DNA Methylation as a Mechanism for Caste System Determination in Solenopsis invicta: Do the Genes Determine the Queen?
By
Kristen E. Walker
A thesis submitted in partial fulfillment of the requirements of the University Honors Program University of South Florida St. Petersburg
May 3, 2017
Thesis Director: David John, Ph.D. Lecturer, College of Arts and Sciences
University Honors Program University of South Florida St. Petersburg
CERTIFICATE OF APPROVAL
______
Honors Thesis ______
This is to certify that the Honors Thesis of
Kristen E. Walker
has been approved by the Examining Committee on May 3, 2017 as satisfying the thesis requirement of the University Honors Program
Examining Committee:
______Thesis Director: David John, Ph.D. Lecturer, College of Arts and Sciences
______Thesis Committee Member: Thomas Smith, Ph.D. Honors Program Director and Associate Professor of Political Science, College of Arts and Sciences
______Thesis Committee Member: Debby Cassill, Ph.D. Associate Chairperson and Associate Professor, College of Arts and Sciences
Abstract
The emerging field of epigenetics seeks to study the interactions of the environment and other factors on gene expression in organisms. Epigenetic mechanisms involve modification to the DNA and/or surrounding structures, resulting in the activation or repression of gene expression. One epigenetic mechanism, DNA methylation, involves the addition of a methyl group to carbon 5 of cytosines in CpG dinucleotide regions in vertebrates and possibly other phyla.
Vertebrate genomes tend to be globally methylated, whereas genes tend to be the target of methylation in insects. Genomic analyses of the order Hymenoptera revealed the evolutionary persistence of DNA methylation in social insects. Fully functioning DNA methylation systems have been discovered in several bee and ant species, including Solenopsis invicta. DNA methylation in insects may play a role in caste determination, as ant embryos are capable of following different developmental pathways. Social insects prove a promising model for understanding methylation in developmental regulation due to the presence of phenotypic plasticity and the potential for genomic imprinting. This study aims to determine whether differential methylation is present among different castes in the fire ant species, Solenopsis invicta. Preforming bisulfite treatment on selected genes derived from whole body DNA extraction could provide data on the presence of differential methylation among castes. Further investigation may reveal whether DNA methylation is the mechanism by which environmental cues affect the developmental trajectory of ant embryos determining their caste.
i Table of Contents
Abstract………………………………………………………………………………………………………………..i
TABLE OF CONTENTS………………………………………………………………………………………..…ii
List of Tables………………………………………………………………………………………………………..v
List of Figures……………………………………………………………………………………………………viii
Chapter 1: Introduction………………………………………………………………………………..………1
1-1: Introduction to epigenetics…………………………………………………………………1
1-2: DNA methylation……………………………………………………………………….…….....2
1-2-1: DNA methylation mechanism………………………………………………...2
1-2-2: DNA methylation in vertebrates……………………………….……………4
1-2-3: DNA methylation in insects…………………………………………………...6
1-3: Identification of differentially methylated regions…….………………………..10
1-4: Phenotypic plasticity………………………………………………………………………...12
1-4-1: Genotype – phenotype mapping function..………………….…..……12
1-4-2: Apis mellifera: An example of phenotypic plasticity ……………...15
1-5: Caste differentiation in social insects…………………………………………………18
1-6: Solenopsis invicta………………………………………………………………………………20
Chapter 2: Materials and Methods……………………………………………………………...……….23
2-1: Determination of target genes...…………………………………………………………23
2-2: Primer design……………………………………………………………………………...……26
2-3: DNA extraction….……………………………………………………………………………...28
2-4: PCR amplification…………………………………………………………………………..…30
2-4-1: PCR overview………………………………………………………………..……30
ii Table of Contents
2-4-2: Primer reconstitution……………………………………………………..…..31
2-4-3: PCR reaction setup……………………………………………………………...31
2-4-4: Thermal cycler parameters………………………………………………….32
2-5: Gel electrophoresis…………………………………………………………………………...34
2-6: Cloning…………………………………………………………………………………………….35
2-6-1: Retailing reactions………………………………………………………………36
2-6-2: PCR cleanup……..…………………………………………………………………36
2-6-3: Cloning ligation…………………………………………………………………..37
2-6-4: Cloning transformation……………………………………………………….37
2-6-5: Cloning……………………………………………………………………………….38
2-7: Sequencing……...……………………………………………………………………………….39
2-8: PCR troubleshooting…………………………………………………………………………40
2-9: Bisulfite conversion…………………………………………………………………………..43
Chapter 3: Results………………………………………………………………………………………………45
3-1: Primer design…………………………………………………………………………………...45
3-2: DNA extraction…………………………………………………………………………………48
3-3: PCR amplification and gel electrophoresis…………………………………………49
3-3-1: Asunder Whole………………………………………………………………...…49
3-3-2: Asunder Front…………………………………………………………………….51
3-3-3: Asunder Rear and Rab11 Rear……………………………………………..53
3-4: Cloning…………………………………………………………………………………………….56
3-5: Sequencing……………………………………………………………………………………….58
iii Table of Contents
3-5-1: Asunder Front………………………………………………………………….…58
3-5-2: Asunder Rear……………………………………………………………………...60
3-5-3: Rab11 Rear…………………………………………………………………………61
3-6: PCR troubleshooting…………………………………………………………………………62
3-6-1: Asunder Front, Asunder Rear, and Rab11 Whole PCR and gel
electrophoresis.…………………………………………………………………………….62
3-6-2: Asunder Front, Asunder Rear, and Rab11 Whole major and
minor worker PCR and gel electrophoresis…………………………………….66
3-6-3: PCR troubleshooting analysis………………………………………………70
Chapter 4: Discussion…………………………………………………………………………………………77
Works Cited……………………………………………………………………………………………………….81
iv List of Tables
Table 1.1 Conserved Differentially Methylated Genes Between Queens and Workers in Camponotus floridanus and Harpegnathos saltator...……………………………....………...24
Table 1.2 Gene Locus Numbers for Camponotus floridanus, Harpegnathos saltator, and Solenopsis invicta…………………………………………………………………………………………25
Table 1.3 Solenopsis invicta Gene Orthologs………………………………………………………..26
Table 2.1 Primer Design for Asunder and Rab11 Genes in Solenopsis invicta………..27
Table 2.2 Concentrations of Primers……………………………………………………………….….33
Table 3.1 Thermal Cycler Parameters…………………………………………………….…………..33
Table 3.2 Thermal Cycler Parameters for Retailing Reactions……………………………..36
Table 4 Colony Numbers for Asunder Front, Asunder Rear, and Rab11 Rear…….….39
Table 5 Vector Cloning Site Sequences…………………………………………………………....….40
Table 6.1a Asunder Whole Master Mix……………………………………………………………….49
Table 6.1b Asunder Whole Individual PCR Reactions………………………………………….50
Table 6.1c Asunder Whole Thermal Cycler Parameters………………………………………50
Table 6.2a Asunder Front Master Mix………………………………………………………………...52
Table 6.2b Asunder Front Individual PCR Reactions…………………………………………...52
Table 6.2c Asunder Front Thermal Cycler Parameters………………………………………..52
Table 6.3a Asunder Rear Master Mix………………………………………………………………….54
Table 6.3b Asunder Rear Individual PCR Reactions…………………………………………….54
Table 6.4a Rab11 Rear Master Mix………………………………………..…………………………...54
Table 6.4b Rab11 Rear Individual PCR Reactions……………………………………………….54
Table 6.4c Asunder Rear and Rab11 Rear Thermal Cycler Parameters………………..55
v List of Tables
Table 7.1a Asunder Front Repeat Master Mix……………………………………………………..63
Table 7.1b Asunder Front Repeat Individual PCR Reactions………………………………..63
Table 7.1c Asunder Front Repeat Thermal Cycler Parameters…………………………….64
Table 7.2a Asunder Rear Repeat Master Mix………………………………………………………64
Table 7.2b Asunder Rear Repeat Individual PCR Reactions…………………………………64
Table 7.2c Asunder Rear Repeat Thermal Cycler Parameters……………………………...64
Table 7.3a Rab11 Whole Master Mix………………………………………………………………….65
Table 7.3b Rab11 Whole Individual PCR Reactions…………………………………………….65
Table 7.3c Rab11 Whole Thermal Cycler Parameters………………………………………….65
Table 7.4a Asunder Front Major and Minor Worker Master Mix………………………….67
Table 7.4b Asunder Front Major and Minor Worker Individual PCR Reactions…….67
Table 7.4c Asunder Front Major and Minor Worker Thermal Cycler Parameters…67
Table 7.5a Asunder Rear Major and Minor Worker Master Mix…………………………..67
Table 7.5b Asunder Rear Major and Minor Worker Individual PCR Reactions……..68
Table 7.5c Asunder Rear Major and Minor Worker Thermal Cycler Parameters…..68
Table 7.6a Rab11 Whole Major and Minor Worker Master Mix……………………………68
Table 7.6b Rab11 Whole Major and Minor Worker Individual PCR Reactions………68
Table 7.6c Rab11 Whole Major and Minor Worker Thermal Cycler Parameters…...69
Table 7.7a 0.2 μM Primer Asunder Front Master Mix………………………………………….71
Table 7.7b 0.2 μM Primer Asunder Front Individual PCR Reactions…………………….71
Table 7.8a 0.4 μM Primer Asunder Front Master Mix………………………………………….72
Table 7.8b 0.4 μM Primer Asunder Front Individual PCR Reactions………………...…..72
vi List of Tables
Table 7.9a 0.8 μM Primer Asunder Front Master Mix…………………………………….……73
Table 7.9b 0.8 μM Primer Asunder Front Individual PCR Reactions…………………….73
Table 8 PCR Analyses of Various Conditions for Asunder Front…………………………...76
vii List of Figures
Figure 1. Four Hypotheses for the Genotype–Phenotype Mapping Function……...…14
Figure 2.1 Graphical Representation of Primer Location on Asunder Gene in
Solenopsis invicta………………………………………………………………………………………………..46
Figure 2.2 Graphical Representation of Primer Location on Rab11 Gene in
Solenopsis invicta………………………………………………………………………………………………..47
Figure 3.1 Major Worker DNA Extraction………………………………………………………..…48
Figure 3.2 Minor Worker DNA Extraction…………………………………………………………..49
Figure 4.1 Asunder Whole Gel Electrophoresis……………………………………...……………51
Figure 4.2 Asunder Front Gel Electrophoresis…………………………………………………….53
Figure 4.3 Asunder Rear and Rab11 Rear Gel Electrophoresis…………………………….56
Figure 4.4 Asunder Front, Asunder Rear, and Rab11 Rear Colony Gel
Electrophoresis………………………………………………………………………………………………….57
Figure 5.1a Asunder Front M13 Plate 1_2…………………………………………………………..59
Figure 5.1b Asunder Front Sequencing Alignment……………………………………………..59
Figure 5.2a Asunder Rear M13 Plate 1_1……………………………………………………………60
Figure 5.2b Asunder Rear Sequencing Alignment……………………………………………….61
Figure 5.3a Rab11 Rear M13 Plate 1_3……………………………………………………………….62
Figure 5.3b Rab11 Rear Sequencing Alignment…………………………………………...……..62
Figure 6 Asunder Front, Asunder Rear, and Rab11 Whole Gel Electrophoresis…….66
Figure 7 Asunder Front, Asunder Rear, and Rab11 Whole Major and Minor Worker
Gel Electrophoresis…………………………………………………………………………………………….70
Figure 8 Asunder Front 0.2 μM, 0.4 μM, and 0.8 μM Analysis Gel Electrophoresis...75
viii Chapter 1: Introduction
1-1: Introduction to epigenetics
Deoxyribonucleic acid serves as a universal blueprint for most organisms on
Earth. Composed of nucleotides containing a phosphate group, a sugar, and one of four nitrogenous bases; adenine, cytosine, guanine, and adenine, DNA contains the genetic material that instructs an organism to develop in a particular fashion. The order of the nitrogenous bases determines the specific genetic code. The human genome contains 3 billion base pairs packed into twenty-three chromosome sets, which reside in each and every one of our cells (National Human Genome Research
Institute 2010). In order to fit this large DNA molecule into the nucleus of a cell, it must be remolded into compact units. DNA is wrapped around protein molecules called histones forming a structure called chromatin. These histone proteins then form an octamer protein complex, in which the DNA can wrap around forming a nucleosome to further condense it. This model of DNA packaging is referred to as
“beads on a string” model, where the beads are the nucleosomes and the string is linker DNA.
The genome is the complete set of genetic material present in a cell or organism, while a gene is a unit of heredity that can be transferred from parent to offspring. Genetics involves the study of heredity and the variation of inherited characteristics and was first demonstrated by Gregor Mendel through his work with pea plants. He showed that genes are paired and inherited in discrete units, one from each parent. The genotype is the genetic code for an organism, while the phenotype is the observable characteristics resulting from the interaction of the
1 genotype with the environment. Relatively recently, an emerging field of science, called epigenetics, studies the interactions of the environment and other flexible cues on gene expression in organisms.
First coined in 1942, Waddington used the term epigenetics to describe,
“cause mechanisms” by which “the genes of the genotype bring about a phenotype”
(Waddington 1942). He described an “epigenetic landscape” where environmental, biological, and chemical factors interact to change gene expression (Haig 2004). A more modern definition describes epigenetics as “the study of changes in organisms caused by modifications of gene expression rather than alterations to the genetic code itself” (Brooker 2015). In general, the epigenetic field studies the biological pathways and mechanisms of modifications that alter gene expression in organisms rather than altering their genetic code. Epigenetic mechanisms may involve modifications to the DNA and or surrounding structures including DNA methylation, chromatin structure and histone modification, and noncoding RNA (Liu and Lu
2015). These modifications, in response to the environment, can either activate or inactivate a specific gene, thus activating or repressing its expression.
1-2: DNA methylation
1-2-1: DNA methylation mechanism
One epigenetic mechanism of modifying DNA structure, DNA methylation, is present in all three domains of life, Archaea, Bacteria, and Eukarya, thus indicating its evolution from a common ancestor (Klose and Bird 2006). DNA methylation is an essential process for chromatin modification, regulation of gene expression, X chromosome inactivation, genomic imprinting, normal embryonic development
2 (Okano et al. 1999), memory formation (Bird 2002), and carcinogenesis (Haines et al. 2001). The mechanism of DNA methylation involves the addition of a methyl group to carbon 5 of a cytosine base. These methyl groups are added to DNA by a class of enzymes called DNA methyltransferases (DNMTs) encoded by DNMT genes.
The chemical modification of a methyl group addition serves as an epigenetic “tag” that identifies certain regions of the DNA to be utilized differently from other regions (Karp and Geer 2013).
DNMTs are divided into classes of enzymes based on their activities within the genome. ‘De novo’ methyltransferases establish new DNA methylation patterns in an organism’s genome and are characterized by the DNMT3 family of enzymes
(Glastad and Hunt 2011). De novo methylation is an essential process for mammalian development and plays a key role in establishing embryonic methylation patterns. Inactivation of DNMT3a and DNMT3b in mice resulted in early embryonic mortality, indicating that de novo methylation may play a role in organizing the genome during tissue differentiation (Okano et al. 1999). However,
DNMT3 is not strictly confined to early development as mice lacking either DNMT3a or DNMT3b display defects at different developmental stages resulting in mortality
(Okano et al. 1999). The second class of enzymes that perform DNA methylation is
‘maintenance’ methyltransferases represented by a family of enzymes called
DNMT1. Maintenance methylation seeks to maintain previously established methylation patterns between cell generations (Bird 2002). The simplest mechanism of maintenance methylation relies on the semiconservative replication of the parental strand methylation pattern onto the daughter strand (Holliday and
3 Pugh 1975). The enzyme DNMT1 preferentially methylates new CpG regions whose partners on the parent strand already contain a methyl group (Pradhan et al. 1999) thus, DNMT1 maintains all the methylation in a genome. A functional DNA methylation system requires the presence of at least one DNMT1 and DNMT3 enzyme (Goli and Bester 2005).
1-2-2: DNA methylation in vertebrates
Although DNA methylation acts on a variety of genomic regions among the taxa, one of the most widely conserved targets of methylation appears to be the gene bodies (Glastad and Hunt 2011). In vertebrates, DNA methylation is mostly confined to CpG dinucleotide regions, cytosine followed by guanine, interspersed globally throughout the genome (Wang et al. 2006). 60-90% of all of these CpG regions are subject to DNA methylation in a majority of mammals (Lister et al.
2009). The most striking feature of methylation patterns in vertebrates is the presence of CpG islands (Bird 2002). These islands are unmethylated regions approximately 300-3000 base pairs in length that are rich in CG regions found near
40% of mammalian gene promoters (Fatemi et al. 2005). A large portion of CpG islands in humans are prone to progressive methylation in certain tissues due to aging or in abnormal cells such as cancer cells (Bird 2002). This evidence suggests that cancer risk due to methylation increases with age. The activation or repression of a gene is linked to the degree of methylation around its promoter such that
“promoter regions of inactive genes tend to be more heavily methylated than the promoter regions of active genes” (Karp and Geer 2013).
4 Methylation in the promoter region of a gene has been linked to transcriptional repression of that gene in vertebrates (Wolffe and Matzke 1999).
DNA methylation likely interferes with the binding of transcription factors needed to convert DNA to RNA at promoter regions, thus inhibiting gene expression (Watt and Molloy 1988) or enhances the binding of repressive proteins to the methylated
CpG regions (Boyes and Bird 1991). Thus, methylation could have important effects on gene expression and changes in the degree of methylation may explain the turning on and off of genes during the developmental process (Holliday 2006). DNA methylation of a promoter is closely linked with another epigenetic mechanism known as histone modification to maintain the gene in an inactive state until needed
(Karp and Geer 2013).
It is believed that in early development, genes that are not required until later in life are held in a repressed state through histone modifications, which are flexible and reversed when expression of these genes are needed (Reik 2007). Gene inactivation may begin with the establishment of a transcriptionally repressive pattern of histone modifications in the core histone proteins of promoter regions.
These modified histone tails recruit the methylation enzymes to that nucleosome so that once DNA methylation occurs in these regions, the methylated cytosine residues serve as binding sites for additional histone modifying enzymes that further repress and compact the chromatin in that promoter (Karp and Geer 2013).
This process holds the gene in an inactivated state until expression is needed later in development.
5 1-2-3: DNA methylation in insects
In contrast to vertebrate genomes, which tend to exhibit global methylation or dispersion of methylation across the genome, DNA methylation in insects is primarily seen in specific genes (Glastad and Hunt 2011). Initially, it was believed that insects did not perform DNA methylation due to low or absent levels of methylation in model invertebrates such as Drosophila melanogaster (Rae and
Steele 1979). The lack of de novo and maintenance methyltransferases and near lack of methylation suggested that other molecular mechanisms could perform the functional role of methylation (Marhold et al. 2004). However, more recent studies have shown the existence of DNA methylation in many invertebrate taxa. The presence of DNA methylation enzymes in the genome of Daphnia pulex (Albalat
2008) and the presence of methylated cytosine in its sister taxa Daphnia magna
(Vandegehuchte et al. 2009) suggest that DNA methylation may have been ancestral to the class of invertebrates, Insecta (Glastad and Hunt 2011). The diversification of insects most likely resulted into the lineage specific loss of DNA methylation
(Glastad and Hunt 2011).
Genomic analyses of the insect order Hymenoptera revealed the evolutionary persistence of DNA methylation in social insects such as bees, wasps, and ants
(Kronfoest et al. 2008). The first DNA methylation system consisting of de novo and maintenance DNMTs in insects was discovered in the honeybee Apis mellifera
(Wang et al. 2006). Fully functioning methylation systems were also discovered in the two ants Harpegnathos saltator and Camponotus floridanus (Bonasio et al. 2012).
Additionally, DNMT1 and DNMT3 enzymes were found in four other ant species;
6 Solenopsis invicta (Wurm et al. 2011), Pogonomyrmex barbatus (Smith C.R. et al.
2011), Linepithema humile (Smith C.D. et al. 2011), and Atta cephalotes (Suen et al.
2011). In contrast to the widespread methylated species in the order hymenoptera, other insect taxa exhibit diminished levels of methylation (Glastad and Hunt 2011).
For example, the flour beetle Tribolium castaneum lost the enzyme DNMT3 and is apparently unable to methylate DNA (Tribolium Genome Sequencing Consortium
2008). Additionally, the insect order Diptera, which includes flies, has shown a loss of DNA methylation proteins as genome sequencing projects have failed to detect
DNMT1 or DNMT3 proteins (Hung et al. 1999; Tweedie et al. 1999). The loss of DNA methylation systems in insect taxa other than Hymenoptera most likely resulted from their diversification.
Analysis of differential DNA methylation of the ants Harpegnathos saltator and Camponotus floridanus gives insight into the mechanism and function of DNA methylation in other species of ants. Bisulfite treatment followed by whole genome sequencing was used to compare the methylomes of different castes of the two species. By analyzing the DNA methylation maps of two developing stages and five adult casts in the species H. saltator and C. floridanus, conserved features of ant methylomes were identified. These conserved features include: the presence of non
CpG methylation in developing and adult castes, the accumulation of methylated cytosines on transcribed exons, and the existence of allele specific DNA methylation and its correlation with allele specific expression (Bonasio et al. 2012). The results indicate that the methylation was most prominent inside gene bodies, and particularly on transcribed exons, which is consistent with findings that the
7 majority of DNA methylation in invertebrates and plants occur on intermediate to high expression genes (Bonasio et al. 2012). The unexpected presence of non-CpG methylation in adult ants brings up the possibility of biologically functional non-CpG methylation in ants (Bonasio et al. 2012). Some of the differentially methylated genes (different methylation levels of the same gene between castes) were conserved between the two species, however many were species-specific indicating the evolutionary divergence between the species and the difference in targets of methylation (Bonasio et al. 2012). This study shows that fully functioning DNA methylation systems not only exist in ant species, but they may play a functional role in biological and developmental processes as well as in caste system determination.
The function of DNA methylation in insects is not fully understood, however researchers have proposed several explanations for the process. DNA methylation of gene bodies in insects may play a role in the maintenance of genome integrity, as well as the regulation of mRNA initiation or splice patterns (Glastad and Hunt
2011). Alternative splicing and transcription patterns vary throughout development of an organism (Barberan-Soler and Zahler 2008) and may play a role in generating phenotypic variation (Ast 2004). A broad study of invertebrates revealed a positive association between amount of cell turnover and levels of DNA methylation suggesting the increased need for epigenetic systems with increased developmental complexity (Regev et al. 1998). It is hypothesized that de novo methylation may play a role in developmental responsiveness to environmental factors and regulation of developmental plasticity as seen in the honeybee Apis mellifera (Kucharski et al.
8 2008). Therefore, the addition of epigenetic processes during the development of an organism may provide a mechanism for the responsiveness to environmental stimuli through variation in the regulation of gene transcription (Glastad and Hunt
2011). DNMT enzymes interact with transcription factors, epigenetic regulators, histone modification, and non-coding RNAs, and may guide caste specific methylomes in ants in response to environmental cues (Bonasio et al. 2012). In general, it is believed that DNA methylation in insects may play a role throughout development and may play a role in caste determination as ant embryos can follow different developmental trajectories (Bonasio et al 2012).
Interestingly, genes with higher levels of methylation were more likely to conserve their methylation pattern over evolutionary time as indicated by an analysis of normalized CpG content in two highly diverged species; Ac. Psium and
Apis melifera (Hunt et al. 2010). This indicates that heavily methylated genes in the common ancestor of these two species were more likely to remain heavily methylated over evolutionary time (Bonasio et al. 2012). More over, genes that are methylated in divergent taxa exhibit more overlap in their function than unmethylated genes (Hunt et al. 2010). These results indicate a functional reason for this conservation of DNA methylation over evolutionary time (Bonasio et al.
2012). Since the field of epigenetics is still in the beginning stages of exploration, further research is needed for a better understanding of DNA methylation in insects.
However, social insects, including ants, prove a promising target for understanding the role of DNA methylation in developmental regulation due to the presence of
9 exceptional phenotypic plasticity and potential for genomic imprinting (Bonasio et al. 2012).
1-3: Identification of differentially methylated regions
DNA methylation involves the addition of a methyl group to carbon 5 of a cytosine base. The mechanism has been known for years, however it has received a recent boost of attention for its functional role in cancer (Feinburg and Tycko 2004), aging (Issa 2003), and diseases (Walter and Paulsen 2003). Identifying differentially methylated genes or regions proved useful in identifying functional conservation of genes over evolutionary time and the role of DNA methylation in developmental regulation of insect taxa such as ants (Bonasio et al. 2012). Current DNA sequencing techniques do not have the ability to distinguish between cytosine and methylated cytosine, thus different methods must be used to distinguish between the two in order to measure the degree of differential methylation (Kurdyukov and Bullock
2016).
Bisulfite sequencing is the most accurate and probably the most widely used method for analyzing differential DNA methylation (Hajkova et al. 2002). Bisulfite treatment works by intervening with the deamination, or removal of an amino group, of cytosine into uracil, and these converted cytosines will read as thymine upon PRC amplification and subsequent Sanger sequencing. However, the methylated cytosines are resistant to the treatment and the resulting conversion and will read as cytosine upon sequencing. Thus, comparing the sequencing read from an untreated DNA sample to the same sample following bisulfite treatment allows for the detection of methylated cytosines (Kurdyukov and Bullock 2016).
10 With the invention of next-generation sequencing technology, differential DNA methylation can be measured across entire genomes allowing for extensive methylome analysis between species. Whole genome bisulfite sequencing is similar to whole genome sequencing with the addition of bisulfite treatment. It is the most comprehensive method of measuring differential methylation, however the high cost and difficulty of analysis limits its use (Kurdyukov and Bullock 2016).
Despite the accuracy of bisulfite sequencing, there are several potential sources for error in the process. Possible sources of error involve the bisulfite conversion, PCR amplification, and sequencing of the DNA (Bock et al. 2005).
Complete conversion of non-methylated cytosines is a crucial step as it is assumed that all unconverted cytosines were originally methylated. Thus, incomplete conversions will result in a higher estimated level of DNA methylation. Error in the actual process of PCR amplification may result in genomic contamination or poor quality gene fragments. Additionally, PCR amplification may produce an over representation of sequences from one or a few individual chromosomes, resulting in a skewed representation of methylation (Bock et al. 2005). Sequencing errors that convert cytosine to thymine and vice versa leads to errors in data collection derived from the sequences (Bock et al. 2005). Furthermore, difficulty in sequence alignment results from DNA fragmentation and decreased genome complexity
(Kurdyukov and Bullock 2016). To reduce potential errors, it is important to incorporate controls for bisulfite reactions, pay close attention to the appearance of cytosines to determine whether complete or incomplete conversion has occurred, and take care in aligning the untreated and treated sequences.
11 In addition to the process of bisulfite sequencing, other factors need to be taken into account in measuring differential methylation. The use of whole body genome analysis versus tissue specific analysis may affect the degree of differential methylation. Whole genome analysis, generated from whole bodies, includes a mixed cell population resulting in a dilution effect resulting in an overall lower amount of methylation (Kurdyukov and Bullock 2016). This technique causes difficulty in determining the location of the differential methylation, but allows for a more comprehensive analysis of the entire genome. Analysis from specific tissue sampling allows for the direct comparison of methylation of particular genes from a particular region of the body without dilution. It allows for increased focus on particular genes, but excludes the potential for other genes that may be differentially methylated as well. The method used to determine differential methylation in any given experiment depends on the question the researcher is trying to answer, the resources available, and any other limiting factors (Kurdyukov and Bullock 2016).
1-4: Phenotypic plasticity
1-4-1: Genotype – Phenotype mapping function
Known as the father of genetics, Gregor Mendel was the first scientist to distinguish between genotype and phenotype. He determined that a particular factor, known as a gene, was responsible for controlling the color of his pea plants
(either yellow or green). In this well-known experiment, the factor (or gene) is the genotype, which affects the color outcome, or phenotype. Since Mendel’s discovery, scientists have been studying the relationship between genes and phenotypes,
12 referred to as the genotype-phenotype mapping function (Alberch 1991). The simplest possible genotype- phenotype mapping function (shown in figure 1.1a) involves the direct causation of genotype and phenotype (Pigluicci 2001). This simple mapping function has been explored in Beadle and Tatum’s research on mutants of Neurospora, which led to the famous one gene - one enzyme hypothesis, stating that one gene encodes a single enzyme. On a molecular level, this hypothesis generally holds true with the exception of open reading frames and substantial posttranscriptional splicing (Pigluicci 2001). However, most traits do not conform to this simple form of Mendelian genetics (Provine 2001).
In reality, a single gene can affect many different aspects of phenotype, either directly or indirectly by acting with other genes (Zhong et al. 1999). Many traits, referred to as polygenic characters, including height and weight, appear to be controlled by multiple genes. This discovery has led to a new field of quantitative genetics focusing on the relationship and extent to which genes control a particular phenotype (Pigluicci 2001). In reference to polygenic characters, pleiotropy is the concept that one gene can affect several traits simultaneously (shown in figure 1B), while epistasis states that genes can affect the action of other genes thus leading to a complex genetic web underlying any given trait (Pigluicci 2001). In addition to these concepts, the environment and development play a role phenotypic determination and have often been ignored until recently. Their effects on the genotype- phenotype mapping function are illustrated in figure 1C and 1D.
13
Figure 1 (from Pigluicii 2001): Four Hypotheses for the Genotype-Phenotype Mapping Function (A) Simple Mendelian system indicating a direct relationship between genotype and phenotype. (B) Quantitative genetic model including pleiotropy (other effects such as epistais are not shown). (C) Model including phenotypic plasticity showing that the same genotype produces different phenotypes in distinct environments. (D) Most realistic model showing that genotype – environment interactions are mediated indirectly by epigenetic effects during development.
Phenotypic plasticity is “the extent to which the environment modifies the phenotype” (Gause 1947). In other words, it is the ability of one genotype to produce more than one phenotype when exposed to different environments. As illustrated in figure 1C, the interaction between the environment and the genotype determines the phenotype because genes respond to the environment in which they are expressed (Pigliucci 2001). However, the most realistic model of genotype- phenotype mapping function, shown in figure 1D, indicates epigenetic effects during development indirectly mediate genotype – environment interactions (Suzuki et al.
1976). How the genotype – environment interactions occur is not entirely clear, as
14 crucial steps of epigenetic effects unfold during development, which accepts environmental and genetic effects as an input and produces specific phenotypes as the output (Piguicci 2001). This challenge necessitates the unification of evolutionary, developmental, and molecule biology to solve.
Evolutionarily speaking, phenotypic response to environmental change may have facilitated the exploitation of some environments and protection from others, thus the level of phenotypic plasticity in a given trait is thought to be molded by selection (Gause 1947; Schmalhausen 1949; Bradshaw 1965). Moderate levels of phenotypic plasticity are optimal in allowing a population to survive in a new environment by allowing for adaptation of traits (Price et al. 2003). In regards to social insects, phenotypic plasticity may play a role in caste differentiation as queens and workers following different developmental trajectories despite identical genotypes, as seen in the honeybee Apis mellifera.
1-4-2: Apis mellifera: An example of phenotypic plasticity
In highly eusocial bees (of the order Hymenoptera), one or a few female queens specialize in reproductive tasks, while a large number of quasi-sterile workers engage in colony maintaining activities (Michener 1974). Both the queen and the worker bees have identical genotypes; however differential feeding of female larvae during development promotes the occurrence of two phenotypes
(Barchuk et al. 2007). Initially, young larvae of both queens and workers are fed royal jelly, a secretion produced by glands in the heads of adult workers. However after larval stage 3, nurse bees feed significantly more royal jelly to prospective queen larvae until they enter metamorphosis, while the diet for worker larvae
15 switches from pure royal jelly to a mixture of glandular secretions with honey and pollen, called worker jelly (Jung-Hoffman 1966). This nutritional stimulus triggers an endocrine response leading to increased Juvenile Hormone in queen larvae compared to worker larvae (Hartfelder 1998). Wirtz and Beetsma demonstrated the queen inducing properties of Juvenile Hormone by topically applying Juvenile
Hormone on fourth and early fifth instar worker larvae (Wirtz and Beetsma 1972).
Once Juvenile Hormone reaches threshold, it controls the expression of genes involved in development of specific organs and in specifying the general body plan of the bee. In addition, Juvenile Hormone also prevents cell death in the ovaries and inhibits the development of some organismal systems characteristic of adult workers that are present in the original developmental pattern such as worker specific leg structure and (Barchuk et al. 2007). The effects of Juvenile Hormone as a consequence of differential feeding result in the two larvae following different developmental trajectories despite having the same genetic background.
Severson and his colleagues were the first to perform a large-scale study on the molecular biology of caste differentiation in Apis mellifera and demonstrated by in vitro translation analysis that workers and queens differ in their mRNA profiles during larval and preputal development (Severson et al. 1989). Further studies by
Corona et al. (1999) and Evans and Wheeler (1999; 2000) determined that the most differentially expressed genes between queens and workers were related to metabolic processes. Specifically, queens appear to up regulate metabolic enzymes while workers up regulate developmental genes.
16 Barchuk and his colleagues (2007) used cDNA microarrays to monitor differential gene expression in worker and queen larvae in order to identify cis- acting elements associated with these two developmental trajectories and proposed a mechanism for caste determination in Apis mellifera. From a cDNA microarray analysis on 6,000 genes throughout larval development, 240 genes were identified as differentially expressed between queens and workers during the third, fourth, and fifth instar. Of the 240 genes that were differentially expressed, a majority were up regulated in the fourth instar for both queens and workers indicating that the majority of changes in gene expression take place during this period of nutritional switch. It was also found that workers up regulate more developmental genes while queens up regulate more physiometabolic genes including genes related to the metabolism of nitrogenous compounds. This is because queen larvae are fed more royal jelly rich in nitrogen compounds (amino acids and nucleotides) than worker larvae (Haydak 1970). The protein products of the up regulated physiometabolic genes associated with cellular localization, protein binding, nucleotide binding, nucleic acid binding, and hydrolase and oxidoreductase activity participate in the processes leading to the differential growth of the queens body (Barchuk 2007). The results of this study exemplify how a difference in environment demonstrated by the differential feeding of larvae can lead to different developmental trajectories resulting in two entirely different phenotypes, a queen and a worker bee, despite identical genotypic backgrounds.
17 1-5: Caste determination in insects
Division of labor and caste determination are central to the organization of social insects and appear to be responsible for their extreme ecological and evolutionary success (Holldobler and Wilson 1990). Most colonies are divided into two major morphologically different castes: the queen and the workers. A queen’s responsibility is to reproduce while semi sterile workers construct a shelter, raise the young, forage for food, and protect the queen. Larger and more complex colonies are often characterized by further division of labor between minor and major workers, thus forming sub castes (Anderson et al. 2008). Unfertilized virgin queens and drone male ants are usually responsible for reproducing and forming new colonies. Each species of eusocial insect demonstrates variation in social organization regarding the number of individuals in the social group, their behavioral and genetic relationships, and the manner in which reproduction is partitioned. This social organization is the product of diverse extrinsic selection pressures generated by local ecology interacting with intrinsic selection pressures related to the interactions among group members (Ross and Keller 1995). However, the factors influencing caste determination are less understood.
The honeybee, Apis mellifera, has long been the model organism for studying reproductive caste determination. Early studies demonstrating that the consumption of “royal jelly” resulted in the queen phenotype led to the long- standing belief that caste differentiation was determined exclusively by environmental factors (Michener 1974). Likewise, early research on ants indicated the importance of nutrition in caste determination (Anderson et al. 2008). Other
18 environmental factors such as temperature, queen pheromones, food quality and/or quantity, queen age and/or overwintering status, and colony size have also been shown to influence caste determination (Schwander et al. 2010). These studies supported the idea of environmental caste determination (ECD) and led to the belief that genes biasing queen or worker development are fixed or lost so that little genetic variation for caste is maintained in the population (Crozier and Pamilo
1996). Such findings indicate the importance of environmental factors on caste determination, however most studies overlook a genetic component and thus do not provide evidence for an environmental caste system that is insensitive to genetic variation (Schwander et al. 2010).
In 1937, W.M. Wheeler observed that individuals from a colony of leaf cutter ants presented a mixture of queen and worker traits leading him to believe there was some genetic control in caste determination of ants. Other researches also inferred genetic influences on caste determination based on their observation of abnormal phenotypes in queens and their presumed offspring (Anderson et al.
2008). Most importantly, Wheeler (1937) concluded that caste system determination in ants would lie somewhere beyond the “environmental – versus – hereditary impasse” as caste is a complex phenotype influenced by multiple interacting genetic and environmental factors. More recent studies have provided mounting evidence for this conclusion where species can either have minor genetic effects with greater environmental effects on caste, equal genetic and environmental effects on caste, and major genetic effects with less environmental effects on caste
(Schwander et al. 2010). This variation in degree of genetic and environmental
19 factors may be due to life history traits and colony social structure of different species.
1-6: Solenopsis invicta
Solenopsis invicta, originally from Mato Grosso, Brazil, now infests nine states in the Southern United States (Lofgren et al. 1975). This highly invasive pest inflicts a painful and very potent sting that causes hypersensitivity reactions in humans.
The species also forms large colonies at high densities capable of damaging agricultural machinery resulting in the interference of harvesting and crop production (Vinson 1986). These fire ants are of economic importance as they have caused agricultural damage worth $750 million a year through crop damage, livestock loses, repairs, and vet bills (McDonald 2006). Due to the specie’s medical and economic importance, there has been a general agreement to generate organized control programs to limit population numbers and to study the general biology, ecology, and methods of control of these ants (Banks et al. 1978).
There are two distinctive social forms of the species Solenopsis invicta. The monogyne (M) form is characterized by colonies with a single egg-laying queen, while the polygyne (P) form is characterized by colonies with multiple egg-laying queens (Ross and Keller 1995). The queen in the monogyne form mates in aerial swarms and finds new nests independently, without the help of workers. These monogyne queens tend to have larger body sizes, higher nutrient reserves, longer life spans (Ross and Keller 1995), and higher fecundity (Herbers 1984). The queens of the polygyne form often mate inside the nest during swarming but initiate egg- laying in established nests with the help of workers (Ross and Keller 1995). Ants of
20 the polygyne form from different nests tend to intermingle without aggression and populations consist of interconnected nests (Vander et al. 1990). Ross and Keller
(1998) discovered that a single genomic element marked by the protein-encoding gene Gp-9 was responsible for the existence of these two social forms in Solenopsis invicta. They concluded that this genetic factor influences the reproductive phenotypes and behavioral strategies of the queens as well as whether workers will tolerate a single queen or multiple queens per colony. This finding reveals how a single genetic factor can play a major role in complex social behavior and influence social organization (Ross and Keller 1998).
If a single genetic factor can heavily influence social organization, it may be possible that genetics also play a role in caste determination in the species
Solenopsis invicta. In this species of fire ants, queens and workers are morphologically distinct, while ants in the worker caste continuously measure between the range of two and six millimeters (Mirenda and Vinson 1981). Wilson
(1978) created a general reference for subcastes of workers based on head width.
He stated that much of the division of labor in ant colonies is based on variation in head properties such as size and shape of mandibles, size of adductor muscles, and volume of mandibular glands. He concluded that minor workers had a head width less than 0.72 mm, media workers had a head width of 0.73 – 0.92 mm, and major workers had a head width of 0.93 mm or greater (Wilson 1978). Although there is no set division of labor in Solenopsis invicta, Wilson (1978) found that small workers were more likely to partake in brood care, while larger workers were more likely to defend the nest and forage for food.
21 Wurm and his collegues (2011) discovered that the species Solenopsis invicta harbors a complete set of genes coding for the enzymes DNMT3, DNMT1, and
TRDMT1 (previously known as DNMT2), which are known to be involved in DNA methylation, maintenance of methylation patters, and tRNA methylation in eukaryotes. Additionally, DNA methylation was confirmed by sequencing bisulfite treated genomic DNA from nine genes (Wurm et al. 2011). This evidence combined with the presence of differentially methylated genes between castes in
Harpegnathos saltator and Camponotus floridanus (Bonasio et al. 2012) has led to the hypothesis that DNA methylation may play a key role in developmental responsiveness to environmental factors and may be a mechanism for social insect caste determination. This study seeks to determine the presence of differentially methylated genes between queen and worker ants of the species Solenopsis invicta through the use bisulfite treatment on selected genes derived from whole body DNA extraction.
22 Chapter 2: Materials and Methods
2-1: Determination of target genes
Bonasio and colleagues (2012) identified twenty conserved differentially methylated genes between queens and workers in the ant species Harpegnathos saltator and Camponotus floridanus (Table 1.1). Since these genes were consistently differentially methylated between the two species, it was presumed that they would also be involved in differential methylation of genes between castes in the species
Solenopsis invicta as this species of fire ant also contains a fully functioning DNA methylation system (Wurm et al. 2011). The symbols and/or names for the genes from Table 1.1 were searched in the NCBI database in order to obtain the gene locus number for Camponotus floridanus and Harpegnathos saltator. Once these locus numbers were obtained, a BLAST search revealed the gene orthologs in Solenopsis invicta (Table 1.2). Some of the gene names or symbols differed between species and are indicated in the notes section of Table 1.2.
The genes Rab11 and Mat89Bb (also known as Asunder in the species
Solenopsis invicta) were chosen as the target genes in this study due to their smaller size and conserved function. The gene Rab 11 is 3372 base pairs in length and contains two exons, while the gene Mat89Bb is 3844 base pairs in length and contains nine exons (Table 1.3). The gene Mat89Bb codes for the protein Asunder that regulates cell cycle, oogenesis, and spermatogenesis, while the gene Rab11 codes for the Ras-related protein Rab - 11A that regulated oogenesis and fertility
(Bonasio et al. 2011). Both genes are involved in cell signaling and cell division leading to the possibility they may be involved in developmental progression.
23 Class Symbol Name Function CDK5 and ABL1 enzyme Reproduction CABLES1 substrate 1 Associated with oogenesis Gametogenetin-binding Male germline-specific genes; GGNBP2 protein 2-like spermatogenesis KLp3A Kinesin-like protein KLP3A Meiosis; fertility Actin- binding protein Anillin anillin Meiotic cytokinesis Response to nutrient levels; Tuberous sclerosis 2 reproductive process; adult TSC2 protein homolog lifespan RNA- binding protein Reproduction; ovarian follicle sqd squid cell development; oogenesis Cell cycle regulator Cell cycle regulator; oogenesis' Mat89Bb Mat89Bb spermatogenesis Meiosis; germ cell development; gamete Mei-P26 Mei-P26 generation Nup-98- Germ-line stem cell 96 Nucleoprin 98-96 maintenance CTP: phosphocholine Oogenesis and ovarian Cct1 cytidylyltransferase 1 morphogenesis Ras - related protein Rab- Rab11 11A Oogenesis; fertility
SMG6, Telomerase-binding Telomere EST1A protein EST1A Regulator of telomere RTEL1 elongation helicase 1 Telomere maintenance Tankyras e Tankyrase Promote telomere elongation Structural maintenance of SMC6 chromosomes protein 6 Maintain telomere length RAD50- interacting protein Associated with telomere RINT1 1 lenghtening
Production of siRNA involved Small RNA AGO2 Protein argonaute-2 in RNA interference Serrate RNA effector Conversion of ds siRNA to ss Ars2 molecule homolog siRNA involved in RNAi MOV10L Essential component of piRNA 1 Putative helicase Mov1011 pathway AGO1 Argonaute - 1 Mature miRNA production
Table 1.1 (from Table S4. Bonasio et al. 2011). Conserved Differentially Methylated Genes Between Queens and Workers in Camponotus floridanus and Harpegnathos saltator Table showing the symbol, name, and function of conserved differentially methylated genes between queens and workers in Camponotus floridanus and Harpegnathos saltator.
24
Camponotus Solenopsis floridanus Harpegnathos Symbol invicta Locus Notes locus saltator locus CABLES1 LOC105195575 LOC105253900 GGNBP2 LOC105193993 LOC105255440 Known as KIF3A not LOC105254083 Klp3A LOC105197783 KLP3A LOC105190359; LOC105254313 Anillin LOC105199020 LOC105185851 Called Tuberin in TSC2 LOC105202531 Solenopsis LOC105251025 sqd LOC105197487 LOC105252127 Asun, asu are synonyms, asunder is LOC105251883 Mat89Bb LOC105194468 protein name LOC105182465 Misannotated in Mei-P26 paper? LOC105201258; Nup98-96 LOC105201691 Cct1 LOC105195638 LOC105259449 Rab11 LOC105200877 LOC105248745 LOC105180684
SMG6, EST1A LOC105205402 Big LOC105252850 LOC105180957 RTEL1 LOC105204462 LOC105248448; LOC105188433; Tankyrase LOC105193132 LOC105258407 LOC105192236 LOC105194259; SMC6 LOC105207477 LOC105253765 LOC105180610 RINT1 LOC105202859 LOC105249092 LOC105185935
LOC105194624; AGO2 LOC105208282 LOC105255733; Ars2 LOC105202422 LOC105249232 LOC105191257 MOV10L1 LOC105207984 LOC105249154 Can only find similar AGO1 to the AGO2
Table 1.2 Gene Locus Numbers for Camponotus floridanus, Harpegnathos saltator, and Solenopsis invicta Gene locus numbers for Camponotus floridanus and Harpegnathos saltator found by searching gene symbols (from Table 1.1) on NCBI database and using BLAST to find corresponding gene orthologs in Solenopsis invicta (locus number shown in table). The target genes in this study Mat89Bb, also known as Asunder, and Rab11 are highlighted in yellow.
25
Length of Solenopsis invicta Locus Number of Locus (in Symbol Number Exons base pairs) CABLES LOC105195575 10 6119 bp GGNBP2 LOC105193993 11 4984 bp Klp3A (KIF3A) LOC105197783 9 3773 bp Anillin LOC105199020 19 8243 bp TSC2 LOC105202531 28 62754 bp sqd LOC105197487 10 12018 bp Mat89Bb LOC105194468 9 3844 bp Nup98-96 LOC105201258 6 13802 bp cct1 LOC105195638 13 8791 bp Rab11 LOC105200877 2 3372 bp SMG6 LOC105205402 27 97825 bp RTEL1 LOC105204462 12 10589 bp Tankyrase LOC105193132 12 8983 bp LOC105194259; SMC6 LOC105207477 7 2164 bp RINT1 LOC105202859 7 32913 bp LOC105194624; AGO2 LOC105208282 17 11524 bp MOV10L1 LOC105207984 8 7061 bp
Table 1.3 Solenopsis invicta Gene Orthologs Table showing Solenopsis invicta gene orthologs including data on locus numbers, number of exons, and locus length. Data was obtained using NCBI BLAST. Target genes Mat89Bb (Asunder) and Rab 11 are highlighted in yellow.
2-2: Primer design
Once the target gene sequences were obtained using the NCBI database, PCR primers were designed in order to amplify these gene sequences in the DNA extracted from the organism Solenopsis invicta. Bonasio and colleagues’ (2012) study on Harpegnathos saltator and Camponotus floridanus revealed the presence of non-CpG methylation and the accumulation of methylated cytosine on exons as well as intron - exon junctions. With these results in mind, it was important to design primers that would incorporate the coding regions as well as the intron – exon
26 junctions of each gene. Additionally, it was important to minimize the CG content of the primers in order to keep the annealing temperature lower among all of the primers. Primers were designed using the “Pick Primers” feature on the NCBI database and they were ordered from Eurofins. Table 2.1 shows the primer sequences used in the study.
Primer Primer Name Sequence 5' to 3' Length CG% Tm 41.70 Asunder Front F TCGTGCTGGATCATACTCCATATT 24 bp % 61.2 °C 52.40 Asunder Front R CCCACCGCATCCTTCACTAAT 21 bp % 62.6 °C 37.50 Asunder Rear F ATGGTGGCGAGATTTTCATTCATA 24 bp % 59.4 °C 41.70 Asunder Rear R TAGGTTCTCTTCCAATCTCCTTCA 24 bp % 61.2 °C 42.90 Asunder Whole F TGCCCGTTGGAATTTGACTTT 21 bp % 58.7 °C Asunder Whole 41.70 R TAGGTTCTCTTCCAATCTCCTTCA 24 bp % 61.2 °C
TTGTTCTCATTGGAGATTCTGGAG 38.50 Rab 11 Rear F TA 26 bp % 61.4 °C
Rab 11 Rear R TTACGCAGAGGTAATCGCAC 20 bp 50% 60.4 °C 57.90 Rab 11 Whole F CTCGGCCTGCCCTTTGTAT 19 bp % 62.3 °C
Rab 11 Whole R CACGATAACGCTCTTGTCCA 20 bp 50% 60.4 °C
Table 2.1 Primer Design for Asunder and Rab 11 Genes in Solenopsis invicta Table showing the forward and reverse primer sequence, length, CG content, and annealing temperature for Asunder Front, Asunder Rear, Asunder Whole, Rab 11 Rear, and Rab 11 Whole.
27 2-3: DNA extraction
There are two distinct social forms of the species Solenopsis invicta; the monogyne form characterized by colonies with a single egg-laying queen and a polygyne form characterized by multiple egg-laying queens in a single colony (Ross and Keller 1995). In this experiment, the monogyne form of Solenopsis invicta was used to study differential methylation between workers and queens in the genes
Asunder and Rab 11. DNA was extracted from whole body samples using the protocol from the DNeasy Blood and Tissue Kit® and then purified for PCR amplification.
Ant samples were divided by caste into major workers, minor workers, and queens. 50 mg of whole body individuals were placed inside a 1.5 mL micro centrifuge tube and crushed using a disposable microtube pestle and electric homogenizer. 180 microliters of PBS were added and the ants were further crushed to expose tissues. 20 microliters of proteinase K and 200 microliters of Buffer AL
(Qiagen) were added to the sample and mixed thoroughly by vortexing for one minute. The sample was then incubated for ten minutes at 56 °C. This incubation period allowed the ants to completely lyse, or break apart, exposing their DNA.
Alcohol, often ethanol, was used to enhance and influence the binding of nucleic acids to the silica in the membrane. 200 microliters of ethanol was added to the sample and mixed thoroughly by vortexing. This mixture containing DNA along with tissues and other precipitates was pipetted into a DNeasy spin column that was placed into a 2 mL micro centrifuge collection tube. The column was placed in a
28 centrifuge at 8,000 RPM for one minute. The flow through and collection tube was discarded.
Since the lysate was centrifuged through the membrane, the DNA should have then been bound to the column and the impurities such as proteins and polysaccharides should have passed through the membrane into the collection tube to be discarded. However, the membrane was still contaminated with residual proteins and salts. The washing steps involved washing the membrane with wash buffers 1 and 2 in order to remove these impurities. Removal of these salts is crucial for high yields of pure DNA. The DNeasy column was placed inside of a new 2 mL collection tube and 500 microliters of Buffer AW1 (wash buffer 1) was added. The sample was run in the centrifuge for one minute at 8,000 RPM and the flow through along with the collection tube were discarded. The column was again placed into a new 2 mL collection tube and 500 microliters of Buffer AW2 (wash buffer 2) was added.
Following the wash steps, the membrane was dried to remove any remaining ethanol that may interfere with subsequent reactions. Skipping the drying step would result in ethanol contamination and low yields of DNA. To perform the dry step, the sample was centrifuged for three minutes at 14,000 RPM to dry the DNeasy membrane.
The final step involved releasing the pure DNA from the silica with the aid of an elution buffer. The column was removed carefully so that it did not come into contact with the flow through and the flow through and collection tube were discarded. The column was placed into a new 2 mL micro centrifuge tube and 200
29 microliters of Buffer AE (elution buffer) was added directly onto the membrane. The sample was incubated for one minute at room temperature and then centrifuged for one minute at 8,000 RPM to elute. Following elution, the extracted DNA along with the elution buffer was located inside the micro centrifuge tube. This tube was labeled with the organism, caste, and date of extraction to be used in subsequent
PCR amplification.
2-4: PCR amplification
2-4-1: PCR overview
The polymerase chain reaction (PCR) developed by Kary Mullis in the 1980s is a technique used to amplify a specific target sequence of DNA based on the ability of DNA polymerase to synthesize a new strand of DNA complementary to the template strand. Because DNA polymerase is only capable of adding a nucleotide to an existing 3’-OH group, a primer is needed to which it can add the first nucleotide
(Polymerase Chain Reaction 2014). This need for a primer allows researchers to target and amplify a specific DNA sequence from the entire genome.
PCR begins with a DNA template that contains the sample DNA and the target sequence. High temperature is applied to the original double stranded DNA to cause denaturation, or separation of the two strands. Two oligonucleotide primers (one forward and one reverse primer) hybridize to the opposite strands and surround the region of interest in the target DNA (Erlich 2015). DNA polymerase, an enzyme that synthesizes new DNA strands complementary to the target sequence, binds to these primers and begins synthesizing the complementary strand. This complementary strand can then serve as a template for a repetitive series of cycles
30 involving template denaturation, primer annealing, and extension of the annealed primers by DNA polymerase resulting in the exponential accumulation of the target sequence (Erlich 2015). The number of target DNA copies approximately doubles after each cycle resulting in millions of copies of the target DNA sequence (known as amplicons). In this study, PCR was used to amplify the sequences of the target genes
Asunder and Rab11.
2-4-2: Primer reconstitution
Primers were initially designed to incorporate the entire gene sequence of
Asunder and Rab11 (shown in figure 2.1, figure 2.2, and table 2.1), however these sequences were too long for proper amplification. As a result, the genes were divided into smaller sections for amplification. Asunder was divided into Asunder
Front and Asunder Rear, while Rab11 was divided into Rab 11 Rear. When the primers arrived, they had to be reconstituted to a 100 micro molar concentration by adding the appropriate amount of water (shown in table 2.2). The 100 micro molar primers were then diluted to a 10 micro molar concentration by adding 10 microliters of primer to 90 microliters of water. This 10 micro molar concentration of primer was then used in the PCR reactions.
2-4-3: PCR reaction setup
One PCR reaction consists of 25 microliters of PCR mix (Thermutisher), 2 microliters of forward primer, 2 microliters of reverse primer, 5 microliters of DNA, and 16 microliters of water yielding 50 microliters total. Using this formula, a master mix containing the proportional constituents can be made for the number of
PCR reactions needed where one reaction is the negative control, one is excess or
31 “slop”, and the rest are positive replicates. The DNA is not added into this master mix, but rather into the individual PCR tubes of positive reactions. 45 microliters of this master mix would be pipetted into each labeled PCR tube. 5 microliters of water would be added into the negative control PCR tube while 5 microliters of extracted
DNA would be added into each of the positive replicate PCR tubes. These reactions would then be placed in a thermal cycler and the parameters would be set in order to optimize amplification of the target gene sequence.
2-4-4: Thermal cycler
The thermal cycler parameters affect how well the target gene sequence is amplified. Most of the parameters remained the same throughout the experiment with the exception of the annealing temperature (Tm), which varied based on the primers used. Table 2.1 shows the optimal annealing temperature for each primer.
Table 3.1 shows the parameters used in this study with the exception of annealing temperatures, which varied by primer. The temperature is initially raised to 95 °C
(steps 1 and 2) to denature the template strand. The temperature is then brought to the annealing temperature (step 3) to allow primers to bind. When the temperature reaches 72 °C, DNA polymerase synthesizes the complementary strand. This cycle of template strand denaturation, primer annealing, and extension of annealed primers by DNA polymerase continues for as many times indicated by step 5 resulting in the millions of amplicons. These copies of the target sequence remain in an infinite hold at 8 °C (step 7) until they are removed from the thermal cycler.
32 Add x μl nmol for Primer concen 100 Tm Name Sequence 5' to 3' tration Scale μM °C Asunder TCGTGCTGGATCATACTCCATAT 10 Front F T 13.9 nmol 139 61.2 Asunder 10 Front R CCCACCGCATCCTTCACTAAT 13.9 nmol 139 62.6 Asunder ATGGTGGCGAGATTTTCATTCAT 10 Rear F A 12.9 nmol 129 59.4 Asunder TAGGTTCTCTTCCAATCTCCTTC 10 Rear R A 14.2 nmol 142 61.2 Asunder 10 Whole F TGCCCGTTGGAATTTGACTTT 14.4 nmol 144 58.7 Asunder TAGGTTCTCTTCCAATCTCCTTC 10 Rear R A 14.2 nmol 142 61.2 Rab 11 TTGTTCTCATTGGAGATTCTGGA 10 Rear F GTA 12.5 nmol 125 61.4 Rab 11 10 Rear R TTACGCAGAGGTAATCGCAC 12.8 nmol 128 60.4 Rab 11 10 Whole F CTCGGCCTGCCCTTTGTAT 15.4 nmol 154 62.3 Rab 11 10 Rear R CACGATAACGCTCTTGTCCA 13.3 nmol 133 60.4 Rab 11 10 Rear R CACGATAACGCTCTTGTCCA 13.3 nmol 133 60.4
Table 2.2 Concentrations of Primers Table showing primer names, sequence of primers, concentration of primers in nano moles on a 10 nano molar scale, amount of water needed to make 100 micro molar concentration, and annealing temperature.
Thermal Cycler Parameters Step Temperature Time 1 95°C 5:00 min 2 95°C 0:30 sec 3 Tm 0:30 sec 4 72°C 1:00 min 5 Go to Step 2 38 X 6 72°C 5:00 min 7 8°C ∞
Table 3.1 Thermal Cycler Parameters Table showing step number, temperature, and time for thermal cycler.
33 2-5: Gel electrophoresis
Gel electrophoresis is a technique used to separate DNA fragments based on size. Samples containing amplified DNA fragments are inserted into wells or indentations at one end of the gel. An electric current is applied to the gel so that the cathode (negative side) is located near the wells and the anode (positive side) is located at the opposite end of the gel. Since DNA fragments have the same amount of negative charge per mass, smaller fragments will move through the gel towards the positive anode faster than larger fragments. A DNA binding dye allows the visualization of fragment location under ultraviolet light in the form of bands. A DNA latter with predetermined fragment length is used as a reference to determine the size of the DNA fragments.
In this study, gel electrophoresis was used to determine the size of the DNA fragments amplified by PCR. The gel was made adding 50 mL of Tris acetate EDTA buffer (TAE buffer solution) and 0.5g of 1% agarose to a flask that was heated and stirred until the solution dissolved. Once the solution dissolved, 2.5 microliters of ethidium bromide (10mg/mL) was added to the flask and mixed. The liquid agar mix was poured into a gel mold containing a comb for well formation and allowed to solidify for fifteen to twenty minutes. Once the gel solidified, the comb was removed and the gel was placed inside the chamber and covered with TAE buffer solution.
The wells were filled with 5 microliters of each PCR reaction product and one well per row was filled with 5 microliters of DNA ladder for reference. An electric current of 110 V was applied to the gel for approximately twenty minutes to allow the separation of fragments based on size. The gel was placed on an ultraviolet light to
34 visualize the fragment size of the PCR products in reference to the DNA ladder. A photograph of the gel was taken for analysis of the results. The purpose was to determine whether the PCR product size was approximately the same as the expected PCR product lengths determined by the primers used in PCR amplification.
The expected PCR product lengths of Asunder Whole, Asunder Front, Asunder Rear,
Rab 11 Whole, and Rab 11 Rear can be seen in figures 2.1 and 2.2.
2-6: Cloning
Molecular cloning is a useful technique for analysis of nucleic acid sequence.
TA cloning is used in this study because of its efficiency at cloning PCR products. TA cloning utilizes Thermus aquatics (Taq) polymerase, which preferentially adds a single adenosine to the 3’ ends of a double stranded DNA molecule during PCR thus creating a 3’ A overhang. A linear T vector with single 3’ T overhangs on both ends will bind to the 3’ A overhangs from the PCR product thus allowing direct and highly efficient cloning of PCR products (Zhou and Gomez-Sanchez 2000). In this study, the successfully amplified PCR products were inserted into E. coli cells using a vector in order to clone the PCR products. After cloning, the best colonies were chosen and their DNA was extracted and sent for sequencing. The goal of sequencing these PCR products was to determine if their sequence matched the sequence in the NCBI database. If the sequences matched, the primers were binding to the correct location and amplifying the desired target sequence on the gene. However, if the sequences did not match, there could have been issues with the primers or errors in PCR or cloning reactions.
35 2-6-1: Retailing reaction
Retailing reactions prepared the samples for cloning by making sure there was an A tail left by taq polymerase. The PCR products of Asunder Front, Asunder
Rear, and Rab11 Rear were placed in a thermal cycler. The parameters for the retailing reactions can be seen in table 3.2 below.
Thermal Cycler Parameters Step Temperature Time 1 95°C 3:00 min 2 95°C 0:30 sec 3 59°C 0:20 sec 4 72°C 1:00 min 5 Go to Step 2 3 X 6 72°C 5:00 min 7 12°C ∞
Table 3.2 Thermal Cycler Parameters For Retailing Reaction Table showing the step number, temperature, and time for thermal cycler during retailing reactions.
2-6-2: PCR cleanup
Following the retailing reactions, the DNA was purified for cloning. The negative samples were discarded. 100 microliters of DNA binding buffer were added to each positive reaction and the two samples were combined in a silica spin column. The sample was centrifuged for one minute at 8,000 RPM and the flow through was discarded. 300 microliters of wash buffer 2 was added to the spin column and centrifuged for one minute at 8,000 RPM. The flow through was discarded and the collection tube was kept. 300 microliters of wash buffer 2 was added to the spin column and centrifuged for one minute at 8,000 RPM. The flow through was discarded and the collection tube was kept. A dry spin was performed at 8,000 RPM for one minute to dry the membrane. The collection tube was
36 discarded and the silica column was moved into a 2 mL micro centrifuge tube. 40 microliters of sterile water was pipetted on the center of the column. The column was incubated at room temperate for one minute and then spun in the centrifuge at
8,000 RPM for one minute. The silica column was discarded and the eluted DNA remained in the bottom of the 2 mL micro centrifuge tube.
2-6-3: Cloning ligation
The eluted DNA from the PCR cleanup step was ligated into the T-vector
(Promega Treasy) for cloning. Cloning reactions were created for Asunder Front,
Asunder Rear, and Rab11 Rear. A single cloning reaction consisted of 3 microliters of purified DNA (from PCR cleanup step), 5 microliters of 2X T4 ligase buffer, 1 microliter of T4 DNA ligase, and 1 microliters of T-vector. Three cloning reactions were made and added to three PCR tubes labeled as Asunder Front, Asunder Rear, and Rab11 Rear. The mixtures were gently mixed by flicking and then incubated at
4°C overnight.
2-6-4: Cloning transformation
E. coli cells were induced to take on the ligations consisting of a vector and the PCR product. E. coli was used because they serve as good hosts as they can grow in high numbers and will multiply the plasmid within as well. 5 microliters of ligation reaction was pipetted into a chilled 2 mL micro centrifuge tube. 30 microliters of E.coli cells were added to the micro centrifuge tube and the tube was incubated on ice for twenty minutes. The tube was then removed and placed in a
42°C water bath for 45 seconds. This heat shock increased the permeability of the E. coli cells allowing them to take in the plasmid DNA. The tube was then returned to
37 the ice bath for two minutes. 600 microliters of SOC medium was added to the tube and the tube was incubated in a shaking incubator at 37°C for sixty minutes. This was the recovery period where the cells converted their new genotype. Three LB
Amp/ X Gal IPTG plates were labeled with the Asunder Front, Asunder Rear, and
Rab11 Rear and the date. 75 microliters of cells were pipetted onto the surface of each plate and spread with a sterile hockey stick spreader. The cells were allowed to soak on the plates for a few minutes and then inverted in an incubator at 37° C.
2-6-5: Cloning
Following incubation, all of the good white colonies were circled and numbered. The five best colonies from each plate were chosen for sequencing. Table
4 shows the number of the selected colonies from Asunder Front, Asunder Rear, and
Rab11 Rear. There were twelve total colonies selected for cloning. 30 microliters of sterile water was added to each of the twelve micro centrifuge tube. A sterile toothpick was used to swab each colony and was placed into the appropriate tube and swirled. The samples were placed in the thermal cycler for five minutes at 95°C.
45 microliters of PCR master mix was added to each micro centrifuge tubes labeled with the colony number and gene symbol. 3 microliters of DNA were added to the positive samples and 3 microliters of water were added to the negative controls.
The samples were then run in the thermal cycler. After the samples were run in the thermal cycler, gel electrophoresis was used to make sure the DNA sequences were approximately the same length.
38 Colony Numbers Asunder Front 1,2,3,6,7 Asunder Rear 1,2 Rab11 Rear 2,4,5,7,8 Table 4 Colony Numbers for Asunder Front, Asunder Rear, and Rab11 Rear Table showing the five best colonies formed after plating transformed E.coli cells for Asunder Front, Asunder Rear, and Rab11 Rear
2-7: Sequencing
One sample colony for each gene was selected and PCR cleanup was used to purify the DNA before sequencing. Colony 1 was chosen for Asunder Front, colony 1 was chosen for Asunder Rear, and colony 2 was chosen for Rab11 Rear. 80 microliters of binding buffer was added to the sample and the whole volume was added to the spin column. The column was spun for one minute at 8,000 RPM. 400 microliters of wash buffer 2 were added to the column and spun in the centrifuge for one minute at 8,000 RPM. 400 microliters of wash buffer 2 were added again to the column and spun in the centrifuge for one minute at 8,000 RPM. A dry spin was performed to dry the membrane. The column was then transferred to a new 2 mL micro centrifuge tube. 35 microliters of elution buffer were added to the column and spun in the centrifuge for one minute at 8,000 RPM. The tubes containing the DNA from Asunder Front, Asunder Rear, and Rab11 Rear in the elution buffer were labeled and sent for sequencing.
When the results were returned, the sequences were analyzed to make sure that they their actual sequence length matched the expected sequence length. In order to analyze the sequences, the sequences were copied and pasted into a word document. Using the find feature, the vector cloning sites and the forward primer were searched and highlighted. The amplified PCR product was the sequence that
39 fell between the forward primer and reverse vector cloning site. The number of base pairs in this sequence was counted and compared to the expected product length.
The vector cloning site sequences can be seen in table 5 below.
Vector Cloning Site Sequences Cloning Site Sequence CTATAGAATACTCAAGCTATGCATCCAACGCGTTGGGAGCTCTCCCATAT Forward GGTCGACCTGCAGGCGGCCGCACTAGTGATT CCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCT Reverse ATAGTGAGTCGTATTACAATTCACT
Table 5 Vector Cloning Site Sequences Table showing the forward and reverse vector cloning site sequences.
2-8: PCR troubleshooting
Due to the poor sequencing results, DNA extraction was redone in the major worker and minor worker ant castes. The ants were frozen at -80°F and crushed up in a micro centrifuge tube. The same extraction procedures were followed as before, with the following exceptions. 82 mg of minor worker ants were crushed and 104 mg of major worker ants were crushed. The sample was vortexed every two minutes during the incubation period and 100 microliters of water was used instead of elution buffer. The Nanodrop2000 spectrophotometer was used to determine the purity of the DNA extracted. The Nanodrop was blanked by placing 1-2 microliters of water on the fiber because water was used as the elution buffer. DNA has an absorbance at 260 nanometers so the wavelength was set to 260 nanometers. The newly extracted major worker and minor worker DNA was analyzed using the nanodrop.
40 Since the nanodrop results showed very pure DNA, there must have been an issue with the PCR reaction resulting in poor amplification of the target sequences.
There may have been an issue with primer concentration, DNA concentration, or the annealing temperature. Using the formula C1V1 = C2V2 (C= primer concentration and V= volume) it was calculated that 0.4 micromolar primers were used for the
PCR reactions. Therefore, three PCR reactions were set up at different primer concentrations; one at 0.2 micro molar by using 1 microliter of primer, one at 0.4 micro molar by using 2 microliters of primer, and one at 0.8 micro molar by using 4 microliters of primer. In the original PCR reactions, 5 microliters of DNA was used.
Two dilutions were created using this DNA in order to determine whether the DNA concentration was an issue. One dilution was 1:10 and was created by adding 2 microliters of DNA to 18 microliters of water. The second dilution was 1:100 and was created by adding 2 microliters of DNA to 198 microliters of water. These dilutions were made for the original minor worker DNA and the newly extracted minor worker DNA. The last issue may have been the annealing temperature.
Therefore the reactions were run at two different temperatures, 60.5°C and 58.5°C.
These troubleshooting methods were used on the Asunder Front gene using the original minor worker and the newly extracted minor worker DNA. A fifteen reaction master mix was made for each primer concentration. The first master mix consisted of 375 microliters of PCR mix, 15 microliters of forward primer, 15 microliters of reverse primer, and 270 microliters of water. 45 microliters of this master mix was added to all thirteen PCR tubes. 5 microliters of water was added to the negative control. 5 microliters of original minor worker DNA was added to two
41 reaction tubes, one of these reactions was run at Tm 60.5°C and the other at 58.5°C.
5 microliters of original minor worker 1:10 dilution DNA was added to two reaction tubes, and one of these reactions was run at 60.5°C and the other at 58.5°C. 5 microliters of original minor worker 1:100 dilution DNA was added to two reaction tubes, and one of these reactions was run at 60.5°C and the other at 58.5°C. This same setup was used for the newly extracted minor worker DNA to make a total of
14 PCR reactions for Asunder Front at a 0.2 micro molar primer concentration. The master mix for the 0.4 micro molar primer concentration consisted of 375 microliters of PCR mix, 30 microliters of forward primer, 30 microliters of reverse primer, and 240 microliters of water. The fifteen reactions were set up the same way as the fifteen reactions for the 0.2 micro molar concentration of primer. Lastly, the master mix for the 0.8 micro molar concentration of primer consisted of 375 microliters of PCR mix, 55 microliters of forward primer, 55 microliters of reverse primer, and 190 microliters of water. Likewise, the same set up was used for the fifteen reactions.
These PCR reactions were run in the thermal cycler using the same parameters as before with the exception of the annealing temperature and number of cycles. The samples were run at 60.5°C and 58.5°C to determine which temperature resulted in better results. Instead of 38 cycles, these samples were run for 40 cycles. Additionally, a “hot start” technique where the sample wells were allowed to heat up to 95°C before the samples were inserted was used in the hope of better results. Once the samples were run in the thermal cycler, gel electrophoresis was used to estimate the length of the PCR products. An analysis was performed to
42 determine which primer concentration, DNA concentration, and annealing temperature yielded the best results.
2-9: Bisulfite treatment
Bisulfite treatment is used to analyze DNA methylation in a sequence. In the treatment reaction, all unmethylated cytosines are deaminated and converted to uracils, while methylated cytosines remain unchanged. Therefore, a bisulfite treated unmethylated cytosine will appear as thymine following PCR. The bisulfite treatment would have been performed following the Thermo Scientific EpiJET
Bisulfite Conversion Kit ® protocol. 20 microliters of DNA sample containing 200-
500 nanograms of purified DNA would have been added to a PCR tube. 120 microliters of modification reagent solution would have been added to 20 microliters of the DNA sample in a PCR tube and mixed by pipetting up and down.
The sample would have been centrifuged so that the liquid would go to the bottom of the tube. The PCR tubes would have been placed in a thermal cycler at 98°C for 10 minutes and then at 60°C for 150 minutes. 400 microliters of binding buffer would have been added to the DNA purification micro column placed in a collection tube.
The converted DNA sample would have been added to the micro column inside the collection tube and mixed by pipetting up and down. The column would have been centrifuged at 12,000 RPM for 30 seconds and the flow through would have been discarded. 200 microliters of wash buffer would have been added to the column and the sample would have been centrifuged at 12,000 RPM for 30 seconds and the flow through would have been discarded. 200 microliters of desulfonation buffer would have been added to the column and the sample would have stood at room
43 temperature for 20 minutes. The column would have been centrifuged at 12,000
RPM for 30 seconds and the flow through would have been discarded. 200 microliters of wash buffer would have been added to the column and the sample would have been centrifuged at 12,000 RPM for 30 seconds and the flow through discarded. An additional 200 microliters of wash buffer would have been added to the column and centrifuged at 12,000 RPM for 60 seconds and the flow through discarded. The column would have been placed into a new 2 mL microcentrofuge tube and 10 microliters of elution buffer would have been added to the column. The sample would have been centrifuged at 12,000 RPM for 30 seconds.
Following bisulfite conversion, PCR would have been run to amplify the target sequences. PCR primers would have been designed to target the Asunder and
Rab 11 genes. PCR would have been performed using 2 microliters of DNA for each
PCR reaction and 35-45 cycles would have been performed for optimal conditions.
Following PCR, gel electrophoresis would have been used to determine the approximate PCR product lengths. PCR cleanup would have been used to purify the
DNA. The same sequencing steps would have been followed to get the sequencing results of the bisulfite treated DNA. An analysis comparing the untreated DNA sequence to the bisulfite treated DNA would reveal the amount methylation on the gene. Using these methods it would be possible to determine the difference of DNA methylation on a gene between major workers, minor workers, and queens. The goal of this study was to determine the presence of differential DNA methylation on the Asunder and Rab 11 genes in major workers, minor workers, and queens of the species Solenopsis invicta. Due to lack of time, this procedure was not performed.
44 Chapter 3: Results
3-1: Primer Design
Initially, primers were designed using NCBI’s “Pick Primers” feature to amplify the entire Asunder and Rab 11 genes (shown in figure 2.1, figure 2.2, and table 2.1). The Asunder gene is 3,844 base pairs in length and the primers would amplify a 3,663 base pair product, while the Rab 11 gene is 3,371 base pairs in length and the primers would amplify a 3,057 base pair product. However, upon subsequent PCR amplification and gel electrophoresis, it was clear that the desired products were too large to amplify.
As a result, new primers were designed to amplify the front half and the back half of the Asunder gene as well as the back half of the Rab 11 gene (shown in figure
2.1, figure 2.2, and table 2.1). By dividing the genes into smaller sections, it is more likely that the fragments will be properly amplified. The primers designed for the front half of the Asunder gene (known as Asunder Front) would amplify six of the nine exons and would yield a 1,914 base pair product, while the primers designed for the back half (known as Asunder Rear) would amplify the remaining three exons and yield a 1,874 base pair product (shown in figure 2.1 and table 2.1). The primers designed for the back half of Rab 11 (known as Rab 11 Rear) would amplify one of the exons and yield a 200 base pair product. A graphical view of forward and reverse primer location on the target gene sequences can be seen in figures 2.1 and
2.2, while the actual sequences of these primers as well as length, CG% content, and annealing temperature can be seen in table 2.1.
45 (A) Asunder Front (B) Asunder Rear (C) Asunder Whole
Figure 2.1 Graphical Representation of Primer Location on Asunder Gene in Solenopsis invicta (A) Asunder Front forward primer begins at base pair number 126,422 and ends at 126,399 resulting in a 24 base pair primer. Asunder Front reverse primer begins at base pair number 124,508 and ends at 124,528 resulting in a 21 base pair primer. The expected PCR product length from these primers is 1,914 base pairs (B) Asunder Rear forward primer begins at base pair number 124,593 and ends at 124,570 resulting in a 24 base pair primer. Asunder Rear reverse primer begins at base pair number 122,719 and ends at 122,742 resulting in a 24 base pair primer. The expected PCR product length from these primers is 1,874 base pairs (C) Asunder Whole forward primer begins at base pair number 126,381 and ends at 126,361 resulting in a 21 base pair primer. Asunder Whole reverse primer begins at base pair number 122,719 and ends at 122,742 resulting in a 24 base pair primer. The expected PCR product length from these primers is 3,663 base pairs Key. The green arrows indicate forward primers, while the red arrows indicate reverse primers. The blue line indicates the expected PCR product length. Note. Graphical representation of primers is approximate
46 (A) Rab 11 Rear
(B) Rab 11 Whole
Figure 2.2 Graphical Representation of Primer Location on Rab 11 Gene in Solenopsis invicta (A) Rab 11 Rear forward primer begins at base pair number 4,342,079 and ends at 4,342,054 resulting in a 26 base pair primer. Rab 11 Rear Reverse primer begins at base pair number 4,342,079 and ends at 4,341,899 resulting in a 20 base pair primer. The expected PCR product length from these primers is 200 base pairs (B) Rab 11 Whole forward primer begins at base pair number 4,344,953 and ends at 4,344,935 resulting a 19 base pair primer. Rab 11 Whole reverse primer begins at base pair number 4,341,897 and ends at 4,341,916 resulting in a 20 base pair primer. The expected PCR product length from these primers is 3,057 base pairs Key. The green arrows indicate forward primers, while the red arrows indicate reverse primers. The blue line indicates the expected PCR product length Note. Graphical representation of primers is approximate
47 3-2: DNA extraction
DNA was originally extracted from 50 mg of minor worker ants of the species
Solenopsis invicta. However, upon repeated failure of PCR product amplification the extraction procedure was redone for both minor worker and major worker castes to determine if DNA extraction was causing the poor results. The Nanodrop2000 spectrophotometer was used to determine the purity of the newly extracted DNA.
The DNA concentration for the major worker sample was 59.1 nanograms/microliters. The DNA absorption (A260) was 1.182 and the protein absorption (A280) was 0.648 indicating very pure DNA. The DNA concentration for the minor worker sample was 117.5 nanograms/microliters. The DNA absorbance
(A260) was 2.35 and the protein absorbance (A280) was 1.25 also indicating pure
DNA. These results (shown in figure 3.1 and figure 3.2) indicate that DNA extraction was not a factor leading to poor PCR amplification results.
Figure 3.1 Major Worker DNA Extraction Figure showing the major worker DNA extraction results from the nanodrop2000. DNA concentration was 59.1 ng/μl. DNA absorbance (A260) was 1.18 and protein absorbance (A280) was 0.65. The protein absorbance to DNA absorbance (260/280) ratio was 1.82.
48
Figure 3.2 Minor Worker DNA Extraction Figure showing the minor worker DNA extraction results from the nanodrop2000. DNA concentration was 117.5 ng/μl. DNA absorbance (A260) was 2.35 and protein absorbance (A280) was 1.25. The protein absorbance to DNA absorbance (260/280) ratio was 1.88
3-3: PCR amplification and gel electrophoresis
3-3-1: Asunder Whole
Initially, primers were designed to amplify the entire Asunder gene. The
Asunder gene is 3,844 base pairs in length and the primers would amplify a 3,663 base pair product (shown in figure 2.1). Table 6.1a shows the master mix created for the PCR reactions that attempted to amplify Asunder Whole, while table 6.1b shows the individual PCR reactions. Table 6.1c shows the thermal cycler parameters used.
Reagents (in μl) Single Reaction Master Mix 1 4 PCR mix 25 100 F Primer 2 8 R Primer 2 8 DNA 5 0 Water 16 64 Table 6.1a Asunder Whole Master Mix Table showing the reagents used to create the master mix for the PCR amplification of Asunder Whole
49
Reaction 1 (-) Reaction 2 (+) Reaction 3 (+) A- A1+ A2+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl water 5 μl DNA 5 μl DNA Table 6.1b Asunder Whole Individual PCR Reactions Table showing the constituents of each individual PCR reaction for Asunder Whole
Thermal Cycler Parameters Step Temperature Time 1 95°C 5:00 min 2 95°C 0:30 sec 3 59°C 0:30 sec 4 72°C 1:00 min 5 Go To Step 2 38X 6 72°C 5:00 min 7 8°C ∞ Table 6.1c Asunder Whole Thermal Cycler Parameters Table showing the thermal cycler parameters including step, temperature, and time used to amplify Asunder Whole
Following PCR amplification, 10 microliters of each PCR reaction were inserted into the wells of a gel and gel electrophoresis was performed. Figure 4.1 shows the results from the gel electrophoresis. The DNA ladder used was “Fast ruler” with bands forming at 5000, 2000, 850, 400, and 100 base pairs. Both positive replicates appear to have amplified a 400 base pair PCR product and there was some amplification in the negative control. The primers were expected to amplify a
3,884 base pair product; therefore the amplification was unsuccessful. Amplification in the negative control may indicate some DNA contamination in the control. As a result, the Asunder gene was broken into the smaller fragments Asunder Front and
Asunder Rear for better amplification.
50 Ladder A1+ A2+ A- 5000 bp 2000 bp 850 bp 400 bp 100 bp
Figure 4.1 Asunder Whole Gel Electrophoresis Figure showing the approximate length of the amplified Asunder Whole gene using gel electrophoresis
3-3-2: Asunder Front
The primers designed for Asunder Front would amplify six of the nine exons and would yield a 1,914 base pair product (shown in figure 2.1). Table 6.2a shows the master mix created for the PCR reactions that attempted to amplify Asunder
Front, while table 6.2b shows the individual PCR reactions. Table 6.2c shows the thermal cycler parameters used.
51 Constituents (in μl) Single Reaction Master Mix 1 4 PCR mix 25 100 F Primer 2 8 R Primer 2 8 DNA 5 0 Water 16 64 Table 6.2a Asunder Front Master Mix Table showing the reagents used to create the master mix for the PCR amplification of Asunder Front
Reaction 1 (-) Reaction 2 (+) Reaction 3 (+) AF- AF1+ AF2+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl water 5 μl DNA 5 μl DNA Table 6.2b Asunder Front Individual PCR Reactions Table showing the constituents of each individual PCR reaction for Asunder Front
Thermal Cycler Parameters Step Temperature Time 1 95°C 5:00 min 2 95°C 0:30 sec 3 60.5°C 0:30 sec 4 72°C 1:00 min 5 Go To Step 2 38X 6 72°C 5:00 min 7 8°C ∞ Table 6.2c Asunder Front Thermal Cycler Parameters Table showing the thermal cycler parameters including step, temperature, and time used to amplify Asunder Front
Following PCR amplification, 10 microliters of each PCR reaction were inserted into the wells of a gel and gel electrophoresis was performed. Figure 4.2 shows the results from the gel electrophoresis. Both positive replicates show an amplified PCR product of about 2,000 base pairs in length, while the negative control shows no product amplification. Since the expected PCR product length of
Asunder Front was 1,914 base pairs, the amplification appeared successful.
52 Ladder 1 +AF1 +AF2 -AF Ladder 2
5000
2000 2000 1500 1000 850 750 500 400 300 150 100 50
Figure 4.2 Asunder Front Gel Electrophoresis Figure showing the approximate length of the amplified Asunder Front gene using gel electrophoresis
3-3-3: Asunder Rear and Rab11 Rear
The primers designed for Asunder Rear (the back half) would amplify the remaining three exons and yield a 1,874 base pair product (shown in figure 2.1).
Table 6.3a shows the master mix created for the PCR reactions that attempted to amplify Asunder Rear, while table 6.3b shows the individual PCR reactions. The primers designed for Rab11 Rear would amplify one of the exons and yield a 200 base pair product (shown in figure 2.2). Table 6.4a shows the master mix created for the PCR reactions that attempted to amplify Rab11 Rear, while table 6.4b shows the individual PCR reactions. Table 6.4c shows the thermal cycler parameters used.
53 Constituents (in μl) Single Reaction Master Mix 1 4 PCR mix 25 100 F Primer 2 8 R Primer 2 8 DNA 5 0 Water 16 64 Table 6.3a Asunder Rear Master Mix Table showing the reagents used to create the master mix for the PCR amplification of Asunder Rear
Reaction 1 (-) Reaction 2 (+) Reaction 3 (+) -AR +1AR +2AR 45 μl master mix 45 μl master mix 45 μl master mix 5 μl water 5 μl DNA 5 μl DNA Table 6.3b Asunder Rear Individual PCR Reactions Table showing the constituents of each individual PCR reaction for Asunder Rear
Constituents (in μl) Single Reaction Master Mix 1 4 PCR mix 25 100 F Primer 2 8 R Primer 2 8 DNA 5 0 Water 16 64 Table 6.4a Rab11 Rear Master Mix Table showing the reagents used to create the master mix for the PCR amplification of Rab11 Rear
Reaction 1 (-) Reaction 2 (+) Reaction 3 (+) -RR +1RR +2RR 45 μl master mix 45 μl master mix 45 μl master mix 5 μl water 5 μl DNA 5 μl DNA Table 6.4b Rab11 Rear Individual PCR Reactions Table showing the constituents of each individual PCR reaction for Rab11 Rear
54 Thermal Cycler Parameters Step Temperature Time 1 95°C 5:00 min 2 95°C 0:30 sec 3 59°C 0:30 sec 4 72°C 1:00 min 5 Go To Step 2 38X 6 72°C 5:00 min 7 8°C ∞ Table 6.4c Asunder Rear and Rab11 Rear Thermal Cycler Parameters Table showing the thermal cycler parameters including step, temperature, and time used to amplify Asunder Rear and Rab11 Rear
Following PCR amplification, 10 microliters of each PCR reaction were inserted into the wells of a gel and gel electrophoresis was performed. Figure 4.3 shows the results from the gel electrophoresis. The amplified PCR products of
Asunder Rear were approximately 50 base pairs in length and there was no product amplification in the negative control. The primers were expected to yield a 1,874 base pair product; therefore the amplification of Asunder Rear appeared to be unsuccessful. Both positive replicates of Rab11 Rear show an amplified PCR product of about 200 base pairs in length and there was no product amplification in the negative control. The primers were expected to yield a 200 base pair product; therefore the amplification of Rab11 Rear appeared to be successful.
55 +2RR +1RR –RR Ladder –AR +1AR +2AR
2000 1500 1000 750 500 300 200 150 50
Figure 4.3 Asunder Rear and Rab11 Rear Gel Electrophoresis Figure showing the approximate length of the amplified Asunder Rear and Rab11 Rear genes using gel electrophoresis
3-4: Cloning
Upon successful amplification of Asunder Front and Rab11 Rear, the PCR products from Asunder Front, Asunder Rear, and Rab11 Rear were prepared for cloning by making sure there was an A tail left by taq polymerase through retailing reactions. Following the retailing reactions, PCR cleanup was used to purify the
DNA. The DNA was then ligated into T vector for cloning during cloning ligation. E. coli cells were then induced to take on the ligations during cloning transformation.
The E.coli cells were then spread onto three LB Amp/X Gal IPTG plates labeled
Asunder Front, Asunder Rear, and Rab11 Rear and incubated at 37°C. After
56 incubation, all of the good white colonies were circled and numbered. The five best colonies from each plate were chosen for cloning. The best colonies for Asunder
Front were colonies 1,2,3,6 and 7; the best colonies for Asunder Rear were colonies
1 and 2; and the best colonies for Rab11 Rear were colonies 2,4,5,7,8 (shown in table 4). These colonies were cloned and 10 microliters of the products were inserted into the wells of a gel and gel electrophoresis was performed to determine the approximate product length. The results from the gel electrophoresis are shown in figure 4.4.
RR2 RR4 RR5 Ladder RR7 RR8 -Control
AR1 AR2 AR3 AR6 AR7 Ladder AF1 AF2
Figure 4.4 Asunder Front, Asunder Rear, and Rab11 Rear Colony Gel Electrophoresis Figure showing the approximate length of the amplified products from each colony for Asunder Front, Asunder Rear, and Rab11 Rear using gel electrophoresis
57 3-5: Sequencing
Following gel electrophoresis, one colony for each gene was chosen for sequencing. Colony 1 was chosen for both Asunder Front and Asunder Rear, while colony 2 was chosen for Rab11 Rear. The DNA was purified using PCR cleanup and the tubes containing the eluted DNA were labeled and sent for sequencing. When the sequencing results were returned, the sequence was copied and pasted into a word document. The vector cloning sites (shown in table 5) and the forward primer
(shown in table 2.1) were searched in order to find the inserted DNA fragment. This inserted fragment was the amplified PCR product for each gene. The actual amplified sequence was compared to the gene sequence found on the NCBI database using MEGA to ensure that the correct segment of gene was amplified.
3-5-1: Asunder Front
The primers for Asunder Front were designed to amplify a 1,914 base pair product (shown in figure 2.1). However, the actual amplified sequence after cloning was 212 base pairs as shown below in figure 5.1a. This result is inconsistent with the results from gel electrophoresis as the gel showed the amplification of PCR product approximately 2,000 base pairs in length when the actual product size after sequencing was only 212 base pairs. When this amplified sequence was aligned on
MEGA with the Asunder sequence shown on the NCBI database, the 212 base pair sequence aligned correctly towards the front of the Asunder gene (shown in figure
5.1b). The alignment began at position 45 and ended at position 280 out of 3,844 base pairs. However, this shorter fragment suggests that the DNA was either poor from the beginning or more likely broken during PCR or cloning. A new DNA
58 extraction may be performed in case the DNA was not good or a new PCR reaction may be performed with a different annealing temperature in order to favor the amplification of a larger fragment. Additionally, gel purification may be performed where the amplified product is cut out of the gel after gel electrophoresis and re purified before sequencing.
NNNNNNNNNNNNNGTGANCTATAGAATACTCAAGCTATGCATCCAACGCGTTG GGAGCTCTCCCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATTTCGTGCTGG ATCATACTCCATATTTTGGCATCTCCACTGAGTGCCCGTTGGAATTTGACTTTCT CAAGAGCAGGGGACAAAATCTGATTCCGCTGGCGCCGGTCTGCAAATCTCTATGG ACCACCAGTGTCGAGGCCTCGTTGGAGTACTGTCGCATTGTGTGGGATCTCTTTC CCACAGGTAAATTGGTACGTCCGATTCCATTGAAAATTATGCTCTGACTATAACA TATTAATCCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCC CTATAGTGAGTCGTATTACAATTCACTNNNNNNNTTTTTTNNN
Figure 5.1a Asunder Front M13 plate 1_2 Figure showing the copied and pasted sequence from the sequencing file where the amplified sequence (in pink) is 212 base pairs in length. Key: Yellow highlighted: Forward Primer Blue highlighted: Vector Cloning Site F Green highlighted: Vector Cloning Site R Pink Highlighted: Amplified Sequence
Figure 5.1b Asunder Front Sequence Alignment Graphical representation of the actual amplified sequence from Asunder Rear (top rows) aligned with the sequence of Asunder found on the NCBI database (bottom rows). Alignment begins at position 45 and ends at position 280 out of a total of 3,844 base pairs.
59 3-5-2: Asunder Rear
The primers for Asunder Rear were designed to amplify a 1,874 base pair product (as shown in figure 2.1). However, the actual amplified sequence after cloning was 37 base pairs as shown below in figure 5.2a. This result is consistent with the results from gel electrophoresis as the gel showed a PCR product length of approximately 50 base pairs. When the amplified sequence was aligned on MEGA with the Asunder sequence found on the NCBI database, the amplified sequence was in three fragments near the end of the Asunder gene (shown in figure 5.2b). The first fragment aligned between positions 3,686 and 3,695; the second fragment aligned between positions 3,698 and 3,721; and the third fragment aligned between positions 3,725 and 3,751 out of a total of 3,844 base pairs. These fragments appear to correspond to the primers used rather than an actual amplified product. It is possible that the primers bound to a non-specific area on the gene. New DNA extraction or PCR amplification may be performed in attempt to amplify the correct target sequence.
NNNNNNNNNNNNGNGANCTNTAGAATACTCAAGCTATGCATCCAACGCGTTGG GAGCTCTCCCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATTATGGTGGCGA GATTTTCATTCATACCGGGTGGAATGAAGGAGATTGGAAGAGAACCTAAATCCC GCGGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCTATAGTGAG TCGTATTACAATTCACTGGCGNNGTTTTACAAATTCCGCTGGCGCCGGTCTGCAA ATCTCTATGGACCACCAGTGTCNAGGCCTCGTTGGANTACTGTCGCATTGTGTGG GATCTCTTTCCCGCAGGTAAATTGGTACGTCCGATTCCATTGAAAATTATGCTCT GACTATNACATANTAGTCCCGCGGCCATGGCGGCCGGGAGCGTGCGACGTCNGGC CAATTCACCCTATNTGAGTCGTATTACAATTCNNTGGCGNCN
Figure 5.2a Asunder Rear M13 plate 1_1 Figure showing the copied and pasted sequence from the sequencing file where the amplified sequence (in pink) is 37 base pairs in length. Key: Yellow highlighted: Forward Primer Blue highlighted: Vector Cloning Site F Green highlighted: Vector Cloning Site R Pink Highlighted: Amplified Sequence
60
Figure 5.2b Asunder Rear Sequence Alignment Graphical representation of the actual amplified sequence from Asunder Rear (top row) aligned with the sequence of Asunder found on the NCBI database (bottom row). The first fragment aligned between positions 3,686 and 3,695; the second fragment aligned between positions 3,698 and 3,721; and the third fragment aligned between positions 3,725 and 3,751 out of a total of 3,844 base pairs.
3-5-3: Rab11 Rear
The primers for Rab11 Rear were designed to amplify a 200 base pair product (as shown in figure 2.2) and the actual amplified sequence after cloning was
202 base pairs in length (shown in figure 5.3a). This result is consistent with the results from gel electrophoresis as the gel showed an amplified product of about
200 base pairs and the actual amplified sequence was 202 base pairs. When the amplified sequence was aligned on MEGA with the Rab11 sequence found on the
NCBI database, the amplified sequence aligned correctly towards the end of the
Rab11 gene (shown in figure 5.3b). The aligned sequence containing six total fragments began at position 319 and ended at position 533 out of 650 total base pairs. Since the amplification was successful for Rab11 Rear, the next step involved attempting to amplify Rab11 Whole.
61 NNNNNNNTNNNGACCTATAGAATACTCAAGCTATGCATCCAACGCGTTGGGAG CTCTCCCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATTTTACGCAGAGGTA ATCGCACGATAACGCTCTTGTCCAGCTGTATCCCAGATTTGGGCTTTAATGGTTT TACCATCAACTTGTATACTGCGTGTTGCAAACTCAACTCCGATGGTAGACTTCGA TTCCAAATTGAATTCATTTCTTGTAAATCGGGATAAGAGATTACTTTTTCCTACT CCAGAATCTCCAATGAGAACAAATCCCGCGGCCATGGCGGCCGGGAGCATGCGAC GTCGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGNNN
Figure 5.3a Rab 11 Rear M13 Plate 1_3 Figure showing the copied and pasted sequence from the sequencing file where the amplified sequence (in pink) is 202 base pairs in length. Key: Yellow highlighted: Forward Primer Blue highlighted: Vector Cloning Site F Green highlighted: Vector Cloning Site R Pink Highlighted: Amplified Sequence
Figure 5.3b Rab11 Rear Sequence Alignment Graphical representation of the actual amplified sequence from Rab11 Rear (top row) aligned with the sequence of Rab11 found on the NCBI database (bottom row). The alignment containing six fragments begins at position 319 and ends at position 533 out of 650 base pairs total.
3-6: PCR troubleshooting
3-6-1: Asunder Front, Asunder Rear, and Rab 11 Whole PCR and gel electrophoresis
The sequencing results indicated unsuccessful amplification of both Asunder
Front and Asunder Rear because the actual sequence length did not match the
62 expected sequence length. PCR amplification was repeated for both genes in attempt to achieve better amplification results. The annealing temperature was altered in attempt to favor the amplification of larger fragments. The master mix created for
Asunder Front is shown in table 7.1a, while the individual PCR reactions are shown in table 7.1b. The thermal cycler parameters used are shown in table 7.1c. The master mix created for Asunder Rear is shown in table 7.2a, while the individual
PCR reactions are shown in table 7.2b. The thermal cycler parameters used are shown in table 7.2c.
From the sequencing results, it was determined that Rab11 Rear yielded the only successful amplification because the actual sequence length matched the expected sequence length determined by the primers. Due to this success, Rab11
Whole was amplified next. The master mix created for Rab11 Whole is shown in table 7.3a, while the individual PCR reactions are shown in table 7.3b. The thermal cycler parameters are shown in table 7.3c.
Constituents (in μl) Single Reaction Master Mix 1 4 PCR mix 25 100 F Primer 2 8 R Primer 2 8 DNA 5 0 Water 16 64 Table 7.1a Asunder Front Repeat Master Mix Table showing the reagents used to create the master mix for the PCR amplification of Asunder Front
Reaction 1 (-) Reaction 2 (+) Reaction 3 (+) -AF +1AF +2AF 45 μl master mix 45 μl master mix 45 μl master mix 5 μl water 5 μl DNA 5 μl DNA Table 7.1b Asunder Front Repeat Individual PCR Reactions Table showing the constituents of each individual PCR reaction for Asunder Front
63 Thermal Cycler Parameters Step Temperature Time 1 95°C 5:00 min 2 95°C 0:30 sec 3 61.2°C 0:30 sec 4 72°C 1:00 min 5 Go To Step 2 38X 6 72°C 5:00 min 7 8°C ∞ Table 7.1c Asunder Front Repeat Thermal Cycler Parameters Table showing the thermal cycler parameters including step, temperature, and time used to amplify Asunder Front
Constituents (in μl) Single Reaction Master Mix 1 4 PCR mix 25 100 F Primer 2 8 R Primer 2 8 DNA 5 0 Water 16 64 Table 7.2a Asunder Rear Repeat Master Mix Table showing the reagents used to create the master mix for the PCR amplification of Asunder Rear
Reaction 1 (-) Reaction 2 (+) Reaction 3 (+) -AR +1AR +2AR 45 μl master mix 45 μl master mix 45 μl master mix 5 μl water 5 μl DNA 5 μl DNA Table 7.2b Asunder Rear Repeat Individual PCR Reactions Table showing the constituents of each individual PCR reaction for Asunder Rear
Thermal Cycler Parameters Step Temperature Time 1 95°C 5:00 min 2 95°C 0:30 sec 3 59.5°C 0:30 sec 4 72°C 1:00 min 5 Go To Step 2 38X 6 72°C 5:00 min 7 8°C ∞ Table 7.2c Asunder Rear Repeat Thermal Cycler Parameters Table showing the thermal cycler parameters including step, temperature, and time used to amplify Asunder Rear
64 Constituents (in μl) Single Reaction Master Mix 1 4 PCR mix 25 100 F Primer 2 8 R Primer 2 8 DNA 5 0 Water 16 64 Table 7.3a Rab11 Whole Master Mix Table showing the reagents used to create the master mix for the PCR amplification of Rab11 Whole
Reaction 1 (-) Reaction 2 (+) Reaction 3 (+) -R +1R +2R 45 μl master mix 45 μl master mix 45 μl master mix 5 μl water 5 μl DNA 5 μl DNA Table 7.3b Rab11 Whole Individual PCR Reactions Table showing the constituents of each individual PCR reaction for Rab11 Whole
Thermal Cycler Parameters Step Temperature Time 1 95°C 5:00 min 2 95°C 0:30 sec 3 59.5°C 0:30 sec 4 72°C 1:00 min 5 Go To Step 2 38X 6 72°C 5:00 min 7 8°C ∞ Table 7.3c Rab11 Whole Thermal Cycler Parameters Table showing the thermal cycler parameters including step, temperature, and time used to amplify Rab11 Whole
Following PCR amplification, 5 microliters of each PCR reaction were inserted into each of the wells in a gel and gel electrophoresis was performed.
Figure 6 shows the results from the gel electrophoresis. The amplified PCR products for Asunder Front, Asunder Rear, and Rab11 Whole were all approximately 50 base pairs in length indicating that the amplification was unsuccessful. As a result, it was concluded that new DNA extraction was needed (results shown in section 3-2).
65 -AF +1AF +2AF -R Ladder +1R +2R –AR +1AR +2AR
2000 1500 1000 750 500 300 150 50
Figure 6 Asunder Front, Asunder Rear, and Rab11 Whole Gel Electrophoresis Figure showing the approximate length of the amplified products from Asunder Front, Asunder Rear, and Rab11 Whole using gel electrophoresis
3-6-2: Asunder Front, Asunder Rear, and Rab11 Whole major and minor worker PCR and gel electrophoresis
DNA was extracted from both major and minor worker castes of Solenopsis invicta and PCR reactions were performed for Asunder Front, Asunder Rear, and
Rab11 Whole using both types forms of DNA. The master mixes created for Asunder
Front, Asunder Rear, and Rab11 Whole are shown in tables 7.4a, 7.5a, and 7.6a, while the individual PCR reactions for these genes are shown in tables 7.4b, 7.5b, and 7.6b. The thermal cycler parameters are shown in tables 7.4c, 7.5c, and 7.6c.
66 Constituents (in μl) Single Reaction Master Mix 1 7 PCR mix 25 175 F Primer 2 14 R Primer 2 14 DNA 5 0 Water 16 112 Table 7.4a Asunder Front Major and Minor Worker Master Mix Table showing the reagents used to create the master mix for the PCR amplification of Asunder Front
Reaction 1 (-) Reaction 2 (+) Reaction 3 (+) AFJ- AFJ1+ AFJ2+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl water 5 μl major DNA 5 μl major DNA Reaction 4 (-) Reaction 5 (+) Reaction 6 (+) AFN- AFN1+ AFN2+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl water 5 μl minor DNA 5 μl minor DNA Table 7.4b Asunder Front Major and Minor Worker Individual PCR Reactions Table showing the constituents of each individual PCR reaction for Asunder Front
Thermal Cycler Parameters Step Temperature Time 1 95°C 5:00 min 2 95°C 0:30 sec 3 61.2°C 0:30 sec 4 72°C 1:00 min 5 Go To Step 2 38X 6 72°C 5:00 min 7 8°C ∞ Table 7.4c Asunder Front Major and Minor Worker Thermal Cycler Parameters Table showing the thermal cycler parameters including step, temperature, and time used to amplify Asunder Front
Constituents (in μl) Single Reaction Master Mix 1 7 PCR mix 25 175 F Primer 2 14 R Primer 2 14 DNA 5 0 Water 16 112 Table 7.5a Asunder Rear Major and Minor Worker Master Mix Table showing the reagents used to create the master mix for the PCR amplification of Asunder Rear
67 Reaction 1 (-) Reaction 2 (+) Reaction 3 (+) ARJ- ARJ1+ ARJ2+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl water 5 μl major DNA 5 μl major DNA Reaction 4 (-) Reaction 5 (+) Reaction 6 (+) ARN- ARN1+ ARN2+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl water 5 μl minor DNA 5 μl minor DNA Table 7.5b Asunder Rear Major and Minor Worker Individual PCR Reactions Table showing the constituents of each individual PCR reaction for Asunder Rear
Thermal Cycler Parameters Step Temperature Time 1 95°C 5:00 min 2 95°C 0:30 sec 3 59.5°C 0:30 sec 4 72°C 1:00 min 5 Go To Step 2 38X 6 72°C 5:00 min 7 8°C ∞ Table 7.5c Asunder Rear Major and Minor Worker Thermal Cycler Parameters Table showing the thermal cycler parameters including step, temperature, and time used to amplify Asunder Rear
Constituents (in μl) Single Reaction Master Mix 1 7 PCR mix 25 175 F Primer 2 14 R Primer 2 14 DNA 5 0 Water 16 112 Table 7.6a Rab11 Whole Major and Minor Worker Whole Master Mix Table showing the reagents used to create the master mix for the PCR amplification of Rab11 Whole
Reaction 1 (-) Reaction 2 (+) Reaction 3 (+) RRJ- RRJ1+ RRJ2+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl water 5 μl major DNA 5 μl major DNA Reaction 4 (-) Reaction 5 (+) Reaction 6 (+) RRN- RRN1+ RRN2+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl water 5 μl minor DNA 5 μl minor DNA Table 7.6b Rab11 Whole Major and Minor Worker Individual PCR Reactions Table showing the constituents of each individual PCR reaction for Rab11 Whole
68 Thermal Cycler Parameters Step Temperature Time 1 95°C 5:00 min 2 95°C 0:30 sec 3 59.5°C 0:30 sec 4 72°C 1:00 min 5 Go To Step 2 38X 6 72°C 5:00 min 7 8°C ∞ Table 7.6c Rab11 Whole Major and Minor Worker Thermal Cycler Parameters Table showing the thermal cycler parameters including step, temperature, and time used to amplify Rab11 Whole
Following PCR amplification, 5 microliters of each PCR reaction was inserted into each of the wells of a gel and gel electrophoresis was ran to determine if the new DNA extraction improved DNA amplification. Figure 7 shows the results from the gel electrophoresis. The amplified products appeared as smudges on the gel indicating that the primers were binding to nonspecific regions on the gene. These unsuccessful results indicated that problems in amplification could have resulted from poor primer concentration, poor DNA concentration, or improper annealing temperature. As a result, numerous PCR reactions were set up to test each factor.
69 -AFJ +1AFJ +2AFJ –AFN Ladder +1AFN +2AFN –ARJ +1ARJ +2ARJ
2000 1000 500 300 150 50
-ARN +1ARN +2ARN Ladder 0 N/A N/A
2000 1000 500 300 150 50
Figure 7 Asunder Front, Asunder Rear, and Rab 11 Whole Major and Minor Worker Gel Electrophoresis Figure showing the approximate length of the amplified products from Asunder Front, Asunder Rear, and Rab11 Whole using newly extracted major and minor worker DNA
3-6-3: PCR troubleshooting analysis
Three concentrations of primer, three concentrations of original minor worker DNA and newly extracted minor worker DNA, and two different annealing temperatures were used in the PCR reactions of Asunder Front to determine which factors would yield the best amplification product. A fifteen reaction master mix was created for each of the three primer concentrations and can be seen in tables 7.7a,
7.8a, and 7.9a, while the individual PCR reactions can be seen in tables 7.7b, 7.8b,
70 and 7.9b. The reactions were run using two annealing temperatures, one at 58.5°C and one at 60.5°C.
Constituents (in μl) Single Reaction Master Mix 1 15 PCR mix 25 375 F Primer 2 15 R Primer 2 15 DNA 5 0 Water 16 270 Table 7.7a 0.2 μM Primer Asunder Front Master Mix Table showing reagents used to create the master mix for the PCR amplification of 0.2 μM primer Asunder Front
Reaction 1 (-) Reaction 2 (+) Reaction 3 (+) AO- AO1+ AO2+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl water 5 μl original DNA 5 μl original DNA 60.5°C 58.5°C Reaction 4 (+) Reaction 5 (+) Reaction 6 (+) AO3+ AO4+ AO5+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl original 1:10 DNA 5 μl original 1:10 DNA 5 μl original 1:100 DNA 60.5°C 58.5°C 60.5°C Reaction 7 (+) Reaction 8 (+) Reaction 9 (+) AO6+ AN1+ AN2+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl original 1:100 DNA 5 μl new DNA 5 μl new DNA 58.5°C 60.5°C 58.5°C Reaction 10 (+) Reaction 11 (+) Reaction 12 (+) AN3+ AN4+ AN5+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl new 1:10 DNA 5 μl new 1:10 DNA 5 μl new 1:100 DNA 60.5°C 58.5°C 60.5°C Reaction 13 (+) AN6+ 45 μl master mix 5 μl new 1:100 DNA 58.5°C Table 7.7b 0.2 μM Primer Asunder Front Individual PCR Reactions Table showing the various DNA concentrations and annealing temperatures for individual PCR reactions of Asunder Front using original minor worker and newly extracted minor worker DNA
71 Constituents (in μl) Single Reaction Master Mix 1 15 PCR mix 25 375 F Primer 2 30 R Primer 2 30 DNA 5 0 Water 16 240 Table 7.8a 0.4 μM Primer Asunder Front Master Mix Table showing reagents used to create the master mix for the PCR amplification of 0.4 μM primer Asunder Front
Reaction 1 (-) Reaction 2 (+) Reaction 3 (+) BO- BO1+ BO2+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl water 5 μl original DNA 5 μl original DNA 60.5°C 58.5°C Reaction 4 (+) Reaction 5 (+) Reaction 6 (+) BO3+ BO4+ BO5+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl original 1:10 DNA 5 μl original 1:10 DNA 5 μl original 1:100 DNA 60.5°C 58.5°C 60.5°C Reaction 7 (+) Reaction 8 (+) Reaction 9 (+) BO6+ BN1+ BN2+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl original 1:100 DNA 5 μl new DNA 5 μl new DNA 58.5°C 60.5°C 58.5°C Reaction 10 (+) Reaction 11 (+) Reaction 12 (+) BN3+ BN4+ BN5+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl new 1:10 DNA 5 μl new 1:10 DNA 5 μl new 1:100 DNA 60.5°C 58.5°C 60.5°C Reaction 13 (+) BN6+ 45 μl master mix 5 μl new 1:100 DNA 58.5°C Table 7.8b 0.4 μM Primer Asunder Front Indivi dual PCR Reactions Table showing the various DNA concentrations and annealing temperatures for individual PCR reactions of Asunder Front using original minor worker and newly extracted minor worker DNA
72 Constituents (in μl) Single Reaction Master Mix 1 15 PCR mix 25 375 F Primer 2 55 R Primer 2 55 DNA 5 0 Water 16 190 Table 7.9a 0.8 μM Primer Asunder Front Master Mix Table showing reagents used to create the master mix for the PCR amplification of 0.8 μM primer Asunder Front
Reaction 1 (-) Reaction 2 (+) Reaction 3 (+) CO- CO1+ CO2+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl water 5 μl original DNA 5 μl original DNA 60.5°C 58.5°C Reaction 4 (+) Reaction 5 (+) Reaction 6 (+) CO3+ CO4+ CO5+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl original 1:10 DNA 5 μl original 1:10 DNA 5 μl original 1:100 DNA 60.5°C 58.5°C 60.5°C Reaction 7 (+) Reaction 8 (+) Reaction 9 (+) CO6+ CN1+ CN2+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl original 1:100 DNA 5 μl new DNA 5 μl new DNA 58.5°C 60.5°C 58.5°C Reaction 10 (+) Reaction 11 (+) Reaction 12 (+) CN3+ CN4+ CN5+ 45 μl master mix 45 μl master mix 45 μl master mix 5 μl new 1:10 DNA 5 μl new 1:10 DNA 5 μl new 1:100 DNA 60.5°C 58.5°C 60.5°C Reaction 13 (+) CN6+ 45 μl master mix 5 μl new 1:100 DNA 58.5°C Table 7.9b 0.8 μM Primer Asunder Front Individual PCR Reactions Table showing the various DNA concentrations and annealing temperatures for individual PCR reactions of Asunder Front using original minor worker and newly extracted minor worker DNA
73 Following PCR amplification, 5 microliters of each PCR reaction were inserted into the wells of a gel and gel electrophoresis was performed. Figure 8 shows the results from the gel electrophoresis. A rating from 0 to 3, where 0 is no amplification and 3 is very good amplification, was given for each condition tested in the PCR reactions (shown in table 8). From the analysis, it was determined that the lower primer concentration of 0.2 μM yielded the best and most significant amplification results. The original DNA concentration, new minor worker DNA extraction, and 60.5°C annealing temperature yielded slightly better amplification results. Additionally, it was interesting that the amplification of Asunder Front at the original 0.4 μM primer concentration was successful in this reaction and not in the previous amplification. Using this analysis, new PCR reactions could be made using the most favorable conditions to yield the best possible PCR products for sequencing.
74 AO1+ AN+1 AO2+ AN2+ AO3+ AN3+ AO4+ AN4+ AO5+ Ladder 5000 2000 1000 500 100
AN5+ AO6+ AN6+ BO1+ BN1+ BO2+ BN2+ BO3+ BN3+ Ladder 5000 2000 1000 500 100
BO4+ BN4+ BO5+ BN5+ BO6+ BN6+ CO1+ CN1+ CO2+ Ladder 5000 2000 1000 500 100
CN2+ CO3+ CN3+ CO4+ CN4+ CO5+ CN5+ CO6+ CN6+ Ladder 5000 2000 1000 500 100
Figure 8 Asunder Front 0.2 μM, 0.4 μM, and 0.8 μM Analysis Gel Electrophoresis Figure showing the approximate lengths of the amplified products from 0.2 μM, 0.4 μM, and 0.8 μM primer concentrations of Asunder Front using original and newly extracted minor worker DNA and various DNA concentrations and annealing temperatures
75 DNA Code Primer concentration Temperature DNA concentration DNA rank a +1O 0.2 60.5 old 1 3 a +1N 0.2 60.5 new 1 3 a +2O 0.2 58.5 old 1 3 a +2N 0.2 58.5 new 1 2 a +3O 0.2 60.5 old 1:10 2 a +3N 0.2 60.5 new 1:10 3 a +4O 0.2 58.5 old 1:10 1 a +4N 0.2 58.5 new 1:10 2 a +5O 0.2 60.5 old 1:100 1 a +5N 0.2 60.5 new 1:100 2 a +6O 0.2 58.5 old 1:100 1 a +6N 0.2 58.5 new 1:100 2 b +1O 0.4 60.5 old 1 3 b +1N 0.4 60.5 new 1 3 B +2O 0.4 58.5 old 1 3 B +2N 0.4 58.5 new 1 3 B + 3O 0.4 60.5 old 1:10 0 B +3N 0.4 60.5 new 1:10 3 B +4O 0.4 58.5 old 1:10 1 B +4N 0.4 58.5 new 1:10 2 B +5O 0.4 60.5 old 1:100 0 B +5N 0.4 60.5 new 1:100 1 B +6O 0.4 58.5 old 1:100 0 B +6N 0.4 58.5 new 1:100 1 C + 1O 0.8 60.5 old 1 2 C +1N 0.8 60.5 new 1 2 C +2O 0.8 58.5 old 1 0 C +2N 0.8 58.5 new 1 2 C +3O 0.8 60.5 old 1:10 1 C +3N 0.8 60.5 new 1:10 1 C +4O 0.8 58.5 old 1:10 1 C +4N 0.8 58.5 new 1:10 1 C +5O 0.8 60.5 old 1:100 0 C +5N 0.8 60.5 new 1:100 1 C +6O 0.8 58.5 old 1:100 0 C +6N 0.8 58.5 new 1:100 1 Table 8 PCR Analysis of Various Conditions for Asunder Front Table showing the ranking of PCR amplification from 0 to 3 (where 0 is no amplification) for primer concentration, DNA concentration, and annealing temperature using original and newly extracted minor worker DNA for Asunder Front
76 Chapter 4: Discussion
The goal of this study was to determine the presence of differential methylation of the Asunder and Rab11 genes between different castes of Solenopsis invicta. A similar study performed by Bonasio and colleagues (2012) identified twenty conserved differentially methylated genes, including Asunder and Rab11, between the ant species Harpegnathos saltator and Camponotus floridanus. Based on their results, it was hypothesized that differential methylation of Asunder and
Rab11 between major workers, minor workers, and queens will also be present in the species Solenopsis invicta as this species of fire ant contains a fully functioning
DNA methylation system (Wurm et al. 2011). Using PCR, gel electrophoresis, and cloning the target genes were amplified and sequenced. The sequencing results were compared with the sequences from the NCBI database using MEGA to ensure the desired target gene was actually amplified. Bisulfite treatment would have then been used on the extracted DNA to gather data for a differential methylation analysis between major workers, minor workers, and queens. However, due to lack of time and funding the results were not sufficient enough to support the hypothesis.
The BLAST results confirmed the presence of the Asunder and Rab11 gene orthologs in Solenopsis invicta (table 1.2 and table 1.3). PCR primers were designed to amplify these genes, however they were too large for proper amplification. As a result, new primers were designed to amplify the genes in fragments referred to as
Asunder Front, Asunder Rear, and Rab11 Rear. Only Rab11 Rear was successfully amplified and correctly matched to the Rab11 sequence provided on the NCBI
77 database (figure 5.3a and figure 5.3b). Both Asunder Front and Asunder Rear resulted in the amplification of broken DNA fragments (figure 5.4b and figure 5.5b).
These broken fragments indicated an issue with the DNA extraction, the PCR primers themselves, or the PCR reaction. The DNA extraction was redone and yielded very pure DNA indicating that the DNA was not causing poor amplification.
As a result, an analysis of various factors including primer concentration, DNA concentration, original versus newly extracted DNA, and annealing temperature was performed on Asunder Front in order to determine the best amplification conditions
(table 8). It was determined that the lower primer concentration of 0.2 μM yielded the best and most significant amplification results. The original DNA concentration, new DNA minor worker DNA extraction, and 60.5°C annealing temperature yielded slightly better amplification results. Using these conditions, PCR would have been redone for both Asunder Front and Asunder Rear in order to amplify and sequence the target gene fragments. However, due to lack of time these sequences were never obtained. Additionally, bisulfite treatment was never performed and DNA was not extracted from all desired castes. Therefore, the results were not sufficient enough to support the hypothesis.
Errors in this experiment may have resulted from a variety of factors. DNA was extracted from whole body individuals resulting in the homogeny of tissue types. It is possible that some genes would present more DNA methylation in one tissue type over another. This differential would not show using whole body extraction, as the presence of methylation would be averaged across all tissue types.
Errors in PCR may have resulted from subsequent freezing and thawing of samples.
78 When the samples are repeatedly frozen and thawed, they are subject to fragmentation due to their more brittle nature. This could have been avoided if larger DNA samples were aliquotted into smaller samples prior to freezing in order to reduce the amount of freeze-thaw cycles that may have led to DNA degradation.
Since PCR reactions of two different genes were often placed in the thermal cycler at the same time, the annealing temperature may not have been ideal for each set of primers. An average of the two recommended temperatures were used instead of using the recommended temperature for each set of primers. When the PCR reactions of Asunder Front, Asunder Rear, and Rab11 Whole were redone, the proper annealing temperatures were used. However, the amplification was still unsuccessful indicating there may have been other errors. The analysis of various factors indicated that a primer concentration of 0.2 μM yielded far better amplification than the 0.4 μM concentration that was previously used. If the lower primer concentration was used earlier on, the amplification of target genes may have been more successful. Additionally, other errors such as contamination, poor technique, and random errors may have occurred leading to poor amplification.
In the future, whole genome sequencing would yield better and more accurate results. Due to lack of funding, PCR primers were designed to target and amplify specific genes. This method leaves room for errors in primer design, PCR amplification, and cloning. It is also more difficult to identify individual errors that may have occurred leading to a compounding effect of errors. Whole genome sequencing provides a high resolution, comprehensive view of the entire genome and can detect single nucleotide variants, insertions/deletions, and structural
79 variants (illumina.com). This method would have allowed for a comprehensive analysis of more genes instead of targeting the two smaller ones. Whole genome sequencing using Illumina Genome Analyzers from each caste followed by bisulfite treatment and sequencing would have allowed for an analysis of differential methylation between castes of all desired genes. The presence of differential methylation between castes could give insight into whether DNA methylation is a possible mechanism for caste system determination in Solenopsis invicta.
The exact mechanism of caste system determination remains largely unknown, however it is most likely that caste is a complex phenotype influenced by multiple genetic and environmental factors (Wheeler 1937). Rising evidence of fully functioning DNA methylation systems in various insect species (Wang et al. 2006;
Bonasio et al. 2012; Wurm et al. 2011) indicates that DNA methylation may provide a mechanism for responsiveness to environmental stimuli during development through variation in the regulation of gene transcription (Glastad and Hunt 2011).
DNMT enzymes interact with transcription factors, epigenetic regulators, histone modification, and non-coding RNAs, and may guide caste specific methylation as ant embryos can follow different developmental trajectories (Bonasio et al. 2012).
Further research is needed to determine whether or not DNA methylation plays a role in caste determination in the species Solenopsis invicta, however various research on similar insects gives the idea a promising start.
80 Works Cited
Albalat, R. (2008) Evolution of DNA-methylation machinery: DNA methyltransferases and methyl-DNA binding proteins in the amphioxus Branchiostoma floridae. Dev Genes Evol218: 691–701.
Alberch, P. (1991). From genes to phenotype: dynamical systems and evolvability. Genetica, 84(1), 5-11.
Anderson, K. E., Linksvayer, T. A., & Smith, C. R. (2008). The causes and consequences of genetic caste determination in ants (Hymenoptera: Formicidae). Myrmecol News, 11, 119-132.
Ast, G. (2004) How did alternative splicing evolve? Nat Rev Genet 5: 773–782.
Banks, W. A., Lofgren, C. S., & Wojcik, D. P. (1978). A bibliography of imported fire ants and the chemicals and methods used for their control. USDA. Agric. Res. Serv. ARS-S-180, 35.
Barberan-Soler, S. and Zahler, A.M. (2008) Alternative splicing regulation during C. elegans development: splicing factors as regulated targets. PLoS Genet 4: e1000001.
Barchuk, A. R., Cristino, A. S., Kucharski, R., Costa, L. F., Simões, Z. L., & Maleszka, R. (2007). Molecular determinants of caste differentiation in the highly eusocial honeybee Apis mellifera. BMC developmental biology, 7(1), 1.
Bird, A. (2002). DNA methylation patterns and epigenetic memory. Genes & development, 16(1), 6-21.
Bock, C., Reither, S., Mikeska, T., Paulsen, M., Walter, J., & Lengauer, T. (2005). BiQ Analyzer: visualization and quality control for DNA methylation data from bisulfite sequencing. Bioinformatics, 21(21), 4067-4068.
Bonasio, R., Li, Q., Lian, J., Mutti, N. S., Jin, L., Zhao, H., ... & Jin, Z. (2012). Genome- wide and caste-specific DNA methylomes of the ants Camponotus floridanus and Harpegnathos saltator. Current Biology, 22(19), 1755-1764.
Boyes, J. and Bird, A. (1991) DNA methylation inhibits transcription indirectly via a Methyl-cpg binding-protein. Cell 64: 1123–1134.
Brooker, R. J. (2015). Genetics: Analysis & principles (5th ed.). New York, NY: McGraw-Hill.
Corona, M., Estrada, E. N. R. I. Q. U. E., & Zurita, M. A. R. I. O. (1999). Differential expression of mitochondrial genes between queens and workers during caste
81 determination in the honeybee Apis mellifera. Journal of Experimental Biology, 202(8), 929-938.
Crozier, R. H., & Pamilo, P. (1996). Sex allocation and kin selection in social insects. New York: Oxford University.
Dolinoy, D. C., Huang, D., & Jirtle, R. L. (2007). Maternal nutrient supplementation counteracts bisphenol A-induced DNA hypomethylation in early development. Proceedings of the National Academy of Sciences,104(32), 13056-13061.
Erlich, H. (2015). PCR technology: principles and applications for DNA amplification. Springer.
Evans, J. D., & Wheeler, D. E. (1999). Differential gene expression between developing queens and workers in the honey bee, Apis mellifera.Proceedings of the National Academy of Sciences, 96(10), 5575-5580.
Evans, J. D., & Wheeler, D. E. (2000). Expression profiles during honeybee caste determination. Genome biology, 2(1), research0001-1.
Fatemi, M., Pao, M.M., Jeong, S., Gal-Yam, E.N., Egger, G., Weisenberger, D.J. et al. (2005)Footprinting of mammalian promoters: use of a CpG DNA methyltransferase revealing nucleosome positions at a single molecule level. Nucleic Acids Res 33: e176.
Feinberg,A.P. and Tycko,B. (2004) The history of cancer epigenetics. Nat. Rev. Cancer, 4, 143–153.
Gause, G. F. 1947. Problems of evolution. Trans. Conn. Acad. Sci. 37:17-68.
Glastad, K. M., Hunt, B. G., Soojin, V. Y., & Goodisman, M. A. (2014). Epigenetic inheritance and genome regulation: is DNA methylation linked to ploidy in haplodiploid insects?. Proceedings of the Royal Society of London B: Biological Sciences, 281(1785), 20140411.
Glastad, K. M., Hunt, B. G., Yi, S. V., & Goodisman, M. A. D. (2011). DNA methylation in insects: on the brink of the epigenomic era. Insect molecular biology, 20(5), 553-565.
Goll, M.G. and Bestor, T.H. (2005) Eukaryotic cytosine methyltransferases. Annu Rev Biochem 74: 481–514.
Haig, D. “The (dual) origin of epigenetics.” Cold Spring Harbor Symposium on Quantitative Biology. 69 (2004):991-1002.
82 Haines, T.R., Rodenhiser, D.I. and Ainsworth, P.J. (2001) Allele-specific non-CpG methylation of the Nf1 gene during early mouse development. Dev Biol 240: 585–598.
Hajkova,P. et al. (2002) DNA-methylation analysis by the bisulfite-assisted genomic sequencing method. Methods Mol. Biol., 200, 143–154.
Hartfelder, K., & Engels, W. (1998). 2 Social Insect Polymorphism: Hormonal Regulation of Plasticity in Development and Reproduction in the Honeybee. Current topics in developmental biology, 40, 45-77.
Haydak, M. H. (1970). Honey bee nutrition. Annual review of entomology,15(1), 143- 156.
Herbers J.M. (1984). Queen-worker conflict and eusocial evolution in a polygynous ant species. Evolution 38:631-43
Hölldobler, B., & Wilson, E. O. (1990). The ants. Harvard University Press.
Holliday, R. (2006). Epigenetics: a historical overview. Epigenetics, 1(2), 76-80.
Holliday, R. and Pugh, J.E. 1975. DNA modification mechanisms and gene activity during development. Science 186: 226–232.
Human Genome Project Completion: Frequently Asked Questions. (2010, October 30). Retrieved December 01, 2016, from https://www.genome.gov/
Hung, M.S., Karthikeyan, N., Huang, B.L., Koo, H.C., Kiger, J. and Shen, C.K.J. (1999)Drosophila proteins related to vertebrate DNA (5-cytosine) methyltransferases. Proc Natl Acad Sci USA 96: 11940–11945.
Hunt, B.G., Brisson, J.A., Yi, S.V. and Goodisman, M.A.D. (2010) Functional conservation of DNA methylation in the pea aphid and the honeybee. Genome Biol Evol 2: 719–728.
Issa,J.P. (2003) Age-related epigenetic changes and the immune system. Clin. Immunol., 109, 103–108
Jung-Hoffmann, I. (1966). Die Determination von Königin und Arbeiterin der Honigbiene. Z. Bienenforsch, 8, 296-322.
Karp, G., & Geer, P. V. (2013). Cell and Molecular Biology: Concepts and Experiments (7th ed.). Hoboken, NJ: John Wiley.
Klose, R.J. and Bird, A.P. (2006) Genomic DNA methylation: the mark and its mediators.Trends Biochem Sci 31: 89–97.
83
Kronforst, M.R., Gilley, D.C., Strassmann, J.E. and Queller, D.C. (2008) DNA methylation is widespread across social Hymenoptera. Curr Biol 18: R287– R288.
Kucharski, R., Maleszka, J., Foret, S. and Maleszka, R. (2008) Nutritional control of reproductive status in honeybees via DNA methylation. Science 319: 1827– 1830. Kurdyukov, S., & Bullock, M. (2016). DNA methylation analysis: choosing the right method. Biology, 5(1), 3.
Lillycrop, K. A., Phillips, E. S., Jackson, A. A., Hanson, M. A., & Burdge, G. C. (2005). Dietary protein restriction of pregnant rats induces and folic acid supplementation prevents epigenetic modification of hepatic gene expression in the offspring. The Journal of nutrition, 135(6), 1382-1386.
Lister, R., Pelizzola, M., Dowen, R.H., Hawkins, R.D., Hon, G., Tonti-Filippini, J. et al. (2009)Human DNA methylomes at base resolution show widespread epigenomic differences.Nature 462: 315–322.
Liu, Y., & Lu, Q. (2015). Introduction to Epigenetics. Epigenetics and Dermatology, 3.
Lofgren, C. S., Banks, W. A., & Glancey, B. M. (1975). Biology and control of imported fire ants. Annual review of entomology, 20(1), 1-30.
Marhold, J., Rothe, N., Pauli, A., Mund, C., Kuehle, K., Brueckner, B. et al. (2004)Conservation of DNA methylation in dipteran insects. Insect Mol Biol 13: 117–123.
McDonald, M. (2006). Reds under your feet.
Michener, C. D. (1974). The social behavior of the bees: a comparative study(Vol. 73, No. 87379). Harvard University Press.
Mirenda, J. T., & Vinson, S. B. (1981). Division of labour and specification of castes in the red imported fire ant Solenopsis invicta Buren. Animal Behaviour, 29(2), 410-420.
Okano, M., Bell, D. W., Haber, D. A., & Li, E. (1999). DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell, 99(3), 247-257.
Pigliucci, M. (2001). Phenotypic plasticity: beyond nature and nurture. JHU Press.
Polymerase Chain Reaction (PCR). (2014, September 26). Retrieved April 20, 2017, from https://www.ncbi.nlm.nih.gov/
84
Pradhan, S., Bacolla, A., Wells, R.D., and Roberts, R.J. 1999. Recombinant human DNA (cytosine-5) methyltransferase. I. Expression, purification, and comparison of de novo and maintenance methylation. J. Biol. Chem. 274: 33002–33010.
Price, T. D., Qvarnström, A., & Irwin, D. E. (2003). The role of phenotypic plasticity in driving genetic evolution. Proceedings of the Royal Society of London B: Biological Sciences, 270(1523), 1433-1440.
Provine, W. B. (2001). The origins of theoretical population genetics: With a new afterword. University of Chicago Press.
Rae, P.M.M. and Steele, R.E. (1979) Absence of cytosine methylation at C-C-G-G and G-C-G-C sites in the rDNA coding regions and intervening sequences of Drosophila and the rDNA of other higher insects. Nucleic Acids Res 6: 2987– 2995.
Reik, W. (2007). Stability and flexibility of epigenetic gene regulation in mammalian development. Nature, 447(7143), 425-432.
Regev, A., Lamb, M. and Jablonka, E. (1998) The role of DNA methylation in invertebrates: developmental regulation or genome defense? Mol Biol Evol 15: 880–891.
Ross, K. G., & Keller, L. (1995). Ecology and evolution of social organization: insights from fire ants and other highly eusocial insects. Annual Review of Ecology and Systematics, 26(1), 631-656.
Ross, K. G., & Keller, L. (1998). Genetic control of social organization in an ant. Proceedings of the National Academy of Sciences, 95(24), 14232-14237.
Schwander, T., Lo, N., Beekman, M., Oldroyd, B. P., & Keller, L. (2010). Nature versus nurture in social insect caste differentiation. Trends in Ecology & Evolution, 25(5), 275-282.
Severson, D. W., Williamson, J. L., & Aiken, J. M. (1989). Caste-specific transcription in the female honey bee. Insect Biochemistry, 19(2), 215-220.
Smith, C.D., Zimin, A., Holt, C., Abouheif, E., Benton, R., Cash, E. et al. (2011) Draft genome of the globally widespread and invasive Argentine ant (Linepithema humile).Proc Natl Acad Sci USA 108: 5673–5678.
Smith, C.R., Smith, C.D., Robertson, H.M., Helmkampf, M., Zimin, A., Yandell, M. et al. (2011) Draft genome of the red harvester ant Pogonomyrmex barbatus. Proc Natl Acad Sci USA 108: 5667–5672.
85
Suen, G., Teiling, C., Li, L., Holt, C., Abouheif, E., Bornberg-Bauer, E. et al. (2011) The genome sequence of the leaf-cutter ant Atta cephalotes reveals insights into its obligate symbiotic lifestyle. PLoS Genet 7: e1002007.
Suzuki, D. T., & Griffiths, A. J. (1976). An introduction to genetic analysis. WH Freeman and Company..
Tribolium Genome Sequencing Consortium (2008) The genome of the model beetle and pest Tribolium castaneum. Nature 452: 949–955.
Tweedie, S., Ng, H.H., Barlow, A.L., Turner, B.M., Hendrich, B. and Bird, A. (1999) Vestiges of a DNA methylation system in Drosophila melanogaster? Nat Genet 23: 389–390.
Vandegehuchte, M.B., Lemiere, F. and Janssen, C.R. (2009) Quantitative DNA- methylation in Daphnia magna and effects of multigeneration Zn exposure. Comp Biochem Physiol C Toxicol Pharmacol 150: 343–348.
Vander Meer, R.K., Obin, M.S., Morel, L. (1990) Nestmate recognition in fire ants: monogyne and polygyne populations. Applied Myrmecology (eds R.K.Vander Meer, K.Jaffe & A.Cedeno), pp.322–328. Westview, Boulder, Colorado.
Vinson, S. B. (1986). Economic impact and control of social insects.
Waddington, C. “The Epigenotype.” Endeavor. 1 (1942): 18-20.
Walter,J. and Paulsen,M. (2003) Imprinting and disease. Semin. Cell Dev. Biol., 14, 101–110.
Wang, Y., Jorda, M., Jones, P.L., Maleszka, R., Ling, X., Robertson, H.M. et al. (2006)Functional CpG methylation system in a social insect. Science 314: 645–647.
Watt, F. and Molloy, P.L. (1988) Cytosine methylation prevents binding to DNA of a hela-cell transcription factor required for optimal expression of the adenovirus major late promoter. Genes Dev 2: 1136–1143.
Wheeler, W. M., & Weber, N. A. (1937). Mosaics and other anomalies among ants.
Wilson, E. O. (1978). Division of labor in fire ants based on physical castes (Hymenoptera: Formicidae: Solenopsis). Journal of the Kansas Entomological Society, 615-636.
86 Wirtz, P., & Beetsma, J. (1972). Induction of caste differentiation in the honeybee (Apis mellifera) by juvenile hormone. Entomologia Experimentalis et Applicata, 15(4), 517-520.
Wolff, G. L., Kodell, R. L., Moore, S. R., & Cooney, C. A. (1998). Maternal epigenetics and methyl supplements affect agouti gene expression in Avy/a mice. The FASEB Journal, 12(11), 949-957.
Wolffe, A.P. and Matzke, M.A. (1999) Epigenetics: regulation through repression. Science 286: 481–486.
Wolstenholme, J. T., Rissman, E. F., & Connelly, J. J. (2011). The role of Bisphenol A in shaping the brain, epigenome and behavior. Hormones and behavior, 59(3), 296-305.
Wurm, Y., Wang, J., Riba-Grognuz, O., Corona, M., Nygaard, S., Hunt, B. G., ... & Dijkstra, M. B. (2011). The genome of the fire ant Solenopsis invicta.Proceedings of the National Academy of Sciences, 108(14), 5679-5684.
Zhong, R., Taylor, J. J., & Ye, Z. H. (1999). Transformation of the collateral vascular bundles into amphivasal vascular bundles in an Arabidopsis mutant.Plant physiology, 120(1), 53-64.
87