www.sciencemag.org/cgi/content/full/317/5842/1220/DC1 Supporting Online Material for A MicroRNA Feedback Circuit in Midbrain Dopamine Neurons Jongpil Kim, Keiichi Inoue, Jennifer Ishii, William B. Vanti, Sergey V. Voronov, Elizabeth Murchison, Gregory Hannon, Asa Abeliovich* *To whom correspondence should be addressed. E-mail: [email protected] Published 31 August, Science 317, 1220 (2007) DOI: 10.1126/science.1140481 This PDF file includes: Materials and Methods Figs. S1 to S6 Tables S1 to S3 References Supplementary Online Materials (1) Methods Generation of Dicer conditional knockout ES cells ES cells homozygous for a floxed allele of Dicer were derived from blastocysts generated by crossing mice homozygous for the Dicer floxed allele (1). Establishment of ES cell lines from blastocysts was performed as described (2). Genotyping of Dicerflox/flox and DAT-Cre alleles was carried out by PCR. ES cells carrying a conditional floxed allele of Dicer (1) were infected with CRE or GFP lentivirus to generate Dicer knockout ES cells at the stage 4 as described (2). Genomic DNA was extracted from stage 5 ES cells and CRE Infected cells were genotyped by using the following PCR primer pairs: for 23F (ATTGTTACCAGCGCT TAGAATTCC); 458F (TCGGAATAGGAACTTCGTTTAA AC), and 460R (GTACGTCTACAATTGTCTATG). Quantitative real time RT-PCR For quantitative real-time RT-PCR of miRNAs, total RNA from human brain and mouse brain were prepared with the mirVana miRNA Isolation Kit (Ambion). 0.5ug RNAs was used for the reverse transcription by using SuperScript II RTase (Invitrogen). Quantitative real-time rtPCR was performed using the qRT-PCR detection kit with precursor miRNA-specific primers. PCRs were optimized to determine the linear amplification range by using a Stratagene MX3000P system with QuantiTect PCR mix (Qiagen). The qPCR used a β-actin control and a standard curve. For the confirmation of the real time PCR result, Northern blot analysis for candidate miRNAs was performed with human and mouse brain RNA. Primers for precursors were designed based on the miRBase database (http://microrna.sanger.ac.uk/sequences/) using the OligoPerfect Designer software (Invitrogen). Primers for miR133b is 5'- TGGTCAAACGGAACCAAGTC-3'(F), 5'-TTGCCAGCCCTGCTGTAG-3'(R, mus), 5'- TCTCCAAGGACTGGGCATT-3'(R, human). Samples were controlled for β-actin using the following primers: 5'-GCTACAGCTTCACCACCACA-3'(F, mus), 5'- TCTCCAGGGAGGAAGAGGAT-3'(R, mus), 5'-CTCTTCCAGCCTTCCTTCCT-3'(F, human), 5’-AGCACTGTGTGTTGGCGTACAG-3'(R, human). Patient information for RNA samples: Control Brain 1: Age: 89 years; Gender: male; Samples: mesencephalon, frontal cortex, cerebellum; Diagnosis: usual aging. Control Brain 2: Age: 89 years; Gender: female; Samples: mesencephalon, frontal cortex, cerebellum; Diagnosis: usual aging. Control Brain 3: Age: 63 years; Gender: male; Samples: frontal cortex; Diagnosis: cardiac arrest. Control Brain 4: Age: 86 years; Gender: male; Samples: Substantia nigra; Diagnosis: Congestive Heart failure. Control Brain 5: Age: 68 years; Gender: male; Samples: Cerebellum; Diagnosis: Coronary Atherosclerosis Parkinson disease Brain 1: Age: 77 years; Gender: male; Samples: Cerebral cortex, Mesencephalon, Cerebellum; Diagnosis: Diffuse Lewy body disease, limbic or transitional type (Parkinson disease –dementia). Parkinson disease Brain 2: Age: 73 years; Gender: male; Samples: Cerebral cortex, Mesencephalon, Cerebellum; diagnosis: Lewy body disease, limbic or transitional type (Parkinson disease –dementia). Parkinson disease Brain 3: Age: 60 years; Gender: male; Samples: prefrontal cortex, mesencephalon, Cerebellum; Diagnosis: Parkinson disease; cause of death: gunshot wound. RNA transfection For rescue experiments, small RNAs(<200bp) and large RNA(>200bp) were separately isolated with the mirVana RNA extraction kit (Ambion). After vCRE infection in mouse ES cell derived dopamine neurons at stage 4, total RNAs were transfected at the end of stage 4 using an RNA transfection kit (TransMessenger Transfection Reagent, Qiagen) according to the manufacturer’s instructions. TUNEL assay Cryostat frozen sections (10 micrometer) embedded in OCT were prepared from control and mutant mouse brain. The TUNEL assay was performed using the ApopTag Plus In Situ Apoptosis Fluorescein Detection Kit (Chemicon) according to the manufacturer’s instructions. Mouse behavior For open field test, 2 month-old male Dat-Cre: Dicer fl/+ and Dat-Cre: Dicer fl/fl mice were used (n = 4 for each group). Activity was monitored over 30 min by beam interruption (10 bins, 3 min per bin) in the novel environment of 17.0” X 17.0” (MED- OFA-RS, Med Associates). Northern blot analysis Total RNA (20ug) was separated on 12% polyacrylamide gels containing 8M urea in vertical electrophoresis cells (Invitrogen). RNAs were transferred to Hybond-N+ nylon membranes (Amersham) in an electrophoretic transfer cell (BioRad) for 2 h at 200V. Oligonucleotides complementary to miRNAs (as described in the Sanger microRNA registry) were end labeled and used as probes to detect their respective miRNAs. Ribonuclease protection assay RNase A/T1 protection assay (RPA) was performed using the mirVana miRNA Detection kit (Ambion) following the manufacturer's protocol. The RNA probes for LNA modified miR133a1 and miR133b were synthesized by Exiqon. The probes were generated by in vitro transcription using 20 pmoles of oligonucleotide as template. RPA reactions were performed using 5 µg total RNA and ~60,000 cpm of gel-purified probe as described by the manufacturer. After hybridization and digestion, probe was separated on a denaturing 15% polyacrylamide/urea gel. For imaging, gels were exposed and analyzed using a Molecular Dynamics Storm Phosphorimager. Luciferase assays pGL3 miR-133 sensor plasmid was constructed by insertion of two miR-133b binding sites in the XbaI site of the pGL3 promoter vector (Promega). The miR-133a and miR- 133b promoter plasmids were constructed by cloning of a 350bp miR-133a or miR-133b promoter sequences into the 5’ region of the pGL3 firefly luciferase assay vector. For luciferase assays, vectors were transfected using lipofectamine (Invitrogen) along with a Renilla luciferase vector as internal control. 48 hours after transfection, cell extracts were analyzed for firefly luciferase activity and normalized with Renilla luciferase activity, as per the manufacturer’s instructions (Amersham). Modified 2'-O-Methyl oligonucleotides siRNA duplexes and 2'-O-methyl oligonucleotides were purchased from a commercial vendor (IDT). 2'-O-methylated DNA oligonucleotides containing a 5' thiol group were reduced with TCEP (Sigma) at room temperature for 15 min. Penetratin (Qbiogene) was added and the mixture was incubated at 65 °C for 5 min followed by an inclubation at 37 °C for 60 min. Coupled oligonucleotides (90 mM) were heated at 65 °C for 15 min with polysalic acid and then added to cells. Dopamine determination by reversed phase HPLC Dopamine levels were determined in high KCL (56mM) medium and in control media essentially as described (2). Flow cytometry Flow cytometry was performed as previously described (3). Briefly, mice at postnatal day 10 were anesthetized, midbrains were removed, and dissociated for 45 minutes at 37C with Papain enzyme (Papain Dissociation System, Worthington Biochem) in EBSS according to the manufacture’s protocol. The dissociated mouse midbrain cells were then pelleted, resuspended in ice-cold 4% paraformaldehyde, and incubated for 15 min at 4°C. The cells were washed twice, resuspended at 106 cells/ml, and stained with appropriate antibody reagents in the presence of saponin (0.5%) for permeabilization. All flow cytometry was performed on a FACScan instrument (Becton-Dickinson). Data were analyzed with FlowJo software (TreeStar). Lentiviral vector production The lentiviral expression plasmids for miR-133b and miR-18 were constructed based on the Lentilox 3.7 plasmid (4). Sequences that generate hairpin repeats containing miRNAs were cloned into the HpaI/XhoI site of Lentilox 3.7. Lentivirus production was as described (2) and miRNA expression was confirmed by Northern blotting (Supplementary Figure 5A). Statistical analysis Results are given as mean ± S.E.M. Where appropriate, statistical analysis were performed with analysis of variance (ANOVA) test. Otherwise, comparisons between groups were conducted using Student’s t test. The null hypothesis was rejected at the P<0.05 level. (2) Supplementary Figures Supplementary Figure 1 (A) PCR analysis of genomic DNA from murine Dicer conditional knockout embryonic stem cells (Dicer fl/fl) and wild-type ES cells (Dicer wt/wt). Dicer can be inducibly deleted (Del) at the terminal stage of differentiation in ES cell-derived dopamine neurons by transduction with a lentivirus that harbors the Cre recombinase (vCRE) but not control lentivirus (vGFP). Lentiviral infection leads to nearly 100% expression of Cre in ES cell culture. Lower panel is a schematic of the floxed Dicer gene with the oligonucleotide primers used in the PCR reactions. (B) Schematic of ES cell embryoid body differentiation protocol. Cultures are transduced with GFP or CRE lentiviral vectors. (C) Cre lentivirus transduction had no affect on the differentiation of wild-type Dicer mouse ES cells cells. Cells were transfected with CRE lentivirus during the differentiation of wild-type Dicer mouse ES cells. Data represent means ± S.E.M. n=3, (10 visual fields per set); Student’s t test, *p < 0.05. (D) As in Figure 1C. Dicer deletion phenotype could be rescued by transfection