DOCSLIB.ORG

High Prevalence of Low Plasma Thiamine Concentration in Diabetes Linked to a Marker of Vascular Disease

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
High Prevalence of Low Plasma Thiamine Concentration in Diabetes Linked to a Marker of Vascular Disease Diabetologia (2007) 50:2164–2170 DOI 10.1007/s00125-007-0771-4 ARTICLE High prevalence of low plasma thiamine concentration in diabetes linked to a marker of vascular disease P. J. Thornalley & R. Babaei-Jadidi & H. Al Ali & N. Rabbani & A. Antonysunil & J. Larkin & A. Ahmed & G. Rayman & C. W. Bodmer Received: 23 February 2007 /Accepted: 22 June 2007 /Published online: 4 August 2007 # Springer-Verlag 2007 Abstract 0.001, and type 2 diabetes 16.3 (95% CI 13.0–9.6) nmol/l, Aims/hypothesis To assess thiamine status by analysis of p<0.001. Renal clearance of thiamine was increased 24- plasma, erythrocytes and urine in type 1 and type 2 diabetic fold in type 1 diabetic patients and 16-fold in type 2 patients and links to markers of vascular dysfunction. diabetic patients. Plasma thiamine concentration correlated Methods Diabetic patients (26 type 1 and 48 type 2) with negatively with renal clearance of thiamine (r=−0.531, p< and without microalbuminuria and 20 normal healthy 0.001) and fractional excretion of thiamine (r=−0.616, p< control volunteers were recruited. Erythrocyte activity of 0.001). Erythrocyte transketolase activity correlated nega- transketolase, the concentrations of thiamine and related tively with urinary albumin excretion (r=−0.232, p<0.05). phosphorylated metabolites in plasma, erythrocytes and Thiamine transporter protein contents of erythrocyte mem- urine, and markers of metabolic control and vascular branes of type 1 and type 2 diabetic patients were increased. dysfunction were determined. Plasma thiamine concentration and urinary excretion of Results Plasma thiamine concentration was decreased 76% thiamine correlated negatively with soluble vascular adhe- in type 1 diabetic patients and 75% in type 2 diabetic sion molecule-1 (r=−0.246, p<0.05, and −0.311, p<0.01, patients: normal volunteers 64.1 (95% CI 58.5–69.7) nmol/l, respectively). type 1 diabetes 15.3 (95% CI 11.5–19.1) nmol/l, p< Conclusions/interpretation Low plasma thiamine concen- tration is prevalent in patients with type 1 and type 2 diabetes, associated with increased thiamine clearance. The conventional assessment of thiamine status was masked by P. J. Thornalley : R. Babaei-Jadidi : H. Al Ali : N. Rabbani : increased thiamine transporter content of erythrocytes. A. Antonysunil : J. Larkin Department of Biological Sciences, University of Essex, . Colchester, Essex, UK Keywords Adhesion molecules Microalbuminuria Thiamine . Type 1 diabetes . Type 2 diabetes P. J. Thornalley (*) : N. Rabbani : A. Antonysunil : J. Larkin Clinical Sciences Research Institute, Warwick Medical School, Abbreviations University of Warwick, University Hospital, Clifford Bridge Road, ARB angiotensin receptor blocker Coventry CV2 2DX, UK ClThiamine renal clearance of thiamine e-mail: [email protected] FEThiamine fractional excretion of thiamine MNL mononuclear leucocyte A. Ahmed : C. W. Bodmer Department of Diabetes and Endocrinology, RFC-1 reduced folate carrier-1 Colchester General Hospital, sVCAM-1 soluble vascular adhesion molecule-1 Colchester, Essex, UK THTR-1 thiamine transporter-1 THTR-2 thiamine transporter-2 G. Rayman Ipswich Diabetic Foot Unit and Diabetes Centre, TK transketolase Ipswich Hospital NHS Trust, TMP thiamine monophosphate Ipswich, UK TPP thiamine pyrophosphate Diabetologia (2007) 50:2164–2170 2165 Introduction Methods Diabetes is increasing in incidence in the UK and elsewhere Patients and normal healthy volunteers Diabetic patients to epidemic proportions. The major health concerns of were recruited from patients attending the Diabetes Clinic at diabetes are achieving good control of blood glucose, BP Colchester General Hospital, and normal healthy control and lipids to suppress the development of associated volunteers from partners and friends of the patients and vascular complications—microvascular complications (ne- investigators. Inclusion criteria were: diabetic patients with phropathy, retinopathy and peripheral neuropathy) and normoalbuminuria (AER <30 mg/24 h) and microalbuminuria macrovascular complications (cardiovascular disease and (AER 30–300 mg/24 h); matched for age and sex (18– stroke) [1, 2]. This is not always achievable because of 65 years); diabetes duration of ≥5 years; HbA1c <10%; and limitations of current drug therapy, patient compliance and BMI 19–40 kg/m2. Exclusion criteria were: patients with other factors linked to the development of vascular end-stage renal disease; severe excess alcohol consumption complications [3]. Secondarily to the global epidemic of (>50 U per week; 1 U is 8 g alcohol); significant comor- diabetes, therefore, is a global burden of vascular compli- bidities; known allergy or intolerance to thiamine; use of cations [4]. The significant residual risk of development of thiamine supplements or goldenseal (Hydrastis canadensis,a microvascular and macrovascular complications in prospec- multipurpose herbal remedy); participating in an intervention tive clinical trials where best efforts have been made to study within 30 days; recipients of renal and/or pancreatic optimise glycaemic control [5, 6], and the failure of major transplants; and women who were pregnant or breastfeeding genetic susceptibility factors for diabetic complications to or of child-bearing potential not using adequate contracep- emerge from intensive studies [7] (although some may be tive precautions. Twenty-four hour urine collections and found with further study [8, 9]), encourage the search for blood samples (fasting) were taken with informed consent of other metabolic and nutritional factors that may predispose the patients and volunteers. Plasma, erythrocyte and mono- to the development of vascular complications in diabetes. nuclear leucocyte (MNL) fractions were prepared immedi- Vascular complications develop progressively from 5– ately and stored at −80°C until analysis. Ethical approval for 40 years after the onset of diabetes, although they may appear the study was given by the local ethics committee (North and earlier in type 2 diabetes when associated with a period of Mid-Essex Local Research Ethics Committee). undiagnosed diabetes and impaired glucose tolerance. A strategy to counter multiple pathways of biochemical Assay of thiamine and phosphorylated metabolites Thi- dysfunction linked to the development of vascular complica- amine status was assessed by measurement of thiamine, tions emerged from recent advances in understanding of the thiamine monophosphate (TMP) and TPP, determined by cell biology of diabetic complications: high-dose therapy HPLC with fluorimetric detection (pre-column derivatisa- with thiamine and related derivatives such as benfotiamine. tion to thiachromes) [13]. The retention times, limits of High-dose thiamine therapy prevented the development of detection, interbatch CV values and recoveries for these microvascular complications in experimental diabetes with- metabolites were: thiamine 13.1 min, 36 fmol, 1.1 and out improvement of metabolic control, as reviewed in [10]. 97%; TMP 6.0 min, 52 fmol, 2.1 and 92%; and TPP Experimental diabetes was also associated with tissue- 4.5 min, 51 fmol, 2.9 and 94%. There was no interference specific thiamine deficiency characterised by a marked from glucose in the assay and validations were not decrease of plasma thiamine concentration and decreased significantly different in analysis of samples from normal activity of the thiamine-dependent enzyme of transketolase healthy volunteers and diabetic patients. Sample storage (TK) and decreased levels of TK protein in renal glomeruli studies indicated that analyte content was stable for plasma, linked to a profound increase in renal clearance of thiamine erythrocytes and urine stored at −80°C for at least 6 weeks (ClThiamine)[11]. Thiamine deficiency was not detected by and storage of plasma, erythrocyte haemolysate and urine the conventional indicator of thiamine status, the erythrocyte and related de-proteinised extracts for 8 h. Stock solutions ‘thiamine effect’ (the percentage unsaturation of TK with of thiamine, TMP and TPP were calibrated by spectropho- thiamine pyrophosphate [TPP] cofactor) [12]. The preva- tometry assuming molar extinction coefficients of ɛ233= −1 −1 lence of similar low plasma thiamine concentrations and 14.2, ɛ247=15.3 and ɛ247=13.0 (mmol/l) cm , respec- impaired renal handling of thiamine in clinical diabetes has tively [14]. Shewhart analysis assessing the stability of not been addressed previously. analyte estimates in samples every day over a period of ten In this study, we sought to establish whether there is a consecutive days indicated the analysis had acceptable disturbance of thiamine homeostasis prevalent in type 1 and quality control (all estimates within mean±2 SD) [15]. The type 2 diabetic patients in the UK and if this is linked to concentration of thiamine metabolites was determined in incipient nephropathy and markers of vascular dysfunction plasma, erythrocytes and urine; ClThiamine and fractional and early stage renal dysfunction. excretion of thiamine (FEThiamine) were deduced. 2166 Diabetologia (2007) 50:2164–2170 Other biochemical measurements Erythrocyte TK activity clearance. Fifty diabetic patients (17 type 1 and 33 type 2) and percentage unsaturation with TPP (thiamine effect) had urinary albumin excretion within the normal range were determined. Erythrocyte membrane content of thia- (median 11.5, 2.3–29.1 mg/24 h) and 24 had urinary mine transporter-1 (THTR-1) [16]andreducedfolate albumin excretion characteristic of microalbuminuria and carrier-1
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Genome-Wide Association Analysis Identifies a Mutation in the Thiamine Transporter 2 (SLC19A3) Gene Associated with Alaskan Husky Encephalopathy
    Genome-Wide Association Analysis Identifies a Mutation in the Thiamine Transporter 2 (SLC19A3) Gene Associated with Alaskan Husky Encephalopathy The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Vernau, Karen M., Jonathan A. Runstadler, Emily A. Brown, et al. Genome-Wide Association Analysis Identifies a Mutation in the Thiamine Transporter 2 (SLC19A3) Gene Associated with Alaskan Husky Encephalopathy. Gerard Roel Rutteman, ed. PLoS ONE 8(3): e57195, 2013. As Published http://dx.doi.org/10.1371/journal.pone.0057195 Publisher Public Library of Science Version Final published version Citable link http://hdl.handle.net/1721.1/78615 Terms of Use Creative Commons Attribution Detailed Terms http://creativecommons.org/licenses/by/2.5/ Genome-Wide Association Analysis Identifies a Mutation in the Thiamine Transporter 2 (SLC19A3) Gene Associated with Alaskan Husky Encephalopathy Karen M. Vernau1*, Jonathan A. Runstadler2¤, Emily A. Brown1, Jessie M. Cameron3, Heather J. Huson2, Robert J. Higgins2, Cameron Ackerley3, Beverly K. Sturges1, Peter J. Dickinson1, Birgit Puschner1, Cecilia Giulivi1, G. Diane Shelton4, Brian H. Robinson3, Salvatore DiMauro5, Andrew W. Bollen6, Danika L. Bannasch1 1 University of California Davis, Davis, California, United States of America, 2 University of Alaska Fairbanks, Fairbanks, Alaska, United States of America, 3 Research Institute, The Hospital for Sick Children, Toronto, Ontario, Canada, 4 Department of Pathology, University of California San Diego, La Jolla, California, United States of America, 5 Department of Neurology, Columbia University Medical Center, New York, New York, United States of America, 6 Department of Pathology, School of Medicine, University of California San Francisco, San Francisco, California, United States of America Abstract Alaskan Husky Encephalopathy (AHE) has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS).
    [Show full text]
  • Transporters
    Alexander, S. P. H., Kelly, E., Mathie, A., Peters, J. A., Veale, E. L., Armstrong, J. F., Faccenda, E., Harding, S. D., Pawson, A. J., Sharman, J. L., Southan, C., Davies, J. A., & CGTP Collaborators (2019). The Concise Guide to Pharmacology 2019/20: Transporters. British Journal of Pharmacology, 176(S1), S397-S493. https://doi.org/10.1111/bph.14753 Publisher's PDF, also known as Version of record License (if available): CC BY Link to published version (if available): 10.1111/bph.14753 Link to publication record in Explore Bristol Research PDF-document This is the final published version of the article (version of record). It first appeared online via Wiley at https://bpspubs.onlinelibrary.wiley.com/doi/full/10.1111/bph.14753. Please refer to any applicable terms of use of the publisher. University of Bristol - Explore Bristol Research General rights This document is made available in accordance with publisher policies. Please cite only the published version using the reference above. Full terms of use are available: http://www.bristol.ac.uk/red/research-policy/pure/user-guides/ebr-terms/ S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: Transporters. British Journal of Pharmacology (2019) 176, S397–S493 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Transporters Stephen PH Alexander1 , Eamonn Kelly2, Alistair Mathie3 ,JohnAPeters4 , Emma L Veale3 , Jane F Armstrong5 , Elena Faccenda5 ,SimonDHarding5 ,AdamJPawson5 , Joanna L Sharman5 , Christopher Southan5 , Jamie A Davies5 and CGTP Collaborators 1School of Life Sciences,
    [Show full text]
  • Transporters
    University of Dundee The Concise Guide to PHARMACOLOGY 2015/16 Alexander, Stephen P. H.; Kelly, Eamonn; Marrion, Neil; Peters, John A.; Benson, Helen E.; Faccenda, Elena Published in: British Journal of Pharmacology DOI: 10.1111/bph.13355 Publication date: 2015 Licence: CC BY Document Version Publisher's PDF, also known as Version of record Link to publication in Discovery Research Portal Citation for published version (APA): Alexander, S. P. H., Kelly, E., Marrion, N., Peters, J. A., Benson, H. E., Faccenda, E., Pawson, A. J., Sharman, J. L., Southan, C., Davies, J. A., & CGTP Collaborators (2015). The Concise Guide to PHARMACOLOGY 2015/16: Transporters. British Journal of Pharmacology, 172(24), 6110-6202. https://doi.org/10.1111/bph.13355 General rights Copyright and moral rights for the publications made accessible in Discovery Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from Discovery Research Portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain. • You may freely distribute the URL identifying the publication in the public portal. Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Download date: 06. Oct. 2021 S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2015/16: Transporters.
    [Show full text]
  • Neurological, Psychiatric, and Biochemical Aspects of Thiamine Deficiency in Children and Adults
    UC Davis UC Davis Previously Published Works Title Neurological, Psychiatric, and Biochemical Aspects of Thiamine Deficiency in Children and Adults. Permalink https://escholarship.org/uc/item/71n066f0 Journal Frontiers in psychiatry, 10(APR) ISSN 1664-0640 Authors Dhir, Shibani Tarasenko, Maya Napoli, Eleonora et al. Publication Date 2019 DOI 10.3389/fpsyt.2019.00207 Peer reviewed eScholarship.org Powered by the California Digital Library University of California MINI REVIEW published: 04 April 2019 doi: 10.3389/fpsyt.2019.00207 Neurological, Psychiatric, and Biochemical Aspects of Thiamine Deficiency in Children and Adults Shibani Dhir 1†, Maya Tarasenko 1†, Eleonora Napoli 1 and Cecilia Giulivi 1,2* 1 Department of Molecular Biosciences, School of Veterinary Medicine, University of California, Davis, Davis, CA, United States, 2 Medical Investigations of Neurodevelopmental Disorders (MIND) Institute, University of California, Davis, Davis, CA, United States Thiamine (vitamin B1) is an essential nutrient that serves as a cofactor for a number of enzymes, mostly with mitochondrial localization. Some thiamine-dependent enzymes are involved in energy metabolism and biosynthesis of nucleic acids whereas others are part of the antioxidant machinery. The brain is highly vulnerable to thiamine deficiency due to its heavy reliance on mitochondrial ATP production. This is more evident during rapid Edited by: growth (i.e., perinatal periods and children) in which thiamine deficiency is commonly Shannon Rose, associated with either malnutrition or genetic defects. Thiamine deficiency contributes University of Arkansas for Medical Sciences, to a number of conditions spanning from mild neurological and psychiatric symptoms United States (confusion, reduced memory, and sleep disturbances) to severe encephalopathy, ataxia, Reviewed by: congestive heart failure, muscle atrophy, and even death.
    [Show full text]
  • Thiamine Transporter-2 Deficiency: Outcome and Treatment Monitoring
    Ortigoza-Escobar et al. Orphanet Journal of Rare Diseases 2014, 9:92 http://www.ojrd.com/content/9/1/92 RESEARCH Open Access Thiamine transporter-2 deficiency: outcome and treatment monitoring Juan Darío Ortigoza-Escobar1, Mercedes Serrano1,5, Marta Molero2,5, Alfonso Oyarzabal4,5, Mónica Rebollo3, Jordi Muchart3, Rafael Artuch2,5, Pilar Rodríguez-Pombo4,5 and Belén Pérez-Dueñas1,5* Abstract Background: The clinical characteristics distinguishing treatable thiamine transporter-2 deficiency (ThTR2) due to SLC19A3 genetic defects from the other devastating causes of Leigh syndrome are sparse. Methods: We report the clinical follow-up after thiamine and biotin supplementation in four children with ThTR2 deficiency presenting with Leigh and biotin-thiamine-responsive basal ganglia disease phenotypes. We established whole-blood thiamine reference values in 106 non-neurological affected children and monitored thiamine levels in SLC19A3 patients after the initiation of treatment. We compared our results with those of 69 patients with ThTR2 deficiency after a review of the literature. Results: At diagnosis, the patients were aged 1 month to 17 years, and all of them showed signs of acute encephalopathy, generalized dystonia, and brain lesions affecting the dorsal striatum and medial thalami. One patient died of septicemia, while the remaining patients evidenced clinical and radiological improvements shortly after the initiation of thiamine. Upon follow-up, the patients received a combination of thiamine (10–40 mg/kg/day) and biotin (1–2 mg/kg/day) and remained stable with residual dystonia and speech difficulties. After establishing reference values for the different age groups, whole-blood thiamine quantification was a useful method for treatment monitoring.
    [Show full text]
  • Metformin Is a Substrate and Inhibitor of the Human Thiamine Transporter, THTR‑2 (SLC19A3) † † † ‡ † § Xiaomin Liang, Huan-Chieh Chien, Sook Wah Yee, Marilyn M
    Article pubs.acs.org/molecularpharmaceutics Metformin Is a Substrate and Inhibitor of the Human Thiamine Transporter, THTR‑2 (SLC19A3) † † † ‡ † § Xiaomin Liang, Huan-Chieh Chien, Sook Wah Yee, Marilyn M. Giacomini, Eugene C. Chen, , † ∥ ‡ ‡ ‡ ‡ Meiling Piao, , Jia Hao, Jolyn Twelves, Eve-Irene Lepist, Adrian S. Ray, † and Kathleen M. Giacomini*, † Department of Bioengineering and Therapeutic Sciences, University of California, San Francisco, California 94158, United States ∥ Department of Pharmacology and Pharmaceutical Sciences, School of Medicine, Tsinghua University, Beijing 100084, China ‡ Department of Drug Metabolism, Gilead Sciences, Inc., Foster City, California 94404, United States *S Supporting Information ABSTRACT: The biguanide metformin is widely used as first-line therapy for the treatment of type 2 diabetes. Predominately a cation at physiological pH’s, metformin is transported by membrane transporters, which play major roles in its absorption and disposition. Recently, our laboratory demonstrated that organic cation transporter 1, OCT1, the major hepatic uptake transporter for metformin, was also the primary hepatic uptake transporter for thiamine, vitamin B1. In this study, we tested the reverse, i.e., that metformin is a substrate of thiamine transporters (THTR-1, SLC19A2, and THTR-2, SLC19A3). Our study demonstrated that human THTR-2 (hTHTR-2), SLC19A3, which is highly expressed in the small intestine, but not hTHTR-1, transports metformin (Km = 1.15 ± 0.2 mM) and other cationic compounds (MPP+ and famotidine). The uptake mechanism for hTHTR-2 was pH and electrochemical gradient sensitive. Furthermore, metformin as well as other drugs including phenformin, chloroquine, verapamil, famotidine, and amprolium inhibited hTHTR-2 mediated uptake of both thiamine and metformin. Species differences in the substrate specificity of THTR-2 between human and mouse orthologues were observed.
    [Show full text]
  • Identification and Characterization of Thiamine Biosynthesis, Transport, and Regulation Elements Among Bacteroides Species
    IDENTIFICATION AND CHARACTERIZATION OF THIAMINE BIOSYNTHESIS, TRANSPORT, AND REGULATION ELEMENTS AMONG BACTEROIDES SPECIES BY ZACHARY ANDREW COSTLIOW DISSERTATION Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Microbiology in the Graduate College of the University of Illinois at Urbana-Champaign, 2018 Urbana, Illinois Doctoral Committee: Assistant Professor Patrick H. Degnan, Chair Associate Professor Carin K. Vanderpool, Co-Chair Professor Gary J. Olsen Professor James A. Imlay ABSTRACT Thiamine (vitamin B1) is an essential cofactor for all organisms. Humans primarily acquire thiamine through their diet and thiamine deficiencies have adverse neurological effects. However, the role gut microbes play in modulating thiamine availability is poorly understood. In addition, little is known about how thiamine, the Bacteroidetes ability to biosynthesize and transport thiamine, or the regulation of biosynthesis and transport impacts the stability of microbial gut communities and human health as a whole. To investigate the role thiamine plays in the gut we leveraged in silico analyses of gut microbial species to determine prominent strategies utilized to attain thiamine. In addition, we have identified the genetic content and operon structure of thiamine transport and biosynthesis across the prominent gut phylum, Bacteroidetes. Along with the bioinformatic methods, RNAseq revealed differential responses to exogenous thiamine by three abundant Bacteroides species. This is highlighted by the global down- regulation of thiamine and amino acid biosynthesis, central, and purine metabolism when thiamine was present in Bacteroides thetaiotaomicron. In contrast Bacteroides uniformis and vulgatus show a much more reserved transcriptomic response to exogenous thiamine. In order to build upon these data, we leveraged genetic mutants of thiamine biosynthesis and transport loci in B.
    [Show full text]
  • Compound Heterozygous SLC19A3 Mutations Further Refine the Critical Promoter Region for Biotin-Thiamine-Responsive Basal Ganglia Disease
    Downloaded from molecularcasestudies.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Compound heterozygous SLC19A3 mutations further refine the critical promoter region for biotin-thiamine-responsive basal ganglia disease Whitney Whitford1,8, Isobel Hawkins1, Emma Glamuzina2, Francessa Wilson3, Andrew Marshall4, Fern Ashton5, Donald R. Love5, Juliet Taylor6, Rosamund Hill7, Klaus Lehnert1,8, Russell G. Snell1,8, Jessie C. Jacobsen1,8 1School of Biological Sciences, The University of Auckland, New Zealand 2Adult and Paediatric National Metabolic Service, Starship Children’s Hospital, New Zealand 3Department of Paediatric Radiology, Starship Children’s Hospital, New Zealand 4Department of Paediatrics and Child Health, Wellington Hospital, New Zealand 5Diagnostic Genetics LabPLUS, Auckland City Hospital, Auckland, New Zealand 6Genetic Health Service New Zealand, Auckland City Hospital, New Zealand 7Department of Neurology, Auckland City Hospital, New Zealand 8Centre for Brain Research, The University of Auckland, New Zealand corresponding author’s e-mail: [email protected] ABSTRACT (250 words max) Mutations in the gene SLC19A3 result in thiamine metabolism dysfunction syndrome 2, also known as biotin-thiamine-responsive basal ganglia disease (BTBGD). This neurometabolic disease typically presents in early-childhood with progressive neurodegeneration, including confusion, seizures, and dysphagia, advancing to coma and death. Treatment is possible via supplement of biotin and/or thiamine, with early treatment resulting in significant life-long improvements. Here we report two siblings who received a refined diagnosis of BTBGD following whole genome sequencing. Both children inherited compound heterozygous mutations from unaffected parents; a missense single nucleotide variant (p.G23V) in the first transmembrane domain of the protein, and a 4,808 bp deletion in exon 1 encompassing the 5’ UTR and critical promoter region.
    [Show full text]
  • SLC19A3 Loss-Of-Function Variant in Yorkshire Terriers with Leigh-Like Subacute Necrotizing Encephalopathy
    G C A T T A C G G C A T genes Case Report SLC19A3 Loss-of-Function Variant in Yorkshire Terriers with Leigh-Like Subacute Necrotizing Encephalopathy 1, 1, 2, 1 Michaela Drögemüller y, Anna Letko y , Kaspar Matiasek y, Vidhya Jagannathan , Daniele Corlazzoli 3, Marco Rosati 2, Konrad Jurina 4, Susanne Medl 5, Thomas Gödde 6, Stefan Rupp 7, Andrea Fischer 8, Alejandro Luján Feliu-Pascual 9 and Cord Drögemüller 1,* 1 Institute of Genetics, Vetsuisse Faculty, University of Bern, 3012 Bern, Switzerland; [email protected] (M.D.); [email protected] (A.L.); [email protected] (V.J.) 2 Section of Clinical & Comparative Neuropathology, Centre for Clinical Veterinary Medicine, Ludwig Maximilians Universität Munich, 80539 Munich, Germany; [email protected] (K.M.); [email protected] (M.R.) 3 Neurology & Neurosurgery Unit, Policlinico Veterinario Roma Sud, 00173 Roma, Italy; [email protected] 4 Small Animal Hospital, Tierklinik Haar, 85540 Haar, Germany; [email protected] 5 Small Animal Hospital, Anicura Kleintierklinik Babenhausen, 87727 Babenhausen, Germany; [email protected] 6 Small Animal Referral Practice, Veterinary Health Centre, 83451 Piding, Germany; [email protected] 7 Small Animal Hospital, Tierklinik Hofheim, 65719 Hofheim, Germany; [email protected] 8 Section of Neurology, Centre for Clinical Veterinary Medicine, Ludwig-Maximilians-Universität, 80539 Munich, Germany; a.fi[email protected] 9 Aúna Especialidades Veterinarias, 46980 Valencia, Spain; [email protected] * Correspondence: [email protected] These authors contributed equally to the work. y Received: 17 September 2020; Accepted: 15 October 2020; Published: 16 October 2020 Abstract: Sporadic occurrence of juvenile-onset necrotizing encephalopathy (SNE) has been previously reported in Yorkshire terriers.
    [Show full text]
  • (2) Patent Application Publication (10) Pub. No.: US 2013/0237454 A1 Schutzer (43) Pub
    US 20130237454A1 (19) United States (2) Patent Application Publication (10) Pub. No.: US 2013/0237454 A1 Schutzer (43) Pub. Date: Sep. 12, 2013 (54) DIAGNOSTIC MARKERS FOR Publication Classification NEUROPSYCHIATRIC DISEASE (51) Int. Cl. (76) Inventor: Steven E. Schutzer, Water Mill, NY G0IN 33/68 (2006.01) (US) (52) U.S. CI. CPC .................................. G0IN33/6896 (2013.01) (21) Appl. No.: 13/697,417 USPC ..…. 506/12 (22) PCT Filed: May 12, 2011 (57) ABSTRACT Biomarkers for the diagnosis of neuropsychiatric diseases are (86) PCT No.: PCT/US11/00843 presented herein. In particular embodiments, biomarkers are § 371 (c)(1), identified that are useful for diagnosing multiple sclerosis, (2), (4) Date: May 23, 2013 chronic fatigue syndrome, or Neurologic Lyme disease. Also encompassed is a method for diagnosing a patient with a Related U.S. Application Data neuropsychiatric disease, such as multiple sclerosis, chronic e K_f e fatigue syndrome, or Neurologic Lyme disease, by analyzing (60) Provisional application No. 61/395,354, filed on May biological samples isolated from the patient or the patient as 12, 2010. a whole to assess levels of the biomarkers described herein. 1895 72% 63 735 8% 92% ; Patent Application Publication Sep. 12, 2013 US 2013/0237454 A1 Figure l US 2013/0237454 A1 Sep. 12, 2013 DLAGNOSTIC MARKERS FOR tiple sclerosis is more common in women than men and NEUROPSYCHIATRIC DISEASE generally begins between ages 20 and 40, but can develop at any age. Multiple sclerosis is generally viewed as an autoim FIELD OF THE INVENTION mune syndrome directed against unidentified central nervous [0001] The present invention relates to identifying biologic tissue antigens.
    [Show full text]
  • Ion Transporters, Channelopathies, and Glucose Disorders
    International Journal of Molecular Sciences Review Ion Transporters, Channelopathies, and Glucose Disorders Huseyin Demirbilek 1, Sonya Galcheva 2, Dogus Vuralli 1 , Sara Al-Khawaga 3,4 and Khalid Hussain 3,* 1 Department of Paediatric Endocrinology, Hacettepe University Faculty of Medicine, 06230 Ankara, Turkey; [email protected] (H.D.); [email protected] (D.V.) 2 Department of Paediatrics, Varna Medical University/University Hospital “St. Marina”, Varna 9002, Bulgaria; [email protected] 3 Department of Paediatric Medicine, Division of Endocrinology, Sidra Medicine, Doha, Qatar; [email protected] 4 College of Health & Life Sciences, Hamad Bin Khalifa University, Qatar Foundation, Education City, Doha, Qatar * Correspondence: [email protected]; Tel.: +974-4003-7608 Received: 24 April 2019; Accepted: 22 May 2019; Published: 27 May 2019 Abstract: Ion channels and transporters play essential roles in excitable cells including cardiac, skeletal and smooth muscle cells, neurons, and endocrine cells. In pancreatic beta-cells, for example, potassium KATP channels link the metabolic signals generated inside the cell to changes in the beta-cell membrane potential, and ultimately regulate insulin secretion. Mutations in the genes encoding some ion transporter and channel proteins lead to disorders of glucose homeostasis (hyperinsulinaemic hypoglycaemia and different forms of diabetes mellitus). Pancreatic KATP, Non-KATP, and some calcium channelopathies and MCT1 transporter defects can lead to various forms of hyperinsulinaemic hypoglycaemia (HH). Mutations in the genes encoding the pancreatic KATP channels can also lead to different types of diabetes (including neonatal diabetes mellitus (NDM) and Maturity Onset Diabetes of the Young, MODY), and defects in the solute carrier family 2 member 2 (SLC2A2) leads to diabetes mellitus as part of the Fanconi–Bickel syndrome.
    [Show full text]