MAP17 Is a Necessary Activator of Renal Na+/Glucose Cotransporter SGLT2

BASIC RESEARCH www.jasn.org

† ‡ † Michael J. Coady,* Abdulah El Tarazi, René Santer, Pierre Bissonnette, † † Louis J. Sasseville,* Joaquim Calado,§ Yoann Lussier, Christopher Dumayne, †| Daniel G. Bichet, and Jean-Yves Lapointe*

*Physics Department & Groupe d’étude des protéines membranaires, †Departement of Molecular and Integrative Physiology & Groupe d’étude des protéines membranaires, and |Department of Medicine, Centre de recherche de l’Hôpital du Sacré-Cœur, University of Montreal, Montreal, Quebec, Canada; ‡Department of Pediatrics, University Medical Center Hamburg-Eppendorf, Hamburg, Germany; and §Department of Nephrology, ToxOmics, Centre for Toxicogenomics and Human Health, NOVA Medical School, New University of Lisbon, Lisbon, Portugal

ABSTRACT The renal proximal tubule reabsorbs 90% of the filtered glucose load through the Na+-coupled glucose transporter SGLT2, and specific inhibitors of SGLT2 are now available to patients with diabetes to increase urinary glucose excretion. Using expression cloning, we identified an accessory protein, 17 kDa mem- BASIC RESEARCH brane-associated protein (MAP17), that increased SGLT2 activity in RNA-injected Xenopus oocytes by two orders of magnitude. Significant stimulation of SGLT2 activity also occurred in opossum kidney cells cotransfected with SGLT2 and MAP17. Notably, transfection with MAP17 did not change the quantity of SGLT2 protein at the cell surface in either cell type. To confirm the physiologic relevance of the MAP17– SGLT2 interaction, we studied a cohort of 60 individuals with familial renal glucosuria. One patient without any identifiable mutation in the SGLT2 coding gene (SLC5A2) displayed homozygosity for a splicing mutation (c.176+1G.A) in the MAP17 coding gene (PDZK1IP1). In the proximal tubule and in other tissues, MAP17 is known to interact with PDZK1, a scaffolding protein linked to other transporters, including Na+/H+ exchanger 3, and to signaling pathways, such as theA-kinaseanchorprotein 2/protein kinase A pathway. Thus, these results provide the basis for a more thorough characterization of SGLT2 which would include the possible effects of its inhibition on colocalized renal transporters.

J Am Soc Nephrol 28: 85–93, 2017. doi: 10.1681/ASN.2015111282

Na+/glucose cotransporters employ the Na+ elec- SGLT2 mRNA, hindering characterization of this trochemical gradient to enable glucose uptake protein.6,7 against a concentration gradient. The low-affinity At least 11 pharmaceutical firms have candidate Na+/glucose cotransporter SGLT2, a product of the drugs for inhibiting SGLT2, including three that SLC5A2 gene (positioned at 16p11.2), is found al- are presently in clinical use, which should help most solely in the apical membranes of renal proximal tubules and reabsorbs over 90% of glucose from the glomerular filtrate.1 Although its cDNA Received November 30, 2015. Accepted April 5, 2016. was first cloned in 1992,2 the physiologic role of M.J.C. and A.E.T. contributed equally to this work.

SGLT2 only became accepted a decade later follow- Published online ahead of print. Publication date available at ing identiﬁcation of SLC5A2 mutations in a large www.jasn.org. majority of patients presenting with familial renal Correspondence: Dr. Jean-Yves Lapointe, Département de phy- 3–5 glucosuria (FRG). A major reason for this delay sique & Groupe d’étude des protéines membranaires, Université de was that, unlike the closely related SGLT1, SGLT2 Montréal, C.P. 6128, succ. Centre-ville, Montréal, Québec, Canada, does not express well either in transfected mamma- H3C 3J7. Email: [email protected] lian cells or in Xenopus laevis oocytes injected with Copyright © 2016 by the American Society of Nephrology

J Am Soc Nephrol 28: 85–93, 2017 ISSN : 1046-6673/2801-85 85 BASIC RESEARCH www.jasn.org diabetic patients to control their glycemia by augmenting urinary glucose excretion.5 The drugs are all analogues of phlorizin (Pz), a specific inhibitor for the transporters of the SGLT family. Given the prev- alence of type 2 diabetes and the great potential for SGLT2 inhibitors in patients with this metabolic syndrome, it is possible that millions will be taking these drugs in the coming years. Our understanding of SGLT2, and of its inhibitors and their physiologic interactions, would obviously ben- efit from a robust expression system for Figure 1. Identification of MAP17 as a factor stimulating SGLT2-mediated AMG up- this protein. take. (A) The uptake of AMG into Xenopus oocytes expressing murine SGLT2 mRNA The SGLT2 protein had been shown to (4.6 ng/oocyte) was stimulated by coexpression of rat renal mRNA (46 ng/oocyte) (the 6 – be stable in oocytes and transfected cells four samples at left; mean SD; n=5 6 oocytes per sample). When the renal mRNA was size-fractionated, no transport activity was associated with expression of fractions even though it exhibited little transport – 8 B1 B4 (10 ng/oocyte) but these mRNA samples steeply increased mSGLT2 activity activity. This suggested the possibility when coinjected with mSGLT2 mRNA, proving that the factor responsible acted by that a second protein might be required augmenting the activity of the mSGLT2 protein. The Renal+mSGLT2 uptake was for SGLT2 to function and so we used ex- significantly different (P,0.001, ANOVA/Bonferroni) from the three other samples pression cloning to isolate the putative ac- shown on the left (Uninjected; Renal; mSGLT2). B3+mSGLT2 uptake is significantly cessory protein. This protein was identified different from mSGLT2 uptake (P,0.001). (B) Expression cloning using a cDNA library as MAP17, a 17 kDa subunit with 2 trans- produced from mRNA fraction B3 produced a single cDNA clone (rMAP17) whose membrane segments which had first been product very significantly augmented murine SGLT2 activity (P,0.001). cloned in 1995 as a protein whose transcription was upregulated in kidney, colon, breast, and lung cancers.9 oocytes with SGLT2 mRNA. Radiolabeled AMG uptake experiments were then performed to identify the pool of plasmids expressing the protein which complemented SGLT2. A plas- RESULTS mid from a single colony was eventually isolated, the transcribed product of which greatly stimulated SGLT2 activity Expression Cloning in oocytes (Figure 1B). The cDNA encoded by this clone was Expression cloning consists of coinjecting Xenopus oocytes fully sequenced and the transcribed protein was identified as with SGLT2 mRNA together with increasingly restricted sam- MAP17, product of the PDZK1IP1 gene. Similar results were ples of renal mRNA to ultimately identify a single protein seen when rat SGLT2 mRNA was coinjected with rat MAP17 that stimulates SGLT2 activity.10 Expression of either rat mRNA (data not shown). renal mRNA or mouse SGLT2 mRNA in oocytes led to enhanced uptake of 14C-labeled a-methyl glucose (AMG, a Characterization of Human SGLT2–MAP17 Activity non-metabolized substrate for SGLT1/SGLT2), while SGLT2 We obtained human SGLT2 and MAP17 cDNAs by PCR coexpression with renal mRNA caused even greater uptake amplification and inserted them into pT7TS to enable tran- (Figure 1A). mRNA size-fractionation produced 24 fractions scription of polyA-tailed, capped mRNA. Coexpression with of renal mRNA, and aliquots were combined to create five human MAP17 in oocytes greatly stimulated human SGLT2– pooled samples (pools A– E). AMG uptakes with samples mediated AMG uptake (150620 fold for three experiments), from each pool indicated that pool B expressed the factor confirming that human MAP17 increases SGLT2 activity that affected AMG uptake. Subsequent oocyte injections of (Figure 2A). Na+/glucose cotransport generated currents of aliquots from the four size fractions contained in pool B are large amplitude (Figure 2B) which were not observed for con- shown in Figure 1A. The individual fractions did not induce a trol oocytes nor for oocytes solely expressing MAP17 or significant AMG uptake but coexpression of fractions B3 or B4 SGLT2. The cotransport current mediated by human SGLT2 with SGLT2 greatly stimulated AMG uptake. Thus, a protein was inhibited by Pz (a specific inhibitor which binds to the expressed by these size fractions of mRNA (approximately 0.5– glucose binding site) with a Ki of about 30 nM (data not 1.5 kb) augmented the level of SGLT2 activity. shown). Adding the high affinity inhibitor dapagliflozin at AcDNA library wasconstructed from mRNAsample B3and 10 nM in the presence of 2 mM glucose (Figure 2B) inhibited iterative screenings of pools of plasmids representing ever- the cotransport current by 90%, consistent with a Ki of 2.5 nM. smaller numbers of colonies were performed where mRNAwas Coexpression of MAP17 with other polyol-transporting mem- transcribed from the NotI-cut plasmids and coinjected into bers of the SLC5A family (i.e., SGLT1, SMIT1, SMIT2, SGLT3,

86 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 85–93, 2017 www.jasn.org BASIC RESEARCH

examined, it can be seen that the sequence homology ends where the cytoplasmic C-terminal domains commence (Figure 2C). Coexpression of MARDI with SGLT2 showed that it stimulated SGLT2 activity by 1869fold,whichisquitesigniﬁcant butisalsoanorderofmagnitudeless than what is seen with MAP17 (Figure 2, AandD).

Expression in Opossum Kidney Cells To better understand the MAP17–SGLT2 interaction, the two human cDNAs were separately inserted into the vector pcDNA3.1(-) and each received an epitope tag expected to face the extracellular solution when the protein had reached the plasma membrane. The recombinant vectors were used for transient transfection of opossum kidney (OK) cells, which express minimal amounts of endogenous MAP17 mRNA.11 Cotransfection caused a large increase in AMG uptake into the cells (Figure 3A) and a parallel increase in the binding of Figure 2. Stimulation of human SGLT2 activity with human MAP17 and MARDI. (A) 14 Coexpression of human MAP17 and human SGLT2 in Xenopus oocytes provided C-labeled Pz (Figure 3B). The transport results similar to those seen with rat MAP17 and murine SGLT2 (the hSGLT2+hMAP17 activity observed with tagged proteins was uptake was significantly different [P,0.001; mean6SD; n=5–6 oocytes per sample; indistinguishable from that seen with un- ANOVA/Bonferroni] from the three other samples, i.e., uninjected, hSGLT2, and tagged proteins (data not shown). hMAP17 mRNA). (B) SGLT2 activity could also be monitored by electrophysiological The four C-terminal amino acids of measurement of the substrate-induced current passing through the protein under MAP17, i.e., -STPM, comprise a PDZ- voltage-clamp conditions. All traces employ the same scales (as shown). For the first binding motif. MAP17 strongly interacts three traces (all from one oocyte held at 250 mV and expressing both hSGLT2 and with a scaffolding protein called PDZK1 hMAP17), the changes in current represent the effect of addition of 2 mM glucose which contains four distinct PDZ do- (denoted by gray bars) to the bathing solution in the presence of i) no inhibitor; ii) mains.12 To determine whether this inter- 10 nM dapagliflozin; iii)100 nM dapagliflozin. The other tracings represent the ab- action is necessary for its stimulation of sence of effect of presenting 2 mM glucose to an uninjected oocyte (iv), and oocytes expressing hMAP17 only (v) or hSGLT2 only (vi). (C) Alignment of hMAP17 and MARDI SGLT2 activity, we measured AMG uptake protein sequences. Sequence identity is indicated by white letters on a black back- into OK cells transfected with SGLT2 and ground and the two transmembrane (TM) segments are indicated. (D) Coexpression of either MAP17 or an engineered version of MARDI causes augmented SGLT2 activity, though less than that seen with MAP17. A MAP17 lacking the last four amino acids typical experiment is shown, of three experiments, where n=6 oocytes for each sample (MAP17-DSTPM). The last four amino in each experiment. The stimulatory effect of MARDI on SGLT2 expression was sig- acids did not affect MAP17’s augmentation nificantly different from the effects seen with oocytes expressing either SGLT2 or of SGLT2 activity (Figure 3A), indicating MARDI alone (P,0.001, ANOVA/Bonferroni). that this effect does not require interaction with PDZK1. Todistinguish between increased SGLT2 and SGLT4) did not cause any significant increase in their trans- expression at the cell surface versus activation of SGLT2 already port activities with the exception of SGLT3, whose transport present, we fixed transiently-transfected cell cultures with currents were increased by a factor of 2.660.8 (data not shown). paraformaldehyde and used epitope-tag antibodies along with Using the default settings for a BLASTsearch of the human fluorescent secondary antibodies to fluorescently measure cell proteome, we have found a single protein (from gene SMIM24) surface F7-SGLT2 (F7 tag added to the N terminus of SGLT2). that shows significant sequence similarity to MAP17, which As shown in Figure 3C, MAP17 coexpression caused no we named MARDI (MAP17-Related Dimer), and which is exchange in the amount of SGLT2 measured at the cell surface pressed in the apical membranes of both renal proximal tu- SGLT2. The data (five separate experiments) was assessed bules and small intestine (http://www.proteinatlas.org/ using two-way ANOVA and Bonferroni post-hoc analysis ENSG00000095932/tissue). When the aligned sequences are in order to eliminate the inter-experiment variability in

J Am Soc Nephrol 28: 85–93, 2017 MAP17 activates SGLT2 87 BASIC RESEARCH www.jasn.org

transport activity. Due to the possibility of contamination with intracellular membranes,wechooserathertoworkwith intact OK cells. We exposed unfixed, transfected cells to the murine anti-F7 primary antibody and measured, via a Western blot, the amount of antibody that was attached to the membrane. Under our conditions, control cells bound no detectable primary antibody while similar amounts of primary antibody were found attached to the cells expressing F7-SGLT2 or F7-SGLT2+MAP17 (Figure 3D, top panel). Similar results were found with Xenopus oocytes expressing F7- SGLT2 alone or with MAP17 (Figure 3D, bottom panel). In agreement with the previous result, equivalent levels of membrane expression of F7-SGLT2 are observed in immunofluorescent staining of OK cells transfected with or without MAP17 (Figure 4, A and B). Thus, the quantity of SGLT2 expressed at the cell membrane is not altered by MAP17 coexpression, but the cotransporter con- Figure 3. MAP17 activates SGLT2 in transfected OK cells and in oocytes without formation must be changed since the pres- increasing SGLT2 surface expression. (A) Uptake of radiolabeled AMG into confluent ence of MAP17 significantly increased both monolayers of OK cells demonstrates that hSGLT2 activity was strongly increased by Pz binding and AMG transport. the presence of hMAP17 (P,0.001) or MAP17D where the terminal four amino acids P, 6 n (-STPM) have been removed ( 0.001; mean SD; =5 wells per sample; ANOVA/ MAP17 Mutation in FRG Patient Bonferroni). (B) OK cells expressing both SGLT2 and MAP17 bind more radiolabeled A cohort of 60 individuals with FRG, and Pz than cells expressing SGLT2 alone (P,0.001; mean6SD; n=5 wells per sample; ANOVA/Bonferroni). Cells expressing SGLT2 alone present a small but significant some of their family members, was assem- 4,13 increase (P,0.05) in Pz binding versus control cells (Ctl). Radiolabeled Pz could be bled over the past decade. Of these, 12 displaced by adding 100 mM cold Pz to the bathing solution. (C) Quantification of were glucosuric without presenting any superficial immunofluorescent labeling of SGLT2 (flagged with an external F7 epitope) mutations in SLC5A2 or with mutation was performed using confluent OK cells fixed with paraformaldehyde. Cells exon one allele only, a finding not expected pressing SGLT2 or SGLT2+MAP17 present larger amounts of attached fluorescent to account for the severity of the glucosuria antibodies than cells expressing either nothing or MAP17 alone (P,0.01; mean6SD; observed. We sequenced the DNA of these n=5 wells per sample; ANOVA/Bonferroni). There was no significant difference be- 12 patients to determine whether muta- tween SGLT2 and SGLT2+MAP17. (D) OK cells (top panel) were transfected with tions in PDZK1IP1 (locus in 1p13) could empty vector (Ctl) or with a vector expressing, F7-hSGLT2 (SGLT2) or F7-hSGLT2 and explain their glucosuria. For one individu- hMAP17 (SGLT2+MAP17). The amount of primary antibody which had been bound to al, without any mutation identified in the the cells was observed in a Western blot with a secondary antibody. A similar experiment was performed with plasma membranes isolated from Xenopus oocytes injected with SLC5A2 gene, homozygosity for a muta- PDZK1IP1 either nothing (Ctl) or mRNAs expressing hSGLT2 or hSGLT2+hMAP17 (n=4). This tion in the gene was found. confirms that the amount of SGLT2 present in the membrane is not increased by the This patient, the daughter of consanguine- presence of MAP17. ous Turkish parents, had reproducible glucosuria in the range of 8–16.7 g/1.73 m2 per day (originally published as case 19–14) background fluorescence. There was a significant increase in and has meanwhile been lost to follow-up. She was homozygous fluorescence associated with SGLT2 expression (i.e., SGLT2 for the mutation c.176+1G.A, affecting the donor splice site of and SGLT2+MAP17 were both different from control or intron 2 of PDZK1IP1. The mutation predicts skipping of exon 2 MAP17 cells; P,0.01) but there was no significant differ- resulting in a shift of the reading frame (see Figure 5A). ence in the amount of fluorescence between SGLT2 and To confirm that the PDZK1IP1 mutation was responsible for SGLT2+MAP17 cells. To confirm these results, one possibil- the glucosuria, we isolated the PDZK1IP1 gene by PCR amplifi- ity would be to obtain membrane vesicles from the apical cation from normal human genomic DNA. The reaction product membrane of OK cells and compare SGLT2 abundance with was 7.2 kb rather than the 6.2 kb suggested by the human genome

88 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 85–93, 2017 www.jasn.org BASIC RESEARCH

Figure 4. The presence of MAP17 does not change the expression level of SGLT2. (A) OK cells expressing pcDNA3.1-F7- hSGLT2 have been ﬁxed with and exposed to an anti-F7 antibody and a ﬂuorescent anti-antibody. (B) OK cells expressing a com- bination of pcDNA3.1-F7-hSGLT2 and pcDNA3.1-hMAP17-HA. Localization of SGLT2 and similar quantities are visible in both cases. The white scale bars indicate distances of 10 mm and the yellow bar indicates the z axis.

GRCh37.p13 Primary Assembly. Sequencing revealed a 1 kb region containing approximately 70 iterations of a 16 bp minisatellite sequence (GGGGGATGGACTCAGT), most of which had been missing from the reference sequence which has a gap replacing some of these iterations. Both the intact gene and the c.176+1G.A mutation (by site-directed muta- genesis) were inserted into pcDNA3.1 and expressed in OK cells. Figure 5. Detection of a PDZK1IP1 mutation in a patient with As Figure 5B shows, significant SGLT2 activation was caused by renal glucosuria. (A) Schematic presentation of sequencing re- coexpression of the normal PDZK1IP1 gene (P,0.001), but not sults of a PCR product containing exon 2 of the PDZK1IP1gene with the c.176+1G.A mutated gene (P.0.05). Injection of the and an adjacent intronic segment in a patient with FRG. The re- same recombinant vectors (containing normal or mutated gion around c.176 is shown with the boundary between exon 2 PDZK1IP1) into the nuclei of Xenopus oocytes did not induce and intron 2 indicated by the dotted line. Note homozygosity for fi measurable transport activity. a single base exchange at the rst position of the consensus sequence of the donor splice site of intron 2 (c.176+1G.A,IVS2+1G.A) in the patient. (B) Uptake of radiolabeled AMG is shown for OK cells that have been transfected with the vector pcDNA3.1(-) itself DISCUSSION (Ctl) or with the recombinant vector containing hSGLT2 cDNA, either alone or cotransfected with the same vector expressing the Expression cloning was used to isolate a cDNA clone for a mutated PDZK1IP1 c.176+1G.A gene (mut gene) or the intact protein that complemented SGLT2 activity. Utilizing expres- PDZK1IP1 gene (wt gene). For comparison, the AMG uptake sion of mRNA for SGLT2 6 size-fractionated renal mRNA obtained from cells cotransfected with the recombinant vectors (Figure 1A) allowed us to identify a specific pool that could containing hSGLT2 and hMAP17 is also shown. The AMG uptakes enhance the level of activity of SGLT2 without generating any in cells expressing SGLT2 + the mutant MAP17 gene was not significant glucose transport by itself. Subsequent isolation different from the uptake in cells expressing SGLT2 alone . 6 of a single clone showed conclusively that MAP17 is required (P 0.05; mean SD; n=4 wells; and the entire experiment was repeated three times). A significant difference was observed for the activity of SGLT2. This was surprising because Blasco between the cells cotransfected with the hSGLT2 cDNA and the et al. 11 , using an expression cloning strategy aimed at identi- intact human PDZK1IP1 gene (SGLT2 + wt gene) versus the cells fying the renal Na/mannose cotransporter, reported that rat cotransfected with the hSGLT2 cDNA alone (P,0.001, ANOVA/ MAP17 could stimulate the endogenous Na/mannose cotrans- Bonferroni). In addition, the control cells and the cells cotransfected port of the oocyte without any effect on coexpressed rat with the two cDNAs were significantly different (P,0.001) from all SGLT1, rat SGLT2, or pig SGLT3. In our hands, the activity other samples. levels of both rat and human versions of SGLT2 are similarly augmented by their corresponding MAP17 proteins, results which have consistently been found in several works from interaction was not observed in the previous study. Neverthe- different laboratories using different types of vectors in both less, the glucosuria associated with the c.176+1G.A cell cultures and Xenopus oocytes. After so much time, it is PDZK1IP1 homozygosity provides conclusive evidence that difficult to reasonably speculate on the reason why this MAP17 is a necessary activator of SGLT2 in situ.

J Am Soc Nephrol 28: 85–93, 2017 MAP17 activates SGLT2 89 BASIC RESEARCH www.jasn.org

Several transport proteins require the presence of a partner the attached high-density lipoprotein receptor SR-B1, leading protein (often called b subunits) in order to reach the plasma to increased plasma HDL levels.34 membrane.14–16 Virtually all of these accessory proteins have As MAP17 was first cloned on the basis of being overex- separate functional activities as well (as does MAP17), and pressed in tumors, it is not surprising that it has been shown to most of the related transporters are found in lipid rafts (as be an excellent marker for tumorigenesis.35,36 Several studies are SGLT1 and SGLT217). While these accessory proteins act examining the role of MAP17 in tumorigenesis showed that by increasing the expression of the transport protein, the case MAP17 over-expression enhanced tumor cell malignancy by of MAP17 is quite different: it enables the transport activity increasing the level of reactive oxygen species.37,38 Very inter- without changing the amount of transport proteins present at estingly, these effects can be inhibited by Pz, but the specific the plasma membrane. In oocytes, the presence of MAP17 Na/glucose cotransporter involved (SGLT1, 2, 3, ...) has not yet must induce a change in the structure of SGLT2 which would been determined.38 Our results provide an additional avenue then allow glucose transport. In OK cells, even though the by which MAP17 may affect reactive oxygen species, via stimulatory effect is smaller than in oocytes, MAP17 signifi- SGLT2. Currently, there is little known about the presence of cantly increases the ability of SGLT2 to transport glucose and SGLT2 in tumors, although it has been shown to be signifi- to bind Pz. It is possible that a low level of endogenously ex- cantly overexpressed in metastatic lesions of liver and lymph pressed MAP17 explains the low Na/glucose cotransport node39 and functionally expressed in pancreatic and prostate activity observed in OK cells after expressing SGLT2 alone. adenocarcinomas.40 Although other explanations involving indirect signalization MAP17 has been shown to bind to the fourth PDZ domain pathways are conceivable, our current working hypothesis is of PDZK1.27 Direct interaction of SGLT2 with MAP17 would that MAP17 activates SGLT2 through direct interaction in the bring the cotransporter into close proximity with other trans- plasma membrane. This hypothesis is consistent with the ob- porters, including NHE3,27 which are known to bind to servation that MARDI, which shares sequence similarities PDZK1.41 A recent paper reported that activating the Na/ with MAP17 only within the two transmembrane domains, glucose cotransporter (presumably SGLT2, which is colocalized can significantly stimulate SGLT2. The stimulatory effects of with NHE3) by adding 5 mM glucose in the lumen of rat prox- MARDI and MAP17 suggest that the interaction with SGLT2 imal tubules can upregulate the Na/HCO3 transport mediated occurs within the membrane plane. Interestingly, the Na/ by NHE3.42 More interestingly, in the total absence of luminal phosphate cotransporter (NaPi-IIa) seems to interact with glucose, addition of luminal Pz produced a clear inhibition of MAP17 in a similar manner since it has been shown to bind NHE3 activity. This unexpected observation could be ex- to intact MAP1718 but not to a truncated version of MAP17 plained if SGLT2/MAP17 and NHE3 are part of a “signaling which lacked the transmembrane domains.19 The putative platform” held together by the scaffolding protein PDZK1.43,44 interaction of MAP17 and SGLT2 within lipid rafts will Future studies will be needed to establish these interactions need to be directly addressed in future studies. within the native environment of a renal proximal tubule. A MAP17 was first identified in 1995 as a protein whose similar interaction may exist in the jejunum, where SGLT1 ac- transcription was upregulated in renal (and other) cancers.20–22 tivity stimulates NHE3 activity by an unknown mechanism in- Believed to form a dimer linked by Cys bridges,11 immuno- volving Akt and NHERF2.45 Although MAP17 is not required for histochemical observation detected MAP17 predominantly in SGLT1 activity (unlike SGLT2), this does not preclude the pos- the apical membranes of renal proximal tubules.9 Screening sibility of a MAP17–SGLT1 interaction. Supporting the idea of an of a cDNA library with the carboxyl half of MAP17, using the interaction of MAP17 with other members of the Na+/glucose yeast two-hybrid procedure, identified strong interaction cotransport family, MAP17 was shown to produce a small but with PDZK1, also known as Na/H exchanger regulatory factor significant increase in SGLT3 activity. In addition, MAP17 and 3(NHERF3).23 PDZK1, with its four PDZ domains, works as a SGLT1 activities appear to be linked in cervical cancers.38 Finally, scaffolding protein and has been shown to interact with a the demonstration of an interaction between MAP17 and NaPi- number of transport proteins including the cystic fibrosis IIa using the two-hybrid system25 shows that MAP17 can interact transmembrane regulator,24 NaPi-IIa,25 the Na proton ex- with an even wider variety of transporters. changer (NHE3),26–30 the organic cation transporter, the In summary, we have presented conclusive evidence that chloride-formate exchanger and the urate-anion ex- MAP17 is required for the normal function of SGLT2in oocytes changer.31 PDZK1 was also shown to interact with several sig- and in mammalian cells. This requirement is confirmed by the naling systems.31,32 Recently, a crystal structure of a protein finding that a mutation in the MAP17 coding gene was found complex revealed the molecular details of a three-partner in- to be associated with a case of familial renal glucosuria, in teraction involving the fourth PDZ domain of PDZK1, an the absence of SGLT2 mutations. This observation establishes A-kinase anchoring protein (D-AKAP2), and its attached PKA.33 the genetic heterogeneity for this human phenotype. The MAP17, through its interaction with PDZK1, has also been interaction between SGLT2 and MAP17 suggests that SGLT2 shown to play a role in trafficking plasma membrane pro- may be working in close proximity with other transporters teins18,19; hepatic overexpression of MAP17 in mice caused with which it can establish a local signaling pathway. As removal of PDZK1 from the plasma membrane along with millions of diabetic patients are going to use SGLT2 inhibitors

90 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 85–93, 2017 www.jasn.org BASIC RESEARCH as a part of their regular treatment, this study suggests that it cDNA with SalI, then mRNAwas prepared using the cleaved DNA and would be important to understand the physiologic effects of the T7 mMessage mMachine kit. SGLT2 inhibition not only on glucose transport but also on other renal transport mechanisms operating nearby. Cell Culture OK cells were cultured in DMEM-F12 media with 10% fetal bovine serum and antibiotics (100 U/ml penicillin and 100 mg/ml strepto-

CONCISE METHODS mycin) in 95% air, 5% CO2. Cells were seeded on 24-well plates and transfected with vectors using Lipofectamine 2000 (Invitrogen) on RNA Preparation 70%–90% confluent monolayers (0.8 mg per well) in accordance with Rat renal RNA was isolated using TriZol reagent (Invitrogen Canada, the manufacturer’s protocol. Experiments were performed after 16– Burlington, ON, Canada) and mRNA was isolated using oligo-dT chro- 24 hours of incubation. matography (Invitrogen), following the manufacturer’sinstructions. AMG Uptake and Pz Binding with Cultured Cells Sucrose Gradient Uptake of radiolabeled AMG and Pz binding was as described earlier48 A 3.6 ml linear 5%–25% sucrose gradient was prepared in 10 mM Tris, using 50 mMAMG+0.5mCi/ml 14C-labeled substrate in Krebs so- 1 mM EDTA pH 8.0 One hundred and fifty micrograms of mRNA lution. All uptakes were performed at 37°C for 10 minutes and were (2 mg/ml) was layered on the gradient and centrifuged for 10 hours 3 stopped by rinsing with ice-cold Krebs (3 3 1 ml/well). Monolayers 150,000 g. Twenty-four 0.15 ml fractions were removed and mRNA were dissolved with 2% SDS in 0.2 N NaOH, scintillation cocktail was recovered by ethanol precipitation. was added, and radioactivity was measured. Binding assays were performed similarly but with 1 mCi/ml 3H-labeled Pz (18 nM) in Oocyte Procedures Krebs solution for 10 minutes at room temperature. Thepreparationandmaintenanceofoocytes, aswellasRNAinjections and electrophysiological measurements, were performed as previously Immunofluorescence described.46 Oocytes were maintained in Barth solution (in mM: Immunofluorescence detection of F7-SGLT2 was performed on 49 90 NaCl, 3 KCl, 0.82 MgSO4,0.74Ca[NO2]2, 10 HEPES, and adjusted confluent OK cells. Twenty-four-well plates were washed with 2+ 2+ to pH 7.5 with Tris). For electrophysiology and uptake experiments, the ice-cold PBS+Ca +Mg (PBS containing 1 mM MgCl2,0.1mM same solution was used but with chloride as the sole anion. CaCl2) then fixed at 4°C for 20 minutes with 4% paraformaldehyde in PBS. Plates were then incubated in 5% BSA in PBS (30 minutes) to Oocyte Uptake Conditions block nonspecific sites, exposed to primary antibody (mouse anti-F7 Uptakes were performed under standard conditions46 where uptake 1/1000; Sigma-Aldrich, St. Louis, MO) for 60 minutes in blocking duration was 2 hours and the uptake solution contained 1 mM man- solution at room temperature, rinsed, blocked again, and incubated nose (to saturate the oocyte high affinity Na/sugar cotransporter), for 60 minutes with secondary antibody (Alexa Fluor 594 conjugated 1 mM galactose (to saturate the renal SGLT1–mediated glucose donkey anti-mouse 1:1000; Santa Cruz Biotechnology, Santa Cruz, uptake), and 50 mM 14C-labeled AMG (American Radiolabeled CA) in the same solution. Plates were washed, then fluorescence was Chemicals, St. Louis, MO). measured using a fluorescence plate reader (Infinite F200 Pro; Tecan). For visualization using an Olympus IX-81 microscope, OK cells were cDNA Library Preparation grown on coverslips and were mounted using an anti-quenching cDNAwas directionally synthesized from size-selected mRNA using the agent (Prolong antifade; Invitrogen). The Image-Pro Plus v.5.0 soft- Zap cDNA synthesis kit (Stratagene, La Jolla, CA) and inserted into ware was used for image deconvolution and Z-stacks. EcoRI, XhoI-cleaved pGem11Zf(+) (Promega, Madison, WI). A library of 15,000 colonies was plated onto nitrocellulose filter-laden Luria- Detecting Surface-Bound Antibodies Bertani agar plates with 600 colonies per filter; the colonies were scraped Confluent monolayers of transfected OK cells in 24-well plates off the filters and plasmids were purified using EZ-10 spin columns were rinsed three times in cold PBS then exposed to the anti-F7 (Bio Basic, Markham, ON). After NotI cleavage, capped mRNA was primary antibody (1:100) in PBS (with 5% BSA) for 1.5 hours at transcribed using the T7 mMessage mMachine kit (Life Technologies, 4°C. Cells were then vigorously washed five times with ice-cold PBS. Carlsbad, CA). Subsequent screenings used plates bearing 100 colonies, Forty microliters of Laemmli buffer was added to each well; cells then single colonies grown in liquid Luria-Bertani medium. were scraped off the plates and sonicated. The homogenates were electrophoresed via SDS-PAGE in 12% polyacrylamide gels, then Vector Construction blotted onto nitrocellulose membranes. Intact Xenopus oocytes were ex- Human SGLT2, MARDI, and MAP17 were obtained by PCR from posed to the primary antibody as explained above but in a Xenopus saline renal cortex cDNA and inserted into the vectors pT7TS and solution. Thirty oocytes were then washed and homogenized in 1 ml of pcDNA3.1(-). Epitope-tagged hSGLT2 received the F7 tag47 upstream Barth solution followed by 5 minutes of centrifugation at 180 g to remove of human SGLT2, i.e., at the extracellular N-terminus of the protein. debris. The supernatant was then centrifuged for 20 minutes at 21,000 g Sequences for the primers used are available upon request. For in vitro to recover cell membranes. The pellet was resuspended in Laemmli transcription, the cDNAs in pT7TS were cleaved downstream of the buffer, applied to a lane of the SDS-PAGE gel, and treated as above.

J Am Soc Nephrol 28: 85–93, 2017 MAP17 activates SGLT2 91 BASIC RESEARCH www.jasn.org

Western blotting was performed as previously described49 except that V, Koepsell H: Expression of Na+-D-glucose cotransporter SGLT2 in only the secondary antibody was used to probe the blot. rodents is kidney-specific and exhibits sex and species differences. Am J Physiol Cell Physiol 302: C1174–C1188, 2012 2. Wells RG, Pajor AM, Kanai Y, Turk E, Wright EM, Hediger MA: Cloning FRG Mutation Analysis of a human kidney cDNA with similarity to the sodium-glucose co- SLC5A2 Of 60 FRG patients investigated, eight showed no mutations transporter. Am J Physiol 263: F459–F465, 1992 and four had mutations on only one allele, despite massive renal 3. Santer R, Kinner M, Schneppenheim R, Hillebrand G, Kemper M, Ehrich glucose excretion. Genomic DNA was extracted from lymphocytes J, Swift P, Skovby F, Schaub J: The molecular basis of renal glucosuria: of these 12 patients. PCR products including single exon and adjacent mutations in the gene for a renal glucose transporter (SGLT2). JInherit intronic segments of PDZK1IP1 (which encodes the MAP17 protein) Metab Dis 23[Suppl 1]: 178, 2000 fi 4. Santer R, Kinner M, Lassen CL, Schneppenheim R, Eggert P, Bald M, were generated with speci c primer pairs (available upon request), Brodehl J, Daschner M, Ehrich JH, Kemper M, Li Volti S, Neuhaus T, fi puri ed and sequenced with an automated ABI Sequencer. Results Skovby F, Swift PG, Schaub J, Klaerke D: Molecular analysis of the were compared with the human PDZK1IP1 Reference Sequence SGLT2 gene in patients with renal glucosuria. JAmSocNephrol14: (NM_005764.3). 2873–2882, 2003 5. Ullman CG, Frigotto L, Cooley RN: In vitro methods for peptide display and their applications. Brief Funct Genomics 10: 125–134, 2011 Cloning of human PDZK1IP1 Gene fi 6. Hummel CS, Lu C, Loo DD, Hirayama BA, Voss AA, Wright EM: Glucose The gene was ampli ed from human genomic DNA with oligonu- transport by human renal Na+/D-glucose cotransporters SGLT1 and cleotides GGGGGAATTCCTAGCTCCTCTCCTCCAGGG and SGLT2. Am J Physiol Cell Physiol 300: C14–C21, 2011 AAAAGGATCCACCTAGACACGGTCTGAGCT, then purified, 7. Wright EM: Renal Na(+)-glucose cotransporters. Am J Physiol Renal cleaved with BamHI and EcoRI, and inserted into pcDNA3.1(-). Physiol 280: F10–F18, 2001 fi The cDNA was sequenced to confirm identity. 8. Ikari A, Suketa Y: Expression of GFP-tagged low af nity Na+-dependent glucose transporter in Xenopus oocytes and CHO cells. Jpn J Physiol 52: 395–398, 2002 Mutating the PDZK1IP1 Gene 9. Kocher O, Cheresh P, Lee SW: Identification and partial characteriza- Overlap extension was performed using oligonucleotides TAATAC- tion of a novel membrane-associated protein (MAP17) up-regulated in GACTCACTATAGGG, AGCACTCATGGCTCCTC, GAGGAGCCAT- human carcinomas and modulating cell replication and tumor growth. GAGTGCT, and TAGAAGGCACAGTCGAGG. The product was Am J Pathol 149: 493–500, 1996 confirmed by sequencing. 10. Hediger MA, Coady MJ, Ikeda TS, Wright EM: Expression cloning and cDNA sequencing of the Na+/glucose co-transporter. Nature 330: 379–381, 1987 Statistical Analyses 11. Blasco T, Aramayona JJ, Alcalde AI, Catalán J, Sarasa M, Sorribas V: Rat All data are expressed as means6SDs. Unless otherwise described, kidney MAP17 induces cotransport of Na-mannose and Na-glucose in statistical analyses employed one-way ANOVAs with Bonferroni Xenopus laevis oocytes. Am J Physiol Renal Physiol 285: F799–F810, post-hoc analysis. 2003 12. Gisler SM, Kittanakom S, Fuster D, Wong V, Bertic M, Radanovic T, Hall RA, Murer H, Biber J, Markovich D, Moe OW, Stagljar I: Monitoring Study Approval protein-protein interactions between the mammalian integral mem- Xenopus laevis All frog manipulations (anesthesia, surgery, and eu- brane transporters and PDZ-interacting partners using a modified split- thanasia of the frogs after the final collection of oocytes) were ubiquitin membrane yeast two-hybrid system. Mol Cell Proteomics 7: performed in accordance with the Canadian guidelines and were ap- 1362–1377, 2008 proved by the ethics committee of the Université de Montréal (CDEA, 13. Santer R, Calado J: Familial renal glucosuria and SGLT2: from a mendelian – protocol #15–042). trait to a therapeutic target. Clin J Am Soc Nephrol 5: 133 141, 2010 14. Finch NA, Linser PJ, Ochrietor JD: Hydrophobic interactions stabilize the basigin-MCT1 complex. Protein J 28: 362– 368, 2009 15. Fernández E, Jiménez-Vidal M, Calvo M, Zorzano A, Tebar F, Palacín M, ACKNOWLEDGMENTS Chillarón J: The structural and functional units of heteromeric amino acid transporters. The heavy subunit rBAT dictates oligomerization of the heteromeric amino acid transporters. J Biol Chem 281: 26552– This work was supported by a Canadian Institute of Health Research 26561, 2006 grant MOP-10580 (J.Y.L.), a Kidney Foundation of Canada grant (J.Y.L.) 16. Verrey F, Singer D, Ramadan T, Vuille-dit-Bille RN, Mariotta L, Camargo – and a grant from Nutricia Metabolics, Erlangen, Germany (R.S.). SM: Kidney amino acid transport. Pflugers Arch 458: 53 60, 2009 17. Lee YJ, Kim MO, Ryu JM, Han HJ: Regulation of SGLT expression and localization through Epac/PKA-dependent caveolin-1 and F-actin activation in renal proximal tubule cells. Biochim Biophys Acta 1823: 971– DISCLOSURES 982, 2012 None. 18. Pribanic S, Gisler SM, Bacic D, Madjdpour C, Hernando N, Sorribas V, Gantenbein A, Biber J, Murer H: Interactions of MAP17 with the NaPi- IIa/PDZK1 protein complex in renal proximal tubular cells. Am J Physiol – REFERENCES Renal Physiol 285: F784 F791, 2003 19. Lanaspa MA, Giral H, Breusegem SY, Halaihel N, Baile G, Catalán J, Carrodeguas JA, Barry NP, Levi M, Sorribas V: Interaction of MAP17 1. Sabolic I, Vrhovac I, Eror DB, Gerasimova M, Rose M, Breljak D, with NHERF3/4 induces translocation of the renal Na/Pi IIa transporter Ljubojevic M, Brzica H, Sebastiani A, Thal SC, Sauvant C, Kipp H, Vallon to the trans-Golgi. Am J Physiol Renal Physiol 292: F230–F242, 2007

92 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 85–93, 2017 www.jasn.org BASIC RESEARCH

20. Kocher O, Cheresh P, Brown LF, Lee SW: Identification of a novel gene, 36. Carnero A: MAP17 and the double-edged sword of ROS. Biochim selectively up-regulated in human carcinomas, using the differential Biophys Acta 1826: 44–52, 2012 display technique. Clin Cancer Res 1: 1209–1215, 1995 37. Guijarro MV, Leal JF, Blanco-Aparicio C, Alonso S, Fominaya J, Lleonart 21. Guijarro MV, Castro ME, Romero L, Moneo V, Carnero A: Large scale M, Castellvi J, Ramon y Cajal S, Carnero A: MAP17 enhances the ma- genetic screen identifies MAP17 as protein bypassing TNF-induced lignant behavior of tumor cells through ROS increase. Carcinogenesis growth arrest. J Cell Biochem 101: 112–121, 2007 28: 2096–2104, 2007 22. Guijarro MV, Link W, Rosado A, Leal JF, Carnero A: MAP17 inhibits 38. Perez M, Praena-Fernandez JM, Felipe-Abrio B, Lopez-Garcia MA, Myc-induced apoptosis through PI3K/AKT pathway activation. Carci- Lucena-Cacace A, Garcia A, Lleonart M, Roncador G, Marin JJ, nogenesis 28: 2443–2450, 2007 Carnero A: MAP17 and SGLT1 protein expression levels as prog- 23. Kocher O, Comella N, Tognazzi K, Brown LF: Identification and partial nostic markers for cervical tumor patient survival. PLoS One 8: characterization of PDZK1: a novel protein containing PDZ interaction e56169, 2013 domains. Lab Invest 78: 117–125, 1998 39. Ishikawa N, Oguri T, Isobe T, Fujitaka K, Kohno N: SGLT gene ex- 24. Lamprecht G, Seidler U: The emerging role of PDZ adapter proteins for pression in primary lung cancers and their metastatic lesions. Jpn J regulation of intestinal ion transport. Am J Physiol Gastrointest Liver Cancer Res 92: 874–879, 2001 Physiol 291: G766–G777, 2006 40. Scafoglio C, Hirayama BA, Kepe V, Liu J, Ghezzi C, Satyamurthy N, 25. Gisler SM, Stagljar I, Traebert M, Bacic D, Biber J, Murer H: Interaction Moatamed NA, Huang J, Koepsell H, Barrio JR, Wright EM: Functional of the type IIa Na/Pi cotransporter with PDZ proteins. JBiolChem276: expression of sodium-glucose transporters in cancer. Proc Natl Acad 9206–9213, 2001 Sci U S A 112: E4111–E4119, 2015 26. Donowitz M, Mohan S, Zhu CX, Chen TE, Lin R, Cha B, Zachos NC, 41.HuS,SongE,TianR,MaS,YangT,MuY,LiY,ShaoC,GaoS,GaoY: Murtazina R, Sarker R, Li X: NHE3 regulatory complexes. J Exp Biol 212: Systematic analysis of a simple adaptor protein PDZK1: ligand identi- 1638–1646, 2009 fication, interaction and functional prediction of complex. Cell Physiol 27. Gisler SM, Pribanic S, Bacic D, Forrer P, Gantenbein A, Sabourin LA, Biochem 24: 231–242, 2009 Tsuji A, Zhao ZS, Manser E, Biber J, Murer H: PDZK1: I. a major scaf- 42. Pessoa TD, Campos LC, Carraro-Lacroix L, Girardi AC, Malnic G: folder in brush borders of proximal tubular cells. Kidney Int 64: 1733– Functional role of glucose metabolism, osmotic stress, and sodium- 1745, 2003 glucose cotransporter isoform-mediated transport on Na+/H+ ex- 28. Seidler U, Singh AK, Cinar A, Chen M, Hillesheim J, Hogema B, changer isoform 3 activity in the renal proximal tubule. JAmSoc Riederer B: The role of the NHERF family of PDZ scaffolding proteins in Nephrol 25: 2028–2039, 2014 the regulation of salt and water transport. Ann N Y Acad Sci 1165: 249– 43. Claperon A, Mergey M, Fouassier L: Roles of the scaffolding proteins 260, 2009 NHERF in liver biology. Clin Res Hepatol Gastroenterol 35: 176–181, 29. Cinar A, Chen M, Riederer B, Bachmann O, Wiemann M, Manns M, 2011 Kocher O, Seidler U: NHE3 inhibition by cAMP and Ca2+ is abolished in 44. Sugiura T, Shimizu T, Kijima A, Minakata S, Kato Y: PDZ adaptors: their PDZ-domain protein PDZK1-deficient murine enterocytes. J Physiol regulation of epithelial transporters and involvement in human dis- 581: 1235–1246, 2007 eases. J Pharm Sci 100: 3620–3635, 2011 30. Zachos NC, Tse M, Donowitz M: Molecular physiology of intestinal Na 45. Lin R, Murtazina R, Cha B, Chakraborty M, Sarker R, Chen TE, Lin Z, +/H+ exchange. Annu Rev Physiol 67: 411–443, 2005 Hogema BM, de Jonge HR, Seidler U, Turner JR, Li X, Kovbasnjuk O, 31. Gisler SM, Madjdpour C, Bacic D, Pribanic S, Taylor SS, Biber J, Murer Donowitz M: D-glucose acts via sodium/glucose cotransporter 1 to H: PDZK1: II. an anchoring site for the PKA-binding protein D-AKAP2 in increase NHE3 in mouse jejunal brush border by a Na+/H+ exchange renal proximal tubular cells. Kidney Int 64: 1746–1754, 2003 regulatory factor 2-dependent process. Gastroenterology 140: 560– 32. Kim H, Abd Elmageed ZY, Davis C, El-Bahrawy AH, Naura AS, Ekaidi I, 571, 2011 Abdel-Mageed AB, Boulares AH: Correlation between PDZK1, Cdc37, 46. Coady MJ, Wallendorff B, Gagnon DG, Lapointe JY: Identification of a Akt and breast cancer malignancy: the role of PDZK1 in cell growth novel Na+/myo-inositol cotransporter. J Biol Chem 277: 35219–35224, through Akt stabilization by increasing and interacting with Cdc37. Mol 2002 Med 20: 270–279, 2014 47. Johnson, KY, Liu, L, Vincent, TS: Minimal FLAG sequence useful in the 33. Sarma GN, Moody IS, Ilouz R, Phan RH, Sankaran B, Hall RA, Taylor SS: functional epitope tagging of H-Ras. Biotechniques 32: 1270–1280, D-AKAP2:PKA RII:PDZK1 ternary complex structure: Insights from the 2002. nucleation of a polyvalent scaffold. Protein Sci 24: 105–116, 2015 48. Bissonnette P, Gagné H, Coady MJ, Benabdallah K, Lapointe JY, 34. Silver DL, Wang N, Vogel S: Identification of small PDZK1-associated Berteloot A: Kinetic separation and characterization of three sugar protein, DD96/MAP17, as a regulator of PDZK1 and plasma high transport modes in Caco-2 cells. Am J Physiol 270: G833–G843, 1996 density lipoprotein levels. JBiolChem278: 28528–28532, 2003 49. Bissonnette P, Noël J, Coady MJ, Lapointe JY: Functional expression of 35. Carnero A: MAP17, a ROS-dependent oncogene. Front Oncol 2: 112, tagged human Na+-glucose cotransporter in Xenopus laevis oocytes. J 2012 Physiol 520: 359–371, 1999

J Am Soc Nephrol 28: 85–93, 2017 MAP17 activates SGLT2 93