DOCSLIB.ORG

Supporting Online Material For

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supporting Online Material For www.sciencemag.org/cgi/content/full/317/5842/1220/DC1 Supporting Online Material for A MicroRNA Feedback Circuit in Midbrain Dopamine Neurons Jongpil Kim, Keiichi Inoue, Jennifer Ishii, William B. Vanti, Sergey V. Voronov, Elizabeth Murchison, Gregory Hannon, Asa Abeliovich* *To whom correspondence should be addressed. E-mail: [email protected] Published 31 August, Science 317, 1220 (2007) DOI: 10.1126/science.1140481 This PDF file includes: Materials and Methods Figs. S1 to S6 Tables S1 to S3 References Supplementary Online Materials (1) Methods Generation of Dicer conditional knockout ES cells ES cells homozygous for a floxed allele of Dicer were derived from blastocysts generated by crossing mice homozygous for the Dicer floxed allele (1). Establishment of ES cell lines from blastocysts was performed as described (2). Genotyping of Dicerflox/flox and DAT-Cre alleles was carried out by PCR. ES cells carrying a conditional floxed allele of Dicer (1) were infected with CRE or GFP lentivirus to generate Dicer knockout ES cells at the stage 4 as described (2). Genomic DNA was extracted from stage 5 ES cells and CRE Infected cells were genotyped by using the following PCR primer pairs: for 23F (ATTGTTACCAGCGCT TAGAATTCC); 458F (TCGGAATAGGAACTTCGTTTAA AC), and 460R (GTACGTCTACAATTGTCTATG). Quantitative real time RT-PCR For quantitative real-time RT-PCR of miRNAs, total RNA from human brain and mouse brain were prepared with the mirVana miRNA Isolation Kit (Ambion). 0.5ug RNAs was used for the reverse transcription by using SuperScript II RTase (Invitrogen). Quantitative real-time rtPCR was performed using the qRT-PCR detection kit with precursor miRNA-specific primers. PCRs were optimized to determine the linear amplification range by using a Stratagene MX3000P system with QuantiTect PCR mix (Qiagen). The qPCR used a β-actin control and a standard curve. For the confirmation of the real time PCR result, Northern blot analysis for candidate miRNAs was performed with human and mouse brain RNA. Primers for precursors were designed based on the miRBase database (http://microrna.sanger.ac.uk/sequences/) using the OligoPerfect Designer software (Invitrogen). Primers for miR133b is 5'- TGGTCAAACGGAACCAAGTC-3'(F), 5'-TTGCCAGCCCTGCTGTAG-3'(R, mus), 5'- TCTCCAAGGACTGGGCATT-3'(R, human). Samples were controlled for β-actin using the following primers: 5'-GCTACAGCTTCACCACCACA-3'(F, mus), 5'- TCTCCAGGGAGGAAGAGGAT-3'(R, mus), 5'-CTCTTCCAGCCTTCCTTCCT-3'(F, human), 5’-AGCACTGTGTGTTGGCGTACAG-3'(R, human). Patient information for RNA samples: Control Brain 1: Age: 89 years; Gender: male; Samples: mesencephalon, frontal cortex, cerebellum; Diagnosis: usual aging. Control Brain 2: Age: 89 years; Gender: female; Samples: mesencephalon, frontal cortex, cerebellum; Diagnosis: usual aging. Control Brain 3: Age: 63 years; Gender: male; Samples: frontal cortex; Diagnosis: cardiac arrest. Control Brain 4: Age: 86 years; Gender: male; Samples: Substantia nigra; Diagnosis: Congestive Heart failure. Control Brain 5: Age: 68 years; Gender: male; Samples: Cerebellum; Diagnosis: Coronary Atherosclerosis Parkinson disease Brain 1: Age: 77 years; Gender: male; Samples: Cerebral cortex, Mesencephalon, Cerebellum; Diagnosis: Diffuse Lewy body disease, limbic or transitional type (Parkinson disease –dementia). Parkinson disease Brain 2: Age: 73 years; Gender: male; Samples: Cerebral cortex, Mesencephalon, Cerebellum; diagnosis: Lewy body disease, limbic or transitional type (Parkinson disease –dementia). Parkinson disease Brain 3: Age: 60 years; Gender: male; Samples: prefrontal cortex, mesencephalon, Cerebellum; Diagnosis: Parkinson disease; cause of death: gunshot wound. RNA transfection For rescue experiments, small RNAs(<200bp) and large RNA(>200bp) were separately isolated with the mirVana RNA extraction kit (Ambion). After vCRE infection in mouse ES cell derived dopamine neurons at stage 4, total RNAs were transfected at the end of stage 4 using an RNA transfection kit (TransMessenger Transfection Reagent, Qiagen) according to the manufacturer’s instructions. TUNEL assay Cryostat frozen sections (10 micrometer) embedded in OCT were prepared from control and mutant mouse brain. The TUNEL assay was performed using the ApopTag Plus In Situ Apoptosis Fluorescein Detection Kit (Chemicon) according to the manufacturer’s instructions. Mouse behavior For open field test, 2 month-old male Dat-Cre: Dicer fl/+ and Dat-Cre: Dicer fl/fl mice were used (n = 4 for each group). Activity was monitored over 30 min by beam interruption (10 bins, 3 min per bin) in the novel environment of 17.0” X 17.0” (MED- OFA-RS, Med Associates). Northern blot analysis Total RNA (20ug) was separated on 12% polyacrylamide gels containing 8M urea in vertical electrophoresis cells (Invitrogen). RNAs were transferred to Hybond-N+ nylon membranes (Amersham) in an electrophoretic transfer cell (BioRad) for 2 h at 200V. Oligonucleotides complementary to miRNAs (as described in the Sanger microRNA registry) were end labeled and used as probes to detect their respective miRNAs. Ribonuclease protection assay RNase A/T1 protection assay (RPA) was performed using the mirVana miRNA Detection kit (Ambion) following the manufacturer's protocol. The RNA probes for LNA modified miR133a1 and miR133b were synthesized by Exiqon. The probes were generated by in vitro transcription using 20 pmoles of oligonucleotide as template. RPA reactions were performed using 5 µg total RNA and ~60,000 cpm of gel-purified probe as described by the manufacturer. After hybridization and digestion, probe was separated on a denaturing 15% polyacrylamide/urea gel. For imaging, gels were exposed and analyzed using a Molecular Dynamics Storm Phosphorimager. Luciferase assays pGL3 miR-133 sensor plasmid was constructed by insertion of two miR-133b binding sites in the XbaI site of the pGL3 promoter vector (Promega). The miR-133a and miR- 133b promoter plasmids were constructed by cloning of a 350bp miR-133a or miR-133b promoter sequences into the 5’ region of the pGL3 firefly luciferase assay vector. For luciferase assays, vectors were transfected using lipofectamine (Invitrogen) along with a Renilla luciferase vector as internal control. 48 hours after transfection, cell extracts were analyzed for firefly luciferase activity and normalized with Renilla luciferase activity, as per the manufacturer’s instructions (Amersham). Modified 2'-O-Methyl oligonucleotides siRNA duplexes and 2'-O-methyl oligonucleotides were purchased from a commercial vendor (IDT). 2'-O-methylated DNA oligonucleotides containing a 5' thiol group were reduced with TCEP (Sigma) at room temperature for 15 min. Penetratin (Qbiogene) was added and the mixture was incubated at 65 °C for 5 min followed by an inclubation at 37 °C for 60 min. Coupled oligonucleotides (90 mM) were heated at 65 °C for 15 min with polysalic acid and then added to cells. Dopamine determination by reversed phase HPLC Dopamine levels were determined in high KCL (56mM) medium and in control media essentially as described (2). Flow cytometry Flow cytometry was performed as previously described (3). Briefly, mice at postnatal day 10 were anesthetized, midbrains were removed, and dissociated for 45 minutes at 37C with Papain enzyme (Papain Dissociation System, Worthington Biochem) in EBSS according to the manufacture’s protocol. The dissociated mouse midbrain cells were then pelleted, resuspended in ice-cold 4% paraformaldehyde, and incubated for 15 min at 4°C. The cells were washed twice, resuspended at 106 cells/ml, and stained with appropriate antibody reagents in the presence of saponin (0.5%) for permeabilization. All flow cytometry was performed on a FACScan instrument (Becton-Dickinson). Data were analyzed with FlowJo software (TreeStar). Lentiviral vector production The lentiviral expression plasmids for miR-133b and miR-18 were constructed based on the Lentilox 3.7 plasmid (4). Sequences that generate hairpin repeats containing miRNAs were cloned into the HpaI/XhoI site of Lentilox 3.7. Lentivirus production was as described (2) and miRNA expression was confirmed by Northern blotting (Supplementary Figure 5A). Statistical analysis Results are given as mean ± S.E.M. Where appropriate, statistical analysis were performed with analysis of variance (ANOVA) test. Otherwise, comparisons between groups were conducted using Student’s t test. The null hypothesis was rejected at the P<0.05 level. (2) Supplementary Figures Supplementary Figure 1 (A) PCR analysis of genomic DNA from murine Dicer conditional knockout embryonic stem cells (Dicer fl/fl) and wild-type ES cells (Dicer wt/wt). Dicer can be inducibly deleted (Del) at the terminal stage of differentiation in ES cell-derived dopamine neurons by transduction with a lentivirus that harbors the Cre recombinase (vCRE) but not control lentivirus (vGFP). Lentiviral infection leads to nearly 100% expression of Cre in ES cell culture. Lower panel is a schematic of the floxed Dicer gene with the oligonucleotide primers used in the PCR reactions. (B) Schematic of ES cell embryoid body differentiation protocol. Cultures are transduced with GFP or CRE lentiviral vectors. (C) Cre lentivirus transduction had no affect on the differentiation of wild-type Dicer mouse ES cells cells. Cells were transfected with CRE lentivirus during the differentiation of wild-type Dicer mouse ES cells. Data represent means ± S.E.M. n=3, (10 visual fields per set); Student’s t test, *p < 0.05. (D) As in Figure 1C. Dicer deletion phenotype could be rescued by transfection
Load more

Recommended publications
  • Case Report a Fetus with Kabuki Syndrome 2 Detected by Chromosomal Microarray Analysis
    Int J Clin Exp Pathol 2020;13(2):302-306 www.ijcep.com /ISSN:1936-2625/IJCEP0104334 Case Report A fetus with Kabuki syndrome 2 detected by chromosomal microarray analysis Chen-Zhao Lin1, Bi-Ru Qi1, Jian-Su Hu2, Xiu-Qiong Huang3 Departments of 1Obstetrics and Gynecology, 2Ultrasound, 3Laboratory Medicine, Fuzhou Municipal First Hospital Affiliated to Fujian Medical University, Fuzhou 350009, Fujian Province, The People’s Republic of China Received November 1, 2019; Accepted January 26, 2020; Epub February 1, 2020; Published February 15, 2020 Abstract: Background: Kabuki syndrome is a rare multiple congenital anomaly syndrome characterized by distinct facial features, intellectual disability, cardiovascular and musculoskeletal abnormalities, persistence of fetal finger- tip pads, and postnatal growth deficiency. Currently, the diagnosis mainly depends on clinical manifestations and genetic testing. To date, there is no report on the identification Kabuki syndrome in fetuses using chromosomal microarray analysis (CMA). Case presentation: A fetus was identified with growth retardation and cardiovascular abnormality on color Doppler ultrasonography; however, non-invasive prenatal testing (NIPT) revealed a low risk and G-banding karyotyping revealed no abnormal karyotype detected. CMA identified a 1.3 Mb deletion on the X chromosome (Xp11.3) containing KDM6A, DUSP21, MIR222, MIR221 and CXorf36 genes. The fetus was diagnosed with Kabuki syndrome 2, and labor was induced. In addition, CMA detected a 1.3 Mb deletion in the chromosome Xp11.3 in the mother, which contains 5 genes namely KDM6A, DUSP21, MIR222, MIR221 and CXorf36, while no chromosomal abnormality was identified in the father. Conclusions: We report a fetus with Kabuki syndrome 2 detected using CMA.
    [Show full text]
  • A Heterozygous Variant in the Human Cardiac Mir-133 Gene, MIR133A2, Alters Mirna Duplex Processing and Strand Abundance
    Ohanian et al. BMC Genetics 2013, 14:18 http://www.biomedcentral.com/1471-2156/14/18 RESEARCH ARTICLE Open Access A heterozygous variant in the human cardiac miR-133 gene, MIR133A2, alters miRNA duplex processing and strand abundance Monique Ohanian1†, David T Humphreys2,3†, Elizabeth Anderson4, Thomas Preiss5 and Diane Fatkin1,2,3,6* Abstract Background: MicroRNAs (miRNAs) are small non-coding RNAs that post-transcriptionally regulate gene expression. Sequential cleavage of miRNA precursors results in a ~22 nucleotide duplex of which one strand, the mature miRNA, is typically loaded into the RNA-induced silencing complex (RISC) while the passenger strand is degraded. Very little is known about how genetic variation might affect miRNA biogenesis and function. Results: We re-sequenced the MIR1-1, MIR1-2, MIR133A1, MIR133A2, and MIR133B genes, that encode the cardiac- enriched miRNAs, miR-1 and miR-133, in 120 individuals with familial atrial fibrillation and identified 10 variants, including a novel 79T > C MIR133A2 substitution. This variant lies within the duplex at the 30 end of the mature strand, miR-133a-3p, and is predicted to prevent base-pairing and weaken thermostability at this site, favoring incorporation of the passenger strand, miR-133a-5p, into RISC. Genomic DNA fragments containing miR-133a-2 precursor sequences with 79T and 79C alleles were transfected into HeLa cells. On Northern blotting the 79T allele showed strong expression of miR-133a-3p with weak expression of miR-133a-5p. In contrast, the 79C allele had no effect on miR-133a-3p but there was a significant increase (mean 3.6-fold) in miR-133a-5p levels.
    [Show full text]
  • A Molecular and Genetic Analysis of Otosclerosis
    A molecular and genetic analysis of otosclerosis Joanna Lauren Ziff Submitted for the degree of PhD University College London January 2014 1 Declaration I, Joanna Ziff, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. Where work has been conducted by other members of our laboratory, this has been indicated by an appropriate reference. 2 Abstract Otosclerosis is a common form of conductive hearing loss. It is characterised by abnormal bone remodelling within the otic capsule, leading to formation of sclerotic lesions of the temporal bone. Encroachment of these lesions on to the footplate of the stapes in the middle ear leads to stapes fixation and subsequent conductive hearing loss. The hereditary nature of otosclerosis has long been recognised due to its recurrence within families, but its genetic aetiology is yet to be characterised. Although many familial linkage studies and candidate gene association studies to investigate the genetic nature of otosclerosis have been performed in recent years, progress in identifying disease causing genes has been slow. This is largely due to the highly heterogeneous nature of this condition. The research presented in this thesis examines the molecular and genetic basis of otosclerosis using two next generation sequencing technologies; RNA-sequencing and Whole Exome Sequencing. RNA–sequencing has provided human stapes transcriptomes for healthy and diseased stapes, and in combination with pathway analysis has helped identify genes and molecular processes dysregulated in otosclerotic tissue. Whole Exome Sequencing has been employed to investigate rare variants that segregate with otosclerosis in affected families, and has been followed by a variant filtering strategy, which has prioritised genes found to be dysregulated during RNA-sequencing.
    [Show full text]
  • Mir-96 Regulates the Progression of Differentiation in Mammalian Cochlear Inner and Outer Hair Cells
    miR-96 regulates the progression of differentiation in mammalian cochlear inner and outer hair cells Stephanie Kuhna,1, Stuart L. Johnsona,1, David N. Furnessb, Jing Chenc, Neil Inghamc, Jennifer M. Hiltonc, Georg Steffesc, Morag A. Lewisc, Valeria Zampinia,d, Carole M. Hackneya, Sergio Masettod, Matthew C. Holleya, Karen P. Steelc, and Walter Marcottia,2 aDepartment of Biomedical Science, University of Sheffield, Sheffield S10 2TN, United Kingdom; bInstitute for Science and Technology in Medicine, Keele University, Keele ST5 5BG, United Kingdom; cWellcome Trust Sanger Institute, Hinxton, Cambridge CB10 1SA, United Kingdom; and dDepartment of Physiology, University of Pavia, 27100 Pavia, Italy Edited by Mary-Claire King, University of Washington, Seattle, WA, and approved December 27, 2010 (received for review November 8, 2010) MicroRNAs (miRNAs) are small noncoding RNAs able to regulate cells up to at least P5 (23) and in the spiral ganglion up to P14 a broad range of protein-coding genes involved in many biological (19). Mutations in miR-96 have been associated with non- processes. miR-96 is a sensory organ-specific miRNA expressed in syndromic progressive hearing loss in humans (15) and mice (23). the mammalian cochlea during development. Mutations in miR-96 We found that hair cell development in diminuendo mice with cause nonsyndromic progressive hearing loss in humans and mice. a Mir96 mutation is arrested at around the day of birth, a time The mouse mutant diminuendo has a single base change in the when IHCs and OHCs still exhibit qualitatively similar bio- seed region of the Mir96 gene leading to widespread changes in physical properties.
    [Show full text]
  • High-Throughput Sequencing of Human Plasma RNA by Using Thermostable Group II Intron Reverse Transcriptases
    Downloaded from rnajournal.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases YIDAN QIN,1,2,3 JUN YAO,1,2,3 DOUGLAS C. WU,1,2 RYAN M. NOTTINGHAM,1,2 SABINE MOHR,1,2 SCOTT HUNICKE-SMITH,1 and ALAN M. LAMBOWITZ1,2 1Institute for Cellular and Molecular Biology, University of Texas at Austin, Austin, Texas 78712, USA 2Department of Molecular Biosciences, University of Texas at Austin, Austin, Texas 78712, USA ABSTRACT Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from <1 ng of plasma RNA in <5 h. TGIRT-seq of RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes.
    [Show full text]
  • Microrna-1182 and Let-7A Exert Synergistic Inhibition on Invasion
    Pan et al. Cancer Cell Int (2021) 21:161 https://doi.org/10.1186/s12935-021-01797-z Cancer Cell International PRIMARY RESEARCH Open Access MicroRNA-1182 and let-7a exert synergistic inhibition on invasion, migration and autophagy of cholangiocarcinoma cells through down-regulation of NUAK1 Xin Pan*, Gang Wang and Baoming Wang Abstract Background: Cholangiocarcinoma (CCA) is the second most common primary liver malignancy worldwide. Several microRNAs (miRNAs) have been implicated as potential tumor suppressors in CCA. This study aims to explore the potential efects of miR-1182 and let-7a on CCA development. Methods: Bioinformatics analysis was conducted to screen diferentially expressed genes in CCA, Western blot analysis detected NUAK1 protein expression and RT-qPCR detected miR-1182, let-7a and NUAK1 expression in CCA tissues and cell lines. Dual luciferase reporter gene assay and RIP were applied to validate the relationship between miR-1182 and NUAK1 as well as between let-7a and NUAK1. Functional experiment was conducted to investigate the role of miR-1182, let-7a and NUAK1 in cell migration, proliferation and autophagy. Then, the CCA cells that received various treatments were implanted to mice to establish animal model, followed by tumor observation and HE staining to evaluate lung metastasis. Results: CCA tissues and cells were observed to have a high expression of NUAK1 and poor expression of miR-1182 and let-7a. NUAK1 was indicated as a target gene of miR-1182 and let-7a. Importantly, upregulation of either miR-1182 or let-7a induced autophagy, and inhibited cell progression and in vivo tumor growth and lung metastasis; moreover, combined treatment of miR-1182 and let-7a overexpression presented with enhanced inhibitory efect on NUAK1 expression and CCA progression, but such synergistic efect could be reversed by overexpression of NUAK1.
    [Show full text]
  • The Role of Microrna in Human Leukemia: a Review
    Leukemia (2009) 23, 1257–1263 & 2009 Macmillan Publishers Limited All rights reserved 0887-6924/09 $32.00 www.nature.com/leu SPOTLIGHT REVIEW The role of microRNA in human leukemia: a review S Yendamuri1 and GA Calin2 1Department of Thoracic Surgery, Roswell Park Cancer Institute, Buffalo, NY, USA and 2Department of Experimental Therapeutics, University of Texas MD Anderson Cancer Center, Houston, TX, USA MicroRNAs (miRNAs or miRs) are 18–22-nucleotide non-coding target. If the sequence is a perfect match, the final result seems RNAs that have emerged as a new paradigm of epigenetic to be target mRNA degradation in a manner similar to siRNA- regulation in both normal development and cellular function, and in the pathogenesis of human disease including cancer. induced gene expression silencing. This seems to be the This review summarizes the current literature of mechanism of predominant mechanism in plants. A less than perfect match gene regulation by miRNA and their role in hematopoiesis and may result in inefficient translation leading to effective down- leukemogenesis. An understanding of these processes sug- regulation of the gene, a mechanism more common in gests further avenues for research to understand gene regula- animals.7–9 Isolated examples of miRNA leading to upregulation tion and miRNA-based therapeutic approaches. of genes have been reported.10 Leukemia (2009) 23, 1257–1263; doi:10.1038/leu.2008.382; The mechanism of translational repression is known only published online 15 January 2009 11 Keywords: microRNA; non-coding RNA; microarray; partially. The mRNA segments that miRNAs bind seem to be mostly in the 30UTRs of genes.
    [Show full text]
  • The Role of TGFβ Type III Receptor in Lung Cancer Cell Migration And
    Western University Scholarship@Western Electronic Thesis and Dissertation Repository 6-26-2018 1:00 PM The role of TGFβ type III receptor in lung cancer cell migration and invasion Anthony Ziccarelli The University of Western Ontario Supervisor Di Guglielmo, John The University of Western Ontario Graduate Program in Physiology and Pharmacology A thesis submitted in partial fulfillment of the equirr ements for the degree in Master of Science © Anthony Ziccarelli 2018 Follow this and additional works at: https://ir.lib.uwo.ca/etd Recommended Citation Ziccarelli, Anthony, "The role of TGFβ type III receptor in lung cancer cell migration and invasion" (2018). Electronic Thesis and Dissertation Repository. 5454. https://ir.lib.uwo.ca/etd/5454 This Dissertation/Thesis is brought to you for free and open access by Scholarship@Western. It has been accepted for inclusion in Electronic Thesis and Dissertation Repository by an authorized administrator of Scholarship@Western. For more information, please contact [email protected]. i Abstract Metastasis is responsible for 90% of cancer-related deaths. An important early step in the metastatic process is epithelial-to-mesenchymal transition (EMT) of tumor cells. Stimulated by TGFβ signaling, cells that undergo EMT have increased migratory and invasive potential, resulting in metastasis and the development of tumors at a secondary site. The TGFβ type 3 receptor (TβR3) has been implicated in modulating TGFβ signaling, yet its functional outcomes remain unclear. My findings demonstrated that TβR3 silencing does not alter TGFβ-dependent Smad2 phosphorylation in neither H1299, not A549 non- small cell lung carcinoma cells but reduces Smad2 expression in H1299 cells.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • NLRP3 Inflammasome at the Interface of Inflammation, Endothelial
    cells Review NLRP3 Inflammasome at the Interface of Inflammation, Endothelial Dysfunction, and Type 2 Diabetes Ilona M. Gora *, Anna Ciechanowska and Piotr Ladyzynski Nalecz Institute of Biocybernetics and Biomedical Engineering, Polish Academy of Sciences, Ks. Trojdena 4, 02-109 Warsaw, Poland; [email protected] (A.C.); [email protected] (P.L.) * Correspondence: [email protected] Abstract: Type 2 diabetes mellitus (T2DM), accounting for 90–95% cases of diabetes, is characterized by chronic inflammation. The mechanisms that control inflammation activation in T2DM are largely unexplored. Inflammasomes represent significant sensors mediating innate immune responses. The aim of this work is to present a review of links between the NLRP3 inflammasome, endothelial dys- function, and T2DM. The NLRP3 inflammasome activates caspase-1, which leads to the maturation of pro-inflammatory cytokines interleukin 1β and interleukin 18. In this review, we characterize the structure and functions of NLRP3 inflammasome as well as the most important mechanisms and molecules engaged in its activation. We present evidence of the importance of the endothelial dysfunction as the first key step to activating the inflammasome, which suggests that suppressing the NLRP3 inflammasome could be a new approach in depletion hyperglycemic toxicity and in averting the onset of vascular complications in T2DM. We also demonstrate reports showing that the expression of a few microRNAs that are also known to be involved in either NLRP3 inflammasome activation or endothelial dysfunction is deregulated in T2DM. Collectively, this evidence suggests that T2DM is an inflammatory disease stimulated by pro-inflammatory cytokines. Finally, studies revealing the role of glucose concentration in the activation of NLRP3 inflammasome are analyzed.
    [Show full text]
  • Development of Novel Therapeutic Agents by Inhibition of Oncogenic Micrornas
    International Journal of Molecular Sciences Review Development of Novel Therapeutic Agents by Inhibition of Oncogenic MicroRNAs Dinh-Duc Nguyen and Suhwan Chang * ID Department of Biomedical Sciences, University of Ulsan College of Medicine, Asan Medical Center, Seoul 05505, Korea; [email protected] * Correspondence: [email protected] Received: 21 November 2017; Accepted: 22 December 2017; Published: 27 December 2017 Abstract: MicroRNAs (miRs, miRNAs) are regulatory small noncoding RNAs, with their roles already confirmed to be important for post-transcriptional regulation of gene expression affecting cell physiology and disease development. Upregulation of a cancer-causing miRNA, known as oncogenic miRNA, has been found in many types of cancers and, therefore, represents a potential new class of targets for therapeutic inhibition. Several strategies have been developed in recent years to inhibit oncogenic miRNAs. Among them is a direct approach that targets mature oncogenic miRNA with an antisense sequence known as antimiR, which could be an oligonucleotide or miRNA sponge. In contrast, an indirect approach is to block the biogenesis of miRNA by genome editing using the CRISPR/Cas9 system or a small molecule inhibitor. The development of these inhibitors is straightforward but involves significant scientific and therapeutic challenges that need to be resolved. In this review, we summarize recent relevant studies on the development of miRNA inhibitors against cancer. Keywords: antimiR; antagomiR; miRNA-sponge; oncomiR; CRISPR/Cas9; cancer therapeutics 1. Introduction Cancer has been the leading cause of death and a major health problem worldwide for many years; basically, it results from out-of-control cell proliferation. Traditionally, several key proteins have been identified and found to affect signaling pathways regulating cell cycle progression, apoptosis, and gene transcription in various types of cancers [1,2].
    [Show full text]
  • Differential Expression of Micrornas in Adipose Tissue After Long-Term High-Fat Diet-Induced Obesity in Mice
    Differential Expression of MicroRNAs in Adipose Tissue after Long-Term High-Fat Diet-Induced Obesity in Mice Dionysios V. Chartoumpekis1, Apostolos Zaravinos2, Panos G. Ziros1, Ralitsa P. Iskrenova1, Agathoklis I. Psyrogiannis1, Venetsana E. Kyriazopoulou1, Ioannis G. Habeos1* 1 Department of Internal Medicine, Division of Endocrinology, Medical School, University of Patras, Patras, Greece, 2 Laboratory of Clinical Virology, Medical School, University of Crete, Heraklion, Greece Abstract Obesity is a major health concern worldwide which is associated with increased risk of chronic diseases such as metabolic syndrome, cardiovascular disease and cancer. The elucidation of the molecular mechanisms involved in adipogenesis and obesogenesis is of essential importance as it could lead to the identification of novel biomarkers and therapeutic targets for the development of anti-obesity drugs. MicroRNAs (miRNAs) have been shown to play regulatory roles in several biological processes. They have become a growing research field and consist of promising pharmaceutical targets in various fields such as cancer, metabolism, etc. The present study investigated the possible implication of miRNAs in adipose tissue during the development of obesity using as a model the C57BLJ6 mice fed a high-fat diet. C57BLJ6 wild type male mice were fed either a standard (SD) or a high-fat diet (HFD) for 5 months. Total RNA was prepared from white adipose tissue and was used for microRNA profiling and qPCR. Twenty-two of the most differentially expressed miRNAs, as identified by the microRNA profiling were validated using qPCR. The results of the present study confirmed previous results. The up- regulation of mmu-miR-222 and the down-regulation of mmu-miR-200b, mmu-miR-200c, mmu-miR-204, mmu-miR-30a*, mmu-miR-193, mmu-miR-378 and mmu-miR-30e* after HFD feeding has also been previously reported.
    [Show full text]