DOCSLIB.ORG

Supplementary File 1B Revised-Förslag

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary File 1B Revised-Förslag Supplementary file 1B. Differentially expressed genes in cancers compared to non-cancers, ranked according to statistical significance based on features present in all samples in at least one replicate. Acc UGCluster Name Symbol log Fold Changet Adj. P - Value B T57841 Hs.474213 Ubiquitin fusion degradation 1 like (yeast) UFD1L 5,02 5,77E-17 36,61 AA279072 Hs.523875 Inositol polyphosphate phosphatase-like 1 INPPL1 4,29 3,40E-16 34,34 AA454143 Hs.77500 Ubiquitin specific peptidase 4 (proto-oncogene) USP4 5,47 9,11E-16 33,04 N68327 Hs.675604 Transcribed locus 5,16 1,33E-15 32,42 T47230 Hs.522885 Zinc finger protein 32 ZNF32 4,96 3,20E-15 31,39 N95249 Hs.505033 V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog KRAS 5,90 1,30E-14 29,85 R41787 Data not found 3,94 1,30E-14 29,75 H51262 Hs.658489 Chloride channel CLIC-like 1 CLCC1 5,67 3,80E-14 28,60 N74623 Hs.523414 Insulin-like growth factor 2 (somatomedin A) IGF2 8,04 1,04E-13 27,52 AA001614 Data not found 6,13 1,97E-13 26,81 AA488626 Hs.81424 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) SUMO1 6,74 2,96E-13 26,33 N50854 Hs.534334 Nucleolar protein 1, 120kDa NOL1 7,55 4,20E-13 25,91 N54596 Hs.523414 Insulin-like growth factor 2 (somatomedin A) IGF2 6,47 5,33E-12 23,37 AA129397 Hs.522868 Deleted in azoospermia 1 DAZ1 2,09 2,37E-11 21,85 N54596 Hs.523414 Insulin-like growth factor 2 (somatomedin A) IGF2 6,58 2,37E-11 21,78 AA424871 Hs.236646 Transcribed locus 3,00 2,11E-10 19,59 AA446876 Hs.165950 Fibroblast growth factor receptor 4 FGFR4 1,93 5,48E-10 18,59 AA152347 Hs.485557 Glutathione S-transferase A4 GSTA4 -2,38 1,31E-09 17,68 AA598863 Hs.535464 Eukaryotic translation initiation factor 3, subunit C-like EIF3CL 2,02 1,86E-09 17,28 H66005 Data not found 3,87 2,30E-09 17,03 AA677246 Data not found -1,74 3,20E-09 16,65 N47484 Hs.485557 Glutathione S-transferase A4 GSTA4 -2,36 3,50E-09 16,52 AI365391 Hs.153357 Procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 PLOD3 1,52 5,02E-09 16,09 AA150422 Hs.221941 Cytochrome b reductase 1 CYBRD1 -2,56 5,02E-09 16,08 AA664101 Hs.76392 Aldehyde dehydrogenase 1 family, member A1 ALDH1A1 -2,87 6,82E-09 15,74 N20305 Hs.20575 Growth arrest-specific 2 like 3 GAS2L3 2,00 9,23E-09 15,40 AA211761 Hs.598634 Transcribed locus -1,69 1,28E-08 15,02 AA482067 Hs.647064 Retinoic acid receptor responder (tazarotene induced) 2 RARRES2 -2,20 1,28E-08 15,00 H77536 Hs.497469 Ethanolamine kinase 2 ETNK2 2,09 1,71E-08 14,68 R70784 Hs.102696 Malignant T cell amplified sequence 1 MCTS1 1,30 1,82E-08 14,59 H01164 Hs.268887 MRNA; cDNA DKFZp686P05119 (from clone DKFZp686P05119) 1,25 1,82E-08 14,56 AA948055 Hs.349283 Chromobox homolog 5 (HP1 alpha homolog, Drosophila) CBX5 1,51 1,84E-08 14,52 AA863125 Hs.112981 DEP domain containing 6 DEPDC6 -1,95 2,02E-08 14,39 AA865224 Hs.709396 Homo sapiens, clone IMAGE:4096273, mRNA -1,30 2,02E-08 14,37 AA858223 Hs.144447 Bromodomain and WD repeat domain containing 2 BRWD2 1,54 2,23E-08 14,24 W49619 Hs.464829 Cadherin 2, type 1, N-cadherin (neuronal) CDH2 -3,06 2,28E-08 14,19 AA417905 Hs.503178 Spectrin, beta, non-erythrocytic 1 SPTBN1 -1,76 2,61E-08 14,03 AA936302 Hs.503178 Spectrin, beta, non-erythrocytic 1 SPTBN1 -1,80 2,81E-08 13,93 R20737 Hs.73625 Kinesin family member 20A KIF20A 1,12 2,88E-08 13,88 H96878 Hs.709414 Transmembrane emp24 protein transport domain containing 4 TMED4 1,10 2,92E-08 13,84 T63980 Hs.632994 MRNA differentially expressed in malignant melanoma, clone MM D3 1,68 3,12E-08 13,75 H19129 Hs.584758 Fibroblast growth factor 12 FGF12 -2,72 3,62E-08 13,58 N69220 Hs.480848 Ubiquitin specific peptidase 38 USP38 1,07 4,13E-08 13,43 R41227 Hs.203965 Putative homeodomain transcription factor 2 PHTF2 1,12 4,85E-08 13,24 AA670419 Hs.592207 Chromosome 22 open reading frame 9 C22orf9 -1,10 4,85E-08 13,22 W67200 Hs.334587 RNA binding protein with multiple splicing RBPMS -1,19 4,98E-08 13,18 W80761 Hs.435413 Metastasis associated 1 family, member 3 MTA3 -1,29 5,27E-08 13,10 AA488297 Hs.595186 Transcribed locus 1,04 5,49E-08 13,04 H90902 Hs.153546 Cell division cycle 23 homolog (S. cerevisiae) CDC23 1,13 8,51E-08 12,58 H17615 Hs.332708 Fibulin 5 FBLN5 -2,56 8,80E-08 12,53 AA199717 Hs.101174 Microtubule-associated protein tau MAPT 1,10 1,17E-07 12,23 AA430504 Hs.93002 Ubiquitin-conjugating enzyme E2C UBE2C 1,53 1,23E-07 12,17 H21943 Data not found 1,76 1,25E-07 12,12 H14208 Hs.631841 Paralemmin PALM -1,44 1,33E-07 12,05 H56345 Hs.709539 Chromosome 19 open reading frame 59 C19orf59 2,64 1,35E-07 12,02 AA490462 Hs.439463 AE binding protein 1 AEBP1 -1,37 1,38E-07 11,97 AA991590 Hs.110675 Apolipoprotein C-I APOC1 -3,26 1,75E-07 11,73 R17667 Hs.706748 Solute carrier family 2 (facilitated glucose transporter), member 1 SLC2A1 1,95 1,99E-07 11,58 H44785 Hs.714159 Transcribed locus 1,23 5,36E-07 10,35 AA004881 Hs.440401 Retinol saturase (all-trans-retinol 13,14-reductase) RETSAT -1,14 5,36E-07 10,34 N30428 Hs.122926 Nuclear receptor subfamily 3, group C, member 1 (glucocorticoid rece NR3C1 0,80 5,36E-07 10,33 AA873159 Hs.110675 Apolipoprotein C-I APOC1 -3,22 5,79E-07 10,24 R54846 Hs.264887 Fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfe FGFR1 1,45 5,88E-07 10,22 H20543 Hs.6278 Dihydroxyacetone kinase 2 homolog (S. cerevisiae) DAK -1,81 5,98E-07 10,18 R78586 Hs.7753 Transcribed locus 1,27 5,98E-07 10,17 AA034051 Hs.158932 Adenomatous polyposis coli APC 1,05 5,98E-07 10,16 AA873599 Hs.460960 Iduronate 2-sulfatase (Hunter syndrome) IDS 1,61 6,07E-07 10,13 R39446 Hs.714136 Transcribed locus -2,08 6,08E-07 10,12 R85914 Hs.437993 MAM domain containing glycosylphosphatidylinositol anchor 1 MDGA1 1,75 6,25E-07 10,08 R72507 Data not found 0,91 6,32E-07 10,06 H59625 Hs.560373 Transcribed locus 1,27 6,38E-07 10,04 AA142922 Hs.655143 Sorbin and SH3 domain containing 2 SORBS2 -3,04 6,39E-07 10,03 AA598601 Hs.697535 Insulin-like growth factor binding protein 3 IGFBP3 2,15 6,65E-07 9,98 H48148 Hs.4944 Chromosome 9 open reading frame 58 C9orf58 1,91 7,03E-07 9,91 AA443702 Hs.707333 Transcribed locus 1,00 7,16E-07 9,88 H10713 Data not found 1,25 7,28E-07 9,85 N21334 Hs.471156 Abl interactor 2 ABI2 -0,92 7,45E-07 9,82 R42227 Hs.245791 Transcribed locus 0,94 7,90E-07 9,74 R55993 Data not found -1,03 7,90E-07 9,74 R06900 Data not found 1,52 8,21E-07 9,69 R42112 Hs.513856 Candidate tumor suppressor in ovarian cancer 2 DPH1 1,03 8,67E-07 9,63 AA465389 Hs.474781 Neutrophil cytosolic factor 4, 40kDa NCF4 -1,22 8,96E-07 9,58 AA453512 Hs.521954 Transcribed locus, strongly similar to NP_036211.2 diacylglycerol O-acyltransfera -1,21 9,73E-07 9,49 AA521300 Hs.333297 Speckle-type POZ protein-like SPOPL 2,40 1,05E-06 9,41 R33642 Hs.523836 Glutathione S-transferase pi GSTP1 -1,72 1,05E-06 9,39 AA479202 Hs.644633 TIMP metallopeptidase inhibitor 3 (Sorsby fundus dystrophy, pseudoin TIMP3 -2,12 1,17E-06 9,28 H58873 Hs.706748 Solute carrier family 2 (facilitated glucose transporter), member 1 SLC2A1 1,86 1,20E-06 9,24 H22922 Hs.517603 MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase MFNG -1,09 1,20E-06 9,23 R09561 Hs.527653 CD55 molecule, decay accelerating factor for complement (Cromer blo CD55 -1,80 1,37E-06 9,10 R44870 Hs.369606 Cleavage and polyadenylation specific factor 6, 68kDa CPSF6 -1,00 1,48E-06 9,01 AA829294 Hs.437855 RNA polymerase II associated protein 3 RPAP3 1,02 1,88E-06 8,76 AA426516 Hs.645557 Transcribed locus 1,32 1,90E-06 8,74 W74133 Hs.47125 GINS complex subunit 3 (Psf3 homolog) GINS3 1,13 1,97E-06 8,70 AA449715 Hs.15154 Sushi-repeat-containing protein, X-linked SRPX -1,29 2,10E-06 8,63 N95578 Hs.535801 CDNA clone IMAGE:4346813 1,04 2,25E-06 8,55 AA485893 Hs.78224 Ribonuclease, RNase A family, 1 (pancreatic) RNASE1 -2,26 2,30E-06 8,52 R33439 Hs.24640 Semaphorin 7A, GPI membrane anchor (John Milton Hagen blood grou SEMA7A 1,20 2,30E-06 8,50 AA701963 Hs.521212 Aldo-keto reductase family 1, member B1 (aldose reductase) AKR1B1 -2,69 2,30E-06 8,50 N54296 Hs.94949 Methylmalonyl CoA epimerase MCEE -0,74 2,30E-06 8,49 R56149 Hs.533336 BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) BAMBI -1,00 2,30E-06 8,49 H14810 Data not found 1,43 2,32E-06 8,47 AA461071 Hs.516866 Solute carrier family 23 (nucleobase transporters), member 2 SLC23A2 -1,81 2,36E-06 8,44 W74668 Hs.59138 Glycophorin C (Gerbich blood group) GYPC -1,21 2,39E-06 8,42 H81645 Hs.162877 Protein kinase C and casein kinase substrate in neurons 2 PACSIN2 -1,18 2,54E-06 8,35 R55294 Data not found -1,82 2,65E-06 8,30 AA457728 Data not found 1,01 2,80E-06 8,24 AA406231 Hs.712560 Dishevelled associated activator of morphogenesis 2 DAAM2 -2,09 2,81E-06 8,23 AA465381 Hs.632527 Solute carrier family 35, member F5 SLC35F5 -1,11 3,02E-06 8,15 AA451851 Hs.102735 Single-stranded DNA binding protein 2 SSBP2 1,47 3,18E-06 8,09 AI361330 Hs.469030 Methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, me MTHFD2 1,15 3,23E-06 8,06 AA465663 Hs.654395 Fc fragment of IgG, low affinity IIb, receptor (CD32) FCGR2B -1,08 3,23E-06 8,05 H98241 Hs.503178 Spectrin, beta, non-erythrocytic 1 SPTBN1 -1,84 3,23E-06 8,05 R07607 Hs.349283 Chromobox homolog 5 (HP1 alpha homolog, Drosophila) CBX5 0,99 3,48E-06 7,97 N48827 Hs.467524 Ubiquitin specific peptidase 48 USP48 -1,16 3,50E-06 7,96 R51912 Hs.12409 Somatostatin SST 0,93 3,51E-06 7,95 T72259 Data not found 1,59 3,51E-06 7,94 AA683321 Hs.664675 Prader-Willi/Angelman syndrome-5 PAR5 1,29 3,51E-06 7,93 R07296 Hs.496383 Sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferas SOAT1 -1,72 3,75E-06 7,86 AA678159 Hs.563228 Transcribed locus -2,13 3,76E-06 7,85 AA757678 Data not found 1,17 8,09E-06
Load more

Recommended publications
  • Supplementary Information
    doi: 10.1038/nature08795 SUPPLEMENTARY INFORMATION Supplementary Discussion Population naming In some contexts, the indigenous hunter-gatherer and pastoralist peoples of southern Africa are referred to collectively as the Khoisan (Khoi-San) or more recently Khoesan (Khoe-San) people. This grouping is based on the unique linguistic use of click-consonants1. Many names, often country-specific, have been used by Bantu pastoralists and European settlers to describe the hunter-gatherers, including San, Saan, Sonqua, Soaqua, Souqua, Sanqua, Kwankhala, Basarwa, Batwa, Abathwa, Baroa, Bushmen, Bossiesmans, Bosjemans, or Bosquimanos. In addition, group-specific names such as !Kung and Khwe are often used for the broader population. The two most commonly used names, “San” and “Bushmen”, have both been associated with much controversy due to derogatory connotations2. “San” has become the more popular term used in Western literature, although “Bushmen” is arguably the more commonly recognized term within the communities. Since they have no collective name for themselves, the term Bushmen was selected for use in this paper as the term most familiar to the participants themselves. Regarding identification of individuals The five men identified in this study have all elected to have their identity made public knowledge. Thus we present two complete personal genomes (KB1 and ABT), a low-coverage personal genome (NB1), and personal exomes for all five men. On a scientific level, identification allows for current and future correlation of genetic data with demographic and medical histories. On a social level, identification allows for maximizing community benefit. For !Gubi, G/aq’o, D#kgao and !Aî, their name represents not only themselves, but importantly their extended family unit and a way of life severely under threat.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Combination of Photodynamic Therapy with Fenretinide and C6
    Wayne State University Wayne State University Theses 1-1-2015 Combination Of Photodynamic Therapy With Fenretinide And C6-Pyridinium Ceramide Enhances Killing Of Scc17b Human Head And Neck Squamous Cell Carcinoma Cells Via The eD Novo Sphingolipid Biosynthesis And Mitochondrial Apoptosis Nithin Bhargava Boppana Wayne State University, Follow this and additional works at: https://digitalcommons.wayne.edu/oa_theses Part of the Medicinal Chemistry and Pharmaceutics Commons Recommended Citation Boppana, Nithin Bhargava, "Combination Of Photodynamic Therapy With Fenretinide And C6-Pyridinium Ceramide Enhances Killing Of Scc17b Human Head And Neck Squamous Cell Carcinoma Cells Via The eD Novo Sphingolipid Biosynthesis And Mitochondrial Apoptosis" (2015). Wayne State University Theses. 431. https://digitalcommons.wayne.edu/oa_theses/431 This Open Access Thesis is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Theses by an authorized administrator of DigitalCommons@WayneState. COMBINATION OF PHOTODYNAMIC THERAPY WITH FENRETINIDE AND C6-PYRIDINIUM CERAMIDE ENHANCES KILLING OF SCC17B HUMAN HEAD AND NECK SQUAMOUS CELL CARCINOMA CELLS VIA THE DE NOVO SPHINGOLIPID BIOSYNTHESIS AND MITOCHONDRIAL APOPTOSIS by NITHIN BHARGAVA BOPPANA THESIS Submitted to the Graduate School of Wayne State University, Detroit, Michigan in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE 2015 MAJOR: PHARMACEUTICAL SCIENCES Approved By: ________________________________ Advisor Date © COPYRIGHT BY NITHIN BHARGAVA BOPPANA 2015 All Rights Reserved DEDICATION Dedicated to my mom Rekha Vasireddy for always believing in me and helping me in becoming the person who I am today. ii ACKNOWLEDGEMENTS I am grateful to my advisor, Dr. Duska Separovic for her invaluable mentorship throughout the project.
    [Show full text]
  • Cytoplasmic Activation-Induced Cytidine Deaminase (AID) Exists in Stoichiometric Complex with Translation Elongation Factor 1Α (Eef1a)
    Cytoplasmic activation-induced cytidine deaminase (AID) exists in stoichiometric complex with translation elongation factor 1α (eEF1A) Julien Häsler, Cristina Rada, and Michael S. Neuberger1 Medical Research Council Laboratory of Molecular Biology, Cambridge CB2 0QH, United Kingdom Edited by Frederick W. Alt, Howard Hughes Medical Institute, Harvard Medical School, Children’s Hospital Immune Disease Institute, Boston, MA, and approved October 12, 2011 (received for review April 27, 2011) Activation-induced cytidine deaminase (AID) is a B lymphocyte- results reveal that endogenous cytoplasmic AID partakes in a specific DNA deaminase that acts on the Ig loci to trigger antibody complex containing stoichiometric quantities of translation elon- gene diversification. Most AID, however, is retained in the cyto- gation factor 1α (eEF1A), with this association likely implicated in plasm and its nuclear abundance is carefully regulated because the regulation of AID’s intracellular trafficking. off-target action of AID leads to cancer. The nature of the cytosolic AID complex and the mechanisms regulating its release from the Results cytoplasm and import into the nucleus remain unknown. Here, we Flag-Tagging the Endogenous AID Locus in DT40 Cells. We generated show that cytosolic AID in DT40 B cells is part of an 11S complex derivatives of the DT40 B-cell line in which the endogenous AID and, using an endogenously tagged AID protein to avoid overex- locus was modified so as to incorporate a single Flag tag at the pression artifacts, that it is bound in good stoichiometry to the AID N terminus. To allow targeting of both alleles, one targeting translation elongation factor 1 alpha (eEF1A).
    [Show full text]
  • Enzymatic Encoding Methods for Efficient Synthesis Of
    (19) TZZ__T (11) EP 1 957 644 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C12N 15/10 (2006.01) C12Q 1/68 (2006.01) 01.12.2010 Bulletin 2010/48 C40B 40/06 (2006.01) C40B 50/06 (2006.01) (21) Application number: 06818144.5 (86) International application number: PCT/DK2006/000685 (22) Date of filing: 01.12.2006 (87) International publication number: WO 2007/062664 (07.06.2007 Gazette 2007/23) (54) ENZYMATIC ENCODING METHODS FOR EFFICIENT SYNTHESIS OF LARGE LIBRARIES ENZYMVERMITTELNDE KODIERUNGSMETHODEN FÜR EINE EFFIZIENTE SYNTHESE VON GROSSEN BIBLIOTHEKEN PROCEDES DE CODAGE ENZYMATIQUE DESTINES A LA SYNTHESE EFFICACE DE BIBLIOTHEQUES IMPORTANTES (84) Designated Contracting States: • GOLDBECH, Anne AT BE BG CH CY CZ DE DK EE ES FI FR GB GR DK-2200 Copenhagen N (DK) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • DE LEON, Daen SK TR DK-2300 Copenhagen S (DK) Designated Extension States: • KALDOR, Ditte Kievsmose AL BA HR MK RS DK-2880 Bagsvaerd (DK) • SLØK, Frank Abilgaard (30) Priority: 01.12.2005 DK 200501704 DK-3450 Allerød (DK) 02.12.2005 US 741490 P • HUSEMOEN, Birgitte Nystrup DK-2500 Valby (DK) (43) Date of publication of application: • DOLBERG, Johannes 20.08.2008 Bulletin 2008/34 DK-1674 Copenhagen V (DK) • JENSEN, Kim Birkebæk (73) Proprietor: Nuevolution A/S DK-2610 Rødovre (DK) 2100 Copenhagen 0 (DK) • PETERSEN, Lene DK-2100 Copenhagen Ø (DK) (72) Inventors: • NØRREGAARD-MADSEN, Mads • FRANCH, Thomas DK-3460 Birkerød (DK) DK-3070 Snekkersten (DK) • GODSKESEN,
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Biochemical and Cellular Studies of Vertebrate Globins
    Biochemical and Cellular Studies of Vertebrate Globins By Shun Wilford Tse Thesis submitted for the degree of Doctor of Philosophy School of Biological Sciences University of East Anglia September 2015 © This copy of the thesis has been supplied on condition that anyone who consults it is understood to recognise that its copyright rests with the author and that no quotations from the thesis, nor any information derived there-from may be published without the author's prior, written consent. Abstract Human cytoglobin is a small heme-containing protein in the globin superfamily with a wide range of tissue and organ distribution. Although several cellular functions have been proposed for cytoglobin, the exact physiological function is still not fully defined. Recently, cytoglobin has been implicated to have a regulatory role in cancer cells to control cell proliferation and migration depending on cellular oxygen level. In order to gain a better understanding of a structure-to-function relationship of cytoglobin as a heme-protein and to evaluate its possible physiological function(s) in cancer cells, a combination of techniques, including protein engineering and advanced spectroscopies, was deployed. In this study, recombinant human cytoglobin purified from E.coli was purified as a monomeric protein, but displayed a dimeric property in solution. An intra-molecular disulphide bond is formed within the protein which has a redox potential at ca -280 mV. Advanced spectroscopic studies confirmed a low-spin bis-histidyl heme in cytoglobin in both ferric and ferrous state regardless of the state of the disulphide bond. Furthermore, nitrite reductase activitiy in globins was investigated in detail using myoglobin as a model to explore the biochemical basis of the distal histidine residue in determining activity.
    [Show full text]
  • Supplemental Information IRF4 Transcription Factor-Dependent Cd11b+ Dendritic Cells in Human and Mouse Control Mucosal IL-17 C
    Immunity, Volume 38 Supplemental Information IRF4 Transcription Factor-Dependent CD11b+ Dendritic Cells in Human and Mouse Control Mucosal IL-17 Cytokine Responses Andreas Schlitzer, Naomi McGovern, Pearline Teo, Teresa Zelante, Koji Atarashi, Donovan Low, Adrian W.S. Ho, Peter See, Amanda Shin, Pavandip Singh Wasan, Guillaume Hoeffel, Benoit Malleret, Alexander Heiseke, Samantha Chew, Laura Jardine, Harriet A. Purvis, Catharien M.U. Hilkens, John Tam, Michael Poidinger, E. Richard Stanley, Anne B. K rug, Laurent Renia, Baalasubramanian Sivasankar, Lai Guan Ng, Matthew Collin, Paola Ricciardi-Castagnoli, Kenya Honda, Muzlifah Haniffa, and Florent Ginhoux Supplemental Inventory 1. Supplemental Figures and Tables Figure S1, Related to Figure 1 Figure S2, Related to Figure 2 and 3 Figure S3, Related to Figure 4 Figure S4, Related to Figure 5 Figure S5, Related to Figure 5 Figure S6, Related to Figure 7 Table S1, Related to Figure 3 Table S2, Related to Figure 6 Table S3, Related to Figure 6 2. Supplemental Experimental Procedures 3. Supplemental References Supplementary figure 1 Sorting strategy for mouse lung and small intestinal DC A Sorting strategy, Lung Singlets Dapi-CD45+ 250K 250K 250K 105 200K 200K 200K 104 A I - 150K 150K 150K C P C C 3 10 S A S S 100K 100K S 100K D S S 102 50K 50K 50K 0 0 0 0 0 50K 100K 150K 200K 250K 0 50K 100K 150K 200K 250K 0 103 104 105 0 103 104 105 FSC FSC-W CD45 GR1 Auto Fluor.- MHCII+ GR1- SSClow CD11c+ CD11b+ 250K 105 105 105 200K 4 104 10 104 150K I 3 I 3 4 3 0 10 3 C 2 H 10 10 100K 1 S D C D S C M 2 C 10 50K 0 0 0 0 0 102 103 104 105 0 103 104 105 0 103 104 105 0 103 104 105 Auto fluor.
    [Show full text]
  • A Human Population-Based Organotypic in Vitro Model for Cardiotoxicity Screening1
    ALTEX preprint published July 8, 2018 doi:10.14573/altex.1805301 Research Article A human population-based organotypic in vitro model for cardiotoxicity screening1 Fabian A. Grimm1, Alexander Blanchette1, John S. House2, Kyle Ferguson1, Nan-Hung Hsieh1, Chimeddulam Dalaijamts1, Alec A. Wright1, Blake Anson5, Fred A. Wright3,4, Weihsueh A. Chiu1, Ivan Rusyn1 1Department of Veterinary Integrative Biosciences, Texas A&M University, College Station, TX, USA; 2Bioinformatics Research Center, 3Department of Biological Sciences, and 4Department of Statistics, North Carolina State University, Raleigh, NC, USA; 5Cellular Dynamics International, Madison, WI, USA Abstract Assessing inter-individual variability in responses to xenobiotics remains a substantial challenge, both in drug development with respect to pharmaceuticals and in public health with respect to environmental chemicals. Although approaches exist to characterize pharmacokinetic variability, there are no methods to routinely address pharmacodynamic variability. In this study, we aimed to demonstrate the feasibility of characterizing inter-individual variability in a human in vitro model. Specifically, we hypothesized that genetic variability across a population of iPSC- derived cardiomyocytes translates into reproducible variability in both baseline phenotypes and drug responses. We measured baseline and drug-related effects in iPSC-derived cardiomyocytes from 27 healthy donors on kinetic Ca2+ flux and high-content live cell imaging. Cells were treated in concentration-response with cardiotoxic drugs: isoproterenol (β- adrenergic receptor agonist/positive inotrope), propranolol (β-adrenergic receptor antagonist/negative inotrope), and cisapride (hERG channel inhibitor/QT prolongation). Cells from four of the 27 donors were further evaluated in terms of baseline and treatment-related gene expression. Reproducibility of phenotypic responses was evaluated across batches and time.
    [Show full text]
  • Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Genetic Landscape of Papillary Thyroid Carcinoma and Nuclear Architecture: an Overview Comparing Pediatric and Adult Populations
    cancers Review Genetic Landscape of Papillary Thyroid Carcinoma and Nuclear Architecture: An Overview Comparing Pediatric and Adult Populations 1, 2, 2 3 Aline Rangel-Pozzo y, Luiza Sisdelli y, Maria Isabel V. Cordioli , Fernanda Vaisman , Paola Caria 4,*, Sabine Mai 1,* and Janete M. Cerutti 2 1 Cell Biology, Research Institute of Oncology and Hematology, University of Manitoba, CancerCare Manitoba, Winnipeg, MB R3E 0V9, Canada; [email protected] 2 Genetic Bases of Thyroid Tumors Laboratory, Division of Genetics, Department of Morphology and Genetics, Universidade Federal de São Paulo/EPM, São Paulo, SP 04039-032, Brazil; [email protected] (L.S.); [email protected] (M.I.V.C.); [email protected] (J.M.C.) 3 Instituto Nacional do Câncer, Rio de Janeiro, RJ 22451-000, Brazil; [email protected] 4 Department of Biomedical Sciences, University of Cagliari, 09042 Cagliari, Italy * Correspondence: [email protected] (P.C.); [email protected] (S.M.); Tel.: +1-204-787-2135 (S.M.) These authors contributed equally to this paper. y Received: 29 September 2020; Accepted: 26 October 2020; Published: 27 October 2020 Simple Summary: Papillary thyroid carcinoma (PTC) represents 80–90% of all differentiated thyroid carcinomas. PTC has a high rate of gene fusions and mutations, which can influence clinical and biological behavior in both children and adults. In this review, we focus on the comparison between pediatric and adult PTC, highlighting genetic alterations, telomere-related genomic instability and changes in nuclear organization as novel biomarkers for thyroid cancers. Abstract: Thyroid cancer is a rare malignancy in the pediatric population that is highly associated with disease aggressiveness and advanced disease stages when compared to adult population.
    [Show full text]
  • Rabbit Anti-DAZAP1/FITC Conjugated Antibody-SL14200R-FITC
    SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-DAZAP1/FITC Conjugated antibody SL14200R-FITC Product Name: Anti-DAZAP1/FITC Chinese Name: FITC标记的无精症缺失相关蛋白1抗体 DAZ associated protein 1; DAZ-associated protein 1; Dazap1; DAZP1_HUMAN; Alias: Deleted in azoospermia associated protein 1; Deleted in azoospermia-associated protein 1. Organism Species: Rabbit Clonality: Polyclonal React Species: Human,Mouse,Rat,Chicken,Dog,Pig,Cow,Horse,Sheep, ICC=1:50-200IF=1:50-200 Applications: not yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 43kDa Form: Lyophilized or Liquid Concentration: 1mg/ml immunogen: KLH conjugated synthetic peptide derived from human DAZAP1 Lsotype: IgG Purification: affinity purified by Protein A Storage Buffer: 0.01Mwww.sunlongbiotech.com TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized antibody is stable at room temperature for at least one month and for greater than a year Storage: when kept at -20°C. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 °C. background: In mammals, the Y chromosome directs the development of the testes and plays an important role in spermatogenesis. A high percentage of infertile men have deletions that map to regions of the Y chromosome. The DAZ (deleted in azoospermia) gene Product Detail: cluster maps to the AZFc region of the Y chromosome and is deleted in many azoospermic and severely oligospermic men.
    [Show full text]