Charakterisierung Und Expression Der MHC-Kodierten BAT2- Und BAT3-Gene

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Charakterisierung und Expression der MHC-kodierten BAT2- und BAT3-Gene Dissertation zur Erlangung des Doktorgrades (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen Fakultät der Rheinischen Friedrich-Wilhelms-Universität Bonn vorgelegt von Johannes Winkler aus Bonn Bonn (Juni) 2003 i 1 Einleitung............................................................................................................1 1.1 Der Haupthistokompatibilitätskomplex (MHC) .................................................1 1.1.1 Der MHC Klasse I-Bereich................................................................................. 4 1.1.2 Der MHC Klasse II-Bereich ............................................................................... 6 1.1.3 Der MHC Klasse III-Bereich.............................................................................. 6 1.2 BAT2.................................................................................................................13 1.3 BAT3.................................................................................................................14 1.4 Zielsetzung der Arbeit.......................................................................................18 2 Material und Methoden.....................................................................................19 2.1 Geräte................................................................................................................19 2.2 Verbrauchsmaterialien ......................................................................................20 2.2.1 E.coli-Bakterienstämme.................................................................................... 22 2.2.2 Zelllinien........................................................................................................... 23 2.2.3 Antikörper......................................................................................................... 23 2.2.4 Peptide...............................................................................................................24 2.2.5 Oligonukleotide ................................................................................................ 24 2.2.6 Crosslinker........................................................................................................ 26 2.2.7 Tierstämme ....................................................................................................... 26 2.3 Methoden ..........................................................................................................27 2.3.1 Zellkultur .......................................................................................................... 27 2.3.2 Bakterienkultur ................................................................................................. 27 2.3.3 Isolierung von RNA aus eukaryontischen Zellen............................................. 27 2.3.4 Northern Blot .................................................................................................... 27 2.3.5 Multiple Tissue Expression-Array (MTE)........................................................ 28 2.3.6 In-situ-Hybridisierung ...................................................................................... 29 2.3.7 Reverse Transkription....................................................................................... 30 2.3.8 Polymerase-Kettenreaktion (PCR) ................................................................... 30 2.3.9 Rapid amplification of cDNA ends (RACE) ....................................................30 2.3.10 Bestimmung einer DNA-Sequenz durch Sequenzierung.................................. 31 2.3.11 Isolierung von Plasmid-DNA aus E.coli........................................................... 31 2.3.12 Restriktionsverdau ............................................................................................ 32 2.3.13 Agarosegelektrophorese und Elution von DNA aus Agarosegelen.....................................................................................................32 2.3.14 Klonierung von DNA-Fragmenten ................................................................... 33 ii 2.3.15 Klonierung von Oligonukleotiden .................................................................... 33 2.3.16 Klonierung von PCR-Produkten durch TOPO-Klonierung.............................. 34 2.3.17 Identifikation rekombinanter Klone durch Kolonie-PCR................................. 34 2.3.18 Ortsspezifische Mutagenese (Site-directed mutagenesis)................................. 35 2.3.19 Expression rekombinanter Proteine in E. coli .................................................. 35 2.3.20 Affinitätsreinigung rekombinanter GST-Fusionsproteine................................ 36 2.3.21 Kopplung von Peptiden an Trägerproteine....................................................... 37 2.3.22 Herstellung von Antiseren in Kaninchen.......................................................... 37 2.3.23 ELISA zur Bestimmung des Antikörpertiters................................................... 38 2.3.24 Affinitätsreinigung von Antikörpern ................................................................ 38 2.3.25 Transiente Proteinexpression in eukaryontischen Zellen ................................. 39 2.3.26 Stabile Proteinexpression in eukaryontischen Zellen ....................................... 39 2.3.27 Metabolische Markierung von eukaryontischen Zellen.................................... 40 2.3.28 Herstellung von Zelllysaten.............................................................................. 40 2.3.29 Immunpräzipitation........................................................................................... 40 2.3.30 Reduzierende SDS-PAGE ................................................................................ 41 2.3.31 Nachweis von Proteinen im SDS-PAGE-Gel...................................................41 2.3.32 Fluorographie.................................................................................................... 41 2.3.33 Western Blot .....................................................................................................42 2.3.34 Immunfluoreszenz ............................................................................................ 42 2.3.35 In-vitro-Transkription/Translation.................................................................... 43 3 Ergebnisse.........................................................................................................44 3.1 Molekularbiologie von BAT2...........................................................................44 3.1.1 Bestimmung der humanen BAT2-cDNA-Sequenz........................................... 44 3.1.2 Bestimmung des Transkriptionsstarts von BAT2 durch 5’-RACE .................. 46 3.1.3 Bestimmung der Genorganisation von BAT2 .................................................. 47 3.1.4 Sequenzanalyse der humanen BAT2-cDNA .................................................... 47 3.1.5 Sequenzvergleiche mit anderen Spezies........................................................... 54 3.1.6 BAT2-verwandte Sequenzen ............................................................................ 54 3.1.7 Zusammensetzen eines vollständigen BAT2 cDNA-Klons.............................. 60 3.1.8 Herstellung rekombinanter GST-BAT2-Fusionsproteine................................. 61 3.1.9 Immunisierung von Kaninchen mit GST-Fusionsproteinen und BAT2- abgeleiteten Peptiden ........................................................................................64 3.1.10 Aufreinigung der BAT2-Antiseren................................................................... 66 iii 3.2 Molekularbiologie von BAT3...........................................................................74 3.2.1 Klonierung und Sequenzierung einer BAT3-cDNA......................................... 74 3.2.2 Sequenzanalyse der BAT3-cDNA.................................................................... 79 3.2.3 Sequenzvergleich der BAT3-cDNA mit anderen Spezies................................ 83 3.2.4 BAT3-verwandte Sequenzen ............................................................................ 83 3.3 Gewebeverteilung der BAT2- und BAT3-mRNA............................................83 3.4 Proteinbiochemische Ergebnisse ......................................................................92 3.4.1 Expression von BAT2 in eukaryontischen Zellen ............................................ 92 3.4.2 Expression und Detektion von BAT3 in COS7-Zellen .................................... 95 3.4.3 Subzelluläre Fraktionierung zur Lokalisierung der BAT-Proteine in transfizierten Zellen ..........................................................................................96 3.4.4 Immunfluoreszenz mit transient transfizierten Zellen...................................... 96 3.4.5 Einfluss von BAT2 und BAT3 auf die proteasomale Degradation des Glukokortikoidrezeptors ...................................................................................99 3.5 Second Mitochondrial Activator of Caspases (Smac) ......................................99 3.5.1 Klonierung einer Smac-cDNA........................................................................ 101 3.5.2 Expression in eukaryontischen Zellen ............................................................ 102 3.5.3 Koexpression von Smac mit BAT3 ................................................................ 102 4 Diskussion.......................................................................................................104
Recommended publications
  • UBQLN2 Polyclonal Antibody C-Terminal Ubiquitin-Associated Domain

    UBQLN2 Polyclonal Antibody C-Terminal Ubiquitin-Associated Domain

    UBQLN2 polyclonal antibody C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, Catalog Number: PAB1699 and thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein Regulatory Status: For research use only (RUO) degradation. This ubiquilin has also been shown to bind the ATPase domain of the Hsp70-like Stch protein. Product Description: Rabbit polyclonal antibody raised [provided by RefSeq] against synthetic peptide of UBQLN2. References: Immunogen: A synthetic peptide (conjugated with KLH) 1. Structural studies of the interaction between ubiquitin corresponding to C-terminus of human UBQLN2. family proteins and proteasome subunit S5a. Walters KJ, Kleijnen MF, Goh AM, Wagner G, Howley PM. Host: Rabbit Biochemistry. 2002 Feb 12;41(6):1767-77. 2. The hPLIC proteins may provide a link between the Reactivity: Human ubiquitination machinery and the proteasome. Kleijnen Applications: WB-Ce MF, Shih AH, Zhou P, Kumar S, Soccio RE, Kedersha (See our web site product page for detailed applications NL, Gill G, Howley PM. Mol Cell. 2000 Aug;6(2):409-19. information) 3. Selection system for genes encoding nuclear-targeted proteins. Ueki N, Oda T, Kondo M, Yano K, Noguchi T, Protocols: See our web site at Muramatsu M. Nat Biotechnol. 1998 http://www.abnova.com/support/protocols.asp or product Dec;16(13):1338-42. page for detailed protocols Form: Liquid Purification: Protein G purification Recommend Usage: Western Blot (1:1000) The optimal working dilution should be determined by the end user. Storage Buffer: In PBS (0.09% sodium azide) Storage Instruction: Store at 4°C.
  • Viewed the Thesis/Dissertation in Its Final Electronic Format and Certify That It Is an Accurate Copy of the Document Reviewed and Approved by the Committee

    Viewed the Thesis/Dissertation in Its Final Electronic Format and Certify That It Is an Accurate Copy of the Document Reviewed and Approved by the Committee

    U UNIVERSITY OF CINCINNATI Date: I, , hereby submit this original work as part of the requirements for the degree of: in It is entitled: Student Signature: This work and its defense approved by: Committee Chair: Approval of the electronic document: I have reviewed the Thesis/Dissertation in its final electronic format and certify that it is an accurate copy of the document reviewed and approved by the committee. Committee Chair signature: Investigation of Phosphorylated Proteins and Peptides in Human Cerebrospinal Fluid via High-Performance Liquid Chromatography Coupled to Elemental and Molecular Mass Spectrometry A thesis submitted to the Graduate School of the University of Cincinnati In partial fulfillment of the Requirements for the degree of MASTER OF SCIENCE In the Department of Chemistry of the College of Arts and Sciences By ORVILLE DEAN STUART B.S., Chemistry The University of Texas at Tyler, Tyler, Texas May 2006 Committee Chair: Joseph A. Caruso, Ph.D Abstract Cerebrospinal fluid (CSF) surrounds and serves as a protective media for the brain and central nervous system (CNS). This fluid remains isolated from other biological matrices in normal bodily conditions, therefore, an in depth analysis of CSF has the potential to reveal important details and malfunctions of many diseases that plague the nervous system. Because phosphorylation of a wide variety of proteins governs the activity of biological enzymes and systems, a method for the detection of 31P in proteins found in human cerebrospinal fluid by high-performance liquid chromatography (HPLC) coupled to inductively coupled plasma mass spectrometry (ICPMS) is described. Specifically, it is of interest to compare phosphorylated proteins/peptides from patients suffering from post subarachnoid hemorrhage (SAH) arterial vasospasms against CSF from non-diseased patients.
  • The Porcine Major Histocompatibility Complex and Related Paralogous Regions: a Review Patrick Chardon, Christine Renard, Claire Gaillard, Marcel Vaiman

    The Porcine Major Histocompatibility Complex and Related Paralogous Regions: a Review Patrick Chardon, Christine Renard, Claire Gaillard, Marcel Vaiman

    The porcine Major Histocompatibility Complex and related paralogous regions: a review Patrick Chardon, Christine Renard, Claire Gaillard, Marcel Vaiman To cite this version: Patrick Chardon, Christine Renard, Claire Gaillard, Marcel Vaiman. The porcine Major Histocom- patibility Complex and related paralogous regions: a review. Genetics Selection Evolution, BioMed Central, 2000, 32 (2), pp.109-128. 10.1051/gse:2000101. hal-00894302 HAL Id: hal-00894302 https://hal.archives-ouvertes.fr/hal-00894302 Submitted on 1 Jan 2000 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Genet. Sel. Evol. 32 (2000) 109–128 109 c INRA, EDP Sciences Review The porcine Major Histocompatibility Complex and related paralogous regions: a review Patrick CHARDON, Christine RENARD, Claire ROGEL GAILLARD, Marcel VAIMAN Laboratoire de radiobiologie et d’etude du genome, Departement de genetique animale, Institut national de la recherche agronomique, Commissariat al’energie atomique, 78352, Jouy-en-Josas Cedex, France (Received 18 November 1999; accepted 17 January 2000) Abstract – The physical alignment of the entire region of the pig major histocompat- ibility complex (MHC) has been almost completed. In swine, the MHC is called the SLA (swine leukocyte antigen) and most of its class I region has been sequenced.
  • Genome-Wide Gene and Pathway Analysis

    Genome-Wide Gene and Pathway Analysis

    European Journal of Human Genetics (2010) 18, 1045–1053 & 2010 Macmillan Publishers Limited All rights reserved 1018-4813/10 www.nature.com/ejhg ARTICLE Genome-wide gene and pathway analysis Li Luo1, Gang Peng1, Yun Zhu2, Hua Dong1,2, Christopher I Amos3 and Momiao Xiong*,1 Current GWAS have primarily focused on testing association of single SNPs. To only test for association of single SNPs has limited utility and is insufficient to dissect the complex genetic structure of many common diseases. To meet conceptual and technical challenges raised by GWAS, we suggest gene and pathway-based GWAS as complementary to the current single SNP-based GWAS. This publication develops three statistics for testing association of genes and pathways with disease: linear combination test, quadratic test and decorrelation test, which take correlations among SNPs within a gene or genes within a pathway into account. The null distribution of the suggested statistics is examined and the statistics are applied to GWAS of rheumatoid arthritis in the Wellcome Trust Case–Control Consortium and the North American Rheumatoid Arthritis Consortium studies. The preliminary results show that the suggested gene and pathway-based GWAS offer several remarkable features. First, not only can they identify the genes that have large genetic effects, but also they can detect new genes in which each single SNP conferred a small amount of disease risk, and their joint actions can be implicated in the development of diseases. Second, gene and pathway-based analysis can allow the formation of the core of pathway definition of complex diseases and unravel the functional bases of an association finding.
  • Splicing Alternativo Y Quimerismo En Genes Del MHC De Clase III

    Splicing Alternativo Y Quimerismo En Genes Del MHC De Clase III

    UNIVERSIDAD AUTÓNOMA DE MADRID FACULTAD DE CIENCIAS DEPARTAMENTO DE BIOLOGÍA Splicing alternativo y quimerismo en genes del MHC de clase III. Relación de esta región con la Artritis Reumatoide. Alternative splicing and chimerism in MHC class III genes. Relation of this region to Rheumatoid Arthritis. Memoria presentada por: Raquel López Díez para optar al grado de Doctor en Ciencias por la Universidad Autónoma de Madrid Trabajo dirigido por la Dra Begoña Aguado Orea y realizado en el Centro de Biología Molecular “Severo Ochoa” (UAM-CSIC). Madrid, 2014 DEPARTAMENTO DE BIOLOGÍA FACULTAD DE CIENCIAS UNIVERSIDAD AUTÓNOMA DE MADRID Memoria presentada por Dña Raquel López Díez para optar al grado de Doctor por la Universidad Autónoma de Madrid Directora: Dra. Begoña Aguado Orea Tutor: Dr. José Miguel Hermoso Núñez Departamento de Biología, Centro de Biología Molecular Severo Ochoa, U.A.M.-C.S.I.C. Madrid, 2014 Este trabajo ha sido realizado en el Departamento de Biología de la Facultad de Ciencias y en el Centro de Biología Molecular Severo Ochoa (C.B.M.S.O.), U.A.M.-C.S.I.C., gracias a la ayuda de una beca de Formación para Personal Universitario de la Universidad Autónoma de Madrid. ÍNDICE Abreviaturas empleadas ________________________________________________ vi SUMMARY ___________________________________________________________ ix Publications __________________________________________________________ xv Communications to meetings ____________________________________________ xv Submissions to the NCBI database ________________________________________ xv 1. INTRODUCCIÓN ___________________________________________________ 1 1.1. EL FENÓMENO DEL SPLICING Y EL SPLICING ALTERNATIVO ______________________ 3 1.1.1. Mecanismo de splicing _______________________________________________________ 4 1.1.1.1. Excepciones en el mecanismo de splicing _____________________________________ 8 1.1.2.
  • (Stch) Gene Reduces Prion Disease Incubation Time in Mice

    (Stch) Gene Reduces Prion Disease Incubation Time in Mice

    Overexpression of the Hspa13 (Stch) gene reduces prion disease incubation time in mice Julia Grizenkovaa,b, Shaheen Akhtara,b, Holger Hummericha,b, Andrew Tomlinsona,b, Emmanuel A. Asantea,b, Adam Wenborna,b, Jérémie Fizeta,b, Mark Poultera,b, Frances K. Wisemanb, Elizabeth M. C. Fisherb, Victor L. J. Tybulewiczc, Sebastian Brandnerb, John Collingea,b, and Sarah E. Lloyda,b,1 aMedical Research Council (MRC) Prion Unit and bDepartment of Neurodegenerative Disease, University College London (UCL) Institute of Neurology, London WC1N 3BG, United Kingdom; and cDivision of Immune Cell Biology, MRC National Institute for Medical Research, London NW7 1AA, United Kingdom Edited by Reed B. Wickner, National Institutes of Health, Bethesda, MD, and approved July 10, 2012 (received for review May 28, 2012) Prion diseases are fatal neurodegenerative disorders that include way crosses and a heterogeneous cross (12–14). In these studies, bovine spongiform encephalopathy (BSE) and scrapie in animals the underlying functional polymorphism is unknown but could be and Creutzfeldt-Jakob disease (CJD) in humans. They are character- an amino acid change within the coding region of a protein or ized by long incubation periods, variation in which is determined by splicing variant or may occur within noncoding sequences such as many factors including genetic background. In some cases it is pos- untranslated regions, promoters, or other regulatory regions sible that incubation time may be directly correlated to the level of thereby influencing the pattern or level of expression. Although gene expression. To test this hypothesis, we combined incubation incubation time is a polygenic trait, it is possible that in some cases, time data from five different inbred lines of mice with quantitative there may be a direct correlation between incubation time and gene expression profiling in normal brains and identified five genes individual gene expression level.
  • WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T

    WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T

    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T (51) International Patent Classification: David [US/US]; 13539 N . 95th Way, Scottsdale, AZ C12Q 1/68 (2006.01) 85260 (US). (21) International Application Number: (74) Agent: AKHAVAN, Ramin; Caris Science, Inc., 6655 N . PCT/US20 12/0425 19 Macarthur Blvd., Irving, TX 75039 (US). (22) International Filing Date: (81) Designated States (unless otherwise indicated, for every 14 June 2012 (14.06.2012) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, English (25) Filing Language: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, Publication Language: English DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, KR, (30) Priority Data: KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, 61/497,895 16 June 201 1 (16.06.201 1) US MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, 61/499,138 20 June 201 1 (20.06.201 1) US OM, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, SD, 61/501,680 27 June 201 1 (27.06.201 1) u s SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, 61/506,019 8 July 201 1(08.07.201 1) u s TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW.
  • Development and Validation of a Serum Biomarker Panel for The

    Development and Validation of a Serum Biomarker Panel for The

    Journal of Cancer 2017, Vol. 8 2346 Ivyspring International Publisher Journal of Cancer 2017; 8(12): 2346-2355. doi: 10.7150/jca.19465 Research Paper Development and Validation of a Serum Biomarker Panel for the Detection of Esophageal Squamous Cell Carcinoma through RNA Transcriptome Sequencing Shan Xing1,2†, Xin Zheng1,2†, Li-Qiang Wei4†, Shi-Jian Song5, Dan Liu1,3, Ning Xue1,3, Xiao-Min Liu1,2, Mian-Tao Wu1,2, Qian Zhong1,3, Chu-Mei Huang6, Mu-Sheng Zeng1,3, Wan-Li Liu1,2 1. State Key Laboratory of Oncology in Southern China, Collaborative Innovation Center for Cancer Medicine, Guangzhou, China 2. Department of Clinical Laboratory, Sun Yat-sen University Cancer Center, Guangzhou, China 3. Department of Experimental Research, Sun Yat-sen University cancer center, Guangzhou, China 4. Department of Clinical Laboratory, Shaanxi Provincial People’s Hospital, Xian, China 5. Guangdong Experimental High School, Guangzhou, China 6. Department of Laboratory Medicine, Sun Yat-sen University First Affiliated Hospital, Guangzhou, China † Xing S, Zheng X and Wei LQ contributed equally to this work Corresponding authors: Wan-Li Liu. Email: [email protected]; Phone: 86-020-87343196. Department of Clinical Laboratory, Sun Yat-sen University Cancer Center, 651 Dongfeng Road East,Guangzhou 510060, P.R. China. Mu-Sheng Zeng; Email: [email protected] Phone: +86-020-87343192. Department of Experimental Research, Sun Yat-sen University cancer center, 651 Dongfeng Road East,Guangzhou 510060, P.R.China © Ivyspring International Publisher. This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) license (https://creativecommons.org/licenses/by-nc/4.0/).
  • RTL8 Promotes Nuclear Localization of UBQLN2 to Subnuclear Compartments Associated with Protein Quality Control

    RTL8 Promotes Nuclear Localization of UBQLN2 to Subnuclear Compartments Associated with Protein Quality Control

    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.21.440788; this version posted April 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Title: RTL8 promotes nuclear localization of UBQLN2 to subnuclear compartments associated with protein quality control Harihar Milaganur Mohan1,2, Amit Pithadia1, Hanna Trzeciakiewicz1, Emily V. Crowley1, Regina Pacitto1 Nathaniel Safren1,3, Chengxin Zhang4, Xiaogen Zhou4, Yang Zhang4, Venkatesha Basrur5, Henry L. Paulson1,*, Lisa M. Sharkey1,* 1. Department of Neurology, University of Michigan, Ann Arbor, MI 48109-2200 2. Graduate Program in Cellular and Molecular Biology, University of Michigan, Ann Arbor, MI 48109- 2200 3. Present address: Department of Neurology, Northwestern University Feinberg School of Medicine, Chicago, IL 60611 4. Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, MI 48109-2200 5. Department of Pathology, University of Michigan Medical School, Ann Arbor, MI 48109. *Corresponding authors: Henry Paulson: Department of Neurology, University of Michigan, Ann Arbor, MI 48109-2200; [email protected]; Tel. (734) 615-5632; Fax. (734) 615-5655 Lisa M Sharkey: Department of Neurology, University of Michigan, Ann Arbor, MI 48109-2200; [email protected]; Tel. (734) 763-3496; Fax (734) 615-5655 Keywords: Ubiquilin, UBQLN2, RTL8, Nuclear Protein Quality Control, Ubiquitin Proteasome System Declarations Funding: This work was supported by NIH 9R01NS096785-06, 1P30AG053760-01, The Amyotrophic Lateral Sclerosis Foundation and the UM Protein Folding Disease Initiative. Conflicts of interest/Competing interests: None declared Availability of data and material: • The authors confirm that the data supporting the findings in this are available within the article, at repository links provided within the article, and within its supplementary files.
  • Genes Between the Complement Cluster and HLA-B THOMAS SPIES*, MAUREEN BRESNAHAN, and JACK L

    Genes Between the Complement Cluster and HLA-B THOMAS SPIES*, MAUREEN BRESNAHAN, and JACK L

    Proc. Nati. Acad. Sci. USA Vol. 86, pp. 8955-8958, November 1989 Immunology Human major histocompatibility complex contains a minimum of 19 genes between the complement cluster and HLA-B THOMAS SPIES*, MAUREEN BRESNAHAN, AND JACK L. STROMINGER Department of Biochemistry and Molecular Biology, Harvard University, Cambridge, MA 02138 Contributed by Jack L. Strominger, August 15, 1989 ABSTRACT A 600-kilobase (kb) DNA segment from the meric side, the gene for 21-OHB is 350 kb distant from the human major histocompatibility complex (MHC) class HI nearest class II locus, DR. Presently, no genes have been region was isolated by extension of a previous 435-kb chromo- localized within this region. On the telomeric side, the gene some walk. The contiguous series of cloned overlapping for C2 is separated by 600 kb from the proximal class I locus, cosmids contains the entire 555-kb interval between C2 in the HLA-B. This interval includes the genes for the tumor complement gene cluster and HLA-B. This region is known to necrosis factors (TNFs) a and 83 and the major heat shock encode the tumor necrosis factors (TNFs) a and (, B144, and protein HSP70 (7, 8, 11). the major heat shock protein HSP70. Moreover, a cluster of To identify genes within the MHC class III region, a 435-kb genes, BAT1-BAT5 (HLA-B-associated transcripts) has been genomic segment centromeric to HLA-B has recently been localized in the vicinity of the genes for TNFa and TNF3. An isolated by chromosome walking with overlapping cosmids additional four genes were identified by isolation of corre- (12).
  • Differential Effects of STCH and Stress-Inducible Hsp70 on the Stability and Maturation of NKCC2

    Differential Effects of STCH and Stress-Inducible Hsp70 on the Stability and Maturation of NKCC2

    International Journal of Molecular Sciences Article Differential Effects of STCH and Stress-Inducible Hsp70 on the Stability and Maturation of NKCC2 Dalal Bakhos-Douaihy 1,2, Elie Seaayfan 1,2,† , Sylvie Demaretz 1,2,†, Martin Komhoff 3,‡ and Kamel Laghmani 1,2,*,‡ 1 Centre de Recherche des Cordeliers, INSERM, Sorbonne Université, USPC, Université Paris Descartes, Université Paris Diderot, 75006 Paris, France; [email protected] (D.B.-D.); [email protected] (E.S.); [email protected] (S.D.) 2 CNRS, ERL8228, 75006 Paris, France 3 University Children’s Hospital, Philipps-University, 35043 Marburg, Germany; [email protected] * Correspondence: [email protected]; Tel.: +33-1-44-27-50-68; Fax: +33-1-44-27-51-19 † These authors contributed equally to this work. ‡ These authors contributed equally to this work. Abstract: Mutations in the Na-K-2Cl co-transporter NKCC2 lead to type I Bartter syndrome, a life- threatening kidney disease. We previously showed that export from the ER constitutes the limiting step in NKCC2 maturation and cell surface expression. Yet, the molecular mechanisms involved in this process remain obscure. Here, we report the identification of chaperone stress 70 protein (STCH) and the stress-inducible heat shock protein 70 (Hsp70), as two novel binding partners of the ER-resident form of NKCC2. STCH knock-down increased total NKCC2 expression whereas Hsp70 knock-down or its inhibition by YM-01 had the opposite effect. Accordingly, overexpressing of STCH and Hsp70 exerted opposite actions on total protein abundance of NKCC2 and its folding mutants.
  • Download Validation Data

    Download Validation Data

    PrimePCR™Assay Validation Report Gene Information Gene Name ubiquilin 2 Gene Symbol UBQLN2 Organism Human Gene Summary This gene encodes an ubiquitin-like protein (ubiquilin) that shares high degree of similarity with related products in yeast rat and frog. Ubiquilins contain a N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases; and thus are thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This ubiquilin has also been shown to bind the ATPase domain of the Hsp70-like Stch protein. Gene Aliases CHAP1, DSK2, FLJ10167, FLJ56541, N4BP4, PLIC2 RefSeq Accession No. NC_000023.10, NG_016249.1, NT_011630.14 UniGene ID Hs.179309 Ensembl Gene ID ENSG00000188021 Entrez Gene ID 29978 Assay Information Unique Assay ID qHsaCEP0055207 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000338222 Amplicon Context Sequence CATTTGCAGATTGACTGTATATGACCTTAATCTTTGTGCAGCCTGAAGGATCAGT GTAGTAATGCCAGGAAAGTGCTTTTTACCTAAGACTTCCTTCTCAGCTTCTCCCA TAAAGAGACCCTAATATGCAT Amplicon Length (bp) 101 Chromosome Location X:56593074-56593204 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 105 R2 0.9967 cDNA Cq 21.06 cDNA Tm (Celsius) 79.5 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 25.2 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay