Design of Polyanhydride-Based Targeted Nanovaccines Against HIV Julia Eulalia Vela Ramirez Iowa State University

Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations

2015 Design of polyanhydride-based targeted nanovaccines against HIV Julia Eulalia Vela Ramirez Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Biomedical Commons, and the Chemical Engineering Commons

Recommended Citation Vela Ramirez, Julia Eulalia, "Design of polyanhydride-based targeted nanovaccines against HIV" (2015). Graduate Theses and Dissertations. 14476. https://lib.dr.iastate.edu/etd/14476

This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected].

Design of polyanhydride-based targeted nanovaccines against HIV

Julia Eulalia Vela Ramirez

A dissertation submitted to the graduate committee

In partial fulfillment of requirements for the degree of

DOCTOR OF PHILOSOPHY

Major: Chemical Engineering

Program of Study Committee:

Balaji Narasimhan, Major Professor Michael J Wannemuehler Nicola L. B. Pohl Ian C. Schneider Jennifer Heinen

Iowa State University

Ames, Iowa

2015

TABLE OF CONTENTS

LIST OF FIGURES...…….…………...……………………………………………….viii

LIST OF TABLES…….…………………………………………………………………xi

ACKNOWLEDGEMENTS……………………………………………………………..xii

ABSTRACT…..………………………………………………………………………..xvii

CHAPTER 1 ...... 1 1.1. Introduction ...... 1 1.2. References ...... 6

CHAPTER 2 ...... 10 2.1 Summary ...... 10 2.2 Biodegradable polymers for drug and vaccine delivery ...... 11 2.2.1 Natural polymers ...... 11 2.2.2. Polyesters ...... 16 2.2.3. Polyurethanes ...... 19 2.2.4. Vinyl polymers ...... 20 2.2.5. Poly(alkyl cyanoacrylates) ...... 22 2.2.6. Polyethers ...... 23 2.2.7. Polyanhydrides ...... 25 2.3. Nanoparticle characteristics as adjuvants and/or delivery vehicles ...... 29 2.3.1. Particle size ...... 29 2.3.2. Shape ...... 34 2.3.3. Hydrophobicity and surface charge ...... 36 2.4. Targeting mechanisms for drug and vaccine delivery ...... 38 2.4.1 Introduction ...... 38 2.4.2. Desired immune system components ...... 39

iii

2.4.2.1. Tumor cells ...... 39 2.4.2.2. Antigen presenting cells ...... 41 2.4.2.3. Targeting approaches ...... 45 2.4.2.4. Antigen specificity ...... 46 2.4.2.5. Environmentally responsive delivery vehicles ...... 47 2.4.2.6. Channeling molecules ...... 48 2.4.3. Nanoparticle targeting strategies ...... 48 2.4.3.1. Passive targeting ...... 49 2.4.3.2. Active targeting ...... 49 2.5. HIV: Overview and current challenges ...... 52 2.5.1. Overview of HIV infection ...... 53 2.5.2. Vaccine strategies ...... 55 2.5.3 Current therapies and challenges...... 57 2.6. Summary ...... 58 2.7. References ...... 60

CHAPTER 3 ...... 78

CHAPTER 4 ...... 80 4.1. Abstract ...... 81 4.2. Introduction ...... 82 4.3. Materials and Methods ...... 84 4.3.1. Materials ...... 84 4.3.2. Construction of pET-gp41-54Q-GHC ...... 85 4.3.3. Expression and purification of gp41-54Q-GHC ...... 86 4.3.4. Monomer and polymer synthesis ...... 87 4.3.5. Nanoparticle synthesis ...... 88 4.3.6. Nanoparticle functionalization...... 89 4.3.6.1. Synthesis of carboxylated di-mannose ...... 89 4.3.6.2. Surface functionalization ...... 89 4.3.7. Nanoparticle characterization ...... 90 4.3.8. Antigen release kinetics ...... 91

4.3.9. Gel electrophoresis ...... 91 4.3.10. Antigenic analysis of released immunogen ...... 92 4.3.11. In vitro DC uptake and activation ...... 93 4.3.11.1 Mice ...... 93 4.3.11.2. DC culture and stimulation ...... 93 4.3.11.3 Particle internalization ...... 94 4.3.11.4 Flow cytometric analysis of cell surface markers and CLRs ...... 94 4.3.12. Cytokine secretion ...... 95 4.3.13. Statistical analysis ...... 95 4.4. Results...... 95 4.4.1 Chemistry-dependent gp41-54Q-GHC kinetics and stabilization upon release from polyanhydride nanoparticles ...... 95 4.4.2. Functionalization and characterization of carbohydrate-modified nanoparticles ...... 97 4.4.3. gp41-54Q-GHC release kinetics from functionalized nanoparticles ...... 99 4.4.4. gp41-54Q-GHC antigenicity was preserved upon release from functionalized nanoparticles ...... 100 4.4.5. Internalization by DCs was enhanced by functionalization ...... 101 4.4.6. Functionalized nanoparticles enhanced DC expression of CD40 and CD206 ...... 102 4.4.7. Functionalized nanoparticles modulated DC secretion of pro- inflammatory cytokines ...... 104 4.5. Discussion ...... 105 4.6. Conclusions ...... 112 4.7. Acknowledgments ...... 113 4.8. References ...... 114

CHAPTER 5 ...... 122 5.1. Abstract ...... 123 5.2. Introduction ...... 124 5.3. Materials and Methods ...... 126 5.3.1. Materials ...... 126 5.3.2. Monomer and Polymer Synthesis ...... 127 5.3.3. Nanoparticle Synthesis ...... 128

5.3.4. Mice ...... 129 5.3.5. Murine serum protein adsorption onto polyanhydride nanoparticles ... 129 5.3.6. Nanoparticle surface analysis...... 130 5.3.7. Analysis of adsorbed serum proteins ...... 130 5.3.8. Macrophage culture and stimulation ...... 131 5.3.9. Internalization profiles of serum-coated nanoparticles ...... 132 5.3.10. Identification of Complement Component C3 ...... 133 5.3.11. Activation of macrophages by serum-coated nanoparticles ...... 134 5.3.12. Cytokine secretion by macrophages ...... 134 5.3.13. Statistical Analysis ...... 135 5.4. Results...... 135 5.4.1. Particle size and characterization ...... 135 5.4.2. Polymer chemistry-dependent serum protein adsorption profiles ...... 135 5.4.3. Polyanhydride nanoparticle internalization is CR3- and serum protein adsorption-dependent ...... 139 5.4.4. Internalization is necessary for the activation of bone marrow-derived macrophages ...... 141 5.4.5. Cytokine secretion is dependent upon both serum protein adsorption and the presence of CR3 ...... 144 5.5. Discussion ...... 145 5.6. Conclusions ...... 152 5.7. Acknowledgments ...... 153 5.8. References ...... 154

CHAPTER 6 ...... 161 6.1. Abstract ...... 162 6.2. Introduction ...... 163 6.3. Materials and Methods ...... 165 6.3.1. Materials ...... 165 6.3.2. Monomer and polymer synthesis ...... 166 6.3.3. Nanoparticle synthesis ...... 167 6.3.4. Sugar synthesis ...... 167 6.3.4.1. Synthesis of carboxymethyl α-1,2-linked dimannoside ...... 167

6.3.4.2. Synthesis of carboxymethyl-α-galactoside ...... 168 6.3.5. Surface functionalization ...... 168 6.3.6. Nanoparticle characterization ...... 169 6.3.7. Mice ...... 169 6.3.8. Mouse treatments ...... 170 6.3.8.1. Liver and kidney histological and biomarker examination ...... 170 6.3.8.2. Serum biomarker analysis ...... 170 6.3.8.3. Urine creatinine and total protein quantification analysis ...... 171 6.3.8.4. Intranasal administration of particle formulations ...... 171 6.3.8.5. Lung histological evaluation ...... 172 6.3.8.6. Flow cytometric analysis of lung tissue ...... 172 6.3.8.7. Bronchoalveolar lavage (BAL) fluid collection ...... 173 6.3.9. Cytokine and chemokine analysis ...... 174 6.3.10. Statistical Analysis ...... 174 6.4. Results...... 174 6.4.1. Functionalization and characterization of carbohydrate-modified nanoparticles ...... 174 6.4.2. Kidney histological evaluation and renal function ...... 176 6.4.3. Liver histological evaluation and hepatic function...... 178 6.4.4. Lung histological evaluation ...... 180 6.4.5. Distribution of lung cellular populations ...... 182 6.4.6. Cytokine/chemokine secretion...... 184 6.5. Discussion ...... 186 6.6. Conclusions ...... 191 6.7. Acknowledgments ...... 191 6.8. References ...... 193

CHAPTER 7 ...... 199 7.1. Abstract ...... 200 7.2. Introduction ...... 201 7.3. Materials and Methods ...... 202 7.3.1. Materials ...... 202 7.3.2. Construction of pET-gp41-54Q-GHC ...... 203

vii

7.3.3. Expression and purification of gp41-54Q-GHC ...... 204 7.3.4. Loading of gp41-54Q-GHC onto gold nanoparticles (GNPs) ...... 205 7.3.5. Monomer and polymer synthesis ...... 205 7.3.6. Nanoparticle synthesis ...... 206 7.3.7. Nanoparticle characterization ...... 206 7.3.8. Antigen release kinetics ...... 207 7.3.9. Mice ...... 207 7.3.10. Mouse treatments ...... 208 7.3.10.1. Preparation of antigens and immunizations ...... 208 7.3.11. Flow cytometry ...... 208 7.3.12. gp41-54Q-specific Enzyme-Linked Immunosorbent Assay (ELISA) .. 210 7.4. Results...... 211 7.4.1. Synthesis and characterization of gp41-loaded polyanhydride nanoparticles ...... 211 7.4.2. Single immunization of gold nanoparticles, alum and polyanhydride nanoparticles elicited measurable anti-gp41 antibody ...... 212 7.4.3. Multiple immunization regimen using polyanhydride nanoparticles elicited robust anti-gp41 antibody responses ...... 217 7.5. Discussion ...... 219 7.6. Conclusions ...... 223 7.7. Acknowledgments ...... 223 7.8. References ...... 224

CHAPTER 8 ...... 228 8.1. Conclusions ...... 228 8.2. Evaluation of nanoparticles functionalized with higher order mannoses .... 229 8.3. Optimization of targeted polyanhydride nanovaccines ...... 230 8.4. Analysis of uptake mechanisms of polyanhydride nanoparticles ...... 231 8.5. Functionalization of nanoparticles with small molecules or peptides ...... 233 8.6. Polyanhydride functionalization with carbohydrate moieties ...... 235 8.7. Analysis of polyanhydride nanoparticle trafficking mechanisms to the lymph nodes ...... 236 8.8. References ...... 238

viii

LIST OF FIGURES

Figure 1.1. Chemical structures of sebacic acid, 1,6-bis(p-carboxyphenoxy) hexane, and 1,8-bis(p-carboxyphenoxy)-3,6 dioxaoctane………...... 4 Figure 2.1. Cumulative release of pDNA from pDNA–collagen and pDNA–LIP–collagen (liposome) and physical structure of collagen after release of pDNA………………………………………………………...…...... 13 Figure 2.2. Crosslinking reaction mechanism of gelatin with glutaraldehyde………...... 14 Figure 2.3. Chemical structure of chitosan with X = degree of acetylation and n = number of sugar units per polymer…………….……………………...... 16 Figure 2.4. Scanning electron photomicrographs of (75:25 L/G) PLGA microspheres at different degradation states…………………………………...….18 Figure 2.5. Chemical structures of common vinyl polymers (PVA and PAA)……………………………………………………………………………...….….21 Figure 2.6. Degradation mechanism of PACA by esterases……………………..23 Figure 2.7. Depiction of PEGylation of a protein………………………………..…24 Figure 2.8. Basic chemical structure of polyanhydrides……………………...…..25 Figure 2.9. Chemical structures of SA, CPH and CPTEG …………………….…28 Figure 2.10. Representation of the respiratory system and its sections………...33 Figure 2.11. Average predicted total and regional lung deposition based on International Commission on Radiological Protection (ICRP) deposition model for nose breathing males and females engaged in light exercise………..34 Figure 2.12. False-colored scanning electron photomicrographs of alveolar macrophages interacting with polystyrene particles with different shapes….…..35 Figure 2.13. Design of adjuvants/delivery vehicles for targeted delivery……….38 Figure 2.14 . Methods of pathogen recognition by pattern-recognition receptors (PRRs) in APCs………………………………………………………...….43 Figure 2.15. Identified members from the Toll-like receptor family with their respective agonist, origin, and examples…………………………………………...44 Figure 2.16. “Magic bullet” development is based on three components: antigen or drug, adjuvant or delivery vehicle, and targeting molecule………..….45

Figure 2.17. Antigen presentation using CLRs…………………………………….52 Figure 2.18. Depiction of an HIV virion……………………………………………..54 Figure 2.19. Mucosal immunization elicits antibodies against HIV……………...57 Figure 4.1. gp41-54Q-GHC antigen release kinetics from polyanhydride nanoparticles and structural stability upon release…………………...... …………97 Figure 4.2. Cumulative fraction of gp41-54Q-GHC released from ( ●) NF, (×) linker- and ( □) di-mannose-functionalized 50:50 CPTEG:CPH nanoparticles………………………………………………………………………….100 Figure 4.3. Antigenic analysis of released gp41-54Q-GHC at 37°C from NF, linker-, and di-mannose-functionalized 50:50 CPTEG:CPH nanoparticles…....101 Figure 4.4. Cellular internalization was enhanced by positively charged polyanhydride nanoparticles……………….………………………………………..102 Figure 4.5. Di-mannose-functionalized nanoparticles enhanced DC expression of co-stimulatory molecules and CLRs...... 103 Figure 4.6. Enhancement of cytokine secretion after stimulation with NF nanoparticles is consistent with the amount of gp41-54Q-GHC released from polyanhydride nanoparticles…………..……………………………………...104 Figure 5.1. Serum protein adsorption onto polyanhydride nanoparticles is chemistry dependent……………………………………………..……………….137 Figure 5.2. Internalization profiles of serum protein coated polyanhydride nanoparticles and quantification of complement component 3 adsorption…….140 Figure 5.3. Activation profiles of bone marrow-derived macrophages by serum protein coated polyanhydride nanoparticles………………………………143 Figure 5.4. Cytokine secretion profiles of bone marrow-derived macrophages after stimulation with serum protein coated polyanhydride nanoparticles….….145 Figure 6.1. Polyanhydride nanoparticle characterization. Chemical structures of the surface moieties on non-functionalized, linker-, galactose-, and di-mannose-functionalized nanoparticles are presented………………………...176 Figure 6.2. Administration of a 5 mg dose of surface-functionalized 50:50 CPTEG:CPH nanoparticles did not affect renal function………………………...178 Figure 6.3. Administration of a 5 mg dose of surface-functionalized 50:50 CPTEG:CPH nanoparticles did not affect induce hepatic inflammation or alter hepatic function…………………………………………………………………180

Figure 6.4. Mild to moderate inflammation was observed in lung samples upon histological evaluation post-administration of surface-functionalized polyanhydride nanoparticles………………………………………………………...182 Figure 6.5. Cellular distribution of lung homogenates of Swiss Webster following administration of surface-functionalized polyanhydride nanoparticles…………………………………………………...…………………….184 Figure 6.6. Low amounts of cytokine/chemokine secretion were observed in bronchoalveolar lavage fluid 6, 24 and 48 hours after intranasal administration of surface-functionalized polyanhydride nanoparticles……...... 185 Figure 7.1. gp41-54Q-GHC antigen release kinetics from polyanhydride nanoparticles………………………………………………………………………….212 Figure 7.2. Serum antibody response induced by single immunization with GNPs…………………………………………………………………………………..213 Figure 7.3. B cell and T cell responses induced by single immunization with GNPs…………………………………………………………………………………..214 Figure 7.4. Serum antibody response induced by single immunization with Alum formulation……………………………………………………………………..215 Figure 7.5. B cell and T cell responses induced by single immunization with Alum…………………………………………………………………………………...215 Figure 7.6. Serum antibody response induced by single immunization with 20:80 CPTEG:CPH nanovaccine…………………………………………………..216 Figure 7.7. B cell and T cell responses induced by single immunizations with gp41-loaded polyanhydride nanovaccine...... 217 Figure 7.8. Antibody and B cell and T cell responses induced by multiple immunizations with gp41-loaded polyanhydride nanovaccine…………………..218 Figure 7.9. Isotype distribution of GC B cells after multiple immunizations with polyanhydride nanovaccine...... 219

LIST OF TABLES

Table 4.1. Non-functionalized and functionalized nanoparticles were characterized by QELS and zeta potential measurements...... ….....99 Table 5.1. Energy-dispersive X-ray spectroscopy (EDS) analysis of elemental composition of non-coated and serum-coated polyanhydride nanoparticles………………………………………………………………………….136 Table 5.2. Quantification of murine serum proteins from 2-D gel electrophoresis……………………………………………………………………….138

xii

ACKNOWLEDGEMENTS

In completing my Ph.D. in Chemical Engineering at Iowa State University,

I would like to thank many people that have helped me reach this high achievement. I want to thank all of those who have mentored, advised, supported, trained, inspired and encouraged me to pursue this dream. Without all these special people, I would have not been able to complete this accomplishment in my life.

I am deeply grateful to my major professor and mentor Dr. Balaji

Narasimhan, who gave me the opportunity to be part of his wonderful research group and helped me to immerse myself in the biomedical engineering field.

Since I was part of the BioMaP REU program in 2008, he was able to transmit his passion and excitement for research in this area, and that experience was key in my decision to pursue this career. His constant motivation, support and guidance through graduate school have been fundamental in my professional development. I appreciate all the time, patience and care that he has always shown to me through hardships and struggles, but also the encouragement every step of the way these four years. It has been a true honor to work with him, and I have been very fortunate to have him as an advisor. Thank you for everything.

Thanks to my program of study committee members, Dr. Jen Heinen, Dr.

Ian Schneider, Dr. Nikki Pohl and Dr. Mike Wannemuehler for their guidance and suggestions that have expanded my knowledge and enriched my thesis. Special thanks to Dr. Wannemuehler, who has been almost a second advisor in my

xiii projects. His curiosity, critical thinking and challenging questions have helped me to become a better scientist, and to improve the quality of my research. I am very grateful for his guidance and support through these years. Also, a second thanks is due to Dr. Nikki Pohl, her constant encouragement and guidance in my project have been invaluable. Her creativity and ability to think outside the box, have taught me that imagination, science and engineering are always linked to each other. Thanks to Dr. Jen Heinen for her support and research discussions that kept me thinking about the polymer science principles involved in my project. And finally, thanks to Dr. Ian Schneider for the discussions about how biological engineering and materials science are related, and for teaching me how to keep thinking as a chemical engineer in a biological field. Lastly, I would like to acknowledge the financial support from the National Institutes of Health (NIAID

U19 AI091031).

I would also like to thank all the people that have been part of this rich interdisciplinary group, without whom this work would not have been possible.

Rajarshi Roychoudhury, from the Pohl laboratory, who synthesized all the carbohydrates used in these projects, for his hard work and patience every time there was a request for more sugars. Habtom Habte, who synthesized the gp41 protein used in the HIV in vivo and in vitro experiments, and whose support and soccer talks were always a friendly welcome. Paola Boggiatto, from the

Wannemuehler group, for her help and valuable discussions in immunobiology, in in vitro and in vivo techniques, and her critical and straightforward thinking , that were very important in the successful completion of this project. Lorraine

xiv

Tygrett and Dr. Tom Waldschmidt, for their expertise and advice in B-cell development experiments. Dr. Yashdeep Phanse for his kind and encouraging words of support, and his hard work in several experiments and projects. I want to thank the members and ex-members of the Wannemuehler group for their help, use of their lab and advice in endless occasions: Mary Jane Long, Lucas

Huntimer, Susie Knetter, Meghan Wymore-Brand, Ross Darling, and Danielle

Wagner. Numerous interactions and collaborations with fellow graduate students and postdocs have been extremely valuable in the development of these projects: Shivani Ghaisas, Duan Loy, Supraja Putamreddy, Lindsey Sharpe, Matt

Brewer, Kiva Forsmark, Anup Sharma, Ryan Swanson, Justin Adams, Laura

Lara, and Srikanth Nayak. Thank you for all your help and hard work.

Furthermore, I would like to thank all of the previous and current graduate students and postdocs that I have worked with in the Narasimhan group that have been not only great research colleagues, but friends. Special thanks are due to Jonathan Goodman, who has worked with me in several projects, long- weekends and early hours, and for his support and friendship that are deeply appreciated. Dr. Brenda Carrillo-Conde, who was my mentor in my first year of graduate school, trained me and helped me to start my project. More importantly, she continued her mentoring even after she graduated from Iowa State, her advice and friendship are very valuable to me. Thanks to Dr. Kathleen Ross, for all the research discussions and advice, that were really helpful these years in graduate school. Her friendship and encouragement were heartily appreciated when experiments did not go as expected. Thanks also to Shannon Haughney

xv and Dr. Tim Brenza for their support and help over the years we have shared together in the Narasimhan lab, you have been excellent research partners and fellow scientists. Dr. Latrisha Petersen, Dr. Feng Jia, Ana Chavez Santoscoy, and Chelsea Sackett, for their help, training and patience during my early years of grad school. I also have had the opportunity to work with several undergraduate researchers, but special thanks to Joe Cicchese, with whom I have had the opportunity to work and mentor.

I also want to thank all the people who have made my Ph.D. experience in

Iowa State more enjoyable. To my fellow grad students and postdocs Kathleen

Ross, Jon Goodman, Laura Lara-Rodriguez, Omer Ozgur Capraz, Kiva

Forsmark, Brenda Carrillo-Conde, Paola Boggiatto, Miguel Suastegui Pastrana,

Ana Chavez Santoscoy, Shannon Haughney, Justin Adams, Tim Brenza, Paul

Lueth, Alex Liu, Xiaofei Hu, Feng Jia, Anup Sharma, Radhika Rao, Joe Petefish and Subbu Venkatachalam thanks for all the laughs, advice and support through these years. To the staff members who became my friends, more than coworkers: DeAnn Pittman, Jody Danielson, Linda Edson, Bellinda Hegelheimer ,

Christi Patterson, Terry Wierson, Molly Seaboch, Brenda Kutz and Kathy

McKown for all their help, kind words and constant encouragement.

Most importantly, I would like to thank the greatest treasure in my life: my family. Without their constant love, support and encouragement, this accomplishment would not have been possible. To my parents, Arturo Vela

Aguilar and Julia Elena Ramirez Garcia, who have always been extremely supportive of my dreams, but they are also the pillars that have guided my life.

xvi

My mom has always been my hero, your strength, cheerfulness and incessant love for life are the light of our family. Dad, you are the guide that has shown us the path to improve ourselves, your intelligence, kindness and your ability to inspire us to try to understand the world more every day. Thank you for your sleepless nights, hard work, and teaching me by example to give my best every time; but above all, your warmth, love and care that have been paramount in my career. I would like to thank my best friends, my brother Arturo and my sister

Alma Margarita, two angels in my life that inspire me to better myself every day.

My brother has always supported, encouraged and cheered me up. Our long talks, inside jokes and your relentless spirit, bright my days. My baby sister is the most perseverant kindred woman I have ever met. Her joyfulness and goodness of heart lift my spirits even in hard and anxious times. Thank you for your continuous encouragement, strength, and love through all my life. Los Amo!

Finally, I want to thank God, my Lord and savior, for all his blessings and allowing me to reach this dream. You are the One who leads me every day, I thank You for lighting my darkest days, and Your infinite love. I trust my past, present, and future to Your will. I owe everything I am to You.

xvii

ABSTRACT

Vaccine development has had a profound impact on healthcare across the world. However, there are still multiple challenges that current strategies need to overcome to be able to deliver highly targeted and easily administered efficacious vaccines. Specifically, viral infections with high mutation rates have become a difficult target for such therapies. Among these, Human

Immunodeficiency Virus (HIV) is one of the major concerns for researchers due to ability of the virus to mutate and the rate of new infections in remote locations.

Since traditional approaches have not had great success against these infections, development of novel platforms using single-dose actively targeted vaccinations is a promising alternative. This work focused on the design and evaluation of a targeted polymeric nanovaccine against this virus, with polyanhydride nanoparticles playing dual roles as delivery vehicle and adjuvant.

The work presented in this dissertation describes the development of a rationally designed targeted polyanhydride nanovaccine against HIV.

Initial research was focused on the screening of different polyanhydride nanoparticle formulations and understanding cell-particle interactions using antigen presenting cells (APCs), which are key components in the initiation of an immune response. These experiments were aimed at understanding the role that chemistry and surface functionalization had in the preservation of the structure and biological activity of an HIV antigen, and particle internalization and release kinetics, to rationally select lead candidates, and to evaluate their ability to stimulate dendritic cells. The results showed that all nanovaccine formulations

xviii used were able to stabilize and sustain antigen release; however, amphiphilic chemistries were specifically identified as lead candidates due to their smaller initial burst release and ability to preserve antigenicity of fragile proteins. In addition, carbohydrate functionalization was not detrimental to the ability of these nanovaccines to release antigen and stimulate dendritic cells. In order to further understand the interactions of polyanhydride nanoparticles with APCs after administration to the body, experiments were carried to analyze the role of complement receptor 3, serum proteins and polymer chemistry in the uptake of these nanoformulations. The results of this investigation showed the complex relationship between the aforementioned factors, which affected the ability of the polyanhydride nanoparticles to be taken up by and stimulate macrophages. The overall observations from these studies were then used to identify the desired characteristics of these polymeric formulations to proceed with in vivo evaluation of these nanovaccines.

The latter chapters of this dissertation were focused on the evaluation of the ability of the lead nanovaccine formulations to elicit immune responses using in vivo models. Before performing efficacy studies with carbohydrate- functionalized polyanhydride nanoparticles, it was necessary to assess the safety of these novel biomaterials; therefore, safety and biodistribution experiments were performed with carbohydrate-functionalized polyanhydride nanoparticles.

Histopathology evaluation of tissue samples, quantification of urine and serum biomarkers, cellular distribution and cytokine secretion confirmed that the functionalization of the nanoparticles did not dramatically affected the behavior of

xix the nanoformulations and did not cause any detrimental effects when compared to saline treatments. Finally, evaluation of immune responses generated after the administration of polyanhydride nanovaccines using an HIV antigen in in vivo models was carried out. These formulations were able to induce germinal center

B cell formation in draining lymph nodes and generate serum antibodies, eliciting more robust responses than traditional adjuvants (such as Alum). The results of this investigation confirm the ability of polyanhydride nanovaccines to generate potent immune responses and to induce both humoral and cellular immunity. In summary, the studies described herein demonstrate the promising capabilities of polyanhydride nanovaccine formulations to design an efficacious vaccine against viral pathogens.

CHAPTER 1

Introduction

1.1. Introduction

Vaccine development has played a major role in the improvement of the quality of life across the world.[1-3] However, emerging and chronic diseases

(e.g., HIV, influenza A, cancer) have caused researchers to explore novel vaccine delivery technologies, since traditional approaches have not been very effective against them. Design of alternative mechanisms for prevention or prophylactic treatments towards pathogens like HIV includes the rational design of antigens, delivery vehicles, and use of potent adjuvants to create efficacious platforms for antigen delivery.[4-6]

Human Immunodeficiency Virus (HIV) has become one of the greatest challenges for researchers around the world.[7, 8] More than 35 million human deaths have occurred from the resulting disease, Acquired Immunodeficiency

Deficiency Syndrome[7], since its outbreak in 1981.[8] The highest number of new infections is in remote locations in Africa where continuous treatment to avoid the progression of the disease is required.[7] Therefore, a prophylactic or a therapeutic intervention strategy that can be easily distributed and administered needs to be developed. An ideal vaccine against HIV-1 must elicit a robust and balanced (includes cellular and humoral immunity) immune response in order to avoid the infection of the host. But the high mutation rate of the virus, its ability to

2 stay dormant for several years, and the different mechanisms to avoid the immune system response, have made HIV a difficult challenge for scientists.[9-

12]

In the quest for safe and efficacious next generation vaccines against pathogens like HIV, the use of subunit proteins specific to the pathogen as vaccine antigens has gained prominence. These molecules have desirable properties as antigens, such as safety and specificity; on the other hand, they may have fragile structures and/or poor immunogenicity when used as soluble protein.[6, 13] To overcome these limitations, use of adjuvants in vaccine formulations has been pursued as a viable strategy, because adjuvants not only improve the immunogenicity of these antigens, but may also stabilize these molecules and provide sustained delivery of antigens to antigen presenting cells.[14-20]

In order to incorporate these properties into adjuvants and/or delivery vehicles, non-traditional molecules have been explored as potential adjuvants, including polymer-based, protein-based, and antibody-based platforms.[3, 6, 21-

24] Before studying the mechanisms of adjuvanticity induced by these platforms, analysis of the preservation of antigenic structure (primary, secondary, and tertiary), which is susceptible to environmental changes (e.g., pH, temperature), and its interaction with the chemicals involved in the fabrication process of these vehicles (i.e., solvents, detergents) is of paramount interest.

Another challenge in the rational design of vaccines is the short half-life of protein antigens in vivo.[25] Depending on the disease of interest, either localized

3 or dispersed behavior of the vaccine is desirable, which also involves their ability to get to the site of action.[26, 27] Typically, these molecules may also require passing through biological barriers (e.g., mucosa), depending on the route of immunization.[28-31] Therefore, to increase their effectiveness, multiple administrations may be required to be able to deliver sufficient amount of the antigen to elicit efficacious immune responses. A prime-boost immunization regimen may reduce the effectiveness of the treatment, because of the time- stringent regimen of vaccines and/or their long-term storage, especially in remote locations. To improve these approaches, a single dose strategy would provide a good solution and also enhance patient compliance.

In order to direct the antigen to specific locations or cellular populations to enhance their immune response and also for dose sparing capabilities, targeting mechanisms have been used recently.[27, 28, 30] Typically, these approaches are oriented to direct the delivery vehicles to specific cellular receptors (e.g., macrophage mannose receptor), organs (e.g., brain), or cell population subsets

(e.g., tumor cells) by modifying the properties of the delivery vehicle.[28, 32-34]

For particle-based vaccine technologies, functionalization of their surfaces with molecules such as carbohydrates, peptides, or antibodies has become a viable methodology.[21, 22, 32-36]

Among these novel platforms for antigen delivery, biodegradable polymers have gained a lot of attention.[6, 24] These systems have flexibility with respect to their properties based upon the control of chemical characteristics of the material(s). These properties include the ability to tune release kinetics of

4 payload, development of responsiveness to the local environment (e.g., pH), and the capacity to be directed towards specific targets.[18, 19, 37-40] These materials have been used to design films, micro- and nanoparticles, stents, gels, scaffolds depending on the target disease and administration route.[24, 41-44]

Specifically, polyanhydrides represent a family of biodegradable polymers that present a set of desirable properties for the design of novel platforms for drug and antigen delivery vehicles.[24, 44, 45] Polyanhydrides are hydrophobic materials with surface-eroding mechanisms that have shown in previous studies to stabilize a variety of antigens (i.e., proteins, peptides), display sustained antigen release kinetics, degrade into safe and non-mutagenic degradation products, show excellent biocompatibility, and adjuvant properties.[24, 44, 45]

The anhydride monomers that have been most commonly studied are sebacic acid (SA), 1,6-bis( p-carboxyphenoxy) hexane (CPH) and 1,8-bis(p- carboxyphenoxy)-3,6-dioxaoctane (CPTEG) (Figure 1.1).

Figure 1.1. Chemical structures of A) sebacic acid, B) 1,6-bis(p-carboxyphenoxy) hexane, and C) 1,8-bis(p-carboxyphenoxy)-3,6-dioxaoctane.

Polyanhydride nanoparticle-based vaccines (or nanovaccines) have been shown to preserve the antigenicity of proteins (e.g., F1-V, ovalbumin, PspA, rPA,

5 hemagglutinin) upon release, stimulate both humoral and cellular immune responses, and elicit protection in live challenge experiments.[19, 46-51] These properties make them promising candidates as drug and vaccine delivery vehicles. Based on these characteristics of polyanhydrides, the main goal of this research was the design of novel targeted polyanhydride nanoparticle-based vaccine delivery vehicles, specifically for HIV-1 antigens, that can help elicit strong and balanced immune responses that result in efficacious treatments against this virus.

1.2. References [1] Andre FE, Booy R, Bock HL, Clemens J, Datta SK, John TJ, Lee BW, et al. Vaccination greatly reduces disease, disability, death and inequity worldwide. Bull World Health Organ. 2008;86:140-6.

[2] NIAID. Vaccines. National Institute of Allergy and Infectious Diseases; 2014.

[3] Plotkin SA. Vaccines: past, present and future. Nat med. 2005;11:S5-11.

[4] Bramwell VW, Perrie Y. The rational design of vaccines. Drug discovery today. 2005;10:1527-34.

[5] Zepp F. Principles of vaccine design-Lessons from nature. Vaccine. 2010;28 Suppl 3:C14-24.

[6] Wilson-Welder JH, Torres MP, Kipper MJ, Mallapragada SK, Wannemuehler MJ, Narasimhan B. Vaccine adjuvants: current challenges and future approaches. J Pharm Sci. 2009;98:1278-316.

[7] UNAIDS. Global report: UNAIDS report on the global AIDS epidemic 2013. Geneva: United Nations; 2013.

[8] U.S.D.H.H.S. Global AIDS Overview. 2013.

[9] Bomsel M, Tudor D, Drillet AS, Alfsen A, Ganor Y, Roger MG, Mouz N, et al. Immunization with HIV-1 gp41 subunit virosomes induces mucosal antibodies protecting nonhuman primates against vaginal SHIV challenges. Immunity. 2011;34:269-80.

[10] Mascola JR, Montefiori DC. The role of antibodies in HIV vaccines. Ann Rev Immunol. 2010;28:413-44.

[11] Mascola JR, Montefiori DC. HIV-1: nature's master of disguise. Nat Med. 2003;9:393-4.

[12] McMichael AJ, Borrow P, Tomaras GD, Goonetilleke N, Haynes BF. The immune response during acute HIV-1 infection: clues for vaccine development. Nat Rev Immunol. 2010;10:11-23.

[13] Coffman RL, Sher A, Seder RA. Vaccine adjuvants: putting innate immunity to work. Immunity. 2010;33:492-503.

[14] Bilati U, Allemann E, Doelker E. Strategic approaches for overcoming peptide and protein instability within biodegradable nano- and microparticles. Eur J Pharm Biopharm. 2005;59:375-88.

[15] Ljutic B, Ochs M, Messham B, Ming M, Dookie A, Harper K, Ausar SF. Formulation, stability and immunogenicity of a trivalent pneumococcal protein vaccine formulated with aluminum salt adjuvants. Vaccine. 2012;30:2981-8.

[16] Schwendeman SP, Costantino HR, Gupta RK, Siber GR, Klibanov AM, Langer R. Stabilization of tetanus and diphtheria toxoids against moisture- induced aggregation. Proc Natl Acad Sci USA. 1995;92:11234-8.

[17] Costa MHB, Quintilio W, Sant'Anna OA, Faljoni-Alario A, de Araujo PS. The use of protein structure/activity relationships in the rational design of stable particulate delivery systems. Braz J Med Biol Res. 2002;35:727-30.

[18] O'Hagan DT, Jeffery H, Roberts MJJ, Mcgee JP, Davis SS. Controlled Release Microparticles for Vaccine Development. Vaccine. 1991;9:768-71.

[19] Carrillo-Conde B, Schiltz E, Yu J, Chris Minion F, Phillips GJ, Wannemuehler MJ, Narasimhan B. Encapsulation into amphiphilic polyanhydride microparticles stabilizes Yersinia pestis antigens. Acta biomater. 2010;6:3110-9.

[20] Torres MP, Wilson-Welder JH, Lopac SK, Phanse Y, Carrillo-Conde B, Ramer-Tait AE, Bellaire BH, et al. Polyanhydride microparticles enhance dendritic cell antigen presentation and activation. Acta biomater. 2011;7:2857-64.

[21] Weiner LM, Murray JC, Shuptrine CW. Antibody-based immunotherapy of cancer. Cell. 2012;148:1081-4.

[22] Zhang XX, Eden HS, Chen X. Peptides in cancer nanomedicine: drug carriers, targeting ligands and protease substrates. J Control Release. 2012;159:2-13.

[23] Elzoghby AO, Samy WM, Elgindy NA. Albumin-based nanoparticles as potential controlled release drug delivery systems. J Control Release. 2012;157:168-82.

[24] Ulery BD, Nair LS, Laurencin CT. Biomedical Applications of Biodegradable Polymers. J Polym Sci B. 2011;49:832-64.

[25] Perrie Y, Mohammed AR, Kirby DJ, McNeil SE, Bramwell VW. Vaccine adjuvant systems: enhancing the efficacy of sub-unit protein antigens. Int J Pharm. 2008;364:272-80.

[26] Storm G, Belliot SO, Daemen T, Lasic DD. Surface Modification of Nanoparticles to Oppose Uptake by the Mononuclear Phagocyte System. Adv Drug Deliver Rev. 1995;17:31-48.

[27] Singh R, Lillard JW, Jr. Nanoparticle-based targeted drug delivery. Exp Mol Path. 2009;86:215-23.

[28] Beduneau A, Saulnier P, Benoit JP. Active targeting of brain tumors using nanocarriers. Biomaterials. 2007;28:4947-67.

[29] Schneider T, Becker A, Ringe K, Reinhold A, Firsching R, Sabel BA. Brain tumor therapy by combined vaccination and antisense oligonucleotide delivery with nanoparticles. J Neuroimmunol. 2008;195:21-7.

[30] Bilusic M, Madan RA. Therapeutic cancer vaccines: the latest advancement in targeted therapy. Am J Ther. 2012;19:e172-81.

[31] Neutra MR, Kozlowski PA. Mucosal vaccines: the promise and the challenge. Nat Rev Immunol. 2006;6:148-58.

[32] Geijtenbeek TB, Gringhuis SI. Signalling through C-type lectin receptors: shaping immune responses. Nat Rev Immunol. 2009;9:465-79.

[33] Cambi A, Figdor CG. Dual function of C-type lectin-like receptors in the immune system. Curr Opin Cell Biol. 2003;15:539-46.

[34] Lepenies B, Lee J, Sonkaria S. Targeting C-type lectin receptors with multivalent carbohydrate ligands. Adv drug deliv rev. 2013;65:1271-81.

[35] Bhojani MS, Van Dort M, Rehemtulla A, Ross BD. Targeted imaging and therapy of brain cancer using theranostic nanoparticles. Mol Pharm. 2010;7:1921-9.

[36] Muro S. Challenges in design and characterization of ligand-targeted drug delivery systems. J Control Release. 2012;164:125-37.

[37] Brannon-Peppas L, Blanchette JO. Nanoparticle and targeted systems for cancer therapy. Adv Drug Deliv Rev. 2004;56:1649-59.

[38] Determan MD, Cox JP, Mallapragada SK. Drug release from pH-responsive thermogelling pentablock copolymers. J Biomed Mater Res A. 2007;81:326-33.

[39] Kipper MJ, Shen E, Determan A, Narasimhan B. Design of an injectable system based on bioerodible polyanhydride microspheres for sustained drug delivery. Biomaterials. 2002;23:4405-12.

[40] Kale AA, Torchilin VP. Environment-Responsive Polymers for Coating of Pharmaceutical Nanocarriers(,). Polym Sci Series A, Chemistry, Physics. 2009;51:730-7.

[41] Langer RS, Peppas NA. Present and future applications of biomaterials in controlled drug delivery systems. Biomaterials. 1981;2:201-14.

[42] Danhier F, Ansorena E, Silva JM, Coco R, Le Breton A, Preat V. PLGA- based nanoparticles: an overview of biomedical applications. J Control Release. 2012;161:505-22.

[43] Dossi M, Storti G, Moscatelli D. Synthesis of Poly(Alkyl Cyanoacrylates) as Biodegradable Polymers for Drug Delivery Applications. Macromol Symp. 2010;289:124-8.

[44] Rosen HB, Chang J, Wnek GE, Linhardt RJ, Langer R. Bioerodible Polyanhydrides for Controlled Drug Delivery. Biomaterials 1983;4:131-3.

[45] Kumar N, Langer RS, Domb AJ. Polyanhydrides: an overview. Adv Drug Deliver Rev. 2002;54:889-910.

[46] Petersen LK, Phanse Y, Ramer-Tait AE, Wannemuehler MJ, Narasimhan B. Amphiphilic polyanhydride nanoparticles stabilize Bacillus anthracis protective antigen. Mol Pharm. 2012;9:874-82.

[47] Lopac SK, Torres MP, Wilson-Welder JH, Wannemuehler MJ, Narasimhan B. Effect of polymer chemistry and fabrication method on protein release and stability from polyanhydride microspheres. J Biomed Mater Res Part B, Appl Biomater. 2009;91:938-47.

[48] Haughney SL, Petersen LK, Schoofs AD, Ramer-Tait AE, King JD, Briles DE, Wannemuehler MJ, et al. Retention of structure, antigenicity, and biological function of pneumococcal surface protein A (PspA) released from polyanhydride nanoparticles. Acta biomater. 2013;9:8262-71.

[49] Ulery BD, Kumar D, Ramer-Tait AE, Metzger DW, Wannemuehler MJ, Narasimhan B. Design of a protective single-dose intranasal nanoparticle-based vaccine platform for respiratory infectious diseases. PloS one. 2011;6:e17642.

[50] Kipper MJ, Wilson JH, Wannemuehler MJ, Narasimhan B. Single dose vaccine based on biodegradable polyanhydride microspheres can modulate immune response mechanism. J of Biomed Mater Res Part A. 2006;76:798-810.

[51] Ross KA, Loyd H, Wu W, Huntimer L, Wannemuehler MJ, Carpenter S, Narasimhan B. Structural and antigenic stability of H5N1 hemagglutinin trimer pon release from polyanhydride nanoparticles. J Biomed Mater Res Part A. 2014;102:4161-8.

CHAPTER 2

Literature Review

2.1 Summary

Polymeric particles have been widely used as vaccine delivery vehicles.

Particle systems based on a variety of natural and synthetic polymers have been studied for the delivery of multiple payloads. This chapter reviews the properties of these polymeric systems, particle characteristics that are important for induction of immune responses, and targeting approaches to enhance the function of these systems. Section 2.2 explores the structure-performance relationships of different polymer-based systems for drug and vaccine delivery. In

Section 2.3, an analysis of specific particle characteristics, such as size, shape, hydrophobicity and surface chemistry that have been previously reported as important for the immune response, is presented. Section 2.4 reviews targeting strategies that have been used for cancer therapy and specific activation of antigen presenting cells. Finally in Section 2.5, a brief overview of HIV pathogenesis, vaccine challenges, and future directions is discussed.

2.2 Biodegradable polymers for drug and vaccine delivery

2.2.1 Natural polymers Polymers have always existed in nature (e.g., DNA, polysaccharides, proteins) and have played important roles in plant, animal and human life.[1]

These compounds can be classified into three types: proteins (e.g., albumin, gelatin, collagen), lipid-based compounds (e.g., liposomes), and polysaccharides

(e.g., chitosan, cellulose). Degradation of these polymers usually involves hydrolytic or enzymatic reactions that break the bonds of the main chain.[2-4]

Albumin is a macromolecular carrier that is attractive for the design of drug and vaccine delivery carriers. It has been shown to be non-toxic, biodegradable, biocompatible, and easy to purify and solubilize in water.[5, 6] In addition, its degradation products are metabolizable and non-toxic after in vivo administration

[5, 6], allowing it to be a viable candidate as a delivery vehicle.

There are three albumin proteins that have been widely used in biomedical applications: ovalbumin, bovine serum albumin and human serum albumin. Ovalbumin (OVA) is a phosphoglycoprotein that consists of 385 amino acid residues with a molecular mass of 47 kDa and an isoelectric point (pI) of 4.8.

OVA has been used extensively as a carrier for drug delivery and as a model antigen, due to the low cost and stability of its properties under different pH and temperatures.[5, 7, 8] Another albumin protein that has been used in biomedical applications is BSA (bovine serum albumin), which is a 69 kDa protein with a pI of 4.7 due to its physical properties, abundance and cost-effectiveness. Finally, to minimize immune responses after administration, human serum albumin [9]

12 has been used instead of BSA or OVA. This protein is the most abundant protein in the human serum, with a concentration of 35-50 g/L and a half-life of 19

days.[8, 10] Having a M w of 66.5 kDa, high solubility, robust pH (4.7) and temperature stability, and resistant to organic solvents, it has become an attractive alternative for gene and drug delivery.

Studies with these naturally occurring proteins as carriers have advanced to different clinical trials in different disease applications.[6, 11, 12] Paclitaxel- albumin nanoparticles called Abraxane ® have been developed for metastatic breast cancer treatment.[6, 13, 14] Another platform using albumin nanoparticles currently in clinical trials use lipophilic drugs against cancer progression, such as mTOR rapamycin, heat shock protein inhibitor Hsp90, docetaxel, etc.[6, 12]

Levermir ® (insulin detemir) and Victoza ® (liraglutide) are two products from Novo

Nordisk that treat diabetes and have shown good results regulating blood sugar levels for long term use.[6] These products were recently approved by the U.S.

FDA in 2005 and 2009, respectively. Treatments that require crossing the blood brain barrier for drug delivery have also been developed, using adsorption of oximes to HSA nanoparticles.[15, 16] In addition, the ability to modify the surface of these nanoparticles with folate for specific targeting has also been studied.[8]

Collagen is the most abundant protein in human body (20-30% of total amount of proteins) and the primary structural material of vertebrates, present in multiple tissues such as bone, cartilage, and ligaments, and is also one of the main components of blood vessels.[11, 17-19] It is composed of polypeptide strands, mainly based upon proline and hydroxyproline. This material has been

13 used in biomedical applications because of its biodegradability, biocompatibility, and weak antigenicity, to create different architectures with different mechanical properties.[11, 19, 20]

Figure 2.1. Cumulative release of pDNA from pDNA–collagen and pDNA–LIP– collagen (liposome) and physical structure of collagen after release of pDNA. [19]

Collagen nanoparticles have been used to provide sustained release of anti-cancer drugs, antibiotics, growth factors, and retinol and facilitate transportation of the encapsulated agent to specific tissues.[17, 18] In addition, this platform has been used to deliver DNA, siRNA, antibiotics, and proteins as shown in Figure 2.1, where pDNA release from collagen gels is demonstrated.

However, a disadvantage of collagen-based delivery vehicles is their lack of mechanical strength and their bulk erosion mechanism that hinder their ability to provide controlled release.

Gelatin is denatured collagen isolated from animal skin or bone and extracted using acid and alkaline hydrolysis, giving it low antigenicity. It is a polyampholyte due to the presence of both cationic and anionic groups together with hydrophobic residues.[11, 21] It has a triple helical structure with multiple sequences from glycine, proline and alanine. It has largely been used in pharmaceutical and medical applications because of its properties, such as its biocompatibility in physiological environments and non-toxic degradation residues.[22] It has also been approved by the U.S. FDA for food and cosmetic products and GRAS materials.[23] Gelatin-based particles have been used as a carrier of proteins such as lysozyme, albumin, a variety of anticancer drugs, antivirals, antimicrobials, antimalarial drugs, anti-inflammatory compounds, and anti-diabetic therapy, and for gene delivery.[11, 21, 24-28] Its properties have been tailored by crosslinking with different materials (e.g., formaldehyde, glutaraldehyde, and other bifunctional reactives) as shown in Figure 2.2.

Figure 2.2. Crosslinking reaction mechanism of gelatin with glutaraldehyde.[28]

Another category of natural polymeric materials that has been commonly used as a drug delivery platform is liposomes and several liposome-based

15 formulations are currently in clinical use.[29] Liposomes are vesicles that have one or many phospholipid bilayers that allow polar drug molecules to be entrapped in them. There have been two “generations” of liposomes based on size and charge.[30, 31] Delivery of multiple drugs, glycolipids and molecules, such as sialic acid, DNA or monoclonal antibodies, has been investigated.[29-31]

However, some of the limitations of this platform are the poor capability to retain encapsulated agents within, the effects of serum protein adsorption on drug release profiles, and their rapid clearance from circulation by uptake of mononuclear phagocytic cells. In attempts to improve their efficacy, poly(ethylene glycol) (PEG)-based coatings have been grafted to their surface to regulate release kinetics and to increase their in vivo half-life.[29, 31]

Although chitosan has been used in multiple applications since 1859, its potential use in pharmaceutical and biomedical applications has only beendeveloped in the last 20 years.[32] Chitosan is derived from the deacetylation of chitin, creating a polysaccharide with random units of D- glucosamine and N-acetylglucosamine as shown in Figure 2.3.[33] Chemical modifications of this material have been used to modulate their degradation rate for drug delivery. This includes combining or crosslinking it with other polymers to create hydrogels, fibers, micelles or particles that can be used to encapsulate a variety of agents such as immunosuppressants, antibiotics, vaccines, anti- inflammatory drugs, DNA, siRNA, and different proteins.[3, 32, 34, 35] A concern with this platform is that its functional properties depend on the chain length, charge density and distribution, molecular weight, degree of deacetylation and

16 pH, which all influence the toxicological profile of drug delivery systems based on chitosan.[3, 33, 35]

Figure 2.3. Chemical structure of chitosan with X = degree of acetylation and n = number of sugar units per polymer.[32]

2.2.2. Polyesters Poly(glycolic acid) (PGA), poly(lactic acid) , poly( ε-caprolactone) (PCL) and their copolymers (e.g., PLGA) have been extensively studied as biomaterials for drug delivery. These polyesters are biodegradable materials and were originally designed for sutures, due to their degradation into natural compounds such as L-lactic acid and glycolic acid. These materials have been characterized extensively and their synthesis and fabrication conditions have been tailored to obtain physical and chemical properties desirable for different applications in drug and vaccine delivery. A wide variety of delivery vehicles based on PLGA,

PLA or PGA have been developed, such as particles, films, scaffolds and fibers for various agents (e.g., antibiotics, anti-cancer drugs, proteins, DNA).[35-46]

Their commercial availability and ease of processing has enhanced their use by researchers.

The physicochemical properties of these biomaterials are highly dependent on the copolymer composition. The bulk erosion mechanism is controlled by the ratio of glycolic acid to lactic acid in PLGA copolymers. The higher the glycolic acid content, the faster is the erosion rate. [44, 47] However, the bulk eroding nature of PLGA also results in microenvironments that are dominated by the presence of GA, which lowers its solubility in non-toxic solvents, causing a threshold of 50 mol% of glycolic acid, limiting the control over release kinetics.

Poly ( ε-caprolactione) (PCL) is a synthetic α-polyester that has a low

Tg.[35] PCL is FDA approved for drug delivery and sutures because of its biodegradable characteristics and slower degradation profiles when compared with other polymers of the same family (i.e., lactic and glycolic acids). PCLA has been commonly used in blends to modulate the release rate of rapid degradation materials.[35, 43] Even though this polymer exhibits bulk erosion, its crystalline structure extends its in vivo half life to over two years by slowing down fluid entrance to the polymer matrix.[48, 49] PCL has been studied as a drug carrier for its mechanical properties by combining it with lactic acid to improve its processability and decrease its degradation rate.[48],[50]

The degradation process of polyesters occurs in four steps. First, water enters the polymer matrix and cleavage of ester bonds occurs (Panel B, Fig. 2.4).

Second, a differentiation begins between the surface and inner sections and a highly acidic environment causes the rapid degradation of the polymer structure

(Panel C, Fig. 2.4). Third, low-molecular weight oligomers are transported

18 towards the outer layer, and when the molecular weight decreases to a certain threshold allowing its solubilization in the liquid environment, allowing more water to penetrate, thus enhancing the degradation of the polymer (Panel D, Fig. 2.4).

Finally, as depicted in Panel E of Fig. 2.4, the shell remains after the inner core has been solubilized, completing the process (Panel F, Fig. 2.4).[51]

Figure 2.4. Scanning electron photomicrographs of (75:25 L/G) PLGA microspheres at different degradation states. A) Immediately after preparation, B) 1, C) 4, D) 7, E) 14, and F) 76 days after degradation at 37°C. Release studies were performed at 37°C in phosphate buffer saline ( 7.5 mg/mL). [51]

A limitation of polyester-based devices is their bulk erosion, which does not offer control of the release rate of the payload. In addition, the highly acidic microenvironments and degradation products of these copolymers affects the stability of the payload.[47, 52] Finally, a bolus-type burst release occurs when

19 these materials are subject to aqueous conditions, and the hydration of the polymer matrix can destabilize the pH-sensitive payloads.[44, 53, 54]

2.2.3. Polyurethanes Polyurethanes are synthetic thermosetting polymers with urethane or carbamate bonds (-NH-COO-) in their backbone structures that are formed by the reaction of isocyanates and diols. Devices made of these materials have been widely used in the biomedical and pharmaceutical fields that include heart valves, intra-aortic balloons, aortic grafts, catheters, vascular grafts, implants, and drug delivery systems.[55, 56] These materials have been tailored to have biodegradable properties for use in ligament reconstruction, temporary scaffolds, and controlled release devices.[55, 57, 58] This was achieved by the addition of labile or hydrolyzable moieties in the polymeric structure backbone such as polyols.

Regarding the use of these materials as drug delivery vehicles, local delivery of clorhexidine diacetate (CDA) was demonstrated using non-degradable medical grade polyurethane for antiseptic use in dentistry and other topical uses.[57] In addition, biodegradable polyurethanes with polyols were reported to deliver gliclazide, which is a hydrophobic drug for diabetes.[59] Furthermore, polyurethane implants have been used to release dexamethasone.[60] Even though polyurethanes have been widely used in biomedical applications, their long-term safety and efficacy still needs to be further analyzed. Due to the necessity to incorporate chemical moieties that allow degradation, polyurethanes have seen limited use for controlled drug delivery.

2.2.4. Vinyl polymers Polymethacrylates are synthetic anionic and cationic polymers that are

FDA-approved with a safe and non-toxic profile. They are synthesized using dimethylaminoethylmetacrylates, methacrylic acid, and methacrylic acid esters in different ratios. Their usage has been primarily in transdermal delivery systems.

Commercialized as Eudragit ©, polymethacrylates have been studied as delivery vehicles for drugs such as felodipine (widely used in the treatment of hypertension) and model proteins as albumin.[61-64]

Poly(vinyl alcohol) (PVA) is a synthetic water-soluble polymer (Figure 2.5) that is non-toxic, biocompatible, and biodegradable. This material is hydrophilic and swells up when subjected to hydration; previous studies report volume expansion up to 500%.[65] This material and copolymers thereof have been used in controlled drug delivery systems.[66-69] The release kinetics profile of drugs from these materials can be controlled by the content of vinyl alcohol, by incorporating electrolytes into the polymer matrix and by application of film coatings onto the PVA-based materials.[65, 70] These materials have been synthesized via cryopolymerization of a highly concentrated PVA solution by several freeze-thaw cycles.[66, 71] This process helps avoid exposure of the payload to potentially harmful reagents and high temperatures. Release of drugs such as theophylline (for respiratory diseases treatment), oxytetracycline hydrochloride and tylosin tartrate (antibiotics for veterinary use) from PVA-

21 hydrogel systems and proteins (i.e. albumin, insulin and IgG) has been previously reported.[64, 72]

Poly(acrylic acid) (PAA) is an anionic biocompatible polyelectrolyte (Figure

2.5) that has been previously used for pH-sensitive drug delivery.[67, 68, 73]

PAA has the unique property of being in the liquid phase at pH 5 and becoming a gel at pH 7.[68] Permeation of cations into the gelled polymer collapses the gel back to a liquid. In addition, this polymer possesses highly mucoadhesive properties. These characteristics are desirable for drug delivery due to the previously mentioned swelling properties in aqueous conditions, allowing the release of molecules or proteins at neutral pH. Systems based on PAA generally have rapid release kinetics and the high water solubility of the polymer limits its use.[68, 74] These drawbacks can be overcome by crosslinking PAA with other polymers, but their interactions determine the mesh size, degradation rate, and diffusion of the encapsulated agent.[70] Lightly crosslinked PAA-based systems have been commercialized such as Polycarbophil ® and Carbopol ® and exhibit favorable mucoadhesive properties for drug delivery in the gastrointestinal tract.[74]

Figure 2.5. Chemical structures of common vinyl polymers (PVA and PAA).[73]

2.2.5. Poly(alkyl cyanoacrylates) Poly(alkyl cyanoacrylates) (PACA) are biodegradable polymers that have been extensively used to prepare nanoparticles for drug delivery.[75, 76] The degradation of PACA is carried out by esterases as shown in Figure 2.6 and is highly dependent upon the length of the alkyl chain.[75, 76] Cyanoacrylates are acrylic monomers that are rapidly polymerized in the presence of water via anionic or zwitterionic polymerization. Therefore, low amounts of water can trigger the polymerization reaction, forming long chains of PACA. Since 1960, cyanoacrylates have been studied for use in biomedical application, as adhesives or degradable sutures.[75]

Ethyl, n-butyl and octyl cyanoacrylate have been approved by the FDA, encouraging the development of novel applications with these materials.[75, 76]

Recently, PACA nanoparticles were used for antileishmanial, loperamide, dalargin, tuborcurarine, methotrexate and doxorubicine delivery since it has been shown to cross the blood brain barrier and been up taken by tumor cells.[77-85]

The ability of PACA nanoparticles to overcome multi-drug resistance allows them to target tumors more effectively than regular chemotherapy since the PACA nanoparticles adsorb to the tumor cell surface, and the formation of an ion pair between the drug and the polymeric particles, thus enhancing their drug delivery.[85] However, the development of delivery platforms based on these polymers has been restricted to applications where rapid degradation of the

23 polymer matrix is desirable, thus reducing its value as a vehicle that can provide sustained release kinetics.

Figure 2.6. Degradation mechanism of PACA by esterases.[85]

2.2.6. Polyethers Polyethers have been used in biomedical and pharmaceutical fields due to their high biocompatibility and high chemical stability.[86, 87] The most commonly used polyether is polyethylene glycol (PEG). PEG is a non-toxic, highly water soluble, non-immunogenic material that is FDA approved.[86, 87]

The use of PEG has increased due to its ability to enhance uptake and increase solubility of various drugs and antigens.[86, 88] Polyether-based platforms have been developed for multiple applications, because they have a long half-life in the body, reduce immunogenic activity of attached proteins, and are not affected by the enzymatic activity of the metabolism of the body which mechanism can be seen in Figure 2.7.[86, 89, 90] In order to confer these properties on other materials, processes have been developed to link PEG chains to molecules such as proteins and peptides.[86, 89, 90]

Figure 2.7. Depiction of PEGylation of a protein.[86]

PEG-based systems have been commercialized for multiple applications, including cancer therapy, diagnostics and drug/antigen delivery.[88]

Commercialized PEgylated molecules such as Pegasys ® and Pegintron ® (α-

Interferon), Neulastra ® (granulocyte colony stimulated factor (GCSF)), and

Adagen ® (adenosine deaminase) have been approved by the FDA.[88, 90]

Clinical studies of PEG-conjugates have included IL-2, hemoglobin (for patients under radiation treatment for solid tumors), growth hormone antagonist, and staphylokinase mutein (for treatment of acute myocardial infarction).[88, 90]

One potential limitation to the use of PEG is that it is non-degradable, and so if high molecular weight PEG is used, it could accumulate in the kidney and liver.[86] In addition, these materials have loading restrictions that can be overcome by attaching dendrimeric structures onto the surface of the polymer groups, but these modifications increase the cost of the product.[88]

2.2.7. Polyanhydrides Polyanhydrides were first synthesized in 1909 and used for textile applications by DuPont in the 1930s. These polymers are hydrolytically unstable and degradable, which has made them viable candidates for its use in medical and pharmaceutical applications.

Figure 2.8. Basic chemical structure of polyanhydrides.[91]

Polyanhydrides are versatile materials due to the hydrolytic reactivity of the anhydride linkage (Figure 2.8), which is the most reactive among carbon or carbonyl bonds. This characteristic allows them to form different backbone structures, but maintain the biodegradability of the polymer. By modifying the length of the main chain and/or copolymerization of anhydride monomers in multiple ratios can help tailor the degradation of the polymer.[92-100] For example, ethylene glycol groups have been inserted into a 1,6-bis( p- carboxyphenoxy)hexane (CPH) backbone, replacing the hexane, and creating a more amphiphilic anhydride called 1,8 bis( p-carboxyphenoxy)-3,6 dioxaoctane)

(CPTEG).[97]

The classical method to prepare polyanhydrides is to use melt polycondensation.[93] A dicarboxylic acid is refluxed using excess of acetic

26 anhydride, obtaining a mixed anhydride solution. Then acetic anhydride is removed using high temperatures and vacuum to generate high molecular weight polyanhydrides. The reaction time and temperature, as well as the presence of catalysts, have a direct impact on the polymer chain length, purity, and polydispersity index.

The tailorable degradation kinetics of polyanhydrides is one of the main benefits of these materials with respect to drug delivery applications. The degradation rates of polyanhydrides have been shown to vary from a week to several months by simply changing the molar ratio of the monomers.[97-99] The most hydrophobic monomer studied is CPH and increasing its content in the copolymer slows the release of payload, while the amphiphilic (i.e., CPTEG- containing) copolymers exhibit a higher burst effect and accelerates the polymer degradation, leading to faster release profiles for payload.[97, 101]

Because of their hydrophobicity, these materials possess a surface erosion mechanism that can be controlled by copolymer composition.[97, 98,

100, 102-105] Due to the ability of polyanhydrides to control their degradation kinetics, multiple drugs have been encapsulated within these materials, including drugs for eye and neuroactive disorders, antibiotics, anticoagulants, anticancer, and chemotherapeutic agents.[106-110] A polyanhydride-based device that has been approved by the FDA for human use is the Gliadel ® wafer, composed of a

20:80 ratio of 1,3 bis( p-carboxyphenoxy) propane (CPP) and sebacic acid (SA), which is loaded with carmustine (1,3-bis(2-chloroethyl)-1-nitro-sourea (BCNU)) and used as a post-surgical brain tumor implant.[111] Other drug delivery

27 applications include a polyanhydride cylinder for the delivery of anesthetic drugs,[35] oral delivery of insulin,[93] and plasmid DNA and delivery systems to treat brain tumors.[35] The commercially available Septacin ® devices for antibiotic delivery are based on copolymers consisting of sebacic acid and dimers of erucic acid.[105, 106]

Poly(sebacic acid), which is the most well-studied polyanhydride, degrades in a period of weeks when subjected to water conditions.[93] SA also can be polymerized with other monomers such as fumaric acid, which increases its circulation in the body and enhances its properties for oral bioadhesive administration of dicumarol (anticoagulant).[107] It has also been used in combination with fatty acid dimer to analyze the release of multiple proteins such as lysozyme, trypsin, heparinase, ovalbumin, albumin and immunoglobulin.[97,

98, 101, 102]

Polyanhydrides have been recently used as vaccine delivery carriers using copolymers based on CPH, SA, and CPTEG, (Figure 2.9). These materials have been fabricated into microparticles and nanoparticles and administered via different routes (i.e., intranasal, subcutaneous) for the delivery antigens to the immune system.[103, 104] Previous studies have analyzed the biocompatibility, antigen stabilization, release kinetics, efficaciousness, and immunomodulatory effects of this system using both in vitro and in vivo models.[103, 104, 108-110,

112-122]

Figure 2.9. Chemical structures of SA, CPH (middle) and CPTEG (bottom). [110,123]

In vitro and in vivo studies have been used to analyzed the interactions of polyanhydride particles in order to rationally design “pathogen mimicking” nanoparticle-based platforms to effectively stimulate the immune system.[117,

118, 120-122] Delivery of different molecules to antigen presenting cells has been studied to analyze activation patterns and determine appropriate formulations of polyanhydride nanoparticles to induce immune activation.[114,

117, 120-122] Antigenically stable proteins have been released after encapsulation into polyanhydride nanoparticles: including tetanus toxoid, ovalbumin, PA (protective antigen towards Bacillus anthracis ), PspA

(Pneumococcal surface protein A, a virulence factor of Streptococcus

Pneumoniae ), and viral hemagglutinin (Influenza surface protein).[98, 101, 114-

117, 124] In addition, surface functionalization of polyanhydrides nanoparticles with targeting molecules (e.g., carbohydrates) has been performed to enable specific interactions with receptors on immune cells.[117, 120, 122] Finally, in

29 vivo studies using a murine model have demonstrated induction of both humoral and cellular responses, as well as efficacy against live challenge.[125, 126]

2.3. Nanoparticle characteristics as adjuvants and/or delivery vehicles

The main characteristics of nanoparticles that affect their performance as adjuvants and/or delivery vehicles include particle size, shape, hydrophobicity and surface charge.

2.3.1. Particle size Particle size and size distribution determine the biodistribution after administration, loading of antigens and their release kinetics, and interactions with immune cells. For some immunization routes, particle size is even more important because of the deposition, uptake, and distribution in the organs exposed to the administration site. Generally, small sized particles are considered more ideal for biological barrier permeation, cellular uptake, and for crossing capillaries after administration.

Particle size is typically characterized using different methods, especially for submicron particles. These methods include light scattering, microscopy

(scanning electron microscopy, transmission electron microscopy, and atomic force microscopy), laser light diffraction, analytical ultra-centrifugation, field flow fractionation, chromatography, and capillary electrophoresis.[127]

Payload amount and release kinetics from particle delivery systems are affected by particle size.[128, 129] Due to the larger surface area, smaller particles have the encapsulated agent closer to the surface, and therefore, when degradation occurs they result in a larger burst of payload and a faster release profile compared to larger particles. Microparticles generally have cores that allow higher amounts of payload to be encapsulated. Release rates of different payloads have been analyzed and found to be dependent upon particle size, in addition to the inherent physicochemical interactions between the payload and the biomaterial.[129, 130]

Another aspect that is affected by particle size is the in vivo biodistribution of nanoparticles. When used in intravenous formulations, small particles (<20-30 nm) are eliminated by renal excretion, while larger particles are taken up by phagocytic monocytes and transported to the liver, spleen, and bone marrow (in smaller amounts).[131] It is known that 30-150 nm nanoparticles locate in the bone marrow, heart, kidney, and stomach, while 150-300 nm particles are localized in the liver and the spleen.[132-134] There are also fenestrations in the aforementioned organs that allow particles to escape the endothelial barrier and enter the parenchyma of the liver and spleen. Generally, these fenestrations allow 20-400 nm particles to travel across the previously mentioned organs.

However, when inflammation or tumors affect the area, this size is increased to

780 nm.[127]

Multiple studies have shown advantages of nanoparticle delivery platforms for drug and vaccine delivery over micron-size vehicles.[130, 135-137]

Nanoparticles are more readily internalized by cells compared to microparticles, specifically for intracellular targets because of their smaller size.[136, 137]

Additionally, the use of smaller size therapeutic delivery systems has shown to be more effective to cross the blood brain barrier and sustain release of treatment agents for brain tumors.[138, 139] Regarding particle internalization, submicron particles are more efficiently internalized by a wider diversity of cells than are particles larger than one micron.[129, 140]

Nonetheless, studies of nanoparticle systems used as vaccine delivery vehicles have reported that immune responses depend on size for different formulations.[130, 137] Particles ranging in size from 20 nm to 70 m have been used in vaccine formulations and have resulted in different cellular activation and immunological responses.[137, 140] A key step in the induction of robust immune responses is to enable antigen to reach the lymphatic system. One way to accomplish this is through antigen presenting cells (APCs) that can control, enhance, and mediate the immunological consequences elicited by vaccination.

Previous studies have reported that particles with a size of 500 nm or less are optimal for APC uptake.[141-143] Within this range, using a model for respiratory syncytial virus, 20-200 nm particles are taken up via endocytosis, eliciting Th1- type cellular immunity. In contrast, following this same model, it was reported that particles >500 nm are internalized by phagocytosis or micropinocytosis, and generated a more humoral response.[142] In a related study using 430 nm, 1 µm,

10 µm, and 32 m polystyrene particles, it was shown that the 430 nm and 1 m particles were effectively internalized by dendritic cells, but the internalization

32 decreased as particle size increased, based on observations using confocal microscopy.[144]

The route of delivery also has an important effect on the induction of immune response, more so than particle size. For example, oral and intranasal

(i.n.) immunization of tetanus toxoid (TT) using 100 and 450 nm and 1 µm sulfobutylated poly(vinyl alcohol)-graft-poly(lactide-co-glycolide) particles was performed and anti-TT IgG titers were measured.[145] Using the i.n. route, the

450 nm formulation elicited higher titers than oral administration; however, when the 100 nm particles were administered, the latter route generated a higher response. The microparticles performed similarly, regardless of route. Similar results have been reported in other studies using different antigens.[137] For intranasal administration, it is known that the particle size has significant impact on particle biodistribution, toxicity, deposition, and immune response.[146, 147]

Such effects have been studied using localized regions or whole lung deposition models.[146-148] Particle size determines the pattern of pulmonary deposition after inhalation and different sized particles are known to deposit in different regions of the lung as depicted in Figure 2.10.[149] These behaviors have also been modeled as shown in Figure 2.11.

Figure 2.10. Representation of the respiratory system and its sections.[149]

Figure 2.11. Average predicted total and regional lung deposition based on International Commission on Radiological Protection (ICRP) deposition model for nose breathing males and females engaged in light exercise. Alv: alveolar region; TB: tracheobronchial region.[150]

2.3.2. Shape Among particle characteristics, size and surface charge have been studied extensively to assess their influence on the immune response.[129, 151]

However, very few in vivo studies have compared the effect of differently shaped nanoparticles on the resultant immune response.[151] Studies have shown that particle shape influenced different aspects of particle-based delivery systems, such as their biodistribution, cellular internalization and toxicity.[151]

Methods to create particles of different shapes include using pre- fabricated spherical particles and modifying their shape as shown in Figure 2.12 or using lithographic methods such as the PRINT TM technology that has been developed recently.[151-155] The first approach has limitations because

35 materials properties can render the creation of particles with different aspect ratios difficult.

Figure 2.12. False-colored scanning electron photomicrographs of alveolar macrophages interacting with polystyrene particles with different shapes. A) Elliptical disk (attached at the end side), B) Elliptical disk (attached at the flat side), and C) spherical nanoparticle. Scale bar=5 m.[151]

Initial studies focused on the impact of shape on the release kinetics of payload.[156] Previous studies have shown that drug or antigen release is highly dependent on surface area, therefore, degradation of spherical particles when using surface erodible polymers resulted in zero-order kinetics after an initial burst.[93, 97, 156] Creation of non-spherical particles provides an opportunity to vary the release kinetics of drugs or antigens.

There have been limited efforts to analyze the effect shape following in vivo administration. Since it has been shown that non-spherical shapes and sizes can be located in different vesicles, organs, and tissues, initial studies have been focused on their biodistribution after administration to the body.[131, 132] The

36 non-spherical shape affects their alignment and permeation into organs, affecting how they drain to the lymphatic system, kidney, liver, or spleen. Some experiments have shown that spherical particles need to be less than 200 nm in diameter to be able to enter the spleen after intravenous administration, while flexible disk-shaped red blood cells of even ~10 m can be transported through the spleen consistently.[131] This information, combined with the spleen morphology, which includes that the filter channels have slit forms, suggests that for certain applications, specific shapes might be more beneficial than traditional spherical structures.

It is known that particle uptake by APCs is affected by the shape.[151-154]

Previous studies have focused on preparing particles with the same surface area, but different shapes, comparing traditional spherical structures with non- spherical particles (i.e., cubes, rods) to analyze the differences in surface marker expression and cytokine secretion after particle internalization.[152, 153, 157] It is not clear if particle shape affects the activation mechanisms of APCs. An in- depth understanding of the effect of particle shape on APC activation and on tailoring the immune response may be desirable to design efficacious particle- based vaccines.

2.3.3. Hydrophobicity and surface charge Previous studies have analyzed the electrostatic characteristics of particle systems and their involvement in the induction of immune responses.[157, 158]

For specific applications, a negative surface charge is desirable to enhance

37 particle uptake into certain vesicles or phagocytic cells (e.g., macrophages), while for others (e.g., targeting to non-phagocytic cells) positive charge has shown to enhance their functionality.

For vaccine delivery applications in which getting antigen inside cells is highly desirable, the adsorption of serum proteins onto the surface of the particles (e.g., opsonization) is beneficial.[159] Therefore, the use of hydrophobic materials that enhance serum protein adsorption may enhance particle uptake.

Hydrophobicity is an important factor in particle internalization due to the lipid-rich domains that are present in the cell membrane, where interactions with cell- surface receptors, and complement proteins can be carried out.[159] Generally, as the hydrophobicity of the particle increases, the probability of particle internalization by phagocytic and macropinocytotic pathways also increases. In addition, receptor-mediated uptake may be enhanced by more specific particle- cell interactions.[160] This may be achieved by incorporating targeting strategies into hydrophobic particle-based systems.

However, when extended circulation of particles (e.g., for systemic gene delivery) is required, hydrophilic surfaces are required to reduce the interaction between the immune cells and the particle formulation. In order to achieve this, surface coating using methods such as PEGylation, as mentioned previously, have been used.[80, 86, 88] Other strategies include use of surfactants or copolymers such as polyethylene oxide, polyoxamer, and Tween 80 that enhance the hydrophilic characteristics of the particles.

2.4. Targeting mechanisms for drug and vaccine delivery

2.4.1 Introduction Many drugs and vaccines exhibit decreased efficacy upon in vivo administration because they are unable to reach their desired target cells or tissue. In recent years, numerous combination systems have been developed as represented in Figure 2.13 to enhance the potency of drugs and vaccines by designing delivery vehicles that can be targeted to specific organs, tissues, or cells.

Figure 2.13. Design of adjuvants/delivery vehicles for targeted delivery.[161]

2.4.2. Desired immune system components Among the desired targets for antigen delivery platforms, two types of cellular populations have generated great interest, which are cancer cells and

APCs.[162-164] Understanding and optimization of platform characteristics that play important roles in the efficient delivery of therapeutics to cancer cells and

APCs has been widely studied.

2.4.2.1. Tumor cells One of the main applications of targeted delivery systems is tumor treatment. Work in this area has focused on designing diagnostic systems and drug delivery vehicles that can locate cancer cells and help treat or aid in the surgical removal of tumors. To enable successful treatment of tumors, the most important characteristic is the specificity of the targeting molecule.

Previous studies in cancer therapy have shown that there are tumor- specific targets that can be utilized in order to deliver treatments to tumor sites.

Rational design of delivery approaches highly depend upon the knowledge of these targets and an appropriate administration route. For example, the folate receptor is over-expressed on the surface of many types of cancer cells, and is therefore, a popular target when drug delivery to cancer cells is desired.[165]

Previous studies have analyzed this strategy with tumor cell lines (e.g., HeLa,

HEK 293) and efficient cellular uptake was observed by attaching folic acid on the surface of poly(ethylene imine) coated mesoporous silica nanoparticles.[166]

Recent studies have identified other molecules that have great selectivity for

40 tumor cells, such as an adriamycin-conjugated PEG linker that has cleavable peptide sequences (alanyl-valine, alanyl-proline, and glycyl-proline) that is cleavaged at tumor cells.[165] Use of these molecules in active targeting approaches for cancer treatment is currently underway.

Another strategy that has been widely studied is the use of antibodies that are specific for cancer types. Several of these therapies have been approved by the FDA and they will become a commercial alternative for cancer treatment using less invasive methods than surgery; these products include Rituxan ®,

Herceptin ®, Mylotarg ®, Campath ®, Zevalin ®, Iressa ® as treatments for a variety of diseases including non-Hodgkins lymphoma, chronic lymphocytic leukemia, breast cancer and non-small cell lung cancer, among others.[161, 165, 167, 168]

Other methodologies for cancer therapy include targeting of molecules that stimulate angiogenesis, such as vascular endothelial growth factor (VEGF), basic fibroblast growth factor, platelet-derived growth factor, transferrin, or epidermal growth factor (EGF).[165, 169] This strategy uses angiogenesis inhibitors such as interferons ( α, β, and γ), thrombospondin-1 and -2, angiostatin, and endostatin. Drug therapies that have been widely studied for cancer therapy include the use of doxorubicin, paclitaxel and camptothecin-based molecules.[165, 169] Appropriate and specific design of these systems to target molecules present in cancer cells can help improve the delivery of treatments to tumor sites and also help in cancer diagnosis.

Targeting mechanisms can be active or passive; active targeting involves the attachment of molecules that are specifically recognized by receptors (e.g.,

41 proteins, carbohydrates), while passive targeting depends on particle characteristics, such as size, shape, and chemistry. The benefits of using targeted strategies are enhanced cellular uptake, dose sparing, specificity of therapy, and improved efficacy.

2.4.2.2. Antigen presenting cells Among the components of the innate immune system, the first line of defense depends on the correlated action of APCs, neutrophils, natural killer

(NK) cells, complement, mucosa, physical barriers (e.g., skin), cytokines and chemokines that act together to uptake foreign entities and if necessary initiate immune responses towards them. The innate immune cells are generally available at tissue or organ surfaces, besides the lymphatic system which is the main link between the innate and adaptive immune responses. After the initial response, T and B lymphocytes join the immune repertoire, thus, eliciting complete immune system activation.

Dendritic cells (DCs) are leukocytes that are specialized in antigen uptake, processing, and presentation, and are important in the integration of innate and adaptive immune responses. These cells are generally located at the interface between the body and environment; therefore, they have the ability to screen for a wide variety of foreign entities. These cells possess properties that make them central to the initiation of an immune response, such as antigen internalization, processing, and presentation, migration to lymph nodes, and activation of other

42 cells by cytokine secretion. Based on the context of APC activation, and by establishing specific combinations of the above properties, these cells are able to influence the type of immune responses.

There are two stages in DC activation that can decide the type of immune response that is mounted towards an antigen. The first step is the recognition of a danger signal, which triggers DC differentiation and activation, thus attracting other cells, due to cytokine and chemokine secretion, and expression of co- stimulatory molecules, guiding the activated DCs to the lymph nodes. The second step starts when DCs enter the lymphatic system and drives generation of antigen-specific T cells that then interact with B cells for the secretion of antibodies.

Macrophages are also sentinel cells that phagocytose foreign bodies and are involved in innate immunity. These cells internalize and digest viruses, bacteria, and parasites, and then present antigen moieties to trigger an immune response. However, they are located in specific organs and their interaction with the lymphatic system is limited, unless they interact with DCs for their activation.

Despite this limitation, macrophages are very important in the immune responses generated in certain organs, such as the lungs.[170]

In order to recognize the aforementioned danger signals, APCs have pattern recognition receptors (PRRs) that recognize microbial-associated molecular patterns (MAMPs), which are small moieties that are present in a variety of pathogens. Recognition of these PAMPs (Figure 2.14) leads to APC activation and triggers the immune cascade. PRRs can be membrane bound or

43 cytosolic. Included in the first group are Toll-like receptors (TLRs) and C-type lectin receptors (CLRs), while retinoic acid-inducible gene I-like (RIG-I) receptors and nucleotide-binding oligomerization domain (NOD-like) receptors belong to the second group .

Figure 2.14 . Methods of pathogen recognition by pattern-recognition receptors (PRRs) in APCs.[164]

One of the main APC targeting strategies is the use of TLR ligands to specifically interact with TLRs. These receptors are single-pass type I transmembrane-spanning proteins characterized by multiple leucine-rich repeats.[171] A total of 13 TLRs have been identified in mice and humans, but not all of them are present in all mammalian species. TLRs have been identified,

44 each with a different origin or possible applications that recognize a small collection of pathogen--derived molecules. Their specificity is shown in Figure

2.15.

Figure 2.15. Identified members from the Toll -like receptor family with their respective agonist, origin, and examples. [171]

Another commonly targeted group of PRRs is the CLR family. C -type lectin receptors bind carbohydrates (e.g., mannose, fucose) in a calcium - dependent manner using highly conserved glycan -recognition domains. [172,

173] CLRs can recognize a wide variety of microbes, leading to their internalization and presentation, which initiates an immune respon se. There are a variety of CLRs that are present in DCs and macrophages, including the

CD206 macrophage mannose receptor (MMR), CD209 (DC -SIGN), Dectin -1,

DEC-205, and the macrophage galactose lectin (MGL). [172] Because of the importance of these receptors in the pathogenesis of multiple diseases, it has been suggested that targeting this signaling pathway can be very important for vaccine design. [173, 174]

2.4.2.3. Targeting approaches

The concept of targeting was initiated by Paul Ehrlich making the hypothesis that a magic bullet could efficaciously enhance the properties of drugs by directing them to their target. [160] This concept involved two main components: one that would recognize and specifically bind the target and another that would provide therapeutic action to the targeted location. Since the development of subunit vaccines and new drugs, this concept has expa nded to three components as depicted in Figure 2.16: the first is the antigen or the drug, the second is the carrier or the adjuvant, and the third is the targeting mechanism or molecule. Carrier vehicles currently include polymer vehicles, particles, cell s, proteins, liposomes, and micelles. All of these delivery vehicles have been functionalized for targeting using a wide variety of strategies, including antigen or drug specificity, targeting molecules, and environmentally responsive platforms.

Figure 2.16. “Magic bullet” development is based on three components: antigen or drug, adjuvant or delivery vehicle, and targeting molecule. [160]

2.4.2.4. Antigen specificity Some of the strategies explored in this area include the use of antibodies, which have been used in monoclonal forms to target the desired location for drug and antigen delivery.[165, 174, 175] For specific diseases (i.e., cancer), the properties of these antibodies have been exploited to increase the effectiveness of antitumor treatment delivery to the desired site.[174] One of these strategies involves the engineering of these molecules to create bispecific antibodies that have dual affinities, one to the tumor therapeutic molecule and the second to a molecular target in the tumor environment.[165, 174]

As mentioned previously, the use of monoclonal antibodies to enhance target treatment for cancer therapy has led to several FDA-approved products, such as Rituxan ® or Zevalin ®, which are based on anti-CD20 antibodies for non-

Hodgkin’s lymphoma, Mylotarg ®, which is an anti-CD33 antibody for acute myelogenous leukemia, and Campath ®, which is an anti-CD52 antibody for B cell chronic lyphocytic leukemia.[165, 174] These therapies are designed to target and specifically kill cancer cells, either by direct action of the antibody (i.e., receptor blockade, delivery of a drug or cytotoxic agent), immune-mediated cell killing mechanisms (i.e., complement-dependent cellular cytotoxicity), or specific effects on tumor vasculature , and most importantly, by avoiding damage to healthy cells surrounding them.[176] The use of these platforms also elicits an immune response towards the tumor in order to prevent its proliferation by activation of multiple components of the immune system.[176-178]

2.4.2.5. Environmentally responsive delivery vehicles In recent years, there have been numerous advances in the design of delivery platforms that respond to their environmental conditions (i.e., pH, temperature). These delivery vehicles can be rationally engineered to change their physical or chemical characteristics when entering into a specific environment. In addition to pH and temperature, other stimuli-responsive platforms involve mechanisms such as ultrasonic radiation, electric field, glucose levels, urea, morphine, antibody concentration, and temperature.[179, 180]

There are different pH responsive therapies that have been developed.

Generally, these therapies have been designed to release their therapeutic payload in endosomal compartments, or within the stomach or intestines, that have different pH than the rest of the gastrointestinal tract.[179, 180] Hydrogels exhibit controlled swelling properties that are stimuli-responsive.[69, 70, 180] By changing their structural conformation, they release cargo at the location where the pH is different.[69, 179] This technology has been applied to deliver drugs, such as amoxicillin, salicylamide, prednisolone, riboflavin, and salicylic acid, among others.[69, 70, 179-181]

Another methodology that has been well studied is temperature- responsive platforms. One of the applications of these platforms is in the design of micelles and nanogels that modify their structure at physiological temperatures. The aforementioned platforms have been used for drug and vaccine delivery, DNA or dsRNA delivery, and gene therapy.[179, 182] Release and delivery of curcumin, paclitaxel, and other drugs or compounds from such materials have also been investigated.[179, 182, 183]

2.4.2.6. Channeling molecules

Conjugation of specific ligands onto delivery vehicles shares a conceptual framework with the previously referred, for the purpose of enhancing the delivery of therapeutic drugs or vaccine delivery. These molecules typically target cellular receptors on APCs or tumor cells. In addition, peptide and drug attachment on the surface of various delivery vehicles has also been explored.[160, 173, 184,

185] Molecule-based targeting approaches are highly dependent on the specificity of the targeting mechanism. These mechanisms will be discussed in more detail in Section 2.4.3, where active targeting approaches for nanoparticles will be discussed. Similar studies have been carried out with polymeric micelles, nanogels, nanotubes, microparticles, and liposomes, among others.[29, 69, 171,

186-188]

2.4.3. Nanoparticle targeting strategies In the design of novel vehicles for drug and vaccine delivery, nanoparticles have taken center stage. Due to the ability to fabricate nanoparticles with a wide variety of materials, and to control their size, shape and surface chemical characteristics, numerous nanoparticle-based platforms have been developed for drug and vaccine delivery.[35]

Targeted nanoparticles have been widely studied to enhance antigen or drug delivery. There are two ways of designing targeted nanoparticles: passive

49 and active. The first is based on the control of particle characteristics such as size, shape, charge, or chemistry. The second is based on attachment of targeting molecules such as antibodies, carbohydrates, TLR agonists or peptides, among others.

2.4.3.1. Passive targeting

A significant advantage of nanoparticles over other approaches is their ability to effectively deliver their payload to specific regions of the body, their internalization by cells, and the ability to fabricate them using a wide variety of materials. This is enabled by control of particle characteristics such as size, shape, charge, or chemistry. These properties allow tailoring nanoparticle characteristics to release antigen or drug in a controlled manner as discussed in

Section 2.3.

2.4.3.2. Active targeting

In recent years, active targeting of nanoparticle platforms has received enhanced interest in order to design highly specific delivery vehicles that can target different cellular populations, environments, or receptors. Among these strategies, linkage of molecules that can be recognized by a selected number of receptors in restricted cell populations has been widely used.[129, 131, 160]

These molecules can have a wide variety of functionalities, such as antibodies, carbohydrates, and peptides, among others.[129, 131, 160, 173] This strategy

50 has been previously studied with tumor cells as described previously in Section

2.4.2.1.

TLR targeting strategies have also been incorporated into multiple platforms. Poly I:C, CpG oligonucleotides, and lipid-related molecules are some of them, that have been used to target Toll-like receptors in dendritic cells and macrophages, to deliver therapeutic drugs or molecules such as imiquimod, single stranded RNA, 852A molecule (TLR-7 agonist) and IMO-2055.[184, 189]

By incorporating TLR agonists, previous studies have shown an enhancement in particle internalization and response by the desired target cells (i.e., cancer cells).[184, 189]

Carbohydrate targeting has been explored more recently thanks to a more detailed understanding of viral and bacterial mechanisms of cellular entry and infection.[162, 172, 190, 191] Specific receptors such as DC-SIGN and MMR have been targeted by using functionalized nanoparticles with glycan moieties.[173, 192, 193] These nanoparticles mimic the natural process recognition by APCs as shown in Figure 2.17. CLRs, as previously described, recognize sugar residues and internalize them (some CLRs, like Dectin-2, require cross-linking before uptake mechanisms are initiated), making them a viable target to enhance antigen delivery and presentation.

Several studies have analyzed the role of targeting CLRs in the development of vaccines. Because conventional strategies have encountered multiple challenges in the prevention and treatment of severe infectious diseases, including Acquired Immunodeficiency Syndrome, tuberculosis,

51 autoimmune diseases, or cancer; use of active targeting strategies involving carbohydrates to mimic their pathogenic behavior and elicit immune responses are being explored.[162, 194-196] Some of these initial studies include ex vivo stimulation of DCs by sugar-functionalized particles to deliver therapeutic drugs and activate immune cells.[117, 120, 122, 194] In addition, targeting of CLRs such as DEC 205, DC-SIGN, and MMR by antibodies have elicited antigen- specific CD4 + T cells and C8 + T cell responses.[172, 197, 198] In vivo immunization of mice with the Dectin-1 ligand curdlan, induces antigen-specific T cell immunity through the SYK-CARD9 pathway, generating CD4+ TH1 and

TH17 cells, as well as CD8 T cell responses.[172] These receptors can also be targeted by antibodies to induce tolerance to prevent autoimmune diseases, such as type 1 diabetes. As reported in previous studies, mannosylation of polyanhydride nanoparticles enhanced particle internalization, and induced DC and alveolar macrophage activation.[117, 120, 122] Also, mannosylated chitosan microparticles have been shown to effectively target the mannose receptor in alveolar macrophages.[163] These studies suggest potential strategies for immunization.

This platform has also used oligomannoses to modulate the immune response, based on the up-regulation of secreted IL-10.[190, 199] In addition, targeting DEC205 by antibodies resulted in the induction of tolerance in absence of TLR agonists included in the formulation.[200, 201] These results offer insights into the development of new strategies for the treatment of allergies and autoimmune diseases.

Figure 2.17. Antigen presentation using CLRs.[202]

For viral infections (e.g., human immunodeficiency virus (HIV)), the use of carbohydrate-targeting based strategies has been studied extensively due to the important role of the glycoproteins present on the surface of the HIV virion (i.e. gp41, gp120) and their involvement in the pathogenesis of the viral spread.[195,

196, 203] Targeting DC-SIGN using mannosylated structures has emerged as an important strategy in the development of HIV vaccines or treatments.[195, 196]

2.5. HIV: Overview and current challenges

The Human Immunodeficiency Virus (HIV) pandemic has become one of the major global health problems. An estimated 34 million people were infected as of 2011, and more than 25 million deaths have been attributed to the

53 subsequent disease, Acquired Immunodeficiency Syndrome, since it emerged in the early 1980s.[204] Sub-Saharan Africa and other remote locations still bear over 75 percent of new infections each year.[204] One of the main approaches in the development of an HIV vaccine is the mimicking of the viral envelope glycoproteins to elicit immune responses towards the virus by using subunit vaccines.

2.5.1. Overview of HIV infection HIV is a 120 nm spherical lentivirus of the Retroviridae family. The virion has two lipid membranes, called the viral envelope, formed by two trimers as shown in Figure 2.18. One of them is a group of external surface glycoproteins

(gp120) bounded to a stem of transmembrane glycoproteins (gp41). Envelope glycoproteins allow the fusion of the virus to the host cell membrane. Inside is a cone-shaped core that envelopes a capsid with more than two thousand copies of the virion and three enzymes (protease, reverse transcriptase and integrase), which are responsible for the proliferation of the virus inside the host. The capsid contains two strands of viral genomic RNA, which are precursors of the viral proteins that start cell transfection.

Figure 2.18. Depiction of an HIV virion.[205]

There are only a few monoclonal antibodies that have these characteristics, b12, 2G12, 447-52D, 2F5, 4E10 and Z13e1.[206, 207] The first three are specific to the HIV glycoprotein gp120 and the latter to gp41.

Nonetheless, antibodies that target gp41 have shown more breadth than the others.[206, 207] The 4E10 antibody neutralizes all the virus isolates from different clades, and even though 2F5 or Z13e1 do not neutralize every isolate, they have been shown to exhibit cross-clade activity.[206, 207]

HIV infection is characterized by sustained activation of the immune system. Upon entrance at the mucosal surface, HIV-1 infects submucosal CD4 +

T cells and initiates the spread of the viral infection. This virus does not rely completely on the host cell machinery, but also on its proteins that act during the cell cycle to modulate cellular signaling. Even though the entrance of this virus is through T cells, other types of cells are also permissive to HIV-1 infection,

55 including macrophages. Macrophages with or without infection become activated by the presence and the signaling cascade of the gp120 protein from the HIV virion. The activation of these two critical types of cells (CD4 + T cells and macrophages) helps to mount an immune response against the virus.

This virus is able to escape from adaptive antibody and T cell responses by eliciting persistent viral replication in macrophages and other immune cells and also by the consistent destruction of CD4 + T cells, which leads to the development of AIDS.[203, 207, 208] Infection with HIV-1 generates antibody responses towards viral proteins, but only antibodies against the surface- exposed envelope glycoprotein possess neutralization capabilities.[207-209]

2.5.2. Vaccine strategies Most successful vaccines involve the production of functional antibodies.

Licensed vaccines that have been developed towards viral infections generally elicit neutralizing antibodies (NAbs) towards the pathogen. Therefore, in the development of an HIV-1 vaccine, elicitation of Nabs is a primary goal. Even though neutralizing antibodies are generated as the infection progresses, by the time the immune response is mounted, the adaptive immune response is not able to fight the virus.

The main approach in the development of an HIV vaccine involves the elicitation of neutralizing antibodies by the construction of subunit proteins, based on the surface protein region, which involves gp41, gp120, and gp160. Among

56 these strategies, most efforts have been focused on the regions of gp120 and gp41, due to the availability and importance of these molecules in the viral entrance.[206, 208] Typically, peptides, mini proteins and other molecules have been constructed as vaccine antigens.[207, 210]

Since most of HIV infections are initiated via vaginal or rectal transmission, several researchers have investigated immune responses elicited in the mucosa-associated lymphoid tissue (MALT).[211, 212] The elicitation of antibodies using mucosal routes is shown in Figure 2.19. Therefore, many studies carried have been through immunizations at mucosal surfaces.

Regarding genital administration of vaccine antigens, specifically using intravaginal immunizations in animal models or humans, results have shown that this route generated antibodies predominantly in local secretions, but not systemically, which is necessary to fight an HIV infection.[211] In rectal immunizations, there have been studies where human volunteers in phase 1 clinical trials were injected intramuscularly with virus-like particle vaccines with

HIV p17/p24 proteins.[211, 212] The studies were carried out for six months with three immunizations and no strong immune responses were elicited by the individuals.[211]

Finally, it has been shown that intranasal immunizations have been the most successful in the generation of systemic responses and in the elicitation of neutralizing antibodies.[211] These immunizations include peptide antigens, DNA vaccines, and live bacterial and viral vectors.[212, 213] Polymeric nanoparticles

57 that were used intranasally with HIV-1 capturing nanoparticles generated antigen-specific immunoglobulin A in vaginal washes in mice.[211]

Figure 2.19. Mucosal immunization elicits antibodies against HIV.[211]

2.5.3 Current therapies and challenges Since there is no HIV vaccine currently available to prevent viral infection, the only available option is to treat patients already exposed to the virus. The treatment consists of the use of antiretroviral drugs (ARVs).[204] Antiretroviral therapy (ART) involves the combination of at least three ARVs to help suppress the effects of HIV and thus stop the progression of the disease. These therapeutics have effectively reduced the mortality rate of seropositives (HIV

58 infected subjects), particularly when used in controlled regimens and at early stages of the progression of AIDS.[204, 214]

Of the 34 million living people infected with HIV in 2011, the World Health

Organization (WHO) and the United Nations Programme on HIV/AIDS calculated that at least 15 million individuals need ART, of which 9.7 million individuals had access to it.[204] WHO has been highly involved in the prevention of HIV infection by offering education, support, and other tools and in efforts to increase production of ARTs so they can be delivered to developing countries.

These therapies do not prevent infection, or transmission of the virus, but they help control it and avoid disease progression. However, they are very expensive and require strict administration regimens, making it difficult to supply across the world. Thus, there is an urgent need to design a prophylactic tool that is easy to administer, that elicits strong immune responses against HIV, and that prevents viral infection.

2.6. Summary

Biodegradable polymers have been used for multiple applications, including as adjuvants/delivery vehicles for antigens. For HIV vaccines, the importance of the choice of adjuvant/delivery vehicle is particularly enhanced, since the potency of the immunogen and its delivery to specific locations or tissue is critical for the generation of a robust immune response. Polyanhydride

59 nanoparticles have exhibited desirable characteristics for antigen delivery as adjuvants and/or delivery vehicles. Therefore, exploiting their properties to design an HIV vaccine is a promising approach. This literature review suggests that to design an effective HIV vaccine, a combination of a potent antigen, an adjuvant that enhances the immunogenicity of the antigen and delivers it to the right cellular population(s), and a route of immunization that results in systemic responses to prevent HIV infection are necessary.

2.7. References

[1] Young. Introduction to polymers / Robert J. Young and Peter A. Lovell.

[2] Parris et al. New Delivery Systems for Controlled Drug Release from Naturally Occurring Materials 2008.

[3] Lim SM, Song DK, Oh SH, Lee-Yoon DS, Bae EH, Lee JH. In vitro and in vivo degradation behavior of acetylated chitosan porous beads. J Biomater Sci Polym Ed. 2008;19:453-66.

[4] Vermehren C, Jorgensen K, Frokjaer S. Influence of lipopolymer concentration on liposome degradation and blood clearance. Int J Pharm. 1999;183:13-6.

[5] Kratz F. Albumin as a drug carrier: design of prodrugs, drug conjugates and nanoparticles. J Control Release. 2008;132:171-83.

[6] Elsadek B, Kratz F. Impact of albumin on drug delivery--new applications on the horizon. J Control Release. 2012;157:4-28.

[7] Damodaran. Food Proteins and Their Applications1997.

[8] Elzoghby AO, Samy WM, Elgindy NA. Albumin-based nanoparticles as potential controlled release drug delivery systems. J Control Release. 2012;157:168-82.

[9] Thomas C, Rawat A, Hope-Weeks L, Ahsan F. Aerosolized PLA and PLGA nanoparticles enhance humoral, mucosal and cytokine responses to hepatitis B vaccine. Mol Pharm. 2011;8:405-15.

[10] Hirose M, Hirose A, Tachibana T. Recombinant human serum albumin hydrogel as a novel drug delivery vehicle. Mater Scie Eng C, Biomimetic materials, sensors and systems. 2010;30:664-9.

[11] Elzoghby AO, Samy WM, Elgindy NA. Protein-based nanocarriers as promising drug and gene delivery systems. J Control Release. 2012;161:38-49.

[12] Wunder A, Muller-Ladner U, Stelzer EH, Funk J, Neumann E, Stehle G, Pap T, et al. Albumin-based drug delivery as novel therapeutic approach for rheumatoid arthritis. J Immunol. 2003;170:4793-801.

[13] Damascelli B, Cantu G, Mattavelli F, Tamplenizza P, Bidoli P, Leo E, Dosio F, et al. Intraarterial chemotherapy with polyoxyethylated castor oil free paclitaxel, incorporated in albumin nanoparticles (ABI-007): Phase I study of

61 patients with squamous cell carcinoma of the head and neck and anal canal: preliminary evidence of clinical activity. Cancer. 2001;92:2592-602.

[14] Ibrahim NK, Desai N, Legha S, Soon-Shiong P, Theriault RL, Rivera E, Esmaeli B, et al. Phase I and pharmacokinetic study of ABI-007, a Cremophor- free, protein-stabilized, nanoparticle formulation of paclitaxel. Clin Cancer Res. 2002;8:1038-44.

[15] Kufleitner J, Wagner S, Worek F, von Briesen H, Kreuter J. Adsorption of obidoxime onto human serum albumin nanoparticles: drug loading, particle size and drug release. J Microencapsul. 2010;27:506-13.

[16] Kufleitner J, Worek F, Kreuter J. Incorporation of obidoxime into human serum albumin nanoparticles: optimisation of preparation parameters for the development of a stable formulation. J Microencapsul. 2010;27:594-601.

[17] Lee CH, Singla A, Lee Y. Biomedical applications of collagen. Int J Pharm. 2001;221:1-22.

[18] Friess W. Collagen--biomaterial for drug delivery. Eur J Pharm Biopharm. 1998;45:113-36.

[19] Cohen-Sacks H, Elazar V, Gao J, Golomb A, Adwan H, Korchov N, Levy RJ, et al. Delivery and expression of pDNA embedded in collagen matrices. J Control Release. 2004;95:309-20.

[20] Olsen D, Yang C, Bodo M, Chang R, Leigh S, Baez J, Carmichael D, et al. Recombinant collagen and gelatin for drug delivery. Adv Drug Deliv Rev. 2003;55:1547-67.

[21] Young S, Wong M, Tabata Y, Mikos AG. Gelatin as a delivery vehicle for the controlled release of bioactive molecules. J Control Release. 2005;109:256-74.

[22] Azarmi S, Huang Y, Chen H, McQuarrie S, Abrams D, Roa W, Finlay WH, et al. Optimization of a two-step desolvation method for preparing gelatin nanoparticles and cell uptake studies in 143B osteosarcoma cancer cells. J Pharm Pharm Sci. 2006;9:124-32.

[23] Veis A. The macromolecular chemistry of gelatin.

[24] Zwiorek K, Kloeckner J, Wagner E, Coester C. Gelatin nanoparticles as a new and simple gene delivery system. J Pharm Pharm Sci. 2005;7:22-8.

[25] Mladenovska K, Kumbaradzi E, Dodov G, Makraduli L, Goracinova K. Biodegradation and drug release studies of BSA loaded gelatin microspheres. Int J Pharm. 2002;242:247-9.

[26] Patel ZS, Yamamoto M, Ueda H, Tabata Y, Mikos AG. Biodegradable gelatin microparticles as delivery systems for the controlled release of bone morphogenetic protein-2. Acta Biomater. 2008;4:1126-38.

[27] Vandelli MA, Rivasi F, Guerra P, Forni F, Arletti R. Gelatin microspheres crosslinked with D,L-glyceraldehyde as a potential drug delivery system: preparation, characterisation, in vitro and in vivo studies. Int J Pharm. 2001;215:175-84.

[28] Hiwale P, Lampis S, Conti G, Caddeo C, Murgia S, Fadda AM, Monduzzi M. In vitro release of lysozyme from gelatin microspheres: effect of cross-linking agents and thermoreversible gel as suspending medium. Biomacromolecules. 2011;12:3186-93.

[29] Allen TM, Cullis PR. Liposomal drug delivery systems: from concept to clinical applications. Adv Drug Deliv Rev. 2013;65:36-48.

[30] Drummond DC, Meyer O, Hong K, Kirpotin DB, Papahadjopoulos D. Optimizing liposomes for delivery of chemotherapeutic agents to solid tumors. Pharmacol Rev. 1999;51:691-743.

[31] Immordino ML, Dosio F, Cattel L. Stealth liposomes: review of the basic science, rationale, and clinical applications, existing and potential. Int J Nanomed. 2006;1:297-315.

[32] Dodane Vr. Pharmaceutical applications of chitosan. Pharm Sci Technol To. 1998;1:246-53.

[33] Ren D, Yi H, Wang W, Ma X. The enzymatic degradation and swelling properties of chitosan matrices with different degrees of N-acetylation. Carbohydr Res. 2005;340:2403-10.

[34] Dash M, Dash F, Chiellini RM, Ottenbrite E. Chitosan:A versatile semi- synthetic polymer in biomedical applications. Prog Polym Sci. 2011;36:981-1014.

[35] Ulery BD, Nair LS, Laurencin CT. Biomedical Applications of Biodegradable Polymers. J Polym Sci B Polym Phys. 2011;49:832-64.

[36] Diez S, Tros de Ilarduya C. Versatility of biodegradable poly(D,L-lactic-co- glycolic acid) microspheres for plasmid DNA delivery. Eur J Pharm Biopharm. 2006;63:188-97.

[37] Danhier F, Ansorena E, Silva JM, Coco R, Le Breton A, Preat V. PLGA- based nanoparticles: an overview of biomedical applications. J Control Release. 2012;161:505-22.

[38] Cun D, Foged C, Yang M, Frokjaer S, Nielsen HM. Preparation and characterization of poly(DL-lactide-co-glycolide) nanoparticles for siRNA delivery. Int J Pharm. 2010;390:70-5.

[39] Duvvuri S, Gaurav Janoria K, Mitra AK. Effect of polymer blending on the release of ganciclovir from PLGA microspheres. Pharmaceut Res. 2006;23:215- 23.

[40] Ehtezazi T, Washington C. Controlled release of macromolecules from PLA microspheres: using porous structure topology. J Control Release. 2000;68:361- 72.

[41] Semete B, Booysen L, Lemmer Y, Kalombo L, Katata L, Verschoor J, Swai HS. In vivo evaluation of the biodistribution and safety of PLGA nanoparticles as drug delivery systems. Nanomed Nanotech Biol Med. 2010;6:662-71.

[42] Klose D, Siepmann F, Elkhamz K, Siepmann J. PLGA-based drug delivery systems: Importance of the type of drug and device geometry. Int J Pharm. 2008;354:95-103.

[43] Mohamed F, van der Walle CF. Engineering biodegradable polyester particles with specific drug targeting and drug release properties. J Pharm Sci. 2008;97:71-87.

[44] Makadia HK, Siegel SJ. Poly Lactic-co-Glycolic Acid (PLGA) as Biodegradable Controlled Drug Delivery Carrier. Polymers. 2011;3:1377-97.

[45] Primard C, Rochereau N, Luciani E, Genin C, Delair T, Paul S, Verrier B. Traffic of poly(lactic acid) nanoparticulate vaccine vehicle from intestinal mucus to sub-epithelial immune competent cells. Biomaterials. 2010;31:6060-8.

[46] Thomas C, Rawat A, Hope-Weeks L, Ahsan F. Aerosolized PLA and PLGA Nanoparticles Enhance Humoral, Mucosal and Cytokine Responses to Hepatitis B Vaccine. Mol Pharm. 2011;8:405-15.

[47] Ding AG, Schwendeman SP. Acidic Microclimate pH Distribution in PLGA Microspheres Monitored by Confocal Laser Scanning Microscopy. Pharmaceut Res. 2008;25:2041-52.

[48] Singh J, Pandit S, Bramwell VW, Alpar HO. Diphtheria toxoid loaded poly- (epsilon-caprolactone) nanoparticles as mucosal vaccine delivery systems. Methods. 2006;38:96-105.

[49] Shi R, Chen D, Liu Q, Wu Y, Xu X, Zhang L, Tian W. Recent advances in synthetic bioelastomers. Int J Mol Sci. 2009;10:4223-56.

[50] Lee J, Choi WI, Tae G, Kim YH, Kang SS, Kim SE, Kim SH, et al. Enhanced regeneration of the ligament-bone interface using a poly(L-lactide-co-epsilon- caprolactone) scaffold with local delivery of cells/BMP-2 using a heparin-based hydrogel. Acta Biomater. 2011;7:244-57.

[51] Cohen S, Yoshioka T, Lucarelli M, Hwang LH, Langer R. Controlled delivery systems for proteins based on poly(lactic/glycolic acid) microspheres. Pharmaceut Res. 1991;8:713-20.

[52] Dunne M, Corrigan I, Ramtoola Z. Influence of particle size and dissolution conditions on the degradation properties of polylactide-co-glycolide particles. Biomaterials. 2000;21:1659-68.

[53] Klose D, Siepmann F, Elkharraz K, Krenzlin S, Siepmann J. How porosity and size affect the drug release mechanisms from PLGA-based microparticles. Int J Pharm. 2006;314:198-206.

[54] Fredenberg S, Wahlgren M, Reslow M, Axelsson A. The mechanisms of drug release in poly(lactic-co-glycolic acid)-based drug delivery systems--a review. Int J Pharm. 2011;415:34-52.

[55] Cherng JY, Hou TY, Shih MF, Talsma H, Hennink WE. Polyurethane-based drug delivery systems. Int J Pharm. 2013;450:145-62.

[56] Asai T, Lee MH, Arrecubieta C, von Bayern MP, Cespedes CA, Baron HM, Cadeiras M, et al. Cellular coating of the left ventricular assist device textured polyurethane membrane reduces adhesion of Staphylococcus aureus. J Thorac Cardiovasc Surg. 2007;133:1147-53.

[57] Huynh TT, Padois K, Sonvico F, Rossi A, Zani F, Pirot F, Doury J, et al. Characterization of a polyurethane-based controlled release system for local delivery of chlorhexidine diacetate. Eur J Pharm Biopharm. 2010;74:255-64.

[58] Huynh CT, Nguyen MK, Lee DS. Biodegradable pH/temperature-sensitive oligo(beta-amino ester urethane) hydrogels for controlled release of doxorubicin. Acta Biomater. 2011;7:3123-30.

[59] Zhang JN, Wu MY, Yang JJ, Wu QY, Jin ZL. Anionic poly (lactic acid)- polyurethane micelles as potential biodegradable drug delivery carriers. Colloids Surf A. 2009;337:200-4.

[60] Moura SAL, Lima LDC, Andrade SP, Da Silva-Cunha A, Orefice RL, Ayres E, Da Silva GR. Local Drug Delivery System: Inhibition of Inflammatory Angiogenesis in a Murine Sponge Model by Dexamethasone-Loaded Polyurethane Implants. J Pharm Sci. 2011;100:2886-95.

[61] Domnina YA, Yeo Y, Tse JY, Bellas E, Kohane DS. Spray-dried lipid- hyaluronan-polymethacrylate microparticles for drug delivery in the peritoneum. J Biomed Mater Res A. 2008;87:825-31.

[62] Kim BK, Hwang SJ, Park JB, Park HJ. Preparation and characterization of drug-loaded polymethacrylate microspheres by an emulsion solvent evaporation method. J Microencapsul. 2002;19:811-22.

[63] Labouta HI, El-Khordagui LK. Polymethacrylate microparticles gel for topical drug delivery. Pharmaceut Res. 2010;27:2106-18.

[64] Burczak K, Fujisato T, Hatada M, Ikada Y. Protein Permeation through Poly(Vinyl Alcohol) Hydrogel Membranes. Biomaterials. 1994;15:231-8.

[65] Lee SY, Jang DH, Kang YO, Kim OB, Jeong L, Kang HK, Lee SJ, et al. Cellular response to poly(vinyl alcohol) nanofibers coated with biocompatible proteins and polysaccharides. Appl Surf Sci. 2012;258:6914-22.

[66] Jiang S, Liu S, Feng WH. PVA hydrogel properties for biomedical application. J Mech Behav Biomed Mater. 2011;4:1228-33.

[67] Deepa G, Thulasidasan AKT, Anto RJ, Pillai JJ, Kumar GSV. Cross-linked acrylic hydrogel for the controlled delivery of hydrophobic drugs in cancer therapy. Int J Nanomed. 2012;7:4077-88.

[68] Ayers D, Cuthbertson JM, Schroyer K, Sullivan SM. Polyacrylic acid mediated ocular delivery of ribozymes. J Control Release. 1996;38:167-75.

[69] Basak P, Adhikari B. Poly (vinyl alcohol) hydrogels for pH dependent colon targeted drug delivery. J Mater Sci Mater Med. 2009;20:137-46.

[70] Brannon-Peppas L, Peppas NA. Dynamic and Equilibrium Swelling Behavior of Ph-Sensitive Hydrogels Containing 2-Hydroxyethyl Methacrylate. Biomaterials. 1990;11:635-44.

[71] Hassan CM, Stewart JE, Peppas NA. Diffusional characteristics of freeze/thawed poly(vinyl alcohol) hydrogels: applications to protein controlled release from multilaminate devices. Eur J Pharm Biopharm. 2000;49:161-5.

[72] Moretto A, Tesolin L, Marsilio F, Schiavon M, Berna M, Veronese FM. Slow release of two antibiotics of veterinary interest from PVA hydrogels. Farmaco. 2004;59:1-5.

[73] Choi J, Kung HJ, Macias CE, Muratoglu OK. Highly lubricious poly(vinyl alcohol)-poly(acrylic acid) hydrogels. J Biomed Mater Res B Appl Biomater. 2012;100:524-32.

[74] Chun MK, Cho CS, Choi HK. Mucoadhesive drug carrier based on interpolymer complex of poly(vinyl pyrrolidone) and poly(acrylic acid) prepared by template polymerization. J Control Release. 2002;81:327-34.

[75] Dossi M, Storti G, Moscatelli D. Synthesis of Poly(Alkyl Cyanoacrylates) as Biodegradable Polymers for Drug Delivery Applications. Macromolecular Symposia. 2010;289:124-8.

[76] Vauthier C, Labarre D, Ponchel G. Design aspects of poly(alkylcyanoacrylate) nanoparticles for drug delivery. J Drug Target. 2007;15:641-63.

[77] Kreuter J, Alyautdin RN, Kharkevich DA, Ivanov AA. Passage of Peptides through the Blood-Brain-Barrier with Colloidal Polymer Particles (Nanoparticles). Brain Res. 1995;674:171-4.

[78] Schroder U, Sabel BA. Nanoparticles, a drug carrier system to pass the blood-brain barrier, permit central analgesic effects of iv dalargin injections. Brain Res. 1996;710:121-4.

[79] Alyautdin RN, Petrov VE, Langer K, Berthold A, Kharkevich DA, Kreuter J. Delivery of loperamide across the blood-brain barrier with polysorbate 80-coated polybutylcyanoacrylate nanoparticles. Pharmaceut Res. 1997;14:325-8.

[80] Alyautdin RN, Tezikov EB, Ramge P, Kharkevich DA, Begley DJ, Kreuter J. Significant entry of tubocurarine into the brain of rats by adsorption to polysorbate 80-coated polybutylcyanoacrylate nanoparticles: an in situ brain perfusion study. J Microencapsul. 1998;15:67-74.

[81] Couvreur P, Kante B, Lenaerts V, Scailteur V, Roland M, Speiser P. Tissue distribution of antitumor drugs associated with polyalkylcyanoacrylate nanoparticles. J Pharm Sci. 1980;69:199-202.

[82] Couvreur P, Kante B, Grislain L, Roland M, Speiser P. Toxicity of polyalkylcyanoacrylate nanoparticles II: Doxorubicin-loaded nanoparticles. J Pharm Sci. 1982;71:790-2.

[83] Colin de Verdiere A, Dubernet C, Nemati F, Poupon MF, Puisieux F, Couvreur P. Uptake of doxorubicin from loaded nanoparticles in multidrug- resistant leukemic murine cells. Cancer Chemother Pharmacol. 1994;33:504-8.

[84] Brasseur F, Couvreur P, Kante B, Deckers-Passau L, Roland M, Deckers C, Speiser P. Actinomycin D absorbed on polymethylcyanoacrylate nanoparticles: increased efficiency against an experimental tumor. Eur J Cancer. 1980;16:1441- 5.

[85] Andrieux K, Couvreur P. Polyalkylcyanoacrylate nanoparticles for delivery of drugs across the blood-brain barrier. Wiley Interdiscip Rev Nanomed Nanobiotechnol. 2009;1:463-74.

[86] Veronese FM, Pasut G. PEGylation, successful approach to drug delivery. Drug Discov Today. 2005;10:1451-8.

[87] Gupta S, Tyagi R, Parmar VS, Sharma SK, Haag R. Polyether based amphiphiles for delivery of active components. Polymer. 2012;53:3053-78.

[88] Greenwald RB, Choe YH, McGuire J, Conover CD. Effective drug delivery by PEGylated drug conjugates. Adv Drug Deliv Rev. 2003;55:217-50.

[89] Calvo P, Gouritin B, Chacun H, Desmaele D, D'Angelo J, Noel JP, Georgin D, et al. Long-circulating PEGylated polycyanoacrylate nanoparticles as new drug carrier for brain delivery. Pharmaceut Research. 2001;18:1157-66.

[90] Roberts MJ, Bentley MD, Harris JM. Chemistry for peptide and protein PEGylation. Adv Drug Deliv Rev. 2002;54:459-76.

[91] Gopferich A, Tessmar J. Polyanhydride degradation and erosion. Adv Drug Deliv Rev. 2002;54:911-31.

[92] Langer RS, Peppas NA. Present and future applications of biomaterials in controlled drug delivery systems. Biomaterials. 1981;2:201-14.

[93] Kumar N, Langer RS, Domb AJ. Polyanhydrides: an overview. Adv Drug Deliv Rev. 2002;54:889-910.

[94] Nair LS, Laurencin CT. Biodegradable polymers as biomaterials. Prog Polym Sci. 2007;32:762-98.

[95] Conix A. Poly[1,3-bis(p-carboxyphenoxy)-propane anhydride]. Macromol Synth. 1966;2:95-8.

[96] Kipper MJ, Hou SS, Seifert S, Thiyagarajan P, Schmidt-Rohr K, Narasimhan B. Nanoscale morphology of polyanhydride copolymers. Macromolecules. 2005;38:8468-72.

[97] Torres MP, Vogel BM, Narasimhan B, Mallapragada SK. Synthesis and characterization of novel polyanhydrides with tailored erosion mechanisms. J Biomed Mater Res A. 2006;76:102-10.

[98] Lopac SK, Torres MP, Wilson-Welder JH, Wannemuehler MJ, Narasimhan B. Effect of polymer chemistry and fabrication method on protein release and

68 stability from polyanhydride microspheres. J Biomed Mater Res B Appl Biomater. 2009;91:938-47.

[99] Ron E, Turek T, Mathiowitz E, Chasin M, Hageman M, Langer R. Controlled release of polypeptides from polyanhydrides. Proc Natl Acad Sci U S A. 1993;90:4176-80.

[100] Vogel BM, Mallapragada SK. Synthesis of novel biodegradable polyanhydrides containing aromatic and glycol functionality for tailoring of hydrophilicity in controlled drug delivery devices. Biomaterials. 2005;26:721-8.

[101] Carrillo-Conde B, Schiltz E, Yu J, Chris Minion F, Phillips GJ, Wannemuehler MJ, Narasimhan B. Encapsulation into amphiphilic polyanhydride microparticles stabilizes Yersinia pestis antigens. Acta Biomater. 2010;6:3110-9.

[102] Leong KW, Kost J, Mathiowitz E, Langer R. Polyanhydrides for Controlled Release of Bioactive Agents. Biomaterials. 1986;7:364-71.

[103] Ulery BD, Kumar D, Ramer-Tait AE, Metzger DW, Wannemuehler MJ, Narasimhan B. Design of a protective single-dose intranasal nanoparticle-based vaccine platform for respiratory infectious diseases. PLoS One. 2011;6:e17642.

[104] Kipper MJ, Wilson JH, Wannemuehler MJ, Narasimhan B. Single dose vaccine based on biodegradable polyanhydride microspheres can modulate immune response mechanism. J Biomed Mater Res A. 2006;76:798-810.

[105] Deng JS, Li L, Stephens D, Tian Y, Harris FW, Cheng SZ. Effect of gamma-radiation on a polyanhydride implant containing gentamicin sulfate. Int J Pharm. 2002;232:1-10.

[106] Li LC, Deng J, Stephens D. Polyanhydride implant for antibiotic delivery-- from the bench to the clinic. Adv Drug Deliv Rev. 2002;54:963-86.

[107] Chickering D, Jacob J, Mathiowitz E. Poly(fumaric-co-sebacic) microspheres as oral drug delivery systems. Biotechnol Bioeng. 1996;52:96-101.

[108] Dang W, Daviau T, Brem H. Morphological characterization of polyanhydride biodegradable implant gliadel during in vitro and in vivo erosion using scanning electron microscopy. Pharm Res. 1996;13:683-91.

[109] Tabata Y, Gutta S, Langer R. Controlled Delivery Systems for Proteins Using Polyanhydride Microspheres. Pharmaceut Res. 1993;10:487-96.

[110] Petersen LK, Sackett CK, Narasimhan B. High-throughput analysis of protein stability in polyanhydride nanoparticles. Acta Biomater. 2010;6:3873-81.

[111] Sandor M, Bailey NA, Mathiowitz E. Characterization of polyanhydride microsphere degradation by DSC. Polymer. 2002;43:279-88.

[112] Kipper MJ, Shen E, Determan A, Narasimhan B. Design of an injectable system based on bioerodible polyanhydride microspheres for sustained drug delivery. Biomaterials. 2002;23:4405-12.

[113] Ulery BD, Phanse Y, Sinha A, Wannemuehler MJ, Narasimhan B, Bellaire BH. Polymer chemistry influences monocytic uptake of polyanhydride nanospheres. Pharmaceut Res. 2009;26:683-90.

[114] Torres MP, Wilson-Welder JH, Lopac SK, Phanse Y, Carrillo-Conde B, Ramer-Tait AE, Bellaire BH, et al. Polyanhydride microparticles enhance dendritic cell antigen presentation and activation. Acta Biomater. 2011;7:2857- 64.

[115] Haughney SL, Petersen LK, Schoofs AD, Ramer-Tait AE, King JD, Briles DE, Wannemuehler MJ, et al. Retention of structure, antigenicity, and biological function of pneumococcal surface protein A (PspA) released from polyanhydride nanoparticles. Acta Biomater. 2013;9:8262-71.

[116] Ross KA, Loyd H, Wu W, Huntimer L, Wannemuehler MJ, Carpenter S, Narasimhan B. Structural and antigenic stability of H5N1 hemagglutinin trimer upon release from polyanhydride nanoparticles. J Biomed Mater Res A. 2014;102:4161-8.

[117] Chavez-Santoscoy AV, Roychoudhury R, Pohl NL, Wannemuehler MJ, Narasimhan B, Ramer-Tait AE. Tailoring the immune response by targeting C- type lectin receptors on alveolar macrophages using "pathogen-like" amphiphilic polyanhydride nanoparticles. Biomaterials. 2012;33:4762-72.

[118] Petersen LK, Ramer-Tait AE, Broderick SR, Kong CS, Ulery BD, Rajan K, Wannemuehler MJ, et al. Activation of innate immune responses in a pathogen- mimicking manner by amphiphilic polyanhydride nanoparticle adjuvants. Biomaterials. 2011;32:6815-22.

[119] Petersen LK, Xue L, Wannemuehler MJ, Rajan K, Narasimhan B. The simultaneous effect of polymer chemistry and device geometry on the in vitro activation of murine dendritic cells. Biomaterials. 2009;30:5131-42.

[120] Carrillo-Conde B, Song EH, Chavez-Santoscoy A, Phanse Y, Ramer-Tait AE, Pohl NL, Wannemuehler MJ, et al. Mannose-functionalized "pathogen-like" polyanhydride nanoparticles target C-type lectin receptors on dendritic cells. Mol Pharm. 2011;8:1877-86.

[121] Carrillo-Conde BR, Roychoudhury R, Chavez-Santoscoy AV, Narasimhan B, Pohl NL. High-throughput synthesis of carbohydrates and functionalization of polyanhydride nanoparticles. J Vis Exp. 2012.

[122] Phanse Y, Carrillo-Conde BR, Ramer-Tait AE, Roychoudhury R, Pohl NL, Narasimhan B, Wannemuehler MJ, et al. Functionalization of polyanhydride microparticles with di-mannose influences uptake by and intracellular fate within dendritic cells. Acta Biomater. 2013;9:8902-9.

[123] Mohamed F, Mohamed C. Engineering biodegradable polyester particles with specific drug targeting and drug release properties. J Pharm Sci. 2008;97:71-87.

[124] Petersen LK, Phanse Y, Ramer-Tait AE, Wannemuehler MJ, Narasimhan B. Amphiphilic polyanhydride nanoparticles stabilize Bacillus anthracis protective antigen. Mol Pharm. 2012;9:874-82.

[125] Huntimer LM, Ross KA, Darling RJ, Winterwood NE, Boggiatto P, Narasimhan B, Ramer-Tait AE, et al. Polyanhydride nanovaccine platform enhances antigen-specific cytotoxic T cell responses. TECHNOLOGY. 2014;02:171-5.

[126] Ross KA, Loyd H, Wu W, Huntimer L, Ahmed S, Sambol A, Flickinger Z, et al. Polyanhydride-based H5 hemagglutinin influenza vaccines elicit protective virus neutralizing titers and cell-mediated immunity. To be submitted to Vaccine. 2015.

[127] Gaumet M, Vargas A, Gurny R, Delie F. Nanoparticles for drug delivery: the need for precision in reporting particle size parameters. Eur J Pharm Biopharm. 2008;69:1-9.

[128] Redhead HM, Davis SS, Illum L. Drug delivery in poly(lactide-co-glycolide) nanoparticles surface modified with poloxamer 407 and poloxamine 908: in vitro characterisation and in vivo evaluation. J Control Rel. 2001;70:353-63.

[129] Singh R, Lillard JW, Jr. Nanoparticle-based targeted drug delivery. Exp Mol Pathol. 2009;86:215-23.

[130] Desai MP, Labhasetwar V, Walter E, Levy RJ, Amidon GL. The mechanism of uptake of biodegradable microparticles in Caco-2 cells is size dependent. Pharmaceut Res. 1997;14:1568-73.

[131] Moghimi SM, Hunter AC, Murray JC. Long-circulating and target-specific nanoparticles: theory to practice. Pharmacol Rev. 2001;53:283-318.

[132] Moghimi SM. Mechanisms of splenic clearance of blood cells and particles: towards development of new splenotropic agents. Adv Drug Deliv Rev. 1995;17:103-15.

[133] Moghimi SM. Exploiting bone marrow microvascular structure for drug delivery and future therapies. Adv Drug Deliv Rev. 1995;17:61-73.

[134] Banerjee T, Mitra S, Kumar Singh A, Kumar Sharma R, Maitra A. Preparation, characterization and biodistribution of ultrafine chitosan nanoparticles. Int J Pharm. 2002;243:93-105.

[135] Mumper RJ, Cui Z, Oyewumi MO. Nanotemplate Engineering of Cell Specific Nanoparticles. J Dispersion Sci Tech. 2003;24:569-88.

[136] Monfardini C, Veronese FM. Stabilization of substances in circulation. Bioconjug Chem. 1998;9:418-50.

[137] Oyewumi MO, Kumar A, Cui Z. Nano-microparticles as immune adjuvants: correlating particle sizes and the resultant immune responses. Expert Rev Vaccines. 2010;9:1095-107.

[138] Kreuter J, Ramge P, Petrov V, Hamm S, Gelperina SE, Engelhardt B, Alyautdin R, et al. Direct evidence that polysorbate-80-coated poly(butylcyanoacrylate) nanoparticles deliver drugs to the CNS via specific mechanisms requiring prior binding of drug to the nanoparticles. Pharmaceut Res. 2003;20:409-16.

[139] Kroll RA, Pagel MA, Muldoon LL, Roman-Goldstein S, Fiamengo SA, Neuwelt EA. Improving drug delivery to intracerebral tumor and surrounding brain in a rodent model: a comparison of osmotic versus bradykinin modification of the blood-brain and/or blood-tumor barriers. Neurosurgery. 1998;43:879-86; discussion 86-9.

[140] Zauner W, Farrow NA, Haines AM. In vitro uptake of polystyrene microspheres: effect of particle size, cell line and cell density. J Control Release. 2001;71:39-51.

[141] Xiang SD, Scholzen A, Minigo G, David C, Apostolopoulos V, Mottram PL, Plebanski M. Pathogen recognition and development of particulate vaccines: does size matter? Methods. 2006;40:1-9.

[142] Mottram PL, Leong D, Crimeen-Irwin B, Gloster S, Xiang SD, Meanger J, Ghildyal R, et al. Type 1 and 2 Immunity Following Vaccination Is Influenced by Nanoparticle Size: Formulation of a Model Vaccine for Respiratory Syncytial Virus. Mol Pharm. 2006;4:73-84.

[143] Rice-Ficht AC, Arenas-Gamboa AM, Kahl-McDonagh MM, Ficht TA. Polymeric particles in vaccine delivery. Curr Opin Microbiol. 2010;13:106-12.

[144] Sharp FA, Ruane D, Claass B, Creagh E, Harris J, Malyala P, Singh M, et al. Uptake of particulate vaccine adjuvants by dendritic cells activates the NALP3 inflammasome. Proc Natl Acad Sci U S A. 2009;106:870-5.

[145] Jung T, Kamm W, Breitenbach A, Hungerer KD, Hundt E, Kissel T. Tetanus toxoid loaded nanoparticles from sulfobutylated poly(vinyl alcohol)-graft- poly(lactide-co-glycolide): evaluation of antibody response after oral and nasal application in mice. Pharmaceut Res. 2001;18:352-60.

[146] Labiris NR, Dolovich MB. Pulmonary drug delivery. Part I: physiological factors affecting therapeutic effectiveness of aerosolized medications. Br J Clin Pharmacol. 2003;56:588-99.

[147] Labiris NR, Dolovich MB. Pulmonary drug delivery. Part II: the role of inhalant delivery devices and drug formulations in therapeutic effectiveness of aerosolized medications. Br J Clin Pharmacol. 2003;56:600-12.

[148] Joshi V, Geary S, Salem A. Biodegradable Particles as Vaccine Delivery Systems: Size Matters. The AAPS Journal. 2013;15:85-94.

[149] Hofmann W. Modelling inhaled particle deposition in the human lung—A review. J Aerosol Sci. 2011;42:693-724.

[150] Carvalho TC, Peters JI, Williams RO, 3rd. Influence of particle size on regional lung deposition--what evidence is there? Int J Pharm. 2011;406:1-10.

[151] Champion JA, Katare YK, Mitragotri S. Particle shape: a new design parameter for micro- and nanoscale drug delivery carriers. J Control Release. 2007;121:3-9.

[152] Champion JA, Katare YK, Mitragotri S. Making polymeric micro- and nanoparticles of complex shapes. Proc Natl Acad Sci U S A. 2007;104:11901-4.

[153] Yoo J-W, Mitragotri S. Polymer particles that switch shape in response to a stimulus. Proc Natl Acad Sciences. 2010;107:11205-10.

[154] Hammond P, DeSimone J. Nanoparticles made to order – inside and out. Membr Tech. 2013;2013:8.

[155] Hampton MJ, Templeton JL, DeSimone JM. Direct Patterning of CdSe Quantum Dots into Sub-100 nm Structures. Langmuir. 2010;26:3012-5.

[156] Hsieh DS, Rhine WD, Langer R. Zero-order controlled-release polymer matrices for micro- and macromolecules. J Pharm Sci. 1983;72:17-22.

[157] He C, Hu Y, Yin L, Tang C, Yin C. Effects of particle size and surface charge on cellular uptake and biodistribution of polymeric nanoparticles. Biomaterials. 2010;31:3657-66.

[158] Zhou Z, Shen Y, Tang J, Jin E, Ma X, Sun Q, Zhang B, et al. Linear polyethyleneimine-based charge-reversal nanoparticles for nuclear-targeted drug delivery. J MaterChem. 2011;21:19114-23.

[159] Walkey CD, Olsen JB, Guo H, Emili A, Chan WC. Nanoparticle size and surface chemistry determine serum protein adsorption and macrophage uptake. J Am Chem Soc. 2012;134:2139-47.

[160] Muro S. Challenges in design and characterization of ligand-targeted drug delivery systems. J Control Release. 2012;164:125-37.

[161] Caldorera-Moore ME, Liechty WB, Peppas NA. Responsive theranostic systems: integration of diagnostic imaging agents and responsive controlled release drug delivery carriers. Acc Chem Res. 2011;44:1061-70.

[162] Upham JP, Pickett D, Irimura T, Anders EM, Reading PC. Macrophage receptors for influenza A virus: role of the macrophage galactose-type lectin and mannose receptor in viral entry. J Virol. 2010;84:3730-7.

[163] Jiang HL, Kang ML, Quan JS, Kang SG, Akaike T, Yoo HS, Cho CS. The potential of mannosylated chitosan microspheres to target macrophage mannose receptors in an adjuvant-delivery system for intranasal immunization. Biomaterials. 2008;29:1931-9.

[164] Brown GD. Dectin-1: a signalling non-TLR pattern-recognition receptor. Nat Rev Immunol. 2006;6:33-43.

[165] Brannon-Peppas L, Blanchette JO. Nanoparticle and targeted systems for cancer therapy. Adv Drug Deliv Rev. 2004;56:1649-59.

[166] Rosenholm J, Rosenholm C, Sahlgren M. Cancer-cell targeting and cell- specific delivery by mesoporous silica nanoparticles. J Mater Chem. 2010;20:2707-13.

[167] Hood JD, Bednarski M, Frausto R, Guccione S, Reisfeld RA, Xiang R, Cheresh DA. Tumor regression by targeted gene delivery to the neovasculature. Science. 2002;296:2404-7.

[168] Chen QR, Zhang L, Gasper W, Mixson AJ. Targeting tumor angiogenesis with gene therapy. Mol Genet Metab. 2001;74:120-7.

[169] Teicher BA. Molecular targets and cancer therapeutics: discovery, development and clinical validation. Drug Resist Updat. 2000;3:67-73.

[170] Gordon SB, Read RC. Macrophage defences against respiratory tract infections: The immunology of childhood respiratory infections. British Medical Bulletin. 2002;61:45-61.

[171] Moresco EM, LaVine D, Beutler B. Toll-like receptors. Curr Biol. 2011;21:R488-93.

[172] Geijtenbeek TB, Gringhuis SI. Signalling through C-type lectin receptors: shaping immune responses. Nat Rev Immunol. 2009;9:465-79.

[173] Keler T, Ramakrishna V, Fanger MW. Mannose receptor-targeted vaccines. Expert Opin Biol Ther. 2004;4:1953-62.

[174] Danhier F, Feron O, Preat V. To exploit the tumor microenvironment: Passive and active tumor targeting of nanocarriers for anti-cancer drug delivery. J Control Release. 2010;148:135-46.

[175] Crielaard BJ, Lammers T, Schiffelers RM, Storm G. Drug targeting systems for inflammatory disease: one for all, all for one. J Control Release. 2012;161:225-34.

[176] Scott AM, Wolchok JD, Old LJ. Antibody therapy of cancer. Nat Rev Cancer. 2012;12:278-87.

[177] Brahmer JR, Drake CG, Wollner I, Powderly JD, Picus J, Sharfman WH, Stankevich E, et al. Phase I study of single-agent anti-programmed death-1 (MDX-1106) in refractory solid tumors: safety, clinical activity, pharmacodynamics, and immunologic correlates. J Clin Oncol. 2010;28:3167-75.

[178] Beatty GL, Chiorean EG, Fishman MP, Saboury B, Teitelbaum UR, Sun W, Huhn RD, et al. CD40 Agonists Alter Tumor Stroma and Show Efficacy Against Pancreatic Carcinoma in Mice and Humans. Science. 2011;331:1612-6.

[179] Bajpai AK, Bajpai S, Shukla S, Bhanu S. Responsive polymers in controlled drug delivery. Prog Polym Sci. 2008;33:1088-118.

[180] Kale AA, Torchilin VP. Environment-Responsive Polymers for Coating of Pharmaceutical Nanocarriers. Polym Sci Ser A Chem Phys. 2009;51:730-7.

[181] Determan MD, Cox JP, Mallapragada SK. Drug release from pH- responsive thermogelling pentablock copolymers. J Biomed Mater Res A. 2007;81:326-33.

[182] Peppas NA, Bures P, Leobandung W, Ichikawa H. Hydrogels in pharmaceutical formulations. Eur J Pharm Biopharm. 2000;50:27-46.

[183] Rejinold NS, Muthunarayanan M, Divyarani VV, Sreerekha PR, Chennazhi KP, Nair SV, Tamura H, et al. Curcumin-loaded biocompatible thermoresponsive polymeric nanoparticles for cancer drug delivery. J Colloid Interface Sci. 2011;360:39-51.

[184] Hennessy EJ, Parker AE, O'Neill LA. Targeting Toll-like receptors: emerging therapeutics? Nat Rev Drug Discov. 2010;9:293-307.

[185] Zhang XX, Eden HS, Chen X. Peptides in cancer nanomedicine: drug carriers, targeting ligands and protease substrates. J Control Release. 2012;159:2-13.

[186] Park J, Park G, Saravanakumar K, Kim I. Targeted delivery of low molecular drugs using chitosan and its derivatives. Adv Drug Deliver Rev. 2010;62:28-41.

[187] Tomasina J, Lheureux S, Gauduchon P, Rault S, Malzert-Freon A. Nanocarriers for the targeted treatment of ovarian cancers. Biomaterials. 2013;34:1073-101.

[188] Chacko RT, Ventura J, Zhuang J, Thayumanavan S. Polymer nanogels: a versatile nanoscopic drug delivery platform. Adv Drug Deliv Rev. 2012;64:836- 51.

[189] Chen HC, Zhan X, Tran KK, Shen H. Selectively targeting the toll-like receptor 9 (TLR9)--IRF 7 signaling pathway by polymer blend particles. Biomaterials. 2013;34:6464-72.

[190] Song EH, Osanya AO, Petersen CA, Pohl NL. Synthesis of multivalent tuberculosis and Leishmania-associated capping carbohydrates reveals structure-dependent responses allowing immune evasion. J Am Chem Soc. 2010;132:11428-30.

[191] Engering AJ, Cella M, Fluitsma D, Brockhaus M, Hoefsmit ECM, Lanzavecchia A, Pieters J. The mannose receptor functions as a high capacity and broad specificity antigen receptor in human dendritic cells. Eur J Immunol. 1997;27:2417-25.

[192] Irache JM, Salman HH, Gamazo C, Espuelas S. Mannose-targeted systems for the delivery of therapeutics. Expert Opin Drug Deliv. 2008;5:703-24.

[193] Deng Z, Deng S, Li X, Jiang R. Well-Defined Galactose-Containing Multi- Functional Copolymers and Glyconanoparticles for Biomolecular Recognition Processes. Macromolecules. 2009;42:6393-405.

[194] Adams EW, Ratner DM, Seeberger PH, Hacohen N. Carbohydrate- mediated targeting of antigen to dendritic cells leads to enhanced presentation of antigen to T cells. Chembiochem. 2008;9:294-303.

[195] Scanlan CN, Offer J, Zitzmann N, Dwek RA. Exploiting the defensive sugars of HIV-1 for drug and vaccine design. Nature. 2007;446:1038-45.

[196] Wang SK, Liang PH, Astronomo RD, Hsu TL, Hsieh SL, Burton DR, Wong CH. Targeting the carbohydrates on HIV-1: Interaction of oligomannose dendrons with human monoclonal antibody 2G12 and DC-SIGN. Proc Natl Acad Sci U S A. 2008;105:3690-5.

[197] Gijzen K, Tacken PJ, Zimmerman A, Joosten B, de Vries IJ, Figdor CG, Torensma R. Relevance of DC-SIGN in DC-induced T cell proliferation. J Leukoc Biol. 2007;81:729-40.

[198] Geijtenbeek. DC-SIGN, a C-type lectin on dendritic cells that unveils many aspects of dendritic cell biology. J Leukoc Biol. 2002;71:921-31.

[199] Lepenies B, Lee J, Sonkaria S. Targeting C-type lectin receptors with multivalent carbohydrate ligands. Adv Drug Deliv Rev. 2013;65:1271-81.

[200] Tel J, Tel D, Benitez Ribas S, Hoosemans A, Cambi G, Adema C, Figdor P, et al. DEC-205 mediates antigen uptake and presentation by both resting and activated human plasmacytoid dendritic cells. Eur J Immunol. 2011;41:1014-23.

[201] Tenbusch M, Nchinda G, Storcksdieck genannt Bonsmann M, Temchura V, Uberla K. Targeting the antigen encoded by adenoviral vectors to the DEC205 receptor modulates the cellular and humoral immune response. Int Immunol. 2013;25:247-58.

[202] Figdor CG, van Kooyk Y, Adema GJ. C-type lectin receptors on dendritic cells and Langerhans cells. Nat Rev Immunol. 2002;2:77-84.

[203] Nguyen DG, Hildreth JE. Involvement of macrophage mannose receptor in the binding and transmission of HIV by macrophages. Eur J Immunol. 2003;33:483-93.

[204] UNAIDS. Global report: UNAIDS report on the global AIDS epidemic 2013. Geneva: United Nations; 2013.

[205] NIAID. HIV Virion. 2013.

[206] Mascola JR, Montefiori DC. The role of antibodies in HIV vaccines. Annu Rev Immunol. 2010;28:413-44.

[207] Mascola JR, Montefiori DC. HIV-1: nature's master of disguise. Nat Med. 2003;9:393-4.

[208] McMichael AJ, Borrow P, Tomaras GD, Goonetilleke N, Haynes BF. The immune response during acute HIV-1 infection: clues for vaccine development. Nat Rev Immunol. 2010;10:11-23.

[209] Bomsel M, Tudor D, Drillet AS, Alfsen A, Ganor Y, Roger MG, Mouz N, et al. Immunization with HIV-1 gp41 subunit virosomes induces mucosal antibodies protecting nonhuman primates against vaginal SHIV challenges. Immunity. 2011;34:269-80.

[210] Shi W, Bohon J, Han DP, Habte H, Qin Y, Cho MW, Chance MR. Structural characterization of HIV gp41 with the membrane-proximal external region. J Biol Chem. 2010;285:24290-8.

[211] Holmgren J, Czerkinsky C. Mucosal immunity and vaccines. Nat Med. 2005;11:S45-53.

[212] Belyakov IM, Berzofsky JA. Immunobiology of mucosal HIV infection and the basis for development of a new generation of mucosal AIDS vaccines. Immunity. 2004;20:247-53.

[213] Wegmann F, Krashias G, Luhn K, Laamanen K, Vieira S, Jeffs SA, Shattock RJ, et al. A novel strategy for inducing enhanced mucosal HIV-1 antibody responses in an anti-inflammatory environment. PLoS One. 2011;6:e15861.

[214] Andre FE, Booy R, Bock HL, Clemens J, Datta SK, John TJ, Lee BW, et al. Vaccination greatly reduces disease, disability, death and inequity worldwide. Bull World Health Organ. 2008;86:140-6.

CHAPTER 3

Research Goals and Thesis Organization

The overall goal of this research is to design novel polyanhydride nanoparticle-based systems as targeted vaccine delivery vehicles, specifically for

HIV antigens. It is hypothesized that these subunit nanovaccines can help elicit strong and balanced immune responses that will result in efficacious treatments against this virus. To achieve this objective, a combination of concepts and techniques from polymer chemistry, immunology, carbohydrate chemistry, nanotechnology, and molecular biology has been woven together for the rational design of these delivery vehicles. The specific goals of this research are:

• Specific goal 1: Identification of carbohydrate-functionalized polyanhydride

nanovaccine formulations that stabilize HIV-1 antigens

• Specific goal 2: Analysis of the role of polymer chemistry on serum protein

adsorption patterns onto polyanhydride nanoparticles and macrophage

activation

• Specific goal 3: Evaluation of the in vivo biodistribution and safety of

carbohydrate-functionalized polyanhydride nanoparticles

• Specific goal 4: In vivo evaluation of carbohydrate-functionalized

polyanhydride nanoparticles with respect to inducing anti-HIV antigen

antibodies

The information obtained from these studies will help us understand the role of polymer chemistry, serum protein adsorption, route of administration, and active targeting mechanisms in the induction of efficacious immune responses.

The studies presented herein describe the experiments carried out to accomplish specific goals listed previously. Chapter 4 focuses on specific goal 1 and deals with the identification of carbohydrate-functionalized polyanhydride nanoparticles that stabilize HIV-1 antigen and that activate dendritic cells.

Chapter 5 describes the studies performed to evaluate the effects of serum protein adsorption and polymer chemistry on antigen presenting cell activation

(specific goal 2). Chapter 6 includes studies on the safety and biodistribution of targeted polyanhydride nanoparticles after administration into mice (specific goal

3). Chapter 7 presents the results obtained during in vivo studies that have been carried out with different polyanhydride particle formulations (specific goal 4).

Finally, ongoing and future studies that will continue this work are discussed in chapter 8.

CHAPTER 4

Carbohydrate-functionalized nanovaccines preserve HIV-1 antigen stability and activate antigen presenting cells

J.E. Vela Ramirez 1, R. Roychoudhury 2, H.H. Habte 3,4, ¶, M. W. Cho 3,4,† , N. L. B. Pohl 2, and B. Narasimhan 1*

Reprinted from a paper published in Journal of Biomaterials Science,

Polymer Edition on July 28, 2014; 25(13):1387-406

1Department of Chemical and Biological Engineering, Iowa State University, Ames, IA 50011

2Department of Chemistry, Indiana University, Bloomington, IN 47405

3Department of Biomedical Sciences, Iowa State University, Ames, IA 50011

4Center for Advanced Host Defenses, Immunobiotics and Translational Comparative Medicine, Iowa State University, Ames, IA 50011

* To whom all correspondence should be addressed

Phone: 515-294-8019; email: [email protected]

†Requests for pET-gp41-54Q-GHC should be made to MWC ([email protected]).

¶Current address: Boehringer Ingelheim, Department of Biotherapeutics, Ridgefield, CT 06877

4.1. Abstract

The functionalization of polymeric nanoparticles with ligands that target specific receptors on immune cells offers the opportunity to tailor adjuvant properties by conferring pathogen mimicking attributes to the particles.

Polyanhydride nanoparticles are promising vaccine adjuvants with desirable characteristics such as immunomodulation, sustained antigen release, activation of antigen presenting cells, and stabilization of protein antigens. These capabilities can be exploited to design nanovaccines against viral pathogens, such as HIV-1, due to the important role of dendritic cells and macrophages in viral spread. In this work, an optimized process was developed for carbohydrate functionalization of HIV-1 antigen-loaded polyanhydride nanoparticles. The carbohydrate-functionalized nanoparticles preserved antigenic properties upon release and also enabled sustained antigen release kinetics. Particle internalization was observed to be chemistry-dependent with positively charged nanoparticles being taken up more efficiently by dendritic cells. Up-regulation of the activation makers CD40 and CD206 was demonstrated with carboxymethyl-

α-D-mannopyranosyl-(1,2)-D-mannopyranoside functionalized nanoparticles. The secretion of the cytokines IL-6 and TNF-α was shown to be chemistry-dependent upon stimulation with carbohydrate-functionalized nanoparticles. These results offer important new insights upon the interactions between carbohydrate- functionalized nanoparticles and antigen presenting cells and provide foundational information for the rational design of targeted nanovaccines against

HIV-1.

4.2. Introduction

Functionalization of antigen delivery platforms to enable active targeting of cells is a well-studied approach for the design of novel adjuvants/delivery formulations for vaccines.[1-4] Activation of cellular receptors on antigen presenting cells (APCs) can enable tailored immune responses against pathogens.[5-7] One such approach is the use of carbohydrate moieties to activate pattern recognition receptors like C-type lectin receptors (CLRs), which play an important role in both innate and adaptive immune responses.[2,5,8-11]

This strategy could be important for viral infections, particularly human immunodeficiency virus (HIV), due to the key role of dendritic cells (DCs) and macrophages in the spread of the virus.[12-15]

In recent years the HIV epidemic has become one of the greatest challenges for researchers around the world.[16-17] Since its outbreak in 1981, more than 25 million people have died of Acquired Immunodeficiency Syndrome

(AIDS), and over 33 million people are currently infected.[18] HIV-1 infection is characterized by the inhibition of the immune response from CD4 + T cells that allows constant replication of the virus and depletion of T helper cells, which ultimately causes disease progression.[12,16,19-21] One of the mechanisms that

HIV-1 uses to block the immune response due to CD4 + T cells is infection of plasmacytoid DCs to prevent the maturation and proliferation of these cells, resulting in the induction of a T regulatory lineage.[12,14,15,22-24] Given the multiple roles that DCs play in the innate and adaptive immune responses, other functions are also affected due to the interaction of the virus with these cells.

These include suppression of TLR7 and TLR9 activation, which are known antiviral Toll-like receptors, and blockage of the release of Type I and II interferons.[15, 22] Therefore, it has been hypothesized that activation of DCs is required to prevent HIV-1 infection.[7,15,22]

One of the main strategies to prevent the continuous spread of HIV-1 worldwide is the development of an efficacious vaccine.[16,19,25] Presently, one of the main foci in the development of efficacious HIV-1 vaccines is the use of recombinant proteins as antigens.[16,17,26] Even though these antigens are safe, they are poorly immunogenic, and therefore need an adjuvant to elicit a robust immune response.[26] In this regard, biodegradable polyanhydride nanoparticles have shown promise as adjuvants and/or delivery vehicles with beneficial properties, including antigen stabilization, sustained antigen release,

APC activation, and immune modulation, that can be exploited to formulate a successful HIV-1 vaccine.[27-34] This study focuses on the use of gp41-54Q-

GHC as the immunogen (to be described in more detail elsewhere), which contains the Heptad Repeat Region 2 (HR2) and the membrane proximal external region (MPER) of the HIV-1 glycoprotein gp41.[26] Polyanhydride nanoparticles based on sebacic acid (SA) 1,6-bis(p-carboxyphenoxy) hexane

(CPH), and 1,8-bis(p-carboxyphenoxy)-3,6-dioxaoctane (CPTEG) and CPH were used to encapsulate and release stable gp41-54Q-GHC immunogen. The nanoparticles were functionalized with carboxymethyl-α-D-mannopyranosyl-(1,2)-

D-mannopyranoside (di-mannose) to specifically target the macrophage mannose receptor (MMR). Bone marrow derived DCs were stimulated with these

84 nanoparticles and their activation patterns were analyzed. The current studies demonstrate the dual capabilities of functionalized polyanhydride nanoparticles to stabilize an HIV-1 antigen and to target and activate DCs.

4.3. Materials and Methods

4.3.1. Materials

Chemicals needed for monomer synthesis, polymerization, and nanoparticle synthesis included 1-methyl-2-pyrrolidinone, anhydrous (99+%), terephthalic acid (99+%) and sebacic acid (99%) and all were purchased from

Aldrich (Milwaukee, WI); 1,6-dibromohexane, 4-p-hydroxybenzoic acid, and triethylene glycol were purchased from Sigma Aldrich (St. Louis, MO); 4-p- fluorobenzonitrile was obtained from Apollo Scientific (Cheshire, UK); acetic acid, acetic anhydride, acetonitrile, dimethyl formamide (DMF), ethyl ether, hexane, methylene chloride, pentane, petroleum ether, potassium carbonate, sulfuric acid, and toluene were purchased from Fisher Scientific (Fairlawn, NJ). For NMR characterization, deuterated chemicals, including chloroform and dimethyl sulfoxide (DMSO), were purchased from Cambridge Isotope Laboratories

(Andover, MA). For nanoparticle functionalization, 1-ethyl-3-(3- dimethylaminopropyl) carbodiimide hydrochloride, N-hydroxysuccinimide, and ethylenediamine were purchased from Thermo Scientific (Waltham, MA). Glycolic acid was purchased from Acros Organics (Pittsburgh, PA). β-Mercaptoethanol,

Escherichia coli lipopolysaccharide (LPS) O26:B6, and rat immunoglobulin (rat

IgG) were purchased from Sigma Aldrich (St. Louis, MO). Materials required for

85 the DC culture medium included: granulocyte-macrophage colony-stimulating factor (GM-CSF), purchased from PeproTech (Rocky Hill, NJ); HEPES buffer,

RPMI 1640, penicillin-streptomycin, and L-glutamine, purchased from Mediatech

(Herndon, VA); and heat inactivated fetal bovine serum, purchased from Atlanta

Biologicals (Atlanta, GA). Materials used for flow cytometry included: BD stabilizing fixative solution purchased from BD Bioscience (San Jose, CA); unlabeled anti-CD16/32 Fc γR, purchased from Southern Biotech (Birmingham,

AL); allophycocyanin (APC) anti-mouse CD40 (clone 1C10), Alexa Fluor ® 700 conjugated anti-mouse MHC Class II (I-A/I-E) (clone M5/114.15.2) and their corresponding isotypes APC-conjugated rat IgG2a κ (clone eBR2a), PE- conjugated rat IgG2a κ (clone eBR2a), Alexa Fluor 700 ®-conjugated rat IgG2b κ were purchased from eBiosciences (San Diego, CA). APC/Cy7 conjugated anti- mouse CD11c (clone N418), PE/Cy7 conjugated anti-mouse CD86 (clone GL-1),

FITC conjugated anti-mouse CD206 (clone C068C2) and their corresponding isotypes APC/Cy7 conjugated Armenian Hamster IgG (clone HTK888), PE/Cy7 conjugated rat IgG2a κ (clone RTK2758), FITC conjugated rat IgG2a κ (clone

RTK2758) were purchased from BioLegend (San Diego, CA). Cadmium selenide quantum dots (QDs) (emission at 630 nm) were a kind gift from Dr. Aaron Clapp at Iowa State University.

4.3.2. Construction of pET-gp41-54Q-GHC

The plasmid encoding gp41-54Q-GHC was constructed based on pET- gp41-54Q (to be described elsewhere), which encodes 54 amino acids of the C-

86 terminal ectodomain of HIV-1 gp41 (based on M group consensus sequence,

MCON6). The terminal lysine residue was mutated to glutamine. A short linker

(GSGSG), followed by a 6xHis tag and a cysteine residue (C) was attached right after the Gln (Q) by PCR using a forward primer 5’-

CGCGGATCCGAGTGGGAGCGCGAGATC-3’ and a reverse primer 5’-

CCATGAATTCTTAGCAATGGTGATGATGGTGATGTCCCGATCCCGATCCC

TGGATGTACCACAGCCAGTT-3’. The PCR product was digested by BamHI and EcoRI and then ligated into corresponding sites in pET-21a to yield pET- gp41-54Q-GHC. Construct was confirmed by sequencing.

4.3.3. Expression and purification of gp41-54Q-GHC

Protein expression and purification were performed according to the method of Penn-Nicholson et al. [35] with a few modifications. For gp41-54Q-

GHC expression, E. coli T7 Express IysY/Iq (New England Biolabs) was transformed with pET-gp41-54Q-GHC and cultured overnight at 37 °C in superbroth containing ampicillin (50 g/mL). Cells were diluted 1:100 in fresh superbroth and cultured to 1.0 OD 600 at 37°C. Protein expression was then induced with 1 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) and continued to grow until OD 600 reached 5.0. Cells were harvested by centrifugation at 4,600 rcf for 30 min in a Sorvall Legend XFR centrifuge (Thermo Scientific). The cell pellet was washed in phosphate-buffered saline (PBS, pH 7.4) and lysed by sonication using a Branson Digital Sonifier. The sample was sonicated until the

87 suspension became translucent, followed by centrifugation at 15,000 rcf for 20 min in Avanti ® J-26 XPI centrifuge (Beckman Coulter). After an additional three repetitions of PBS resuspension, sonication, and centrifugation, the pellet containing inclusion bodies was solubilized in PBS containing 8 M urea and sonicated. Insoluble debris was removed by centrifugation at 15,000 rcf for 20 min, and soluble proteins were bound to Ni-NTA resin (QIAGEN) by mixing on an end to end shaker overnight at 4 °C. The mixture wa s loaded onto a column, and the protein was renatured through serial incubations with 20 bed volumes of PBS containing a decreasing step gradient of urea at 8 M, 6 M, 4 M, 3 M, 2 M, 1 M, and 0 M. The column was washed with PBS containing 20 mM imidazole, and the protein was eluted with PBS containing 250 mM of imidazole. Purified protein was finally dialyzed in PBS (pH 8). The endotoxin content in gp41-54Q-GHC was quantified using a commercially available QCL-1000 Limulus Amebocyte Lysate

(LAL) kit (Lonza, Switzerland) and found to be < 0.1pg/ g of protein, which is acceptable for use in cell-based assays [36-38] for subunit proteins.

4.3.4. Monomer and polymer synthesis

Monomers of 1,6-bis( p-carboxyphenoxy) hexane (CPH) and 1,8-bis( p- carboxyphenoxy)-3,6-dioxaoctane (CPTEG) were synthesized as described previously.[27,29,39] CPTEG:CPH and CPH: SA copolymers of various ratios were synthesized by melt polycondensation as previously described.[39-41] The chemical structure was characterized with 1H NMR using a Varian VXR 300 MHz spectrometer (Varian Inc., Palo Alto, CA) and the molecular mass was

88 determined using gel permeation chromatography (GPC) on a Waters GPC chromatograph (Milford, MA) containing PL gel columns (Polymer Laboratories,

Amherst, MA). The synthesized 50:50 CPTEG:CPH copolymer had a Mw of 5,400

Da, the 20:80 CPH:SA copolymer had a Mw of 14,400 Da and the 20:80

CPTEG:CPH copolymer had a Mw of 7,700 Da. The polydispersity indexes (PDI) of these copolymers were 1.5, 1.4 and 1.3, respectively. These values are consistent with previous work.[29-33,39]

4.3.5. Nanoparticle synthesis

Polyanhydride nanoparticles were synthesized using anti-solvent nanoencapsulation as described previously.[42] Briefly, gp41-54Q-GHC (1% w/w) and 20 mg/mL polymer were dissolved in methylene chloride (at 4°C for 50:50

CPTEG:CPH and at room temperature (RT) for 20:80 CPH:SA). The polymer solution was sonicated at 40 Hz for 30 s using a probe sonicator (Ultra Sonic

Processor VC 130PB, Sonics Vibra Cell, Newtown, CT) to create a homogeneous protein/polymer mixture and rapidly poured into a pentane bath (at

-40°C for CPTEG:CPH and at RT for CPH:SA) at a solv ent to non-solvent ratio of

1:250. Particles were then collected by filtration and dried under vacuum for 1 h.

4.3.6. Nanoparticle functionalization

4.3.6.1. Synthesis of carboxylated di-mannose

carboxymethyl-α-D-mannopyranosyl-(1,2)-D-mannopyranoside was synthesized using an alkenyl fluorous tag as previously reported.[43] Fluorous solid phase extraction (FSPE) was used to purify all the intermediates.[44-46]

The double bond was cleaved by ozonolysis to produce an aldehyde at the reducing end, which was further oxidized to carboxylic acid by Jones oxidation.

The global deprotection of the protecting groups was carried out by Birch reduction to generate the target dimannoside.[47-50]

4.3.6.2. Surface functionalization

carboxymethyl-α-D-mannopyranosyl-(1,2)-D-mannopyranoside was conjugated onto the surface of polyanhydride nanoparticles using an amine- carboxylic acid coupling reaction.[47-50] Particles with glycolic acid groups on the surface (linker) and non-functionalized (NF) particles were used as controls.

The conjugation reaction was performed in two reaction steps. Briefly, a nanoparticle suspension was made in nanopure water (10 mg/mL), and 10 equivalents of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride

(EDC) and 12 equivalents of N-hydroxysuccinimide (NHS), and 10 equivalents of ethylenediamine were added. This reaction was carried out at 4°C temperature for 1 h at a constant agitation of 17 rcf. Following the reaction, the particles were centrifuged at 10,000 rcf for 10 min and the supernatant was removed. The particles were washed with the same volume of nanopure water, centrifuged at

10,000 rcf for 10 min and the supernatant was removed. A second reaction was performed with 10 eq. of EDC, 12 eq. of NHS and 10 eq. of the corresponding functionalizing agent (i.e., di-mannose or glycolic acid) in nanopure water, using constant agitation at 17 rcf for 1 h at 4°C. Partic les were sonicated before and after each reaction to break aggregates. After the reaction was completed, nanoparticles were collected by centrifugation (10,000 rcf, 10 min) and dried under vacuum for 1 h.

4.3.7. Nanoparticle characterization

Characterization of morphology and size of both the functionalized and the

NF nanoparticles was performed using scanning electron microscopy (SEM, FEI

Quanta 250, Kyoto, Japan) and quasi-elastic light scattering (QELS, Zetasizer

Nano, Malvern Instruments Ltd., Worchester, UK). In order to confirm the successful attachment of the glycans onto the nanoparticles, QELS was used to measure the ζ-potential of the nanoparticles. To quantify the amounts of the carbohydrates conjugated to the nanoparticles, a high throughput version of a phenol-sulfuric acid assay was used.[47,51] A microplate reader (SpectraMax

M3, Molecular Devices, Sunnyvale, CA) was used to obtain the absorbance of standards and unknown samples using a wavelength of 490 nm. The total amount of sugar per unit weight of nanoparticles (g/mg) was calculated.

4.3.8. Antigen release kinetics

In vitro antigen release kinetics studies were performed using a micro bicinchoninic acid (BCA) assay. Samples of protein-loaded nanoparticles were suspended in 750 µL of phosphate buffered saline (0.1 M, pH 7.4) with 0.01% w/v sodium azide and incubated at 37°C and 106 rcf. For each time point, samples were centrifuged at 10,000 rcf for 10 min, the supernatant was removed and aliquoted at 4°C, and fresh buffer was added to each sample to maintain perfect sink conditions. Aliquots were analyzed using micro BCA at an absorbance of 562 nm. Ethylenediamine-functionalized nanoparticles were used as a control for carbohydrate-modified nanoparticle quantification because the ethylene glycol linker interfered with the micro BCA assay. The experiment was carried out for 30 days, and the amount of released protein was normalized with total amount of protein encapsulated, as described previously.[52,53] After 30 days, the remaining protein was extracted by adding 750 µL of 17 mM NaOH solution. Protein encapsulation efficiency and antigen loss because of functionalization conditions were estimated using the micro-BCA assay.

4.3.9. Gel electrophoresis

For electrophoretic analysis of released gp41-54Q-GHC, nanoparticles were suspended in 250 µL of PBS (pH 7.4) for 1 h. After incubation, samples were centrifuged at 10,000 rcf for 10 min and supernatants were removed and stored for further analysis. Protein concentrations were measured using a micro-

BCA assay and 500 ng of gp41-54Q-GHC released from each polymer chemistry was loaded in 4-20% polyacrylamide gels and run for 2 h at 120 V. Protein standards (10-250 kDa) were used to measure molecular weight. The gels were incubated in fixative solution (40% methanol, 10% acetic acid) for 3 h at 4°C.

Staining with Flamingo fluorescent gel stain (BioRad Laboratories, Richmond,

CA) was performed at 4°C overnight. Gels were scann ed using a Typhoon 9410

Variable Mode Imager (GE Healthcare). [54]

4.3.10. Antigenic analysis of released immunogen

Antigenic analysis of gp41-54Q-GHC immunogen one hour after release from NF and functionalized 50:50 CPTEG:CPH nanoparticles was performed using an enzyme-linked immunosorbent assay (ELISA). Briefly, gp41-54Q-GHC

(30 ng/well) was coated onto 96 well Costar TM High Binding plates (Costar

#3590) using antigen coating buffer (15 mM Na 2CO 3, 35 mM NaHCO 3, 3 mM

NaN 3, pH 9.6) overnight at 4°C. Non-specific antibody b inding was prevented by blocking wells with 290 µL of PBS (pH 7.4) containing 2.5% skim milk and 10% fetal bovine serum (FBS) (1 h at 37°C). Plates were washed six times with 0.1%

Tween 20 in PBS. Primary antibodies (2F5 [55-57], 4E10 [58] and Z13e1 [59-60]) were diluted at 1:1,000 in blocking buffer, and 100 µl were added to each well and incubated for 2 h at 37°C. The plates were wash ed six times and secondary antibody (goat anti-human) (Thermo-Scientific; Cat# 31430) at 1:3,000 dilution was added to each well and incubated (100 µL, 1 h at 37°C). The plate washing process was repeated six times and wells were developed using 100 µL of TMB-

HRP substrate for 10 min. The reaction was stopped with 50 µL of 2 N H2SO 4.

The developed plates were analyzed using a microplate reader (SpectraMax

M3).

4.3.11. In vitro DC uptake and activation

4.3.11.1 Mice

C57BL/6 (B6) mice were purchased from Harlan Laboratories

(Indianapolis, IN). Mice were housed in specific pathogen-free conditions where all bedding, caging, and feed were sterilized prior to use. All animal procedures were conducted with the approval of the Iowa State University Institutional

Animal Care and Use Committee.

4.3.11.2. DC culture and stimulation

Dendritic cells were derived from bone marrow, harvested from tibias and femurs of C57/BL6 mice as described previously in published protocols.[40, 47,

50,61] DCs were >90% positive for CD11c (data not shown). Briefly, mice were euthanized using carbon dioxide inhalation and cardiac puncture was performed to ensure death. Bone marrow cells were harvested from tibias and femurs, and cultured in 10 mL of DC media containing RPMI-1640 with 10% FBS, 5% penicillin/streptomycin, 5% 2mM L-glutamine, 0.5% gentamycin, 2.5% HEPES buffer, 0.1% β-mercaptoethanol, and 0.1% granulocyte macrophage colony-

94 stimulating factor (GMCSF) in T-75 cell culture grade flasks. At day 2, 10 mL of fresh DC media was added. At day 6, 10 mL of DC media were removed, centrifuged at 250 rcf for 10 min, and cells were resuspended in fresh media and added to corresponding flasks. At day 8, DCs were removed from the flasks, centrifuged at 250 rcf for 10 min and counted for plating. Cells were plated in 24 well plates using a concentration of 1 x 10 6 cells per well. GMCSF was added at

0.1 vol.% to DC media on days 0, 2, and 6. The DCs were stimulated with 200 ng/mL of Escherichia coli lipopolysaccharide (LPS, positive control) or polyanhydride nanoparticles at 125 µg/mL.[40,42,45-50] Non-stimulated (NS) cells were used as a negative control.[40,42]

4.3.11.3 Particle internalization

Analysis of particle internalization was performed by co-encapsulating quantum dots (QDs, 630 nm emission) and gp41-54Q-GHC. 1% (w/w) QD- loaded and 1% (w/w) gp41-54Q-GHC-loaded polyanhydride nanoparticles were prepared. Nanoparticles were suspended in PBS for 48 h and supernatants were collected and used to stimulate DCs as a control to account for released

QDs.[61,62] Bone marrow-derived DCs were stimulated with nanoparticle formulations for 48 h and using flow cytometry, particle positive cells were quantified. Non-stimulated cells were used as control.[61,62]

4.3.11.4 Flow cytometric analysis of cell surface markers and CLRs

Cultured cells were analyzed using flow cytometry as described

95 previously.[40-42] Antibodies for CD40, CD86, MHC II and CD206 and their corresponding isotypes were used in these studies. Samples were analyzed using a Becton-Dickinson FACSCanto TM flow cytometer (San Jose, CA) and the data was processed using the FlowJo vX software (TreeStar Inc., Ashland, OR).

4.3.12. Cytokine secretion

Supernatants of cultured cells were recovered 48 h post-stimulation and were analyzed for presence of IL-6, IL1-β, TNF-α, IL-12p40, and IFN-γ using a multiplex cytokine assay processed in a Bio-Plex 200 TM system (Bio-Rad,

Hercules, CA) as described in previous protocols.[40,52]

4.3.13. Statistical analysis

The cell surface marker expression and cytokine secretion data were subjected to statistical analysis using Prism6 (GraphPad, La Jolla, CA). One-way

ANOVA and Tukey’s HSD were used to determine statistical significance among treatments and p-values ≤ 0.05 were considered significant.

4.4. Results

4.4.1 Chemistry-dependent gp41-54Q-GHC kinetics and stabilization upon release from polyanhydride nanoparticles

The sizes of the 20:80 CPH:SA, 20:80 CPTEG:CPH and 50:50

CPTEG:CPH nanoparticles were 445 ± 230 nm, 179 ± 48 nm, and 231 ± 77 nm, respectively. The release profiles of gp41-54Q-GHC from these particles are shown in Figure 4.1. These data show that over 80% of the amount of gp41-54Q-

GHC encapsulated within the particles was released within 30 days for all three formulations studied. Based upon the release profiles in Figure 4.1, there was a more pronounced “burst” release of the immunogen from the 20:80 CPH:SA nanoparticles within the first 72 h in comparison to the release from the

CPTEG:CPH formulations. The amphiphilic 50:50 CPTEG:CPH formulation provided sustained release of the immunogen with a small burst. The encapsulation efficiency of gp41-54Q-GHC into the nanoparticles was chemistry- dependent with 79%, 70%, and 92% for 20:80 CPH:SA, 20:80 CPTEG:CPH, and

50:50 CPTEG:CPH, respectively. Analysis of released gp41-54Q-GHC via gel electrophoresis showed that bands consistent with the molecular weight of the non-encapsulated antigen (~14 kDa) were present in the polyacrylamide gels. As shown in Figure 4.1 the ~14 kDa protein band was present for the antigen released from all the nanoparticle formulations. However, the band corresponding to protein released from 50:50 CPTEG:CPH nanoparticles was more intense than that corresponding to protein released from 20:80

CPTEG:CPH or 20:80 CPH:SA nanoparticles. A small amount of degraded protein was visible in the lane corresponding to the 20:80 CPTEG:CPH nanoparticles. No low molecular weight bands were observed in the lanes corresponding to the other two chemistries. Based upon these results and upon our previous work, which suggested that amphiphilic formulations were more

97 suitable for release of stable proteins [31, 41, 42, 50, 52], the 50:50 CPTEG:CPH nanoparticle formulation was chosen to perform the carbohydrate functionalization and DC activation studies.

Figure 4.1. gp41-54Q-GHC antigen release kinetics from polyanhydride nanoparticles and structural stability upon release. A) Cumulative fraction of gp41-54Q-GHC released from (●) 50:50 CPTEG:CPH , (×) 20:80 CPTEG:CPH and (□) 20:80 CPH:SA nanoparticles. Error bars represent standard error of the mean; results are representative of two independent experiments with duplicate samples used in each experiment. B) Primary structure analysis of released gp41-54Q-GHC by gel electrophoresis. Samples were analyzed after one hour of release from 50:50 CPTEG:CPH, 20:80 CPTEG:CPH and 20:80 CPH:SA nanoparticles.

4.4.2. Functionalization and characterization of carbohydrate-modified nanoparticles

The functionalization of gp41-54Q-GHC-loaded 50:50 CPTEG:CPH nanoparticles was carried out using the two-step amine-carboxylic acid coupling reaction. This reaction was carried out under aqueous conditions, which leads to partial degradation of the biodegradable nanoparticles, and loss of payload in the

98 process. In order to minimize this loss, the total reaction time was varied from two to 18 hours and the resultant functionalized nanoparticles were characterized using QELS to measure zeta potential and the phenol sulfuric acid assay to quantify the amount of sugar attached to the surface of the nanoparticles. The ζ- potential and the surface concentration of the sugars for each formulation are shown in Table 4.1. The NF particles are negatively charged, consistent with the presence of carboxylic acid moieties with a ζ-potential of -20 ± 2.6 mV, while the addition of the linker resulted in a positively charged surface with a ζ-potential of

23 ± 3.7 mV. The reaction time did not significantly affect the ζ-potential of the di- mannose-functionalized nanoparticles, suggesting that one hour for each coupling reaction was sufficient. Based upon these results, and because of the importance of minimizing the time that the nanoparticles were subject to aqueous conditions, a total reaction time of two hours for carbohydrate functionalization was used in subsequent studies.

Table 4.1. Non-functionalized and functionalized nanoparticles were characterized by QELS and zeta potential measurements. Particle size data represent the mean value± standard deviation (SD) of dynamic light scattering data collected in two independent experiments. Zeta potential data represent the mean value±SD of three independent readings. Change in zeta potential indicates that sugars were efficiently conjugated to the 50:50 CPTEG:CPH nanoparticles' surface. Sugar density on nanoparticles' surface was determined by a colorimetric phenol-sulfuric acid assay. Amount of sugar was determined using standard curves; data is presented as mean ± SD of two independent experiments.

4.4.3. gp41-54Q-GHC release kinetics from functionalized nanoparticles

Figure 4.2 shows the sustained release of gp41-54Q-GHC immunogen from NF, linker-, and di-mannose functionalized 50:50 CPTEG:CPH nanoparticles for 30 days. The data in Figure 4.2 shows that surface functionalization did not affect the cumulative release kinetics from the functionalized nanoparticles in comparison with the NF nanoparticles. The protein loss because of the exposure to aqueous conditions was observed to be

24-30% for the functionalized nanoparticles. All the formulations showed a small

100 burst and >80% of the total amount of protein encapsulated in the nanoparticles was released from all the formulations.

Figure 4.2. Cumulative fraction of gp41-54Q-GHC released from (●) NF, (×) linker- and (□) di-mannose-functionalized 50:50 CPTEG:CPH nanoparticles. Error bars represent standard error of the mean; results are representative of two independent experiments with duplicate samples used in each experiment.

4.4.4. gp41-54Q-GHC antigenicity was preserved upon release from functionalized nanoparticles

The antigenicity of the released gp41-54Q-GHC from the NF and functionalized 50:50 CPTEG:CPH nanoparticles was evaluated with an ELISA by using three broadly neutralizing monoclonal HIV-1 antibodies (2F5, Z13e1 and

4E10) and the results are shown in Figure 4.3. Samples of released protein after

1 h in PBS (pH 7.4) at 37°C were compared to non-en capsulated gp41-54Q-

GHC. The relative antigenicity is defined as the ratio between the antigenicity of the released immunogen compared to that of the non-encapsulated immunogen.

The data in Figure 4.3 demonstrate that the antigenicity of the immunogen

101 released from all the formulations was preserved based on its recognition by all three monoclonal antibodies.

Figure 4.3. Antigenic analysis of released gp41-54Q-GHC at 37°C from NF, linker-, and di-mannose-functionalized 50:50 CPTEG:CPH nanoparticles. Antibody binding capability was measured by ELISA using three HIV monoclonal antibodies: Z13e1, 2F5, and 4E10. Error bars represent standard error of the mean from results obtained from two independent experiments with triplicate samples in each experiment.

4.4.5. Internalization by DCs was enhanced by functionalization

The internalization of gp41-54Q-GHC-loaded polyanhydride nanoparticles by DCs was investigated using QDs to identify cells that were positive for nanoparticles. The internalization data in Figure 4.4 is expressed as the percentage of cells that were positive for the QDs. These results indicate that the internalization of the nanoparticles was enhanced by functionalization. In particular, DCs internalized both linker- and di-mannose-functionalized nanoparticles more than two-fold in comparison with the NF nanoparticles. About

3% of DCs internalized the NF 50:50 CPTEG:CPH nanoparticles, while ~6% of

DCs internalized the linker- and di-mannose-functionalized nanoparticles. These results are consistent with previous studies in which CPTEG:CPH particles were

102 internalized by bone marrow-derived DCs.[54]

Figure 4.4. Cellular internalization was enhanced by positively charged polyanhydride nanoparticles. The internalization by DCs of QD-loaded NF, linker- , and di-mannose-functionalized nanoparticles was analyzed using flow cytometry. Error bars represent standard error of the mean; results are representative of three independent experiments with triplicate samples used in each experiment.

4.4.6. Functionalized nanoparticles enhanced DC expression of CD40 and CD206

DC activation was evaluated by stimulating bone marrow-derived DCs with gp41-54Q-GHC-containing nanoparticle formulations. Non-stimulated cells were used as a negative control and cells stimulated with LPS were used as a positive control. The up-regulation of MHC II, the co-stimulatory surface markers

CD40 and CD86, and the CLR, CD206, was analyzed using flow cytometry. The data in Figure 4.5 is presented as the mean fluorescence intensity (MFI) from

103 positive cells compared to isotypes for the marker of interest for each of the treatment groups. All the markers studied showed significant up-regulation compared to the negative control, as anticipated. Moreover, the data showed up- regulation of the co-stimulatory molecule CD40 and the CLR CD206 for cells stimulated with linker- and di-mannose-functionalized nanoparticles in comparison with NF nanoparticles as shown in Figure 4.5. The results also indicated that functionalization did not enhance the up-regulation of MHC II and the co-stimulatory molecule CD86 compared to the NF nanoparticles.

Figure 4.5. Di-mannose-functionalized nanoparticles enhanced DC expression of co-stimulatory molecules and CLRs. After stimulation with either 125 µg/mL of NF or functionalized nanoparticles for 48 h, DCs were harvested and analyzed by flow cytometry for surface expression of MHC II, CD86, CD40, and CD206. LPS-

104 stimulated and non-stimulated cells (NS) were used as positive and negative controls, respectively. Data are expressed as the mean ± SEM of three independent experiments performed in triplicate. * and # represent groups that are statistically significant (p ≤ 0.05) compared to the NS or NF groups, respectively. MFI = mean fluorescence intensity.

4.4.7. Functionalized nanoparticles modulated DC secretion of pro- inflammatory cytokines

The gp41-54Q-GHC-loaded nanoparticles were used to stimulate DCs and the supernatants were analyzed using a Bioplex assay to measure concentrations of the following cytokines: IL-6, IL-1β, TNF-α, IL-12p40, and IFN-

γ. Figure 4.6 shows that cells stimulated with the functionalized nanoparticles secreted less IL-6 and TNF-α, compared to that of the NF treatment, specifically when gp41-54Q-GHC is loaded into the nanoparticles. There were no significant differences for IL-1β, IL-12p40, and IFN-γ secretion between cells stimulated with antigen-loaded NF and functionalized particles (data not shown). The cytokine secretion from DCs stimulated with all the nanoparticle treatments was enhanced significantly compared to the negative control.

105

Figure 4.6. Enhancement of cytokine secretion after stimulation with NF nanoparticles is consistent with the amount of gp41-54Q-GHC released from polyanhydride nanoparticles. After stimulation with 125 µg/mL of NF or functionalized nanoparticles for 48 h, supernatants were collected and assayed for IL-6 and TNF-α. Data is represented as mean concentration of cytokines ± the SEM of three independent experiments performed in triplicate for antigen-loaded nanoparticles and two independent experiments in triplicate for blank nanoparticles. LPS was used as a positive control stimulant, and non-stimulated cells (NS) were used as a negative control. LPS control had the following MFI values: 50,000 for IL-6 and 25,000 for TNF-α. * and # represent statistical significance (p ≤ 0.05) compared to the NS or NF groups, respectively. Cumulative mass of released gp41-54Q-GHC from NF and functionalized nanoparticles over 72 h. Results are expressed as the average of two independent experiments with duplicate samples in each.

4.5. Discussion

Surface functionalization of polymeric nanoparticles to achieve targeted delivery of antigen has been used to enhance vaccine efficacy by directing antigens to specific cells of the immune system.[2,3,8,41-42,47,53] Previous studies have shown that particle size, charge, shape, chemistry and surface functionality affect the immune response.[28,31-32,40,47] Therefore, rational design of particle-based adjuvants must involve optimization of these attributes to enhance the efficacy of the immune response. This strategy has also been utilized to mimic pathogenic signals in order to generate potent and protective immune responses.[39-42] In the current studies, the HIV-1 immunogen gp41-

54Q-GHC was encapsulated into different polyanhydride formulations functionalized with carbohydrates and the stability of the released gp41-54Q-

GHC and the effect of the functionalization on DC activation were investigated.

The HIV-1 antigen gp41-54Q-GHC was first encapsulated in three

106 different polyanhydride nanoparticle formulations, i.e., 50:50 CPTEG:CPH, 20:80

CPTEG:CPH and 20:80 CPH:SA. These nanoparticles enabled sustained antigen release kinetics and provided an appropriate environment to preserve the primary structure of gp41-54Q-GHC. Released protein from 50:50 CPTEG:CPH nanoparticles displayed a more intense band after gel electrophoretic analysis when compared to the other formulations. This result combined with the high encapsulation efficiency of the protein and the amphiphilic properties of this copolymer suggested that this chemistry was the most appropriate to stabilize gp41-54Q-GHC [30,31,53]; accordingly, this chemistry was chosen for further studies with carbohydrate functionalization and DC activation.

The functionalization of antigen-loaded polyanhydride nanoparticles was optimized and the total reaction time was reduced to two hours with 24-30% loss of immunogen during the process. As shown in Figure 4.2, the release kinetics of gp41-54Q-GHC from the different polyanhydride nanoparticle formulations displayed similar behavior, independent of the type of functionalization (i.e., linker and di-mannose) and was consistent with the release of the immunogen from the

NF nanoparticles.[29] All these formulations provided sustained release of gp41-

54Q-GHC, which is a desirable attribute for vaccine formulations. This is because it has been demonstrated previously that prolonging the presence of antigen in the host can improve the generation of antigen-specific memory cells that can trigger potent immune responses towards future infections.[19,32]

The gp41-54Q-GHC immunogen released from the functionalized polyanhydride nanoparticles maintained its antigenic activity upon release, which

107 was tested by its ability to bind to three monoclonal HIV-1 antibodies: 2F5, 4E10 and Z13e1 (Figure 4.3). The slight increase in the relative antigenicity of the protein released from the NF nanoparticles with the 2F5 antibody and that released from all the nanoparticle formulations with the 4E10 antibody may be attributed to minor conformational changes of the antigen after encapsulation and release, as observed previously.[31,52-53,62-63] These results indicated that the functionalization process did not significantly affect the antigenicity of gp41-54Q-

GHC upon release. The small changes in antigenicity, if any, may be attributable to the encapsulation and release processes, as shown previously.[31,52-53,63-

64]

It is known that cells internalize positively charged nanoparticles more effectively than neutral or negatively charged nanoparticles.[2-3,8] Previous studies have demonstrated the effect of surface charge on particle internalization and the results from the current studies are consistent with these studies.[39-41]

Functionalization with linker results in positively charged nanoparticles, which were internalized more efficiently by DCs, as shown in Figure 4.4. There were significant differences in cells positive for nanoparticles between the functionalized and the NF nanoparticles, indicating the importance of surface charge and/or specific internalization pathways (i.e., mannose receptor-mediated endocytosis) with respect to particle uptake. The enhanced internalization was observed for both the di-mannose- and the linker-functionalized nanoparticles, suggesting that surface charge may be more important than receptor-mediated uptake. On the other hand, previous work has shown that targeting specific

108 receptors such as the macrophage mannose receptor by functionalizing nanoparticles with carbohydrates such as di-mannose resulted in enhanced APC activation.[39-41,48] Based on these observations and the current work, it is hypothesized that combinatorial use of both surface charge and functionalization with ligands that target specific CLRs may be important for enhanced internalization of the functionalized nanoparticles. This enhanced internalization can lead to the efficient delivery of antigen to the APCs, which is important for the induction of robust T cell-mediated immune responses.[2-3,40,65] It is important to note even though only a small percentage of cells were positive for CPTEG- containing particles in vitro, antigen-encapsulated 50:50 CPTEG:CPH formulations have been shown in previous studies to induce protective immunity.

The appropriate activation of APCs is an important component of an immune response a subsequent live challenge.[32,34] In addition, it has been hypothesized that HIV-1 infection of DCs via dendritic cell-specific intercellular adhesion molecule-3-grabbing non-integrin (DC-SIGN) may cause DC-DC viral transmission, or DC-T cell infection amplification.[66,67] In addition, it is known that DC-SIGN+ immature DCs, which are located in vaginal, cervical and rectal mucosa, are the first type of cells to encounter the HIV-1 virion.[68] It is also known that DC-SIGN captures HIV-1 in the periphery and facilitates its transport to secondary lymphoid organs rich in T cells.[66] While these functions are performed by DC-SIGN in DCs, they are performed by the MMR in macrophages and epithelial DCs, which are present at mucosal surfaces.[68, 69] In this regard, surface functionalization of nanoparticle-based vaccines or anti-viral delivery

109 vehicles with carbohydrates offers the possibility to target CLRs such as the

MMR or DC-SIGN in macrophages or dendritic cells.towards pathogens.[1,16,47-

48,50] Specifically, during HIV-1 infection, DCs and macrophages play critical roles in the induction of robust and balanced immune responses.[1-2,14-

16,19,22-23] Even though DC-SIGN has been identified as a key player in HIV-1 infection, the presence of the MMR on epithelial DCs and macrophages offers the possibility to specifically target nanovaccines and/or anti-viral delivery vehicles towards these cellular populations, since mucosal vaccination has been shown to elicit antibodies across these surfaces, specifically in vaginal and genital tissues.[70]

Therefore, up-regulation of APC activation markers, including CD206, is a desirable characteristic of adjuvants used in conjunction with an HIV-1 vaccine.[25,52-53] All the nanoparticle formulations studied herein enhanced the

DC surface expression of MHC II, the co-stimulatory molecules CD40 and CD86, and the CLR CD206 compared to non-stimulated cells (Figure 4.5). While cells stimulated with the carbohydrate-functionalized nanoparticles showed enhanced expression of CD40 and CD206 compared to cells stimulated with NF nanoparticles, the surface expression of CD86 and MHC II were similar in cells stimulated by both NF and functionalized nanoparticles. The MFI of cells stimulated with the gp41-54Q-GH-encapsulated nanoparticles was higher than that of the cells stimulated by the NF nanoparticles, regardless of functionalization (data not shown). The enhanced expression of CD40 and

CD206 is consistent with the internalization data of Figure 4.4 because it has

110 been shown previously that particle uptake is required for the up-regulation of these molecules.[41-42] It is known that CD40 is important for DC maturation that drives T cell activation, while CD206-mediated antigen delivery has been shown to enhance humoral immune responses.[1,2,10,65,71] These characteristics are desirable when designing an HIV-1 vaccine due to the important role of a balanced immune response involving both cellular and humoral components.[19,72] The results in Figure 4.5 also indicated that functionalization did not enhance the up-regulation of MHC II and the co-stimulatory molecule

CD86 compared to the NF nanoparticles. This observation suggests the presence of a bystander effect, which enables cells that are in close proximity with nanoparticles to enhance their surface expression of MHC II and CD86, rendering nanoparticle internalization unnecessary.[48,54] These data are consistent with previous studies that also postulated a bystander effect for up- regulation of MHC II and CD86.[48,54]

Nanoparticle functionalization modulated cytokine secretion by DCs, as shown in Figure 4.6. The secretion of IL-1β, IL-12p40 and IFN-γ was similar in cells stimulated by NF or functionalized nanoparticles. In contrast, the DC secretion of IL-6 and TNF-α was higher when stimulated with the NF nanoparticles in contrast to the functionalized nanoparticles. This observation may be attributed to the higher amount of antigen present in the NF nanoparticles compared to that in the functionalized nanoparticles. These results are consistent with the mass of gp41-54Q-GHC released from the nanoparticles within the first 72 h as shown in Figure 4.6. In control experiments, it was

111 demonstrated that the antigen-containing nanoparticles (regardless of functionalization or lack thereof) resulted in higher cytokine secretion than their respective “blank” (i.e., no antigen) counterparts. The antigen-dependent response of cytokine secretion suggests that the higher amount of protein encapsulated within the NF nanoparticles compared to the carbohydrate- functionalized nanoparticles may be important and is consistent with previous observations.[5] The presence of antigen within the particles appears to be more important for IL-6 and TNF-α secretion than for the secretion of IL-1β, IL-12p40 and IFN-γ. These results are consistent with previous work, in which it has been shown that when targeting specific CLRs such as SIGNR1, there is a decrease in the secretion of cytokines such as IL-6 or TNF-α.[73,74] It has also been shown using a colitis model that deficiency of this receptor results in a decrease in the secretion of these cytokines.[75] These results suggest that creating combinations of NF and functionalized nanoparticle formulations may provide the benefits of enhanced internalization, up-regulation of cell surface markers, and enhanced secretion of the appropriate cytokines, all of which will lead to potent immune responses.

The current experiments demonstrate that polyanhydride nanoparticles can serve as a promising adjuvant and/or delivery system for an HIV-1 nanovaccine. The studies provide important insights upon the behavior of APCs when stimulated with nanoparticles of different chemistries, surface charge, functionalization, and antigen encapsulation. Such insights are valuable for the rational design of adjuvants/delivery vehicles for vaccine development. The

112 desirable characteristics of the polyanhydride nanoparticle platform include the provision of antigen stability, sustained release, enhanced particle uptake, and

DC activation. Carbohydrate functionalization of the nanoparticles enhanced their adjuvant capabilities by enabling charge and receptor-mediated uptake mechanisms. The current studies demonstrate the potential of using functionalized polyanhydride nanoparticles as an adjuvant/delivery vehicle for

HIV-1 antigens and provide the opportunity to tailor specific properties to lead to efficacious immune responses downstream.

4.6. Conclusions

In these studies, carbohydrate-functionalized polyanhydride nanoparticles were investigated as targeted antigen delivery vehicles and adjuvants for gp41-

54Q-GHC, an HIV-1 antigen. Polymer chemistry, surface functionalization, and antigen encapsulation were analyzed and their effect on DC activation was evaluated. The results demonstrated that amphiphilic polyanhydride nanoparticles released antigenic gp41-54Q-GHC and that functionalization enhanced particle internalization. Functionalization also enhanced the up- regulation of DC activation markers, while regulating cytokine secretion. These data offer important insights into the performance of functionalized nanoparticles with respect to releasing stable HIV-1 immunogens and activating DCs. Active targeting of these nanoparticles by functionalization with carbohydrates offers a promising opportunity to design efficacious vaccine delivery systems for HIV-1.

113

4.7. Acknowledgments

The authors acknowledge financial support from NIH-NIAID (U19 AI-

091031). The authors acknowledge useful discussions with Dr. Michael J.

Wannemuehler on the DC activation data and thank Shawn Rigby of the Iowa

State University Flow Cytometry facility for his assistance with the flow cytometry experiments. MWC has an equity interest in NeoVaxSyn Incorporated, and serves as CEO/President. NeoVaxSyn Inc. did not contribute to this work or to the interpretation of the data. The following reagents were obtained through the

NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 gp41 mAb

2F5, 4E10 and Z13e1.

114

4.8. References

[1] Geijtenbeek TB, Gringhuis SI. Signalling through C-type lectin receptors: shaping immune responses. Nat Rev Immunol 2009;9:465-79.

[2] Keler T, Ramakrishna V, Fanger MW. Mannose receptor-targeted vaccines. Expert Opin Biol Ther 2004;4:1953-62.

[3] Irache JM, Salman HH, Gamazo C, Espuelas S. Mannose-targeted systems for the delivery of therapeutics. Expert Opin Drug Deliv 2008;5:703-24.

[4] Deng Z, Li S, Jiang X, Narain R. Well-defined galactose-containing multi- functional copolymers and glyconanoparticles for biomolecular recognition processes. Macromolecules 2009;42:6393-405.

[5] Song EH, Osanya AO, Petersen CA, Pohl NL. Synthesis of multivalent tuberculosis and Leishmania-associated capping carbohydrates reveals structure-dependent responses allowing immune evasion. J Am Chem Soc 2010;132:11428-30.

[6] Engering AJ, Cella M, Fluitsma D, Brockhaus M, Hoefsmit EC, Lanzavecchia A, et al. The mannose receptor functions as a high capacity and broad specificity antigen receptor in human dendritic cells. Eur J Immunol 1997;27:2417-25.

[7] Upham JP, Pickett D, Irimura T, Anders EM, Reading PC. Macrophage receptors for influenza A virus: role of the macrophage galactose-type lectin and mannose receptor in viral entry. J Virol 2010;84:3730-7.

[8] Jiang HL, Kang ML, Quan JS, Kang SG, Akaike T, Yoo HS, et al. The potential of mannosylated chitosan microspheres to target macrophage mannose receptors in an adjuvant-delivery system for intranasal immunization. Biomaterials 2008;29:1931-9.

[9] Figdor CG, van Kooyk Y, Adema GJ. C-type lectin receptors on dendritic cells and Langerhans cells. Nat Rev Immunol 2002;2:77-84.

[10] Cambi A, Figdor CG. Dual function of C-type lectin-like receptors in the immune system. Curr Opin Cell Biol 2003;15:539-46.

115

[11] Stahl PD. The mannose receptor and other macrophage lectins. Curr Opin Immunol 1992;4:49-52.

[12] Pyz E, Marshall AS, Gordon S, Brown GD. C-type lectin-like receptors on myeloid cells. Ann Med 2006;38:242-51.

[13] Chehimi J, Luo Q, Azzoni L, Shawver L, Ngoubilly N, June R, et al. HIV-1 transmission and cytokine-induced expression of DC-SIGN in human monocyte- derived macrophages. J Leukoc Biol 2003;74:757-63.

[14] Herbein G, Gras G, Khan KA, Abbas W. Macrophage signaling in HIV-1 infection. Retrovirology 2010;7:34.

[15] Gringhuis SI, van der Vlist M, van den Berg LM, den Dunnen J, Litjens M, Geijtenbeek TB. HIV-1 exploits innate signaling by TLR8 and DC-SIGN for productive infection of dendritic cells. Nat Immunol 2010;11:419-26.

[16] Mascola JR, Montefiori DC. The role of antibodies in HIV vaccines. Ann Rev Immunol 2010;28:413-44.

[17] Zolla-Pazner S. Identifying epitopes of HIV-1 that induce protective antibodies. Nat Rev Immunol 2004;4:199-210.

[18] UNAIDS. Global report: UNAIDS report on the global AIDS epidemic 2010. 2010.

[19] McMichael AJ, Borrow P, Tomaras GD, Goonetilleke N, Haynes BF. The immune response during acute HIV-1 infection: clues for vaccine development. Nat Rev Immunol 2010;10:11-23.

[20] Catalfamo M, Di Mascio M, Hu Z, Srinivasula S, Thaker V, Adelsberger J, et al. HIV infection-associated immune activation occurs by two distinct pathways that differentially affect CD4 and CD8 T cells. Proc Natl Acad Sci U S A 2008;105:19851-6.

[21] Karlsson Hedestam GB, Fouchier RA, Phogat S, Burton DR, Sodroski J, Wyatt RT. The challenges of eliciting neutralizing antibodies to HIV-1 and to influenza virus. Nat Rev Microbiol 2008;6:143-55.

116

[22] Nguyen DG, Hildreth JE. Involvement of macrophage mannose receptor in the binding and transmission of HIV by macrophages. Eur J Immunol 2003;33:483-93.

[23] Sol-Foulon N, Moris A, Nobile C, Boccaccio C, Engering A, Abastado JP, et al. HIV-1 NEF-induced upregulation of DC-SIGN in dendritic cells promotes lymphocyte clustering and viral spread. Immunity 2002;16:145-55.

[24] Geijtenbeek TB, Kwon DS, Torensma R, van Vliet SJ, van Duijnhoven GC, Middel J, et al. DC-SIGN, a dendritic cell-specific HIV-1-binding protein that enhances trans-infection of T cells. Cell 2000;100:587-97.

[25] Scanlan CN, Offer J, Zitzmann N, Dwek RA. Exploiting the defensive sugars of HIV-1 for drug and vaccine design. Nature 2007;446:1038-45.

[26] Shi W, Bohon J, Han DP, Habte H, Qin Y, Cho MW, et al. Structural characterization of HIV gp41 with the membrane-proximal external region. J Biol Chem 2010;285:24290-8.

[27] Conix A. Poly[1,3-bis( p-carboxyphenoxy)-propane anhydride]. Macromolecular Synthesis 1966;2:95-8.

[28] Kumar N, Langer RS, Domb AJ. Polyanhydrides: an overview. Adv Drug Deliv Rev 2002;54:889-910.

[29] Torres MP, Vogel BM, Narasimhan B, Mallapragada SK. Synthesis and characterization of novel polyanhydrides with tailored erosion mechanisms. J Biomed Mater Res A 2006;76:102-10.

[30] Petersen LK, Sackett CK, Narasimhan B. High-throughput analysis of protein stability in polyanhydride nanoparticles. Acta Biomater 2010;6:3873-81.

[31] Carrillo-Conde B, Schiltz E, Yu J, Chris Minion F, Phillips GJ, Wannemuehler MJ, et al. Encapsulation into amphiphilic polyanhydride microparticles stabilizes Yersinia pestis antigens. Acta Biomater 2010;6:3110-9.

[32] Ulery BD, Kumar D, Ramer-Tait AE, Metzger DW, Wannemuehler MJ, Narasimhan B. Design of a protective single-dose intranasal nanoparticle-based

117 vaccine platform for respiratory infectious diseases. PLoS One 2011;6:e17642 doi:17610.11371/journal.pone.0017642.

[33] Kipper MJ, Wilson JH, Wannemuehler MJ, Narasimhan B. Single dose vaccine based on biodegradable polyanhydride microspheres can modulate immune response mechanism. J Biomed Mater Res A 2006;76:798-810.

[34] Ulery BD, Petersen LK, Phanse Y, Kong CS, Broderick SR, Kumar D, et al. Rational design of pathogen-mimicking amphiphilic materials as nanoadjuvants. Sci Rep. 2011;1:198 DOI:10.1038/srep00198.

[35] Penn-Nicholson A, Han DP, Kim SJ, Park H, Ansari R, Montefiori DC, et al. Assessment of antibody responses against gp41 in HIV-1-infected patients using soluble gp41 fusion proteins and peptides derived from M group consensus envelope. Virology 2008;372:442-56.

[36] Gaiha GD, Dong T, Palaniyar N, Mitchell DA, Reid KB, Clark HW. Surfactant protein A binds to HIV and inhibits direct infection of CD4+ cells, but enhances dendritic cell-mediated viral transfer. J Immunol. 2008;181:601-9.

[37] Fantuzzi L, Canini I, Belardelli F, Gessani S. HIV-1 gp120 stimulates the production of beta-chemokines in human peripheral blood monocytes through a CD4-independent mechanism. J Immunol. 2001;166:5381-7.

[38] Shan M, Klasse PJ, Banerjee K, Dey AK, Iyer SP, Dionisio R, et al. HIV-1 gp120 mannoses induce immunosuppressive responses from dendritic cells. PLoS Pathog. 2007;3:e169.

[39] Shen E, Pizsczek R, Dziadul B, Narasimhan B. Microphase separation in bioerodible copolymers for drug delivery. Biomaterials 2001;22:201-10.

[40] Torres MP, Wilson-Welder JH, Lopac SK, Phanse Y, Carrillo-Conde B, Ramer-Tait AE, et al. Polyanhydride microparticles enhance dendritic cell antigen presentation and activation. Acta Biomater 2011;7:2857-64.

118

[41] Kipper MJ, Shen E, Determan A, Narasimhan B. Design of an injectable system based on bioerodible polyanhydride microspheres for sustained drug delivery. Biomaterials 2002;23:4405-12.

[42] Ulery BD, Phanse Y, Sinha A, Wannemuehler MJ, Narasimhan B, Bellaire BH. Polymer chemistry influences monocytic uptake of polyanhydride nanospheres. Pharm Res 2009;26:683-90.

[43] Jaipuri FA, Pohl NL. Toward solution-phase automated iterative synthesis: fluorous-tag assisted solution-phase synthesis of linear and branched mannose oligomers. Org Biomol Chem 2008;6:2686-91.

[44] Curran DP, Luo Z. Fluorous synthesis with fewer fluorines (light fluorous synthesis): Separation of tagged from untagged products by solid-phase extraction with fluorous reverse-phase silica gel. J Amer Chem Soc 1999;121:9069-72.

[45] Zhang W. Fluorous linker-facilitated chemical synthesis. Chem Rev 2009;109:749-95.

[46] Zhang W, Curran DP. Synthetic applications of fluorous solid-phase extraction (F-SPE). Tetrahedron 2006;62:11837-65.

[47] Carrillo-Conde B, Song EH, Chavez-Santoscoy A, Phanse Y, Ramer-Tait AE, Pohl NL, et al. Mannose-functionalized "pathogen-like" polyanhydride nanoparticles target C-type lectin receptors on dendritic cells. Mol Pharm 2011;8:1877-86.

[48] Chavez-Santoscoy AV, Roychoudhury R, Pohl NL, Wannemuehler MJ, Narasimhan B, Ramer-Tait AE. Tailoring the immune response by targeting C- type lectin receptors on alveolar macrophages using "pathogen-like" amphiphilic polyanhydride nanoparticles. Biomaterials 2012;33:4762-72.

[49] Carrillo-Conde BR, Roychoudhury R, Chavez-Santoscoy AV, Narasimhan B, Pohl NL. High-throughput synthesis of carbohydrates and functionalization of polyanhydride nanoparticles. J Vis Exp 2012; 64:e3884, DOI:10.3791/3884.

119

[50] Phanse Y, Carrillo-Conde BR, Ramer-Tait AE, Roychoudhury R, Pohl NL, Narasimhan B, et al. Functionalization of polyanhydride microparticles with di- mannose influences uptake by and intracellular fate within dendritic cells. Acta Biomater 2013;9:8902-9.

[51] Masuko T, Minami A, Iwasaki N, Majima T, Nishimura S, Lee YC. Carbohydrate analysis by a phenol-sulfuric acid method in microplate format. Anal Biochem 2005;339:69-72.

[52] Lopac SK, Torres MP, Wilson-Welder JH, Wannemuehler MJ, Narasimhan B. Effect of polymer chemistry and fabrication method on protein release and stability from polyanhydride microspheres. J Biomed Mater Res B Appl Biomater 2009;91:938-47.

[53] Torres MP, Determan AS, Anderson GL, Mallapragada SK, Narasimhan B. Amphiphilic polyanhydrides for protein stabilization and release. Biomaterials 2007;28:108-16.

[54] Carrillo-Conde BR, Ramer-Tait AE, Wannemuehler MJ, Narasimhan B. Chemistry-dependent adsorption of serum proteins onto polyanhydride microparticles differentially influences dendritic cell uptake and activation. Acta Biomater 2012;8:3618-28.

[55] Buchacher A, Predl R, Strutzenberger K, Steinfellner W, Trkola A, Purtscher M, et al. Generation of human monoclonal antibodies against HIV-1 proteins; electrofusion and Epstein-Barr virus transformation for peripheral blood lymphocyte immortalization. AIDS Res Hum Retroviruses 1994;10:359-69.

[56] Purtscher M, Trkola A, Grassauer A, Schulz PM, Klima A, Döpper S, et al. Restricted antigenic variability of the epitope recognized by the neutralizing gp41 antibody 2F5. AIDS 1996;10:587-93.

[57] Purtscher M, Trkola A, Gruber G, Buchacher A, Predl R, Steindl F, et al. A broadly neutralizing human monoclonal antibody against gp41 of human immunodeficiency virus type 1. AIDS Res Hum Retroviruses 1994;10:1651-8.

120

[58] Nelson JD, Brunel FM, Jensen R, Crooks ET, Cardoso RM, Wang M, et al. An affinity-enhanced neutralizing antibody against the membrane-proximal external region of human immunodeficiency virus type 1 gp41 recognizes an epitope between those of 2F5 and 4E10. J Virol 2007;81:4033-43.

[59] Stiegler G, Kunert R, Purtscher M, Wolbank S, Voglauer R, Steindl F, et al. A potent cross-clade neutralizing human monoclonal antibody against a novel epitope on gp41 of human immunodeficiency virus type 1. AIDS Res Hum Retroviruses 2001;17:1757-65.

[60] Zwick MB, Labrijn AF, Wang M, Spenlehauer C, Saphire EO, Binley JM, et al. Broadly neutralizing antibodies targeted to the membrane-proximal external region of human immunodeficiency virus type 1 glycoprotein gp41. J Virol 2001;75:10892-905.

[61] Petersen LK, Xue L, Wannemuehler MJ, Rajan K, Narasimhan B. The simultaneous effect of polymer chemistry and device geometry on the in vitro activation of murine dendritic cells. Biomaterials 2009;30:5131-42.

[62] Petersen LK, Ramer-Tait AE, Broderick SR, Kong CS, Ulery BD, Rajan K, et al. Activation of innate immune responses in a pathogen-mimicking manner by amphiphilic polyanhydride nanoparticle adjuvants. Biomaterials 2011;32:6815-22.

[63] Determan AS, Graham JR, Pfeiffer KA, Narasimhan B. The role of microsphere fabrication methods on the stability and release kinetics of ovalbumin encapsulated in polyanhydride microspheres. J Microencapsul 2006;23:832-43.

[64] Petersen LK, Phanse Y, Ramer-Tait AE, Wannemuehler MJ, Narasimhan B. Amphiphilic polyanhydride nanoparticles stabilize Bacillus anthracis protective antigen. Mol Pharm 2012;9:874-82.

[65] Adams EW, Ratner DM, Seeberger PH, Hacohen N. Carbohydrate-mediated targeting of antigen to dendritic cells leads to enhanced presentation of antigen to T cells. Chembiochem 2008;9:294-303.

121

[66] Turville S, Wilkinson J, Cameron P, Dable J, Cunningham AL. The role of dendritic cell C-type lectin receptors in HIV pathogenesis. J Leukoc Biol 2003;74:710-8.

[67] Berzi A, Varga N, Sattin S, Antonazzo P, Biasin M, Cetin I, et al. Pseudo- mannosylated DC-SIGN ligands as potential adjuvants for HIV vaccines. Viruses 2014;6:391-403. [68] Jameson B, Baribaud F, Pohlmann S, Ghavimi D, Mortari F, Doms RW, et al. Expression of DC-SIGN by dendritic cells of intestinal and genital mucosae in humans and rhesus macaques. J Virol 2002;76:1866-75.

[69] Cunningham AL, Harman AN, Donaghy H. DC-SIGN 'AIDS' HIV immune evasion and infection. Nat Immunol 2007;8:556-8. [70] Holmgren J, Czerkinsky C. Mucosal immunity and vaccines. Nat Med 2005;11:S45-53. [71] Elgueta R, Benson MJ, de Vries VC, Wasiuk A, Guo Y, Noelle RJ. Molecular mechanism and function of CD40/CD40L engagement in the immune system. Immunol Rev 2009;229:152-72. [72] McKenzie EJ, Taylor PR, Stillion RJ, Lucas AD, Harris J, Gordon S, et al. Mannose receptor expression and function define a new population of murine dendritic cells. J Immunol 2007;178:4975-83. [73] Ohtani M, Iyori M, Saeki A, Tanizume N, Into T, Hasebe A, et al. Involvement of suppressor of cytokine signalling-1-mediated degradation of MyD88-adaptor-like protein in the suppression of Toll-like receptor 2-mediated signalling by the murine C-type lectin SIGNR1-mediated signalling. Cell Microbiol 2012;14:40-57. [74] Lewis JS, Zaveri TD, Crooks CP, 2nd, Keselowsky BG. Microparticle surface modifications targeting dendritic cells for non-activating applications. Biomaterials 2012;33:7221-32. [75] Saunders SP, Barlow JL, Walsh CM, Bellsoi A, Smith P, McKenzie AN, et al. C-type lectin SIGN-R1 has a role in experimental colitis and responsiveness to lipopolysaccharide. J Immunol 2010;184:2627-37.

122

CHAPTER 5

Serum protein adsorption and complement receptor 3 mediate macrophage activation by polyanhydride nanoparticles

Julia E. Vela-Ramirez 1, Paola M. Boggiatto 2, Michael J.

Wannemuehler 2 and Balaji Narasimhan 1*

1Department of Chemical and Biological Engineering, Iowa State University, Ames, IA 50011

2Department of Veterinary Microbiology and Preventive Medicine, Iowa State University, Ames,

IA 50011

To be submitted to the Journal of Biomedical Materials Research A on January 15, 2015

* To whom all correspondence should be addressed Phone: 515-294-8019; email: [email protected]

123

5.1. Abstract

An in-depth understanding of the interactions of antigen delivery vehicles with antigen presenting cells and the complement system is important for tailoring adjuvant properties and eliciting efficacious immune responses.

Polymeric nanoparticles have been widely used as adjuvants and delivery vehicles, and upon parenteral administration, serum proteins adsorb onto these particles, modifying their interactions with the components of the immune system.

The current studies present a systematic analysis of the role of the presence of complement receptor 3 (CR3), serum protein adsorption, and polymer chemistry on the uptake and activation of bone marrow-derived macrophages. The results suggest that all of these factors affected macrophage activation. Serum protein adsorption was dependent on polymer chemistry and hydrophobicity, with a wide variety of proteins being adsorbed onto the surface of the nanoparticles.

Secretion of the pro-inflammatory cytokines IL-6 and TNF-α was up-regulated by the presence of CR3 and because of serum protein adsorption, resulting in a classically activated macrophage phenotype, which is known to be beneficial for the induction of immune responses. The complex dependence of the activation of macrophages on nanoparticle chemistry, CR3, and protein opsonization provides new insights that can aid the rational design of antigen delivery platforms for induction of robust immune responses.

124

5.2. Introduction

A major area of research in vaccine design is focused on the generation of robust immune responses towards specific antigens [1, 2]. In order to elicit these responses and confer protective immunity, activation of the innate immune system is critical [3-5]. A key component of innate immunity is the activation of antigen presenting cells (APCs) by recognition of microbial-associated molecular patterns (MAMPS) by pattern recognition receptors (PRRs) [6-8]. The interactions between APCs and antigen delivery systems can be tailored to enhance antigen presentation and processing, thus impacting the downstream immune response [9, 10]. Therefore, in order to rationally design vaccine delivery vehicles, an understanding of the role of carrier chemistry and surface functionality on interactions with APCs is necessary [11-14].

Complement system activation is one of the mechanisms of innate immunity that is used to induce inflammatory responses to help the body fight infections [3-5, 15]. Complement is a series of plasma proteins that interacts with pathogens and opsonizes them, causing a cascade of signals [4, 15].

Opsonization of pathogens and foreign bodies is part of the mechanism used by the immune system to increase uptake and antigen processing by phagocytic cells through specific recognition of complement receptors [4, 16-19]. In particular, complement receptor 3 (CD11b/CD18) is the most promiscuous of these integrins, because of its broad diversity of ligand recognition, which includes iC3b, fibrinogen, ICAM-1, haptoglobin, etc. [17-19] Complement receptor 3 (CR3) is known to mediate internalization of opsonized and non-

125 opsonized pathogens through different pathways and has been implicated in the binding of β-glucans and soluble and particulate saccharides by human phagocytic cells [17, 20]. Previous studies have shown that this integrin facilitates the polysaccharide binding associated with lipopolysaccharide (LPS), Leishmania lipophosphoglycan , Klebsiellapneumoniae acylpolyglactoside , and

Mycobacterium tuberculosis and aids the uptake of Salmonella typhimurium and

Ross River virus [21-26]. In order to rationally design pathogen mimicking vaccine delivery systems, the role of CR3 on the interactions between immune cells and antigen delivery vehicles needs to be systematically analyzed.

Polymeric nanoparticle-based adjuvants/delivery systems have been studied for the past several decades as an alternative strategy to develop efficacious vaccine formulations [27]. In particular, biodegradable polyanhydride particles have demonstrated superior capabilities with respect to antigen stabilization, sustained antigen release, and immune stimulation that make them promising candidates for vaccine adjuvants and/or delivery vehicles [5, 9, 14, 28-

30]. In addition, polyanhydride particles have shown: i) uptake by and activation of APCs [9, 12, 30]; and ii) surface chemistry and polymer chemistry-dependent serum protein adsorption patterns [12, 16, 30, 31]. These attributes have important implications for adjuvant design and development and for the induction of efficacious immune responses [9, 28-32].

In this study serum protein adsorption patterns onto two types of polyanhydride nanoparticles and their effects on macrophage uptake and activation were investigated. These two formulations have been shown to be

126 potent adjuvants, based on their ability to enhance both humoral and cell- mediated immunity [33-35]. CR3 knockout (CR3 -/-) mice were used to understand the role of this receptor in nanoparticle internalization. The insights gained from these studies can be used to unravel the role of particle/protein and particle/cell interactions on the activation of APCs and aid in the rational design of efficacious vaccine adjuvants/delivery systems.

5.3. Materials and Methods

5.3.1. Materials Chemicals needed for monomer synthesis, polymerization, and nanoparticle synthesis are: 1-methyl-2-pyrrolidinone, anhydrous (99+%) p- carboxy benzoic acid (99+%), and sebacic acid (99%), purchased from Aldrich

(Milwaukee, WI); 1,6-dibromohexane, 4-p-hydroxybenzoic acid, and triethylene glycol, purchased from Sigma-Aldrich (St. Louis, MO); 4-p-fluorobenzonitrile, obtained from Apollo Scientific (Cheshire, UK); and acetic acid, acetic anhydride, acetonitrile, dimethyl formamide (DMF), ethyl ether, hexane, methylene chloride, pentane, petroleum ether, potassium carbonate, sulfuric acid, and toluene, purchased from Fisher Scientific (Fairlawn, NJ). For 1H NMR characterization, deuterated chemicals, including chloroform and dimethyl sulfoxide (DMSO), were purchased from Cambridge Isotope Laboratories (Andover, MA). β- mercaptoethanol, E. coli LPS O26:B6 and rat immunoglobulin (rat IgG) were purchased from Sigma Aldrich. Materials required for harvest and culture

127 mediums for macrophages included: Dulbecco’s Modified Eagle Medium with high glucose, sodium pyruvate, 1M HEPES buffer, penicillin-streptomycin, and L- glutamine, purchased from Mediatech (Herndon, VA); and heat inactivated fetal bovine serum, purchased from Atlanta Biologicals (Atlanta, GA). Materials used for flow cytometry included: BD stabilizing fixative solution purchased from BD

Bioscience (San Jose, CA); unlabeled anti-CD16/32 Fc γR, purchased from

Southern Biotech (Birmingham, AL); allophycocyanin anti-mouse CD40 (clone

1C10), PE conjugated anti-mouse MHC Class I (H-2Kd/H-2Dd) (clone 34-1-2S),

FITC conjugated anti-mouse MHC Class II (I-A/I-E) (clone M5/114.15.2) and their corresponding isotypes APC-conjugated rat IgG2a κ (clone eBR2a), PE- conjugated rat IgG2a κ (clone eBR2a), FITC-conjugated rat IgG2b κ (clone eB149/10H5) were purchased from eBiosciences (San Diego, CA). APC/Cy7 conjugated anti-mouse F4/80 (clone BM8), PE/Cy7 conjugated anti-mouse CD86

(clone GL-1), PerCP/Cy5.5 conjugated anti-mouse CD80 (clone 16-10A1) and their corresponding isotypes APC/Cy7 conjugated rat IgG2a κ (clone RTK2758),

PE/Cy7 conjugated rat IgG2a κ (clone RTK2758), PerCP/Cy5.5 conjugated

Armenian Hamster IgG (clone HTK888) were purchased from BioLegend (San

Diego, CA). Cadmium selenide quantum dots (QDs) (emission at 630 nm) were a kind gift from Dr. Aaron Clapp at Iowa State University.

5.3.2. Monomer and Polymer Synthesis

Di-acid monomers based on 1,6-bis( p-carboxyphenoxy) hexane (CPH) and 1,8-bis( p-carboxyphenoxy)-3,6-dioxaoctane (CPTEG) were synthesized as

128 described previously [28, 36]. SA and CPH prepolymers were synthesized by the methods described by Shen et al. [32] and Conix et al. [36], respectively.

Subsequently, 20:80 CPH:SA and 20:80 CPTEG:CPH copolymers were synthesized by melt polycondensation as described by Kipper et al. [14] and

Torres et al. [9], respectively. The chemical structure was characterized with 1H

NMR using a Varian VXR 300 MHz spectrometer (Varian Inc., Palo Alto, CA) and the molecular mass was determined using gel permeation chromatography

(GPC) on a Waters GPC chromatograph (Milford, MA) containing PL gel columns

(Polymer Laboratories, Amherst, MA). The 20:80 CPH:SA copolymer had a M w of

14,000 Da and a polydispersity index (PDI) of 1.4 and the 20:80 CPTEG:CPH copolymer had a M w of 7,800 and a PDI of 1.3. These values are consistent with previous work [27, 28, 32, 33, 37, 38].

5.3.3. Nanoparticle Synthesis Polyanhydride nanoparticles were synthesized using an anti-solvent nanoencapsulation method as described previously [39]. Briefly, polymer (20 mg/mL) was dissolved in methylene chloride (at 4°C for 20:80 CPTEG:CPH and at room temperature (RT) for 20:80 CPH:SA). The polymer solution was sonicated at 40 Hz for 30 s using a probe sonicator (Ultra Sonic Processor VC

130PB, Sonics Vibra Cell, Newtown, CT) and rapidly poured into a pentane bath

(at -40°C for CPTEG:CPH and at RT for CPH:SA) at a solvent to non-solvent ratio of 1:250. Particles were collected by filtration and dried under vacuum for 1 h. Nanoparticles were characterized using scanning electron microscopy (SEM,

FEI Quanta 250, Kyoto, Japan).

129

5.3.4. Mice C57BL/6 mice were purchased from Harlan Laboratories (Indianapolis, IN) and CR3 -/- mice (C57BL/6 background) were obtained as a generous gift from Dr.

Mary Ann McDowell of the University of Notre Dame. Mice were housed in specific pathogen-free conditions where all bedding, caging, and feed were sterilized prior to use. All animal procedures were conducted with the approval of the Iowa State University Institutional Animal Care and Use Committee.

5.3.5. Murine serum protein adsorption onto polyanhydride nanoparticles Blood was obtained via cardiac puncture after euthanasia of the mice, samples were centrifuged at 10,000 rcf for 10 min, and serum was removed and stored at -20°C. For the adsorption studies, 13.3% w/v suspensions of polyanhydride nanoparticles were prepared in phosphate buffer saline (PBS, pH

7.4). Nanoparticle suspensions were incubated with serum in a 1:4 volume ratio

(i.e., 25% nanoparticles and 75% serum). The nanoparticle/serum suspension was sonicated for 30 s at 40 Hz and incubated for 30 min at 37°C under constant agitation. Next, the suspension was centrifuged at 10,000 rcf for 10 min to pellet the nanoparticles. Supernatants were removed, nanoparticles were resuspended in PBS, and the centrifugation step was repeated. This process was repeated three times and the nanoparticles were dried under vacuum for 1 h and stored for characterization and further use.

130

5.3.6. Nanoparticle surface analysis To assay for the presence of serum protein on the nanoparticle surface, energy-dispersive X-ray spectroscopy (EDS) analysis of elemental composition was performed. Samples of serum-coated nanoparticles were prepared in carbon stubs, and analyzed using an AZtec EDS system incorporated in a scanning electron microscope (Oxford Instruments, Concord, MA). The quantified elements were presented as percent of total content and the experiments were performed in triplicate.

5.3.7. Analysis of adsorbed serum proteins

Analysis of serum proteins adsorbed onto polyanhydride nanoparticles was performed using 2D gel electrophoresis [30, 31]. After adsorption, nanoparticles were dried and incubated with 250 L of elution buffer with 5%

(w/v) sodium dodecyl sulfate (SDS) and 2.3% (w/v) dithioerythritol to elute protein. Nanoparticle samples were heated at 95°C f or 10 min and centrifuged for

10,000 rcf for 10 min, and the supernatants were removed from the particle pellet for analysis. To quantify and analyze serum proteins, supernatants were passed through SDS removal columns (Pierce, Cat # 87777) to reduce the amount of

SDS because of its interference with microBCA and gel electrophoresis. To analyze eluted proteins, equal amounts of protein in elution buffers were processed for the first dimensional separation. For the first dimension, IPGPhor

131 systems (GE Healthcare, Piscataway, NJ) were used with 7-cm IPG strips (pH 3-

10) and a slow voltage ramping protocol: 50 V for 12 h, 500 V for 1 h, 1000 V for

1 h, and 8000 V for 6 h. For the second dimension of the separation analysis the

IPG strips were loaded in 4-20% polyacrylamide gels and run for 4 h at 90 V. The gels were incubated in fixative solution (40% methanol, 10% acetic acid) for 3 h at 4°C. Staining with Flamingo fluorescent gel stai n (BioRad Laboratories,

Richmond, CA) was performed at 4°C overnight, follo wing which a de-staining process with a 0.1% Tween 20 solution was carried out for 30 min to reduce background. The gels were scanned using a Typhoon 9410 Variable Mode

Imager (GE Healthcare). Images were collected using ImageQuant TL and qualitative analyses were performed using ImageJ (version 1.47, NIH, Bethesda,

MD) and Progenesis SameSpots (Nonlinear Dynamics, Durham, NC) to determine the location and intensity of the spots on the gels. The intensity of each spot was normalized with the total fluorescence and the values are presented as percentages of the total fluorescence of the gels. Identification of each spot was performed by comparison of experimental gels with murine serum protein profiles found in the literature and in protein databases [40-45].

5.3.8. Macrophage culture and stimulation Macrophages were derived from bone marrow cells and harvested from tibias and femurs of C57BL/6 or CR3 -/- mice as described previously in published protocols [46-48]. Macrophages were identified using an F4/80 antibody. Briefly, mice were euthanized using carbon dioxide inhalation and cardiac puncture was

132 performed. Bone marrow cells were harvested from tibias and femurs and maintained in 10 mL of Complete Tissue Culture Media (CTCM) containing

Dulbecco’s Modified Eagle Medium with 10% fetal bovine serum, 1% penicillin/streptomycin, 1% 2mM L-glutamine, 2.5% HEPES buffer, and 0.1% β- mercaptoethanol. Cell culture was performed using 12 mL of bone-marrow macrophage media containing Dulbecco’s Modified Eagle Medium, with 20% fetal bovine serum, 30% L-cell conditioning supernatant, 1% penicillin/streptomycin, 1% 2 mM L-glutamine, and 1% sodium pyruvate in T-75

Cell culture grade flasks at a cell density of 12 x 10 6 in an incubator at 37°C with

5% CO 2 for 6 days. At day 2, 12 mL of fresh bone marrow macrophage media were added. After 6 days, flasks were placed on ice for 30 min, macrophages were removed from the flasks using cell scrapers, centrifuged at 250 rcf for 10 min and counted for plating. Cells were plated in 24 well plates using a concentration of 5 x 10 5 cells per well in CTCM. Macrophages were stimulated with 0.125 mg/mL of polyanhydride nanoparticles, based on previous studies [9,

30]. Non-stimulated (NS) cells were used as a negative control and 200 ng/mL of

Escherichia coli LPS was used as a positive control.

5.3.9. Internalization profiles of serum-coated nanoparticles Cadmium selenide quantum dot (QD)-loaded polyanhydride nanoparticles were synthesized using an anti-solvent nanoencapsulation method [39]. Briefly,

1% w/w QDs (630 nm emission) were suspended with respective polymer solution and nanoparticles were fabricated as previously described.

133

Nanoparticles were suspended in PBS (pH 7.4, 37°C) for 48 h and supernatants were collected and used as controls to account for released QDs [49]. Serum adsorption onto these nanoparticles was performed as described previously and used for macrophage internalization experiments. Bone-marrow derived macrophages were stimulated with nanoparticle formulations for 48 h and particle-positive cells were quantified using flow cytometry. Non-stimulated cells were used as control [30].

5.3.10. Identification of Complement Component C3 To identify and quantify complement component 3 (C3) in the eluted protein samples from the nanoparticles, a sandwich ELISA was performed. A mouse complement component C3 ELISA kit was purchased from Kamiya

Biomedical Company (Seattle, WA) and used following manufacturer’s instructions to determine amounts of C3 in eluted protein samples from polyanhydride nanoparticles based on a calibration curve. Briefly, samples were diluted to 1:50,000 using provided sample diluent. 100 L of samples, calibrators, and positive control (provided) were added to the designated wells. Microtiter plates covered with aluminum foil were incubated at room temperature (RT, 25

°C) for 20 ± 2 min. Next, well contents were remove d and filled with wash solution (provided and appropriately diluted). This process was repeated four times. 100 L of enzyme-antibody conjugate were added to each well, and incubated at RT for 20 ± 2 min covered from light. A washing process was performed as previously described, and then 100 L of TMB substrate solution

134 was added. Plates were incubated in the dark for 10 min and 100 L of stop solution (provided) was added. Absorbance was measured at 450 nm.

5.3.11. Activation of macrophages by serum-coated nanoparticles Cultured cells from wild type (WT) and CR3 -/- C57BL/6 mice were analyzed using flow cytometry and cell surface marker expression was measured as described previously [9]. Serum adsorption onto nanoparticles was performed as described previously and used for macrophage activation studies. Antibodies for CD40, CD80, CD86, and MHC II and their corresponding isotypes were used.

Samples were analyzed using a Becton-Dickinson FACSCanto TM flow cytometer

(San Jose, CA) and the data was processed using the FlowJo vX software

(TreeStar Inc., Ashland, OR).

5.3.12. Cytokine secretion by macrophages Supernatants of cultured cells 48 h post-stimulation were analyzed for secretion of IL-6, IL-1β, TNF-α, IL-12p40, IFN-γ, and IL-10 using a multiplex cytokine assay with a Bio-Plex 200 TM system (Bio-Rad, Hercules, CA) as described in previous protocols [48, 50].

135

5.3.13. Statistical Analysis

Statistical analysis was used to analyze the cell surface marker expression and cytokine secretion data. One-way ANOVA and Tukey’s HSD were used to determine statistical significance among treatments and p-values <

0.05 were considered significant.

5.4. Results

5.4.1. Particle size and characterization The size of the 20:80 CPTEG:CPH nanoparticles was 208 ± 60 nm, while that of the 20:80 CPH:SA nanoparticles was 306 ± 122 nm (data expressed as average ± standard deviation). The zeta potentials of the 20:80 CPH:SA and

20:80 CPTEG:CPH nanoparticles were -20 ± 3.7 mV and -24 ± 4.1 mV, respectively, which are consistent with previous work [51].

5.4.2. Polymer chemistry-dependent serum protein adsorption profiles Serum protein adsorption onto polyanhydride nanoparticles was analyzed using EDS and the results are shown in Table 5.1. The nitrogen content ranged from 1-2% for the serum-coated nanoparticles, while no nitrogen was detectable on the surface of the non-serum coated particles. No significant differences were observed in the nitrogen content between the CR3 -/- and the WT treatments, or between the two chemistries tested.

136

Table 5.1. Energy-dispersive X -ray spectroscopy (EDS) analys is of elemental composition of non-coated and serum -coated polyanhydride nanoparticles. Presence or increase in the nitrogen content of polyanhydride nanoparticles represents the serum protein coating effect. Data reported as mean ± standard error of the mean (SEM) of three independent experiments performed in triplicate. Non-coated nanoparticles were used as controls to assess the absence of nitrogen.

Protein separation using 2D gel electrophoresis was used to identify serum proteins eluted from the surface of polyanhydride nanopar ticles. Figure

5.1 shows representative images of 2D gels of the eluted serum proteins. The greatest amounts of protein that were adsorbed onto both nanoparticle chemistries were albumin, IgG, and apolipoproteins. However, there were differences in the profiles between the two chemistries. Greater amounts of proteins were adsorbed onto the more hydrophob ic 20:80 CPTEG:CPH nanoparticles. Additionally, more diverse proteins were adsorbed on to the 20:80

CPTEG:CPH nanoparticles than that on to the 20:80 CPH:SA nanoparticles.

137

Figure 5.1. Serum protein adsorption onto polyanhydride nanoparticles is chemistry dependent. Representative 2-D gels of proteins of: (A) Wild-type serum proteins onto 20:80 CPTEG:CPH nanoparticles, (B) Wild-type serum proteins onto 20:80 CPH:SA nanoparticles. Identified proteins are numbered and are listed and quantified as presented in Table 5.2.

Table 5.2 shows how nanoparticle chemistry affected the relative composition of the adsorbed protein mixture eluted from the nanoparticles. The most abundantly adsorbed proteins on both types of nanoparticles were albumin, immunoglobulins and alipoproteins, with these protein spots accounting for 30-

40% of the total fluorescence from the gels. Fibrinogen, complement factor B, serotransferrin, lactotransferrin, and IgG2a chain C were more abundantly adsorbed on the 20:80 CPTEG:CPH nanoparticles. In contrast, α1-acid glycoprotein, ceruloplasmin, apolipoprotein E, hemopexin and CDR1 accounted for a higher percentage of fluorescence on the 20:80 CPH:SA nanoparticles.

138

Table 5.2. Quantification of murine serum proteins from 2-D gel electrophoresis. Identification of protein nanoparticles was performed using isoelectric point (pI) and molecular weight (MW). Normalized volume was quantified using Progenesis SameSpots ©. Percentage of normalized volume is presented for each gel. (A) Wild-type serum proteins onto 20:80 CPTEG:CPH nanoparticles, (B) Wild-type serum proteins onto 20:80 CPH:SA nanoparticles.

139

5.4.3. Polyanhydride nanoparticle internalization is CR3- and serum protein adsorption-dependent Particle uptake is one of the main benefits of opsonization and one of the key functions of CR3 [4, 17-19]. Figure 5.2 (panel A) shows that nanoparticle internalization was strongly affected by polymer chemistry, which in turn influenced the importance of the CR3 receptor and serum protein adsorption. In these experiments, about 5-20% of bone marrow derived macrophages from WT mice internalized the 20:80 CPTEG:CPH and 20:80 CPH:SA nanoparticles, respectively. Upon adsorption of serum proteins on these nanoparticles, about

15-30% of cells internalized the particles. However, for the 20:80 CPH:SA chemistry, there were no significant differences in internalization before and after serum adsorption. In contrast, there was a ~5-fold increase in 20:80

CPTEG:CPH nanoparticle internalization after adsorption of serum proteins.

When these experiments were performed with macrophages derived from the bone marrow of CR3 -/- mice, the internalization patterns changed, with only 5-8% of particles being internalized for both chemistries, which was two-fold lower compared to the internalization of the 20:80 CPH:SA nanoparticles by the WT mice, but similar to the percent of WT macrophages internalizing 20:80

CPTEG:CPH particles. Upon adsorption of serum proteins, the percent of CR3 -/- macrophages that internalized nanoparticles was affected by the polymer chemistry. For CPH:SA nanoparticles, there was a significant increase in particle- positive macrophages, up to ~20%, which is two-fold higher than the percent of particle-positive macrophages prior to serum adsorption. In contrast, there were no significant differences observed between the uptake levels of non-serum and

140 serum-protein adsorbed 20:80 CPTEG:CPH nanoparticles. Figure 5.2 (panel B) also shows the quantification of complement component 3 using ELISA in ng of

C3 /mg of nanoparticles. For both nanoparticle formulations, the amounts of C3 were similar (11-12 ng /mg of particles ). These results are consistent with the 2D gel electrophoresis data in Table 5.2. The total amount of complement component 3a and 3b (rows 5 and 6) were similar for both nanoparticle formulations (2.16% and 2.57% for 20:80 CPTEG:CPH and 20 :80 CPH:SA nanoparticles, respectively).

Figure 5.2. Internalization profiles of serum protein coated polyanhydride nanop articles and quantification of c omplement component 3 adsorption . A) Particle in ternalization was analyzed using flow cytometry in bone marrow derived macrophages. Quantum dots (630 emission) were encapsulated in polyanhydride nanoparticles and used as tracking agent. Data are expressed as the mean ± the SEM of three independent experiments performed in triplicate. * represent groups that are statistically significant (p ≤ 0.05) compared to the CR3 - /-. B) Complement component 3 was quantified using ELISA. Three independent experiments were per formed in triplicate. Wild type serum was diluted and used as positive control. Quantification was obtained using a calibration curve.

141

5.4.4. Internalization is necessary for the activation of bone marrow- derived macrophages In these studies, bone marrow-derived macrophages from WT and CR3 -/- mice were cultured and stimulated with polyanhydride nanoparticles prior to and after incubation with mouse serum. The effect of particle presence within the cells on the surface expression of MHC II and surface markers was studied using flow cytometric analysis. Figure 5.3 shows the cell surface expression of MHC II and the co-stimulatory molecules, CD40 and CD86, upon incubation of macrophages with polyanhydride nanoparticles. Macrophages were separated into particle positive and negative populations; the left panel of Figure 5.3 shows the percentage of particle-positive cells that were also positive for MHC II, CD40 and CD86 markers, while the right panel shows the percentages for particle- negative cells that were positive for the same markers. The results indicate that serum protein adsorption significantly affected the activation of macrophages by

20:80 CPH:SA nanoparticles, but this effect was not evidenced when the cells were incubated with the 20:80 CPTEG:CPH nanoparticles. It was also observed that this effect was caused by the presence of CR3, which was found to be necessary for the enhanced expression of CD40 and CD86 when serum proteins were adsorbed to the surface of these nanoparticles. As it has been reported previously, CD40 is a cell surface marker that requires particle internalization to be up-regulated, confirming the results shown in Figures 5.2 and 5.3 in this work

[30, 51]. While the CR3 receptor appears to be important for the up-regulation of

CD40, and CD86, it was not needed for MHC II expression by macrophages after stimulation with serum-adsorbed 20:80 CPH:SA nanoparticles. Serum protein

142 adsorption onto 20:80 CPH:SA nanoparticles caused the up-regulation of MHC II and CD40 in macrophages from WT mice, but this effect was not observed with the 20:80 CPTEG:CPH nanoparticles. However, the most striking factor in the activation of either WT or CR3 -/- bone marrow-derived macrophages was the need for nanoparticle internalization. For both chemistries, with or without serum proteins adsorbed, cell activation was dependent on particle internalization. The percentage of particle-positive macrophages also positive for MHC II and CD40 ranged from 80-100%, while for CD86, this percentage was 15-60%. These amounts substantively decreased to 10-40% for MHC II and CD40 and 5-10% for

CD86 for particle-negative cells that were also positive for these respective markers. These trends were also observed when the analysis was replaced with the mean fluorescence intensity of these markers.

143

Figure 5.3. Activation profiles of bone marrow-derived macrophages by serum protein coated polyanhydride nanoparticles. Cell surface marker expression was analyzed via flow cytometry. Expression of CD40, CD86, and MHCII was particle, CR3 and serum coating dependent. LPS and Non-stimulated groups were used as positive and negative controls, respectively. Data are expressed as the mean ± the SEM of three independent experiments performed in triplicate. *, # and ♦ represent groups that are statistically significant (p ≤ 0.05) compared to the correspondent CR3-/- , non-serum adsorbed and particle negative group, respectively.

144

5.4.5. Cytokine secretion is dependent upon both serum protein adsorption and the presence of CR3 The amounts of IL-6, IL-12p40, and TNF-α secreted by bone marrow- derived macrophages upon stimulation with polyanhydride nanoparticles are shown in Figure 5.4. The results indicated that both serum protein adsorption and the presence of CR3 were important for the secretion of cytokines. Serum protein adsorption onto the 20:80 CPTEG:CPH nanoparticles resulted in reduced secretion of IL-6, IL-12p40, and TNF-α. However, there was no effect of serum protein adsorption on the cytokine secretion of cells stimulated with 20:80

CPH:SA nanoparticles. The secretion of IL-6 and TNF-α was found to be dependent upon the presence of CR3 when cells were stimulated with 20:80

CPTEG:CPH nanoparticles. Similarly, in the absence of CR3, macrophages secreted lower amounts of IL-6 and TNF-α when stimulated by 20:80 CPH:SA nanoparticles with serum protein adsorbed. For both nanoparticle formulations, regardless of serum protein adsorption, the secretion of TNF-α by macrophages was significantly reduced in the absence of CR3.

145

Figure 5.4. Cytokine secretion profiles of bone marrow-derived macrophages after stimulation with serum protein coated polyanhydride nanoparticles. Cytokine secretion was analyzed using a Bioplex assay. Amounts of IL-6, IL-10, TNF-α and IL-12p40 was chemistry and complement dependent. LPS and Non- stimulated groups were used as positive and negative controls, respectively. Data are expressed as the mean ± the SEM of three independent experiments performed in triplicate. * represent groups that are statistically significant (p ≤ 0.05) compared to the correspondent CR3 -/- group, respectively.

5.5. Discussion

In the development of next generation vaccine delivery vehicles, polymeric carriers have been extensively used because their material properties can be tailored to elicit specific immune responses [1, 2]. In this work, two types of

146 polyanhydride nanoparticles were incubated with mouse serum, allowing serum proteins to be adsorbed onto the nanoparticles, mimicking the opsonization process that foreign entities (e.g., pathogens, delivery vehicles, implants, etc.) need to undergo after entering the body [4-6]. The effect of this adsorption process is important for the in vivo performance of parenterally administered nanoparticles with respect to immune cell activation.

Carrier chemistry, surface charge, and surface functionality have all been shown to be important for nanoparticle internalization and activation of immune cells [10-12, 16, 52]. It is also known that hydrophobic particles adsorb higher amounts of protein when exposed to serum [30, 53-55]. Both 20:80 CPH:SA and

20:80 CPTEG:CPH nanoparticles are hydrophobic, with the latter being more so

[29]. Previous studies with polyanhydride microparticles showed chemistry- dependent behavior with respect to their interactions with dendritic cells [30, 31].

In the current study, the role of serum protein adsorption and the presence of the

CR3 receptor on macrophage activation by polyanhydride nanoparticles were analyzed.

The primary contact of the immune system with these particles is through innate immunity components, including complement [3-5]. Complement has three functions in the induction of immune responses: a) defense against microbial infections by recruitment of complement fragments (C3a, C4a, and C5a) that interact with complement receptors on APCs to enhance phagocytosis; b) recruitment and activation of phagocytes by fragments of complement proteins, which act as chemo-attractants; and c) opsonization of pathogens by

147 complement opsonins (C4b, C3b, and C3bi) to recruit phagocytic cells [56]. One of the proteins involved in the complement system is complement receptor 3

(CR3), which is a versatile and promiscuous adhesion and recognition receptor

[17, 18]. The ability to recognize MAMPs through PRRs is an important feature of phagocytic lymphocytes [6, 17]. Therefore, in order to design pathogen mimicking nanovaccines, it is necessary to understand the factors that influence nanoparticle uptake by and activation of APCs. There are two well-known mechanisms of activation of macrophages: classical and alternative [8, 57]. In addition, a third activation mechanism has been proposed that elicits an innate activation phenotype [8, 57]. Activated macrophages perform a myriad of functions, such as phagocytosis, pro-inflammatory signaling, antigen presentation, killing of intracellular pathogens and parasites, enhancement of co- stimulatory antigen expression, promotion of cell growth and tissue repair, and enhancement of humoral and allergic immunity [8, 57]. These capabilities make macrophages both sentinel and effector cells and they are important for a functional immune system. Therefore, analysis of the uptake and activation of macrophages by adjuvants and/or delivery vehicles such as polyanhydride nanoparticles is of paramount importance.

The hydrophobicity of the nanoparticles affected protein adsorption and activation of the macrophages, as evidenced by expression of cell surface markers and cytokine secretion patterns. As shown in Figure 5.1, the more hydrophobic 20:80 CPTEG:CPH nanoparticles adsorbed greater amounts and with a larger diversity of serum proteins than the 20:80 CPH:SA particles,

148 consistent with previous studies, suggesting that both surface charge and hydrophobicity are important for protein adsorption and opsonization by immune cells.[11, 12, 30, 53-55]

Analysis of the protein profiles eluted from the polyanhydride nanoparticles shown in Table 5.2 showed that the presence and relative amounts of proteins adsorbed were dependent on nanoparticle chemistry. The 20:80

CPTEG:CPH nanoparticles adsorbed a more diverse set of serum proteins and had higher relative values of the dominant components of the eluted mixture

(e.g., albumin). However, as mentioned previously, there were other proteins that were present in the 20:80 CPH:SA elution buffer, that were not as abundant for the 20:80 CPTEG:CPH formulation, such as ceruloplasmin or apolipoprotein E.

Ceruloplasmin and lactotransferrin are important proteins involved in particle adhesion to the cell surface, which helps to increase their circulation in the body

[58]. While apolipoproteins have a variety of roles, apoliprotein E is involved in the transportation of lipoproteins to the brain using the low density lipoprotein receptor on the blood brain barrier; thus it has been used to target uptake of particles to the brain via endocytosis [59]. In addition, apolipoproteins were identified when thermally treated poly(L-lactide) microspheres were incubated with macrophages, which was attributed to increased crystallinity [60]. This is consistent with the current studies, since 20:80 CPH:SA polymer is more semicrystalline than 20:80 CPTEG:CPH [32, 61].These differences indicate variances in the interactions between complement proteins and polyanhydride nanoparticle chemistries.

149

Our previous work indicated that CR3 has a direct role in regulating the uptake of polyanhydride microparticles by dendritic cells [30]. The results obtained in the current study confirm that depending upon chemistry and type of

APC, CR3 has a critical function in the internalization of polyanhydride nanoparticles. As shown in Figure 5.2 (panel A), the internalization of both nanoparticle formulations had different responses to serum protein adsorption, depending upon the presence or absence of the CR3 receptor. These results suggest that opsonization alone is not enough to enhance uptake, but together with receptors such as CR3, effective ways can be developed to target the delivery of antigens [13, 15]. Depending on opsonization of the foreign agent,

CR3 receptor can trigger different intracellular responses [12, 17]. In addition, the results shown in Figure 5.2 indicate that serum protein adsorption enhanced the internalization of 20:80 CPTEG:CPH nanoparticles. This observation is consistent with previous reports, which attribute enhanced internalization to the interaction of specific serum proteins with cellular receptors, including complement receptors [13, 16, 18]. Nanoparticle uptake is hypothesized to be caused by the involvement of the mononuclear phagocyte system (MPS), in which macrophages play a very important role, and are involved in the activation of cellular and humoral immunity [62, 63]. However, the propensity of these particles to be taken up by the MPS provides a good alternative to deliver antigen to sites such as mucosal cavities, liver, kidney, or lungs [62].

The results shown in Figure 5.3 delineate the effects of nanoparticle internalization, chemistry, serum protein adsorption, and the presence of CR3 on

150 the surface expression of cellular markers. Particle hydrophobicity is known to affect particle fate after in vivo administration [12, 16]. Adsorptive endocytosis is chemistry-dependent, therefore, to extend the half-life of polymeric particles in the body, the addition of hydrophilic moieties or coatings is necessary [12, 16].

However, for vaccine delivery applications, particle internalization by the desired cellular populations highlights the benefits obtained by the use of hydrophobic materials [62]. The presence of CR3 is fundamental to the internalization of foreign bodies, and so its absence in macrophages results in non-receptor mediated endocytosis and/or phagocytosis of foreign bodies. Phagocytic activity is one of the primary roles of macrophages, and their activation profile is highly dependent on uptake and recognition mechanisms [12, 13, 24, 53, 64]. When

CR3 is not present, APCs show a diminished capacity to take up and process pathogens [18, 24, 25]. The behavior exhibited by the polyanhydride nanoparticles mimics pathogenic internalization in the absence of the CR3 receptor. Indeed, previous work has shown that polyanhydride chemistry and molecular structure, size, and surface charge all conferred pathogen mimicking capabilities to these particles [49]. Primarily, hydrophobicity, the presence of hydroxyl end groups, and the oxygen content of the backbone of the polymer were identified as the most important contributors to APC activation, similar to pathogenic components like LPS. The data obtained herein provide additional evidence that polyanhydride nanoparticles exhibit pathogen mimicking abilities.

The internalization of the polyanhydride nanoparticles significantly impacted the surface expression of CD40, CD86, and MHC II, regardless of the

151 presence of the CR3 receptor or serum protein adsorption. The up-regulation of these markers has been described previously as a signature of the classical activation mechanism of macrophages [8, 13]. This type of activation enhances antigen presentation and killing of intracellular pathogens, which recruits a variety of cells and proteins to the site of infection [13]. The display of this activation profile in macrophages suggests that polyanhydride nanoparticles effectively stimulated macrophages. The enhancement in the ability of these cells to present antigen in the context of MHC II molecules has shown to be important for cytotoxic CD8 + T cells, facilitated by CD4 + T helper cells [65]. In addition, even though the level of up-regulation of these markers was not the same for particle positive and negative macrophages, the presence of a bystander effect was demonstrated by the data in Figure 5.3. This is caused by the presence of the polyanhydride nanoparticles in close proximity to the cells that did not internalize the particles, which contributed to macrophage activation. The role of macrophages in triggering both humoral and immune responses has been described previously, and the capacity of polyanhydride nanoparticles to enhance these properties after contact with serum proteins suggests that their in vivo performance would result in the induction of robust immune responses.

In this study, chemistry- and serum protein adsorption-dependent secretion of pro-inflammatory cytokines such as IL-6 and TNF-α was observed after stimulation with polyanhydride nanoparticles as shown in Figure 5.4. These results are also in agreement with the classical activation profile of macrophages.

This type of activation exhibits enhanced secretion of pro-inflammatory cytokines

152

(e.g., TNF-α, IL-6) and chemokines (e.g., MIP-1α) [13]. There was no significant dependence on polymer chemistry for the secretion of IL-12p40, which is known to be important for the differentiation of macrophages from a classical M1 lineage towards an M2 lineage, which has an immunoregulatory and tissue regeneration function [66, 67]. This profile is consistent with the alternative activation mechanism of macrophages, which is desirable for therapeutic applications, injury, and tissue repair [13]. Since this platform is designed to enhance immune responses, activation of macrophages through the classical pathway is more beneficial, and the cytokine secretion data confirm this result.

Altogether, the results described herein provide new insights into the roles of particle chemistry, serum protein adsorption and presence of CR3 on the internalization of nanoparticles and activation of immune cells. The opsonization of foreign entities (such as nanoparticles) is one of the first steps after parenteral administration of particle-based vaccines. Therefore, an in-depth understanding of the interactions between these particles and serum as well as between the particles and immune cells is necessary to rationally design nanovaccines with optimal in vivo performance.

5.6. Conclusions

The studies reported herein systematically analyzed the effects of nanoparticle hydrophobicity, the presence of one of the most promiscuous phagocytic receptors (i.e., CR3), polymer chemistry, and serum protein

153 opsonization upon the activation of macrophages. The results indicated that each of these factors has different levels of impact upon activation of macrophages, specifically after particle internalization and together, they contribute to result in a classical activation profile of macrophages, which is known to be beneficial for the induction of efficacious immune responses. The studies also show that controlling the chemistry of polyanhydride nanoparticles will provide more opportunities to optimize and tailor the in vivo performance of nanovaccine platforms based on these particles.

5.7. Acknowledgments

The authors would like to acknowledge financial support from NIH-NIAID

(U19 AI-091031). The authors would also like to thank Shawn Rigby of the ISU

Flow Cytometry Facility for his expertise in flow cytometry and Joel Nott of the

ISU Protein Facility and Dr. Brenda Carrillo-Conde for their assistance with 2-D electrophoresis. The authors are grateful to Dr. Mary Ann McDowell of the

University of Notre Dame for generously providing the CR3 -/- mice.

154

5.8. References

[1] Plotkin SA. Vaccines: past, present and future. Nature medicine 2005;11:S5- 11.

[2] Wilson-Welder JH, Torres MP, Kipper MJ, Mallapragada SK, Wannemuehler MJ, Narasimhan B. Vaccine Adjuvants: Current Challenges and Future Approaches. J Pharm Sci-Us 2009;98:1278-316.

[3] Rus H, Cudrici C, Niculescu F. The role of the complement system in innate immunity. Immunologic research 2005;33:103-12.

[4] Trouw LA, Daha MR. Role of complement in innate immunity and host defense. Immunology letters 2011;138:35-7.

[5] Dunkelberger JR, Song WC. Complement and its role in innate and adaptive immune responses. Cell research 2010;20:34-50.

[6] Janeway CA, Jr. The immune system evolved to discriminate infectious nonself from noninfectious self. Immunology today 1992;13:11-6.

[7] Zhang X, Mosser DM. Macrophage activation by endogenous danger signals. The Journal of pathology 2008;214:161-78.

[8] Mosser DM, Edwards JP. Exploring the full spectrum of macrophage activation. Nat Rev Immunol 2008;8:958-69.

[9] Torres MP, Wilson-Welder JH, Lopac SK, Phanse Y, Carrillo-Conde B, Ramer-Tait AE, Bellaire BH, Wannemuehler MJ, Narasimhan B. Polyanhydride microparticles enhance dendritic cell antigen presentation and activation. Acta Biomater 2011;7:2857-64.

[10] Walkey CD, Chan WC. Understanding and controlling the interaction of nanomaterials with proteins in a physiological environment. Chemical Society reviews 2012;41:2780-99.

[11] Yang AS, Liu W, Yang XL. Serum proteins opsonization and phagocytic uptake of PEG-modified PLGA nanoparticles: Effect of particle size. Adv Mater Res-Switz 2012;393-395:939-42.

[12] Walkey CD, Olsen JB, Guo H, Emili A, Chan WC. Nanoparticle size and surface chemistry determine serum protein adsorption and macrophage uptake. J Am Chem Soc 2012;134:2139-47.

155

[13] Taylor PR, Martinez-Pomares L, Stacey M, Lin HH, Brown GD, Gordon S. Macrophage receptors and immune recognition. Annual Review of Immunology 2005;23:901-44.

[14] Kipper MJ, Shen E, Determan A, Narasimhan B. Design of an injectable system based on bioerodible polyanhydride microspheres for sustained drug delivery. Biomaterials 2002;23:4405-12.

[15] Gasque P. Complement: a unique innate immune sensor for danger signals. Molecular immunology 2004;41:1089-98.

[16] Mosqueira VCF, Legrand P, Gulik A, Bourdon O, Gref R, Labarre D, Barratt G. Relationship between complement activation, cellular uptake and surface physicochemical aspects of novel PEG-modified nanocapsules. Biomaterials 2001;22:2967-79.

[17] Le Cabec V, Carreno S, Moisand A, Bordier C, Maridonneau-Parini I. Complement receptor 3 (CD11b/CD18) mediates type I and type II phagocytosis during nonopsonic and opsonic phagocytosis, respectively. J Immunol 2002;169:2003-9.

[18] Ehlers MRW. CR3: a general purpose adhesion-recognition receptor essential for innate immunity. Microbes Infect 2000;2:289-94.

[19] Rakshit DS, Lim JTE, Ly K, Ivashkiv LB, Nestor BJ, Sculco TP, Purdue PE. Involvement of complement receptor 3 (CR3) and scavenger receptor in macrophage responses to wear debris. J Orthop Res 2006;24:2036-44.

[20] Abe Y, Kuroda Y, Kuboki N, Matsushita M, Yokoyama N, Kojima N. Contribution of Complement Component C3 and Complement Receptor Type 3 to Carbohydrate-dependent Uptake of Oligomannose-coated Liposomes by Peritoneal Macrophages. J Biochem 2008;144:563-70.

[21] Velasco-Velazquez MA, Barrera D, Gonzalez-Arenas A, Rosales C, Agramonte-Hevia J. Macrophage - Mycobacterium tuberculosis interactions: role of complement receptor 3. Microb Pathogenesis 2003;35:125-31.

[22] van Bruggen R, Zweers D, van Diepen A, van Dissel JT, Roos D, Verhoeven AJ, Kuijpers TW. Complement receptor 3 and toll-like receptor 4 act sequentially in uptake and intracellular killing of unopsonized Salmonella enterica serovar typhimurium by human neutrophils. Infection and immunity 2007;75:2655-60.

[23] Polando R, Dixit UG, Carter CR, Jones B, Whitcomb JP, Ballhorn W, Harintho M, Jerde CL, Wilson ME, McDowell MA. The roles of complement receptor 3 and Fc gamma receptors during Leishmania phagosome maturation. J Leukocyte Biol 2013;93:921-32.

156

[24] Ben Nasr A, Haithcoat J, Masterson JE, Gunn JS, Eaves-Pyles T, Klimpel GR. Critical role for serum opsonins and complement receptors CR3 (CD11b/CD18) and CR4 (CD11c/CD18) in phagocytosis of Francisella tularensis by human dendritic cells (DC): uptake of Francisella leads to activation of immature DC and intracellular survival of the bacteria. J Leukocyte Biol 2006;80:774-86.

[25] Melo MD, Catchpole IR, Haggar G, Stokes RW. Utilization of CD11b knockout mice to characterize the role of complement receptor 3 (CR3, CD11b/CD18) in the growth of Mycobacterium tuberculosis in macrophages. Cell Immunol 2000;205:13-23.

[26] Morrison TE, Simmons JD, Heise MT. Complement Receptor 3 Promotes Severe Ross River Virus-Induced Disease. Journal of Virology 2008;82:11263- 72.

[27] Ulery BD, Kumar D, Ramer-Tait AE, Metzger DW, Wannemuehler MJ, Narasimhan B. Design of a protective single-dose intranasal nanoparticle-based vaccine platform for respiratory infectious diseases. PLoS One 2011;6:e17642.

[28] Torres MP, Vogel BM, Narasimhan B, Mallapragada SK. Synthesis and characterization of novel polyanhydrides with tailored erosion mechanisms. J Biomed Mater Res A 2006;76:102-10.

[29] Lopac SK, Torres MP, Wilson-Welder JH, Wannemuehler MJ, Narasimhan B. Effect of polymer chemistry and fabrication method on protein release and stability from polyanhydride microspheres. J Biomed Mater Res B Appl Biomater 2009;91:938-47.

[30] Carrillo-Conde BR, Ramer-Tait AE, Wannemuehler MJ, Narasimhan B. Chemistry-dependent adsorption of serum proteins onto polyanhydride microparticles differentially influences dendritic cell uptake and activation. Acta Biomater 2012;8:3618-28.

[31] Carrillo-Conde B, Garza A, Anderegg J, Narasimhan B. Protein adsorption on biodegradable polyanhydride microparticles. J Biomed Mater Res A 2010;95:40-8.

[32] Shen E, Pizsczek R, Dziadul B, Narasimhan B. Microphase separation in bioerodible copolymers for drug delivery. Biomaterials 2001;22:201-10.

157

[34] Huntimer L, Wilson Welder JH, Ross K, Carrillo-Conde B, Pruisner L, Wang C, Narasimhan B, Wannemuehler MJ, Ramer-Tait AE. Single immunization with a suboptimal antigen dose encapsulated into polyanhydride microparticles promotes high titer and avid antibody responses. J Biomed Mater Res B Appl Biomater 2013;101:91-8.

[35] Huntimer LM, Ross KA, Darling RJ, Winterwood NE, Boggiatto P, Narasimhan B, Ramer-Tait AE, Wannemuehler MJ. Polyanhydride nanovaccine platform enhances antigen-specific cytotoxic T cell responses. TECHNOLOGY 2014;02:171-5.

[36] Conix A. Poly[1,3-bis(p-carxoyphenoxy)-propane anhydride]. Macromolecular Synthesis 1966;2:95-8.

[37] Petersen LK, Sackett CK, Narasimhan B. High-throughput analysis of protein stability in polyanhydride nanoparticles. Acta Biomater 2010;6:3873-81.

[38] Carrillo-Conde B, Schiltz E, Yu J, Chris Minion F, Phillips GJ, Wannemuehler MJ, Narasimhan B. Encapsulation into amphiphilic polyanhydride microparticles stabilizes Yersinia pestis antigens. Acta Biomater 2010;6:3110-9.

[39] Ulery BD, Phanse Y, Sinha A, Wannemuehler MJ, Narasimhan B, Bellaire BH. Polymer chemistry influences monocytic uptake of polyanhydride nanospheres. Pharm Res 2009;26:683-90.

[40] Duan X, Yarmush DM, Berthiaume F, Jayaraman A, Yarmush ML. A mouse serum two-dimensional gel map: application to profiling burn injury and infection. Electrophoresis 2004;25:3055-65.

[41] Hornbeck PV, Kornhauser JM, Tkachev S, Zhang B, Skrzypek E, Murray B, Latham V, Sullivan M. PhosphoSitePlus: a comprehensive resource for investigating the structure and function of experimentally determined post- translational modifications in man and mouse. Nucleic Acids Res 2012;40:D261- 70.

[42] Pong JC, Chu CY, Li WY, Tang LY, Li L, Lui WT, Poon TC, Rao SK, Lam DS, Wang CC, Pang CP. Association of hemopexin in tear film and conjunctival macrophages with vernal keratoconjunctivitis. Archives of ophthalmology 2011;129:453-61.

[43] Klose J. Protein mapping by combined isoelectric focusing and electrophoresis of mouse tissues. A novel approach to testing for induced point mutations in mammals. Humangenetik 1975;26:231-43.

[44] Rithidech KN, Honikel L, Rieger R, Xie W, Fischer T, Simon SR. Protein- expression profiles in mouse blood-plasma following acute whole-body exposure

158 to (137)Cs gamma rays. International journal of radiation biology 2009;85:432- 47.

[45] UniProt C. Update on activities at the Universal Protein Resource (UniProt) in 2013. Nucleic Acids Res 2013;41:D43-7.

[46] Mukbel R, Petersen CA, Jones DE. Soluble factors from Leishmania major- specific CD4+T cells and B cells limit L. amazonensis amastigote survival within infected macrophages. Microbes Infect 2006;8:2547-55.

[47] Racoosin EL, Swanson JA. Macrophage colony-stimulating factor (rM-CSF) stimulates pinocytosis in bone marrow-derived macrophages. The Journal of experimental medicine 1989;170:1635-48.

[49] Petersen LK, Ramer-Tait AE, Broderick SR, Kong CS, Ulery BD, Rajan K, Wannemuehler MJ, Narasimhan B. Activation of innate immune responses in a pathogen-mimicking manner by amphiphilic polyanhydride nanoparticle adjuvants. Biomaterials 2011;32:6815-22.

[50] Petersen LK, Xue L, Wannemuehler MJ, Rajan K, Narasimhan B. The simultaneous effect of polymer chemistry and device geometry on the in vitro activation of murine dendritic cells. Biomaterials 2009;30:5131-42.

[51] Carrillo-Conde B, Song EH, Chavez-Santoscoy A, Phanse Y, Ramer-Tait AE, Pohl NL, Wannemuehler MJ, Bellaire BH, Narasimhan B. Mannose- functionalized "pathogen-like" polyanhydride nanoparticles target C-type lectin receptors on dendritic cells. Mol Pharm 2011;8:1877-86.

[52] Thiele L, Diederichs JE, Reszka R, Merkle HP, Walter E. Competitive adsorption of serum proteins at microparticles affects phagocytosis by dendritic cells. Biomaterials 2003;24:1409-18.

[53] Lunov O, Syrovets T, Loos C, Beil J, Delacher M, Tron K, Nienhaus GU, Musyanovych A, Mailander V, Landfester K, Simmet T. Differential uptake of functionalized polystyrene nanoparticles by human macrophages and a monocytic cell line. ACS nano 2011;5:1657-69.

[54] Hartvig RA, van de Weert M, Ostergaard J, Jorgensen L, Jensen H. Protein adsorption at charged surfaces: the role of electrostatic interactions and interfacial charge regulation. Langmuir : the ACS journal of surfaces and colloids 2011;27:2634-43.

159

[55] Freij-Larsson C, Nylander T, Jannasch P, Wesslen B. Adsorption behaviour of amphiphilic polymers at hydrophobic surfaces: effects on protein adsorption. Biomaterials 1996;17:2199-207.

[56] Murphy K, Travers P, Walport M, Janeway C. Janeway's immunobiology. 7th ed. New York: Garland Science; 2008.

[57] Sica A, Mantovani A. Macrophage plasticity and polarization: in vivo veritas. The Journal of clinical investigation 2012;122:787-95.

[58] Gupta AK, Curtis AS. Lactoferrin and ceruloplasmin derivatized superparamagnetic iron oxide nanoparticles for targeting cell surface receptors. Biomaterials 2004;25:3029-40.

[59] Goppert TM, Muller RH. Polysorbate-stabilized solid lipid nanoparticles as colloidal carriers for intravenous targeting of drugs to the brain: comparison of plasma protein adsorption patterns. Journal of drug targeting 2005;13:179-87.

[60] Luck M, Pistel KF, Li YX, Blunk T, Muller RH, Kissel T. Plasma protein adsorption on biodegradable microspheres consisting of poly(D,L-lactide-co- glycolide), poly(L-lactide) or ABA triblock copolymers containing poly(oxyethylene). Influence of production method and polymer composition. Journal of controlled release : official journal of the Controlled Release Society 1998;55:107-20.

[61] Kipper MJ, Seifert S, Thiyagarajan P, Narasimhan B. Morphology of polyanhydride copolymers: Time-resolved small-angle X-ray scattering studies of crystallization. Journal of Polymer Science Part B: Polymer Physics 2005;43:463- 77.

[62] Mohanraj VJ CY. Nanoparticles. Tropical Journal of Pharmaceutical Research 2006;5:561-73.

[63] Hume DA. The mononuclear phagocyte system. Curr Opin Immunol 2006;18:49-53.

[64] Aderem A, Underhill DM. Mechanisms of phagocytosis in macrophages. Annu Rev Immunol 1999;17:593-623.

[65] Denis-Mize KS, Dupuis M, MacKichan ML, Singh M, Doe B, O'Hagan D, Ulmer JB, Donnelly JJ, McDonald DM, Ott G. Plasmid DNA adsorbed onto cationic microparticles mediates target gene expression and antigen presentation by dendritic cells. Gene therapy 2000;7:2105-12.

160

[66] O'Farrell AM, Liu Y, Moore KW, Mui AL. IL-10 inhibits macrophage activation and proliferation by distinct signaling mechanisms: evidence for Stat3-dependent and -independent pathways. The EMBO journal 1998;17:1006-18.

[67] Bastos KR, Alvarez JM, Marinho CR, Rizzo LV, Lima MR. Macrophages from IL-12p40-deficient mice have a bias toward the M2 activation profile. J Leukoc Biol 2002;71:271-8.

161

CHAPTER 6

Safety and Biocompatibility of Carbohydrate-Functionalized Polyanhydride Nanoparticles

Julia E. Vela Ramirez 1, Jonathan T. Goodman 1, Paola M. Boggiatto 2, Rajarshi Roychoudhury 3, Nicola L.B. Pohl 3, Jesse M. Hostetter 4, Michael J. Wannemuehler 2, and Balaji Narasimhan 1*

1Department of Chemical and Biological Engineering, Iowa State University, Ames, IA 50011

2Department of Veterinary Microbiology and Preventive Medicine, Iowa State University, Ames,

IA 50011

3Department of Chemistry, Indiana University, Bloomington, IN 47405

4Department of Veterinary Pathology, Iowa State University, Ames, IA 50011

Reprinted from a paper accepted for publication in The AAPS Journal

on November 7, 2014

* To whom all correspondence should be addressed 2035 Sweeney Hall, Department of Chemical and Biological Engineering, Ames, IA 50011 Phone: 515-294-8019; Fax: 515-294-2689; email: [email protected]

162

6.1. Abstract

Carbohydrate functionalization of nanoparticles allows for targeting of C- type lectin receptors. This family of pattern recognition receptors expressed on innate immune cells, such as macrophages and dendritic cells, can be used to modulate immune responses. In this work, the in vivo safety profile of carbohydrate-functionalized polyanhydride nanoparticles was analyzed following parenteral and intranasal administration in mice. Polyanhydride nanoparticles based on 1,6-bis-(p-carboxyphenoxy)hexane and 1,8-bis-(p-carboxyphenoxy)-

3,6-dioxaoctane were used. Nanoparticle functionalization with di-mannose

(specifically carboxymethyl-α-D-mannopyranosyl-(1,2)-D-mannopyranoside), galactose (specifically carboxymethyl-β-galactoside), or glycolic acid induced no adverse effects after administration based on histopathological evaluation of liver, kidneys, and lungs. Regardless of the polymer formulation, there was no evidence of hepatic or renal damage or dysfunction observed in serum or urine samples. The histological profile of cellular infiltration and the cellular distribution and kinetics in the lungs of mice administered nanoparticle treatments followed similar behavior as that observed in the lungs of animals administered saline.

Cytokine and chemokine profiles in bronchoalveolar lavage fluid indicated surface-chemistry dependence on modest secretion of IL-6, IP-10, and MCP-1; however, there was no evidence of any deleterious histopathological changes.

Based on these analyses, carbohydrate-functionalized nanoparticles are safe for in vivo applications. These results provide foundational information towards the

163 evaluation of the capabilities of these surface-modified nanoparticles as vaccine delivery formulations.

Keywords : safety; biocompatibility; nanoparticles; carbohydrate; polyanhydride

6.2. Introduction

The development of novel strategies to improve adjuvant formulations by directly targeting innate immune cells is an important area of interest in the design of novel vaccines.[1-4] Biodegradable nanoparticles possess promising characteristics in this regard by playing dual roles, both as adjuvants and delivery vehicles.[5] In particular, polyanhydride particles have been demonstrated to induce enhanced expression of MHC I and II on and stimulation of antigen presenting cells (APCs), which are fundamental to initiating adaptive immune responses.[6-8] After in vivo administration, the nanoparticles interact with a variety of cells, including APCs.[9, 10] Before analyzing the effects of surface modification upon vaccine efficacy, an assessment of their safety and biocompatibility is necessary.[11]

The use of polymeric nanoparticle systems for drug and vaccine delivery offers several advantages, including controlled delivery of encapsulated payload(s), and depending on their chemical properties, improved biocompatibility, receptor targeting capabilities, sustained antigen/drug release kinetics, adjuvanticity, and opportunities for both local and systemic delivery.[12,

13] Polyanhydride nanoparticles have displayed these characteristics in both in vitro and/or in vivo settings.[6, 9, 14-20] In particular, the use of biodegradable nanoparticles for lung delivery is an attractive proposition because of the

164 following advantages: 1) uniform particle distribution in the lung; 2) local administration of vaccine antigens or therapeutic drugs; 3) sustained delivery of macromolecules; 4) improved patient compliance associated with non-invasive immunization and administration of fewer doses; and 5) avoidance of first pass metabolism, among others.[2, 12, 21-23]

In previous in vitro studies, it was demonstrated that di-mannose functionalization of polyanhydride nanoparticles, which would induce signaling via C-type lectin receptors (CLRs) on APCs, enhanced the activation of macrophages and dendritic cells (DCs).[6, 17, 18, 24] Because of the role of CLR signaling in stimulating innate immunity, identifying safe and effective means to selectively target APC receptors such as the macrophage mannose receptor

(MMR) and the macrophage galactose binding lectin (MGL) will provide novel approaches to enhance and shape adaptive immunity.[3, 25, 26] Both the charge and surface properties of these polyanhydride nanoparticles are altered upon functionalization and could engage additional signaling cascade(s), which may affect the magnitude of immune response to the presence of these functionalized adjuvants/delivery vehicles. In this regard, even though these functionalized particles have displayed desirable properties ( i.e. , activation of APCs) in vitro , the focus of this study was to perform a systematic evaluation of their safety and biocompatibility profile in vivo to assess any toxicological effects that might be associated with functionalization.

165

6.3. Materials and Methods

6.3.1. Materials Chemicals needed for monomer synthesis, polymerization, and nanoparticle synthesis included anhydrous (99+%) 1-methyl-2-pyrrolidinone

(Aldrich, Milwaukee, WI); 1,6-dibromohexane, 4-p-hydroxybenzoic acid, N,N- dimethylacetamide and triethylene glycol (Sigma Aldrich, St. Louis, MO); 4-p- fluorobenzonitrile (Apollo Scientific, Cheshire, UK); acetic acid, acetic anhydride, acetone, acetonitrile, dimethyl formamide (DMF), hexanes, methylene chloride, pentane, potassium carbonate, sodium hydroxide, sulfuric acid, and toluene

(Fisher Scientific, Fairlawn, NJ). For NMR characterization, deuterated dimethyl sulfoxide was purchased from Cambridge Isotope Laboratories (Andover, MA).

For nanoparticle tracking AlexaFluor ® 647 hydrazide was purchased from Life

Technologies (Grand Island, NY). For nanoparticle functionalization, 1-ethyl-3-(3- dimethylaminopropyl) carbodiimide hydrochloride, N-hydroxysuccinimide, and ethylenediamine were purchased from Thermo Scientific (Waltham, MA). Glycolic acid was purchased from Acros Organics (Pittsburgh, PA). Materials required for the lung tissue processing included: Dulbecco’s Modified Eagle Medium and

Hank’s balanced salt solution (Life Technologies, Grand Island, NY); HEPES buffer, penicillin-streptomycin, and L-glutamine, (Mediatech, Herndon, VA); and heat inactivated fetal bovine serum (Atlanta Biologicals, Atlanta, GA); and ammonium chloride, potassium bicarbonate, 0.5 M EDTA and sodium azide

(Fisher Scientific). β-mercaptoethanol and rat immunoglobulin (rat IgG) were purchased from Sigma Aldrich (St. Louis, MO). Materials used for flow cytometry

166 included: stabilizing cellular fixative solution (BD Bioscience, San Jose, CA); unlabeled anti-CD16/32 (i.e. , anti-Fc γR) (Southern Biotech, Birmingham, AL);

FITC conjugated anti-mouse CD11c (clone N418), PE conjugated anti-mouse

CD11b (clone M1/70), Alexa Fluor ® 700 conjugated anti-mouse F4/80 (clone

BM8), PerCP/Cy5.5 conjugated anti-mouse Ly-6G/Ly-6C (Gr-1) (clone RB6-

8C5), PE/Cy7 anti-mouse CD326 (clone G8.8) and their corresponding isotype controls: FITC conjugated Armenian Hamster IgG (clone HTK888), PE- conjugated rat IgG2b κ (clone RTK4530), Alexa Fluor ® 700 conjugated rat IgG2a κ

(clone RTK2758), and PerCP/Cy5.5 conjugated rat IgG2b κ (clone RTK4530) and

PE/Cy7 conjugated rat IgG2a κ (clone RTK2758) (BioLegend, San Diego, CA).

Endotoxin-free saline was obtained from the Iowa State University College of

Veterinary Medicine Pharmacy.

6.3.2. Monomer and polymer synthesis Monomers of 1,6-bis( p-carboxyphenoxy) hexane (CPH) and 1,8-bis( p- carboxyphenoxy)-3,6-dioxaoctane (CPTEG) were synthesized as described previously.[15, 27] The 50:50 CPTEG:CPH copolymer was synthesized by melt polycondensation as previously described.[15] The chemical structure was characterized with 1H NMR using a Varian VXR 300 MHz spectrometer (Varian

Inc., Palo Alto, CA). The synthesized 50:50 CPTEG:CPH copolymer had a Mw of

10,500 Da, and the polydispersity index (PDI) of this copolymer was 1.5, which is consistent with previous work.[15, 20]

167

6.3.3. Nanoparticle synthesis Polyanhydride nanoparticles were synthesized using anti-solvent nanoencapsulation as described previously.[28] Briefly, for flow cytometry,

AlexaFluor ® 647 hydrazide (1% w/w) and 20 mg/mL 50:50 CPTEG:CPH polymer were dissolved in methylene chloride (at 4°C). For histological and cytokine analyses, blank nanoparticles were synthesized. The polymer solution was sonicated at 40 Hz for 30 s using a probe sonicator (Ultra Sonic Processor VC

130PB, Sonics Vibra Cell, Newtown, CT) and rapidly poured into a pentane bath

(at -40°C) at a solvent to non-solvent ratio of 1:2 50. Particles were collected by filtration and dried under vacuum for 30 min.

6.3.4. Sugar synthesis

6.3.4.1. Synthesis of carboxymethyl α-1,2-linked dimannoside

Synthesis of carboxymethyl α-1,2-linked dimannose was carried out using fluorous-solid phase extraction (FSPE) as per literature procedure.[29-31] Each glycosylation was performed with 2.0 equivalents of the donor in anhydrous dichloromethane at 0 ºC for 15 min. Facile purification of crude product by FSPE enabled easy preparation of the protected linear α-1,2-linked dimannose in high yield. FSPE was very helpful in the context of this particular synthesis as isolation of the target compound using regular silica gel chromatography turned out to be difficult owing to the formation of unwanted side products (hydrolyzed and rearranged donor). The reducing terminal of the disaccharide was further functionalized by ozonolysis followed by Jone’s oxidation to yield a carboxylic

168 acid. Global deprotection was carried out using Birch reduction condition to produce the desired deprotected dimannoside.[6]

6.3.4.2. Synthesis of carboxymethyl-β-galactoside

Allylated β-galactose acetate was subjected to Ruthenium catalyzed

Sharpless oxidation, which resulted in carboxylic acid terminated β-galactose acetate in high yield. Base catalyzed deacetylation yielded the desired galactoside in high yield.

6.3.5. Surface functionalization carboxymethyl-α-D-mannopyranosyl-(1,2)-D-mannopyranoside and carboxymethyl-β-galactoside were conjugated onto the surface of polyanhydride nanoparticles using an amine-carboxylic acid coupling reaction.[6, 17, 18, 24]

Particles with glycolic acid groups on the surface (linker) and non-functionalized

(NF) particles were used as controls. The conjugation reaction was performed in two reaction steps, as described previously.[6, 18] Briefly, a nanoparticle suspension (10 mg/mL) was made using nanopure water, and 10 equivalents of

1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) and 12 equivalents of N-hydroxysuccinimide (NHS), and 10 equivalents of ethylenediamine were added. This reaction was carried out at 4°C temperature for 1 h at a constant agitation of 17 rcf. Following the reaction, the particles were centrifuged at 10,000 rcf for 10 min and the supernatant was removed. The particles were washed with the same volume of nanopure water, centrifuged at

169

10,000 rcf for 10 min and the supernatant was removed. A second reaction was performed with 10 eq. of EDC, 12 eq. of NHS and 10 eq. of the corresponding functionalizing agent (i.e. , di-mannose or galactose) in nanopure water, using constant agitation at 17 rcf for 1 h at 4°C. Partic les were sonicated before and after each reaction to break aggregates. After the reactions were completed, nanoparticles were collected by centrifugation (10,000 rcf, 10 min) and dried under vacuum for 1 h.

6.3.6. Nanoparticle characterization Morphological and size characterization of both the functionalized and the

NF nanoparticles was performed using scanning electron microscopy (SEM, FEI

Quanta 250, Kyoto, Japan) and quasi-elastic light scattering (QELS, Zetasizer

Nano, Malvern Instruments Ltd., Worchester, UK). The QELS experiments were used to measure the ζ-potential of the nanoparticles. To quantify the amounts of the carbohydrates conjugated to the nanoparticles, a high throughput version of a phenol-sulfuric acid assay was used.[6, 32] A microplate reader (SpectraMax M3,

Molecular Devices, Sunnyvale, CA) was used to obtain the absorbance of standards and samples using a wavelength of 490 nm. The total amount of sugar per unit weight of nanoparticles (g/mg) was calculated.

6.3.7. Mice

Female Swiss Webster outbred mice were purchased from Harlan

Laboratories (Indianapolis, IN). Mice were housed in specific pathogen-free conditions where all bedding, caging, and feed were sterilized prior to use. All

170 animal procedures were conducted with the approval of the Iowa State University

Institutional Animal Care and Use Committee.

6.3.8. Mouse treatments

6.3.8.1. Liver and kidney histological and biomarker examination Separate groups of five Swiss Webster outbred mice were subcutaneously injected with 5 mg of polyanhydride nanoparticles (non- or surface-functionalized) in 1.5 mL of phosphate buffer saline (PBS) at the nape of the neck.[33] Control animals received treatment that included Alum (100 L) or saline (1.5 mL). Urine samples were collected at 7 and 30 days post-administration, prior to necropsy.

Whole blood was collected via cardiac puncture in heparinated tubes, and liver and kidney tissues were harvested during necropsy and placed in phosphate- buffered formalin. Formalin-fixed tissues after 7 and 30 days post-administration were embedded, sectioned, and stained with hematoxylin and eosin (H&E), and blindly evaluated by a board-certified veterinary pathologist. Histopathological damage caused by inflammation, the distribution of inflammatory cells, and tissue necrosis were evaluated using a 0-5 scoring system for each independent parameter.

6.3.8.2. Serum biomarker analysis Serum biomarkers of kidney and liver function were analyzed using an

Ortho Vitros 5.1 Chemistry Analyzer by the Iowa State University Clinical

171

Pathology Laboratory. Toxicological biomarkers analyzed included blood urea nitrogen (BUN), albumin, alkaline phosphatase (Alk Phos), alanine aminotransferase (ALT), serum creatinine, glucose, total bilirubin, cholesterol and total triglycerides. Normal range values for these biomarkers were obtained from the Laboratory and compared with literature.[34, 35]

6.3.8.3. Urine creatinine and total protein quantification analysis Creatinine levels were measured in urine samples collected at 7 and 30 days post-administraton using a creatinine assay kit (Sigma Aldrich). The ELISA- based colorimetric assay was performed following the manufacturer’s specifications. Quantification of creatinine was performed using standards provided by the manufacturer. Total protein amount in urine was quantified using a micro-bicinchoninic acid (BCA) assay at an absorbance of 562 nm using a plate reader (SpectraMax M3).

6.3.8.4. Intranasal administration of particle formulations Five separate groups of Swiss Webster mice were intranasally administered nanoparticle formulations. To sedate the mice prior to intranasal adminsitration of the nanoparticles, the mice were intraperitoneally injected with

90 L of anesthetic solution (20 mg/mL ketamine + 1 mg/mL xylazine). Particle treatment groups included mice that were administered: 1) 500 g of non- functionalized, 2) linker-functionalized, 3) galactose-functionalized or 4) di-

172 mannose functionalized 50:50 CPTEG:CPH nanoparticles. Mice intranasally administered saline were used as a control. Nanoparticles were suspended in

PBS and sonicated before administration. For all formulations, a volume of 50 L was intranasally administered. After mice were deeply anesthetized, they were held upright by the nape of the neck and nanoparticle suspension was slowly applied through the nostrils of each mouse with a micropipette. They were held in this position until the breathing rate of the animals was back to normal. Mice were monitored after anaesthesia and mobile function was restored.

6.3.8.5. Lung histological evaluation Lungs from Swiss Webster mice were excised at 6 h, 24 h and 48 h post- immunization and formalin-fixed. Tissues were embedded, sectioned, and stained with H&E, and blindly evaluated by a board-certified veterinary pathologist. Adverse reactions in the lung tissue caused by inflammatory infiltration, necrosis, edema, bronchial associated lymphoid tissue (BALT) hyperplasia, and hemorrhage were evaluated using a 0-5 scoring system for each independent parameter.

6.3.8.6. Flow cytometric analysis of lung tissue Mice were euthanized at 2 h, 24 h, and 48 h time points post- immunization. Lungs were processed as previously described.[9] Briefly, lungs were excised and perfused with PBS. Lungs were incubated in Hank’s Balanced

173

Salt Solution with 1 mg/mL collagenase D and 60 U/mL DNAse II for 20 min at

37°C. Lung tissue was homogenized using a gentleMAC S ® tissue dissociator

(Miltenyi Biotec, Cambridge, MA). To remove debris, samples were centrifuged for 250 rcf for 20 s, and filtered with a 40 m cell filter. Red blood cells were lysed using ACK lysis buffer (150 mM ammonium chloride, 10 mM potassium bicarbonate, and 0.1 mM EDTA). Cell samples (1 x 106 cells/mL) were blocked to prevent non-specific binding with 1% Rat IgG, 0.1% anti-mouse CD16/32 and

0.1% unconjugated Armenian Hamster IgG. Cells were surface stained with

CD11c, CD11b, Ly6G/C Gr-1, and F4/80 markers. Samples were fixed with stabilizing fixative solution (BD Biosciences) and analyzed on a FACSCanto TM flow cytometer (Becton-Dickinson, San Jose, CA) and the data was processed using FlowJo vX software (TreeStar Inc., Ashland, OR).

6.3.8.7. Bronchoalveolar lavage (BAL) fluid collection BAL fluid was collected after 6 h, 24 h, and 48 h post immunization.[36,

37] Briefly, after mice were euthanized, a sterile catheter was inserted into the exteriorized trachea of each mouse. Using a 1 mL syringe attached to the catheter, 1 mL of PBS was infused into the lungs, and aspirated back to the syringe. The process was repeated 2-3 times, per mouse, while massaging the chest externally. Samples were placed on ice, and centrifuged at 300 rcf for 30 s at RT to remove cellular debris, and stored at -20°C until further analysis.

174

6.3.9. Cytokine and chemokine analysis BAL fluid samples obtained at 6 h, 24 h and 48 h post-immunization were analyzed using a 13-plex cytokine and chemokine quantification kit (MILLIPLEX ®

MAP mouse cytokine/chemokine magnetic bead panel, EMD Millipore, Billerica,

MA). Analytes quantified included: IL-6, KC, MCP-1, MIP-1α, MIP-2, IP-10, TNF-

α, IFN-γ, IL-1β, IL-10, IL-12p40, MIG, and RANTES. The assay was performed following manufacturer’s instructions, and data was acquired and analyzed using a Bio-Plex 200 TM system (Bio-Rad, Hercules, CA) as described in previous protocols.[8, 17]

6.3.10. Statistical Analysis Statistical analysis was used to analyze the cell surface marker expression and cytokine secretion data. Two-way ANOVA and Dunnett’s test were used to determine statistical significance among treatments and p-values <

0.05 were considered significant.

6.4. Results

6.4.1. Functionalization and characterization of carbohydrate-modified nanoparticles

Our previous work has shown that amphiphilic nanoparticle chemistries were suitable for protein stabilization[16, 24, 28, 38, 39], demonstrated potent adjuvant responses[20], and were effectively internalized by and activated

175

APCs.[6, 17, 24, 40] Therefore, the 50:50 CPTEG:CPH nanoparticle formulation was chosen to perform the carbohydrate functionalization and to evaluate safety upon in vivo administration.

Particle morphology was characterized using scanning electron microscopy, as shown by the photomicrographs in Figure 6.1. The size of these particles was measured using ImageJ software (version 1.47v, NIH, Bethesda,

MD). The diameter of the non-functionalized 50:50 CPTEG:CPH nanoparticles was 182 ± 59 nm. After functionalization, the diameter increased to 223 ± 61 nm,

228 ± 43 nm, and 236 ± 55 nm, for linker-, galactose-, and di-mannose-modified particles, respectively. In addition, the ζ-potentials and the surface concentration of the sugars for each formulation were measured and are shown in Figure 6.1.

The NF particles are negatively charged, consistent with the presence of carboxylic acid moieties with a ζ-potential of -21 ± 3.2 mV, while the addition of the amine linker to which the neutral sugar moieties (i.e. , galactose and di- mannose) were attached resulted in a positively charged surface with ζ-potentials of 18 ± 2.5 mV, 16 ± 2.1 mV and 19 ± 1.9 mV, respectively. After the carbohydrate modification was completed, quantification of the amount of sugar linked to the particle surface was measured using a phenol sulfuric acid assay and indicated that 15 ± 5.5 g of galactose or 19 ± 2.4 g of di-mannose were present per milligram of particles.

176

Figure 6.1. Polyanhydride nanoparticle characterization. Chemical structures of the surface moieties on non-functionalized, linker-, galactose-, and di-mannose- functionalized nanoparticles are presented. Particle size data represent the mean ± standard deviation (SD) of data collected from scanning electron microscopy photomicrographs using ImageJ software from four independent experiments. Zeta potential data were measuring using QELS and represent the mean ± SD of four independent experiments. Sugar density data were measured using a phenol sulphuric acid assay and are presented as the mean ± SD of four independent experiments.

6.4.2. Kidney histological evaluation and renal function Following subcutaneous administration of 5 mg of particles to mice, serum, urine, and kidney samples were collected at 7 and 30 days. Histological evaluation of the tissue sections was performed and renal function biomarker levels were analyzed. Blood urea nitrogen (BUN) was measured in serum

177 samples, while creatinine and total protein were quantified in urine samples. As shown in the representative histological images in Figure 6.2A, the inflammatory changes in the kidney during the period of the study were unremarkable as no significant differences were observed between the histological scores of mice treated with saline and the animals treated with the various nanoparticle formulations. Using a five point scale, the inflammatory infiltration scores ranged from 0-2, in all groups, with an average of 0.67, and these levels did not worsen between 7 to 30 days post-administration indicating that no acute or chronic inflammation was induced (Figure 6.2B). The distribution of the cellular infiltration had an average score of ~1.67, with only one mouse that was administered the galactose nanoparticles receiving a score of 3 at 7 days post-administration. In summary, these studies show that there was no histological evidence of tissue damage in the kidneys . Figure 6.2C shows renal function biomarker levels, BUN, and creatinine, both indicative of normal glomerular filtration rate. For the two biomarkers assessed and the total protein/creatinine ratio in the urine, there were no significant differences in urine samples collected at 7 or 30 days post- administration from mice that were treated with saline and samples from mice that received any of the nanoparticle treatments. Both BUN and creatinine levels were within previously reported normal range levels [41, 42]. Even though BUN levels were slightly lower than the reference values, there were no significant differences between the saline and particle groups. Variations in normal BUN levels have been previously reported to be mouse strain-dependent [34, 35, 43].

178

Figure 6.2. Administration of a 5 mg dose of surface-functionalized 50:50 CPTEG:CPH nanoparticles did not affect renal function. Panel A shows representative histological sections of kidney samples from Swiss Webster mice (n= 6) seven days post-administration of the nanoparticle formulations. Panel B shows the inflammatory scores of kidney samples after histopathological evaluation. Panel C displays the levels of blood urea nitrogen (BUN) in serum and creatinine and total protein/creatinine ratio in urine samples from Swiss Webster mice seven and 30 days post-administration. Reference levels provided by the Iowa State University Clinical Pathology Laboratory are indicated as dashed lines. No significant differences were observed when compared to mice administered saline (n = 5 at each time point).

6.4.3. Liver histological evaluation and hepatic function Seven and 30 days after subcutaneous administration of 5 mg of nanoparticle formulations, histological evaluation of the tissue sections was performed. Cholestasis and hepatocellular damage were evaluated in serum samples by measuring the levels of alkaline phosphatase (Alk Phos) and alanine

179 aminotransferase (ALT), respectively. As shown in Figure 6.3A, the inflammatory changes in the liver were mild, and these were interpreted as non-specific background changes common to this mouse strain. Representative histological images of liver tissue are shown. The inflammatory infiltration scores ranged from

0-2 (on a scale of 0-5) in all the animals studied, with an average of ~1, regardless of the treatment as shown in Figure 6.3B. These scores did not significantly change between the two time points analyzed. The frequency of infiltration within the liver (distribution score) was also low; the distribution score ranged from 0-3, with an average of ~1.8. In Figure 6.3C, the levels of Alk Phos,

ALT, and albumin are shown. There were no significant differences in the serum levels of any of the biomarkers analyzed between saline and nanoparticle treatment groups in the levels of these serum biomarkers at either time point.

The ALT levels in mice administered the particle formulations were slightly higher than the upper limit of the reference values at day 30 post-administration; however, these were no different than the levels observed in mice treated with saline at the same time point.

180

Figure 6.3. Administration of a 5 mg dose of surface-functionalized 50:50 CPTEG:CPH nanoparticles did not affect induce hepatic inflammation or alter hepatic function. Panel A shows representative histological sections of liver samples from Swiss Webster mice (n= 6) seven days post-administration of the nanoparticle formulations. Panel B shows the inflammatory scores of liver samples after histopathological evaluation. Panel C displays the levels of alkaline phosphatase, alanine aminotransferase, and albumin in serum samples from Swiss Webster mice seven and 30 days post-administration. Reference levels provided by the Iowa State University Clinical Pathology Laboratory are indicated as dashed lines. No significant differences were observed when compared to mice administered saline (n = 5 at each time point).

6.4.4. Lung histological evaluation Based upon the results obtained so far, which suggested that the subcutaneous administration of carbohydrate-functionalized polyanhydride nanoparticles did not have a detrimental effect upon liver or kidney function of the

181 treated animals, we next evaluated the safety profile upon intranasal administration of surface-modified polyanhydride nanoparticles. Previous work from our laboratories has shown that nanovaccines delivered intranasally resulted in protective long-term immunity.[20] After intranasal administration of

0.5 mg of nanoparticle formulations, tissue samples were collected at 6, 24, and

48 h post-administration to evaluate acute histological changes. Figure 6.4A shows representative histological images from the lung for each treatment group at the 24 h time point (when the highest histological scores were registered). The parameter that contributed mostly to the final histological score was inflammation as shown in Figure 6.4B. Inflammatory infiltrates tended to be focused on bronchioles and adjacent alveolar spaces with neutrophils predominating. In general, the inflammatory scores peaked at 24 h, with scores up to 4 in some animals. The animals that received the linker and galactose-functionalized nanoparticles displayed a higher level of inflammation. In addition, the average necrosis values increased with time, with the highest value at 48 h, regardless of treatment groups (data not shown). There were only two mice with minor hemorrhage, with a score of 1, 24 h after administration of the NF particles.

Hemorrhage was likely a tissue collection artifact. There were no mice with signs of edema or BALT hyperplasia at any time point analyzed (data not shown). Total histological scores are shown in Figure 6.4C.

182

Figure 6.4. Mild to moderate inflammation was observed in lung samples upon histological evaluation post-administration of surface-functionalized polyanhydride nanoparticles. Lung tissue samples from Swiss Webster mice were collected at 6, 24 and 48 hours post-administration. A) Representative images of each treatment group at 24 h post-administration. B) Inflammatory infiltration scores on a scale of 0-5 after histopathological evaluation. C) Composite histopathological scores representing the sum of five individual parameters (inflammatory infiltration, necrosis, edema, bronchial associated lymphoid tissue hyperplasia, and hemorrhage), with a total possible score of 25. No significant differences were observed when compared to mice administered saline (n = 6 at each time point).

6.4.5. Distribution of lung cellular populations Given the inflammatory cell infiltration scores described above, the cell types recruited into the lungs following particle administration were assessed by flow cytometry. Cellular populations were analyzed in whole lung homogenate at

2 h, 24 h, and 48 h post-intranasal administration. Flow cytometric analysis was

183 performed and populations were identified with the following surface marker combinations: dendritic cells (CD11c + CD11b -), interstitial macrophages (CD11c -

CD11b + F4/80 +), neutrophils (CD11b + Ly6G/C Gr-1+), and activated monocytes

(CD11b + Ly6G/C Gr-1-).[44-47] Figure 6.5 shows the cellular population distribution in the lungs. The percentage of DCs (Figure 6.5A) increased with time for all the treatment groups including the saline control and ranged from 1-

4% of total lung cells. The percentage of interstitial macrophages (Figure 6.5B) peaked at 24 h, with all the treatment groups following similar dynamics. The neutrophil percentage (Figure 6.5C) at 2 h was the highest (2.5-5%) and with time, these populations decreased to 1.5-2.5% of all the cells; this behavior was observed in the tissue from the animals that received all the treatment groups except the NF nanoparticles, in which the neutrophil population peaked at 24 h.

As another measure of cellular recruitment into the lungs, the presence of activated monocytes was assessed (Figure 6.5D) and the presence of this cell type followed similar dynamics as neutrophils, starting at 4-6%, and decaying to

1.5-3% of total lung cells by 48 h. These data support the histological evaluation, as no major changes were observed in the inflammatory cell populations in the lungs of mice treated with saline or mice administered any of the nanoparticle formulations.

184

Figure 6.5. Cellular distribution of lung homogenates of Swiss Webster following administration of surface-functionalized polyanhydride nanoparticles. Cellular populations were analyzed by flow cytometry at 6, 24 and 48 hours post- administration and various cell populations were analyzed. A) dendritic cells; B) interstitial macrophages; C) neutrophils; and D) activated monocytes. No significant differences were observed in these distributions when compared to mice administered saline (n = 6 at each time point).

6.4.6. Cytokine/chemokine secretion To assess the inflammatory environment in the lungs following intranasal administration of 0.5 mg of nanoparticle formulations, the BAL fluid was collected and used to measure the amounts of the following chemokines and cytokines: IL-

6, KC, MCP-1, MIP-1α, MIP-2, IP-10, TNF-α, IFN-γ, IL-1β, IL-10, IL-12p40, MIG, and RANTES. Negligible amounts (i.e. , below the levels of detection) of IFN-γ,

185

IL-1β, IL-10, IL-12p40, MIG, and RANTES were observed (data not shown).

Figure 6.6 shows the kinetics of the secretion of IL-6, KC, MIP-2, TNF-α, IP-10,

MCP-1, and MIP-1α. Two distinct trends were observed. The secretion of IL-6,

KC, MIP-2, and TNF-α peaked at 6 h post-administration, while the highest amounts of IP-10, MCP-1, and MIP-1α secreted were observed 48 h post- administration. The BAL fluid from animals that received the linker and galactose- modified nanoparticle groups showed consistently higher amounts of these cytokines compared with saline. The absence of a major cytokine/chemokine response after intranasal administration of the nanoparticle formulations is consistent with the histological data and provides further evidence of the safety and biocompatibility of these materials following pulmonary delivery.

Figure 6.6. Low amounts of cytokine/chemokine secretion were observed in bronchoalveolar lavage fluid 6, 24 and 48 hours after intranasal administration of surface-functionalized polyanhydride nanoparticles. The amounts of IL-6, KC, MIP-2, TNF-α, IP-10, MCP-1 and MIP-1α in the bronchoalveolar lavage fluid were quantified using a Multiplex magnetic bead assay. * represents groups that are statistically significant (p ≤ 0.05) compared to the saline control (n = 5 at each time point).

186

6.5. Discussion

In this work we report on the safety profile of surface-functionalized polyanhydride nanoparticles following parenteral or intranasal administration to mice. The safety and biocompatibility of non-functionalized polyanhydride nanoparticles has been demonstrated previously[33]; however, the ability of di- mannose functionalized nanoparticles to initiate signaling via CLRs warrants a systematic evaluation of the potential toxicity associated with the induction of innate and/or inflammatory responses by these novel biomaterials.

As shown in Figure 6.1, the particle morphology and size of the functionalized particles were similar to previously reported data.[6, 19, 28, 48, 49]

The characterization of polyanhydride nanoparticles before and after surface modification was consistent with previous studies.[6, 17, 18] The change in zeta potential from negative to positive charge after linker attachment can be beneficial for enhanced cellular uptake, as reported previously.[50, 51] In addition, carbohydrate functionalization is known to enhance both APC activation in vitro [6, 17, 18] as well as the therapeutic efficacy of drug delivery.[4]

Based on the histological analysis scores reported in this work, subcutaneous administration of 5 mg of carbohydrate-functionalized nanoparticles did not result in tissue damage of the liver or kidney when assessed at 7 or 30 days post-administration and is consistent with previously reported safety profiles of parenterally administered polyanhydride nanoparticles.[33] The histological changes noted in hepatic tissue samples after nanoparticle administration were mild, which is comparable to other

187 biodegradable polymer formulations, but much less than that exhibited by extremely cytotoxic metal particles of similar size.[11] No other histological changes such as distortion and swelling of hepatocytes, cellular binucleation, or hydropic degeneration of the tissue were detected in the liver samples, as reported with other nanoparticle formulations.[52] The histological scores of the kidney samples of mice administered saline alone were not significantly different when compared to the scores from the kidneys of mice administered the various particle formulations. No interstitial edema, inflammatory cell infiltration, tubular epithelial flattening, urinary casts, or signs of renal histopathological lesions were detected, which have been reported previously for other nanoparticles.[53, 54]

Based on the data presented here, the systemic effects of functionalized nanoparticle administration, in terms of hepatic and renal health, are consistent with effects of other biodegradable nanoparticle systems.[33, 55, 56]

In addition to histological evaluation, serum and urine biomarkers, which are indicators of renal and hepatic injury and inflammation, were used to evaluate the safety of the functionalized nanoparticles. The levels of BUN, urine creatinine, and total protein/creatinine ratio in mice receiving the particle treatments were not significantly different from the levels in animals receiving the saline. Even though BUN content level was lower than the reference values provided, the values were consistent with previously reported data in Swiss

Webster mice.[43] Creatinine and total protein to creatinine ratio levels in mice administered the particles were no different than in animals receiving the saline control, and consistent with amounts reported in urine from mice of this

188 lineage.[35, 41] Creatinine, a byproduct of muscle metabolism, is an important indicator of kidney function. When glomerular filtration rate is impaired, creatinine levels rise in the blood and in the urine.[57] Creatinine measurement is commonly used because urinary excretion of any biomarker that is filtered through the glomerulus is affected by the glomerular filtration rate and therefore used to normalize other markers, such as total protein or albumin.[58] Together with urine specific gravity, these markers are part of the standard clinical diagnosis for renal function during impairments such as chronic kidney disease[59], acute kidney injury[60], or renal injury.[41] Together, the inability to detect elevated levels of key biomarkers in serum and urine combined with the histopathology assessment of liver and kidney samples, demonstrates that there were no detrimental effects on renal or hepatic systems in mice treated with 5 mg of di-mannose functionalized nanoparticles.

The use of the pulmonary route offers several advantages for drug and vaccine delivery since the lungs allow targeted [2], non-invasive administration

[22], and the capability to ensure systemic or local delivery of agents.[12, 21]

However, the respiratory system is also a more delicate environment, and parameters such as particle size [61-63], charge [2, 50, 51], chemistry [9, 33], and material [12, 64] affect deposition, distribution, and biocompatibility. In previous work, a single intranasal administration of non-functionalized polyanhydride nanovaccines demonstrated the ability to induce protective immunity upon lethal challenge.[9, 20, 65] The current work builds upon these studies by evaluating the safety profile of carbohydrate-functionalized

189 nanoparticles in the lung. The acute histopathology results from lung tissues after administration of particle formulations (Figure 6.4) displayed a bell-shaped curve with a peak at the 24 h time point. The lesions in the lung samples were mild to moderate, likely attributable to the administration procedure itself, because the lungs of the mice administered the saline control group received similar scores.

As shown in Figure 6.4B, the major contributor to the histological scores was inflammatory cell infiltration.

The inflammatory infiltrates found in the lung samples after intranasal administration were consistent with the recruitment kinetics described for other pulmonary innate immune responses[36, 50, 61, 66], in which initial cellular recruitment was primarily composed of mononuclear cells and neutrophils. Next, neutrophils and macrophage infiltrates appeared in the lung tissue by 24 h, and were still present 48 h post-administration. Since the differences in the inflammatory cell infiltrates in the lung samples may be attributed to pulmonary recruitment of cells from circulation[50], we analyzed the kinetics of various cell populations in the lungs of treated animals. As shown in Figure 6.5, there were no significant changes in lung cellular populations between the various particle treatment groups, but all of them followed similar kinetics. Consistent with the histological data and previous studies[66, 67], neutrophils were the first cells to be recruited to the administration site, followed by macrophages and/or DCs.

Overall, the lung cellular populations observed were not statistically distinguishable from the populations in the lungs of mice receiving saline. This observation suggests that the administration of the nanoparticles likely caused a

190 mild inflammatory response similar to that induced by the administration of saline, and supports the conclusion that the particle formulations themselves were not detrimental to the health of the treated animals.

Another component of lung response to foreign material is the secretion of cytokines and chemokines to recruit a cellular response and mediate clearance.

The presence of these molecules can mediate leukocyte trafficking, inflammation, and link the innate and adaptive immune responses.[68] However, overproduction of chemokines and cytokines can cause severe tissue damage.[68, 69] As shown in Figure 6.6, different kinetics were observed for the analyzed cytokines and chemokines. The amounts of IL-6, KC, MIP-2 and TNF-α levels were elevated at early time points but decreased by 48 h, while the amounts of IP-10, MCP-1 and MIP-1α secreted were the highest at 48 h. The observed differential production of these cytokines/chemokines is likely related to the dynamic nature of the innate immune response and the different cell types that produce, utilize, and respond to these molecules. Nevertheless, our data indicate that intranasal administration of any of the nanoparticle formulations did not cause a major increase in cytokine or chemokine production that would result in severe tissue damage. All together, the histological evaluation of lung tissue, the unremarkable changes in the recruitment of inflammatory cells to the lung, and the absence of a major cytokine/chemokine response after intranasal administration of carbohydrate-functionalized polyanhydride nanoparticles provide confirmatory evidence of the safety and biocompatibility of these novel materials for pulmonary delivery.

191

6.6. Conclusions

The studies reported herein demonstrate the safety and biocompatibility of carbohydrate-functionalized polyanhydride nanoparticles upon parenteral and intranasal administration. The results showed that a 5 mg dose of either linker- or di-mannose-functionalized nanoparticles did not induce hepatic or renal tissue damage or cause elevation of damage-related or functional biomarkers in serum or urine following subcutaneous administration. In addition, a 0.5 mg dose of either linker- or di-mannose-functionalized nanoparticles administered intranasally did not result in demonstrable tissue changes in the lungs of treated animals. The favorable histological profile, distribution and kinetics of cellular populations, and the lack of a remarkable pro-inflammatory cytokine and chemokine profile in the lungs of mice administered functionalized nanoparticles supported the biocompatibility of the linker- and di-mannose-functionalized nanoparticles. Together, these studies demonstrate the safety of administering carbohydrate-functionalized nanoparticles in vivo and provide foundational information to evaluate the capabilities of these surface-modified nanoparticles for drug and vaccine delivery.

6.7. Acknowledgments

The authors would like to acknowledge financial support from NIH-NIAID

(U19 AI-091031) and U.S. Army Medical Research and Materiel Command

192

(Grant No. W81XWH-10-1-0806). The authors would also like to thank Shawn

Rigby of the ISU Flow Cytometry Facility for his expertise in flow cytometry.

193

6.8. References

[1] Engering A, Geijtenbeek TB, van Vliet SJ, Wijers M, van Liempt E, Demaurex N, Lanzavecchia A, et al. The dendritic cell-specific adhesion receptor DC-SIGN internalizes antigen for presentation to T cells. J Immunol. 2002;168:2118-26.

[2] Azarmi S, Roa WH, Lobenberg R. Targeted delivery of nanoparticles for the treatment of lung diseases. Adv Drug Deliv Rev. 2008;60:863-75.

[3] Geijtenbeek TB, Gringhuis SI. Signalling through C-type lectin receptors: shaping immune responses. Nat Rev Immunol. 2009;9:465-79.

[4] Irache JM, Salman HH, Gamazo C, Espuelas S. Mannose-targeted systems for the delivery of therapeutics. Expert Opin Drug Deliv. 2008;5:703-24.

[5] Ulery BD, Nair LS, Laurencin CT. Biomedical Applications of Biodegradable Polymers. Journal of polymer science Part B, Polymer physics. 2011;49:832-64.

[6] Carrillo-Conde B, Song EH, Chavez-Santoscoy A, Phanse Y, Ramer-Tait AE, Pohl NL, Wannemuehler MJ, et al. Mannose-functionalized "pathogen-like" polyanhydride nanoparticles target C-type lectin receptors on dendritic cells. Molecular pharmaceutics. 2011;8:1877-86.

[7] Torres MP, Wilson-Welder JH, Lopac SK, Phanse Y, Carrillo-Conde B, Ramer-Tait AE, Bellaire BH, et al. Polyanhydride microparticles enhance dendritic cell antigen presentation and activation. Acta Biomater. 2011;7:2857- 64.

[8] Petersen LK, Xue L, Wannemuehler MJ, Rajan K, Narasimhan B. The simultaneous effect of polymer chemistry and device geometry on the in vitro activation of murine dendritic cells. Biomaterials. 2009;30:5131-42.

[9] Ross KA, Haughney SL, Petersen LK, Boggiatto P, Wannemuehler MJ, Narasimhan B. Lung Deposition and Cellular Uptake Behavior of Pathogen- Mimicking Nanovaccines in the First 48 Hours. Advanced healthcare materials. 2014.

[10] Carrillo-Conde BR, Ramer-Tait AE, Wannemuehler MJ, Narasimhan B. Chemistry-dependent adsorption of serum proteins onto polyanhydride microparticles differentially influences dendritic cell uptake and activation. Acta biomaterialia. 2012;8:3618-28.

[11] Semete B, Booysen L, Lemmer Y, Kalombo L, Katata L, Verschoor J, Swai HS. In vivo evaluation of the biodistribution and safety of PLGA nanoparticles as drug delivery systems. Nanomedicine. 2010;6:662-71.

[12] Mansour HM, Rhee YS, Wu X. Nanomedicine in pulmonary delivery. International journal of nanomedicine. 2009;4:299-319.

194

[13] Nguyen J, Steele TW, Merkel O, Reul R, Kissel T. Fast degrading polyesters as siRNA nano-carriers for pulmonary gene therapy. Journal of controlled release : official journal of the Controlled Release Society. 2008;132:243-51.

[14] Torres MP, Determan AS, Anderson GL, Mallapragada SK, Narasimhan B. Amphiphilic polyanhydrides for protein stabilization and release. Biomaterials. 2007;28:108-16.

[15] Torres MP, Vogel BM, Narasimhan B, Mallapragada SK. Synthesis and characterization of novel polyanhydrides with tailored erosion mechanisms. J Biomed Mater Res A. 2006;76:102-10.

[16] Carrillo-Conde B, Schiltz E, Yu J, Chris Minion F, Phillips GJ, Wannemuehler MJ, Narasimhan B. Encapsulation into amphiphilic polyanhydride microparticles stabilizes Yersinia pestis antigens. Acta biomaterialia. 2010;6:3110-9.

[17] Chavez-Santoscoy AV, Roychoudhury R, Pohl NL, Wannemuehler MJ, Narasimhan B, Ramer-Tait AE. Tailoring the immune response by targeting C- type lectin receptors on alveolar macrophages using "pathogen-like" amphiphilic polyanhydride nanoparticles. Biomaterials. 2012;33:4762-72.

[18] Vela Ramirez JE, Roychoudhury R, Habte HH, Cho MW, Pohl NL, Narasimhan B. Carbohydrate-functionalized nanovaccines preserve HIV-1 antigen stability and activate antigen presenting cells. Journal of biomaterials science Polymer edition. 2014:1-20.

[19] Huntimer LM, Ross KA, Darling RJ, Winterwood NE, Boggiatto P, Narasimhan B, Ramer-Tait AE, et al. Polyanhydride nanovaccine platform enhances antigen-specific cytotoxic T cell responses. TECHNOLOGY. 2014;02:171-5.

[20] Ulery BD, Kumar D, Ramer-Tait AE, Metzger DW, Wannemuehler MJ, Narasimhan B. Design of a protective single-dose intranasal nanoparticle-based vaccine platform for respiratory infectious diseases. PLoS One. 2011;6:e17642.

[21] Patton JS, Byron PR. Inhaling medicines: delivering drugs to the body through the lungs. Nature reviews Drug discovery. 2007;6:67-74.

[22] Sung JC, Pulliam BL, Edwards DA. Nanoparticles for drug delivery to the lungs. Trends in biotechnology. 2007;25:563-70.

[23] Bailey MM, Berkland CJ. Nanoparticle formulations in pulmonary drug delivery. Med Res Rev. 2009;29:196-212.

[24] Phanse Y, Carrillo-Conde BR, Ramer-Tait AE, Roychoudhury R, Pohl NL, Narasimhan B, Wannemuehler MJ, et al. Functionalization of polyanhydride microparticles with di-mannose influences uptake by and intracellular fate within dendritic cells. Acta biomaterialia. 2013;9:8902-9.

195

[25] Napoletano C, Zizzari IG, Rughetti A, Rahimi H, Irimura T, Clausen H, Wandall HH, et al. Targeting of macrophage galactose-type C-type lectin (MGL) induces DC signaling and activation. Eur J Immunol. 2012;42:936-45.

[26] Cambi A, Figdor CG. Dual function of C-type lectin-like receptors in the immune system. Curr Opin Cell Biol. 2003;15:539-46.

[27] Conix A. Poly[1,3-bis(p-carxoyphenoxy)-propane anhydride]. Macro Synth. 1966;2:95-8.

[28] Ulery BD, Phanse Y, Sinha A, Wannemuehler MJ, Narasimhan B, Bellaire BH. Polymer chemistry influences monocytic uptake of polyanhydride nanospheres. Pharmaceutical research. 2009;26:683-90.

[29] Curran DP, Luo Z. Fluorous Synthesis with Fewer Fluorines (Light Fluorous Synthesis): Separation of Tagged from Untagged Products by Solid-Phase Extraction with Fluorous Reverse-Phase Silica Gel. J Am Chem Soc. 1999;121:9069-72.

[30] Zhang W, Curran DP. Synthetic applications of fluorous solid-phase extraction (F-SPE). Tetrahedron. 2006;62:11837-65.

[31] Zhang W. Fluorous linker-facilitated chemical synthesis. Chem Rev. 2009;109:749-95.

[32] Masuko T, Minami A, Iwasaki N, Majima T, Nishimura S, Lee YC. Carbohydrate analysis by a phenol-sulfuric acid method in microplate format. Anal Biochem. 2005;339:69-72.

[33] Huntimer L, Ramer-Tait AE, Petersen LK, Ross KA, Walz KA, Wang C, Hostetter J, et al. Evaluation of biocompatibility and administration site reactogenicity of polyanhydride-particle-based platform for vaccine delivery. Advanced healthcare materials. 2013;2:369-78.

[34] Mazzaccara C, Labruna G, Cito G, Scarfo M, De Felice M, Pastore L, Sacchetti L. Age-Related Reference Intervals of the Main Biochemical and Hematological Parameters in C57BL/6J, 129SV/EV and C3H/HeJ Mouse Strains. PLoS One. 2008;3:e3772.

[35] Cheetham SA, Smith AL, Armstrong SD, Beynon RJ, Hurst JL. Limited variation in the major urinary proteins of laboratory mice. Physiology & behavior. 2009;96:253-61.

[36] Kirby AC, Raynes JG, Kaye PM. CD11b regulates recruitment of alveolar macrophages but not pulmonary dendritic cells after pneumococcal challenge. The Journal of infectious diseases. 2006;193:205-13.

196

[37] Kirby AC, Coles MC, Kaye PM. Alveolar macrophages transport pathogens to lung draining lymph nodes. J Immunol. 2009;183:1983-9.

[38] Kipper MJ, Shen E, Determan A, Narasimhan B. Design of an injectable system based on bioerodible polyanhydride microspheres for sustained drug delivery. Biomaterials. 2002;23:4405-12.

[39] Lopac SK, Torres MP, Wilson-Welder JH, Wannemuehler MJ, Narasimhan B. Effect of polymer chemistry and fabrication method on protein release and stability from polyanhydride microspheres. J Biomed Mater Res B Appl Biomater. 2009;91:938-47.

[40] Petersen LK, Ramer-Tait AE, Broderick SR, Kong CS, Ulery BD, Rajan K, Wannemuehler MJ, et al. Activation of innate immune responses in a pathogen- mimicking manner by amphiphilic polyanhydride nanoparticle adjuvants. Biomaterials. 2011;32:6815-22.

[41] O'Bryan T, Weiher H, Rennke HG, Kren S, Hostetter TH. Course of renal injury in the Mpv17-deficient transgenic mouse. Journal of the American Society of Nephrology : JASN. 2000;11:1067-74.

[42] Dunn SR, Qi Z, Bottinger EP, Breyer MD, Sharma K. Utility of endogenous creatinine clearance as a measure of renal function in mice. Kidney international. 2004;65:1959-67.

[43] Eaton KA, Friedman DI, Francis GJ, Tyler JS, Young VB, Haeger J, Abu-Ali G, et al. Pathogenesis of renal disease due to enterohemorrhagic Escherichia coli in germ-free mice. Infection and immunity. 2008;76:3054-63.

[44] Lee PY, Wang JX, Parisini E, Dascher CC, Nigrovic PA. Ly6 family proteins in neutrophil biology. J Leukoc Biol. 2013;94:585-94.

[45] Lai L, Alaverdi N, Maltais L, Morse HC, 3rd. Mouse cell surface antigens: nomenclature and immunophenotyping. J Immunol. 1998;160:3861-8.

[46] Vermaelen K, Pauwels R. Pulmonary dendritic cells. American journal of respiratory and critical care medicine. 2005;172:530-51.

[47] Lohmann-Matthes ML, Steinmuller C, Franke-Ullmann G. Pulmonary macrophages. The European respiratory journal. 1994;7:1678-89.

[48] Petersen LK, Phanse Y, Ramer-Tait AE, Wannemuehler MJ, Narasimhan B. Amphiphilic polyanhydride nanoparticles stabilize Bacillus anthracis protective antigen. Molecular pharmaceutics. 2012;9:874-82.

[49] Haughney SL, Petersen LK, Schoofs AD, Ramer-Tait AE, King JD, Briles DE, Wannemuehler MJ, et al. Retention of structure, antigenicity, and biological

197 function of pneumococcal surface protein A (PspA) released from polyanhydride nanoparticles. Acta biomaterialia. 2013;9:8262-71.

[50] Harush-Frenkel O, Bivas-Benita M, Nassar T, Springer C, Sherman Y, Avital A, Altschuler Y, et al. A safety and tolerability study of differently-charged nanoparticles for local pulmonary drug delivery. Toxicology and applied pharmacology. 2010;246:83-90.

[51] Nguyen J, Reul R, Betz T, Dayyoub E, Schmehl T, Gessler T, Bakowsky U, et al. Nanocomposites of lung surfactant and biodegradable cationic nanoparticles improve transfection efficiency to lung cells. Journal of controlled release : official journal of the Controlled Release Society. 2009;140:47-54.

[52] Alarifi S, Ali D, Al-Doaiss AA, Ali BA, Ahmed M, Al-Khedhairy AA. Histologic and apoptotic changes induced by titanium dioxide nanoparticles in the livers of rats. International journal of nanomedicine. 2013;8:3937-43.

[53] Yamagishi Y, Watari A, Hayata Y, Li X, Kondoh M, Yoshioka Y, Tsutsumi Y, et al. Acute and chronic nephrotoxicity of platinum nanoparticles in mice. Nanoscale research letters. 2013;8:395.

[54] Kelley VE, Winkelstein A. Age- and sex-related glomerulonephritis in New Zealand white mice. Clinical immunology and immunopathology. 1980;16:142- 50.

[55] Yang Y, Pan D, Luo K, Li L, Gu Z. Biodegradable and amphiphilic block copolymer-doxorubicin conjugate as polymeric nanoscale drug delivery vehicle for breast cancer therapy. Biomaterials. 2013;34:8430-43.

[56] Italia JL, Bhatt DK, Bhardwaj V, Tikoo K, Kumar MN. PLGA nanoparticles for oral delivery of cyclosporine: nephrotoxicity and pharmacokinetic studies in comparison to Sandimmune Neoral. Journal of controlled release : official journal of the Controlled Release Society. 2007;119:197-206.

[57] Zhang XD, Wu D, Shen X, Liu PX, Fan FY, Fan SJ. In vivo renal clearance, biodistribution, toxicity of gold nanoclusters. Biomaterials. 2012;33:4628-38.

[58] Goldstein SL. Urinary kidney injury biomarkers and urine creatinine normalization: a false premise or not? Kidney international. 2010;78:433-5.

[59] Peralta CA, Shlipak MG, Judd S, Cushman M, McClellan W, Zakai NA, Safford MM, et al. Detection of chronic kidney disease with creatinine, cystatin C, and urine albumin-to-creatinine ratio and association with progression to end- stage renal disease and mortality. JAMA : the journal of the American Medical Association. 2011;305:1545-52.

198

[60] Waikar SS, Sabbisetti VS, Bonventre JV. Normalization of urinary biomarkers to creatinine during changes in glomerular filtration rate. Kidney international. 2010;78:486-94.

[61] Nemmar A, Hoylaerts MF, Hoet PH, Vermylen J, Nemery B. Size effect of intratracheally instilled particles on pulmonary inflammation and vascular thrombosis. Toxicology and applied pharmacology. 2003;186:38-45.

[62] Heyder J, Gebhart J, Rudolf G, Schiller CF, Stahlhofen W. Deposition of particles in the human respiratory tract in the size range 0.005–15 m. Journal of aerosol science. 1986;17:811-25.

[63] Hofmann W. Modelling inhaled particle deposition in the human lung—A review. Journal of aerosol science. 2011;42:693-724.

[64] Choi HS, Ashitate Y, Lee JH, Kim SH, Matsui A, Insin N, Bawendi MG, et al. Rapid translocation of nanoparticles from the lung airspaces to the body. Nature biotechnology. 2010;28:1300-3.

[65] Ulery BD, Petersen LK, Phanse Y, Kong CS, Broderick SR, Kumar D, Ramer-Tait AE, et al. Rational design of pathogen-mimicking amphiphilic materials as nanoadjuvants. Scientific reports. 2011;1:198.

[66] Dailey LA, Jekel N, Fink L, Gessler T, Schmehl T, Wittmar M, Kissel T, et al. Investigation of the proinflammatory potential of biodegradable nanoparticle drug delivery systems in the lung. Toxicology and applied pharmacology. 2006;215:100-8.

[67] Xing Z, Gauldie J, Cox G, Baumann H, Jordana M, Lei XF, Achong MK. IL-6 is an antiinflammatory cytokine required for controlling local or systemic acute inflammatory responses. The Journal of clinical investigation. 1998;101:311-20.

[68] Coelho AL, Hogaboam CM, Kunkel SL. Chemokines provide the sustained inflammatory bridge between innate and acquired immunity. Cytokine & growth factor reviews. 2005;16:553-60.

[69] Frevert CW, Huang S, Danaee H, Paulauskis JD, Kobzik L. Functional characterization of the rat chemokine KC and its importance in neutrophil recruitment in a rat model of pulmonary inflammation. J Immunol. 1995;154:335- 44.

199

CHAPTER 7

Polyanhydride Nanovaccines Induce Germinal Center B Cell Formation and Sustained Serum Antibody Responses

Julia E. Vela Ramirez 1, Lorraine T. Tygrett 2, Jihua Hao 3, Habtom H. Habte 4, Michael W. Cho 4, Neil S. Greenspan 3, Thomas J. 2 1 Waldschmidt , and Balaji Narasimhan *

1Department of Chemical and Biological Engineering, Iowa State University, Ames, IA 50011

2Department of Pathology, University of Iowa, Iowa City, IA 52242

3Department of Pathology, Case Western Reserve University, Cleveland, OH 44106

4Department of Biomedical Sciences, Iowa State University, Ames, IA 50011

To be submitted to J Biomed Nanotechnol on December 15, 2014

* To whom all correspondence should be addressed 2035 Sweeney Hall, Department of Chemical and Biological Engineering, Ames, IA 50011 Phone: 515-294-8019; Fax: 515-294-2689; email: [email protected]

200

7.1. Abstract

Biodegradable polymeric nanoparticles have shown promising characteristics as adjuvants and/or delivery vehicles by enhancing antigen presentation and inducing protective immune responses compared with soluble protein. Specifically, polyanhydride nanoparticle-based vaccines (i.e., nanovaccines) have been shown to successfully encapsulate and release antigens, activate B and T cells, and induce both antibody- and cell-mediated immunity towards a variety of immunogens. One of the characteristics of strong antibody responses is the formation of germinal center B cells, which is part of the T helper cell driven cellular response. In order to further understand the role of these nanovaccines in the induction of antigen-specific immune responses, their ability to induce germinal center B cell formation and isotype switching and the effects thereof on serum antibody responses were investigated in these studies. Polyanhydride nanovaccines based on 1,6-bis-(p- carboxyphenoxy)hexane and 1,8-bis-(p-carboxyphenoxy)-3,6-dioxaoctane were used to subcutaneously administer a HIV-related antigen (gp41-54Q-GHC). The germinal center B cell formation and serum antibody responses induced by the nanovaccines were compared with that induced by vaccine formulations with non-degradable control adjuvants such as gold nanoparticles and alum. It was demonstrated that a single dose of polyanhydride nanovaccines resulted in the formation of robust B cell germinal centers and serum antibody in comparison to that induced by the control adjuvants. This was attributed to the sustained release of antigen provided by the nanovaccines. When administered in a

201 multiple dose regimen, the immune response induced by the nanovaccines was further amplified. These studies provide foundational information on the mechanism of action of polyanhydride nanovaccines.

7.2. Introduction

The design of novel adjuvant formulations to improve vaccine efficacy by inducing strong and balanced immune responses towards a variety of pathogens is one of the main goals in the development of new generation vaccines. In this regard, nanoparticle-based systems have shown desirable characteristics because they provide dual functions as adjuvants and delivery vehicles.[1-3]

Among these systems, biodegradable polymers have been shown to stimulate the immune system and induce protective immunity.[3] In particular, polyanhydride nanoparticles have demonstrated the ability to stimulate and activate antigen presenting cells (APCs), induce both cellular and robust antibody responses with a variety of antigens, and provide protective immunity with a single dose.[4, 5] Antigen transport and presentation by APCs to B cells and T cells in the draining lymph node is one of the first steps in the induction of potent immune responses.

Previous studies have shown the ability of biodegradable and non- degradable nanoparticles to induce antibody responses with multiple antigens.[6,

7] In particular, the use of polymeric nanoparticle systems for drug and vaccine delivery offers several advantages, including controlled delivery of encapsulated payload(s), and depending on their chemistry, improved biocompatibility, receptor targeting capabilities, sustained antigen/drug release kinetics,

202 adjuvanticity, and opportunities for both local and systemic delivery.[8, 9] Among these systems, polyanhydride nanoparticles have displayed many of these characteristics in both in vitro and/or in vivo settings. [4, 10-17]

Even though polyanhydride nanoparticle-based vaccines (i.e., nanovaccines) have been demonstrated to induce protective antibody-driven immune responses, their ability to induce germinal center B cells, and hence activate the T helper cell driven cellular response, has not been investigated.

Therefore, the main focus of these studies was the analysis of germinal center B cells and T follicular helper cells in the draining lymph nodes of animals immunized subcutaneously with vaccines based on three different adjuvants: gold nanoparticles, alum, and polyanhydride nanoparticles. In these studies, an

HIV-1 protein (gp41-54Q-GHC) was used as a model antigen. The results obtained showed that polyanhydride nanovaccines provided sustained antibody responses, induced germinal center B cell formation and T follicular helper cells, which led to robust serum antibody responses. In addition, it was shown that multiple immunizations improved the performance of the polyanhydride nanovaccines with respect to generating more robust immune responses.

7.3. Materials and Methods

7.3.1. Materials Chemicals needed for monomer synthesis, polymerization, and nanoparticle synthesis included anhydrous (99+%) 1-methyl-2-pyrrolidinone

203

(Aldrich, Milwaukee, WI); 1,6-dibromohexane, 4-p-hydroxybenzoic acid, N,N- dimethylacetamide, triethylene glycol and Span ® 80 (Sigma Aldrich, St. Louis,

MO); 4-p-fluorobenzonitrile (Apollo Scientific, Cheshire, UK); acetic acid, acetic anhydride, acetone, acetonitrile, dimethyl formamide (DMF), hexanes, methylene chloride, pentane, potassium carbonate, sodium hydroxide, sulfuric acid, and toluene (Fisher Scientific, Fairlawn, NJ). For NMR characterization, deuterated dimethyl sulfoxide was purchased from Cambridge Isotope Laboratories

(Andover, MA).

7.3.2. Construction of pET-gp41-54Q-GHC The plasmid encoding gp41-54Q-GHC was constructed based on pET- gp41-54Q, which encodes 54 amino acids of the C-terminal ectodomain of HIV-1 gp41 (based on M group consensus sequence, MCON6). The terminal lysine residue was mutated to glutamine.[18] A short linker (GSGSG), followed by a

6xHis tag and a cysteine residue (C), was attached right after the glutamine[18] by PCR using a forward primer 5’-CGCGGATCCGAGTGGGAGCGCGAGATC-3’ and a reverse primer 5’- ccatGAATTCttaGCAatggtgatgatggtgatgTCCCGATCCCGATCCC

TgGATGTACCACAGCCAGTT-3’. The PCR product was digested by BamHI and

EcoRI and then ligated into corresponding sites in pET-21a to yield pET-gp41-

54Q-GHC. The construct was confirmed by sequencing.

204

7.3.3. Expression and purification of gp41-54Q-GHC Protein expression and purification were performed according to the method of Penn-Nicholson et al. with a few modifications.[19] For gp41-54Q-

GHC expression, E. coli T7 Express IysY/Iq (New England Biolabs, Ipswich, MA) was transformed with pET-gp41-54Q-GHC and cultured overnight at 37 °C in superbroth containing ampicillin (50 g/mL). Cells were diluted 1:100 in fresh superbroth and cultured to 1.0 OD 600 at 37 °C. Protein expression was induced with 1 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) and continued to grow until OD 600 reached 5.0. Cells were harvested by centrifugation at 4,600 rcf

(relative centrifugal force) for 30 min in a Sorvall Legend XFR centrifuge (Thermo

Scientific, Waltham, MA). The cell pellet was washed in phosphate-buffered saline (PBS, pH 7.4) and lysed by sonication using a Branson Digital Sonifier.

The sample was sonicated until the suspension became translucent, followed by centrifugation at 15,000 rcf for 20 min in Avanti ® J-26 XPI centrifuge (Beckman

Coulter, Brea, CA). After an additional three repetitions of PBS resuspension, sonication, and centrifugation, the pellet containing inclusion bodies was solubilized in PBS containing 8 M urea and sonicated. Insoluble debris was removed by centrifugation at 15,000 rcf for 20 min, and soluble proteins were bound to Ni-NTA resin (QIAGEN) by mixing on an end to end shaker overnight at

4 °C. The mixture was loaded onto a column, and the protein was renatured through serial incubations with 20 bed volumes of PBS containing a decreasing step gradient of urea at 8 M, 6 M, 4 M, 3 M, 2 M, 1 M, and 0 M. The column was washed with PBS containing 20 mM imidazole, and the protein was eluted with

205

PBS containing 250 mM of imidazole. Purified protein was finally dialyzed in

PBS (pH 8).

7.3.4. Loading of gp41-54Q-GHC onto gold nanoparticles (GNPs)

50 nm GNPs were purchased from NANOCSTM (New York, NY).

Conjugation of gp41-54Q-GHC to the GNPs was performed according to the method of Chen et al. (2010).[20] As discussed, an extra cysteine residue (Cys) was added to the C-terminus of gp41-54Q-GHC to enhance binding of gp41-

54Q-GHC to the GNP surface. Antigen-GNP conjugation was achieved by titrating the antigens into a GNP suspension. After reaching the saturation point, the antigen-GNP complex was pelleted by centrifugation at 6000 rcf for 60 min at

4 °C, and the supernatant was removed and saved for protein analysis. The antigen-GNP pellet was then resuspended in 100 µL of PBS at pH 7.4 and used for immunization. To minimize aggregation, vaccine formulations were mixed well prior to each immunization. The amount of gp41-54Q-GHC loaded onto GNPs was calculated as the protein amount initially added minus the protein amount in the supernatant following centrifugation.

7.3.5. Monomer and polymer synthesis

Monomers of 1,6-bis( p-carboxyphenoxy) hexane (CPH) and 1,8-bis( p- carboxyphenoxy)-3,6-dioxaoctane (CPTEG) were synthesized as described previously.[11, 21] A 20:80 CPTEG:CPH copolymer was synthesized by melt polycondensation as previously described.[11] The chemical structure was

206 characterized with 1H NMR using a Varian VXR 300 MHz spectrometer (Varian

Inc., Palo Alto, CA). The synthesized 20:80 CPTEG:CPH copolymer had a Mw of

8,000 Da, and the polydispersity index (PDI) of this copolymer was 1.5, which is consistent with previous work.[4, 11]

7.3.6. Nanoparticle synthesis

Polyanhydride nanoparticles based on the 20:80 CPTEG:CPH chemistry were synthesized using anti-solvent nanoencapsulation as described previously.[22] Briefly, lyophilized gp41-54Q-GHC (2% w/w) and Span® 80 (1% v/v) and 20 mg/mL of 20:80 CPTEG:CPH polymer were dissolved in methylene chloride (at 4°C). The polymer solution was sonicat ed at 40 Hz for 30 s using a probe sonicator (Ultra Sonic Processor VC 130PB, Sonics Vibra Cell, Newtown,

CT) and rapidly poured into a pentane bath (at -40°C) at a solvent to non-solvent ratio of 1:250. Particles were collected by filtration and dried under vacuum for 30 min.

7.3.7. Nanoparticle characterization

Morphological and size characterization of the nanoparticles was performed using scanning electron microscopy (SEM, FEI Quanta 250, Kyoto,

Japan) and quasi-elastic light scattering (QELS, Zetasizer Nano, Malvern

Instruments Ltd., Worchester, UK).

207

7.3.8. Antigen release kinetics

In vitro antigen release kinetics studies were performed using a micro bicinchoninic acid (BCA) assay. Samples of protein-loaded nanoparticles were suspended in 750 µL of phosphate buffered saline (0.1 M, pH 7.4) with 0.01% w/v sodium azide and incubated at 37°C and 106 rcf. For each time point, samples were centrifuged at 10,000 rcf for 10 min, the supernatant was removed and aliquoted at 4°C, and fresh buffer was added to each sample to maintain perfect sink conditions. Aliquots were analyzed using the micro BCA assay at an absorbance of 562 nm. The experiment was carried out for 30 days, and the amount of released protein was normalized with total amount of protein encapsulated, as described previously.[10, 23] After 30 days, the remaining protein was extracted by adding 750 µL of 17 mM NaOH solution. Protein encapsulation efficiency was estimated using the micro-BCA assay.

7.3.9. Mice

Specific pathogen free female BALB/c mice were purchased from the

National Cancer Institute (Frederick, MD) and housed in barrier rooms at the

University of Iowa Animal Care Facility. All mice used in the experiments were at least eight weeks of age. Animal procedures were approved by the University of

Iowa Institutional Animal Care and Use Committee in accordance with

Association for Assessment and Accreditation of Laboratory Animal Care,

International (AAALAC International), and PHS Animal Welfare mandates.

208

7.3.10. Mouse treatments

7.3.10.1. Preparation of antigens and immunizations

Separate groups of mice were subcutaneously injected with 20:80

CPTEG:CPH gp41-loaded polyanhydride nanoparticles, aluminium salts (Alum) and gold nanoparticles. Nanoparticles were resuspended in phosphate buffer saline by probe sonication (Sonicator Model CL-18, Fisher Scientific, Pittsburgh,

PA). Mice were immunized subcutaneously in both rear footpads with 2 wt.% gp41-54Q-GHC-loaded 250 g of antigen-loaded nanoparticles in a 50 L volume (500 g total per mouse containing a total of 10 µg of antigen). Single immunization experiments involved one administration of particle/antigen formulation and serum samples and popliteal draining lymph nodes (dLNs) were collected at days 8, 12 and 18 post-immunization. Multiple immunization regimens included the administration of particle/antigen formulations at days 0, 7 and 14. Serum samples and popliteal dLNs were collected at day 21 post- immunization.

7.3.11. Flow cytometry Draining popliteal lymph nodes were harvested from immunized mice at the designated time points. To obtain single cell suspensions, dLNs were minced with frosted slides and washed with balanced salt solution. The cell suspensions were subjected to Fico/Lite-LM (Atlanta Biologicals, Norcross, GA) density centrifugation to obtain viable mononuclear cells, and resuspended in staining

209 buffer (balanced salt solution, 5% bovine calf serum, and 0.1% sodium azide). 5 x 10 5 to 1 x 10 6 cells were stained with combinations of fluorochrome-conjugated antibodies to identify various cell subsets. Non-specific binding of conjugated antibodies was inhibited by blocking cells with 10 L of rat serum (Pel Freez,

Rogers, AR) and 10 g of 2.4G2, an anti-Fc γR monoclonal antibody. Rat anti- mouse monoclonal antibodies used were anti-IgM (b7-6), anti-B220 (6B2), anti-

CD44 (9F3), anti-CD4 (PerCP/Cy5.5 conjugate, BioLegend, San Diego, CA), anti-CD150 (PE conjugate, BioLegend, San Diego, CA) and anti-CXCR5 (biotin conjugate, BD Pharmingen, San Diego, CA). Goat anti-mouse antibodies used were biotin-labeled anti-IgG1, -IgG2a, -IgG2b, and -IgG3 (all from Southern

Biotechnology Associates, Birmingham, AL). FITC-conjugated peanut agglutinin

(PNA) was purchased from Vector Laboratories (Burlingame, CA). 2.4G2, b7-6,

6B2, 9F3 were semi-purified from HB101 serum-free supernatants using 50% ammonium sulfate precipitation. b7-6 was conjugated to biotin (Sigma-Aldrich,

St. Louis, MO) and 6B2 and 9F3 were conjugated to Cy5 (Amersham Pharmacia,

Piscataway, NJ) using standard procedures. Purified rat IgG (Jackson

Immunoresearch Laboratories, West Grove, PA) was conjugated and used for isotype controls. Primary monoclonal antibodies or PNA were added to cells and incubated for 20 minutes on ice. For anti-CXCR5 staining, the primary incubation was 30 minutes at room temperature. After washing cells twice in staining buffer,

PE-conjugated streptavidin (Southern Biotechnology Associates) was used to detect most biotinylated Abs. PE-Cy7-conjugated streptavidin (eBioscience, San

Diego, CA) was used to detect biotin-conjugated anti-CXCR5 monoclonal

210 antibody. Cells were incubated on ice for 20 minutes and resuspended in fixative

(1% formaldehyde in 1.25X PBS) after washing twice with staining buffer.

Stained cells were run on a FACSCanto II (Becton Dickinson, San Jose, CA). All data were analyzed using FlowJo software (Tree Star, Ashland, OR).

7.3.12. gp41-54Q-specific Enzyme-Linked Immunosorbent Assay (ELISA) Purified gp41 protein or overlapping peptides (0.5 or 20 pmoles per well, respectively) were coated onto 96-well Nunc-Immuno Plates (Nunc; Cat #

439454) using antigen coating buffer (150 mM Na 2CO 3, 350 mM NaHCO 3, 30 mM NaN 3, pH 9.6) at 4°C overnight. Plates were coated with gp41 antigens at 33 ng/well. Wells were blocked with PBS (pH 7.5) containing 2.5% skim milk and

25% FBS at 37°C for 1 h, then washed four times wit h 0.1% Tween 20 in PBS.

NP-40 was added to plasma samples (0.1% final) before dilution in blocking buffer. Antibodies and plasma samples were diluted as indicated, added to wells and incubated for 2 h at 37°C in 200 L blocking buffer. Wells were washed 4 times, and secondary antibody goat anti-human IgG conjugated to horseradish peroxidase (Pierce; Cat # 31410) was incubated at 1:3,000 dilution at 37°C for one hour. Wells were washed four times, and developed by adding 100 L of

TMB HRP-substrate (Bio-Rad) for 5–10 min. Reactions were stopped with 50 L of 2 N H 2SO 4. Plates were read on a microplate reader (Versamax by Molecular

Devices) at 450 nm. Experiments were performed in duplicate.

211

7.4. Results

7.4.1. Synthesis and characterization of gp41-loaded polyanhydride nanoparticles Previous work has shown that amphiphilic nanoparticle chemistries exhibited desirable characteristics in terms of protein stabilization, robust antibody responses, activation of APCs, and induction of CD8 + T cell responses.[4, 10, 12, 16, 24, 25] Specifically, it was demonstrated that a 20:80

CPTEG:CPH nanoparticle formulation provided sustained release of stable gp41-

54Q-GHC, as evidenced by the ability to be recognized by several HIV-1 monoclonal antibodies.[26] Based on these studies, the 20:80 CPTEG:CPH nanoparticle formulation was selected to carry out the studies described herein.

Particle morphology was characterized using scanning electron microscopy, and the size of these particles was measured using ImageJ software (version 1.47v,

NIH, Bethesda, MD). The diameter of the 20:80 CPTEG:CPH nanoparticles was

192 ± 79 nm, which is consistent with previous studies.[13, 16, 22, 27, 28] The encapsulation efficiency of the antigen was ~70%, and as shown in Figure 7.1, the 20:80 CPTEG:CPH gp41-54Q-GHC-loaded nanoparticles displayed sustained release kinetics over 30 days releasing ~95% of the encapsulated antigen, with an initial burst of ~20% of encapsulated gp41-54Q-GHC.

212

Figure 7.1. gp41-54Q-GHC antigen release kinetics from polyanhydride nanoparticles. Cumulative fraction of gp41-54Q-GHC released from (●) 20:80 CPTEG:CPH nanoparticles. Error bars represent standard error of the mean; results are representative of two independent experiments with duplicate samples used in each experiment. Inset shows scanning electron photomicrograph of the antigen-loaded particles. Scale bar: 0.2 µm.

7.4.2. Single immunization of gold nanoparticles, alum and polyanhydride nanoparticles elicited measurable anti-gp41 antibody

Following a single subcutaneous administration in the footpad of 10 g of gp41-antigen to mice using the three aforementioned vaccine formulations, serum and dLNs were collected at 8, 12 and 18 days. As shown in Figure 7.2, serum antibody levels in animals treated with the GNP formulation peaked at day

12 post-immunization, reaching a maximum titer of 0.25 x 10 4. Initial antibody titers reached 1 x 10 3 however, they decreased by 18 days, waning down to background levels. These results indicate that even though the GNP formulation was able to induce an immune response towards the gp41 antigen, the response

213 induced was not robust or sustained. Therefore, we analyzed the quality of the immunity that was induced by this methodology by measuring the amounts of germinal center B cells and T follicular helper cells in the popliteal lymph nodes.

Figure 7.2. Serum antibody response induced by single immunization with GNPs. BALB/c mice were injected s.c. with GNPs. Serum samples were collected at days 8, 12 and 18 post-challenge and antibody titers were measured via ELISA. Plates were scanned at 490 nm.

The results shown in Figure 7.3 demonstrate that the amounts of germinal center B cells followed a bell shaped curve, with 5 x 10 4 cells present initially in the dLN, followed by a peak at day 12 (consistent with the antibody secretion data) with 8 x 10 4 cells and returning to 5 x 10 4 cells by day 18. Similar trends were found in the numbers of T follicular helper cells, but these numbers ranged from 0.5 x 10 4 to 1.5 x 10 4 cells over the course of the study.

214

Figure 7.3. B cell and T cell responses induced by single immunization with GNPs. BALB/c mice were injected s.c. with 500 µg total of antigen loaded nanoparticles. dLNs were harvested at days 8, 12 and 18 post-challenge and cell suspensions stained with either PNA and anti-B220 mAb, or with anti-CD4, anti- CD44, anti-CXCR5 and anti-CD150 mAbs. Stained cells were analyzed by flow cytometry. GC B cell bar graphs represent the total number of B220 +PNA hi GC B cells per LN from mice at each time point. T FH bar graphs represent the total + hi + lo number of CD4 CD44 CXCR5 CD150 TFH cells per LN at each time point. Each bar represents mean ± SEM. n = 4-6 mice at each time point.

Next, analysis of the immune responses elicited by a single administration of the gp41-antigen precipitated in alum were performed. As shown in Figure 7.4, similar serum antibody levels were obtained with this vaccine formulation as with the GNP formulation. However, the highest titer (1 x 10 3) was detected at day 8 post-immunization, which was maintained through day 12, but not sustained beyond as evidenced by a decrease in the titer 18 days post-administration.

215

Figure 7.4. Serum antibody response induced by single immunization with Alum formulation. BALB/c mice were injected s.c. with gp41-protein precipitated in alum. Serum samples were collected at days 8, 12 and 18 post-challenge and antibody titers were measured via ELISA. Plates were scanned at 490 nm.

Consistent with these results, the numbers of germinal center B cells and

TFH cells in the dLNs of animals vaccinated with the alum formulation were similar to that elicited by the GNP formulation (Figure 7.5). Both the germinal center B

4 4 cells and the T FH cells peaked at day 12, with 8 x 10 cells and 1.5 x 10 cells, respectively, and waned by day 18.

Figure 7.5. B cell and T cell responses induced by single immunization with Alum. BALB/c mice were injected s.c. with 10 µg of gp41-54Q-GHC precipitated in Alum. dLNs were harvested at days 8, 12 and 18 post-challenge and cell suspensions stained with either PNA and anti-B220 mAb, or with anti-CD4, anti- CD44, anti-CXCR5 and anti-CD150 mAbs. Stained cells were analyzed by flow cytometry. GC B cell bar graphs represent the total number of B220 +PNA hi GC B

216

cells per LN from mice at each time point. T FH bar graphs represent the total + hi + lo number of CD4 CD44 CXCR5 CD150 TFH cells per LN at each time point. Each bar represents mean ± SEM. n = 4-6 mice at each time point.

Finally, similar experiments were carried out using the gp41-54Q-GHC- loaded 20:80 CPTEG:CPH polyanhydride nanovaccine formulation . As shown in Figure 7.6, the serum antibody levels obtained with this vaccine formulation were more robust, reaching 2 x 10 4 within eight days post-vaccination, which was maintained through 18 days post-immunization (which was the duration of

the study).

Figure 7.6. Serum antibody response induced by single immunization with 20:80 CPTEG:CPH nanovaccine. BALB/c mice were injected s.c. with polyanhydride nanovaccines. Serum samples were collected at days 8, 12 and 18 post- challenge and antibody titers were measured via ELISA. Plates were scanned at 490 nm.

To be able to directly compare the responses induced by the three different vaccine formulations used, a quantification of the numbers of germinal center B cells and T FH cells in the dLNs was performed. The numbers of these cells were similar to the numbers observed in the dLNs of animals treated with

GNPs or alum, as shown in Figure 7.7. However, the sustained release provided

217 by the polyanhydride nanoparticle formulations enabled the maintenance of the antibody titers and activated the T helper cellular responses more effectively.

Figure 7.7. B cell and T cell responses induced by single immunizations with gp41-loaded polyanhydride nanovaccine BALB/c mice were injected s.c. with 500 µg total of 2%-antigen loaded nanoparticles. dLNs were harvested at days 8, 12 and 18 post-challenge and cell suspensions stained with either PNA and anti- B220 mAb, or with anti-CD4, anti-CD44, anti-CXCR5 and anti-CD150 mAbs. Stained cells were analyzed by flow cytometry. GC B cell bar graphs represent the total number of B220 +PNA hi GC B cells per LN from mice at each time point. + hi + lo TFH bar graphs represent the total number of CD4 CD44 CXCR5 CD150 TFH cells per LN at each time point. Each bar represents mean ± SEM. n = 4-6 mice at each time point.

7.4.3. Multiple immunization regimen using polyanhydride nanoparticles elicited robust anti-gp41 antibody responses

In order to investigate if multiple immunizations with the polyanhydride nanovaccines induced even more robust immune responses, animals were immunized three times with gp41 antigen-loaded 20:80 CPTEG:CPH nanoparticles at 0, 7 and 14 days. As expected, the multiple immunizations resulted in the induction of a robust antibody response, with the titers reaching 2 x 10 5 by 21 days post the first dose as shown in Figure 7.8. In addition, 6 x 10 4

218 germinal center B cells were detected in the dLN 21 days post-immunization, which is higher than the number of cells detected at day 18 with a single immunization. However, similar numbers (0.2 x 10 4) of follicular T helper cells were detected in the dLN at day 21 when compared to the number of T FH cells at day 18 in the single immunization experiments.

Figure 7.8. Antibody and B cell and T cell responses induced by multiple immunizations with gp41-loaded polyanhydride nanovaccine. BALB/c mice were injected s.c. with 500 µg total of 2%-antigen loaded nanoparticles. dLNs were harvested at day 21 post-immunization and cell suspensions stained with either PNA and anti-B220 mAb, or with anti-CD4, anti-CD44, anti-CXCR5 and anti- CD150 mAbs. Stained cells were analyzed by flow cytometry. GC B cell bar graphs represent the total number of B220 +PNA hi GC B cells per LN from mice at each time point. T FH bar graphs represent the total number of + hi + lo CD4 CD44 CXCR5 CD150 TFH cells per LN at each time point. Each bar represents mean ± SEM. n = 4-6 mice at each time point.

Finally, isotype switching analysis was carried out in these serum samples. Figure 7.9 shows that the polyanhydride nanovaccines induced balanced immune responses after a multiple immunization regimen. The immunoglobulin [18] phenotypes switched from an IgG1-dominated response to a more balanced response that included IgG2a/b and IgG3. A balanced immune

219 response suggests the induction of both humoral and cell-mediated immunity, which is important to counter viral pathogens.

Figure 7.9. Isotype distribution of GC B cells after multiple immunizations with polyanhydride nanovaccine. BALB/c mice were injected s.c. with 500 µg of antigen loaded polyanhydride nanoparticles on days 0, 7 and 14. dLNs were harvested 7 days after the last challenge (day 21). Cell suspensions were stained with PNA, anti-B220 mAb and either goat anti-IgG1, IgG2a+IgG2b (BALB/c), IgG2b+IgG2c (C57BL/6), or IgG3 specific Abs. Stained cells were analyzed by flow cytometry. A) Representative plots showing the gating strategy used to define IgM +, IgG1 +, IgG2a +/IgG2b +, and IgG3 + B cells within the B220 hi PNA hi GC B cell compartment. IgM +, IgG1 +, IgG2 + and IgG3 + B cells as a percent of total GC B cells. Each bar represents mean ± SEM. n = 4 mice at each time point.

7.5. Discussion

In this work we report on the ability of polyanhydride nanovaccines to induce germinal center B cells and T follicular helper cells, using a viral antigen following subcutaneous administration to mice.[29] A variety of adjuvants have shown to elicit potent immune responses towards a variety of antigens.[30] In order to rationally design formulations that can elicit robust and balanced immune responses, it is necessary to understand the mechanisms by which these

220 materials induce immune responses. In this regard, the ability to induce germinal center B cells and serum antibody responses provides foundational information about the adjuvanticity provided by the nanovaccines and this work describes a systematic study of the adjuvant properties of three different vaccine delivery platforms using a viral antigen.

It is known that B cell responses that include germinal center formation and generation of long-lived plasma cells and memory T cell responses are dependent on the involvement of CD4 + T cells.[31, 32] In order to help B cell development, a specialized group of T cells, known as T follicular helper cells, participate directly in the presentation of antigen to B cells.[29] The generation of long-lived plasma cells is a highly desirable outcome upon vaccination.[32] The induction of long-lived plasma cells has the ability to induce central memory, which is important upon re-introduction of the pathogen to the immune system.

The work presented herein showed that single immunization with GNPs and alum was only able to elicit poor and short-lived antibody responses towards the gp41 antigen as shown in Figure 7.2 and Figure 7.4, respectively. These observations suggest that the generated plasma cells were short lived. In contrast, immunizing with the polyanhydride nanovaccines induced moderate antibody responses, which were sustained for up to 18 days post-immunization as shown in Figure 7.6. In addition, all three vaccine formulations induced the formation of germinal center B cells and T FH cells, with the responses peaking at

12 days post-immunization, consistent with their antibody responses.

221

The relationship between GC formation and robust immune responses is strongly influenced by constant exposure to antigen.[29] It has been shown previously that T FH and germinal B cells require sustained presence of antigen in order to elicit memory T cell and B cell responses. Each of the vaccine formulations used in these experiments have different modes of making the antigen available to the immune system. Alum is physically mixed with the gp41 antigen, the antigen is chemically attached to the surface of the GNPs, and the polyanhydride nanovaccines contain encapsulated antigen, which is slowly released upon degradation of the nanoparticles (as shown in Figure 7.1).[12, 20,

33, 34] The data obtained in our experiments indicates that the sustained antigen release enabled by the polyanhydride nanoparticles may be critical for the induction of robust immune responses. This observation is consistent with other studies from our laboratories that also demonstrate the important of sustained antigen release kinetics in the maintenance of long-lived antibody with high avidity.[4, 24, 35]

The induction of T FH cells in the lymph nodes is hypothesized to be a consequence of the participation of APCs, specifically dendritic cells (DCs), in carrying antigen to T cell zones and B-T cell zone borders in the lymph nodes.[31, 36] In previous studies, polyanhydride nanoparticles have demonstrated the ability to activate APCs [13, 25] and induce phenotypes that migrate to the lymph nodes. Based on the induction of T FH cells by all the vaccine formulations studied herein (as shown in Figures 7.3, 7.5 and 7.7), it can be hypothesized that all of these formulations are activating DCs. Future

222 improvements in the activation of DCs by nanoparticles could be achieved by the use of targeting mechanisms as suggested in several studies.[13, 37, 38]

Follicular helper T cells that are CXCR5 + are known to play an important role in the induction of isotype switching and somatic hypermutation of B cells in germinal centers.[31, 39] TFH cells promote GC responses by providing developmental and survival signals, as well as soluble factors important for B cells, which eventually become memory B cells and long-lived antibody secreting plasma cells.[31] An important consideration in the development of vaccines is the quality of the antibody response elicited by the formulation, which is characterized by the isotype profile and the avidity of the antibody.[40] Therefore, the presence of isotype-switching evidence on the antigen-specific B cells

(Figure 7.9) induced by immunization with polyanhydride nanovaccines is a desirable characteristic in the design of novel nanovaccines. These types of balanced immune responses, especially when induced with mild inflammatory responses[33], are important to neutralize viral pathogens that attack tissues such as the lungs where it is important to not induce inflammation.

In previous work, a single intranasal administration of polyanhydride nanovaccines demonstrated the ability to induce high titer antibody and confer protective immunity upon lethal challenge with bacterial pathogens.[4, 17, 41]

The current work builds upon these studies by evaluating the mechanisms by which these novel biodegradable nanovaccine formulations induce strong antibody responses. Overall, the successful induction of long-lived antibody against viral pathogens, the expansion of T follicular helper cells and the

223 formation of germinal center B cells are important components of mounting robust and balanced immune responses towards antigens. The polyanhydride nanovaccine platform has been demonstrated to exhibit all of these components, making it a promising vehicle for vaccine development.

7.6. Conclusions

The studies reported herein demonstrate the ability of polyanhydride nanovaccines to induce long-lived antibody against viral pathogens, expand T follicular helper cells and form B cells in germinal centers, especially in comparison to GNP- and alum-based vaccines. Low antibody titers were obtained from subcutaneous immunization of mice from GNP- and alum-based vaccine formulations. Finally, balanced immune responses were induced by the polyanhydride nanovaccines by initiation of isotype switching. Together, these studies demonstrate the ability of the polyanhydride nanovaccine platform to elicit robust antibody-mediated immune responses in vivo and provide foundational information to evaluate the capabilities of this novel platform for vaccine delivery.

7.7. Acknowledgments

The authors would like to acknowledge financial support from NIH-NIAID

(U19 AI-091031).

224

7.8. References

[1] Kumari A, Yadav SK, Yadav SC. Biodegradable polymeric nanoparticles based drug delivery systems. Colloids and surfaces B, Biointerfaces. 2010;75:1- 18.

[2] De Jong WH, Borm PJ. Drug delivery and nanoparticles:applications and hazards. International journal of nanomedicine. 2008;3:133-49.

[3] Sahdev P, Sahdev L, Ochyl J. Biomaterials for Nanoparticle Vaccine Delivery Systems. Pharmaceutical research. 2014;31:2563-82.

[4] Ulery BD, Kumar D, Ramer-Tait AE, Metzger DW, Wannemuehler MJ, Narasimhan B. Design of a protective single-dose intranasal nanoparticle-based vaccine platform for respiratory infectious diseases. PLoS One. 2011;6:e17642.

[5] Huntimer L, Wilson Welder JH, Ross K, Carrillo-Conde B, Pruisner L, Wang C, Narasimhan B, et al. Single immunization with a suboptimal antigen dose encapsulated into polyanhydride microparticles promotes high titer and avid antibody responses. Journal of biomedical materials research Part B, Applied biomaterials. 2013;101:91-8.

[6] Gregory AE, Titball R, Williamson D. Vaccine delivery using nanoparticles. Frontiers in Cellular and Infection Microbiology. 2013;3:13.

[7] Zhao L, Seth A, Wibowo N, Zhao C-X, Mitter N, Yu C, Middelberg APJ. Nanoparticle vaccines. Vaccine. 2014;32:327-37.

[8] Mansour HM, Rhee YS, Wu X. Nanomedicine in pulmonary delivery. International journal of nanomedicine. 2009;4:299-319.

[9] Nguyen J, Steele TW, Merkel O, Reul R, Kissel T. Fast degrading polyesters as siRNA nano-carriers for pulmonary gene therapy. Journal of controlled release : official journal of the Controlled Release Society. 2008;132:243-51.

[10] Torres MP, Determan AS, Anderson GL, Mallapragada SK, Narasimhan B. Amphiphilic polyanhydrides for protein stabilization and release. Biomaterials. 2007;28:108-16.

[11] Torres MP, Vogel BM, Narasimhan B, Mallapragada SK. Synthesis and characterization of novel polyanhydrides with tailored erosion mechanisms. J Biomed Mater Res A. 2006;76:102-10.

[12] Carrillo-Conde B, Schiltz E, Yu J, Chris Minion F, Phillips GJ, Wannemuehler MJ, Narasimhan B. Encapsulation into amphiphilic polyanhydride microparticles stabilizes Yersinia pestis antigens. Acta biomaterialia. 2010;6:3110-9.

225

[13] Carrillo-Conde B, Song EH, Chavez-Santoscoy A, Phanse Y, Ramer-Tait AE, Pohl NL, Wannemuehler MJ, et al. Mannose-functionalized "pathogen-like" polyanhydride nanoparticles target C-type lectin receptors on dendritic cells. Molecular pharmaceutics. 2011;8:1877-86.

[14] Chavez-Santoscoy AV, Roychoudhury R, Pohl NL, Wannemuehler MJ, Narasimhan B, Ramer-Tait AE. Tailoring the immune response by targeting C- type lectin receptors on alveolar macrophages using "pathogen-like" amphiphilic polyanhydride nanoparticles. Biomaterials. 2012;33:4762-72.

[15] Vela Ramirez JE, Roychoudhury R, Habte HH, Cho MW, Pohl NL, Narasimhan B. Carbohydrate-functionalized nanovaccines preserve HIV-1 antigen stability and activate antigen presenting cells. Journal of biomaterials science Polymer edition. 2014:1-20.

[16] Huntimer LM, Ross KA, Darling RJ, Winterwood NE, Boggiatto P, Narasimhan B, Ramer-Tait AE, et al. Polyanhydride nanovaccine platform enhances antigen-specific cytotoxic T cell responses. TECHNOLOGY. 2014;02:171-5.

[17] Ross KA, Haughney SL, Petersen LK, Boggiatto P, Wannemuehler MJ, Narasimhan B. Lung Deposition and Cellular Uptake Behavior of Pathogen- Mimicking Nanovaccines in the First 48 Hours. Advanced healthcare materials. 2014.

[18] Bomsel M, Tudor D, Drillet AS, Alfsen A, Ganor Y, Roger MG, Mouz N, et al. Immunization with HIV-1 gp41 subunit virosomes induces mucosal antibodies protecting nonhuman primates against vaginal SHIV challenges. Immunity. 2011;34:269-80.

[19] Penn Nicholson A, Penn Nicholson D, Han S, Kim H, Park R, Ansari D, Montefiori M. Assessment of antibody responses against gp41 in HIV-1-infected patients using soluble gp41 fusion proteins and peptides derived from M group consensus envelope. Virology. 2008;372:442-56.

[20] Chen Y-C, Hung W-H, Lin G. Assessment of gold nanoparticles as a size- dependent vaccine carrier for enhancing the antibody response against synthetic foot-and-mouth disease virus peptide. Nanotechnology. 2010;21:195101.

[21] Conix A. Poly[1,3-bis(p-carxoyphenoxy)-propane anhydride]. Macro Synth. 1966;2:95-8.

[22] Ulery BD, Phanse Y, Sinha A, Wannemuehler MJ, Narasimhan B, Bellaire BH. Polymer chemistry influences monocytic uptake of polyanhydride nanospheres. Pharmaceutical research. 2009;26:683-90.

[23] Lopac SK, Torres MP, Wilson-Welder JH, Wannemuehler MJ, Narasimhan B. Effect of polymer chemistry and fabrication method on protein release and

226 stability from polyanhydride microspheres. Journal of biomedical materials research Part B, Applied biomaterials. 2009;91:938-47.

[24] Haughney SL, Ross KA, Boggiatto PM, Wannemuehler MJ, Narasimhan B. Effect of nanovaccine chemistry on humoral immune response kinetics and maturation. Nanoscale. 2014;6:13770-8.

[25] Torres MP, Wilson-Welder JH, Lopac SK, Phanse Y, Carrillo-Conde B, Ramer-Tait AE, Bellaire BH, et al. Polyanhydride microparticles enhance dendritic cell antigen presentation and activation. Acta biomaterialia. 2011;7:2857-64.

[26] Vela Ramirez JE, Roychoudhury R, Habte HH, Cho MW, Pohl NL, Narasimhan B. Carbohydrate-functionalized nanovaccines preserve HIV-1 antigen stability and activate antigen presenting cells. Journal of biomaterials science Polymer edition. 2014;25:1387-406.

[27] Petersen LK, Phanse Y, Ramer-Tait AE, Wannemuehler MJ, Narasimhan B. Amphiphilic polyanhydride nanoparticles stabilize Bacillus anthracis protective antigen. Molecular pharmaceutics. 2012;9:874-82.

[28] Haughney SL, Petersen LK, Schoofs AD, Ramer-Tait AE, King JD, Briles DE, Wannemuehler MJ, et al. Retention of structure, antigenicity, and biological function of pneumococcal surface protein A (PspA) released from polyanhydride nanoparticles. Acta biomaterialia. 2013;9:8262-71.

[29] Deenick EK, Chan A, Ma CS, Gatto D, Schwartzberg PL, Brink R, Tangye SG. Follicular helper T cell differentiation requires continuous antigen presentation that is independent of unique B cell signaling. Immunity. 2010;33:241-53.

[30] Vogel FR. Improving vaccine performance with adjuvants. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America. 2000;30 Suppl 3:S266-70.

[31] Kim Y. Regulation of Germinal Center Reactions by B and T Cells. Antibodies. 2013;2:554.

[32] Bortnick A, Allman D. What is and what should always have been: long-lived plasma cells induced by T cell-independent antigens. Journal of immunology. 2013;190:5913-8.

[33] Hutchison S, Benson RA, Gibson VB, Pollock AH, Garside P, Brewer JM. Antigen depot is not required for alum adjuvanticity. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 2012;26:1272-9.

227

[34] Kipper MJ, Shen E, Determan A, Narasimhan B. Design of an injectable system based on bioerodible polyanhydride microspheres for sustained drug delivery. Biomaterials. 2002;23:4405-12.

[35] Kipper MJ, Wilson JH, Wannemuehler MJ, Narasimhan B. Single dose vaccine based on biodegradable polyanhydride microspheres can modulate immune response mechanism. Journal of biomedical materials research Part A. 2006;76:798-810.

[36] Kratky W, Reis e Sousa C, Oxenius A, Sporri R. Direct activation of antigen- presenting cells is required for CD8+ T-cell priming and tumor vaccination. Proceedings of the National Academy of Sciences of the United States of America. 2011;108:17414-9.

[37] Phanse Y, Carrillo-Conde BR, Ramer-Tait AE, Roychoudhury R, Pohl NL, Narasimhan B, Wannemuehler MJ, et al. Functionalization of polyanhydride microparticles with di-mannose influences uptake by and intracellular fate within dendritic cells. Acta biomaterialia. 2013;9:8902-9.

[38] Goodman JT, Vela Ramirez JE, Boggiatto PM, Roychoudhury R, Pohl NLB, Wannemuehler MJ, Narasimhan B. Nanoparticle Chemistry and Functionalization Differentially Regulates Dendritic Cell–Nanoparticle Interactions and Triggers Dendritic Cell Maturation. Particle & Particle Systems Characterization. 2014:n/a- n/a.

[39] Cucak H, Yrlid U, Reizis B, Kalinke U, Johansson-Lindbom B. Type I interferon signaling in dendritic cells stimulates the development of lymph-node- resident T follicular helper cells. Immunity. 2009;31:491-501.

[40] Wilson-Welder JH, Torres MP, Kipper MJ, Mallapragada SK, Wannemuehler MJ, Narasimhan B. Vaccine adjuvants: current challenges and future approaches. Journal of pharmaceutical sciences. 2009;98:1278-316.

[41] Ulery BD, Petersen LK, Phanse Y, Kong CS, Broderick SR, Kumar D, Ramer-Tait AE, et al. Rational design of pathogen-mimicking amphiphilic materials as nanoadjuvants. Scientific reports. 2011;1:198.

228

CHAPTER 8

Ongoing and Future Work

8.1. Conclusions

The research described in this thesis describes the promising properties of polyanhydride nanoparticles as targeted nanovaccines. The ability to modify the properties of polymeric nanomaterials by functionalizing their surface with a variety of immune-activating moieties offers a variety of options that can help direct and enhance the immune response induced by these materials. In these studies, nanoparticle interactions with immune cells using in vitro and in vivo models were analyzed in order to understand the different roles of antigen presenting cells (i.e. dendritic cells, macrophages), serum proteins, T cells and B cells in the induction of antigen-specific immune responses induced by polyanhydride nanovaccines.

The work described in Chapters 4 and 6 showed that carbohydrate- functionalized polyanhydride nanoparticles possess favorable properties with respect to their use as vaccine delivery vehicles. The work in Chapter 4 was in vitro and that in Chapter 6 analyzed the safety and biocompatibility of carbohydrate-functionalized nanocarriers, respectively. Therefore, the next step is to perform efficacy experiments to obtain better insights regarding their potential use as adjuvant platforms for vaccines. The work presented in Chapter

229

5 provided valuable insights on one of the important internalization pathways in the uptake of polyanhydride nanoparticle platforms. In order to fully understand the mechanisms by which these nanoparticles are internalized by antigen presenting cells, it is necessary to explore and analyze other signaling pathways that are engaged and involved in the uptake of these nanoparticles and that trigger immune responses. In Chapter 7, the capabilities of these polyanhydride nanoparticles in the induction of antigen-specific immune responses and on the formation of germinal B cell cells and T follicular helper cells were investigated.

Overall, the studies described in this thesis have laid the foundation for future in- depth analysis of the efficacy of these targeted nanomaterials for drug and vaccine delivery. Future research directions based on this work are briefly described next.

8.2. Evaluation of nanoparticles functionalized with higher order mannoses

It is known that the DC-SIGN receptor plays a vital role in the entrance of the HIV virion into the cell, and previous studies with HIV immunogens have shown that this receptor influences the induction of immune responses against

HIV immunogens.[1, 2] It is also known that the DC-SIGN receptor, which is a

CLR, specifically recognizes higher order mannose structures.[3-5] Therefore, in order to obtain further insights into the active targeting of DC-SIGN by functionalized nanoparticles, our ongoing collaboration with Dr. Nicola Pohl at

Indiana University can be expanded to include the synthesis of high mannose

230 structures by the Pohl laboratory. These structures can be used to functionalize

50:50 CPTEG:CPH nanoparticles using the methods described in Chapter 4.

Our proposed studies will help characterize the role of this receptor in two different types of APCs: DCs and macrophages. For each cell type, it is known that DC-SIGN receptor activation generates different types of immune responses.[3, 6] For DCs, DC-SIGN is fundamental in the triggering of T cell responses via CD4 + T cells.[4, 7, 8] In this regard, the use of a DC-SIGN knockout mouse model will help delineate the specific role of this integrin in particle internalization and APC activation. On the other hand, for macrophages, highly structured carbohydrates have been reported to be very important for phagocytosis using DC-SIGN.[6, 9] Therefore, in addition to activation and internalization studies with these cells, analysis of the effect of DC-SIGN on the phagocytic activity of the cells will help characterize the mechanistic role of carbohydrate-functionalized polyanhydride nanoparticles in terms of activating

APCs and influencing the downstream immune response.

8.3. Optimization of targeted polyanhydride nanovaccines

In order to optimize the immune response that can be induced by polyanhydride nanovaccines, this thesis explored targeting mechanisms (Chapter

4) and surface functionalization of these nanomaterials with carbohydrate moieties. In addition, optimization of dose and route of immunization are necessary to elicit strong and balanced immune responses. While subcutaneous

231 administration (via the footpad) successfully demonstrated the induction and quantification of B cells and T follicular helper cells in germinal centers as described in Chapter 7, an in-depth investigation of the responses induced using different delivery routes, such as intranasal and subcutaneous (nape of the neck) immunizations, needs to be carried out. The intranasal route offers advantages since it can engage the mucosal system and simultaneously provide systemic immunity.[10] In addition, for viral diseases such as HIV or influenza, the capability to provide protection at the infection site offers an attractive alternative to traditional adjuvants. [11, 12] Subcutaneous administration in the nape of the neck has shown to provide an adequate environment for systemic distribution of polyanhydride nanoparticles as shown previously.[13] The dissemination of these nanomaterials helps in the induction of systemic immune responses compared to other alternatives (i.e., microparticles, alum) where the adjuvant effects are dependent upon the creation of a depot.[13] Finally, it is necessary to rationally identify the optimal combination of dose, route, and functionalization of polyanhydride nanovaccines in order to induce robust antigen-specific immune responses.

8.4. Analysis of uptake mechanisms of polyanhydride nanoparticles

To understand the mechanisms by which polyanhydride nanovaccines are internalized and identify the pathways involved in the activation of APCs to trigger the signaling cascade that elicits immune responses, exploration of

232 signaling pathways that involve Syk and MyD88, which are critical in particle internalization and B cell and T cell activation need to be carried out.[14-16]

The presence of multiple families of receptors on the surface or in the cytoplasm of APCs, combined with innate immunity components (such as complement) offers a myriad of signaling pathways that may be involved in particle uptake and activation of the immune system.[14, 17] Thus, a combination of the work presented in Chapter 4 regarding the capability of carbohydrates in engaging CLRs and the data presented in Chapter 5 where the involvement of the complement receptor in the activation of immune cells was explored may offer new insights upon the complexity of the cellular activation systems.

Concomitantly, the role of CLRs, Toll-like receptors, Fc receptors, and complement receptors and their synergistic effects must be explored in more detail in order to determine the specific mechanisms by which these nanovaccines effectively engage the immune system.

In this regard, experiments on the role of the Fc γ chain receptor in particle uptake and macrophage activation are ongoing. In these studies, bone marrow cells from wild type and Fc γ -/- mice on the C57BL/6 background were harvested and cultured towards a macrophage phenotype (F4/80 +). In addition to analysis of the role of this receptor, the effects on particle internalization and activation by the adsorption of serum proteins (such as immunoglobulins, complement component 3) onto the surface of these nanocarriers is also being investigated.

By comparing the responses induced by serum-coated and non-serum coated

233 nanoparticles, the role of Fc receptors in particle internalization and APC activation can be determined.

Furthermore, future studies with MyD88 -/- and Syk -/- mice need to be performed since these two major enzymes are involved in the signaling pathways from CLRs and TLRs to determine the relevance of these receptors. These studies need to be performed with both non-functionalized and carbohydrate- functionalized polyanhydrides to fully understand the mechanisms by which these particles induce antigen-specific immune responses. Such studies will provide mechanistic information that will lead to rational design of vaccine adjuvants based on these biomaterials.

8.5. Functionalization of nanoparticles with small molecules or peptides

In order to take full advantage of the properties and capabilities of the polyanhydride nanocarriers, exploration of other surface modifications to enhance drug delivery to APCs are being performed. In the work presented in this thesis, the main focus of the surface modification of polyanhydride nanoparticles was to target CLRs with carbohydrate moieties. For other applications (e.g., drug delivery to specific cells, organs, or organelles) it may be more relevant to target these particles using other molecules (such as peptides) to maximize their efficacy.

Experiments on surface functionalization of polyanhydride nanoparticles with folic acid molecules to target the folate receptor in macrophages are ongoing

234 in order to deliver antioxidants across the blood brain barrier (BBB). [18, 19]

These studies are focused on the design of a polyanhydride nanoparticle-based delivery system for treatment of traumatic brain injury.

In this work, a similar approach to the one described in Chapter 4 is being followed for the attachment of folic acid molecules onto the surface of the polyanhydride nanoparticles. Using an amine-carboxylic acid coupling reaction, an ethylenediamine linker was conjugated to the carboxylic acids present on the surface of the polyanhydride nanoparticles and then folic acid was used to cap the amine linker.[20] In vitro experiments using macrophages and neuronal cells have been performed in collaboration with the Gendelman and Kanmogne groups at the University of Nebraska Medical Center and with the Kanthasamy group at Iowa State University.

These experiments showed enhanced uptake of polyanhydride nanoparticles when they were modified with folic acid compared to that of the non-functionalized nanoparticles. In addition, the amount of drug delivered (an oxidase assembly inhibitor called Mito-APO) using these nanomaterials was enhanced compared to soluble formulations.[21] Finally, the efficacy of these

Mito-APO-loaded folate-modified nanoparticles was evaluated in neuronal cell models, showing promising results in terms of protection of these cells from insult. Related experiments on folate-modified nanoparticles are being carried out to enhance their uptake by macrophages, and using these cells as a carrier model for drug delivery across the blood brain barrier (BBB).[19] Future experiments can include the use of this methodology in in vivo models and

235 observe if the in vitro results on the delivery system based on functionalized polyanhydride nanoparticles can translate to delivery across the BBB under in vivo conditions.

8.6. Polyanhydride functionalization with carbohydrate moieties

The use of carbohydrates as targeting moieties has been shown to be a promising approach as described in the work in this thesis (Chapters 4 and 6).

However, the approach used in these studies was to functionalize only the surface of the polyanhydride nanoparticles. This was accomplished by carrying out the functionalization reaction after particle formation. In order to increase the density of the sugar in each particle and to be able to modify the properties of the copolymers used, ongoing experiments are exploring the functionalization of the polymer prior to particle synthesis. This way, the carbohydrate moieties will be present not only on the surface, but also within the bulk of the nanoparticles.

Due to the concentration-dependent solubility of sugars (such as lactose) and carboxylic acid molecules (i.e., glycolic acid) in tetrahydrofuran and its compatibility with pentane, ongoing experiments are exploring the ability of this solent/non-solvent system to successfully synthesize carbohydrate-functionalized polyanhydride nanoparticles.[22] NMR, scanning electron microscopy, and energy-dispersive X-ray spectroscopy have been used to confirm the successful attachment of the aforementioned molecules onto the polymers.

236

Initial results showed the dependence of the sugar concentration on the particle formation process. In order to proceed with encapsulation and release of relevant antigens or molecules and their analysis using in vitro models, it is necessary to determine the range of the amounts of these targeting molecules that can be attached to allow particle formation. Ongoing experiments are underway using various amounts of glycolic acid in the functionalization of the polyanhydride nanoparticles and the polymer concentration in the initial solvent step.

Future experiments can include the encapsulation of model antigens and drug molecules and focus on analysis of any changes in the release kinetics mechanisms caused by the functionalization of the polyanhydrides. In addition, the ability of these nanoparticles to effectively stimulate APCs can be examined.

Altogether, this approach may offer a new alternative in the use of these materials as drug and vaccine delivery vehicles.

8.7. Analysis of polyanhydride nanoparticle trafficking mechanisms to the lymph nodes

It is important to build upon the results described in Chapter 7, where B cell and T follicular helper cell formation in the germinal centers were demonstrated upon polyanhydride nanovaccine immunizations, and further understand the mechanisms by which these nanocarriers induce antigen-specific immune responses. In previous experiments these nanoparticles have shown the

237 ability to engage T cells and to generate high antibody titers, thus inducing both humoral and cellular immune responses.[23] One of the main steps in the induction of strong immunity is antigen trafficking to the lymph nodes, either solubly or via transport by APCs. [24, 25] As shown previously in Chapter 4 and in previous studies, polyanhydride nanoparticles have the ability to activate

APCs, and process and present antigen on their surface either in a MHC I or

MHC II context.[26] Based on these results, further understanding on the mechanisms by which these particles result in antigen trafficking to the lymph nodes is necessary.

Ongoing studies include the synthesis of <100 nm polyanhydride nanoparticles by the incorporation of surfactants, varying solvent/non-solvent ratios, and modifying the synthesis methodology used in this thesis. Since it has been reported that particles of this size can directly traffic to the lymph nodes, use of small polyanhydride nanoparticles may elucidate the mechanisms by which nanoparticles can deliver antigen to the lymph nodes.[27, 28]

Complementing this work, analysis of the APC-dependent particle transport to the lymphatic system can be performed to be able to understand the dynamics of these particles after in vivo administration.

238

8.8. References

[1] Scanlan CN, Offer J, Zitzmann N, Dwek RA. Exploiting the defensive sugars of HIV-1 for drug and vaccine design. Nature. 2007;446:1038-45.

[2] Wang SK, Liang PH, Astronomo RD, Hsu TL, Hsieh SL, Burton DR, Wong CH. Targeting the carbohydrates on HIV-1: Interaction of oligomannose dendrons with human monoclonal antibody 2G12 and DC-SIGN. Proc Natl Acad Sci. 2008;105:3690-5.

[3] Figdor CG, van Kooyk Y, Adema GJ. C-type lectin receptors on dendritic cells and Langerhans cells. Nat Rev Immunol. 2002;2:77-84.

[4] Geijtenbeek TBH, Gringhuis SI, Gringhuis S. Signalling through C-type lectin receptors: shaping immune responses. Nat Rev Immunol. 2009;9:465-79.

[5] Takahara K, Yashima Y, Omatsu Y, Yoshida H, Kimura Y, Kang YS, Steinman RM, et al. Functional comparison of the mouse DC-SIGN, SIGNR1, SIGNR3 and Langerin, C-type lectins. Int Immunol. 2004;16:819-29.

[6] Geijtenbeek TBH, Geijtenbeek Y. Pathogens target DC-SIGN to influence their fate DC-SIGN functions as a pathogen receptor with broad specificity. Acta Pathol Microbiol Immunol Scand A. 2003;111:698-714.

[7] Gijzen K, Tacken PJ, Zimmerman A, Joosten B, de Vries IJ, Figdor CG, Torensma R. Relevance of DC-SIGN in DC-induced T cell proliferation. J Leukoc Biol. 2007;81:729-40.

[8] Geijtenbeek. DC-SIGN, a C-type lectin on dendritic cells that unveils many aspects of dendritic cell biology. J Leukoc Biol. 2002;71:921-31.

[9] van Kooyk Y, Geijtenbeek TB. DC-SIGN: escape mechanism for pathogens. Nat Rev Immunol. 2003;3:697-709.

[10] Holmgren J, Czerkinsky C. Mucosal immunity and vaccines. Nat Med. 2005;11:S45-53.

[11] Belyakov IM, Berzofsky JA. Immunobiology of mucosal HIV infection and the basis for development of a new generation of mucosal AIDS vaccines. Immunity. 2004;20:247-53.

[12] Wegmann F, Krashias G, Luhn K, Laamanen K, Vieira S, Jeffs SA, Shattock RJ, et al. A novel strategy for inducing enhanced mucosal HIV-1 antibody responses in an anti-inflammatory environment. PloS One. 2011;6:e15861.

[13] Huntimer L, Ramer-Tait AE, Petersen LK, Ross KA, Walz KA, Wang C, Hostetter J, et al. Evaluation of biocompatibility and administration site

239 reactogenicity of polyanhydride-particle-based platform for vaccine delivery. Adv Healthc Mater. 2013;2:369-78.

[14] Lionakis MS, Netea MG. Candida and host determinants of susceptibility to invasive candidiasis. PLoS Pathog. 2013;9:e1003079.

[15] Huang H-R. Endocytic pathway is required for Drosophila Toll innate immune signaling. Proc Natl Acad Sci. 2010;107:8322-7.

[16] Drummond R, Drummond G. The role of Dectin-1 in the host defence against fungal infections. Curr Opin Microbiol. 2011;14:392-9.

[17] Hennessy EJ, Parker AE, O'Neill LA. Targeting Toll-like receptors: emerging therapeutics? Nat Rev Drug Discover. 2010;9:293-307.

[18] Lu Y, Low PS. Folate-mediated delivery of macromolecular anticancer therapeutic agents. Adv Drug Deliver Rev. 2012;64, Supplement:342-52.

[19] Rollett A, Rollett T, Reiter P, Nogueira M, Cardinale A, Loureiro A, Gomes A, et al. Folic acid-functionalized human serum albumin nanocapsules for targeted drug delivery to chronically activated macrophages. Int J Pharm. 2012;427:460-6.

[20] Carrillo-Conde B, Song EH, Chavez-Santoscoy A, Phanse Y, Ramer-Tait AE, Pohl NL, Wannemuehler MJ, et al. Mannose-functionalized "pathogen-like" polyanhydride nanoparticles target C-type lectin receptors on dendritic cells. Mol Pharm. 2011;8:1877-86.

[21] Jin H, Kanthasamy A, Ghosh A, Anantharam V, Kalyanaraman B, Kanthasamy AG. Mitochondria-targeted antioxidants for treatment of Parkinson's disease: Preclinical and clinical outcomes. Biochim Biophys Acta. 2014;1842:1282-94.

[22] Bradley J-C, Neylon, Cameron, Guha, Rajarshi, Williams, Antony, Hooker, Bill, Lang, Andrew, Friesen, Brent, Bohinski, Tim, Bulger, David, Federici, Matthew, Hale, Jenny, Mancinelli, Jenna, Mirza, Khalid, Moritz, Marshall, Rein, Daniel, Tchakounte, Cedric, and Truong, Hai. Open Notebook Science Challenge: Solubilities of Organic Compounds in Organic Solvents Nature Precedings. 2010:1756-0357.

[23] Huntimer LM, Ross KA, Darling RJ, Winterwood NE, Boggiatto P, Narasimhan B, Ramer-Tait AE, et al. Polyanhydride nanovaccine platform enhances antigen-specific cytotoxic T cell responses. TECHNOLOGY. 2014;02:171-5.

[24] Bortnick A, Allman D. What is and what should always have been: long-lived plasma cells induced by T cell-independent antigens. J Immunol. 2013;190:5913- 8.

240

[25] Rao D, Rao ML, Alani GS, Alani G, Kwon J. Biodegradable PLGA based nanoparticles for sustained regional lymphatic drug delivery. J Pharm Sci. 2009;99:2018-31.

[26] Torres MP, Wilson-Welder JH, Lopac SK, Phanse Y, Carrillo-Conde B, Ramer-Tait AE, Bellaire BH, et al. Polyanhydride microparticles enhance dendritic cell antigen presentation and activation. Acta Biomater. 2011;7:2857- 64.

[27] Reddy ST, van der Vlies AJ, Simeoni E, Angeli V, Randolph GJ, O'Neil CP, Lee LK, et al. Exploiting lymphatic transport and complement activation in nanoparticle vaccines. Nat Biotech. 2007;25:1159-64.

[28] Manolova V, Flace A, Bauer M, Schwarz K, Saudan P, Bachmann MF. Nanoparticles target distinct dendritic cell populations according to their size. Eur J Immunol. 2008;38:1404-13.