Sorting Nexin 5 and Dopamine 1 Receptor Regulate Insulin Signaling and Metablism in Renal Proximal Tubule Cells

SORTING NEXIN 5 AND DOPAMINE 1 RECEPTOR REGULATE INSULIN SIGNALING AND METABLISM IN RENAL PROXIMAL TUBULE CELLS

A Dissertation submitted to the Faculty of the Graduate School of Arts and Sciences of Georgetown University in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Physiology and Biophysics

Fengmin Li, MS

Washington, DC May 2, 2011

SORTING NEXIN 5 AND DOPAMINE 1 RECEPTOR REGULATE INSULIN SIGNALING AND METABLISM IN RENAL PROXIMAL TUBULE CELLS

Fengmin Li , MS

Thesis Advisor: Pedro A. Jose, MD, PhD

ABSTRACT

The mechanisms that regulate the renal degradation of insulin are unknown. This dissertation research tests the overall hypothesis that in the kidney, sorting nexin 5 (SNX5) and dopamine D1

receptor (D1R) regulate insulin receptor (IR) expression and insulin signaling pathway, as well as

the insulin degrading enzyme (IDE). Two parallel objectives of this dissertation research are: 1)

to investigate how SNX5 and D1R regulate the IR and insulin signaling pathway; and 2) to

investigate how SNX5 and D1R regulate IDE and insulin degradation.

SNX5 is one of the members of the sorting nexin family, which is composed of a diverse group of proteins that mediate trafficking of various receptors. The D1R is defective in

individuals with essential hypertension and diabetes. In this work, we determined the roles of

D1R and SNX5 in the regulation of the IR, IDE and insulin signaling pathway in human renal proximal tubule cells (hRPTCs). We studied the expression of these proteins and their interaction

in hRPTCs, by laser scanning confocal microscopy and immunoprecipitation. Insulin promoted

the co-localization of SNX5 and IRβ in the perinuclear area. SNX5 and IRβ did not co-

immunoprecipitate in the basal state or after treatment with insulin. In contrast, D1R and IRβ co-

localized and co-immunoprecipitated, and were increased by insulin. Moreover, IDE co-

immunoprecipitated with both SNX5 and D1R in the basal state and was also increased by

iii

insulin. To silence stably the endogenous SNX5 and D1R expression, shRNA was transfected

into hRPTCs. SNX5 or D1R depletion decreased IRβ and IDE expression, as well as IDE activity. SNX5 depletion also decreased the phosphorylation of IRS1 and Akt. In conclusion,

SNX5 needed to interact with D1R to regulate IRβ expression, and the downregulation of SNX5

or D1R impaired the insulin signaling pathway. Moreover, both SNX5 and D1R were involved in

the degradation of insulin by increasing IDE expression and activity. This work may help explain

why up to 65% of individuals with diabetes also suffer from hypertension and 25–47% of

individuals with hypertension have insulin resistance or impaired glucose tolerance.

ACKNOWLEDGMENTS

• Pedro A. Jose, MD, PhD, my research mentor and thesis advisor for inspiring this work and

for his generous, brilliant, and dedicated commitment to my education.

• Susan E. Mulroney, PhD, for her faith, support, encouragement, and critical help with

preparation of the dissertation and document.

• Ines Armando, PhD, for painstakingly reviewing the drafts of figures, manuscript and

dissertation, for teaching me how to write, and her wholehearted help.

• Kathryn Sandberg, PhD, for her willing hands-on assistance in developing my presentation skills and revising my research statement and for her true and valued friendship and advices.

• Peter M. Andrews, PhD, for his support and advice on the kidney tissue images.

• Van Anthony Villar, MD, PhD, and John E. Jones, PhD, for their enthusiastic support of the project, hands-on assistance with some experiments and for painstakingly reviewing the drafts.

• Hewang Li, MD, PhD, for helping and teaching me how to do FRET microscopy and co- localization analyses.

• Julie Jurgen, BS, for correcting my pronunciation, helping me practice my presentation, and revising my writing.

• Yu Yang, MD, PhD, for teaching me how to do immunohistochemistry in kidney tissues.

• Peiying Yu, MD, PhD, for helping and teaching me some basic cell biological techniques.

• Xiaoyan Wang, MD, PhD, for sharing some antibodies and her expertise in protein expression studies.

• Laureano Asico, DVM, PhD, and Laura B Teitelbaum, BS, for helping me with all the documents and ordering of all the supplies.

• Crisanto Escano, DVM, PhD, for helping me with the animal experiments.

• All members of Dr. Jose’s laboratory at Children’s National Medical Center for their willing assistance and camaraderie.

• And finally, I owe a special “thank you” to my husband and son, Bingchen Du and Allen Yu

Du, my parents, and my sisters for their patient love and understanding during this challenging endeavor.

The research and writing of this thesis are dedicated to everyone who helped along the way.

Many thanks!

vii

TABLE OF CONTENTS

Introduction ...... 1

Hypertension ...... 1

Diabetes mellitus ...... 2

Hypertension and diabetes ...... 4

Metabolic syndrome...... 4

CHAPTER I Sorting nexin family ...... 6

1.1 Sorting nexin classification ...... 6

1.2 Functions of SNXs ...... 7

1.3 Retromer ...... 8

1.4 Sorting nexin 5 ...... 9

CHAPTER II Dopamine and dopamine receptor ...... 11

2.1 Dopamine ...... 11

2.2 Renal dopamine D1 receptors ...... 12

2.3 Intracellular signaling ...... 14

CHAPTER III Insulin receptor and insulin metabolism ...... 16

3.1 Insulin receptor ...... 16

3.1.1 Insulin receptor (IR) synthesis ...... 16

3.1.2 Insulin signaling pathways ...... 16

3.1.3 Insulin receptor substrate (IRS) ...... 19

3.1.4 Insulin receptor (IR) crossover and degradation ...... 20

viii

3.2 Insulin metabolism ...... 20

3.2.1 Insulin ...... 20

3.2.2 Insulin degradation...... 21

3.2.3 Insulin degrading enzyme (IDE) ...... 23

3.2.4 Cathepsin D (CD) ...... 24

3.3 Insulin function in the kidney ...... 24

CHAPTER IV Hypotheses and specific aims ...... 27

4.1 Hypothesis...... 27

4.2 Specific aim 1 ...... 27

4.3 Specific aim 2 ...... 27

4.4 Significance...... 28

4.5 Novelty ...... 29

4.6 Rationale ...... 29

CHAPTER V Materials and methods ...... 31

5.1 Cell lines ...... 31

5.2 Antibodies ...... 31

5.3 RNA preparation and reverse transcription PCR (RT-PCR) ...... 31

5.4 Quantitative real-time PCR (qRT-PCR) ...... 32

5.5 SNX5 and D1R shRNA stable transfection ...... 33

5.6 SNX5 siRNA transfection ...... 33

5.7 Western blot ...... 34

5.8 Co-immunoprecipitation ...... 35

5.9 Immunofluorescence and laser scanning confocal microscopy ...... 35

5.10 Immunohistochemistry ...... 36

5.11 Antibody labeling...... 37

5.12 FRET microscopy and data processing ...... 37

5.13 Insulin degrading enzyme (IDE) activity ...... 38

5.14 Insulin receptor (IR) degradation ...... 39

5.15 Densitometry ...... 39

5.16 Co-localization measurement ...... 39

5.17 Statistical analysis ...... 39

5.18 Pharmacological agents and final concentrations ...... 40

CHAPTER VI Results of the studies on SNX5, D1R and IRβ ...... 41

6.1 SNX5 expression in models of hypertension and obesity ...... 41

6.1.1 Serum insulin levels in WKY rats with SNX5 siRNA injection into the renal cortex ...... 41

6.1.2 SNX5 expression in animals and in RPTCs ...... 41

6.2 Interaction among SNX5, D1R and IRβ in hRPTCs ...... 48

6.2.1 Interaction between SNX5 and IRβ ...... 48

6.2.2 Interaction between D1R and IRβ ...... 63

CHAPTER VII Results of the studies on SNX5, D1R and IDE ...... 78

7.1 Interaction between SNX5 and IDE ...... 78

7.2 Interaction between D1R and IDE ...... 88

CHAPTER VIII Discussion ...... 97

8.1 SNX5 regulates IRβ protein and mRNA expression and insulin signaling ...... 97

8.2 D1R interacts with IRβ and regulates its protein expression ...... 102

8.3 SNX5 and D1R regulate the protein expression and activity of IDE ...... 107

Appendix A ...... 116

Bibliography ...... 118

LIST OF FIGURES

1. Dopamine receptor expression along the nephron 13

2. Insulin signalling pathway 18

3. Intra-renal pathway of insulin removal 22

4. Serum insulin levels resulting from the chronic decrease in renal SNX5 expression

in WKY rats 43

5. SNX5 antibody specificity and SNX5 distribution in rat tissues 44

6. SNX5 expression in the kidney of lean and obese rats 45

7. SNX5 expression in wRPTCs and sRPTCs 46

8. SNX5 expression in hRPTCs from normotensive subjects and hypertensive patients 47

9. Effect of insulin on pAkt abundance in hRPTCs 51

10. Co-localization of SNX5 and IRβ in hRPTCs 52

11 Co-localization of SNX5 and IRβ in human kidney 53

12. Co-localization of SNX5 and IRβ in rat kidney (200x) 54

13. Co-immunoprecipitation of SNX5 and IRβ in hRPTCs 55

14. SNX5 expression in SNX5 shRNA-transfected hRPTCs 56

15. IRβ expression in SNX5 shRNA-transfected hRPTCs 57

16. IR expression in SNX5 siRNA-transfected hRPTCs at mRNA level 58

17. IRβ expression in SNX5 siRNA-transfected hRPTCs treated with CHX and chloroquine

18. pIRS1 and tIRS1 abundance in SNX5 shRNA-transfected hRPTCs 60

19. tAkt and pAkt abundance in SNX5 shRNA-transfected hRPTCs 61

xii

20. Akt phosphorylation with or without insulin treatment 62

21. Co-localization of D1R and IRβ in hRPTCs 66

22. Co-localization of D1R and IRβ in human kidney (400X) 67

23. Co-localization of D1R and IRβ in rat kidney (200X) 68

24. Fluorescence Resonance Energy Transfer (FRET) between D1R and IRβ 69

25. Co-immunoprecipitation of D1R and IRβ in hRPTCs 70

26. D1R expression in D1R shRNA-transfected hRPTCs 71

27. IRβ expression in D1R shRNA-transfected hRPTCs 72

28. tIRS1 and pIRS1 abundance in D1R shRNA-transfected hRPTCs 73

29. tAKT and pAKT abundance in D1R shRNA-transfected hRPTCs 74

30. Co-localization of D1R, SNX5 and IRβ in hRPTCs 75

31. Quantification of the co-localization of D1R, SNX5 and IRβ in hRPTCs 77

32. IDE expression in WKY and SHRs 80

33. Co-localization of SNX5 and IDE in hRPTCs 81

34. Co-localization of SNX5 and IDE in human kidney (100X) 82

35. Co-localization of SNX5 and IDE in rat kidney (200X) 83

36. Co-immunoprecipitation between SNX5 and IDE in hRPTCs 84

37. IDE expression and activity in SNX5 shRNA-transfected hRPTCs 85

38. Expression of IDE mRNA in SNX5 siRNA-transfected hRPTCs 86

39. Cathepsin-D expression in SNX5 siRNA-transfected hRPTCs 87

40. Co-localization of D1R and IDE in hRPTCs 90

41. Quantification of co-localization of D1R and IDE in hRPTCs 91

xiii

42. Co-localization of D1R and IDE in proximal tubules of human kidney (400X) 92

43. Co-immunoprecipitation between D1R and IDE in hRPTCs 93

44. IDE expression and activity in D1R shRNA-transfected hRPTCs 94

45. Co-localization among D1R, SNX5 and IDE in hRPTCs 95

46. Quantification of the co-localization of SNX5 and IDE in hRPTCs 96

47. A simplified model of the interaction among SNX5, D1R, and IRβ 105

48. A simplified model of the interaction among SNX5, D1R, IRβ and IDE and

their roles in hypertension, insulin resistance, and diabetes 113

LIST OF TABLES

1. Real-time primers 33

xiv

INTRODUCTION

Hypertension

The term “blood pressure” (BP) is the force of the blood that pushes against the walls of the

arteries and is generally applied to the arterial blood pressure in the systemic circulation. Normal

blood pressure is less than 120 mmHg systolic and less than 80 mmHg diastolic (120/80 mmHg).

Blood pressures from 120/80 mmHg to 139/89 mmHg are considered to be in prehypertensive

range and carries an increased risk for developing hypertension, which could be prevented by

choosing a healthy lifestyle. Blood pressures equal to or higher than 140/90 are considered to be

in the hypertensive range1.

Hypertension affects about 74.5 million United States (US) middle-aged adults while about 85 million have prehypertension2. It is a risk factor for stroke, kidney disease, and cardiovascular

morbidity and mortality3. There are two general classes of hypertension: essential hypertension

and secondary hypertension4,5.

Essential hypertension (or primary hypertension), with no identifiable cause, is the most

common type of hypertension in adults, affecting around 95% of hypertensive patients. It tends

to be familial and is probably the consequence of an interaction of environmental and genetic

factors4. Secondary hypertension, which affects about 5% of hypertensive patients, includes those with an identifiable cause, such as endocrine disease, kidney disease, and tumors5.

Essential hypertension, the largest risk factor for cardiovascular diseases, can be prevented,

controlled, and treated which leads to the reduction of the incidence of complications6. The long-

term control of blood pressure is mainly provided by the kidney, with input from several

systems, including the endocrine, vascular, and nervous system, through adjustment of sodium

balance and peripheral resistance7. The hormones and neural and humoral factors that influence

blood pressure are classified into 2 groups based on their effects on sodium excretion and

vascular smooth muscle contractility. One group causes natriuresis and vasodilation and the

other group causes sodium retention and vasoconstriction. There are exceptions. For example

circulating ouabain, by inhibiting vascular smooth muscle Na+-K+-ATPase activity increases

blood pressure, but by inhibiting renal tubular Na+-K+-ATPase activity, increases sodium

excretion which should lead to a decrease in blood pressure8. The balance between these two

groups keeps the blood pressure in the normal range7. In most of hypertensive patients, the

activities of the prohypertensive systems, the sympathetic nervous and renin-angiotensin systems, are increased causing sodium retention and vasoconstriction9,10. At the same time, the

activities of the antihypertensive systems, such as the dopaminergic, kinin, prostaglandin

systems, are decreased or do not compensate for the increased activity of the prohypertensive

systems, aggravating the sodium retention and vasoconstriction7. These topics will be discussed

further in the following chapters.

Diabetes mellitus

Diabetes mellitus (DM) is a group of chronic metabolic diseases characterized by high blood

glucose levels. In 2010, DM affected 25.8 million people in US and around 285 million people

worldwide11. The US Center for Disease Control and Prevention (CDC) predicts that by 2050,

between one-fifth to one-third of all adults could have diabetes, if the inception of this disease is

not prevented12.

DM results from defects in insulin secretion, cellular responsiveness to insulin, or both. After eating, the stomach digests carbohydrates into sugars, including glucose. Normally, glucose enters the bloodstream and stimulates the β cells of the pancreas to secrete insulin. Glucagon, secreted by the α cells of the pancreas, has an effect opposite that of insulin. When blood glucose levels decrease, glucagon starts to break down glycogen (the stored form of glucose), which releases glucose for energy consumption. Insulin and glucagon work together to balance and regulate the level of blood glucose of the body in the normal range.

There are two major types of DM, type I and type II13. Type I DM results from insufficient insulin secretion and exogenous insulin is necessary to regulate blood glucose levels. Thus, type

I DM is also called insulin-dependent diabetes mellitus (IDDM). IDDM is caused by autoimmune, genetic, or environmental factors. IDDM develops when the immune system of the body destroys the β cells of the pancreas, making them unable to produce sufficient amounts of insulin to regulate blood glucose to normal levels. In adults, IDDM accounts for about 5-8% of all cases of diabetes14.

There is no deficiency of circulating insulin in Type II DM. Therefore, type II DM is also called non-insulin-dependent diabetes mellitus (NIDDM). In NIDDM, there is a resistance to the ability of insulin to increase the cellular uptake of glucose, creating a state of relative insulin deficiency. The relative insulin deficiency is caused by many factors, including old age, physical inactivity, obesity, race/ethnicity, family history of diabetes, history of gestational diabetes, or drugs. The insulin resistance in type II DM patients causes the β cells of the pancreas to secrete more insulin to compensate the defective responsiveness15. In adults, type II DM accounts for about 90-95% of all diagnosed cases of diabetes.

Hypertension and diabetes

Essential hypertension and type II DM are common diseases, especially in older persons16.

Hypertension accelerates the vascular and cardiac abnormalities in diabetes, including atherosclerosis, arterial stiffness, left ventricular hypertrophy, and diastolic dysfunction17.

Hypertension is also aggravated by the sodium retention caused by the increased insulin levels in type II DM, because the renal tubule cells remain responsive to insulin. When hypertension is present in patients with diabetes, the mortality rate increases more than seven-fold18.

Metabolic syndrome

Human essential hypertension and type II DM are frequently associated with other

anthropometric and metabolic abnormalities. Three findings out of five meet the definition of the

metabolic syndrome (elevated waist circumference, elevated triglycerides, reduced HDL

cholesterol, elevated blood pressure, elevated fasting glucose, and reduced HDL), also called

syndrome X19,20. Around 20%-30% of the population in developed countries have metabolic

syndrome. In 2010, 50-75 million people in the US have metabolic syndrome21.

Insulin resistance occurs when the ability of insulin to increase the cellular uptake of glucose

is impaired. The body tries to compensate for this impairment by increasing the secretion of

insulin, resulting in hyperinsulinemia. Because the ability of insulin to increase renal sodium

transport is not impaired in type II DM, insulin resistance and hyperinsulinemia contribute to the

development of hypertension by causing the kidney to retain sodium22.

Obesity is measured by body mass index (BMI) which is the weight in kg divided by the square of the height in meters23. Normal BMI is 18.5 to 24.9, underweight is less than 18.5,

overweight is between 25.0 and 29.9 and obese is greater than 3024. Increased fat distribution in

the abdominal trunk is called abdominal or central obesity usually defined by a waist-to-hip ratio

(WHR), a ratio of the circumference of the waist to that of the hips. WHR is considered a better

indicator of central obesity. Men with a WHR >= 1.00 and women with a WHR >= 0.85 are classified as obese25, which have high cardiovascular risk, including hypertension. Abnormally

increased weight is an important risk factor in the development of hypertension and diabetes,

while the loss of weight to the normal range generally leads to the normalization of blood

pressure and prevention of and recovery from type II DM26-28. However, high BMI may not be

associated with excess death among Indians and Bangladeshis29.

A very important public health concern is the development of numerous other diseases when obesity, hypertension, and diabetes are present. These diseases exacerbate each other resulting in a decrease in overall health and life expectancy30. Therefore, it is extremely important to

elucidate the mechanisms that promote the association of these diseases.

This dissertation will identify novel mechanisms that promote the development of

hypertension, diabetes, and insulin resistance. We expect that this work will help explain why up

to 65% of individuals with diabetes also suffer from hypertension and that 25–47% of

individuals with hypertension also have insulin resistance or impaired glucose tolerance.

CHAPTER I SORTING NEXIN FAMILY

1.1 Sorting nexin classification

Endosomal trafficking plays a vital role in regulating the physiological function of membrane

receptors and transporters31. Recently, the sorting nexin (SNX) family has been shown to be

associated with endosomal compartments. These proteins mediate the membrane and cytosolic

trafficking of plasma membrane proteins, e.g., various receptors and transporters32,33. However,

the mechanisms by which the SNX family regulates membrane receptors and transporters remain

to be clarified34.

The SNX family is composed of a diverse group of proteins. So far, 10 yeast and 33 mammalian sorting nexins have been identified32,33. The members of the SNX family are

characterized by the presence of phox-homology (SNX-PX) domain33. The PX domain-

containing proteins have diverse functions in different types of cells. However, the major

function of the PX domain is to bind to specific phosphoinositides and to help target these PX-

domain-containing proteins to different endosomal compartments. In certain situations, PX

domains may also be involved in protein-protein interaction35. The PX domain is able to bind to

various phosphotidylinositol phosphates (PtdInsPs), thereby potentially targeting these PX- containing proteins to specific cellular membranes that are enriched in these phospholipids36.

Some of the PX domains, by themselves, are capable of membrane targeting. However, others require additional domains or components to target to PI(3)P-containing membranes in cells37.

The BAR domain (Bin, amphiphysin, Rvs) that is located in the C-terminal region of some members of the SNX family may help the host proteins target to proper compartments. The BAR

domain is able to dimerize, causing membrane tubulation, and inducing and sensing membrane

curvature. Therefore, SNX-BARs effectively integrate phosphoinositide and membrane-

geometry cues and target themselves to high-curvature, phosphoinositide-containing subdomains of the early endocytic network38. For SNX1, both functional PX and BAR domains are needed

for its targeting to the sorting endosomes39. However, for SNX5, the results have been

inconsistent. Some studies have shown that the BAR domain is sufficient for SNX5 target to

subcellular membrane, but others have not34. Further investigation is needed to clarify this

puzzle.

Depending on the presence of the lipid-binding PX domain and the BAR domain35,38, the

sorting nexins are classified into three sub-families: 1) SNX1, SNX2, SNX4, SNX5, SNX6,

SNX7, SNX8, SNX9, SNX18, SNX30, SNX32, and SNX33 sub-family has a PX and a C-

terminal BAR domains; 2) SNX3, SNX10, SNX11, SNX12, SNX16, SNX20, SNX21, SNX22,

SNX24, and SNX sub-family has only a PX domain; and 3) SNX13, SNX14, SNX15, SNX17,

SNX19, SNX23, SNX25, SNX26, SNX27, SNX28, and SNX31 subfamily has a PX and a non-

BAR domains e.g., SH3 domain, PDZ domain, and regulator of G-protein signaling (RGS) domain40.

1.2 Functions of SNXs

SNXs, as sorting proteins, play vital roles in regulating the trafficking of membrane receptors41. It has been reported that SNX1, SNX5, SNX9, SNX18 and SNX33 are involved in

macropinosome formation42. SNX1, SNX2, SNX9 and SNX13 have been reported to be

involved in the sorting of G protein-coupled receptors (GPCRs). SNX1, SNX2, and SNX4 have

also been reported to bind to the epidermal growth factor receptor (EGFR), platelet-derived

growth factor receptor (PDGFR), IR and leptin receptor43. SNX1, SNX6, SNX9 drive the

PtdIns(3)P-mediated degradation of apoptotic cells44. The co-localization of SNX2 and androgen

receptor has been detected in the higher vocal center of the zebra finch45. SNX25 interacts with

TGF-β and negatively regulates TGF-β signaling by enhancing the degradation of TGF-β

receptors. SNX6 has been reported to increase the breast cancer metastasis suppressor-1-

dependent repression of transcription46. SNX6 has also been reported to co-localize with β-site β-

amyloid precursor protein cleaving enzyme-1 trans-Golgi network of HELA cells47.

Receptor sorting is mediated by the interaction of the receptor’s cytosolic domain with peripheral membrane proteins or their complexes. The peripheral membrane proteins, in contrast to integral membrane proteins, are associated with membranes but do not penetrate the hydrophobic core of the membrane. They are often found in association with integral membrane proteins and help in receptor sorting.

1.3 Retromer

SNX1/SNX2 and SNX5/SNX6 may be the SNX dimer in the mammalian retromer. The retromer, which was first identified in yeast, is a five-subunit complex composed of an SNX dimer and a Vps26-Vps29-Vps35 trimer48. Subsequently, a similar complex was found in

mammals49. It is associated with the cytosolic face of endosomes and can regulate the retrograde

transport of many transmembrane proteins from the endosomes to the trans-Golgi network50-52.

In yeast, the SNX dimer consists of Vps5 and Vps1753. However, in mammals, the composition

of the SNX dimer is not clear. SNX1 and SNX2 may be the mammalian orthologs of Vps549,54,

while SNX5 and SNX6 may be the mammalian orthologs of Vps1755. In the retromer, the SNX

dimer, the “membrane targeting complex” is responsible for the recruitment of the retromer to

endosomes through their PX and BAR domains. The Vps26-Vps29-Vps35, called the “cargo

recognition complex”, is considered to be important in cargo binding56. Vps26 contains a two-

lobed structure with a polar core and fits into the retromer complex by interacting with Vps35

subunit. Vps26 binds to the N-terminus of Vps35 via its C-terminal lobe and Vps29 binds to the

C-terminus of Vps3557,58. Vps35 and Vps29 cooperate to associate with PI(3)-binding SNX

complex49.

1.4 Sorting nexin 5

SNX5 contains a central PX domain and two coiled-coil regions at the C-terminal domain. Its

PX domain interacts with both PtdIns(3)P (phosphatidylinositol (3)-phosphate) and

PtdIns(3,4)P235. In overexpression studies, SNX5 was found to interact with and decrease the

degradation of the epithelial growth factor receptor (EGFR), a member of the receptor tyrosine

kinase family, upon EGF stimulation34.

Previous work in our laboratory showed that SNX1 interacts with and regulates the

59 internalization and intracellular trafficking of the dopamine D5 receptor (D5R) , while SNX5

interacts with and regulates the internalization and recycling of the D1R. The chronic intrarenal

infusion of SNX5 siRNA in normotensive Wistar-Kyoto (WKY) rats increases their serum

insulin levels. In contrast, the same maneuver in spontaneously hypertensive rats (SHRs) whose

serum insulin are higher than those in their normotensive controls, WKY rats, are decreased by

the selective renal SNX5 siRNA infusion. How a protein expressed in the kidney can regulate

plasma insulin levels is not clear. It is known, however, that patients with chronic renal failure

have increased plasma insulin levels and are insulin resistant60. It is also well known that

increased insulin levels and insulin resistance play a role in the pathogenesis of essential

hypertension61,62. Compared to normotensives, hypertensives have increased plasma insulin levels and are insulin resistant63, similar to those observed in SHRs. Humans with essential

64 hypertension and SHRs also have impaired D1R function . In this dissertation, the role of SNX5 and D1R in insulin signaling and metabolism will be studied, results of which should enhance the understanding of the relationships among hypertension, diabetes, and insulin resistance.

CHAPTER II DOPAMINE AND DOPAMINE RECEPTOR

2.1 Dopamine

Dopamine is an important endogenous neurotransmitter in the mammalian brain where it affects a variety of physiological processes, including locomotor activity, cognition, emotion, behavior, memory, food intake, endocrine function, and the autonomic responses to stress by its effects on specific dopamine receptors65. It also serves as a precursor of epinephrine and norepinephrine in the central and peripheral nervous system66. The role of dopamine receptors in the central nervous system (CNS) has been extensively studied, which has yielded therapeutic benefits in diseases such as Parkinson’s and Alzheimer’s disease67.

Dopamine is now recognized as an important regulator of blood pressure and fluid and electrolyte balance68. Dopamine controls systemic blood pressure through the regulation of fluid and sodium intake via “appetite” centers in the brain69 and by direct action on cardiovascular centers. Endogenous dopamine can also affect blood pressure by regulating the release or synthesis of hormones and humoral agents, such as aldosterone, catecholamines, endothelin, prolactin, proopiomelanocortin, renin, and vasopressin70-72.

Dopamine, synthesized in non-neural tissues (e.g., intestine and kidney) and acting as a paracrine/autocrine humoral agent, is important in the regulation of sodium balance and blood pressure. In the kidney, dopamine is synthesized by renal proximal tubule cells and engenders natriuresis or the excretion of sodium by binding to its cognate receptors, resulting in the inhibition of sodium transport in almost all the segments of the nephron68. Dopamine receptors belong to the rhodopsin-like family of GPCRs, characterized by the presence of seven-

transmembrane domains73,74. Based on their differential effects on adenylyl cyclase (AC)

activity, the five mammalian dopamine receptors are classified into the D1-like receptors (D1R

and D5R), which stimulate AC activity, and D2-like receptors (D2R, D3R, and D4R), which

inhibit AC activity74,75. Circulating dopamine levels are in the picomolar range and are not

sufficiently high to activate the dopamine receptors because the affinity of dopamine to its

cognate receptors is in the low nanomolar range. High nanomolar concentrations of dopamine

can be produced by dopamine-producing cells and tissues like the renal proximal tubule and

jejunal cells.

The exogenous administration of dopamine results in high concentrations that can stimulate

other receptors, e.g., α-adrenergic receptor, β-adrenergic receptor, and serotonin receptor. At these high concentrations, dopamine serves as pharmacological inotrope to enhance cardiac contractility, via the β-adrenergic receptors. The increase in cardiac output and vascular smooth muscle contractility, via the α-adrenergic receptors, increases blood pressure66. Thus, dopamine

is used to increase the blood pressure in patients in shock not caused by decreased blood volume.

2.2 Renal dopamine D1 receptors

All of the dopamine receptor subtypes are expressed in the kidney and are differentially

74 expressed along all the segment of the nephron (Figure 1) . D1R is expressed in the proximal

tubule, distal convoluted tubule, macula densa, cortical collecting duct, and renal vasculature,

76,77 including the juxtaglomerular cell . The D1 receptor-mediated regulation of ion transport occurs predominantly in the proximal tubule and thick ascending limb of Henle, and has been characterized to a greater extent in the former than in the latter. Furthermore, the D1R has a

74 higher expression in the proximal tubule compared to D5R, another D1-like receptor . Therefore, 12

we have directed our studies to the renal proximal tubule. In the renal proximal tubule, D1-like receptor activation leads to inhibition of the activities of the sodium/hydrogen exchanger 3

- - (NHE3), sodium-phosphate co-transporter (NaPi2), and Cl /HCO3 exchanger at the apical

+ - + + membrane, and electrogenic Na /HCO3 co-transporter and Na -K -ATPase at the basolateral

membrane78-83, which results in the inhibition of sodium reabsorption and therefore, causes a

natriuresis.

Figure 1. Dopamine receptor expression along the nephron. All dopamine receptor subtypes

are expressed in the kidney but differentially expressed along the segments of the nephron74.

The human D1 receptor gene (DRD1) locus (chromosome 5q35.1) is linked to human essential hypertension84. Single nucleotide polymorphisms in the non-coding region of DRD1 is associated with human essential hypertension (A-48G)85, and albuminuria (G-94A)86. There is a

deficiency of D1R protein expression in the renal proximal tubule of obese Zucker rats which

have hypertension87. Deletion of the Drd1 in mice increases blood pressure88. It is possible that a

deficiency of D1R expression contributes to the development of essential hypertension in

84 humans . However, renal D1R expression is not decreased in humans with essential

hypertension89. There are also no variants in the human DRD1 coding region that are associated

with essential hypertension or impair D1R function. However, a constitutive desensitization of

the renal D1R but not the D5R caused by activating variants of GPCR kinase type 4 (GRK4) has

been reported in humans with essential hypertension; there are no GRK4 variants in rodent

models of essential hypertension, but renal GRK4 expression is increased relative to their

normotensive controls90-93.

2.3 Intracellular signaling

Upon agonist stimulation of the D1R receptor, activated D1R oligomers dissociate into

monomers and couple with Gsα to stimulate adenylyl cyclase, and also recruit GRK4 to

rd phosphorylate the 3 cytoplasmic loop and C-terminal tail of D1R. This is followed by the

binding of adaptor proteins such as the β arrestins, leading to the internalization of the activated

receptors through the invagination of the plasma membrane94. Once internalized, the receptors,

in vesicles termed “early endosomes”, are sorted by SNXs and follow divergent pathways: the

receptors are either sorted into recycling endosomes for their return to the cell membrane

(recycling and resensitization) or accumulate in late endosomes which target the lysosomes for

their subsequent degradation95. Additional proteolytic mechanisms, such as proteasomes or cell- associated endopeptidases, are also implicated in mediating the down-regulation of certain

GPCRs96.

CHAPTER III INSULIN RECEPTOR AND INSULIN METABOLISM

3.1 Insulin receptor

3.1.1 Insulin receptor (IR) synthesis

The IR is a single-transmembrane receptor composed of two α and two β subunits. Both α and

β subunits are encoded by a single gene which is larger than 120 kilobases in length and contains

22 exons97. The earliest identifiable form of the IR has a molecular weight of approximately 180

kDa. It is digested by a protease-furin98 into 125 kDa and 83 kDa proteins99. Subsequently, a 200

kDa molecular weight form appears due to terminal glycosylation, and finally the mature α

subunit (135 kDa) and β subunit (95 kDa) appear100,101. Only the mature 135 kDa (α) and 95 kDa

(β) subunits contain terminal sialic acid residues. Monensin, which interferes with Golgi

function, can hinder the maturation of the receptor and thus lead to the accumulation of the 180

kDa molecular weight form102. The α subunit is extracellular and contains the ligand-binding domain, whereas the β subunit, which contains the transmembrane and intracellular domains, has the tyrosine kinase domain. The two subunits are held together by disulfide bonds. The formation of this α-β disulfide linkage prior to proteolytic cleavage of the proreceptor ensures the firm attachment of the external α subunit to the membrane bound β subunit during the transit to the plasma membrane103.

3.1.2 Insulin signaling pathways

IR is a protein tyrosine kinase. Ligand-binding results in receptor autophosphorylation on

tyrosine residues. The receptor that is bound to insulin is internalized by invagination, resulting

in the formation of an intracellular vesicle, the orientation of which is opposite to that of the cell

membrane, that is, the inside surface becomes the outside surface103.

The phosphorylation of the IR allows its binding to the IR substrate (IRS) and SHC

(squalene-hopene cyclase), both of them provide binding sites for the adaptor proteins that

initiate the downstream signaling pathways104. There are two major insulin signaling pathways

(Figure 2): PI3K (phosphatidylinositol 3-kinase)-PDK (phosphoinositide-dependent protein

kinase)-Akt, and Ras-MEK-MAPK (mitogen-activated protein kinase)105,106. Ras-MEK-MAPK is involved in cell growth and regulation of gene expression. In contrast, PI3K-PDK-Akt is involved in the stimulation of glucose metabolism and glycogen/lipid/protein synthesis called

“metabolic effects”. In my dissertation, the major effort was devoted to the determination of the roles of SNX5 and D1R in regulating IR and IDE. A study on insulin-IR-PI3K-Akt signaling pathway was also conducted.

Akt is a serine/threonine kinase that belongs to the protein kinase B (PKB) family. Akt kinases are now known to be key mediators of signal transduction pathways downstream of activated growth factor and cytokine receptors. In addition to the insulin signaling pathway, Akt is a target of platelet-derived growth factor (PDGF)-activated PI3K107. Akt is also involved in

other growth factor-activated signaling pathways, including epidermal growth factor (EGF),

fibroblast growth factor (FGF), mammalian target of rapamycin (mTOR) kinase, and integrin108.

Figure 2. Insulin signalling pathway: Insulin binds to the α subunits of its receptor, leading to an increase in the autophosphorylation of the β subunits. The docking proteins, SHC and IRS, interact with Tyr(Y)960 in the juxtamembrane domain of the IR. Recruitment of the Grb2–SOS

(growth factor receptor-bound protein 2-son of sevenless) complex to the tyrosine- phosphorylated SHC activates the MAPK cascade, which is involved in cell growth and regulation of gene expression. Association of PI3K and IRS increases the amount of PtdIns3P which activates PDK1 and its effectors, the Ser/Thr kinases Akt/PKB (protein kinase B). These kinases are involved in the stimulation of glucose metabolism and glycogen/lipid/protein synthesis109.

3.1.3 Insulin receptor substrate (IRS)

IRSs are central in mediating the IR tyrosine kinase signaling pathway104. The IRS family

includes IRS1, IRS2, IRS3, and IRS4 isoforms110. They have several characteristics in common,

such as a well-conserved pleckstrin homology (PH) domain at the extreme NH2-terminus, and a

phosphotyrosine binding (PTB) domain110. Activated IRS acts as a second messenger within the

cell to stimulate the transcription of insulin-regulated genes111. Insulin-resistant, obese, and diabetic animals and humans have decreased IRS protein expression112. Moreover, 3T3-L1 (3-

day transfer, innoculum 3 x 105) adipocytes and CHO (Chinese hamster ovary) cells, chronically

treated with insulin, also have decreased IRS1 expression112,113.

IRS1, the first identified isoform of IRS, transduces both metabolic and growth-promoting

signals of insulin114. IRS1 null mice have impaired embryonic and postnatal growth, insulin resistance, and glucose intolerance but do not have diabetes. In contrast, IRS2 null mice have nearly normal growth, but have insulin resistance and diabetes115. IRS1 is more closely linked to

glucose homeostasis while IRS2 is more closely linked to lipid metabolism116. IRS4 null mice

have nearly normal glucose homeostasis, which probably indicates a limited role of IRS4 in the

metabolic effects of insulin117. IRS3 is mainly expressed in adipocytes of rodents and probably not expressed in humans118. Therefore, IRS1 expression was studied in my dissertation because

of its possible role in insulin resistance in the absence of overt diabetes. The expression and

function of IRS2 will be studied in the future because of its possible role in insulin resistance

with overt diabetes.

3.1.4 Insulin receptor (IR) crossover and degradation

The IR, in addition to binding insulin with a high affinity, is capable of binding to IGF-I and

IGF-II. The IGF-I receptor has high binding affinity for IGF-I, but much lower binding affinity

for IGF-II or insulin. Of the three receptors IR, IGF-I receptor, and IGF-II receptor, the IGF-II

receptor has the most selectivity for IGF-II and it does not bind insulin at all, but does,

nonetheless, bind IGF-I, although with a lower affinity119.

In most cell types, IRs are in a dynamic state. That is, while new IRs are being synthesized, existing IRs are being degraded; the half-life of IR is 6.7 hours120. The insulin bound to IR is

internalized into endosomes where its degradation is initiated100. IR, in contrast, can either be

degraded in the lysosome or recycled back to the plasma membrane121, 122. Before the IR is

recycled, it needs to be dephosphorylated, a process that is mediated by protein tyrosine

phosphatases (PTPs)123. PTPs are important regulators of signal transduction. PTP1B, the first

PTP purified from human placental tissue, acts as an important negative regulator of insulin signaling by dephosphorylating the activated IR and IRS1124. An interaction between PTP1B and

IR is detected as early as 5 minutes following IR activation125. Disruption of PTP1B activity

results in an enhancement of insulin and leptin sensitivity126.

3.2 Insulin metabolism

3.2.1 Insulin

Insulin is the first hormone that was identified (1922)127. Insulin, synthesized exclusively in

the β cells of the pancreas, is a small hormone (6 kDa) consisting of two chains joined by

disulfide bonds. It causes the uptake of glucose from the circulation, mainly by liver, muscle, and

fat cells, resulting in a decrease in blood glucose concentration. Glucose taken up by liver and

muscle cells is stored as glycogen. In fat cells, glucose is metabolized, and the metabolic

products are converted to glyceraldehyde 3-phosphate and eventually to triglycerides. Insulin increases fatty acid synthesis, amino acid transport, and protein synthesis predominantly in the liver. Insulin also prevents the breakdown of fat in adipose tissue by inhibiting the activity of intracellular lipase that hydrolyzes triglycerides to release fatty acids128. Thus, insulin promotes

the synthetic phase of energy metabolism by activating glucose uptake, glycogen synthesis, and

lipogenesis. Insulin also enhances the activities of Na+-K+-ATPases and sodium hydrogen

exchanger (NHE) in renal proximal tubule cells, which will be discussed subsequently129,130.

3.2.2 Insulin degradation

The primary sites of insulin clearance are the liver and kidney. About 50% of portal insulin is

removed during the first-pass transit through the liver. The kidney removes from 30 to 80% of

circulating insulin, depending on certain conditions131. The proximal tubule cell is very active in

the degradation of circulating insulin132. Two different mechanisms have been proposed to

explain the removal of insulin by the kidney (Figure 3): glomerular filtration and proximal

tubular reabsorption and degradation133. IRs are found on glomerular endothelial134 and renal

proximal tubule cells135.

Figure 3. Intra-renal pathway of insulin removal. Insulin is removed from the blood by the

kidney via both receptor- and non-receptor-mediated uptake131. (A) Glomerular-filtration- tubular-uptake pathway. Filtered insulin is internalized by endocytosis and degraded with the release of amino acids into the peritubular vessels. (B) Insulin is removed from the postglomerular peritubular vessels by binding to the contraluminal (basolateral) cell membrane.

- IR.

The internalized insulin is separated from its receptor in the acidified endosomes, and then cross-linked to IDE, also known as insulysin/insulinase. Insulin-degrading activity was detected in tissue homogenates 60 years ago136. IDE was identified by its enzymatic cleavage of the β

chain of insulin in the late 1990s137. Although protein disulfide isomerase (PDI) and cathepsin D

(CD) are also involved in insulin metabolism, IDE is the major insulin degrading enzyme138.

IDE-null mice have a ~3-fold higher insulin levels than wild-type mice at 17-20 weeks of age139.

3.2.3 Insulin degrading enzyme (IDE)

IDE is a highly conserved and ubiquitous protein. IDE is present predominantly in the cytosol140 although small but significant amounts are also present in subcellular compartments, including the plasma membrane141, endosome142, peroxisomes143, and mitochondria144. IDE has been detected in almost all tissues and cell types (both insulin sensitive and insulin-insensitive cells) examined145. A recent multi-organ tissue microarray in humans showed that IDE is more

highly expressed in liver, kidney tubule, pulmonary pneumocytic, pancreatic acinar, and bone marrow cells than neural, breast, placenta, striated muscle, thymic, and splenic cells146.Both

nonspecific diffusion and specific receptor-mediated transport of insulin can occur in the

glomerulus and proximal tubule147. The degradation of insulin by the renal proximal tubule

follows processes similar those in the liver138 where the internalized insulin goes to endosome where its degradation is initiated148. Increased expression of IDE is associated with decreased

circulating levels of insulin, while decreased expression of IDE is associated with increased risk

of type 2 DM and Alzheimer’s disease because IDE is not only a major enzyme for insulin

degradation, but also for amyloid β-protein (Aβ) which accumulates in Alzheimer’s disease149.

Other peptides that are degraded by IDE include IGF-II, transforming growth factor-α, glucagon, amylin, atrial natriuretic peptide, calcitonin and C-terminal domain of Aβ precursor protein150,151.

The proteins that are substrates of IDE are supposed to share high structural similarity152.

Human IDE, synthesized as a single polypeptide with 1019 residues, is encoded by a gene

located at chromosome 10153. Its molecular weight is around 110 kDa and is a Zn2+-requiring

insulinase, optimally works at pH of 7.0, and has the highest affinity to insulin (low nanomolar

range), relative to its other substrates146,154. The degradation of insulin begins with two or more

cleavages in the β chain, followed by reduction of the disulfide bond by PDI or a related enzyme,

producing an intact α chain and several β chain fragments155. The insulin fragments are further

cleaved by multiple proteolytic systems, including the lysozymes100. How these processes are

regulated, is unclear.

IDE, the key protease in insulin degradation, is also regulated by insulin as a downstream target of insulin signaling. For example, in hippocampal neurons, insulin treatment increases IDE protein levels by 25-50%, a case of a negative feedback inhibition of IDE. Wortmannin and LY

294002, PI3 kinase (PI3K) inhibitors, blunt the IDE upregulation caused by insulin, providing

evidence that insulin-induced increase in IDE is mediated by PI3K/Akt pathway156.

3.2.4 Cathepsin D (CD)

Endosomal acidic insulysin (EAI), which is not related to IDE, hydrolyzes internalized insulin at PheB24-PheB25, and seven other cleavage sites. Compared to IDE, EAI has a lower pH optimum (pH 4–5.5) and is easily extracted from endocytic vesicles157. EAI was subsequently shown to be actually cathepsin D, an aspartic insulinase158.

3.3 Insulin function in the kidney

Insulin is the body’s most potent anabolic hormone. Insulin plays a vital role in energy

management159 with its primary function to regulate blood glucose levels160. In the kidney,

insulin can work in multiple ways and some of them may have opposing effects on blood

pressure161. It is well known that insulin is antinatriuretic by increasing sodium reabsorption in

the proximal tubule162, thick ascending limb163,164, and collecting duct165. Insulin administration

causes a marked decrease in fractional sodium excretion and an increase in blood pressure in rats

and humans166,167. However, insulin has also vasodilatory and natriuretic effects168, probably through its ability to induce nitric oxide (NO) production. The natriuretic effect of insulin via NO probably occurs in the distal nephron (thick ascending limb and beyond)169. Thus, the sodium

retaining properties of insulin may occur predominantly in the proximal tubule and its

counterregulatory effect on sodium transport occurs beyond the proximal tubule. This becomes

evident only when IRs in the distal nephron is deleted.

Various mechanisms could account for the pro-hypertensive action of insulin, e.g., an increase

in renal sodium reabsorption, the stimulation of other antinatriuretic pathways (e.g., the renin-

angiotensin system), and impairment of natriuretic pathways (e.g., the renal dopamine

system)170-172. Many reports have demonstrated that hyperinsulinemia can lead to sodium

retention and consequentially result in hypertension173,174. As stated above, the SHR is not only

genetically hypertensive but also has increased fasting levels of insulin and insulin resistance175.

Insulin level are 5 times higher in the SHR than in the WKY rat176.

It is well known that insulin suppresses glucose release and enhances gluconeogenesis in the

liver and kidney177. There are two groups of renal glucose transporters sodium-glucose

transporters (SGLTs) and facilitated glucose transporters (GLUTs)178. SGLTs, expressed

predominantly on the luminal surface of proximal tubule epithelial cells, reabsorb glucose

coupled with sodium from the glomerular filtrate179. In contrast, GLUTs present on the basolateral membrane of proximal tubule cells and mediate the passive transport and release of glucose into the circulation180. SGLT2 is located at S1 and S2 segments of the proximal tubule and absorbs 90% of filtered glucose; and SGLT1 at S3 segments reabsorbs the remaining

10%179. The two major GLUTs are GLUT2 and GLUT1. The former is expressed at the S1

segment of the proximal tubule and its expression at protein and mRNA levels is increased at

one-day insulin treatment181; and the latter at S3 segment of the proximal tubule where

gluconeogenesis occurs180,182,183. Altogether, kidney takes up and releases glucose and therefore

plays a role in the development of diabetes.

As stated above, about 65% people with diabetes also suffer from hypertension, or high blood

pressure. About 25-47% of individuals with hypertension have insulin resistance or impaired

glucose tolerance184. More than 11 million Americans are living with both hypertension and diabetes, and this number is increasing185. Thus, elucidating the interaction among hypertension,

diabetes, and insulin resistance is of paramount importance.

SNX5 gene maps at chromosome 20p11, a locus linked to high insulin levels in hypertensive

186 subjects . SNX5 may regulate D1R and D1 and IRs play crucial roles in hypertension and

187,188 diabetes, respectively . D1R function is defective in renal proximal tubules of both

172 hypertensive and diabetic individuals . Fenoldopam (D1R-like receptor agonist, agonist for

189 both D1R and D5R) decreases IRβ expression in vascular smooth muscle cells but its effect in

renal proximal tubule cells is unknown. Insulin treatment decreases of D1R expression in rat

172 190 renal proximal tubule cells but also increases D5R expression . Whether or not these

observations are pertinent to humans are not known. Therefore, the elucidation of the

interactions among SNX5, D1R, IR and IDE, especially in humans, may lead to a better

understanding of the relationships among hypertension, diabetes, and insulin resistance.

CHAPTER IV HYPOTHESES AND SPECIFIC AIMS

4.1 Hypothesis

This dissertation tested the overall hypothesis that SNX5 and D1R in the kidney regulate IR, insulin signaling pathway, and insulin metabolism. Specifically, SNX5 and D1R depletion decreases IRβ expression and IDE expression and function in hRPTCs.

4.2 Specific aim 1

To test the hypothesis that SNX5 and D1R regulate the expression of the IRβ. SNX5 and D1R depletion disrupts the insulin signaling pathway, via the downregulation of IRβ. The hypothesis was tested by studying the:

a) interaction among SNX5, D1R, and IRβ with insulin treatment;

b) expression of SNX5, IRβ, IRS1, and Akt; and

c) degradation of IRβ.

In these and subsequent experiments, gene silencing was accomplished using shRNA; non- transfected and empty vector-transfected cells served as controls.

4.3 Specific aim 2

To test the hypothesis that SNX5 and D1R regulate the expression and activity of IDE. The hypothesis was tested by studying the:

a) interaction among SNX5, D1R, and IDE with insulin treatment;

b) expression of IDE; and

c) activity of IDE.

4.4 Significance

Hypertension affects hundreds of millions of people worldwide. In the US alone, more than

65 million individuals suffer from hypertension20. Essential hypertension, which is high blood pressure with no identifiable cause, affects 29% of the middle-aged adult population and is increasing in prevalence191. The kidney is a major organ that is involved in the long-term

regulation of blood pressure and abnormal sodium retention is a common phenomenon in

individuals suffering from essential hypertension64,192. Intrarenal dopamine, synthesized by

RPTCs, by itself or by the interaction with other blood pressure-regulating systems, regulates renal sodium handling193.

DM is a group of metabolic diseases characterized by high blood glucose levels caused by

defects in insulin secretion, and/or function. Normally, blood glucose levels are controlled tightly by insulin, produced by the β cells of the pancreas. When blood glucose level increases, insulin is released from the pancreas to normalize the glucose level. In diabetic patients, the absence of or the inability of cells to use insulin properly and efficiently results in hyperglycemia and other metabolic consequences. The inability of cells to use insulin properly and efficiently, which is the primary problem in type II DM, leads to the insulin resistance13,15.

Epidemiological data show that about 65% of individuals with diabetes also suffer from hypertension, and about 25-47% of individuals with hypertension also have insulin resistance or impaired glucose tolerance184. Approximately 75% and 65% of the cases of hypertension in men and women, respectively, are directly attributable to obesity. As mentioned above, the presence of three of the five metabolic risk factors constitute what is called the “metabolic syndrome” or

“syndrome X”20. There are 47 million Americans suffering from the metabolic syndrome,

according to the American Heart Association. That means almost one out of every six people

and that number is increasing194.

The elucidation of the molecular interactions amongst D1R, SNX5, IR, and IDE should

greatly increase the understanding of the pathogenesis of hypertension, diabetes, and insulin

resistance, and hence of the metabolic syndrome. Results from these studies may provide clues in

the prevention and treatment of the metabolic syndrome.

4.5 Novelty

The sorting nexin family is involved in the trafficking of many receptors32. The elucidation of

the role of SNX5 and D1R in IR expression and insulin signaling pathway is of great importance

and a novel research topic. Some SNXs have been reported to participate in the trafficking of the

IR but its regulation in the kidney has not been studied43. Furthermore, the roles of SNX5 and

D1R in IDE expression, activity, and insulin degradation are also shown for the first time. We

expect that the studies on the interactions among SNX5, D1R, IR, and IDE will provide novel

information and may provide important clues into the relationships among hypertension,

diabetes, and insulin resistance.

4.6 Rationale

SNX5 gene maps at chromosome 20p11, a locus linked to high insulin levels in hypertensive subjects195. Studies have shown that dopamine and IRs play crucial roles in the development of

hypertension and diabetes, respectively. D1R function is defective in the RPTs of both

hypertensive and diabetic individuals. Stimulation of D1-like receptors decreases IRβ expression

189 172 in vascular smooth muscle cells . The observation that insulin decreases D1R but increases

190 D5R expression in RPTCs indicates a close link between renal D1R, D5R, and IR. Therefore, it

is important to study the relationship among SNX5, D1R, IR, and IDE which may lead to a better understanding of the relationships among hypertension, diabetes and insulin resistance, three of the components of the metabolic syndrome.

CHAPTER V MATERIALS AND METHODS

5.1. Cell lines

Immortalized hRPTCs were used (passage < 20). hRPTCs were cultured in Dulbecco’s

modified Eagle’s medium: Nutrient Mixture F-12 (DMEM/F12) (Invitrogen), supplemented with

10% fetal bovine serum (Sigma), 1% penicillin-streptomycin (Invitrogen), hydrocortisone (36 ng/mL) (Sigma), and epidermal growth factor (10 ng/mL) (Sigma). The cells were incubated at

37°C in 95% O2/5% CO2. When the cells were 75-90% confluent, they were treated with 0.25%

Trypsin-EDTA (Invitrogen) for 2 minutes. The reaction was stopped by adding 2 ml complete medium. The cells were seeded in 100 mm dishes, 6-well plates, or on coverslips, depending on the purpose of the experiments.

5.2. Antibodies

D1R (clone #408) antibodies were generated in our laboratory; D1R antibody (D2944) was

obtained from Sigma-Aldrich and D1R (G-18) was obtained from Santa Cruz Biotechnology.

These three antibodies were used to ensure reproducibility of our results. Antibodies directed

against SNX5 (D-18), IRβ (C-19) and were from Santa Cruz. IRβ (Clone CT-3), IRS1 (Clone

4.2.2) and GAPDH (MAB374) were from Millipore. Mouse IDE antibody [9B12.225] was from

Genetex, and rabbit IDE antibody was from Abcam. Cocktail 1, tAkt and Cathepsin-D (CD)

antibodies were from Cell Signaling.

5.3. RNA preparation and reverse transcription PCR (RT-PCR)

All of the following reactions were performed either in BioRad iCycler PCR Detection

System or C1000™ Thermal Cycler machine. Cultured hRPTCs were washed twice with 1X

PBS (phosphate buffered saline), after which total RNA was extracted using an RNease plus

mini kit from Qiagen. Semi-quantitative RT-PCR was performed with SuperScript® III One-

Step RT-PCR System with Platinum® Taq High Fidelity (Invitrogen), using the following reaction mixture: 12.5 μl of 2x reaction mix, 1 μg RNA, 1 μl Superscript III RT/Taq, 1.0 μl each of forward and reverse primers for human SNX5 (Santa Cruz), and variable nuclease-free deionized H2O to make a final reaction mixture of 25 μl. The following thermal cycler settings

were: 55oC for 30 minutes; followed by a denaturation step of 94oC for 2 minutes; 30-40 cycles of 94oC for 30 seconds; then an annealing step of 55oC for 30 seconds; and amplification at 68oC

for 1 minute. These steps were followed by a single elongation step consisting of 68oC for 7

minutes. The amplificates were run in a 2% agarose gel (with 0.5 μg/ml ethidium bromide) along

with an appropriate DNA ladder (100 bp or 1 kb plus ladder). DNA bands were visualized using

the UVP Biospectrum ®500 imaging system.

5.4. Quantitative real-time PCR (qRT-PCR)

Equal amounts of RNA (1 μg) were loaded for cDNA synthesis, which was conducted using

Tetro cDNA Synthesis Kit from Bioline. One μl cDNA was used as template for the reaction, and the standard curve was obtained for each pair of primers. RT-qPCR was then performed using a 7900HT Fast Real-Time PCR machine and SYBR® Green PCR Master Mix (Applied

Biosystems). Relative amounts of SNX5, IRβ and IDE were normalized by β-actin. Thermal cycler settings were: 50oC for 2 minutes; 95oC for 10 minutes; 40 cycles of 95oC for 15 seconds;

59oC for 1 minute, 95oC for 15 seconds; and 60oC for 15 seconds (dissociation curve).

The cDNA sequences were obtained from PubMed website (http://www.ncbi.nlm.nih.gov/

sites/entrez?db=nucleotide). The primers were designed using GenScript Real-time PCR

(TaqMan) Primer Design tool in the Genscript website (http://www.genscript.com).

Primers are listed below:

Genes Primers

Forward: ACGTTTCAGAGCCCAGAGTT SNX5 Reverse: TCGAGGACCATCAAAGTCG

Forward: AGACCTTGGAAATTGGGAACT IRβ Reverse: TCTGACAAGCAGAGTTTGGG

Forward:TTCCAAGAAGAACATCTTAAACAACT IDE Reverse: ACCTTCATGCCCAATGAGAT

Forward: ACCTGTACGCCAACACAGTG β-actin Reverse: ACACGGAGTACTTGCGCTCA

5.5. SNX5 and D1R shRNA stable transfection

Fugene 6 transfection reagent was used to transfect an SNX5 shRNA construct into hRPTCs.

One day post-transfection, puromycin, a selective antibiotic, was added into the plates at various

concentrations, and the cells were incubated for 14 days at 37oC. Single clones were selected for subsequent experiments.

5.6. SNX5 siRNA transfection

Lipofectamine™ RNAiMAX Transfection Reagent was used to transfect hRPTCs with SNX5 siRNA (Santa Cruz). The cells were seeded into 6-well plate one day before the transfection. 33

After the cells reached 70-80% confluence, the medium was changed to serum-free medium.

Four μl transfection reagent and 5 μl siRNA stock solution (10 μM) were mixed and incubated at room temperature for 20-30 minutes. Non-transfected, transfection reagent only, and scrambled siRNA-transfected hRPTCs were used as negative controls. Between 4-6 hours post-transfection, the same amount of complete medium was added into each well. The cells were harvested after

48 hours for RNA extraction and RT-qPCR and after 72 hours for total protein extraction and western blot.

5.7. Western blot

Total cell lysates were prepared from cells using RIPA lysis buffer supplemented with a cocktail of protease and phosphatase inhibitors. Samples were centrifuged at 2,500 x g to remove the insoluble debris. The protein concentration of the supernatant was quantified using a BCA kit

(Pierce). Uniform amounts of protein were run in a 10% SDS-polyacrylamide gel along with a protein marker (Fermentas* PageRuler* Protein Ladder from Fisher Scientific), and electro- transferred using the semi-dry method onto a nitrocellulose membrane from BioRad. PBS with

1% casein was used to block the membranes at room temperature for 1 hour. The primary antibodies were diluted in antibody diluent (Invitrogen) and incubated with the membranes overnight with rocking at 4oC. For each antibody, the following dilutions were used: SNX5

(1:500); IRβ (1:500); IDE (1:1000); D1R (1:500); IRS1 (1:1000); Cocktail 1 (1:1000); tAkt

(1:1000); GAPDH (1:5000); and Cathepsin D (1:500). This was followed by 3 ten-minute

washes in 1X PBST (20X PBS with 0.05% Tween-20 from TEKNOVA). The secondary

antibodies were obtained from Santa Cruz or from Li-cor. Donkey anti-mouse IgG-HRP, donkey anti-rabbit IgG-HRP and donkey anti-goat IgG-HRP were from Santa Cruz and used at a 1:5000

dilution. IRDye donkey anti-mouse 800CW and 680LT, IRDye donkey anti-rabbit 800CW and

680LT, IRDye donkey anti-goat 800CW and 680LT were from Li-cor Biosciences and used at a

1:10,000 dilution. The bands were analyzed by either Image J or Li-cor Odyssey software.

5.8. Co-immunoprecipitation

Co-immunoprecipitation was performed using an Immunoprecipitation Kit (Protein G) from

Roche Applied Science. Buffer 1 (50 mM Tris-Hcl, pH 7.5, 150 mM NaCl, 1% Nonidet P40,

0.5% sodium deoxycholate, protease inhibitor) was used to lyze the cells, and the cell lysates were pre-cleared by using 50 μl of protein A/G Plus-Agarose (Santa Cruz) for 30 minutes with rocking at 4oC. The protein levels in the supernatant were quantified using the BCA kit, and

uniform amounts (500~800 μg) of protein were immunoprecipitated with a primary antibody (2

μg) specific for the protein of interest for 2 hours at room temperature. Fifty μl of Protein G

beads were then added, and the mixture was incubated overnight at 4oC. Normal Goat IgG, normal Mouse IgG and normal Rabbit IgG were obtained from Santa Cruz and used as controls.

The beads were washed twice with buffer 1, twice with buffer 2 (50 mM Tris-Hcl, pH 7.5, 500 mM NaCl, 0.1% Nonidet P40, 0.05% sodium deoxycholate), and once with buffer 3 (10 mM

Tris-HCl, pH 7.5, 0.1% Nonidet P40, 0.05% sodium deoxycholate) before fifty μl of 2X loading buffer was added to the tube. The samples were boiled for 5 minutes then resolved by western blot.

5.9. Immunofluorescence and laser scanning confocal microscopy

All of the following reactions were performed at room temperature, unless otherwise specified. Cells were grown on glass coverslips and fixed for 20 minutes with 4% cold paraformaldehyde (USB Corporation #19943). They were then permeabilized for 5 minutes with

0.05% Triton X, followed by three washes with PBS. The cells were then subjected to immunostaining with appropriately diluted antibodies against SNX5, IRβ, D1R, and IDE in PBS containing 3% normal donkey serum (blocking buffer) for one hour at room temperature or overnight at 4oC. The secondary antibodies (Alexa Fluor® 488 donkey anti-mouse IgG (H+L),

Alexa Fluor® 488 donkey anti-rabbit IgG (H+L) and Alexa Fluor® 568 donkey anti-goat IgG

(H+L) were used at room temperature for 1 hour. The fluorescence images of the immunostained cells were obtained using laser scanning confocal microscopy and the fluorescence densities were quantified using the MetaMorph image analysis software.

5.10. Immunohistochemistry

Kidney samples (rat and human) were embedded in paraffin and 4-μm thick sections were mounted on glass slides. Immunohistochemistry was performed following standard procedures.

In a dry oven (60oC), the slides were incubated in xylene for 1 hour for deparaffinization. They were then washed twice for 3 minutes in 100%, 95%, and 75% ethanol, followed by a 5-minute wash in tap water for hydration. The slides were boiled in sodium citrate buffer (pH 6.0) for 3 minutes for antigen retrieval and then cooled to room temperature. Then, the slides were washed

3 times for 5 minutes in PBS and blocked in 1% BSA blocking buffer for 30 minutes at room temperature. Double-staining with the following pairs of antibodies was performed: SNX5 and

IRβ, D1R, and IRβ; SNX5 and IDE; and D1R and IDE. The primary antibodies were added to the top of the tissues at a 1:50 dilution and incubated at 4oC overnight. After washing 3 times, each for 5 minutes in PBS, the secondary antibodies were added and incubated for 1 hour at room temperature. The slides were then washed three more times for 5 minutes in PBS. The slides were mounted using ProLong ® Gold antifade reagent with DAPI (from Invitrogen) and imaged

with an LSM 510 confocal microscope at Children’s National Medical Center.

5.11. Antibody labeling

Antibodies directed against SNX5, D1R, IRβ, and IDE were labeled with the APEX™ Alexa

Fluor® 488 Antibody Labeling Kit and APEX™ Alexa Fluor® 555 Antibody Labeling Kit. An

APEX™ antibody labeling tip was hydrated by applying 100 μL of washing buffer to the resin in

the labeling tip and incubated for 30 minutes at room temperature. Ten μl of IgG antibody

solution was added to the top of the resin and gently pushed onto the resin using an elution

syringe. Two μL DMSO and 18 μL labeling buffer were added to dissolve the reactive dye. Ten

μL of the reactive dye were added to the top of the resin and incubated overnight at 4°C. An

APEX™ antibody labeling tip was washed twice with 50 μL washing buffer, and then 40 μL

elution buffer were added to the top of resin and transferred to a clean microcentrifuge tube

containing 10 μL neutralization buffer. A 1:10 dilution of labeled antibodies was used for

Fluorescence Resonance Energy Transfer (FRET).

5.12. FRET microscopy and data processing

The fluorophore pairs used for FRET imaging in this study were Alexa Fluor 555 (acceptor dipole) conjugated with D1R antibody and pIR-Alexa Fluor 488 (donor dipole). Fluorophore

pairs were obtained from Invitrogen. Seven images were acquired for each FRET analysis with

an Olympus Fluoview FV300 laser scanning confocal microscope equipped with a 60 × /1.4 NA

objective, an Argon (488 nm) and HeNe (543 nm) laser, emission filters of 515/50 nm, and a

590-nm long press (LP) filter. Images were acquired using the facilities and equipment at the

Georgetown University Lombardi Cancer Center.

Samples were labeled either individually with donor or acceptor fluorophores, or with both

donor and acceptor fluorophores, simultaneously. All samples were imaged under the same

conditions. Uncorrected FRET images (uFRET) were acquired with donor excitation in the

acceptor channel, which included pure FRET (pFRET) and contaminations from both donor and

acceptor spectral bleed-through (DSBT and ASBT). pFRET images were generated by removal

of DSBT and ASBT on the basis of matched fluorescence levels between the double-labeled

specimen and the single-labeled reference specimens. ROIs (regions of interest) were then

selected from the uFRET images and subjected to further analysis196,

E% = 1 – {Ida/(Ida + pFRET × (Pd/Pa) × (Sd/Sa)× (Qd/Qa) },)

where Pd and Pa are the photo multiplier tube (PMT) gains of donor and acceptor channels;

Sd and Sa are the spectral sensitivity of donor and acceptor channels provided by the manufacturer; Qd and Qa are the donor and acceptor quantum yield measured by spectrofluorometer, as described197. Ida is the image of donor excitation in the donor channel of the double-labeled samples after removing the background; and pFRET is the “processed FRET”

or “pure FRET.” The calculation of distance between donor and acceptor (r) was based on the

1/6,198 equation as described in r=R0[(1/E)−1] .

5.13. Insulin degrading enzyme (IDE) activity

InnoZyme™ Insulysin/IDE Immunocapture Activity Assay Kit (Calbiochem) was used to measure IDE activity. hRPTCs were lysed with CytoBuster™ Protein Extraction Reagent from

EMD 4Biosciences. The cell lysate protein concentration was quantified using a BCA kit

(Pierce). Uniform amounts of protein were adjusted with lysis buffer. The standard curve was

created using different dilutions of purified rat insulin provided in the kit and 100 μL of sample

buffer used as a blank control. One hundred μL total lysates were added to the plate provided with the kit and incubated at room temperature for 1 hour with shaking followed by 5 washes with 1X sample buffer. Finally, one hundred μL substrate was added to the plate and followed by a 2-4 hour long incubation at 37oC. The fluorescence of the plate with 100 μL substrate was measured with Vector at 350-410 nm.

5.14. Insulin receptor (IR) degradation

hRPTCs were seeded in 6-well plates and transfected with non-silencing mock and SNX5 siRNA. Cells were treated with cycloheximide solution (CHX, 100 mg/mL diluted 1:2000 in

DMSO), chloroquine (25 mM diluted 1:1000), 66 hours post-transfection. The first group was treated with CHX only and the second group was treated with CHX plus chloroquine. After a 7- hour treatment, the cells were harvested and the protein expression of the samples was detected by western blot. All of the drugs were obtained from Sigma.

5.15. Densitometry

Band densities of amplificates in agarose gels were measured with Image J software. The band densities of proteins in SDS-polyacrylamide gels were measured using either an Image J software or a Li-cor machine.

5.16. Co-localization measurement

Co-localization of SNX5 and IRβ, D1R and IRβ, SNX5 and IDE, and D1R and IDE was analyzed by MetaMorph image analysis software.

5.17. Statistical analysis

Results are reported as Mean ± SEM (standard error of the mean). Significant differences between two groups were determined by Student’s t-test. Significance among groups was

determined by one-way factorial ANOVA followed by Student-Newman-Keuls tests. A P value

< 0.05 was considered significant difference.

5.18. Pharmacological agents and final concentrations

All drugs were freshly prepared from stock solutions in a dark environment. A 1:1000 dilution was usually used. The final concentrations of different drugs were as follows:

Dopamine D1-like receptor agonist: Fenoldopam (1 μM)

Insulin solution (100 nM)

De novo protein synthesis inhibitor: CHX (50 μg/mL)

Lysosomal inhibitor: Chloroquine (25 μM)

Proteasosomal inhibitor: Epoxomicin (50 nM)

CHAPTER VI RESULTS OF THE STUDIES ON SNX5, D1R AND IRΒ

6.1 SNX5 expression in models of hypertension and obesity

6.1.1 Serum insulin levels in WKY rats with SNX5 siRNA injection into the renal cortex

SNX5 is one of the members of the SNX family that is involved in many aspects of

endocytosis and receptor trafficking32,33. SNXs are involved in the trafficking of GPCRs in the

kidney and the Center for Molecular Physiology Research is involved in deciphering the role of

some members of the GPCR superfamily (e.g., dopamine, angiotensin, endothelin,

cholecystokinin) in the regulation of ion transport.

In experiments performed at the Center for Molecular Physiology Research, Children’s

National Medical Center, renal SNX5 expression was decreased selectively in the remaining

kidney of uninephrectomized WKY rats. SNX5 siRNA was infused continuously into the renal

cortex for 7 days via an osmotic minipump implanted in the abdomen. Vehicle and scrambled

siRNA were used as controls. SNX5 is located at chromosome 20p11, a locus that is linked to

high insulin levels in hypertensive subjects186. Therefore, serum insulin levels were measured in

these rats. A selective decrease in renal SNX5 expression in uninephrectomized WKY rats

resulted in a significant increase in serum insulin levels (Figure 4).

6.1.2 SNX5 expression in animals and RPTCs

We quantified the renal expression of SNX5 by immunoblotting. Specificity of the SNX5 antibody was tested by preblocking the SNX5 antibody with its immunizing peptide prior to using it for immunoblotting. The band (~47-51 kDa) was detected only when the antibody was not pre-incubated with the immunizing peptide, indicating the specificity of the SNX5 antibody

(Figure 5). In rats, the expression of SNX5 was the highest in the liver and followed by the kidney and pancreas. There was minimal expression of SNX5 in the intestine and heart (Figure

5).

In obese, insulin-resistant Zucker rats on normal salt diet, renal SNX5 expression was decreased significantly compared to lean Zucker rats (Figure 6). To determine the mechanism by

which SNX5 regulates serum insulin levels, we measured SNX5 protein expression in RPTCs

from WKY and SHRs (wRPTCs and sRPTCs, respectively). SNX5 expression was significantly

decreased in sRPTCs compared to that in wRPTCs (Figure 7). To determine the relevance of the rodent studies to humans, SNX5 expression in hRPTCs from normotensive subjects and hypertensive patients was also measured. SNX5 expression was significantly decreased in hRPTCs from hypertensive patients compared to hRPTCs from normotensive subjects (Figure

8). These data suggest that SNX5 may be involved in hypertension, obesity, insulin resistance, and/or their combination (metabolic syndrome). In addition, SNX5 may interact with D1R

7,64,68,72,74,78,88,91,192 87,172 because D1R function is impaired in SHRs and obese Zucker rats .

Figure 4. Serum insulin levels resulting from the chronic decrease in renal SNX5

expression in WKY rats. A decrease in renal SNX5 expression increased serum insulin levels

in WKY rats. Veh: vehicle-infused rats, Scr: scrambled siRNA- infused rats, siRNA: SNX5 siRNA-infused rats (Student’s t-tests).

Figure 5. SNX5 antibody specificity and SNX5 distribution in rat tissues. The band that

SNX5 antibody recognizes is around 47~51 kDa. Addition of the immunizing peptide to the diluted SNX5 antibody solution prior to immunoblotting prevented the visualization of the

47~51 kDa band. GAPDH expression was used as internal control (A). The tissues were homogenized and total lysates and immunoblotted using the specific SNX5 antibody (B). SNX5 expression was highest in the liver followed by the kidney and pancreas. SNX5 was expressed minimally in the intestine and heart.

Figure 6. SNX5 expression in the kidney of lean and obese rats. SNX5 expression was significantly decreased in obese Zucker rats compared to lean Zucker rats (n=4, Student’s t-test).

Figure 7. SNX5 expression in wRPTCs and sRPTCs. SNX5 expression was significantly decreased in sRPTCs compared to wRPTCs (n=3, Student’s t-test).

Figure 8. SNX5 expression in hRPTCs from normotensive subjects and hypertensive patients. SNX5 expression was significantly decreased in hRPTCs from hypertensive patients compared to hPTCs from normotensive subjects (n=3, Student’s t-test).

6.2 Interaction among SNX5, D1R, and IRβ in hRPTCs

Akt is a downstream protein of PDK1 in the insulin signaling pathway and is highly phosphorylated by insulin106. To determine if hRPTCs respond to insulin, we quantified the

phosphorylated form of Akt (pAkt) after treating the cells with insulin. We found that the lowest

concentration of insulin that increased pAkt abundance was 100 nM (Figure 9), in agreement

with published reports199.

6.2.1 Interaction between SNX5 and IRβ

The cellular distribution of SNX5 and IRβ in hRPTCs was determined by laser scanning confocal microscopy. There was minimal co-localization between SNX5 and IRβ in the basal state. Some co-localization was observed between SNX5 and IRβ after 15 and 30 minutes of insulin (100 nM) treatment (Figure 10). The distribution of SNX5 and IRβ was also studied in human kidney. Both SNX5 and IRβ were expressed in all the nephron segments where the co- localization (yellow signal) was observed. IRβ but not SNX5 was expressed in glomeruli

(Figure 11). The cellular distribution of SNX5 and IRβ in rat kidney was also determined. As in the human kidney, both SNX5 and IRβ are expressed in all segments of the nephron. Their co- localization (yellow signal) was observed only in the brush border and apical membranes

(Figure 12) of proximal tubules, which was unlike that observed in the human kidney where both SNX5 and IRβ were evenly distributed throughout the cell. However, there was no co- immunoprecipitation between SNX5 and IRβ in the basal state or even with insulin (100 nM) or fenoldopam (1 μM) treatment (Figure 13).

To determine if SNX5 regulates IRβ, a plasmid that encodes for a short hairpin loop RNA of

SNX5 (shRNA) was transfected into hRPTCs to silence the expression of endogenous SNX5.

One day post-transfection, puromycin, a selective antibiotic, was added into the plates, and then

the cells were incubated for 14 days at 37oC. Single clones were selected and allowed to grow to

70-80% confluence. Immunoblotting showed that SNX5 expression was decreased by about 50%

in SNX5 shRNA-transfected hRPTCs (Figure 14). Silencing the expression of SNX5 decreased

the expression of IRβ by 70% (Figure 15). The decreased expression of IRβ may be related to

decreased transcription, decreased translation, or increased degradation.

To determine if the decreased protein expression is related to decreased gene transcription, mRNA expression of IR was quantified by real-time PCR (qRT-PCR) in SNX5 shRNA- transfected hRPTCs. Silencing SNX5 caused a ~40% decrease in IR mRNA expression without affecting the mRNA expression of actin, a housekeeping gene, (Figure 16). These results indicate that SNX5 regulates the transcription of IR. However, our studies show that the decrease in IRβ protein expression when SNX5 is silenced cannot be explained completely by its effect of transcription. Whereas, silencing of SNX5 decreased the protein expression of IRβ by 70%, IRβ mRNA expression was decreased by only ~40%. Therefore, the degradation of IRβ was also measured.

CHX (50 μg/ml, 7 hours) inhibits translation and blocks de novo protein synthesis.

Chloroquine inhibits protein degradation by being a lysosomal inhibitor200. The decreased

expression of IRβ in SNX5-siRNA-treated hRPTCs was partially prevented by CHX treatment.

However, it was almost completely abrogated by chloroquine (25 μM, 7 hours) in SNX5 siRNA-

transfected hRPTCs (Figure 17).

IRS1 is an adaptor protein and its phosphorylation initiates downstream insulin signaling pathways. The expression of total IRS1 (tIRS1) was increased in SNX5 shRNA-transfected

hRPTCs compared to NT and EV-transfected hRPTCs. In contrast, the amount of phosphorylated IRS1 (pIRS1) was decreased significantly in SNX5 shRNA-transfected hRPTCs

(Figure 18).

Akt is downstream of pIRS in the insulin signaling pathway that is involved in the metabolic effects of insulin. The phosphorylated Akt (pAkt) abundance was markedly increased when

SNX5 was silenced in SNX5 shRNA-transfected hRPTCs. However, the expression level of total

Akt (tAkt) was not changed (Figure 19).

In the basal state, pAkt abundance was significantly increased when SNX5 is silenced.

However, its (SNX5) silencing impaired the increase in pAkt abundance in response to insulin

(100 nM, 30 minutes) in hRPTCs (Figure 20).

Figure 9. Effect of insulin on pAkt abundance in hRPTCs. hRPTCs were treated with varying

concentrations of insulin, and then tAkt and pAkt abundance were quantified by immunoblotting.

The lowest concentration of insulin that increased pAkt abundance was 100 nM.

Figure 10. Co-localization of SNX5 and IRβ in hRPTCs. IRβ (green) co-localized weakly with SNX5 (red) after 15 and 30 minutes of insulin (100 nM) treatment in hRPTCs.

Figure 11. Co-localization of SNX5 and IRβ in human kidney (100X). IRβ (green) and SNX5

(red) co-localized (yellow signal) in renal proximal tubules and other nephron segments of the human kidney. The inset shows an area under higher magnification.

Figure 12. Co-localization of SNX5 and IRβ in rat kidney (200X). IRβ (green) and SNX5

(red) co-localized at the brush borders (yellow signal) of RPTs in rat kidney. IRβ was also expressed in sub-apical areas of RPTs in rat kidney. The inset shows an area under higher magnification.

Figure 13. Co-immunoprecipitation of SNX5 and IRβ in hRPTCs. SNX5 and IRβ did not co- immunoprecipitate in hRPTCs in the basal state or even when treated with insulin (100 nM) or fenoldopam (1 μM) for 30 minutes. Negative control: goat normal IgG, positive control: immunoprecipitation and immunoblotting with IRβ antibody, another positive control: whole lysates.

Figure 14. SNX5 expression in SNX5 shRNA-transfected hRPTCs. SNX5 expression was

decreased in SNX5 shRNA-transfected hRPTCs compared to NT and EV-transfected hRPTCs

(n=3, one-way ANOVA followed by Student-Newman-Keuls test). NT: non-transfected hRPTCs, EV: empty vector-transfected hRPTCs, SNX5 shRNA: SNX5 shRNA-transfected hRPTCs.

Figure 15. IRβ expression in SNX5 shRNA-transfected hRPTCs. The expression of IRβ was

decreased in SNX5 shRNA-transfected hRPTCs compared to NT and EV-transfected hRPTCs

(n=3, one-way ANOVA followed by Student-Newman-Keuls test). NT: non-transfected hRPTCs, EV: empty vector-transfected hRPTCs, SNX5 shRNA: SNX5 shRNA-transfected hRPTCs.

Figure 16. IR expression in SNX5 siRNA-transfected hRPTCs at mRNA level. IR mRNA expression, determined by quantitative real-time PCR (qRT-PCR), was decreased in SNX5 siRNA-transfected hRPTCs. However, the quantity of actin, a housekeeping gene, was not changed in these cells. The standard curve was performed for each pair of primers to obtain directly the relative quantity (n=6, Student’s t-test).

Figure 17. IRβ expression in SNX5 siRNA-transfected hRPTCs treated with CHX and chloroquine. CHX (50 μg/ml) inhibits the translation and blocks de novo protein synthesis, while chloroquine inhibits protein degradation by being a lysosomal inhibitor. The decreased expression of IRβ in SNX5-siRNA-treated hRPTCs was partially prevented by CHX treatment.

However, it was almost completely abrogated by chloroquine (n=6, Student’s t-test).

Figure 18. tIRS1 and pIRS1 abundance in SNX5 shRNA-transfected hRPTCs. The ratio of

pIRS1 to tIRS1 was decreased in SNX5 shRNA-transfected hRPTCs (A, B). However, the

expression of tIRS1 was increased significantly in SNX5 shRNA-transfected hRPTCs (C) (n=3,

one-way ANOVA followed by Student-Newman-Keuls test). NT: non-transfected hRPTCs, EV: empty vector-transfected hRPTCs, SNX5 shRNA: SNX5 shRNA-transfected hRPTCs.

Figure 19. tAkt and pAkt abundance in SNX5 shRNA-transfected hRPTCs. The ratio of

pAkt to tAkt was increased in SNX5 shRNA-transfected hRPTCs (A, B). In contrast, tAkt

expression was not changed in SNX5 shRNA-transfected hRPTCs (C) (n=3, one-way ANOVA

followed by Student-Newman-Keuls test). NT: non-transfected hRPTCs, EV: empty vector- transfected hRPTCs, SNX5 shRNA: SNX5 shRNA-transfected hRPTCs.

Figure 20. Akt phosphorylation with or without insulin treatment. The ratio of pAkt to tAkt

increased significantly in SNX5 siRNA-transfected hRPTCs in the basal state. tAkt expression was not changed with SNX5 depletion. However, pAkt abundance was markedly increased by insulin (100 nM) in control cells but the increase was blunted in cells depleted of their endogenous SNX5 (n=3, Student’s t-test).

6.2.2 Interaction between D1R and IRβ

There have been numerous reports on the role of renal dopamine receptors in diabetes. D2-like

receptor stimulation with bromocriptine does not affect serum glucose or insulin levels in type II

diabetic humans. However, addition of bromocriptine to sulfonyl urea improves serum glucose

201 202 control without increasing insulin concentrations . The involvement of the D2-like receptor in type II DM is unclear.

Renal D1R function is defective in hypertension and diabetes. Fenoldopam, a D1-like receptor agonist, improves the decreased insulin sensitivity and renal function in streptozotocin (STZ)-

induced type II diabetes in rats. Fenoldopam decreased serum glucose, insulin, cholesterol,

triglyceride, urea, creatinine and blood pressure in these diabetic rats172,203. These observations

indicate a close link between dopamine receptors and diabetes mellitus.

The cellular distribution of the D1R and IRβ in hRPTCs was determined by laser scanning

confocal microscopy. There was some co-localization of D1R and IRβ at the perinuclear area in

the basal state. Their co-localization increased with insulin (100 nM) treatment, reaching

maximum co-localization at 30 minutes. However, 60 minutes of insulin treatment decreased

their co-localization relative to 30 minute-treatment (Figure 21). The distribution of D1R and

IRβ in human kidney was also determined. Both D1R and IRβ were expressed at the brush border

of proximal tubules where co-localization (yellow signal) was observed (Figure 22) different

from the co-localization of SNX5 and IRβ. The distribution of D1R and IRβ in rat kidney was

also determined; IRβ was expressed to the greatest extent in brush borders of proximal tubules

(Figure 23) similar to those shown in Figure 12. There was minimal expression of D1R and IRβ in glomeruli consistent with that seen in the human kidney (Figure 11). As expected D1R

expression was found in all cortical tubules, especially in the brush borders of proximal tubules.

There was co-localization of D1R and IRβ at the brush border of proximal tubules (yellow signal)

(Figure 23), similar to the co-localization of SNX5 and IRβ (Figure 12). Co-localization was minimal in other nephron segments.

As aforementioned the resolution of laser scanning confocal microscopy is around 200 nm.

To further refine the resolution of the interaction between D1R and IRβ, Fluorescence Resonance

Energy Transfer (FRET) was employed. FRET is a biophysical imaging method used to

determine the distance between two specific molecules. The distance by which FRET can occur

is limited to 1-10 nm204. Alexa Fluor 488 labeled-IRβ was the donor and Alexa Fluor 555

labeled-D1R was the acceptor. The cells were treated by insulin (100 nM) for 30 minutes and the

time of their maximum co-localization observed with confocal microscopy. There was FRET

between IRβ and D1R with the efficiency of transfer (E%) between D1R and IRβ around 30%

(Figure 24).

Unlike the absence of a physical interaction between SNX5 and IRβ (Figure 13), there was a

physical interaction between D1R and IRβ in hRPTCs, determined by co-immunoprecipitation.

Co-immunoprecipitation between D1R and IRβ, observed in the basal state, was an increased

with insulin (100 nM, 30 minutes) treatment (Figure 25).

To determine if D1R can regulate IRβ, a plasmid that encodes for a hairpin loop RNA

(shRNA) of D1R was transfected into the hRPTCs to silence the expression of endogenous D1R.

D1R expression was decreased by 70% in D1R shRNA-transfected hRPTCs (Figure 26).

Endogenous IRβ, IRS1, and Akt expression was also measured in the D1R shRNA-transfected

hRPTCs. The shRNA-mediated silencing of D1R decreased IRβ protein expression (Figure 27),

and pIRS1 (Figure 28), similar to the effect of SNX5 silencing in Figure 18. Silencing of D1R

did not affect tIRS1 expression (Figure 28), unlike the increase observed with SNX5 silencing in

Figure 18. Silencing of D1R decreased pAkt abundance (Figure 29) the opposite of that

observed with silencing of SNX5 which increased pAkt in hRPTCs (Figure 19), although it decreased the stimulatory effect of insulin (Figure 20) in these cells. However, silencing of D1R

did not affect tAkt expression (Figure 29) similar to that observed with SNX5 silencing in

Figure 19.

Previous studies in our laboratory (Jose et al.) showed that SNX5 physically interacted with

D1R and SNX5 is involved in D1R trafficking (Jose et al., unpublished data). Since the D1R

physically interacts with both SNX5 and IRβ, it is possible that SNX5 regulates IRβ through its

interaction and regulation of D1R. Therefore, we studied the co-localization of D1R, SNX5, and

IRβ. There was a slight co-localization at the perinuclear area (white signal) in the basal state

that gradually increased with insulin treatment (100 nM), and peaked at 30 minutes treatment.

Their co-localization decreased within 60 minutes of insulin treatment (Figure 30), reminiscent

of the decrease in D1R and IRβ co-localization with 60 minutes of insulin treatment in Figure

21. The co-localization of D1R, SNX5, and IRβ was quantified using MetaMorph Image

Analysis Software. The images processed by that software showed that the co-localization was maximal at 30 minutes of insulin treatment (Figure 31).

Figure 21. Co-localization of D1R and IRβ in hRPTCs. D1R (red) and IRβ (green) co- localized in hRPTCs. Their co-localization, observed in the basal state, was increased gradually by insulin (100 nM) at the perinuclear areas, reaching a maximum at 30 minutes. Co-localization decreased with 60 minute-treatment.

Figure 22. Co-localization of D1R and IRβ in human kidney (400X). IR (green) and D1R (red) co-localized at the brush borders (yellow signal) of renal proximal tubules in human kidney. The inset shows a local area under higher magnification.

Figure 23. Co-localization of D1R and IRβ in rat kidney (200X). IRβ (green) and D1R (red) co-localized at the brush borders (yellow signal) of renal proximal tubules in rat kidney. The inset shows a local area under higher magnification.

Figure 24. Fluorescence Resonance Energy Transfer (FRET) between D1R and IRβ. Alexa

Fluor 488-labeled IRβ was used as the donor while Alexa Fluor 555-labeled D1R was used as the acceptor in the FRET dipole. The cells are treated with insulin for 30 minutes, the time of maximum co-localization observed with confocal microscopy. Seven images were taken and analyzed by image J FRET calculation program. The images (from left to right) are uFRET or uncorrected FRET, pFRET or processed or pure FRET, and E% or efficiency of energy transfer.

The presence of fluorescence indicates that the distance between D1R and IRβ is less than 10 nm with an E% around 30%.

Figure 25. Co-immunoprecipitation of D1R and IRβ in hRPTCs. There was co-

immunoprecipitation of D1R and IRβ in the basal state that was increased by insulin treatment

(100 nM, 30 minutes). Negative control: rabbit normal IgG, positive control:

immunoprecipitation and immunoblotting with D1R antibody, another positive control: whole

lysates. Note: IRβ antibody (Ab) was used for co-immunoprecipitation and D1R antibody (Ab) was used for immunoblotting.

Figure 26. D1R expression in D1R shRNA-transfected hRPTCs. The expression of D1R was decreased in D1R shRNA-transfected hRPTCs relative to NT and EV-transfected hRPTCs (n=3,

one-way ANOVA followed by Student-Newman-Keuls test). NT: non-transfected hRPTCs, EV: empty vector-transfected hRPTCs, D1R shRNA: D1R shRNA-transfected hRPTCs.

Figure 27. IRβ expression in D1R shRNA-transfected hRPTCs. The expression of IRβ was decreased significantly when D1R was silenced in D1R shRNA-transfected hRPTCs (n=3, one- way ANOVA followed by Student-Newman-Keuls test). NT: non-transfected hRPTCs, EV: empty vector-transfected hRPTCs, D1R shRNA: D1R shRNA-transfected hRPTCs.

Figure 28. tIRS1 and pIRS1 abundance in D1R shRNA-transfected hRPTCs. The ratio of pIRS1 to tIRS1 was decreased significantly in D1R shRNA-transfected hRPTCs compared to NT and EV-transfected hRPTCs (A, B). In contrast, tIRS expression was unchanged (C) (n=3, one- way ANOVA followed by Student-Newman-Keuls test). NT: non-transfected hRPTCs, EV: empty vector-transfected hRPTCs, D1R shRNA: D1R shRNA-transfected hRPTCs.

Figure 29. tAKT and pAKT abundance in D1R shRNA-transfected hRPTCs. The ratio of pAkt to tAkt was decreased significantly in D1R shRNA-transfected hRPTCs compared to NT

and EV-transfected hRPTCs (A, B). In contrast, tAkt expression was unchanged (C) (n=3, one-

way ANOVA followed by Student-Newman-Keuls test). NT: non-transfected hRPTCs, EV:

empty vector-transfected hRPTCs, D1R shRNA: D1R shRNA-transfected hRPTCs.

Figure 30. Co-localization of D1R, SNX5, and IRβ in hRPTCs. D1R (green), SNX5 (red) and

IRβ (blue) co-localized in hRPTCs. Their co-localization was increased gradually by insulin (100 nM) at the perinuclear area, reaching maximum at 30 minutes of treatment. Co-localization decreased with 60 minutes of insulin treatment.

Figure 31. Quantification of the co-localization of D1R, SNX5, and IRβ in hRPTCs. The co- localization of D1R, SNX5, and IRβ shown in Figure 30 was quantified using MetaMorph Image

Analysis Software. The images were processed images by MetaMorph Image Analysis Software.

The bar graph (A) shows that the co-localization of SNX5 and IRβ reached maximum at 30 minutes (30 minutes vs. other groups, * P=0.007, n=3, one-way ANOVA followed by Student-

Newman-Keuls test) and decreased at 60 minutes of insulin treatment. The bar graph (B) shows that the co-localization of D1R and IRβ also gradually increased from 5 to 30 minutes (30 minutes vs. 0 minute, * P=0.016, n=3, student’s t-test) and also decreased at 60 minutes of insulin treatment.

CHAPTER VII RESULTS OF THE STUDIES ON SNX5, D1R AND IDE

7.1 Interaction between SNX5 and IDE

IDE works as a major insulinase and degrades insulin with a high degree of specificity. The

internalized insulin that is separated from IRβ in the acidified endosomes becomes cross-linked

to IDE146,154.

As shown earlier, the selective intrarenal infusion of SNX5 siRNA increased the serum

insulin levels in WKY rats but decreased them in SHRs (Jose et al, unpublished data), a rat strain

that is hypertensive with some components of the metabolic syndrome, including a much higher

serum insulin levels than WKY rats. The IDE protein expression was also decreased in RPTCs

from SHRs compared to those from WKY rats (Figure 32).

The distribution of SNX5 and IDE was observed in hRPTCs by laser scanning confocal microscopy. SNX5 co-localized weakly with IDE at the perinuclear area in the basal state.

Insulin (100 nM) treatment gradually increased the co-localization of SNX5 and IDE at the

perinuclear area from 5 to 15 minutes of treatment, reaching maximum at 30 minutes of

treatment. Co-localization decreased with 60 minutes of insulin treatment, relative to 30 minutes

of treatment (Figure 33). These findings are similar to that observed with the co-localization of

SNX5 and IRβ in Figure 10, D1R and IRβ in Figure 21, and SNX5 and D1R (Jose et al.,

unpublished data) with insulin treatment.

The distribution of SNX5 and IDE in human kidney was also determined. SNX5 and IDE are

expressed and co-localized in both proximal tubules and distal tubules where the yellow signal

was observed (Figure 34). The distribution of SNX5 and IDE in rat kidney was also determined.

There was minimal or no expression of IDE and SNX5 in glomeruli, consistent with those shown

in Figure 11. Both SNX5 and IDE are expressed and co-localized in the brush borders of proximal tubules and luminal membranes of distal tubules (yellow signal) (Figure 35). The co- localization of SNX5 and IDE in brush borders is similar to those observed with SNX5 and IRβ in Figures 12 and D1R and IRβ in Figures 22 and 23 and D1R and SNX5 (Jose et al.,

unpublished data).

The physical interaction between SNX5 and IDE was confirmed by co-immunoprecipitation.

Co-immunoprecipitation between SNX5 and IDE was observed in the basal state and after

insulin treatment for 30 minutes (Figure 36), which coincided with the time when co-

localization was most evident by confocal microscopy (Figure 33).

The expression and activity of IDE were also determined in SNX5 shRNA-transfected hRPTCs. Both IDE expression and activity were decreased significantly in SNX5 shRNA- transfected hRPTCs (Figure 37). The decreased IDE protein expression in SNX5 shRNA- transfected hRPTCs was associated with decreased IDE mRNA expression (Figure 38).

Cathepsin-D (CD), another insulinase, is an aspartic protease that gets activated at pH 5 in the endosomes where it degrades insulin157. CD protein expression was unaltered in SNX5 siRNA-

transfected hRPTCs (Figure 39).

Figure 32. IDE expression in WKY and SHRs. IDE expression was significantly decreased in

RPTCs from SHRs relative to those from WKY rats (n=3, Student’s t-test).

Figure 33. Co-localization of SNX5 and IDE in hRPTCs. SNX5 (red) and IDE (green) co- localized in hRPTCs. Their co-localization, observed in the basal state, was increased gradually by insulin (100 nM) at the perinuclear areas, reaching a maximum at 30 minutes. Co-localization decreased with 60 minute treatment.

Figure 34. Co-localization of SNX5 and IDE in human kidney (100X). IDE (green) and

SNX5 (red) co-localized at brush borders (yellow signal) of proximal tubules and luminal membranes of distal tubules of human kidney. The inset shows an area under higher magnification.

Figure 35. Co-localization of SNX5 and IDE in rat kidney (200X). IDE (green) and SNX5

(red) co-localized at the brush border (yellow signal) of proximal tubules and luminal side of distal tubules in rat kidney. The inset shows an area under higher magnification.

Figure 36. Co-immunoprecipitation between SNX5 and IDE in hRPTCs. There was co- immunoprecipitation of SNX5 and IDE that was increased with insulin treatment (100 nM, 30 minutes). Negative control: goat normal IgG, positive control: immunoprecipitation and immunoblotting with IDE antibody, another positive control: whole lysates. SNX5 antibody (Ab) was used for immunoprcipitation and IDE antibody was used for immunoblotting.

Figure 37. IDE expression and activity in SNX5 shRNA-transfected hRPTCs. IDE expression (A, B) and activity (C) were decreased in SNX5 shRNA-transfected hRPTCs compared to NT and EV transfected hRPTCs (n=3, one-way ANOVA followed by Student-

Newman-Keuls test). NT: non-transfected hRPTCs, EV: empty vector-transfected hRPTCs, D1R

shRNA: D1R shRNA-transfected hRPTCs.

Figure 38. Expression of IDE mRNA in SNX5 siRNA-transfected hRPTCs. IDE mRNA expression, quantified by real-time PCR (qRT-PCR), was decreased significantly in SNX5 siRNA-transfected hRPTCs. However, the expression of actin, a housekeeping gene, was not changed in these cells. The standard curve was performed for each pair of primers to obtain directly the relative quantity (n=6, Student’s t-test).

Figure 39. Cathepsin-D expression in SNX5 siRNA-transfected hRPTCs. Cathepsin D expression, another insulinase, was not changed in SNX5 siRNA-transfected hRPTCs (P>0.05, n=3, Student’s t-test).

7.2 Interaction between D1R and IDE

The distribution of D1R and IDE was determined in hRPTCs by laser scanning confocal microscopy. The D1R co-localized with IDE at the perinuclear area in the basal state and their

co-localization gradually increased after insulin treatment, reaching maximum at 30 minutes. Co-

localization decreased after 60 minutes of insulin treatment, relative to 30 minutes of insulin

treatment (Figure 40). The co-localization of D1R and IDE, quantified using the MetaMorph

Image Analysis Software, reached the maximum at 30 minutes of treatment with insulin (Figure

41), similar to those observed with SNX5 and IDE in Figure 38 and SNX5 and IRβ in Figure

10, D1R and IRβ in Figure 21 and SNX5 and D1R (Jose et al., unpublished data) with insulin

treatment.

The distribution of D1R and IDE in the human kidney was also studied. Both D1R and IDE

are expressed in the proximal tubules and co-localized mainly in the subapical areas (yellow

signal) (Figure 42), unlike the diffuse co-localization of SNX5 and IRβ in Figure 11 and D1R

and IRβ in Figure 22 only in the brush borders, in the human kidney.

The physical interaction between D1R and IDE was confirmed by co-immunoprecipitation in

the basal state which increased after insulin (100 nM, 30 minutes) treatment (Figure 43). In D1R

shRNA-transfected hRPTCs, IDE expression and activity were significantly decreased (Figure

44). These studies indicate that a decrease in D1R expression and function results in a decrease in

IDE expression and activity. Indeed, IDE expression is decreased significantly in SHRs which

64 have decreased D1R function .

To determine if D1R, SNX5 and IDE interact, their co-localization was studied in hRPTCs.

Their co-localization (white signal), which was observed in the basal state, increased gradually at

the perinuclear area with insulin treatment (100 nM), and reached maximum co-localization at 30 minutes. Their co-localization decreased with 60 minutes treatment with insulin, relative to the

60 minute treatment (Figures 45). The co-localization of D1R, SNX5 and IDE was quantified using MetaMorph Image Analysis Software. The images processed by that software showed that the co-localization was maximal at 30 minutes of insulin treatment (Figure 46). These findings are similar to those observed with the co-localization of SNX5 and IRβ in Figure 10, D1R and

IRβ in Figure 21, SNX5 and IDE in Figure 33 and SNX5 and D1R (Jose et al., unpublished data) with insulin treatment.

Figure 40. Co-localization of D1R and IDE in hRPTCs. D1R (green) and IDE (red) co- localized in hRPTCs. Their co-localization, observed in the basal state, was increased gradually by insulin (100 nM) at the perinuclear areas, reaching a maximum at 30 minutes. Co-localization decreased with 60 minute treatment, relative to the 30 minute treatment.

Figure 41. Quantification of the co-localization of D1R and IDE in hRPTCs. The co- localization of D1R, and IDE shown in Figure 40 was quantified using MetaMorph Image

Analysis Software. The images were processed images by MetaMorph Image Analysis Software.

The bar graph shows that the co-localization of D1R and IDE reached maximum at 30 minutes

(30 minutes vs. other groups, * P=0.009, n=3, one-way ANOVA followed by Student-Newman-

Keuls Method) and decreased at 60 minute insulin treatment, relative to 30 minute insulin

treatment. The cellular distribution of D1R, SNX5, and IDE are also shown.

Figure 42. Co-localization of D1R and IDE in proximal tubules of human kidney (400X).

IDE (green) and SNX5 (red) co-localized at the apical membranes (yellow signal) of proximal tubules in human kidney. The inset shows a local area under higher magnification.

Figure 43. Co-immunoprecipitation between D1R and IDE in hRPTCs. There was co- immunoprecipitation of D1R and IDE that was increased slightly with insulin treatmenty (100

nM, 30 minutes). Negative control: goat normal IgG and mouse normal IgG, positive control:

immunoprecipitation and immunoblotting with IDE antibody, another positive control: whole

lysates. D1R antibody (Ab) was used for immunoprecipitation while IDE antibody was used for

immunoblotting.

Figure 44. IDE expression and activity in D1R shRNA-transfected hRPTCs. IDE expression

(A, B) and activity (C) were decreased in D1R shRNA-transfected hRPTCs compared to non- transfected and EV transfected hRPTCs (n=3, one-way ANOVA followed by Student-Newman-

Keuls Method). NT: non-transfected hRPTCs, EV: empty vector-transfected hRPTCs, D1R

shRNA: D1R shRNA-transfected hRPTCs.

Figure 45. Co-localization among D1R, SNX5 and IDE in hRPTCs. D1R (green), SNX5 (red)

and IDE (blue) co-localized in hRPTCs. Their co-localization which was observed in the basal state increased gradually at the perinuclear area with insulin treatment (100 nM), reaching maximum co-localization at 30 minutes of insulin treatment. Co-localization decreased within 60

minutes of insulin treatment.

Figure 46. Quantification of the co-localization of SNX5 and IDE in hRPTCs. The co- localization of D1R, SNX5 and IRβ shown in Figure 45 was quantified using MetaMorph Image

Analysis Software. The co-localization of SNX5 and IDE reached maximum at 30 minutes of

insulin treatemtn (30 minutes vs. other groups, * P=0.025, n=3, one-way ANOVA followed by

Student-Newman-Keuls Method) and decreased with 60 minutes of insulin treatment.

CHAPTER VIII DISCUSSION

8.1 SNX5 regulates IRβ protein and mRNA expression and insulin signaling

Considerable progress has been made toward the elucidation of the cellular mechanisms of membrane receptor trafficking and signaling by SNXs. SNXs have been found to bind many receptors. For example, SNX1, SNX2, SNX4, and SNX6 have been reported to bind epithelial

growth factor receptor (EGFR), platelet-derived growth factor receptor (PDGFR), leptin receptor

and IR43, 205. SNX5 and SNX6 structurally resemble each other with 66% identity at amino acid

level206. However, the interaction of SNX5 with those receptors has not been well studied.

In rodents, we have shown that the protein expression of SNX5 was highest in the liver followed by the kidney and pancreas, and there was minimal protein expression of SNX5 in the intestine and heart. Although to date, there are no reports on tissue-specific expression of SNX5 protein expression, one research group did show tissue-specific expression of SNX5 mRNA by

Northern blot207 in human tissue. That study demonstrated that there were two different

molecular sizes of SNX5 mRNA and that the highest levels of SNX5 mRNA were found in

skeletal muscle and the kidney followed by the pancreas. They also reported that the liver has the

least SNX5 mRNA expression207. Species differences might explain the difference in high SNX5

protein expression in the rat liver versus low mRNA expression in human liver. Another

possibility is that the tissue-specific distribution of SNX5 mRNA expression does not correlate

with tissue-specific distribution of SNX5 protein expression due to translational regulation. Most

studies regarding the tissue distribution of SNXs have been conducted at the mRNA level.

Hence, it is not known whether the mRNA distribution reflects the protein distribution. In future

studies, it will be important to investigate the relationship between SNX5 mRNA and protein

expression in rodents as well as other species including humans.

In our findings, the highest protein expression of SNX5 in liver, kidney and pancreas suggest

a potential role of SNX5 in insulin metabolism since the pancreas is the only organ to produce

insulin, in contrast, the liver and kidney are major organs for insulin clearance100.

Interestingly, we found that renal SNX5 protein expression is decreased in RPTCs from SHRs and hypertensive patients and in obese Zucker rats that are not only hypertensive but also insulin resistant. It is, therefore, possible that SNX5 may be involved in insulin resistance. Indeed, high insulin levels in hypertensive patients has been linked to chromosome 20p11, where SNX5 gene

is located186. This observation, in combination with our findings, suggests a potential role of

SNX5 in both hypertension and insulin signaling. To date, as far as we know, no report has

shown either that any other SNXs protein expression variance in those hypertensive and insulin

resistant cell lines and animal models or that SNX5 protein expression variance in other animal

models, such as ob/ob mouse. Clearly this research field is still open for further investigations in

the future.

Our data showed that both in vivo and in vitro SNX5 and IRβ are adjacent to each other.

However, they do not co-immunoprecipitate either in the basal state or after insulin or

fenoldopam treatment indicating that they do not physically interact. Therefore, SNX5 and IRβ

co-localize, within 200 nm, the resolution of confocal microscopy, but do not physically interact.

These results indicate the limitation of confocal laser scanning microscopy. Besides IRβ, SNX5

also has been shown to co-localize with SNX1 and lysosomal-associated membrane protein 1

(LAMP1), and weakly co-localize with early endosome antigen 1 (EEA1) and TGN38, a marker

for the recycling endosome and trans-Golgi Network (TGN)34. Because the interaction of other

SNXs with the IR was mainly studied by way of co-immunoprecipitation, the interaction between SXN5 and IR went unnoticed. Recently, SNX9 is detected to co-immunoprecipitate with IR208. It is possible that the co-immunoprecipitation gives a false negative result, but it can

be ruled out by using appropriate positive and negative controls. In this dissertation, besides the

whole cell lysate that was used as a positive control, I also co-immunoprecipitates and immunoblots with the same antibody and use it as another positive control which was processed under exactly the same conditions with immunoprecipitation samples to avoid the false negative result.

Our data indicate that SNX5 seems to upregulate IR protein expression, in part by increasing

IR gene transcription. The mechanism by which SNX5 regulates the transcription of IR was not studied. However, it has been recently shown that SNX6 regulates transcription through binding breast cancer metastasis suppressor 1 (BRMS1)46. The Pim1-mediated phosphorylation of SNX6

causes its translocation from cytoplasm to the nucleus and consequent binding to the BRMS1209.

Although SNX6 and BRMS1 interact both in cytoplasm and the nucleus, the BRMS1 has largely been restricted to the cell nucleus where it functions as a transcriptional repressor210. SNX6, which is structurally and functionally close to SNX5, interacts with BRMS1 and enhances

BRMS1-dependent transcriptional repression46. To data, however, whether or not a similar mechanism is involved in the SNX5 regulation of IR transcription remains to be determined.

Our studies showed that the decrease in IRβ protein expression in human RPTCs when SNX5 is silenced cannot be explained completely by its effect of transcription or translation. Whereas, silencing of SNX5 decreased the protein expression of IRβ by 70%, IRβ mRNA expression was

decreased by only ~40%. When de novo protein synthesis of IRβ was blocked with CHX, silencing SNX5 was still associated with a decrease in IRβ protein expression, indicating a role of protein degradation. However, chloroquine, an inhibitor of lysosome activity, was found to nearly completely block the decrease in IRβ protein expression, suggesting a crucial role of lysosomes in SNX5 protecting IR from degradation. Indeed, SNX5 predominantly co-localized

with the late endosomal and lysosomal marker LAMP1. It has been reported that overexpression

of SNX5 protects the EGFR from degradation under EGF stimulation through the PX domain34.

SNX1, SNX2, SNX9, and SNX16 also have been shown to be involved in EGFR regulation.

However, they promote the EGFR degradation and exert antagonistic role with SNX5211-214.

Interestingly, SNX5 and EGFR, as with SNX5 and IR do not physically interact, which suggests

that protection from degradation may involve one or more adapter proteins34. Our demonstration

that SNX5 regulates IRβ expression at both protein and mRNA level indicates a novel function

of SNX5 in regulation of gene expression.

We also found that SNX5 protein expression is decreased in the kidney of obese, insulin-

resistant Zucker rats. The notion that SNX5 regulates IRβ protein expression is supported by Dr.

Ecelbarger’s work in which they showed that IRβ protein expression is also decreased in the

kidney of these rats159. SNX5 is not the major regulator of IR protein expression, but rather by insulin. Insulin exhibits a time and concentration-dependent decrease in IR concentration, which plays a vital role in the pathogenesis of insulin resistance in many disease states215. Recently, this

process has been found to be mediated by growth factor receptor-bound protein 10 (Grb10), an adapter protein that interacts with a number of tyrosine-phosphorylated growth factor receptors, including the IR216.

100

Since a lack of SNX5 was found to decrease the phosphorylation of IRS1 and Akt in response

to insulin treatment in SNX5-depleted hRPTCs, the decrease in IRβ expression caused by

downregulation of SNX5 expression in RPTCs is physiologically important. However, in the

basal state, the ratio of pAkt to tAkt was significantly increased when SNX5 was silenced.

Phosphorylated IRS acts as a second messenger within the cell to stimulate the transcription of

insulin-regulated genes111. Insulin-resistant, obese, and diabetic animals and humans have

decreased IRS protein expression112. Akt is a serine/threonine kinase that belongs to the protein

kinase B (PKB) family. It (Akt) is a downstream protein in the signaling of insulin but also those

others, including EGF, PDGF, fibroblast growth factor (FGF), integrin and others107,108. It is

possible that impairment in pAkt abundance in response to insulin is secondary to indirect

activation of those other signaling pathways. To our best knowledge, no studies have shed light

on the mechanism how SNXs regulate insulin signaling pathway. However, SNX9 has been

shown to interact with IR and is translocated from cytosol to plasma membrane with insulin

stimulation. The impaired IRS-PI3K-PDK-Akt insulin signaling with SNX5 depletion could

contribute to the development of some diseases, such as hypertension and the metabolic

syndrome, because IRS-PI3K-PDK-Akt is mainly involved in the stimulation of glucose

metabolism and glycogen/lipid/protein synthesis, called “metabolic effects”109. In contrast, another major insulin signaling pathway is Ras-MEK-MAPK which is predominantly involved in cell growth and regulation of gene expression105,106. Our demonstration implies a potential role

of SNX5 in insulin signaling and provides a promising target for the treatment of type II DM or

insulin resistance.

101

8.2 D1R interacts with IRβ and regulates its protein expression

The mechanism by which SNX5 regulates the IRβ protein expression does not involve physical interaction. Although SNX5 and IRβ co-localize in proximal tubules of the kidney and in RPTCs in rodents and humans, they do not physically interact, even with insulin treatment. If a physical interaction is important in the SNX5-mediated regulation of IRβ, then other proteins are that tether both SNX5 and IRβ are needed. D1R has been identified as a novel partner of

SNX5 (Jose et al.). Therefore, we determined if the D1R could be that interacting protein.

Our data showed that both in vivo and in vitro D1R and IRβ are co-localized to each other.

Moreover, the FRET was performed to narrow down the resolution (200nM) of confocal laser

scanning microscopy because the distance over which FRET can occur is limited to 1-10 nm.

The pFRET signal between D1R and IRβ provides further evidence that D1R and IRβ are in close

proximity. Co-immunoprecipitation between D1R and IRβ, observed in the basal state, is

increased with insulin treatment. Therefore, unlike the absence of a physical interaction between

SNX5 and IRβ, there is a physical interaction between D1R and IRβ. These observations suggest

that D1R interacts with IRβ and raise the possibility that the D1R may serve to tether SNX5 and

IRβ since the D1R physically interacts with both SNX5 and IRβ. SNX5, D1R, and IRβ co-

localize in human RPTCs and their colocalization is also increased with insulin treatment, which

presents the evidence that SNX5 regulates IRβ through the D1R because the D1R physically

interacts with both SNX5 and IRβ. SNX1 interacts and regulates D5R protein expression and trafficking like what SNX5 does to D1R. It is known that SNX1 co-immunoprecipitates with

43 IR , however, the interaction between D5R and IRβ has not been studied. It is good to clarify

102

how other dopamine receptors interact with and regulate IRβ in the future, and these findings

will deepen the understanding of their relationships and the mechanisms of related diseases.

The downregulation of the D1R decreases IRβ protein expression by about 35% which is

much less than the 70% decrease in IRβ protein expression caused by SNX5 downregulation. IR

transcription after D1R downregulation was not determined yet, therefore any of D1R-mediated regulation of IR transcription similar to that observed with SNX5 cannot be determined. These data indicate that the D1R may be less important than SNX5 in the regulation of IR protein expression in human RPTCs. Numerous studies have described alterations in renal D1R receptor

function in hypertension and diabetes. Fenoldopam improves the decreased insulin sensitivity

and renal function in STZ-induced type II diabetes in rats172,203. In contrast, high insulin level

172 decreases D1R protein expression in plasma membrane of proximal tubule cells . Furthermore,

insulin increased D1R serine phosphorylation mediated in a PI3K-dependent manner, which

increases PKC activity and GRK2 membranous translocation. D1R serine phosphorylation is known to contribute to receptor desensitization217. Moreover, fenoldopam decreases IR protein expression in vascular smooth muscle cells (VSMCs)189, which is opposite with our findings that

D1R actually increase IR protein expression in hRPTCs, suggesting that the regulation may be

tissue-specific. Dr. Zeng’s work has shown that PD128907, a D3R agonist, decreases IRβ protein

expression in VSMCs, which is confirmed to be tissue-specific since D3R stimulation does not

affect IRβ protein expression in RPTCs218. These observations indicate a close link between dopamine receptors and diabetes. Our data are expected to give an explanation, although partial, of why hypertension coincides with diabetes so frequently (up to 65% of people with diabetes also suffer from hypertension).

103

A simplified model of the interaction among SNX5, D1R, and IRβ is proposed and depicted in

Figure 47. We conclude that both SNX5 and D1R regulate the protein expression of IRβ, SNX5 regulates the protein expression of IRβ by regulating its transcription and its degradation in lysosomes. The mechanism by which SNX5 increases the degradation of IRβ is not known, but it is for sure not due to direct physical interaction, However, D1R, which can directly interact with

IRβ and regulate its protein expression, may act as the conduit to enable SNX5 to regulate IRβ.

Indeed, SNX5 has been shown to directly interact with D1R. The co-immunoprecipitation of D1R

and IRβ is increased by insulin, and the co-localization of SNX5 and IRβ, SNX5 and D1R, as well as SNX5, IRβ and D1R are increased by insulin. Therefore, an interaction between SNX5

and D1R regulates the protein expression of IRβ in the absence or presence of insulin. This

regulation of IRβ by SNX5 and D1R is important in the insulin signaling pathway.

The other SNXs that bind IR include SNX1, SNX2, SNX4, SNX6 and SNX943,205,208. Until

now, some work has been done in exploring the interactions among SNXs families, dopamine

receptors and IR, however, the map is far from being completed. One of the limited number of

59 these exemplary samples is the experimentally confirmed SNX1 binding to D5R . It therefore

can be expected that in the near future, the interaction between dopamine receptors and these

SNXs and the corresponding regulation mechanism will be one of the hotspots in the field of

receptor trafficking and regulation.

104

Figure 47. A simplified model of the interaction among SNX5, D1R, and IRβ. (A) In this model, insulin binding initiates the autophosphorylation of IRβ, the recruitment and 105

phosphorylation of IRS, and phosphorylation of Akt. After insulin and IRs are delivered to the

endosomes, insulin separates from the IR in this acidic environment. Most of the ligand-

unoccupied IRs is recycled back to the plasma membrane and only a small fraction of the ligand-

unoccupied IRs goes to the lysosomes for degradation. SNX5 also increases IR transcription. (B)

In the absence of SNX5 and D1R, most of the IRs goes to the lysosomes for degradation. Less

IRs is recycled back to plasma membrane and consequently, the insulin signaling pathway is impaired, as indicated by the decreased phosphorylation of both IRS1 and Akt. The lack of

SNX5 also decreases the IRβ at mRNA level, which contributes to the decrease in IRβ protein expression and impairment of the insulin signaling pathway.

106

8.3 SNX5 and D1R regulate the protein expression and activity of IDE

Our studies showed that the selective decrease in renal SNX5 protein expression in uninephrectomized WKY rats caused a significant increase in serum insulin levels (Jose et al.).

Insulin is only produced by pancreas β cells219 and allows glucose in the blood to be taken up by

liver and skeletal muscle cells where it is converted into glycogen220. The liver and kidney are

the primary sites for insulin degradation. About 50% of portal insulin is removed during the first- pass transit through the liver. The kidney removes from 30 to 80% of circulating insulin, depending on certain conditions131. Thus, the increase in serum insulin levels after renal selective

SNX5 depletion may be caused by the changes in renal insulin degradation. IDE functions as a

major insulinase and degrades insulin with a high degree of specificity. The highest enzymatic

activity is found in the liver and kidney which is consistent with the idea that IDE plays a crucial

role in the degradation of insulin221.

We found that SNX5 and D1R co-localize and co-immunoprecipite with IDE in hPTCs, and

silencing the expression of SNX5 or D1R decreases endogenous IDE protein expression and

activity. The co-localization of SNX5 and IDE, D1R and IDE is similar to that observed with the

co-localization of D1R and IRβ. However, the interaction between SNX5 and IRβ is indirect via

D1R because SNX5 and IRβ do not co-immunoprecipitate. The decrease in the activity seen after

downregulation of SNX5 or D1R is probably due to a decrease in the protein expression since enzyme activity was measured with saturating concentrations of substrate which reflects the amount of enzyme221. The decreased IDE protein expression in SNX5-depleted hRPTCs is

associated with decreased IDE mRNA expression, indicating a role of transcription in the SNX5-

mediated regulation of IDE protein expression. We did not determine IDE transcription after

107

D1R downregulation so we cannot rule out that D1R like SNX5 also affects IDE transcription.

Therefore, both SNX5 and D1R regulate the protein expression and activity of IDE. Indeed, IDE

protein expression is decreased in RPTCs from SHRs and from hypertensive patients which have

decreased SNX5 protein expression and D1R function compared to their normotensive controls

respectively64. No reports are available about the co-localization and co-immunoprecipitation

between IDE and dopamine receptors or other SNXs, but a dopamine receptor agonist,

apomorphine, has been shown to increase IDE activity222 which is consistent with our findings that D1R increases the IDE protein expression and activity. These findings would be able to

provide more therapeutic targets for type II DM and Alzheimer’s in which reduced IDE activity

have been observed223. IDE is subject to fine control by ambient conditions. In addition to SNX5 and D1R that regulate IDE protein expression and activity, IDE is downstream of Akt in insulin

signaling, and its protein expression and activity are increased by activated insulin signaling

serving as a negative feedback to bring insulin back to normal range156. At high glucose concentrations, the insulin-induced change in IDE activity is undetectable in HepG2 cells, suggesting that glucose inhibits the insulin-induced activation of IDE, which should maintain high insulin level to bring blood glucose to normal level224. Moreover, IDE activity also can be inhibited by nitric oxide (NO), reactive oxygen species (ROS)225, fatty acids, polyphosphates and

ATP226.

Our data show that the protein expression of cathepsin D (CD), another major insulinase

tested in this dissertation158, was unaltered in SNX5-depleted hRPTCs, proving that the effect of

SNX5 on IDE protein expression is specific. Since the activity of CD has not been measured in

108

SNX5-depleted hRPTCs, the regulation of SNX5 on CD activity cannot be ruled out and could

be the subject of future work.

The co-localization of SNX5, D1R, and IDE was found to be similar to that observed with the

co-localization of SNX5, D1R, and IRβ. Their co-localization suggested that SNX5, D1R, and

IDE could interact, and SNX5 and D1R could regulate the protein expression and activity of IDE.

Another possibility is that IDE, as a downstream molecule of insulin signaling pathway156, is

regulated by IRβ which is decreased with SNX5 and D1R depletion. This, however, does not

seem to be the case since the decrease in IDE activity is similar in cells in which D1R or SNX5

have been downregulated while the protein expression of IRβ is lower in those in which SNX5

has been silenced.

A simplified model of the interaction among SNX5, D1R, IRβ, and IDE in hRPTCs and

tissues, and their potential roles in hypertension, diabetes, and insulin resistance are depicted in

Figure 48. Normally, when sodium intake is increased, renal dopamine production is also

increased. Dopaminergic stimulation of D1R located at the plasma membrane increases sodium

excretion by inhibiting the activity of NHE3 in apical membrane and Na+-K+-ATPase in basolateral membrane, which keeps the blood pressure in a normal range. Immediately following

D1R occupation by dopamine, D1R is desensitized, in part, by its internalization from the plasma

membrane into cytosolic endosomes. SNX5 mediates the internalization and trafficking of D1R

back to the plasma membrane.

In contrast, insulin exerts an anti-natriuretic effect by increasing the activity of NHE3 and

Na+-K+-ATPase. SNX5 plays an important role in increasing the protein and mRNA expression

of IRβ and increasing the protein and mRNA expression and activity of IDE, serving a dual

109

purpose of increasing sensitivity to insulin and returning the increased insulin levels in response

to an increase in blood glucose back to normal.

When SNX5 protein expression is decreased, the internalization and plasma membrane

trafficking of D1R are impaired, resulting in a decreased number of D1R expressed at the plasma

membrane, (Jose et al., unpublished data) which further impairs the inhibition on NHE3 and

Na+-K+-ATPase activities and the ability to excrete a sodium load. Sodium retention eventually

leads to elevation of the blood pressure, the body’s attempt to eliminate the retained sodium. A

decrease in SNX5 and D1R protein expression also causes a decrease in IRβ protein expression

and insulin signaling, evidenced by a decrease in pAkt. SNX5 and D1R depletion also decreases

IDE protein expression and activity. IDE activity, as a downstream of pAkt in insulin signaling,

is further decreased in response to the impairment in insulin signaling, which also decreases

insulin degradation. As a consequence of the decreased IRβ protein expression and impaired

insulin signaling pathway, there is a relative deficiency of insulin, the consequence of which is

an increase in blood glucose levels which promote more insulin secretion. The decrease in

insulin degradation in the face of the increase in insulin secretion leads to hyperinsulinemia. This

causes an increase in the activity of NHE3 and Na+-K+-ATPase and subsequently and increase in

renal sodium retention. High insulin level also decreases plasma membrane D1R protein

expression exacerbating the sodium retention. Inevitably, hypertension develops.

Based on our findings in hRPTCs, it is reasonable to assume that SNX5 depletion in liver and

skeletal will also decrease the IR protein expression and impair the insulin signaling, which leads

to a decrease of glucose uptake, resulting in hyperglycemia (Figure 48). In an attempt to keep

110

the glucose in a normal range, more insulin is secreted by the pancreas resulting in a vicious cycle and eventually leading into overt type II DM.

111

112

Figure 48. A simplified model of the interaction among SNX5, D1R, IRβ, and IDE in

hRPTCs and different tissues and their roles in hypertension, insulin resistance, and

diabetes. (A) Normally, SNX5 mediates the internalization and trafficking of D1R back to the

plasma membrane and D1R increases the natriuresis by inhibiting the activity of NHE3 in apical membrane and Na+-K+-ATPase in basolateral membrane. In contrast, insulin exerts an anti-

natriuretic effect by increasing the activity of NHE3 and Na+-K+-ATPase. SNX5 increases the

protein expression of IRβ and IDE as well as the activity of IDE, serving a dual purpose of

increasing sensitivity to insulin and returning the increased insulin levels in response to an

increase in blood glucose back to normal. (B) When SNX5 is depleted, the internalization and 113

plasma membrane insertation of D1R are impaired, which results in a decreased number of D1R

expressed at the plasma membrane and impaired ability to excrete a sodium load. Sodium

retention eventually leads to elevation of the blood pressure. A decrease in SNX5 or D1R protein expression also causes a decrease in IRβ protein expression and IDE protein expression and activity, which decrease the insulin degradation. As a consequence of the decreased IRβ and impaired insulin signaling pathway, there is a relative deficiency of insulin, which promote more insulin secretion. The decrease in insulin degradation in the face of the increase in insulin secretion leads to hyperinsulinemia which increases the activity of NHE3 and Na+-K+-ATPase,

and renal sodium retention. High insulin level also decreases plasma membrane D1R protein expression exacerbating the sodium retention. Inevitably, hypertension develops. (C) SNX5 depletion in liver and skeletal muscle is assumed to decrease the IR protein expression and impair the insulin signaling, which leads to a decrease of glucose uptake, resulting in hyperglycemia. In an attempt to keep the glucose in a normal range, more insulin is secreted by the pancreas resulting in a vicious cycle and eventually leading into overt type II DM.

In summary, first, we found that the SNX5 and IRβ co-localize in hRPTCs and kidney tissue, but do not co-immunoprecipitate. In contrast, D1R and IRβ co-localize in hRPTCs and kidney

tissue and also co-immunoprecipitate each other in hRPTCs. D1R serves as a tether to connect

SNX5 and IRβ. Second, SNX5 or D1R depletion decreases the IR protein expression and impairs

the IR-IRS-Akt insulin signaling pathway evidenced by a decrease in pIRS1 and pAkt in hRPTCs. Third, both SNX5 and D1R co-localize and co-immunoprecipitate with IDE in hRPTCs, and SNX5 or D1R depletion decreases the protein expression and activity of IDE.

Fourth, SNX5 regulates the transcription of IRβ and IDE. The regulation on IDE protein

114

expression is specific because SNX5 doesn’t regulate CD protein expression. Conclusively, this

dissertation research elucidates the possible molecular interactions among D1R, SNX5, IR, and

IDE, which will greatly deepen our understanding about the pathogenesis of hypertension,

diabetes, and insulin resistance, and hence of the metabolic syndrome. We expect that results

from these studies may provide clues in the prevention and treatment of the metabolic syndrome.

Along with the achievements that have been made in this dissertation, in the future, this research is expected to expand to obesity, another important component of “metabolic syndrome”. In details, the leptin receptor, its variations associated with obesity, will be studied.

Some of the SNXs, such as, SNX1, SNX2, SNX4 and SNX6, have already been reported to interact with the leptin receptor. However, whether or not SNX5 regulates leptin receptor protein or mRNA expression, function, and trafficking is not clear yet and will be the subject of future work.

115

APPENDIX A

LIST OF ABBREVIATIONS

AC Adenylyl cyclase

AKT/PKB Protein kinase B

cAMP Cyclic adenosine monophosphate

CD Cathepsin D

CHX Cycloheximide

CO2 Carbon Dioxide

D1R Dopamine D1 receptor

D5R Dopamine D5 receptor

DRD1 D1 receptor gene

EGFR Epithelial growth factor receptor

FGF Fibroblast growth factor

GPCRs G protein-coupled receptors

hRPTCs human renal proximal tubule cells

IDE Insulin degrading enzyme

IR Insulin receptor

IRβ Insulin receptor β subunit

IRS1 Insulin receptor substrate 1

MAPK Mitogen-activated protein kinase

Na+, K+-ATPase Sodium-Potassium ATPase

116

NaPi2 Sodium-phosphate co-transporter

NHE3 Sodium/hydrogen exchanger 3

NO Nitric oxide

PDGFR Platelet-derived growth factor receptor

PDK1 Phosphoinositide-dependent protein kinase 1

PI 3-kinase Phosphoinositide 3-kinase

PtdIns(3)P phosphatidylinositol (3)-phosphate

PX domain Phox-homology domine

RGS Regulator of G-protein signaling

RT- qPCR Real-time Quantitative Polymerase Chain Reaction

RT-PCR Reverse Transcriptase Polymerase Chain Reaction

Scr Scrambled

SHR Spontaneously hypertensive rat shRNA Short-hairpin RNA siRNA Small interfering RNA

SNX Sorting nexin

SNX5 Sorting nexin 5

Vps Vacuolar protein sorting

WKY Wistar-Kyoto rats

117

BIBLIOGRAPHY

1. NHLBI. What are high blood pressure and prehypertension?

http://www.nhlbi.nih.gov/hbp/hbp/whathbp.htm.

2. Egan BM, Laken MA, Donovan JL, Woolson RF. Does dark chocolate have a role in the

prevention and management of hypertension?: Commentary on the evidence.

Hypertension. 2010;55:1289-1295

3. Hall JE. The kidney, hypertension, and obesity. Hypertension. 2003;41:625-633

4. Carretero OA, Oparil S. Essential hypertension. Part I: Definition and etiology.

Circulation. 2000;101:329-335

5. Black HR. Secondary hypertension. J Clin Hypertens (Greenwich). 2008;10:520-521

6. Damasceno A, Azevedo A, Silva-Matos C, Prista A, Diogo D, Lunet N. Hypertension

prevalence, awareness, treatment, and control in mozambique: Urban/rural gap during

epidemiological transition. Hypertension. 2009;54:77-83

7. Zeng C, Jose PA. Dopamine receptors: Important antihypertensive counterbalance

against hypertensive factors. Hypertension. 2011;57:11-17

8. Liu J. Ouabain-induced endocytosis and signal transduction of the Na/K-ATPase. Front

Biosci. 2005;10:2056-2063

9. DiBona GF. The sympathetic nervous system and hypertension: Recent developments.

Hypertension. 2004;43:147-150

10. Atlas SA. The renin-angiotensin aldosterone system: Pathophysiological role and

pharmacologic inhibition. J Manag Care Pharm. 2007;13:9-20

118

11. Publication N. National diabetes statistics.

http://diabetes.niddk.nih.gov/dm/pubs/statistics/#Hypertension. 2011

12. Health E. One-third of u.S. Adults could have diabetes by 2050.

http://www.businessweek.com/lifestyle/content/healthday/644785.html. 2010

13. MedicineNet. Diabetes mellitus.

http://www.medicinenet.com/diabetes_mellitus/article.htm. 2011

14. Eiselein L, Schwartz HJ, Rutledge JC. The challenge of type 1 diabetes mellitus. ILAR J.

2004;45:231-236

15. Campbell RK. Type 2 diabetes: Where we are today: An overview of disease burden,

current treatments, and treatment strategies. J Am Pharm Assoc (2003). 2009;49 Suppl

1:S3-9

16. Sowers JR, Levy J, Zemel MB. Hypertension and diabetes. Med Clin N Am.

1988;72:1399-1414

17. Jandeleit-Dahm K, Cooper ME. Hypertension and diabetes. Curr Opin Nephrol

Hypertens. 2002;11:221-228

18. Kdoqi clinical practice guidelines and clinical practice recommendations for diabetes and

chronic kidney disease. Am J Kidney Dis. 2007;49:S12-154

19. Grundy SM, Brewer HB, Jr., Cleeman JI, Smith SC, Jr., Lenfant C. Definition of

metabolic syndrome: Report of the national heart, lung, and blood institute/american

heart association conference on scientific issues related to definition. Arterioscler

Thromb Vasc Biol. 2004;24:e13-18

119

20. Eckel RH, Grundy SM, Zimmet PZ. The metabolic syndrome. Lancet. 2005;365:1415-

1428

21. MedicineNet. Http://www.Medicinenet.Com/metabolic_syndrome/page2.Htm#tocd. 2011

22. Brands MW, Hall JE, Van Vliet BN, Alonso-Galicia M, Herrera GA, Zappe D. Obesity

and hypertension: Roles of hyperinsulinemia, sympathetic nervous system and intrarenal

mechanisms. J Nutr. 1995;125:1725S-1731S

23. (OAC) OAC. Measuring obesity.

http://www.obesityaction.org/measuringobesity/calculatebmi.php. 2011

24. Poirier P, Giles TD, Bray GA, Hong Y, Stern JS, Pi-Sunyer FX, Eckel RH. Obesity and

cardiovascular disease: Pathophysiology, evaluation, and effect of weight loss.

Arterioscler Thromb Vasc Biol. 2006;26:968-976

25. Dalton M, Cameron AJ, Zimmet PZ, Shaw JE, Jolley D, Dunstan DW, Welborn TA.

Waist circumference, waist-hip ratio and body mass index and their correlation with

cardiovascular disease risk factors in australian adults. J Intern Med. 2003;254:555-563

26. Delaney J.

Http://www.Obesityaction.Org/magazine/oacnews14/hypertensionandobesity.Php.

Obesity Action Coalition (OAC). 2011

27. Oguma Y, Sesso HD, Paffenbarger RS, Jr., Lee IM. Weight change and risk of

developing type 2 diabetes. Obes Res. 2005;13:945-951

28. Aucott L, Poobalan A, Smith WC, Avenell A, Jung R, Broom J. Effects of weight loss in

overweight/obese individuals and long-term hypertension outcomes: A systematic

review. Hypertension. 2005;45:1035-1041

120

29. Zheng W, McLerran DF, Rolland B, Zhang X, Inoue M, Matsuo K, He J, Gupta PC,

Ramadas K, Tsugane S, Irie F, Tamakoshi A, Gao YT, Wang R, Shu XO, Tsuji I,

Kuriyama S, Tanaka H, Satoh H, Chen CJ, Yuan JM, Yoo KY, Ahsan H, Pan WH, Gu D,

Pednekar MS, Sauvaget C, Sasazuki S, Sairenchi T, Yang G, Xiang YB, Nagai M,

Suzuki T, Nishino Y, You SL, Koh WP, Park SK, Chen Y, Shen CY, Thornquist M,

Feng Z, Kang D, Boffetta P, Potter JD. Association between body-mass index and risk of

death in more than 1 million asians. N Engl J Med. 2011;364:719-729

30. Imazu M. Hypertension and insulin disorders. Curr Hypertens Rep. 2002;4:477-482

31. Miaczynska M, Pelkmans L, Zerial M. Not just a sink: Endosomes in control of signal

transduction. Curr Opin Cell Biol. 2004;16:400-406

32. Worby CA, Dixon JE. Sorting out the cellular functions of sorting nexins. Nat Rev Mol

Cell Biol. 2002;3:919-931

33. Carlton J, Bujny M, Rutherford A, Cullen P. Sorting nexins - unifying trends and new

perspectives. Traffic. 2005;6:75-82

34. Liu H, Liu ZQ, Chen CXQ, Magill S, Jiang Y, Liu YJ. Inhibitory regulation of EGF

receptor degradation by sorting nexin 5. Biochem Biophys Res Commun. 2006;342:537-

546

35. Seet LF, Hong WJ. The phox (PX) domain proteins and membrane traffic. BBA-Mol Cell

Biol L. 2006;1761:878-896

36. Kanai F, Liu H, Field SJ, Akbary H, Matsuo T, Brown GE, Cantley LC, Yaffe MB. The

PX domains of p47phox and p40phox bind to lipid products of PI(3)k. Nat Cell Biol.

2001;3:675-678

121

37. Zhong Q, Watson MJ, Lazar CS, Hounslow AM, Waltho JP, Gill GN. Determinants of

the endosomal localization of sorting nexin 1. Mol Biol Cell. 2005;16:2049-2057

38. Peter BJ, Kent HM, Mills IG, Vallis Y, Butler PJG, Evans PR, McMahon HT. BAR

domains as sensors of membrane curvature: The amphiphysin bar structure. Science.

2004;303:495-499

39. Carlton J, Bujny M, Peter BJ, Oorschot VMJ, Rutherford A, Mellor H, Klumperman J,

McMahon HT, Cullen PJ. Sorting nexin-1 mediates tubular endosome-to-tgn transport

through coincidence sensing of high-curvature membranes and 3-phosphoinositides. Curr

Biol. 2004;14:1791-1800

40. Cullen PJ. Endosomal sorting and signalling: An emerging role for sorting nexins. Nat

Rev Mol Cell Biol. 2008;9:574-582

41. Cavet ME, Pang J, Yin G, Berk BC. An epidermal growth factor (EGF) -dependent

interaction between GIT1 and sorting nexin 6 promotes degradation of the EGF receptor.

FASEB J. 2008;22:3607-3616

42. Wang JT, Kerr MC, Karunaratne S, Jeanes A, Yap AS, Teasdale RD. The SNX-PX-BAR

family in macropinocytosis: The regulation of macropinosome formation by SNX-PX-

BAR proteins. PLoS One. 2010;5:e13763

43. Haft CR, de la Luz Sierra M, Barr VA, Haft DH, Taylor SI. Identification of a family of

sorting nexin molecules and characterization of their association with receptors. Mol Cell

Biol. 1998;18:7278-7287

44. Lu N, Shen Q, Mahoney TR, Liu X, Zhou Z. Three sorting nexins drive the degradation

of apoptotic cells in response to PtdIns(3)P signaling. Mol Biol Cell. 2010

122

45. Wu D, Tang YP, Wade J. Co-localization of sorting nexin 2 and androgen receptor in the

song system of juvenile zebra finches. Brain Res. 2010;1343:104-111

46. Rivera J, Megias D, Bravo J. Sorting nexin 6 interacts with breast cancer metastasis

suppressor-1 and promotes transcriptional repression. J Cell Biochem. 2010;111:1464-

1472

47. Okada H, Zhang WZ, Peterhoff C, Hwang JC, Nixon RA, Ryu SH, Kim TW. Proteomic

identification of sorting nexin 6 as a negative regulator of bace1-mediated app

processing. FASEB J. 2010;24:2783-2794

48. Seaman MNJ, McCaffery JM, Emr SD. A membrane coat complex essential for

endosome-to-golgi retrograde transport in yeast. J Cell Biol. 1998;142:665-681

49. Rojas R, Kametaka S, Haft CR, Bonifacino JS. Interchangeable but essential functions of

SNX1 and SNX2 in the association of retromer with endosomes and the tracking of

mannose 6-phosphate receptors. Mol Cell Biol. 2007;27:1112-1124

50. Seaman MNJ. Recycle your receptors with retromer. Trends Cell Biol. 2005;15:68-75

51. Bonifacino JS, Rojas R. Retrograde transport from endosomes to the trans-golgi network.

Nat Rev Mol Cell Biol. 2006;7:568-579

52. Verges M. Retromer and sorting nexins in development. Front Biosci. 2007;12:3825-

3851

53. Horazdovsky BF, Davies BA, Seaman MNJ, McLaughlin SA, Yoon S, Emr SD. A

sorting nexin-1 homologue, vps5p, forms a complex with vps17p and is required for

recycling the vacuolar protein-sorting receptor. Mol Biol Cell. 1997;8:1529-1541

123

54. Griffin CT, Trejo J, Magnuson T. Genetic evidence for a mammalian retromer complex

containing sorting nexins 1 and 2. Proc Natl Acad Sci U S A. 2005;102:15173-15177

55. Wassmer T, Attar N, Bujny MV, Oakley J, Traer CJ, Cullen PJ. A loss-of-function screen

reveals SNX5 and SNX6 as potential components of the mammalian retromer. J Cell Sci.

2007;120:45-54

56. Bonifacino JS, Hurley JH. Retromer. Curr Opin Cell Biol. 2008;20:427-436

57. Shi H, Rojas R, Bonifacino JS, Hurley JH. The retromer subunit vps26 has an arrestin

fold and binds vps35 through its C-terminal domain. Nat Struct Mol Biol. 2006;13:540-

548

58. Hierro A, Rojas AL, Rojas R, Murthy N, Effantin G, Kajava AV, Steven AC, Bonifacino

JS, Hurley JH. Functional architecture of the retromer cargo-recognition complex.

Nature. 2007;449:1063-U1068

59. Villar VM, Jones JE, Armando I, Asico LD, Escano CS, Wang XY, Pascua AM, Li HW,

Palmes-Saloma CP, Jose PA. Sorting nexin 1 is crucial to dopamine D-5 receptor

function in human renal proximal tubule cells. Hypertension. 2010;56:E123-E123

60. Rigalleau V, Blanchetier V, Combe C, Guillot C, Deleris G, Aubertin J, Aparicio M, Gin

H. A low-protein diet improves insulin sensitivity of endogenous glucose production in

predialytic uremic patients. Am J Clin Nutr. 1997;65:1512-1516

61. Hussain T, and Lokhandwala, M.F. Renal dopamine receptors and hypertension. Exp Biol

Med. 2003;228:134-142

62. Meshkani R, Adeli K. Hepatic insulin resistance, metabolic syndrome and cardiovascular

disease. Clin Biochem. 2009;42:1331-1346

124

63. Fujita T. Insulin resistance and salt-sensitive hypertension in metabolic syndrome.

Nephrol Dial Transplant. 2007;22:3102-3107

64. Jose PA, Eisner GM, Drago J, Carey RM, Felder RA. Dopamine receptor signaling

defects in spontaneous hypertension. Am J Hypertens. 1996;9:400-405

65. Missale C, Nash SR, Robinson SW, Jaber M, Caron MG. Dopamine receptors: From

structure to function. Physiol Rev. 1998;78:189-225

66. Fuxe K, Li XM, Tanganelli S, Hedlund P, Oconnor WT, Ferraro L, Ungerstedt U, Agnati

LF. Receptor-receptor interactions and their relevance for receptor diversity-focus on

neuropeptide/dopamine interactions. In: Abood LG, Lajtha A, eds. Diversity of

interacting receptors. Ann N Y Acad Sci. 1995:365-376.

67. Hornykiewicz O. Biochemical aspects of parkinson's disease. Neurology. 1998;51:S2-9

68. Jose PA, Eisner GM, Felder RA. Renal dopamine receptors in health and hypertension.

Pharmacol Ther. 1998;80:149-182

69. Roitman MF, Schafe GE, Thiele TE, Bernstein IL. Dopamine and sodium appetite:

Antagonists suppress sham drinking of NaCl solutions in the rat. Behav. Neurosci.

1997;111:606-611

70. Somers RL, Klein DC. Rhodopsin kinase-activity in the mammalian pineal-gland and

other tissues. Science. 1984;226:182-184

71. Van den Buuse M. Role of the mesolimbic dopamine system in cardiovascular

homeostasis. Stimulation of the ventral tegmental area modulates the effect of

vasopressin on blood pressure in conscious rats. Clin Exp Pharmacol Physiol.

1998;25:661-668

125

72. Jose PA, Eisner GM, Felder RA. Role of dopamine in the pathogenesis of hypertension.

Clin Exp Pharmacol Physiol Suppl. 1999;26:S10-13

73. Dearry A, Gingrich JA, Falardeau P, Fremeau RT, Bates MD, Caron MG. Molecular-

cloning and expression of the gene for a human D1 dopamine receptor. Nature.

1990;347:72-76

74. Zeng C, Sanada H, Watanabe H, Eisner GM, Felder RA, Jose PA. Functional genomics

of the dopaminergic system in hypertension. Physiol Genomics. 2004;19:233-246

75. Creese I, Sibley DR, Leff S, Hamblin M. Dopamine-receptors-subtypes, localization and

regulation. Fed Proc. 1981;40:147-152

76. Ozono R, Oconnell DP, Wang ZQ, Moore AF, Sanada H, Felder RA, Carey RM.

Localization of the dopamine D-1 receptor protein in the human heart and kidney.

Hypertension. 1997;30:725-729

77. Yamaguchi I, Jose PA, Mouradian MM, Canessa LM, Monsma FJ, Sibley DR, Takeyasu

K, Felder RA. Expression of dopamine-D(1A) receptor gene in proximal tubule of rat

kidneys. Am J Physiol. 1993;264:F280-F285

78. Albrecht FE, Drago J, Felder RA, Printz MP, Eisner GM, Robillard JE, Sibley DR,

Westphal HJ, Jose PA. Role of the D-1A dopamine receptor in the pathogenesis of

genetic hypertension. J Clin Invest. 1996;97:2927-2927

79. Aperia A, Bertorello A, Seri I. Dopamine causes inhibition of Na+-K+-ATPase activity in

rat proximal convoluted tubule segments. Am J Physiol. 1987;252:F39-F45

126

80. Bacic D, Kaissling B, McLeroy P, Zou LX, Baum M, Moe OW. Dopamine acutely

decreases apical membrane Na/H exchanger NHE3 protein in mouse renal proximal

tubule. Kidney Int. 2003;64:2133-2141

81. Grider JS, Ott CE, Jackson BA. Dopamine D1 receptor-dependent inhibition of NaCl

transport in the rat thick ascending limb: Mechanism of action. Eur J Pharmacol.

2003;473:185-190

82. Nishi A, Eklof AC, Bertorello AM, Aperia A. Dopamine regulation of renal Na+-K+-

ATPase activity is lacking in Dahl salt-sensitive rats. Hypertension. 1993;21:767-771

83. Pedrosa R, Jose PA, Soares-da-Silva P. Defective D-1-like receptor-mediated inhibition

of the Cl-/HCO3- exchanger in immortalized SHR proximal tubular epithelial cells. Am J

Physiol-Renal Physiol. 2004;286:F1120-F1126

84. Krushkal J, Xiong MM, Ferrell R, Sing CF, Turner ST, Boerwinkle E. Linkage and

association of adrenergic and dopamine receptor genes in the distal portion of the long

arm of chromosome 5 with systolic blood pressure variation. Hum Mol Genet.

1998;7:1379-1383

85. Sato M, Soma M, Nakayama T, Dolkun R, Watanabe Y, Izumi Y, Kanmatsuse K.

Dopamine D1 receptor gene polymorphism is associated with essential hypertension.

Hypertension. 2000;18:S175-S175

86. Rao FW, Wessel J, Wen G, Zhang L, Rana BK, Kennedy BP, Greenwood TA, Salem

RM, Chen YQ, Khandrika S, Hamilton BA, Smith DW, Holstein-Rathlou NH, Ziegler

MG, Schork NJ, O'Connor DT. Renal albumin excretion - twin studies identify influences

127

of heredity, environment, and adrenergic pathway polymorphism. Hypertension.

2007;49:1015-1031

87. Hussain T, Beheray SA, Lokhandwala MF. Defective dopamine receptor function in

proximal tubules of obese zucker rats. Hypertension. 1999;34:1091-1096

88. Albrecht FE, Drago J, Felder RA, Printz MP, Eisner GM, Robillard JE, Sibley DR,

Westphal HJ, Jose PA. Role of the D1A dopamine receptor in the pathogenesis of genetic

hypertension. J Clin Invest. 1996;97:2283-2288

89. Sanada H, Jose PA, Hazen-Martin D, Yu PY, Xu J, Bruns DE, Phipps J, Carey RM,

Felder RA. Dopamine-1 receptor coupling defect in renal proximal tubule cells in

hypertension. Hypertension. 1999;33:1036-1042

90. Felder RA, Wang XL, Gildea J, Bengra C, Sasaki M, Zeng C, Jones J, Wang Z, Asico

LD, Jose PA. Human renal angiotensis type 1 receptor regulation by the D1 dopamine

receptor. Hypertension. 2003;42:P178

91. Zeng C, Luo YJ, Asico LD, Hopfer U, Eisner GM, Felder RA, Jose PA. Perturbation of

D1 dopamine and AT(1) receptor interaction in spontaneously hypertensive rats.

Hypertension. 2003;42:787-792

92. Jose PA, Soares-da-Silva P, Eisner GM, Felder RA. Dopamine and g protein-coupled

receptor kinase 4 in the kidney: Role in blood pressure regulation. Biochim Biophys Acta.

2010

93. Zeng C, Villar VA, Eisner GM, Williams SM, Felder RA, Jose PA. G protein-coupled

receptor kinase 4: Role in blood pressure regulation. Hypertension. 2008;51:1449-1455

128

94. Gardner B, Liu ZF, Jiang D, Sibley DR. The role of phosphorylation/dephosphorylation

in agonist-induced desensitization of D1 dopamine receptor function: Evidence for a

novel pathway for receptor dephosphorylation. Mol Pharmacol. 2001;59:310-321

95. Jean-Alphonse F, Hanyaloglu AC. Regulation of GPCR signal networks via membrane

trafficking. Mol Cell Endocrinol. 2011;331:205-214

96. von Zastrow M. Mechanisms regulating membrane trafficking of G protein-coupled

receptors in the endocytic pathway. Life Sci. 2003;74:217-224

97. Seino S, Seino M, Nishi S, Bell GI. Structure of the human insulin-receptor gene and

characterization of its promoter. Proc Natl Acad Sci U S A. 1989;86:114-118

98. Belfiore A, Frasca F, Pandini G, Sciacca L, Vigneri R. Insulin receptor isoforms and

insulin receptor/insulin-like growth factor receptor hybrids in physiology and disease.

Endocr Rev. 2009;30:586-623

99. Czech MP. The nature and regulation of the insulin-receptor-structure and function. Annu

Rev Physiol. 1985;47:357-381

100. Duckworth WC, Bennett RG, Hamel FG. Insulin degradation: Progress and potential.

Endocr Rev. 1998;19:608-624

101. Hedo JA, Kahn CR, Hayashi M, Yamada KM, Kasuga M. Biosynthesis and glycosylation

of the insulin-receptor-evidence for a single polypeptide precursor of the 2 major

subunits. J Biol Chem. 1983;258:20-26

102. Jacobs S, Kull FC, Jr., Cuatrecasas P. Monensin blocks the maturation of receptors for

insulin and somatomedin c: Identification of receptor precursors. Proc Natl Acad Sci U S

A. 1983;80:1228-1231

129

103. Jacobs S, Cuatrecasas P. Insulin receptors. Annu Rev Pharmacol Toxicol. 1983;23:461-

479

104. Yenush L, and White, M.F. The IRS-signalling system during insulin and cytokine

action. Bioessays. 1997;19:491-500

105. Chiu SL, Cline HT. Insulin receptor signaling in the development of neuronal structure

and function. Neural Devt. 2010;5

106. Cohen P, Alessi DR, Cross DA. PDK1, one of the missing links in insulin signal

transduction? FEBS Lett. 1997;410:3-10

107. Franke TF, Yang SI, Chan TO, Datta K, Kazlauskas A, Morrison DK, Kaplan DR,

Tsichlis PN. The protein kinase encoded by the Akt proto-oncogene is a target of the

PDGF-activated phosphatidylinositol 3-kinase. Cell. 1995;81:727-736

108. Cao HQ, Dronadula N, Rao GN. Thrombin induces expression of FGF-2 via activation of

PI3k-akt-fra-1 signaling axis leading to DNA synthesis and motility in vascular smooth

muscle cells. Am J Physiol-Cell Physiol. 2006;290:C172-C182

109. Insulin signaling pathway.

http://www.biochemsoctrans.org/bst/031/1152/bst0311152f01.htm?resolution=HIGH.

2010

110. White MF. The irs-signaling system: A network of docking proteins that mediate insulin

and cytokine action. In: Conn PM, ed. Recent Prog Horm Res, vol 53. 1998:119-138.

111. Rose DW, Saltiel, A.R., Majumdar, M., Decker, S.J., and Olefsky, J.M. Insulin-receptor

substrate-1 is required for insulin-mediated mitogenic signal-transduction. Proc Natl

Acad Sci U S A. 1994; 91:797-801

130

112. Sun XJ, Goldberg JL, Qiao LY, Mitchell JJ. Insulin-induced insulin receptor substrate-1

degradation is mediated by the proteasome degradation pathway. Diabetes.

1999;48:1359-1364

113. Ricort JM, Tanti JF, Vanobberghen E, Lemarchandbrustel Y. Alterations in insulin

signaling pathway induced by prolonged insulin-treatment of 3T3-L1 adipocytes.

Diabetologia. 1995;38:1148-1156

114. White MF, Cohen P. The IRS-signalling system in insulin and cytokine action. Philos

Trans R Soc Lond B Biol Sci. 1996;351:189-189

115. Thirone ACP, Huang C, Klip A. Tissue-specific roles of IRS proteins in insulin signaling

and glucose transport. Trends Endocrinol Metab. 2006;17:70-76

116. Taniguchi CM, Ueki K, Kahn CR. Complementary roles of IRS-1 and IRS-2 in the

hepatic regulation of metabolism. J Clin Invest. 2005;115:718-727

117. Fantin VR, Wang Q, Lienhard GE, Keller SR. Mice lacking insulin receptor substrate 4

exhibit mild defects in growth, reproduction, and glucose homeostasis. Am J Physiol

Endocrinol Metab. 2000;278:E127-E133

118. Sciacchitano S, Kulansky R, Taylor SI. Cloning, tissue distribution, chromosomal

localization, and expression of the mouse IRS-3 gene. Mol Biol Cell. 1997;8:746-746

119. Blazer-Yost BL, Watanabe M, Haverty TP, Ziyadeh FN. Role of insulin and IGF1

receptors in proliferation of cultured renal proximal tubule cells. Biochim Biophys Acta.

1992;1133:329-335

120. Reed BC, Lane MD. Insulin-receptor synthesis and turnover in differentiating 3T3-L1

preadipocytes. Proc Natl Acad Sci U S A. 1980;77:285-289

131

121. Knutson VP. Cellular trafficking and processing of the insulin-receptor. FASEB J.

1991;5:2130-2138

122. Haft CR, Klausner RD, Taylor SI. Involvement of dileucine motifs in the internalization

and degradation of the insulin-receptor. J Biol Chem. 1994;269:26286-26294

123. Backer JM, Kahn CR, White MF. Tyrosine phosphorylation of the insulin-receptor

during insulin-stimulated internalization in rat hepatoma-cells. J Biol Chem.

1989;264:1694-1701

124. Goldstein BJ, Bittner-Kowalczyk A, White MF, Harbeck M. Tyrosine dephosphorylation

and deactivation of insulin receptor substrate-1 by protein-tyrosine phosphatase 1B -

possible facilitation by the formation of a ternary complex with the GRB2 adaptor

protein. J Biol Chem. 2000;275:4283-4289

125. Romsicki Y, Reece M, Gauthier JY, Asante-Appiah E, Kennedy BP. Protein tyrosine

phosphatase-1B dephosphorylation of the insulin receptor occurs in a perinuclear

endosome compartment in human embryonic kidney 293 cells. J Biol Chem.

2004;279:12868-12875

126. Zabolotny JM, Bence-Hanulec KK, Stricker-Krongrad A, Haj F, Wang YP, Minokoshi

Y, Kim YB, Elmquist JK, Tartaglia LA, Kahn BB, Neel BG. PTP1B regulates leptin

signal transduction in vivo. Dev Cell. 2002;2:489-495

127. Blog JstCH. Http://history1900s.About.Com/b/2008/01/17/insulin-discovered-in-

1922.Htm. 1922

128. Bowen R. Physiologic effects of insulin.

http://www.vivo.colostate.edu/hbooks/pathphys/endocrine/pancreas/insulin_phys.html

132

129. Tiwari S, Riazi S, Ecelbarger CA. Insulin's impact on renal sodium transport and blood

pressure in health, obesity, and diabetes. Am J Physiol-Renal Physiol. 2007;293:F974-

F984

130. Fuster DG, Bobulescu IA, Zhang J, Wade J, Moe OW. Characterization of the regulation

of renal Na+/H+ exchanger NHE3 by insulin. Am J Physiol-Renal Physiol.

2007;292:F577-F585

131. Rabkin R, Ryan MP, Duckworth WC. The renal metabolism of insulin. Diabetologia.

1984;27:351-357

132. Hammerman MR. Interaction of insulin with the renal proximal tubular cell. Am J

Physiol. 1985;249:F1-11

133. Hysing J, Tolleshaug H, Kindberg GM. Renal uptake and degradation of trapped-label

insulin. Ren Physiol Biochem. 1989;12:228-237

134. Elliot SJ, Conti FG, Striker LJ, Striker GE. Mouse glomerular endothelial cells have an

insulin receptor. Horm Metab Res. 1990;22:557-560

135. Morrisey K, Evans RA, Wakefield L, Phillips AO. Translational regulation of renal

proximal tubular epithelial cell transforming growth factor-beta1 generation by insulin.

Am J Pathol. 2001;159:1905-1915

136. Mirsky IA, Broh-Kahn RH. The inactivation of insulin by tissue extracts; the distribution

and properties of insulin inactivating extracts. Arch Biochem. 1949;20:1-9

137. Affholter JA, Fried VA, Roth RA. Human insulin-degrading enzyme shares structural

and functional homologies with E. Coli protease III. Science. 1988;242:1415-1418

133

138. Valera Mora ME, Scarfone A, Calvani M, Greco AV, Mingrone G. Insulin clearance in

obesity. J Am Coll Nutr. 2003;22:487-493

139. Farris W, Mansourian S, Chang Y, Lindsley L, Eckman EA, Frosch MP, Eckman CB,

Tanzi RE, Selkoe DJ, Guenette S. Insulin-degrading enzyme regulates the levels of

insulin, amyloid beta-protein, and the beta-amyloid precursor protein intracellular domain

in vivo. Proc Natl Acad Sci U S A. 2003;100:4162-4167

140. Authier F, Cameron PH, Taupin V. Association of insulin-degrading enzyme with a 70

kDa cytosolic protein in hepatoma cells. Biochem J. 1996;319 ( Pt 1):149-158

141. Hersh LB. The insulysin (insulin degrading enzyme) enigma. Cell Mol Life Sci.

2006;63:2432-2434

142. Hamel FG, Mahoney MJ, Duckworth WC. Degradation of intraendosomal insulin by

insulin-degrading enzyme without acidification. Diabetes. 1991;40:436-443

143. Authier F, Bergeron JJ, Ou WJ, Rachubinski RA, Posner BI, Walton PA. Degradation of

the cleaved leader peptide of thiolase by a peroxisomal proteinase. Proc Natl Acad Sci U

S A. 1995;92:3859-3863

144. Leissring MA, Farris W, Wu XN, Christodoulou DC, Haigis MC, Guarente L, Selkoe DJ.

Alternative translation initiation generates a novel isoform of insulin-degrading enzyme

targeted to mitochondria. Biochem J. 2004;383:439-446

145. Kuo WL, Montag AG, Rosner MR. Insulin-degrading enzyme is differentially expressed

and developmentally regulated in various rat tissues. Endocrinology. 1993;132:604-611

146. Weirich G, Mengele K, Yfanti C, Gkazepis A, Hellmann D, Welk A, Giersig C, Kuo

WL, Rosner MR, Tang WJ, Schmitt M. Immunohistochemical evidence of ubiquitous

134

distribution of the metalloendoprotease insulin-degrading enzyme (IDE; insulysin) in

human non-malignant tissues and tumor cell lines. Biol Chem. 2008;389:1441-1445

147. Rabkin R, Tsao T, Elliot SJ, Striker LJ, Striker GE. Insulin uptake and processing by

cultured mouse glomerular endothelial cells. Am J Physiol. 1993;265:C453-459

148. Surmacz CA, Wert JJ, Jr., Ward WF, Mortimore GE. Uptake and intracellular fate of

[14c]sucrose-insulin in perfused rat livers. Am J Physiol. 1988;255:C70-75

149. Qiu WQ, Walsh DM, Ye Z, Vekrellis K, Zhang J, Podlisny MB, Rosner MR, Safavi A,

Hersh LB, Selkoe DJ. Insulin-degrading enzyme regulates extracellular levels of amyloid

beta-protein by degradation. J Biol Chem. 1998;273:32730-32738

150. Gehm BD, Rosner MR. Regulation of insulin, epidermal growth factor, and transforming

growth factor-alpha levels by growth factor-degrading enzymes. Endocrinology.

1991;128:1603-1610

151. Edbauer D, Willem M, Lammich S, Steiner H, Haass C. Insulin-degrading enzyme

rapidly removes the beta-amyloid precursor protein intracellular domain (AICD). J Biol

Chem. 2002;277:13389-13393

152. Kurochkin IV. Amyloidogenic determinant as a substrate recognition motif of insulin-

degrading enzyme. FEBS Lett. 1998;427:153-156

153. Affholter JA, Hsieh CL, Francke U, Roth RA. Insulin-degrading enzyme: Stable

expression of the human complementary DNA, characterization of its protein product,

and chromosomal mapping of the human and mouse genes. Mol Endocrinol.

1990;4:1125-1135

135

154. Ebrahim A, Hamel FG, Bennett RG, Duckworth WC. Identification of the metal

associated with the insulin degrading enzyme. Biochem Biophys Res Commun.

1991;181:1398-1406

155. Seabright PJ, Smith GD. The characterization of endosomal insulin degradation

intermediates and their sequence of production. Biochem J. 1996;320:947-956

156. Zhao LX, Teter B, Morihara T, Lim GP, Ambegaokar SS, Ubeda OJ, Frautschy SA, Cole

GM. Insulin-degrading enzyme as a downstream target of insulin receptor signaling

cascade: Implications for Alzheimer's disease intervention. J Neurosci. 2004;24:11120-

11126

157. Authier F, Rachubinski RA, Posner BI, Bergeron JJM. Endosomal proteolysis of insulin

by an acidic thiol metalloprotease unrelated to insulin degrading enzyme. J Biol Chem.

1994;269:3010-3016

158. Authier F, Metioui M, Fabrega S, Kouach M, Briand G. Endosomal proteolysis of

internalized insulin at the C-terminal region of the B chain by cathepsin D. J Biol Chem.

2002;277:9437-9446

159. Tiwari S, Halagappa VKM, Riazi S, Hu XQ, Ecelbarger CA. Reduced expression of

insulin receptors in the kidneys of insulin-resistant rats. J Am Soc Nephrol.

2007;18:2661-2671

160. Peterson DR, Carone FA, Oparil S, Christensen EI. Differences between renal tubular

processing of glucagon and insulin. Am J Physiol. 1982;242:F112-F118

136

161. Tiwari S, Sharma N, Gill PS, Igarashi P, Kahn CR, Wade JB, Ecelbarger CM. Impaired

sodium excretion and increased blood pressure in mice with targeted deletion of renal

epithelial insulin receptor. Proc Natl Acad Sci U S A. 2008;105:6469-6474

162. Baum M. Insulin stimulates volume absorption in the rabbit proximal convoluted tubule.

J Clin Invest. 1987;79:1104-1109

163. Mandon B, Siga E, Chabardes D, Firsov D, Roinel N, DeRouffignac C. Insulin stimulates

Na+, Cl-, Ca2+, and Mg2+ transports in TAL of mouse nephron: Cross-potentiation with

avp. Am J Physiol. 1993;265:F361-F369

164. Ito O, Kondo Y, Takahashi N, Kudo K, Igarashi Y, Omata K, Imai Y, Abe K. Insulin

stimulates NaCl transport in isolated-perfused MATL of Henle's loop of rabbit kidney.

Am J Physiol. 1994;267:F265-F270

165. Takahashi N, Ito O, Abe K. Tubular effects of insulin. Hypertens Res. 1996;19 Suppl

1:S41-45

166. Song J, Hu X, Riazi S, Tiwari S, Wade JB, Ecelbarger CA. Regulation of blood pressure,

the epithelial sodium channel (ENaC), and other key renal sodium transporters by chronic

insulin infusion in rats. Am J Physiol Renal Physiol. 2006;290:F1055-1064

167. Gans RO, vd Toorn L, Bilo HJ, Nauta JJ, Heine RJ, Donker AJ. Renal and cardiovascular

effects of exogenous insulin in healthy volunteers. Clin Sci (Lond). 1991;80:219-225

168. Hayashi K, Fujiwara K, Oka K, Nagahama T, Matsuda H, Saruta T. Effects of insulin on

rat renal microvessels: Studies in the isolated perfused hydronephrotic kidney. Kidney

Int. 1997;51:1507-1513

137

169. Stoos BA, Garcia NH, Garvin JL. Nitric oxide inhibits sodium reabsorption in the

isolated perfused cortical collecting duct. J Am Soc Nephrol. 1995;6:89-94

170. Brands MW, Harrison DL, Keen HL, Gardner A, Shek EW, Hall JE. Insulin-induced

hypertension in rats depends on an intact renin-angiotensin system. Hypertension.

1997;29:1014-1019

171. Defronzo RA. The effect of insulin on renal sodium-metabolism-a review with clinical

implications. Diabetologia. 1981;21:165-171

172. Umrani DN, Banday AA, Hussain T, Lokhandwala MF. Rosiglitazone treatment restores

renal dopamine receptor function in obese zucker rats. Hypertension. 2002;40:880-885

173. Ferrannini E, Buzzigoli G, Bonadonna R, Giorico MA, Oleggini M, Graziadei L,

Pedrinelli R, Brandi L, Bevilacqua S. Insulin resistance in essential-hypertension. N Engl

J Med. 1987;317:350-357

174. Reaven GM. Relationship between insulin resistance and hypertension. Diabetes Care.

1991;14:33-38

175. Reaven GM, Chang H. Relationship between blood-pressure, plasma-insulin and

triglyceride concentration, and insulin action in spontaneous hypertensive and wistar-

kyoto rats. Am J Hypertens. 1991;4:34-38

176. Potenza MA, Marasciulo FL, Chieppa DM, Brigiani GS, Formoso G, Quon MJ,

Montagnani M. Insulin resistance in spontaneously hypertensive rats is associated with

endothelial dysfunction characterized by imbalance between NO and ET-1 production.

Am J Physiol Heart Circ Physiol. 2005;289:H813-H822

138

177. Meyer C, Dostou J, Nadkarni V, Gerich J. Effects of physiological hyperinsulinemia on

systemic, renal, and hepatic substrate metabolism. Am J Physiol. 1998;275:F915-921

178. Wright EM, Hirayama BA, Loo DF. Active sugar transport in health and disease. J Intern

Med. 2007;261:32-43

179. Wright EM, Turk E. The sodium/glucose cotransport family SLC5. Pflugers Arch.

2004;447:510-518

180. Wright EM. Renal Na+-glucose cotransporters. Am J Physiol Renal Physiol.

2001;280:F10-18

181. Freitas HS, Schaan BD, Seraphim PM, Nunes MT, Machado UF. Acute and short-term

insulin-induced molecular adaptations of glut2 gene expression in the renal cortex of

diabetic rats. Mol Cell Endocrinol. 2005;237:49-57

182. Schoolwerth AC, Smith BC, Culpepper RM. Renal gluconeogenesis. Miner Electrolyte

Metab. 1988;14:347-361

183. Guder WG, Ross BD. Enzyme distribution along the nephron. Kidney Int. 1984;26:101-

111

184. http://www.dlife.com/diabetes/information/complications/heart/hypertension-

diabetes.html?s_kwcid=TC|3015|diabetes%2520and%2520hypertension||S||2840638793

&gclid=CL2n-MC0xqECFYM65Qod4EOBAA, 2010

185. Bakris GL, Williams M, Dworkin L, Elliott WJ, Epstein M, Toto R, Tuttle K, Douglas J,

Hsueh W, Sowers J, Natl Kidney Fdn Hypertension D. Preserving renal function in adults

with hypertension and diabetes: A consensus approach. Am J Kidney Dis. 2000;36:646-

661

139

186. Chiu YF, Chuang, L.M., Hsiao, C.F., Hung, Y.J., Lin, M.W., Chen, Y.T., Grove, J.,

Jorgenson, E., Quertermous, T., Risch, N., et al. An autosomal genome-wide scan for loci

linked to pre-diabetic phenotypes in nondiabetic chinese subjects from the stanford asia-

pacific program of hypertension and insulin resistance family study. Diabetes.

2005;54:1200-1206

187. Zeng C, Eisner GM, Felder RA, Jose PA. Dopamine receptor and hypertension. Curr

Med Chem Cardiovasc Hematol Agents. 2005;3:69-77

188. Hotamisligil GS, Budavari A, Murray D, Spiegelman BM. Reduced tyrosine kinase

activity of the insulin receptor in obesity-diabetes. Central role of tumor necrosis factor-

alpha. J Clin Invest. 1994;94:1543-1549

189. Zeng C, Han Y, Huang H, Yu C, Ren H, Shi W, He D, Huang L, Yang C, Wang X, Zhou

L, Jose PA. D1-like receptors inhibit insulin-induced vascular smooth muscle cell

proliferation via down-regulation of insulin receptor expression. J Hypertens.

2009;27:1033-1041

190. Yang J, Cui Z, He D, Ren H, Han Y, Yu C, Fu C, Wang Z, Yang C, Wang X, Zhou L,

Asico LD, Villar VA, Hopfer U, Mi M, Zeng C, Jose PA. Insulin increases D5 dopamine

receptor expression and function in renal proximal tubule cells from Wistar-kyoto rats.

Am J Hypertens. 2009;22:770-776

191. Torpy JM, Lynm C, Glass RM. Jama patient page. Hypertension. JAMA. 2010;303:2098

192. Hajjar I, Kotchen TA. Trends in prevalence, awareness, treatment, and control of

hypertension in the united states, 1988-2000. JAMA. 2003;290:199-206

140

193. Hussain T, Lokhandwala MF. Renal dopamine receptor function in hypertension.

Hypertension. 1998;32:187-197

194. Http://www.Webmd.Com/heart/metabolic-syndrome/metabolic-syndrome-what-is-

it?Ecd=ppc_google_syndromemetabolic_heart_metabolicsyndrome-

overview++facts++educationandcauses_search&gclid=cluiqm2gjqicfr_e3aodjfs7ww.

195. Chiu YF, Chuang LM, Hsiao CF, Hung YJ, Lin MW, Chen YT, Grove J, Jorgenson E,

Quertermous T, Risch N, Hsiung CA. An autosomal genome-wide scan for loci linked to

pre-diabetic phenotypes in nondiabetic chinese subjects from the stanford asia-pacific

program of hypertension and insulin resistance family study. Diabetes. 2005;54:1200-

1206

196. Li H, Li HF, Felder RA, Periasamy A, Jose PA. Rab4 and rab11 coordinately regulate the

recycling of angiotensin II type I receptor as demonstrated by fluorescence resonance

energy transfer microscopy. J Biomed Opt. 2008;13:031206

197. Lakowicz JR, Piszczek G, Kang JS. On the possibility of long-wavelength long-lifetime

high-quantum-yield luminophores. Anal Biochem. 2001;288:62-75

198. Y. Chen ME, and A. Periasamy, Fret data analysis: The algorithm in molecular imaging:

Fret microscopy and spectroscopy,. 2005:pp. 126–145,

199. Zhuang D, Pu QH, Ceacareanu B, Chang YZ, Dixit M, Hassid A. Chronic insulin

treatment amplifies PDGF-induced motility in differentiated aortic smooth muscle cells

by suppressing the expression and function of PTP1B. Am J Physiol Heart Circ Physiol.

2008;295:H163-H173

141

200. Sehat B, Andersson S, Vasilcanu R, Girnita L, Larsson O. Role of ubiquitination in IGF-

1 receptor signaling and degradation. PLoS One. 2007;2:e340

201. Cincotta AH, Meier AH, Cincotta Jr M. Bromocriptine improves glycaemic control and

serum lipid profile in obese type 2 diabetic subjects: A new approach in the treatment of

diabetes. Expert Opin Investig Drugs. 1999;8:1683-1707

202. Scranton R, Cincotta A. Bromocriptine--unique formulation of a dopamine agonist for

the treatment of type 2 diabetes. Expert Opin Pharmacother. 2010;11:269-279

203. Umrani DN, Goyal RK. Fenoldopam treatment improves peripheral insulin sensitivity

and renal function in stz-induced type 2 diabetic rats. Clin Exp Hypertens. 2003;25:221-

233

204. Piston DW, Kremers GJ. Fluorescent protein fret: The good, the bad and the ugly. Trends

Biochem Sci. 2007;32:407-414

205. Parks WT, SNX6. UCSD Molecule Pages. 2006; doi:10.1038/mp.a002977.01

206. Parks WT, Frank DB, Huff C, Renfrew Haft C, Martin J, Meng X, de Caestecker MP,

McNally JG, Reddi A, Taylor SI, Roberts AB, Wang T, Lechleider RJ. Sorting nexin 6, a

novel SNX, interacts with the transforming growth factor-beta family of receptor serine-

threonine kinases. J Biol Chem. 2001 Jun 1;276(22):19332-9. Epub 2001 Mar 8

207. Otsuki T, Kajigaya S, Ozawa K, Liu JM. SNX5, a new member of the sorting nexin

family, binds to the Fanconi anemia complementation group A protein. Biochem Biophys

Res Commun.1999 Nov 30;265(3):630-5

208. MaCaulay SL, Stoichevska V, Grusovin J, Gough KH, Castelli LA, Ward CW. Insulin

stimulates movement of sorting nexin 9 between cellular compartments: a putative role

142

mediating cell surface receptor expression and insulin action. Biochem J. 2003 Nov

15;376(Pt 1):123-34

209. Ishibashi Y, Maita H, Yano M, Koike N, Tamai K, Ariga H, Iguchi-Ariga SM. Pim-1

translocates sorting nexin 6/ TRAF4-associated factor 2 from cytoplasm to nucleus.

FEBS Lett. 2001 Sep 28;506(1):33-8

210. Samant RS, Seraj MJ, Saunders MM, Sakamaki TS, Shevde LA, Harms JF, Leonard TO,

Goldberg SF, Budgeon L, Meehan WJ, Winter CR, Christensen ND, Verderame MF,

Donahue HJ, Welch DR. Analysis of mechanisms underlying BRMS1 suppression of

metastasis. Clin Exp Metastasis. 2000;18(8):683-93

211. Kurten RC, Cadena DL, Gill GN. Enhanced degradation of EGF receptors by a sorting

nexin, SNX1. Science. 1996 May 17;272(5264):1008-10

212. Gullapalli A, Garrett TA, Paing MM, Griffin CT, Yang Y, Trejo J. A role for sorting

nexin 2 in epidermal growth factor receptor down-regulation: evidence for distinct

functions of sorting nexin 1 and 2 in protein trafficking. Mol Biol Cell. 2004

May;15(5):2143-55. Epub 2004 Feb 20

213. Lin Q, Lo CG, Cerione RA, Yang W. The Cdc42 target ACK2 interacts with sorting

nexin 9 (SH3PX1) to regulate epidermal growth factor receptor degradation. J Biol

Chem. 2002 Mar 22;277(12):10134-8. Epub 2002 Jan 17

214. Choi JH, Hong WP, Kim MJ, Kim JH, Ryu SH, Suh PG. Sorting nexin 16 regulates EGF

receptor trafficking by phosphatidylinositol-3-phosphate interaction with the Phox

domain. J Cell Sci. 2004 Aug 15;117(Pt 18):4209-18. Epub 2004 Aug 3

143

215. Gavin JR 3rd, Roth J, Neville DM Jr, de Meyts P, Buell DN. Insulin-dependent

regulation of insulin receptor concentrations: a direct demonstration in cell culture. Proc

Natl Acad Sci U S A. 1974 Jan;71(1):84-8

216. Ramos FJ, Langlais PR, Hu D, Dong LQ, Liu F. Grb10 mediates insulin-stimulated

degradation of the insulin receptor: a mechanism of negative regulation. Am J Physiol

Endocrinol Metab. 2006 Jun;290(6):E1262-6. Epub 2006 Jan 24

217. Banday AA, Fazili FR, Lokhandwala MF. Insulin causes renal dopamine D1 receptor

desensitization via GRK2-mediated receptor phosphorylation involving

phosphatidylinositol 3-kinase and protein kinase C. Am J Physiol Renal Physiol. 2007

Sep;293(3):F877-84. Epub 2007 Jun 13

218. Huang H, Han Y, Wang X, Chen C, Yu C, He D, Wang H, Zhou L, Asico LD, Jose PA,

Zeng C. Inhibitory Effect of the D(3) Dopamine Receptor on Insulin Receptor Expression

and Function in Vascular Smooth Muscle Cells. Am J Hypertens. 2011 Mar 17

219. Bowen R. Synthesis and secretion

http://www.vivo.colostate.edu/hbooks/pathphys/endocrine/pancreas/insulin.htmlInsulin.

1999

220. Http://en.Wikipedia.Org/wiki/insulin

221. Hulse RE, Ralat LA, Wei-Jen T. Structure, function, and regulation of insulin-degrading

enzyme. Vitam Horm. 2009;80:635-48

222. Himeno E, Ohyagi Y, Ma L, Nakamura N, Miyoshi K, Sakae N, Motomura K, Soejima

N, Yamasaki R, Hashimoto T, Tabira T, M LaFerla F, Kira J. Apomorphine treatment in

Alzheimer mice promoting amyloid-β degradation. Ann Neurol. 2011 Feb;69(2):248-56

144

223. Kim M, Hersh LB, Leissring MA, Ingelsson M, Matsui T, Farris W, Lu A, Hyman BT,

Selkoe DJ, Bertram L, Tanzi RE. Decreased catalytic activity of the insulin-degrading

enzyme in chromosome 10-linked Alzheimer disease families. J Biol Chem. 2007 Mar

16;282(11):7825-32. Epub 2007 Jan 22

224. Pivovarova O, Gögebakan O, Pfeiffer AF, Rudovich N. Glucose inhibits the insulin-

induced activation of the insulin-degrading enzyme in HepG2 cells. Diabetologia. 2009

Aug;52(8):1656-64. Epub 2009 Apr 25

225. Cordes CM, Bennett RG, Siford GL, Hamel FG. Redox regulation of insulin degradation

by insulin-degrading enzyme. PLoS One. 2011 Mar 23;6(3):e18138

226. Fernández-Gamba A, Leal MC, Morelli L, Castaño EM. Insulin-degrading enzyme:

structure-function relationship and its possible roles in health and disease. Curr Pharm

Des. 2009;15(31):3644-55

145