Keiichi Kakui In: Schmidt-Rhaesa, A

Bull. Kitakyushu Mus. Nat. Hist. Hum. Hist., Ser. A, 18: 1–4, March 31, 2020 1

First record of a tanaidacean crustacean fed upon by dation in the water column. arboreal life in oribatid mites indicates the primacy of larvae and juveniles in marine soft-bottom communities. an arrow worm (Chaetognatha) ecology. Proceedings of the Royal Society B, 276: Marine Ecology Progress Series, 7: 179–184. 3219–3227. Puitika, T., Kasahara, Y., Miyoshi, N., Sato, Y. and Shimano, ACKNOWLEDGMENTS Müller, C. H. G., Harzsch, S. and Perez, Y. 2018. Chaetognatha. S. 2007. A taxon-specific oligonucleotide primer set for Keiichi Kakui In: Schmidt-Rhaesa, A. (ed.), Miscellaneous Invertebrates, PCR-based detection of soil ciliate. Microbes and I thank Taeko Kimura for providing the specimen used in De Gruyter, Berlin, pp. 163–282. Environments, 22: 78–81. this study; Captain Yoichi Maekawa and the crew of TR/V Nakayama, T., Watanabe, S., Mitsui, K., Uchida, H. and Inoue, Shaffer, P. L. 1979. The feeding biology of Podarke pugettensis Faculty of Science, Hokkaido University, Sapporo 060-0810, Japan. Seisui-maru, and researchers aboard, for support during the I. 1996. The phylogenetic relationship between the (Polychaeta: Hesionidae). Biological Bulletin, 156: E-mail: [email protected] cruise in 2019; Matthew H. Dick for reviewing the manuscript Chlamydomonadales and Chlorococcales inferred from 343–355. and editing the English; and Taichiro Goto and one anonymous 18SrDNA sequence data. Phycological Research, 44: Tomioka, S., Kondoh, T., Sato-Okoshi, W., Ito, K., Kakui, K. (Received May 14, 2019; accepted July 25, 2019) reviewer for critical comments on the manuscript. This study 47–55. and Kajihara, H. 2016. Cosmopolitan or cryptic species? was supported in part by a KAKENHI grant (JP19K06800) Nomura, H., Aihara, K. and Ishimaru, T. 2007. Feeding of A case study of Capitella teleta (Annelida: Capitellidae). from the Japan Society for the Promotion of Science (JSPS). the chaetognath Sagitta crassa Tokioka in heavily Zoological Science, 33: 545–554. ABSTRACT − This paper reports the first observation of a tanaidacean crustacean in the gut of a eutrophicated Tokyo Bay, Japan. Plankton & Benthos Tonnesson, K. and Tiselius, P. 2005. Diet of the chaetognaths chaetognath. The female tanaidacean was identified as Pseudotanais sp. in Pseudotanaidae and the arrow worm Research, 2: 120–127. Sagitta setosa and S. elegans in relation to prey abundance was a member of Sagittidae. The chaetognath was collected with a small plankton net attached inside a larger REFERENCES Oliver, J. S., Oakden, J. M. and Slattery, P. N. 1982. and vertical distribution. Marine Ecology Progress Series, beam trawl. The net included bottom sediments, and female pseudotanaids are generally benthic whereas Phoxocephalid amphipod crustaceans as predators on 289: 177–190. Altschul, S. F., Gish, W., Miller, W., Myers, E. W. and chaetognaths are planktonic, this case of predation thus may have been the result of cod-end feeding in the net. Lipman, D. J. 1990. Basic local alignment search tool. KEY WORDS: arrow worm, gut content, benthos, predator, prey, food web Journal of Molecular Biology, 215: 403–410. RESULTS AND DISCUSSION Błażewicz-Paszkowycz, M., Jenning, R. M., Jeskulke, K. and Brix, S. 2014. Discovery of swimming males of The tanaidacean in the chaetognath gut (Fig. 1) was very Paratanaoidea (Tanaidacea). Polish Polar Research, 35: INTRODUCTION MATERIALS AND METHODS fragile, and most of its appendages were broken or lost during 415–453. dissection, but I observed that it has 1) a ring-shaped pereonite Feigenbaum, D. L. and Maris, R. C. 1984. Feeding in the Tanaidaceans are typically benthic, free-living crusta- The chaetognath was collected on 23 April 2019 during 1 (p1 in Fig. 1); 2) the maxillipedal endites partly fused; 3) a Chaetognatha. Oceanography and Marine Biology, An ceans; most are small, up to a few millimeters long. They are the cruise 1903 by TR/V Seisui-maru, at Station 3B in Tanabe ventrodistal blade-like seta on a pereopod (not pereopod 1, but Annual Review, 22: 343–392. highly abundant in shallow-water and deep-sea bottom habi- Bay (33°32.66'N 135°7.2'E to 33°33.67'N 135°6.07'E; 646–752 one of pereopods 2–6); 4) a chelipedal fixed finger with one Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. tats, and play an important role in ecosystems (Larsen et al., m depth), in one of two small plankton nets attached inside a ventral simple seta; and 5) a developing oostegite (part of the 1994. DNA primers for amplification of mitochondrial 2015). Species in various animal groups have been reported as larger beam trawl; the sample from Station 3B contained many brood pouch). Although identification to species was not cytochrome c oxidase subunit I from diverse metazoan their consumers, including crustaceans, polychaetes, sea anem- other chaetognaths and tanaidaceans. The specimen was possible, these features allowed identification of the female invertebrates. Molecular Marine Biology and Biotechnology, ones, wading birds, and fishes (Shaffer, 1979; Oliver et al., photographed and then fixed and preserved in 80% ethanol. individual as Pseudotanais sp., in the family Pseudotanaidae. I 3: 294–299. 1982; Larsen, 2005). The tanaidacean was extracted from the gut of the chaetognath morphologically identified the chaetognath specimen as Heard, R. W. and Anderson, G. 2009. Tanaidacea (Crustacea) Planktonic arrow worms (phylum Chaetognatha) are by using sharpened needles, mounted on a glass slide in belonging to the family Sagittidae, one of planktonic families of the Gulf of Mexico. In: Felder, D. L. and Camp, D. K. strictly carnivorous and occupy an important position in the glycerin, and observed with an Olympus BX51 microscope. (Müller et al., 2018); this was supported by the BLAST result (eds.), Gulf of Mexico Origin, Waters, and Biota, Volume marine food web (Feigenbaum and Maris, 1984). As predators, The chaetognath and tanaidacean were subsequently deposited of its 18S sequence (1620 nt long; INSD accession number 1, Biodiversity, Texas A&M University Press, College they consume mainly copepods but are not copepod specialists, in the Kitakyushu Museum of Natural History & Human LC494513) which determined a sagittid sequence in INSD as Station, pp. 987–1000. and various other organisms have also been reported from their History (KMNH IvR 600,001 and 600,002, respectively). the most similar to the present sequence (the COI sequence Kehayias, G., Lykakis, J. and Fragopoulu, N. 1996. The diets gut contents, including chaetognaths, polychaete larvae, roti- The tanaidacean was in too poor condition to obtain tissue could not be amplified). of the chaetognaths Sagitta enflata, S. serratodentata fers, cladocerans, cirripedian nauplii, ostracods, amphipods, for DNA extraction. Total DNA was extracted from a piece of The chaetognath I observed was collected in one of two atlantica and S. bipunctata at different seasons in Eastern decapod larvae, euphausiids, appendicularians, echinoderm the chaetognath’s body muscle by using a NucleoSpin Tissue small plankton nets attached inside a larger beam trawl. Both Mediterranean coastal waters. ICES Journal of Marine larvae, ciliates, diatoms, dinoflagellates, infusorians, and fish XS kit (TaKaRa Bio, Japan). Attempts were made to amplify nets had picked up bottom sediments (Fig. 2). As female Science, 53: 837–846. larvae and postlarvae (e.g., Feigenbaum and Maris, 1984; part of the cytochrome c oxidase subunit I (COI) and 18S pseudotanaids are typically benthic tube-dwellers (Heard and Larsen, K. 2005. Deep-sea Tanaidacea (Peracarida) from the Kehayias et al., 1996; Tonnesson and Tiselius, 2005; Nomura rRNA (18S) genes by PCR using the primers listed in Table 1. Anderson, 2009), whereas sagittid chaetognaths are planktonic, Gulf of Mexico. Brill, Leiden. et al., 2007). PCR amplification conditions for COI with TaKaRa Ex Taq this case of chaetognath predation on a tanaidacean may have Larsen, K., Guţu, M. and Sieg, J. 2015. Order Tanaidacea Dana, During a cruise of the TR/V Seisui-maru (Mie University, DNA polymerase (TaKaRa Bio) were 94°C for 1 min; 35 cycles resulted from cod-end feeding in the net. 1849. In: Vaupel Klein, J. C. von, Charmantier-Daures, M. Japan) in 2019, one chaetognath individual containing a of 98°C for 10 sec, 50°C for 30 sec, and 72°C for 50 sec; and 72°C Although chaetognaths are probably uncommon preda- and Schram, F. R. (eds.), The Crustacea. Revised and tanaidacean in its gut was collected. As tanaidaceans had not for 2 min. Conditions for 18S amplification with KOD FX Neo tors on tanaidaceans as they usually occupy different oceanic Updated, as well as Extended from the Traité de Zoologie been previously noted among chaetognath prey items, I report polymerase (Toyobo, Japan) were 94°C for 2 min; 45 cycles of were as described by Tomioka et al. (2016). The nucleotide of Japan (DDBJ). BLAST searches (Altschul et al., 1990) zones, species in several tanaidacean families produce 5, Brill, Leiden, pp. 249–329. this observation here. 98°C for 10 sec, 65°C for 30 sec, and 68°C for 1 min; and 68°C sequence obtained was deposited in the International Nucle- were used to determine the nucleotide sequences in the INSD non-benthic, swimming males (Błażewicz-Paszkowycz et al., Maraun, M., Erdmann, G., Schulz, G., Norton, R. A., Scheu, S. for 2 min. Methods for sequencing and sequence assembly otide Sequence Database (INSD) through the DNA Data Bank most similar to the sequence obtained. 2014), and these males would be exposed to chaetognath pre- and Domes, K. 2009. Multiple convergent evolution of 2 Keiichi Kakui First record of a tanaidacean crustacean fed upon by an arrow worm (Chaetognatha) 3

Table 1. List of PCR and cycle sequencing (CS) primers used in this study. dation in the water column. arboreal life in oribatid mites indicates the primacy of larvae and juveniles in marine soft-bottom communities. ecology. Proceedings of the Royal Society B, 276: Marine Ecology Progress Series, 7: 179–184. Marker Primer Sequence Reaction Source 3219–3227. Puitika, T., Kasahara, Y., Miyoshi, N., Sato, Y. and Shimano, COI LCO1490 GGTCAACAAATCATAAAGATATTGG PCR & CS Folmer et al. (1994) Müller, C. H. G., Harzsch, S. and Perez, Y. 2018. Chaetognatha. S. 2007. A taxon-specific oligonucleotide primer set for HCO2198 TAAACTTCAGGGTGACCAAAAAATCA PCR & CS Folmer et al. (1994) ACKNOWLEDGMENTS In: Schmidt-Rhaesa, A. (ed.), Miscellaneous Invertebrates, PCR-based detection of soil ciliate. Microbes and 18S SR1 TACCTGGTTGATCCTGCCAG PCR Nakayama et al. (1996) I thank Taeko Kimura for providing the specimen used in De Gruyter, Berlin, pp. 163–282. Environments, 22: 78–81. SR8 GGATTGACAGATTGAGAGCT CS Nakayama et al. (1996) this study; Captain Yoichi Maekawa and the crew of TR/V Nakayama, T., Watanabe, S., Mitsui, K., Uchida, H. and Inoue, Shaffer, P. L. 1979. The feeding biology of Podarke pugettensis SR9 AACTAAGAACGGCCATGCAC CS Nakayama et al. (1996) Seisui-maru, and researchers aboard, for support during the I. 1996. The phylogenetic relationship between the (Polychaeta: Hesionidae). Biological Bulletin, 156: SR10 AGGTCTGTGATGCCCTTAGA CS Nakayama et al. (1996) cruise in 2019; Matthew H. Dick for reviewing the manuscript Chlamydomonadales and Chlorococcales inferred from 343–355. SR12 CCTTCCGCAGGTTCACCTAC PCR & CS Nakayama et al. (1996) and editing the English; and Taichiro Goto and one anonymous 18SrDNA sequence data. Phycological Research, 44: Tomioka, S., Kondoh, T., Sato-Okoshi, W., Ito, K., Kakui, K. EU929R TTGGCAAATGCTTTCGC CS Puitika et al. (2007) reviewer for critical comments on the manuscript. This study 47–55. and Kajihara, H. 2016. Cosmopolitan or cryptic species? 18S554f AAGTCTGGTGCCAGCAGCGCG CS Maraun et al. (2009) was supported in part by a KAKENHI grant (JP19K06800) Nomura, H., Aihara, K. and Ishimaru, T. 2007. Feeding of A case study of Capitella teleta (Annelida: Capitellidae). 18S614r* TCCAACTACGAGCTTTTTAACC CS Maraun et al. (2009) from the Japan Society for the Promotion of Science (JSPS). the chaetognath Sagitta crassa Tokioka in heavily Zoological Science, 33: 545–554. *The nucleotide sequence determined using this sequencing primer contained many unreadable sites and was not used. eutrophicated Tokyo Bay, Japan. Plankton & Benthos Tonnesson, K. and Tiselius, P. 2005. Diet of the chaetognaths Research, 2: 120–127. Sagitta setosa and S. elegans in relation to prey abundance Fig. 2. Two small plankton nets detached from a larger beam Oliver, J. S., Oakden, J. M. and Slattery, P. N. 1982. and vertical distribution. Marine Ecology Progress Series, trawl just after sampling at Station 3B, where the REFERENCES Phoxocephalid amphipod crustaceans as predators on 289: 177–190. chaetognath was collected. Both nets contain muddy Altschul, S. F., Gish, W., Miller, W., Myers, E. W. and bottom sediment. Lipman, D. J. 1990. Basic local alignment search tool. Journal of Molecular Biology, 215: 403–410. RESULTS AND DISCUSSION Błażewicz-Paszkowycz, M., Jenning, R. M., Jeskulke, K. and Brix, S. 2014. Discovery of swimming males of The tanaidacean in the chaetognath gut (Fig. 1) was very Paratanaoidea (Tanaidacea). Polish Polar Research, 35: INTRODUCTION MATERIALS AND METHODS fragile, and most of its appendages were broken or lost during 415–453. dissection, but I observed that it has 1) a ring-shaped pereonite Feigenbaum, D. L. and Maris, R. C. 1984. Feeding in the Tanaidaceans are typically benthic, free-living crusta- The chaetognath was collected on 23 April 2019 during 1 (p1 in Fig. 1); 2) the maxillipedal endites partly fused; 3) a Chaetognatha. Oceanography and Marine Biology, An ceans; most are small, up to a few millimeters long. They are the cruise 1903 by TR/V Seisui-maru, at Station 3B in Tanabe ventrodistal blade-like seta on a pereopod (not pereopod 1, but Annual Review, 22: 343–392. highly abundant in shallow-water and deep-sea bottom habi- Bay (33°32.66'N 135°7.2'E to 33°33.67'N 135°6.07'E; 646–752 one of pereopods 2–6); 4) a chelipedal fixed finger with one Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. tats, and play an important role in ecosystems (Larsen et al., m depth), in one of two small plankton nets attached inside a ventral simple seta; and 5) a developing oostegite (part of the 1994. DNA primers for amplification of mitochondrial 2015). Species in various animal groups have been reported as larger beam trawl; the sample from Station 3B contained many brood pouch). Although identification to species was not cytochrome c oxidase subunit I from diverse metazoan their consumers, including crustaceans, polychaetes, sea anem- other chaetognaths and tanaidaceans. The specimen was possible, these features allowed identification of the female invertebrates. Molecular Marine Biology and Biotechnology, ones, wading birds, and fishes (Shaffer, 1979; Oliver et al., photographed and then fixed and preserved in 80% ethanol. individual as Pseudotanais sp., in the family Pseudotanaidae. I 3: 294–299. 1982; Larsen, 2005). The tanaidacean was extracted from the gut of the chaetognath morphologically identified the chaetognath specimen as Heard, R. W. and Anderson, G. 2009. Tanaidacea (Crustacea) Planktonic arrow worms (phylum Chaetognatha) are by using sharpened needles, mounted on a glass slide in belonging to the family Sagittidae, one of planktonic families of the Gulf of Mexico. In: Felder, D. L. and Camp, D. K. strictly carnivorous and occupy an important position in the glycerin, and observed with an Olympus BX51 microscope. (Müller et al., 2018); this was supported by the BLAST result (eds.), Gulf of Mexico Origin, Waters, and Biota, Volume marine food web (Feigenbaum and Maris, 1984). As predators, The chaetognath and tanaidacean were subsequently deposited of its 18S sequence (1620 nt long; INSD accession number 1, Biodiversity, Texas A&M University Press, College they consume mainly copepods but are not copepod specialists, in the Kitakyushu Museum of Natural History & Human LC494513) which determined a sagittid sequence in INSD as Station, pp. 987–1000. and various other organisms have also been reported from their History (KMNH IvR 600,001 and 600,002, respectively). the most similar to the present sequence (the COI sequence Kehayias, G., Lykakis, J. and Fragopoulu, N. 1996. The diets gut contents, including chaetognaths, polychaete larvae, roti- The tanaidacean was in too poor condition to obtain tissue could not be amplified). of the chaetognaths Sagitta enflata, S. serratodentata fers, cladocerans, cirripedian nauplii, ostracods, amphipods, for DNA extraction. Total DNA was extracted from a piece of The chaetognath I observed was collected in one of two atlantica and S. bipunctata at different seasons in Eastern decapod larvae, euphausiids, appendicularians, echinoderm the chaetognath’s body muscle by using a NucleoSpin Tissue small plankton nets attached inside a larger beam trawl. Both Mediterranean coastal waters. ICES Journal of Marine larvae, ciliates, diatoms, dinoflagellates, infusorians, and fish XS kit (TaKaRa Bio, Japan). Attempts were made to amplify nets had picked up bottom sediments (Fig. 2). As female Science, 53: 837–846. larvae and postlarvae (e.g., Feigenbaum and Maris, 1984; part of the cytochrome c oxidase subunit I (COI) and 18S pseudotanaids are typically benthic tube-dwellers (Heard and Larsen, K. 2005. Deep-sea Tanaidacea (Peracarida) from the Kehayias et al., 1996; Tonnesson and Tiselius, 2005; Nomura rRNA (18S) genes by PCR using the primers listed in Table 1. Anderson, 2009), whereas sagittid chaetognaths are planktonic, Gulf of Mexico. Brill, Leiden. et al., 2007). PCR amplification conditions for COI with TaKaRa Ex Taq this case of chaetognath predation on a tanaidacean may have Larsen, K., Guţu, M. and Sieg, J. 2015. Order Tanaidacea Dana, Fig. 1. Chaetognath predation on a tanaidacean, fresh specimen. A, Chaetognath (dorsal view), with a tanaidacean (left view) in the During a cruise of the TR/V Seisui-maru (Mie University, DNA polymerase (TaKaRa Bio) were 94°C for 1 min; 35 cycles resulted from cod-end feeding in the net. 1849. In: Vaupel Klein, J. C. von, Charmantier-Daures, M. gut; B, enlargement of the tanaidacean. p1, pereonite 1 (ring shaped). Scale bars: 1 mm. Japan) in 2019, one chaetognath individual containing a of 98°C for 10 sec, 50°C for 30 sec, and 72°C for 50 sec; and 72°C Although chaetognaths are probably uncommon preda- and Schram, F. R. (eds.), The Crustacea. Revised and tanaidacean in its gut was collected. As tanaidaceans had not for 2 min. Conditions for 18S amplification with KOD FX Neo tors on tanaidaceans as they usually occupy different oceanic Updated, as well as Extended from the Traité de Zoologie been previously noted among chaetognath prey items, I report polymerase (Toyobo, Japan) were 94°C for 2 min; 45 cycles of were as described by Tomioka et al. (2016). The nucleotide of Japan (DDBJ). BLAST searches (Altschul et al., 1990) zones, species in several tanaidacean families produce 5, Brill, Leiden, pp. 249–329. this observation here. 98°C for 10 sec, 65°C for 30 sec, and 68°C for 1 min; and 68°C sequence obtained was deposited in the International Nucle- were used to determine the nucleotide sequences in the INSD non-benthic, swimming males (Błażewicz-Paszkowycz et al., Maraun, M., Erdmann, G., Schulz, G., Norton, R. A., Scheu, S. for 2 min. Methods for sequencing and sequence assembly otide Sequence Database (INSD) through the DNA Data Bank most similar to the sequence obtained. 2014), and these males would be exposed to chaetognath pre- and Domes, K. 2009. Multiple convergent evolution of 4 Keiichi Kakui Bull. Kitakyushu Mus. Nat. Hist. Hum. Hist., Ser. A, 18: 5–42, March 31, 2020 5 dation in the water column. arboreal life in oribatid mites indicates the primacy of larvae and juveniles in marine soft-bottom communities. List of the Adoliadini (Lepidoptera, Nymphalidae) ecology. Proceedings of the Royal Society B, 276: Marine Ecology Progress Series, 7: 179–184. of the Philippine Islands (Part 1) 3219–3227. Puitika, T., Kasahara, Y., Miyoshi, N., Sato, Y. and Shimano, ACKNOWLEDGMENTS Müller, C. H. G., Harzsch, S. and Perez, Y. 2018. Chaetognatha. S. 2007. A taxon-specific oligonucleotide primer set for In: Schmidt-Rhaesa, A. (ed.), Miscellaneous Invertebrates, PCR-based detection of soil ciliate. Microbes and Takashi Yokochi1 and Fidel Bendanillo2 I thank Taeko Kimura for providing the specimen used in De Gruyter, Berlin, pp. 163–282. Environments, 22: 78–81. this study; Captain Yoichi Maekawa and the crew of TR/V Nakayama, T., Watanabe, S., Mitsui, K., Uchida, H. and Inoue, Shaffer, P. L. 1979. The feeding biology of Podarke pugettensis Seisui-maru, and researchers aboard, for support during the I. 1996. The phylogenetic relationship between the (Polychaeta: Hesionidae). Biological Bulletin, 156: 1 Asian Insects Research Society (AIRS). 1-10-26, Shonan, Owariasahi, Aichi, 488-0823, Japan. cruise in 2019; Matthew H. Dick for reviewing the manuscript Chlamydomonadales and Chlorococcales inferred from 343–355. E-mail: [email protected] 2 and editing the English; and Taichiro Goto and one anonymous 18SrDNA sequence data. Phycological Research, 44: Tomioka, S., Kondoh, T., Sato-Okoshi, W., Ito, K., Kakui, K. University of San Carlos Biological Museum. Learning Resource Center, reviewer for critical comments on the manuscript. This study 47–55. and Kajihara, H. 2016. Cosmopolitan or cryptic species? Josef Baumgartner Bldg. Talamban Campus, Cebu, Republic of Philippines. E-mail: [email protected] was supported in part by a KAKENHI grant (JP19K06800) Nomura, H., Aihara, K. and Ishimaru, T. 2007. Feeding of A case study of Capitella teleta (Annelida: Capitellidae). from the Japan Society for the Promotion of Science (JSPS). the chaetognath Sagitta crassa Tokioka in heavily Zoological Science, 33: 545–554. eutrophicated Tokyo Bay, Japan. Plankton & Benthos Tonnesson, K. and Tiselius, P. 2005. Diet of the chaetognaths (Received June 30, 2019; accepted September 6, 2019) Research, 2: 120–127. Sagitta setosa and S. elegans in relation to prey abundance REFERENCES Oliver, J. S., Oakden, J. M. and Slattery, P. N. 1982. and vertical distribution. Marine Ecology Progress Series, ABSTRACT − The type-specimens of one-hundred and twenty taxa of the tribe Adoliadini from Philippines Phoxocephalid amphipod crustaceans as predators on 289: 177–190. are examined and the classification of species-subspecies relations is revised. With information of the type Altschul, S. F., Gish, W., Miller, W., Myers, E. W. and locality and the current repository of the type or syntypes all of the taxonomic names are shown alphabetically in Lipman, D. J. 1990. Basic local alignment search tool. part 1. The annotated synonymic list is present in part 2. Journal of Molecular Biology, 215: 403–410. RESULTS AND DISCUSSION Błażewicz-Paszkowycz, M., Jenning, R. M., Jeskulke, K. and Brix, S. 2014. Discovery of swimming males of KEY WORDS: Lepidoptera, Rhopalocera, Nymphalidae, Adoliadini, Philippines, Bassarona, Cynthia, Dophla, The tanaidacean in the chaetognath gut (Fig. 1) was very Paratanaoidea (Tanaidacea). Polish Polar Research, 35: Euthalia, Lexias, Tanaecia, aconthea, adonia, albusequus, alpheda, amlana, anosia, antiquea, aquamarina, aruna, INTRODUCTION MATERIALS AND METHODS fragile, and most of its appendages were broken or lost during 415–453. balabacana, balabacensis, boholensis, bongaoensis, borromeoi, cabigoni, calliphorus, candida, canescens, dissection, but I observed that it has 1) a ring-shaped pereonite Feigenbaum, D. L. and Maris, R. C. 1984. Feeding in the cavarna, chloe, circe, cocytina, cocytus, cusama, dacasini, damalis, darani, dhayma, dinagatensis, dinorah, dirtea, Tanaidaceans are typically benthic, free-living crusta- The chaetognath was collected on 23 April 2019 during 1 (p1 in Fig. 1); 2) the maxillipedal endites partly fused; 3) a Chaetognatha. Oceanography and Marine Biology, An djata, dodong, dohertyi, dumaranensis, dunya, ellora, eson, eva, evelina, exul, felicitacionae, gahiti, galoa, ceans; most are small, up to a few millimeters long. They are the cruise 1903 by TR/V Seisui-maru, at Station 3B in Tanabe ventrodistal blade-like seta on a pereopod (not pereopod 1, but Annual Review, 22: 343–392. garuda, godartii, goertzi, hikarugenzi, hinunanganensis, hiwaga, howarthi, imperator, ingae, irauana, jama, highly abundant in shallow-water and deep-sea bottom habi- Bay (33°32.66'N 135°7.2'E to 33°33.67'N 135°6.07'E; 646–752 one of pereopods 2–6); 4) a chelipedal fixed finger with one Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. joloana, kayumanggia, kulaya, laetitiae, leopardina, leucotaenia, leytana, leytensis, liaoi, lubentina, ludonia, tats, and play an important role in ecosystems (Larsen et al., m depth), in one of two small plankton nets attached inside a ventral simple seta; and 5) a developing oostegite (part of the 1994. DNA primers for amplification of mitochondrial 2015). Species in various animal groups have been reported as larger beam trawl; the sample from Station 3B contained many brood pouch). Although identification to species was not cytochrome c oxidase subunit I from diverse metazoan lupina, lusiada, macer, mahadeva, malissia, marinduque, medaga, merta, mindanaensis, mindorana, mindorensis, their consumers, including crustaceans, polychaetes, sea anem- other chaetognaths and tanaidaceans. The specimen was possible, these features allowed identification of the female invertebrates. Molecular Marine Biology and Biotechnology, miscus, monara, monina, nadenya, negrosiana, nirodha, obatrata, ormocana, ornata, palawana, pallida, ones, wading birds, and fishes (Shaffer, 1979; Oliver et al., photographed and then fixed and preserved in 80% ethanol. individual as Pseudotanais sp., in the family Pseudotanaidae. I 3: 294–299. panayana, panopus, pardalis, pelea, phelada, philippensis, phlegethon, pinamalayana, piratica, placida, princesa, 1982; Larsen, 2005). The tanaidacean was extracted from the gut of the chaetognath morphologically identified the chaetognath specimen as Heard, R. W. and Anderson, G. 2009. Tanaidacea (Crustacea) proditrix, producta, ramada, rhamases, rodriguezi, romeo, rudraca, saidja, samarensis, sarmana, satrapes, Planktonic arrow worms (phylum Chaetognatha) are by using sharpened needles, mounted on a glass slide in belonging to the family Sagittidae, one of planktonic families of the Gulf of Mexico. In: Felder, D. L. and Camp, D. K. schoenigi, semperi, senilis, sibutana, sibuyana, smaragdifera, soloni, soregina, subpiratica, suluana, susoni, strictly carnivorous and occupy an important position in the glycerin, and observed with an Olympus BX51 microscope. (Müller et al., 2018); this was supported by the BLAST result (eds.), Gulf of Mexico Origin, Waters, and Biota, Volume tanagra, tawitawia, tethys, teuta, trapesa, treadawayi, tsukada, tyawena, uposatha, virginalis, visayana, vistrica, marine food web (Feigenbaum and Maris, 1984). As predators, The chaetognath and tanaidacean were subsequently deposited of its 18S sequence (1620 nt long; INSD accession number 1, Biodiversity, Texas A&M University Press, College volupia, waltraudae, yoshiroui, yui, holotype, paratype, syntype, lectotype, homonym, synonym, taxonomy. they consume mainly copepods but are not copepod specialists, in the Kitakyushu Museum of Natural History & Human LC494513) which determined a sagittid sequence in INSD as Station, pp. 987–1000. and various other organisms have also been reported from their History (KMNH IvR 600,001 and 600,002, respectively). the most similar to the present sequence (the COI sequence Kehayias, G., Lykakis, J. and Fragopoulu, N. 1996. The diets gut contents, including chaetognaths, polychaete larvae, roti- The tanaidacean was in too poor condition to obtain tissue could not be amplified). of the chaetognaths Sagitta enflata, S. serratodentata fers, cladocerans, cirripedian nauplii, ostracods, amphipods, for DNA extraction. Total DNA was extracted from a piece of The chaetognath I observed was collected in one of two atlantica and S. bipunctata at different seasons in Eastern INDEX decapod larvae, euphausiids, appendicularians, echinoderm the chaetognath’s body muscle by using a NucleoSpin Tissue small plankton nets attached inside a larger beam trawl. Both Mediterranean coastal waters. ICES Journal of Marine larvae, ciliates, diatoms, dinoflagellates, infusorians, and fish XS kit (TaKaRa Bio, Japan). Attempts were made to amplify nets had picked up bottom sediments (Fig. 2). As female Science, 53: 837–846. (PART 1) larvae and postlarvae (e.g., Feigenbaum and Maris, 1984; part of the cytochrome c oxidase subunit I (COI) and 18S pseudotanaids are typically benthic tube-dwellers (Heard and Larsen, K. 2005. Deep-sea Tanaidacea (Peracarida) from the 1. INTRODUCTION Kehayias et al., 1996; Tonnesson and Tiselius, 2005; Nomura rRNA (18S) genes by PCR using the primers listed in Table 1. Anderson, 2009), whereas sagittid chaetognaths are planktonic, Gulf of Mexico. Brill, Leiden. 2. ABBREVIATIONS et al., 2007). PCR amplification conditions for COI with TaKaRa Ex Taq this case of chaetognath predation on a tanaidacean may have Larsen, K., Guţu, M. and Sieg, J. 2015. Order Tanaidacea Dana, 3. LIST OF DESCRIBED SPECIES AND SUBSPECIES NAME During a cruise of the TR/V Seisui-maru (Mie University, DNA polymerase (TaKaRa Bio) were 94°C for 1 min; 35 cycles resulted from cod-end feeding in the net. 1849. In: Vaupel Klein, J. C. von, Charmantier-Daures, M. Japan) in 2019, one chaetognath individual containing a of 98°C for 10 sec, 50°C for 30 sec, and 72°C for 50 sec; and 72°C Although chaetognaths are probably uncommon preda- and Schram, F. R. (eds.), The Crustacea. Revised and (PART 2) tanaidacean in its gut was collected. As tanaidaceans had not for 2 min. Conditions for 18S amplification with KOD FX Neo tors on tanaidaceans as they usually occupy different oceanic Updated, as well as Extended from the Traité de Zoologie 4. DESCRIPTIONS OF SPECIES AND SUBSPECIES been previously noted among chaetognath prey items, I report polymerase (Toyobo, Japan) were 94°C for 2 min; 45 cycles of were as described by Tomioka et al. (2016). The nucleotide of Japan (DDBJ). BLAST searches (Altschul et al., 1990) zones, species in several tanaidacean families produce 5, Brill, Leiden, pp. 249–329. 5. DISCUSSION this observation here. 98°C for 10 sec, 65°C for 30 sec, and 68°C for 1 min; and 68°C sequence obtained was deposited in the International Nucle- were used to determine the nucleotide sequences in the INSD non-benthic, swimming males (Błażewicz-Paszkowycz et al., Maraun, M., Erdmann, G., Schulz, G., Norton, R. A., Scheu, S. 6. ACKNOWLEDGMENTS for 2 min. Methods for sequencing and sequence assembly otide Sequence Database (INSD) through the DNA Data Bank most similar to the sequence obtained. 2014), and these males would be exposed to chaetognath pre- and Domes, K. 2009. Multiple convergent evolution of 7. REFERENCES