Use of Whole-Genome Sequencing to Diagnose a Cryptic Fusion Oncogene

Supplementary Online Content

Welch JS, Westervelt P, Ding L, et al. Use of whole-genome sequencing to diagnose a cryptic fusion oncogene. JAMA. 2011;305(15):1577-1584.

eMethods. Sequencing, PCR Validation, RT-PCR, FISH Analysis, Entrez Gene ID Numbers eFigure 1. Copy Number Alterations in the Leukemia Genome eFigure 2. Junctional Sequences eFigure 3. Abbott/Vysis FISH Probe Analysis eFigure 4. Work-Flow for WGS

This supplementary material has been provided by the authors to give readers additional information about their work.

Downloaded From: https://jamanetwork.com/ on 09/27/2021

eMethods

Sequencing All genomic sequences use NCBI36/hg18 assembly.

Whole genome sequencing with paired-end reads was performed as previously described using Illumina HiSeq 2000 per manufacturer’s instruction.1-3 Sequence variants have been deposited at dbGaP, patient UPN: 757128.

PCR validation of whole genome sequencing using genomic DNA: PCR was performed using Amplitaq gold (Applied Biosystems, Carlsbad, CA), 10 ng genomic DNA and 1 μM pooled primer pairs. Products were visualized on Flash-gel (Lonza, Basal, Switzerland). PCR products were treated with Exo-sap (USB, Cleveland, OH) prior to 3730 sequencing.

Primer sequences for deletion validation: del(12):43,803,388-103,860,201; 60,056,813 bp deletion chr12:ATCACTGGTAGCGACTGACCTT forward primer chr12:TGCTGAGTGATGAGGAGGTAAA reverse primer

del(14):69,691,336-69,713,945; 22,610 bp deletion chr14:CAAAAGGCCAGAGAAGTACCAT forward primer chr14:GCGATTCCTCACTTATCTCCAC reverse primer

del(15):72,026,999-72,104,282; 77,284 bp deletion chr15:CTCGTGGAGAGAAGGAAACATC forward primer (P5) chr15:CAGCCAACCCTTCTTTAATGTC reverse primer (P6)

del(19):12,363,122-12,403,091; 39,942 bp deletion chr19:CACATATCTTGCATTTGTGAGG forward primer chr19:TATGCATGAAAGAACGCACA reverse primer

Primer sequences used for ins(17;15) validation: chr15:CCGGTAGTGATGGCTTTATGAT forward primer (P3) chr17:TAAAACCCTACCCTGTCAGGAA reverse primer (P4)

chr17:GGAGCCAGGGAGTCTCTTTGT forward primer (P2) chr15:CTGGGAAGCCTAAACCTCAAGT reverse primer (P1)

Downloaded From: https://jamanetwork.com/ on 09/27/2021

eMethods (Continued)

RT-PCR of PML-RARA RNA was generated using Trizol (Invitrogen, Carlsbad, CA). Reverse transcription was performed using Superscript (Invitrogen) and cDNA purified using DNeasy columns (Qiagen, Valencia, CA). PCR was performed using Amplitaq gold (Applied Biosystems, Carlsbad, CA), 10 ng cDNA and 1.2 μM pooled primer pairs. Products were visualized on Flash-gel (Lonza, Basal, Switzerland). PCR products were treated with Exo-sap (USB, Cleveland, OH) prior to 3730 sequencing. Commercial RNA was obtained from: Stratagene (Santa Clara, CA). In addition, RT-PCR was performed using the PML/RARa translocation assay (InVivoScribe, San Diego, CA) per manufacturer’s instructions and products visualized on Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA). PML-RARA amplification was noted with Mix2b (313 bp), but not Mix2c, consistent with bcr3 variant.

Primers used in PML-RARA RT-PCR Primer set 3: bcr3 238 bp PML3: GCTGGTGCAGAGGATGAAGT forward primer RARA3: AGGGCTGGGCACTATCTCTT reverse primer

Primer set 4: bcr3 302 bp (Figure 2D) PML4: CCGATGGCTTCGACGAGTT forward primer RARA4: GTTCCGGGTCACCTTGTTGAT reverse primer

Fluorescence in situ hybridization (FISH) analysis Diagnostic FISH was performed and interpreted by Sonora Quest Laboratories (Tempe, AZ).

Fosmid clones were selected to target a minimal region of the PML and RARA loci that might be involved in an insertional event (general strategy and fosmid clone numbers described in Figure 3). Fosmid clones were obtained from the University of Washington Fosmid libarary collection (Department of Genome Sciences, Seattle, WA) and purified using Phase Prep BAC DNA Kit (Sigma, St. Louis, MO). Each clone was end sequenced to confirm correct probe amplification. Probes were labeled with Spectrum Green and Spectrum Orange by nick translation (Vysis Inc, Downers Grove, Illinois, USA), using standard methods.4 Slides were analyzed using a fluorescence microscope, and images recorded using Cytovision software.

Eleven patients with t(15;17)-negative promyelocytic leukemia were selected for FISH testing. FISH analysis on interphase bone marrow cells was done using the probe mixture described in Figure 3. A normal signal pattern, 2 red signals (PML) and 4 green signals (RARA), was seen in 9 of the samples.

Downloaded From: https://jamanetwork.com/ on 09/27/2021

eMethods (Continued)

Entrez Gene ID numbers of genes described in text:

PML: 5371 (http://www.ncbi.nlm.nih.gov/gene/5371) RARA: 5914 (http://www.ncbi.nlm.nih.gov/gene/5914) NuMA1: 4926 (http://www.ncbi.nlm.nih.gov/gene/4926) NPM1: 4869 (http://www.ncbi.nlm.nih.gov/gene/4869) STAT5B: 6777 (http://www.ncbi.nlm.nih.gov/gene/6777) PRKAR1A: 5573 (http://www.ncbi.nlm.nih.gov/gene/5573) FIP1L1: 81608 (http://www.ncbi.nlm.nih.gov/gene/81608) BCOR: 54880 (http://www.ncbi.nlm.nih.gov/gene/54880) NUP98: 4928 (http://www.ncbi.nlm.nih.gov/gene/4928) RARG: 5916 (http://www.ncbi.nlm.nih.gov/gene/5916) PLZF: 7704 (http://www.ncbi.nlm.nih.gov/gene/7704) LOXL1: 4016 (http://www.ncbi.nlm.nih.gov/gene/4016) PITPNM1: 9600 (http://www.ncbi.nlm.nih.gov/gene/9600) SLC35A4: 113829 (http://www.ncbi.nlm.nih.gov/gene/113829) DYTN: 391475 (http://www.ncbi.nlm.nih.gov/gene/391475) PCSK2: 5126 (http://www.ncbi.nlm.nih.gov/gene/5126) ZNF687: 57592 (http://www.ncbi.nlm.nih.gov/gene/57592) PTK2: 5747 (http://www.ncbi.nlm.nih.gov/gene?term=5747) SH3D19: 152503 (http://www.ncbi.nlm.nih.gov/gene/152503) GPRC6A: 222545 (http://www.ncbi.nlm.nih.gov/gene/222545) C3orf54: 389119 (http://www.ncbi.nlm.nih.gov/gene/389119) CDC45: 8318 (http://www.ncbi.nlm.nih.gov/gene/8318) DEGS2: 123099 (http://www.ncbi.nlm.nih.gov/gene/123099) ZFHX4: 79776 (http://www.ncbi.nlm.nih.gov/gene/79776) CDC6: 990 (http://www.ncbi.nlm.nih.gov/gene/990)

REFERENCES

1. Ley TJ, Mardis ER, Ding L, et al. DNA sequencing of a cytogenetically normal acute myeloid leukaemia genome. Nature. Nov 6 2008;456(7218):66-72. 2. Mardis ER, Ding L, Dooling DJ, et al. Recurring mutations found by sequencing an acute myeloid leukemia genome. N Engl J Med. Sep 10 2009;361(11):1058-1066. 3. Ley TJ, Ding L, Walter MJ, et al. DNMT3A Mutations in Acute Myeloid Leukemia. New England Journal of Medicine. Dec 16 2010;363(25):2424-2433. 4. Higgins AW, Alkuraya FS, Bosco AF, et al. Characterization of apparently balanced chromosomal rearrangements from the developmental genome anatomy project. Am J Hum Genet. Mar 2008;82(3):712-722.

Downloaded From: https://jamanetwork.com/ on 09/27/2021

eFigure 1. Copy Number Alterations in the Leukemia Genome

The Y axis displays the ratio of read counts across each chromosome (using a 10 kilobase sliding window). Copy number neutral regions have equivalent ratios (e.g. zero), while deletions that occur in the leukemia sample relative to the skin sample have a negative ratio and amplifications have a positive ratio. Note deletions on chromosomes 9 and 12, consistent with metaphase cytogenetic findings. Note also the absence of copy number alterations on chromosomes 15 and 17; and 6 and 16.

Downloaded From: https://jamanetwork.com/ on 09/27/2021

eFigure 2. Junctional Sequences

A. PML-RARA RT-PCR sequence PML-exon 3 gaggatgaagtgctacgcctcggaccaggaggtgctggacatgcacggtttcctgcgccaggcgctctgccgcctgcgccaggagga RARA exon 3 gccccagagcctgcaagctgccgtgcgcaccgatggcttcgacgagttcaaggtgcgcctgcaggacctcagctcttgcatcacccag

gggaaagccattgagacccagagcagcagttctgaagagatagtgcccagccctccctcgccaccccctctaccccgcatctacaag RARA exon 4 ccttgctttgtctgtcaggacaagtcctcaggctaccactatggggtcagcgcctgtgagggctgcaagggcttcttccgccgcagcatcc

agaagaacatggtgtacacgtgtcaccgggacaagaactgcatcatcaacaaggtgacccggaacggt

B. RARA-LOXL1 RT-PCR sequence RARA exon 2 tacgccttcttcttcccccctatgctgggtggactctccccgccaggcgctctgaccactctccagcaccagcttccagttagtggatatag LOXL1 exon 5 Stop cacaccatccccagccaggcctgagcccaggctgctatgacacctacaatgcggacatcgactgccagtggatcgacataaccga

C. LOXL1-PML RT-PCR sequence LOX1 exon 4 agaaggtggccgagggccacaaggccagtttctgcctggaggacagcacctgtgacttcggcaacctcaagcgctatgcatgcacct LOXL1 intron 4/5 ctcatacccaggttgggctggagagatggggtttggggcatgggaggataaggagttggggaggcaaagagcgaggcccgctgag

gcccggcaagtgccaaggcttctggccactcagctctgctcacagtgaaggtcttctcaccagtcctcaggctgccacactgccctgca Stop gggactgttccctccctgccccagcccctttcccatgttattccaggtgatctgctcgtggagagaaggaaacatcgcaacagtctggag

agcaacacgtcctattggcctgttcacccacccatatccctctttccatcatccaccctaaatatccacaaactgtccatctgtcctgtctcttt PML exon 4 ttatccattctgccatccatctcgtccctcccagctgccagcactcccagggaccctatt

RT-PCR products were analyzed by 3730 sequencing. A. PML-RARA bcr3 fusion occurs between PML exon 3 and RARA exon 3. B. RARA-LOXL1 is fused out of frame, leads to a stop codon in LOXL1 exon 5, and a predicted 67 amino acid protein. C. LOXL1-PML leads to an unusual splice variant between LOXL1 intron 4/5 and PML exon 4, resulting in a premature stop codon and a predicted 573 amino acid protein. Italics indicates a transition between exons within the same gene.

Downloaded From: https://jamanetwork.com/ on 09/27/2021

eFigure 3. Abbott/Vysis FISH Probe Analysis

A. Abbott/Vysis FISH probes recognize the following sequences (NCBI36/hg18):

PML 5': chr15:71877721-72116436 (~239kb) PML 3': chr15:72131017-72408852 (~278 kb) RARA 5': chr17:35344410-35754702 (~412 kb) RARA 3': chr17:35762877-36180271 (~418 kb)

Clinical results: one fusion on der(17), one red signal, two green signals.

A. Positions of complementary genomic sequences to PML 5’ and 3’ probes and RARA 5’ and 3’ probes. B. Schematic representation of FISH probe binding during proband analysis. Note the large size of probes relative to the ins(17;15). Probe segments shown at diagonal represent probe regions that do not hybridize (e.g. the deletion in chromosome 15 overlaps with the PML 5’ probe, and only a portion of the PML 5’ probe still hybridizes).

Downloaded From: https://jamanetwork.com/ on 09/27/2021

eFigure 4. Work-Flow for WGS

SNVs: single nucleotide variants. Indels: insertions and deletions. CNVs: copy number variants. SVs: structural variants.

Downloaded From: https://jamanetwork.com/ on 09/27/2021