and the zebrafish (Danio rerio) L.T.M. van der Ven Contact: L.T.M. van der Ven Laboratory for Health Protection Research [email protected] This investigation has been performed by order and for the account of the Ministry of Health, Welfare and Sport, within the framework of V/340720 Alternatives for animal testing RIVM, P.O. Box 1, 3720 BA Bilthoven, the Netherlands Tel +31 30 274 91 11 www.rivm.nl © RIVM 2009 Parts of this publication may be reproduced, provided acknowledgement is given to the 'National Institute for Public Health and the Environment', along with the title and year of publication. RIVM report 340720003 2 Abstract Lower organisms as alternatives for toxicity testing in rodents With a focus on Caenorhabiditis elegans and the zebrafish (Danio rerio) The nematode C. elegans and the zebrafish embryo are promising alternative test models for assessment of toxic effects in rodents. Tests with these lower organisms may have a good predictive power for effects in humans and are thus complementary to tests with in vitro models (cell cultures). However, all described tests need further validation. This is the outcome of a literature survey, commissioned by the ministry of Health, Welfare and Sport of the Netherlands. The survey is part of the policy to reduce, refine and replace animal testing (3R policy).
    [Show full text]
  • Stages of Embryonic Development of the Zebrafish
    DEVELOPMENTAL DYNAMICS 2032553’10 (1995) Stages of Embryonic Development of the Zebrafish CHARLES B. KIMMEL, WILLIAM W. BALLARD, SETH R. KIMMEL, BONNIE ULLMANN, AND THOMAS F. SCHILLING Institute of Neuroscience, University of Oregon, Eugene, Oregon 97403-1254 (C.B.K., S.R.K., B.U., T.F.S.); Department of Biology, Dartmouth College, Hanover, NH 03755 (W.W.B.) ABSTRACT We describe a series of stages for Segmentation Period (10-24 h) 274 development of the embryo of the zebrafish, Danio (Brachydanio) rerio. We define seven broad peri- Pharyngula Period (24-48 h) 285 ods of embryogenesis-the zygote, cleavage, blas- Hatching Period (48-72 h) 298 tula, gastrula, segmentation, pharyngula, and hatching periods. These divisions highlight the Early Larval Period 303 changing spectrum of major developmental pro- Acknowledgments 303 cesses that occur during the first 3 days after fer- tilization, and we review some of what is known Glossary 303 about morphogenesis and other significant events that occur during each of the periods. Stages sub- References 309 divide the periods. Stages are named, not num- INTRODUCTION bered as in most other series, providing for flexi- A staging series is a tool that provides accuracy in bility and continued evolution of the staging series developmental studies. This is because different em- as we learn more about development in this spe- bryos, even together within a single clutch, develop at cies. The stages, and their names, are based on slightly different rates. We have seen asynchrony ap- morphological features, generally readily identi- pearing in the development of zebrafish, Danio fied by examination of the live embryo with the (Brachydanio) rerio, embryos fertilized simultaneously dissecting stereomicroscope.
    [Show full text]
  • Helical Insertion of Peptidoglycan Produces Chiral Ordering of the Bacterial Cell Wall
    Helical insertion of peptidoglycan produces PNAS PLUS chiral ordering of the bacterial cell wall Siyuan Wanga,b, Leon Furchtgottc,d, Kerwyn Casey Huangd,1, and Joshua W. Shaevitza,e,1 aLewis-Sigler Institute for Integrative Genomics, Princeton University, Princeton, NJ 08544; bDepartment of Molecular Biology, Princeton University, Princeton, NJ 08544; cBiophysics Program, Harvard University, Cambridge, MA 02138; dDepartment of Bioengineering, Stanford University, Stanford, CA 94305; and eDepartment of Physics, Princeton University, Princeton, NJ 08854 AUTHOR SUMMARY Cells from all kingdoms of wall growth to demonstrate life face the task of that patterning of cell-wall constructing a specific, synthesis by left-handed mechanically robust three- MreB polymers leads to a dimensional (3D) cell shape right-handed chiral from molecular-scale organization of the glycan components. For many strands. This organization bacteria, maintaining a rigid, produces a left-handed rod-like shape facilitates a twisting of the cell body diverse range of behaviors during elongational growth. including swimming motility, We then confirm the detection of chemical existence of right-handed gradients, and nutrient access Fig. P1. Helical insertion of material into the bacterial cell wall (green) glycan organization in E. coli during elongational growth, guided by the protein MreB (yellow), leads and waste evacuation in by osmotically shocking biofilms. The static shape of to an emergent chiral order in the cell-wall network and twisting of the cell that can be visualized using surface-bound beads (red). surface-labeled cells and a bacterial cell is usually directly measuring the defined by the cell wall, a difference in stiffness macromolecular polymer network composed of glycan strands between the longitudinal and transverse directions.
    [Show full text]
  • High Abundance of Invasive African Clawed Frog Xenopus Laevis in Chile: Challenges for Their Control and Updated Invasive Distribution
    Management of Biological Invasions (2019) Volume 10, Issue 2: 377–388 CORRECTED PROOF Research Article High abundance of invasive African clawed frog Xenopus laevis in Chile: challenges for their control and updated invasive distribution Marta Mora1, Daniel J. Pons2,3, Alexandra Peñafiel-Ricaurte2, Mario Alvarado-Rybak2, Saulo Lebuy2 and Claudio Soto-Azat2,* 1Vida Nativa NGO, Santiago, Chile 2Centro de Investigación para la Sustentabilidad & Programa de Doctorado en Medicina de la Conservación, Facultad de Ciencias de la Vida, Universidad Andres Bello, Republica 440, Santiago, Chile 3Facultad de Ciencias Exactas, Departamento de Matemáticas, Universidad Andres Bello, Santiago, Republica 470, Santiago, Chile Author e-mails: [email protected] (CSA), [email protected] (MM), [email protected] (DJP), [email protected] (APR), [email protected] (MAR), [email protected] (SL) *Corresponding author Citation: Mora M, Pons DJ, Peñafiel- Ricaurte A, Alvarado-Rybak M, Lebuy S, Abstract Soto-Azat C (2019) High abundance of invasive African clawed frog Xenopus Invasive African clawed frog Xenopus laevis (Daudin, 1802) are considered a major laevis in Chile: challenges for their control threat to aquatic environments. Beginning in the early 1970s, invasive populations and updated invasive distribution. have now been established throughout much of central Chile. Between September Management of Biological Invasions 10(2): and December 2015, we studied a population of X. laevis from a small pond in 377–388, https://doi.org/10.3391/mbi.2019. 10.2.11 Viña del Mar, where we estimated the population size and evaluated the use of hand nets as a method of control. First, by means of a non-linear extrapolation Received: 26 October 2018 model using the data from a single capture session of 200 min, a population size of Accepted: 7 March 2019 1,182 post-metamorphic frogs (range: 1,168–1,195 [quadratic error]) and a density Published: 16 May 2019 of 13.7 frogs/m2 (range: 13.6–13.9) of surface water were estimated.
    [Show full text]