MIAMI UNIVERSITY

THE GRADUATE SCHOOL

CERTIFICATE FOR APPROVING THE DISSERTATION

We hereby approve the Dissertation of

Elizabeth Aileen French

Candidate for the Degree: Doctor of Philosophy

______Dr. Annette Bollmann, Director

______Dr. Donald J. Ferguson, Reader

______Dr. Rachael M. Morgan-Kiss, Reader

______Dr. Gary R. Janssen

______Dr. Michael J. Vanni Graduate School Representative ABSTRACT

INVESTIGATION OF FACTORS INFLUENCING NICHE DIFFERENTATION OF AMMONIA-OXIDIZING ARCHAEA AND BACTERIA IN FRESHWATER ENVIRONMENTS

by Elizabeth Aileen French

Nitrification, the transformation of nitrogen from its most reduced form (ammonia) to its most oxidized form (nitrate) is a component of the nitrogen cycle in aquatic habitats. The first step of this process, the oxidation of ammonia to nitrite, is performed by two distinct groups of microorganisms in the environment, the ammonia-oxidizing archaea (AOA) and bacteria (AOB). Here we present a study using cultivation techniques to investigate environmental factors that influence the niche differentiation of AOA and AOB from freshwater environments. In order to investigate factors that drive the diversity of freshwater AOB communities, we enriched AOB from lakes representing a range of trophic states. The resulting enrichments were not influenced by the ammonium concentrations used in enrichment medium, but were comprised of AOB species commonly detected in freshwater environments. The AOB communities of the sediment and enrichments were strongly influenced by the watershed land use of the lake, and ammonium and nitrate concentrations within the sediment. Further enrichment efforts yielded cultures of three species of AOA, two of which represent a previously undescribed genus. These AOA grew more slowly than a freshwater AOB enrichment in all conditions tested (ammonium concentration, oxygen concentration, pH, and light exposure). Data from these experiments indicated that ammonium and oxygen concentrations and light exposure, would be the strongest factors driving niche separation of AOA and AOB. Chemostat competition experiments were conducted using one representative AOA and AOB under ammonia-limiting, high oxygen (21%) and ammonia-limiting, low oxygen (1%) conditions. In all cases, the AOA outcompeted the AOB for ammonia, and the AOB was washed from the chemostat. AOA and AOB were also investigated with respect to their starvation tolerance; both AOA and AOB survived nearly two months of starvation while maintaining amoA mRNA and 16S rRNA, however the AOB was able to recover from starvation faster. The results from these experiments suggest that, within the ammonia-oxidizers, AOB represent a copiotrophic lifestyle and will thrive in conditions of pulses of high ammonia availability, while AOA represent an oligotrophic lifestyle and will thrive in conditions of very low but constant ammonia availability. Investigation of Factors Influencing Niche Differentiation of Ammonia-oxidizing Archaea and Bacteria in Freshwater Environments

A Dissertation

Submitted to the Faculty of Miami University in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Microbiology

by

Elizabeth Aileen French Miami University Oxford, OH 2013

Dissertation Director: Annette Bollmann, Ph.D. TABLE OF CONTENTS List of Tables iii List of Figures v Acknowledgements vii Introduction 1 Chapter 1. Influence of Ammonium Concentration on the Enrichment of Ammonia-oxidizing Bacteria from Freshwater Sediments in Ohio. 29 Chapter 2. Ecophysiological Characterization of Ammonia-Oxidizing Archaea and Bacteria from Freshwater. 48 Chapter 3. Starvation and Competition: Survival Capabilities of Ammonia-oxidizing Archaea and Bacteria 90 Summary 130 References 144

ii LIST OF TABLES Table Page 1. Primers used for identification and DGGE separation of sequences from enriched AOB based on 16S rRNA gene sequence 35 2. Characteristics of lakes/sediments from which AOB were enriched 37 3. Closest cultured relative of enriched AOB 38 4. Primers used to identify AOA and AOB based on amoA and 16S rRNA gene sequence 58 5. Oligonucleotide probes used for CARD-FISH 59 6. Identities [%] of AOA in the enrichment cultures AOA-AC2, AOA-AC5, and AOA-DW in comparison with previously cultivated AOA. 63 7. Quantitative analysis of the composition of the enrichment cultures AOA-AC2; AOA-AC5 and AOA-DW. 64 + -1 8. Influence of the NH4 concentration on the growth rates [h ] of the enrichment culture AOA-AC2, AOA-AC5, AOA-DW and AOB-G5-7 68 + 9. Influence of NH4 concentration on the lag phase [h] before onset of logarithmic growth in the enrichment cultures AOA-AC2; AOA-AC5, AOA-DW, and AOB-G5-7 71

10. Influence of the calculated O2 concentrations in the headspace of the bottle on the growth rates [h-1] of the enrichment cultures AOA-AC2, AOA-AC5, AOA-DW, and AOB-G5-7 74 11. Influence of the pH value on the growth rates [h-1] of the enrichment cultures AOA-AC2, AOA-AC5, AOA-DW, and AOB-G5-7 77 12. Influence of white, red, and blue light with the intensity of 30 µmol photons m-2 s-1 and blue light with the intensity of 3 µmol photons m-2 s-1 on the growth rates [h-1] of the enrichment culture AOB-G5-7 81 13. Influence of white, red, and blue light with the intensity of 30 µmol photons m-2 s-1 and blue light with the intensity of 3 µmol photons m-2 s-1 on the growth rates [h-1] of the enrichment culture AOA-DW 82 14. Influence of white, red, and blue light with the intensity of 30 µmol photons m-2 s-1 and blue light with the intensity of 3 µmol photons m-2 s-1

iii on the growth rates [h-1] of the enrichment culture AOA-AC2 83 15. Influence of white, red, and blue light with the intensity of 30 µmol photons m-2 s-1 and blue light with the intensity of 3 µmol photons m-2 s-1 on the growth rates [h-1] of the enrichment culture AOA-AC5 84 16. Primers used to quantify amoA and 16S rRNA gene and RNA abundance in laboratory cultures of AOA and AOB 98 17. Influence of starvation time [days] on growth rate [h-1] of the enrichment cultures AOB-G5-7 and AOA-AC1 117 18. Influence of starvation time [days] on lag phase [h] of the enrichment cultures AOB-G5-7 and AOA-AC1 118 19. Influence of starvation time [days] on amoA copy number [copies/ng RNA] of the enrichment cultures AOB-G5-7 and AOA-AC1 121 20. Influence of starvation time [days] on 16S rRNA copy number [*106 copies/ng RNA] of the enrichment cultures AOB-G5-7 and AOA-AC1 122

iv LIST OF FIGURES Figure Page 1. Simplified schematic diagram of the nitrogen cycle 2 2. Neighbor-joining tree of cultivated AOB species based on 16S rRNA gene sequence 9 3. Neighbor-joining tree of cultivated AOA species and environmental strains based on amoA nucleotide sequence 17 4. Principal Component Analysis of the community composition in the enrichment cultures and the original sediment samples 40 5. Canonical Correspondence Analysis of the relationship between the distribution of the AOB species, the sediment samples and the environmental factors 43 - - 6. Determination of the duration of lag phase based on the NO2 /NO3 - - concentration and log (NO2 /NO3 concentration) in an enrichment culture over time 56 7. Neighbor-joining phylogenetic tree of the AOA enrichment cultures based on amoA gene sequences 61 + 8. Influence of NH4 concentration on the growth rates of the enrichment cultures AOA-AC2; AOA-AC5, AOA-DW, and AOB-G5-7 66 + 9. Influence of NH4 concentration on the lag phase before onset of logarithmic growth in the enrichment cultures AOA-AC2; AOA-AC5, AOA-DW, and AOB-G5-7 69

10. Influence of the calculated O2 concentration in the headspace of the bottle on the growth rate of the enrichment cultures AOA-AC2; AOA-AC5, AOA-DW, and AOB-G5-7 72 11. Influence of the pH of the medium on the growth rates of the enrichment cultures AOA-AC2, AOA-AC5, AOA-DW, and AOB-G5-7 75 12. Influence of white, red, and blue light with the intensity of 30 µmol photons m-2 s-1 and blue light with the intensity of 3 µmol photons m-2 s-1 on the growth rates of the enrichment cultures AOB-G5-7, AOA-DW, AOA-AC2, and AOA-AC5 79

v 13. Chemical and microbial composition of a chemostat initially inoculated with AOB-G5-7 in ammonia-limited, high oxygen conditions 100 14. Chemical and microbial composition of a chemostat initially inoculated with AOA-AC1 in ammonia-limited, high oxygen conditions 102 15. Expression of amoA by AOB-G5-7 (A) and AOA-AC1 (B) during the chemostat growth and competition under ammonia-limited, high oxygen conditions 105 16. Chemical and microbial composition of a chemostat initially inoculated with AOB-G5-7 in ammonia-limited, low oxygen conditions 108 17. Chemical and microbial composition of a chemostat initially inoculated with AOA-AC1 in ammonia-limited, low oxygen conditions 111 18. Expression of amoA by AOB-G5-7 (A) and AOA-AC1 (B) during the chemostat growth and competition under ammonia-limited, low oxygen conditions 113 19. Influence of starvation on the growth rate and lag phase of AOB-G5-7 and AOA-AC-1 recovery cultures 115 20. amoA mRNA and 16S rRNA abundance [copies/ng RNA] during starvation of the AOA enrichment cultures AOA-AC1 (A) and the AOB enrichment culture AOB-G5-7 (B) 119 21. Conceptual model of the niche of AOA and AOB in a eutrophic lake 135 22. Conceptual model of the niches of AOA and AOB in an oligotrophic lake 138

vi ACKNOWLEDGEMENTS A wise person once wrote on a bumper sticker, “graduate school is like hitting yourself on the head with a hammer: it feels good when you stop.” While that might be a bit of an exaggeration, grad school is certainly full of ups and downs, but at the end, I’d like to think my experience was a positive one, where the ups outnumbered and overcame the downs. You can’t go anywhere in grad school without good advice, and my experience has certainly been a reflection of the support of the faculty in microbiology at Miami. I must first thank my advisor, Annette Bollmann. Without her guidance and passion for science, I wouldn’t have stayed to earn a PhD. I am thankful that she agreed to take me on as her first grad student, and am grateful for her patience in working with me and that she continually challenged me to become a better person and a better scientist. I also am thankful for my committee members, D.J. Ferguson, Gary Janssen, Rachael Morgan-Kiss, and Mike Vanni. They have provided me nothing but positive support and guidance, and have helped me to think critically about the world around me. I think I have matured a lot as a grad student since my first committee meeting, and that is certainly due to the feedback and encouragement from my committee. I am particularly grateful to Rachael and Mike, for assistance and advice with field work, and for letting me borrow what seemed like all of the equipment I needed to use. I couldn’t have made it without the love and support of my parents, who, in addition to cultivating a knack for sarcasm and love of fine beer, taught me from a young age that I wasn’t allowed to quit anything that I knew I could finish. I also am so lucky to have an family that have been supportive and interested in my work along the way, so thanks to my brother, Robert, my Grandma, and all of my aunts, uncles, and cousins who have encouraged me along the way. Working in the Bollmann lab has been more fun that it probably should have been, and I have been so fortunate to be able to go to work every day with awesome people. Thanks especially to Jessica Kozlowski and Austin Duprey for being fantastic undergrads to mentor, for helping me to collect so much data, and for being awesome friends as well. Thanks also to all of the undergrads who have been in the lab over the past six years for keeping things entertaining and the dishes clean. Finally, I am grateful for my friends, the people who broke me out of my shell and kept me from going completely crazy over the last six years. So thanks to Jeremy, Kristen, Adam, Nate, Patrick, Erich, and Fish, for being my first friends at Miami, for introducing me to the BBC

vii and all its wonders, and for helping me survive the first two years; to Jenna, Ryann, Chris, Heather, Steve, Bill, Mary, and everyone else for having fun and making grad school some of the best years of my life. And to my best friend, Dan, you’ve made the past few years some of the funnest times ever. Thanks for always having my back and laughing with me.

viii INTRODUCTION Microorganisms are constantly under the influence of the biotic and abiotic characteristics of their habitat. Parameters such as nutrient availability, pH, oxygen concentration, and light influence the diversity of organisms able to exist in an ecosystem, and the activity of these organisms within their habitat. The ability of organisms to respond differently to changes in any of these habitat characteristics may allow for niche separation between organisms that are competing for the same substrate (1). The freshwater lake environment represents an ecosystem that provides natural gradients of many abiotic parameters that can influence microbial niche differentiation (2). In order to determine factors that influence niche differentiation of microorganisms, investigations of natural diversity over a gradient of abiotic conditions as well as laboratory growth and activity in a range of growth conditions are often employed (3-8).

The Nitrogen Cycle and Nitrification Nitrogen is a critical nutrient in the environment that is required by all forms of life for the synthesis of nucleic acids and amino acids. The most predominant form of nitrogen in the environment is nitrogen gas, which is inaccessible for biosynthesis by the majority of living organisms (9). Nitrogen gas must be fixed through bacterial nitrogen fixation to provide ammonia, a biologically available form of nitrogen, which can then be assimilated by other organisms (Figure 1) (10). Free ammonia in the environment is utilized by heterotrophic and autotrophic organisms for assimilation, and by chemolithoautotrophic organisms for energy generation through the process of nitrification. Nitrification is a two-step reaction that comprises the aerobic portion of the microbially-mediated nitrogen cycle, in which nitrogen is transformed from ammonium to nitrate (9). The first step and rate-limiting step, ammonia oxidation, involves the oxidation of ammonia to nitrite. Through the process of nitrite oxidation, nitrogen is then fully oxidized to nitrate (11). Ammonia oxidation and nitrite oxidation often co-occur in the environment, and as a result only the final product, nitrate, is detectable in most environments. Nitrate is also a biologically available form of nitrogen, and can be used by some organisms for assimilation and biosynthesis (9). In addition to aerobic ammonia oxidation, anaerobic ammonia oxidation (anammox) can occur in anoxic environments. In the anammox process, ammonia is

1

Figure 1. Simplified schematic diagram of the nitrogen cycle. Microbially mediated

+ + processes are responsible for the fixation of N2 to NH4 (nitrogen fixation), the oxidation of NH4 - - to NO3 (nitrification) and the reduction of NO3 to NH2 (denitrification). In addition, the process of anammox oxidizes ammonium anaerobically via nitrite to form N2.

2

3 oxidized and nitrite is reduced to produce nitrogen gas and nitrate (12). In anaerobic environments, nitrate produced either aerobically or anaerobically can be utilized by many organisms as a terminal electron acceptor, and through a series of reductions, is returned to nitrogen gas through the process of denitrification (10). Nitrification is an essential part of ecosystem functioning, providing an ample pool of fixed nitrogen (nitrate), which is the most abundant of the biologically available forms of nitrogen (9). This process is required to link nitrogen transformations from the most reduced form (ammonium) to the most oxidized form (nitrate) (9). Since the advent of the Haber-Bosch process, which is an industrial process that uses a significant amount of energy to generate ammonia from nitrogen gas and hydrogen gas, the amount of nitrogen in the form of ammonia added to ecosystems by means of agricultural fertilizers has increased significantly (13). While ammonium can bind to anionic soil particles and be retained in soils, any ammonium that is oxidized via nitrification is transformed to nitrate, which is readily leached from soils (11). Nitrate that enters ground water is transported to surface freshwater, such as streams and lakes, where, along with phosphorus pollution, it can cause significant eutrophication of the environment. The negative impacts of eutrophication include harmful algal blooms, oxygen depletion and the formation of dead zones, and fish kills (14). While a wealth of knowledge is available in the literature about the consequences of increased ammonia fertilizer usage and increased eutrophication of marine and inland freshwaters, there is no clear strategy for remediating this significant global problem. In addition to nitrate leaching from soils, nitrification also contributes to global warming through the production of potent greenhouse gases. Nitric and nitrous oxides are produced in trace amounts during ammonia oxidation by both ammonia oxidizing bacteria (AOB) and ammonia oxidizing archaea (AOA) in a processes known as nitrifier denitrification (15, 16). This process is increased under microaerophilic conditions, and may support low growth of some AOB under anaerobic conditions (17). The full biochemical and metabolic underpinnings of nitric and nitrous oxide production in AOA and AOB remains unknown, and much more work on cultured strains is required to fully elucidate the pathways by which these greenhouse gases are produced, and the environmental factors that could be manipulated to decrease production. The organisms involved in ammonia oxidation have been under investigation since their discovery in late 1800s. There are three major recognized groups of aerobic microbial nitrifiers:

4 the AOB, the AOA, and the nitrite-oxidizing bacteria (NOB). While the AOB and NOB have been well-studied with respect to physiology, biochemistry, and ecology for many years, the AOA have only recently been discovered and have therefore sparked a rapidly growing field of research within the last 10 years (10). While much is known about the habitat range of the AOA, specific knowledge of the ammonia oxidation pathway and the full metabolic capabilities of these organisms is only beginning to develop. Continued cultivation and in situ approaches will be required to fully elucidate the similarities and differences in ammonia oxidation pathways between the AOA and AOB in the future. Understanding whether, and how much, AOA or AOB contribute more to the process of ammonia oxidation in the environment, as well as the specific physiology and biochemistry involved with these processes, may allow for better control of the harmful effects of nitrification in environments that are impacted by anthropogenic inputs.

Freshwater environments Freshwater lakes comprise a small fraction of the total volume of water on Earth’s surface, but comprise the majority of water used by humans worldwide (18). Freshwater from lakes, rivers, and streams is utilized for many urban and agricultural functions, and is simultaneously sensitive to the influence of these activities (19). The land surrounding and draining into a lake is known as the watershed, and includes land, ground water, and streams that input into a lake basin. In Ohio, the majority of lakes are in actuality reservoirs; man-made dammed basins constructed for water management, flood control, drinking water, and recreation (18). These reservoirs typically have larger watersheds than naturally occurring lakes, and are therefore more sensitive to the inputs from the watershed than a natural lake (20, 21). The type of land usage within a watershed can have significant effects on the lake ecosystem; agricultural and urban watersheds tend to input higher levels of nutrients, including fertilizers and other pollutants, and agricultural watersheds often add significant amounts of sediment to lakes (20). These increases in nutrients and particulate matter can have serious implications for the biological and geological processes occurring within the lake. Lakes and reservoirs are often classified into one of several trophic states that are related to nutrient concentrations (nitrogen and phosphorus) and impact both biotic and abiotic factors in the lake (22). These classifications range from hyper-eutrophic to ultra-oligotrophic. Lakes in the eutrophic range tend to have higher nutrient concentrations that support higher primary

5 productivity and algal biomass. Oligotrophic lakes have lower nutrient concentrations and are less productive (22). There is a strong link between watershed land use and trophic state of the lake, with lakes in agricultural watersheds being more eutrophic and those in forested or undisturbed watersheds being more oligotrophic (23). Nitrification in freshwater lakes has only been well studied with respect to the contribution of the AOB (24). To date, the role of AOA and anammox bacteria have not been studied in these environments in detail. While AOA have been detected in numerous freshwater lakes globally (25, 26), no work has been published that demonstrated the activity or contribution of these organisms in freshwater environments. Measurements for the rate of nitrification in freshwater lakes in general is also lacking, due to the difficult nature of obtaining these data (24). However, the use of cultivation-dependent and independent techniques has been used to investigate the ecology of AOB within freshwater ecosystems (27). Further work will be required to elucidate how much AOA contribute to ammonia oxidation in freshwater environments, and factors that separate the niches of AOA and AOB in these environments. Insight into niche differentiating factors between freshwater AOA and AOB will allow for a better understanding of how the nitrogen cycle may be affected by increased nutrient loads in these sensitive aquatic environments. The distribution and activity of AOB within a lake varies considerably by the specific lake under investigation, zone of the lake, and season. Typically, most nitrification takes place in the upper sediment layer (28). This is presumed to be due to the higher number of AOB detected in the sediment compared with the rest of the water column; within the sediment, AOB have been detected with cell numbers 4-5 orders of magnitude higher than in any portion of the water column (28). The activity of AOB within a lake depends primarily on availability of ammonia and oxygen, which are often inversely related within the water column. Ammonium is released from decaying organic matter in the sediment, and oxygen is generally consumed by animals, zooplankton, and heterotrophic bacteria higher in the water column (24). It is likely that the sediment-water interface supports the greatest amount of nitrification in freshwater environments, as this habitat often has the highest concentration of ammonia within the lake.

Ammonia-oxidizing Bacteria

6 Ammonia-oxidizing bacteria are perhaps the best studied nitrifying organisms; they have been investigated using cultivation dependent approaches since the late 19th century and their ecology has been studied using advances in molecular biology since the late 20th century (29). Much of the physiological and biochemical investigation of these organisms has been done with Nitrosomonas europaea, the model organism of ammonia-oxidizing bacteria. This species is often used for its relative ease of cultivation; N. europaea can be easily grown at ammonium concentrations of 50-100 mM, which generates enough biomass to conduct biochemical analyses. Unlike many other species of AOB, N. europaea can be cultured on agar plates (though not readily), and a genetic system has been developed for this species to generate mutations to investigate the ammonia oxidation pathway (11). Most AOB, however, cannot grow at such high, environmentally irrelevant ammonium concentrations and have consequently been neglected in cultivation and physiological investigations until recently. Cultivation and characterization of environmentally relevant species of AOB is essential to better understanding how these widespread organisms are responding to anthropogenic impacts and affecting eutrophication of environments worldwide.

Ammonia oxidation: biochemistry and genetics AOB are obligately chemolithoautotrophic, generating all reductant for energy and biosynthesis from the oxidation of ammonia to nitrite, and fixing inorganic carbon via the Calvin cycle (11). The bacterial oxidation of ammonia proceeds through a two step reaction, in which ammonia is first oxidized to hydroxylamine via the membrane bound protein ammonia monooxygenase (Amo) (11). Hydroxylamine is subsequently oxidized to nitrite by the periplasmic protein hydroxylamine oxidoreductase (Hao) (11). From this reaction, four electrons are generated and transferred from cytochrome c554, to cytochrome cm552, and then to the ubiquinone pool, where two are transferred back to Amo and the remaining two to a terminal oxidase (11). Because of its critical role in the ammonia oxidation pathway, the gene encoding the alpha-subunit of Amo (amoA) is often used as a marker gene to classify AOB.

Obligate autotrophy AOB have a strict reliance on ammonia as their sole source of energy and reductant, and require CO2 for their sole carbon source. The genetic basis for this obligately chemolithotrophic

7 lifestyle is seen in the lack of genes encoding the catabolic functions for the use of sugars, amino acids, phospholipids, and nucleic acids for bioassimilation (30-33). While many of these species have the genetic potential to oxidize pyruvate, fructose, and glutamate, no genes encoding transport functions for these compounds are present in any of the sequenced AOB genomes (30- 33). Laboratory growth experiments have demonstrated that very small amounts of fructose can be assimilated, and very low growth of N. europaea was achieved on high concentrations of fructose, but only in the complete absence of CO2. In these experiments, however, ammonia was still required for reductant, indicating that N. europaea may be able to grow chemolithoheterotrophically (34). This mode of growth is not feasible in the environment, as

CO2 is present in high concentrations in atmospheric air, and would thus inhibit heterotrophic growth of N. europaea (35). In addition to the lack of transporters for organic compounds, all sequenced AOB genomes thus far also lack a complete tricarboxylic acid (TCA) cycle (36, 37). It has been previously demonstrated in N. europaea that, while the genes encoding α-ketoglutarate dehydrogenase are present, it’s activity is not detectable in cell free extracts (30, 38). Branched reductive and oxidation pathways exist to generate intermediate compounds for biosynthesis, however the full cycle is incomplete, rendering the AOB incapable of heterotrophic growth (30). The absence of α-ketoglutarate dehydrogenase genes and activity has also been proposed as the driver of obligate autotrophy in other chemolithotrophic bacteria, such as the methane-oxidizing bacterium Methylococcus capsulatus (37).

Phylogeny and ecophysiology AOB belong to two phylogenetic groups: the γ-Proteobacteria, which are found in marine environments, and the β-Proteobacteria, which are common in soil and many aquatic environments (Figure 2) (29). The γ-AOB are represented by one genus, Nitrosococcus, which contains two recognized species, N. oceani, and N. halophilus (39). The β-AOB are comprised of two genera, Nitrosospira and Nitrosomonas (40). Within the β-AOB there are more than 16 named species that have been isolated into pure culture and described with respect to ecophysiology, and many more reported within the literature (27, 29, 41). The genus Nitrosospira contains the species N. briensis, N. tenuis, and N. multiformis, and several other uncultivated strains that in total can be classified into three phylogenetic clusters (40).

8

Figure 2. Neighbor-joining tree of the cultured AOB based on 16S rRNA gene nucleotide sequences. Phylogenetic clusters and environments from which these species are commonly isolated are noted.

9

10 The genus Nitrosomonas contains the species N. europaea, N. eutropha, N. halophila, N. ureae, N. oligotropha, N. marina, N. aestuarii, N. communis, N. nitrosa, N. cryotolerans, and N. mobilis. These species, along with many other uncultivated strains, can be grouped into five distinct phylogenetic clusters (41-43). AOB have been detected in a wide variety of habitats, including soils, fresh and marine water, sediments, and estuaries. While AOB in general can be detected in almost any environment, the environmental distribution of a given species often reflects its physiology, as supported by laboratory growth characterization (29). While the basic energy-generating metabolism of all AOB is biochemically very similar, the different species, particularly of the β- AOB, each inhabit specific habitat ranges. This has been attributed primarily to the difference in the Ks of each characterized species for ammonia; within the genus Nitrosomonas, there is a correlation between phylogeny (based on 16S rRNA) and substrate affinity (43, 44). Additionally, the salt requirement for several species of AOB also contributes to their environmental distribution (29). Members of the N. europaea cluster, including N. eutropha, N. halophila and N. mobilis, are frequently isolated from high ammonia environments such as wastewater treatment plants and agricultural soils. Others strains from this cluster have also been isolated from eutrophic freshwater and estuarine environments (29). All of the characterized isolates from this cluster are urease negative, and tend to live in environments where there is sufficient free ammonia to support growth (29). In contrast, members of the N. oligotropha cluster are commonly isolated from oligotrophic freshwater environments, as well as soils with minimal anthropogenic inputs

(29). These isolates have very low Ks for ammonia (1.9-4.2 µM) (44, 45). The majority of strains that have been characterized in the laboratory possess urease genes, which is believed to be an adaptation to survival in environments where free ammonia is low, as urease cleaves urea into ammonia and carbon dioxide, which the AOB can use for energy and biosynthesis (29). Members of the Nitrosospira genus can be grouped into at least four distinct phylogenetic clusters, which have been associated with detection in specific environments (27). Species from this genus have been detected and isolated from marine environments (cluster 1), acid soils (cluster 2) and soil environments and freshwater environments that have minimal exposure to human inputs (clusters 0, 3, and 4) (27, 46).

11 In addition to substrate affinity, different phylogenetic clusters of AOB are hypothesized to be adapted to specific habitats based on other physiological and environmental characteristics. For example, AOB that typically inhabit freshwater and sediment environments often encounter extreme oxygen fluctuations, and must be able to survive periods of hypoxia and anoxia (29, 47). In contrast, AOB that typically inhabit high ammonia environments including wastewater treatment plants must be able to tolerate conditions of high oxygen concentrations. The presence of a functional urease enzyme may allow some species to survive in low ammonia environments. AOB that are commonly found in soils encounter conditions of fluctuating ammonia availability and constant competition with plants for ammonia. As a result, many of these species have the ability to utilize urea as an ammonia source, allowing them to survive in competitive conditions of low free ammonia (29, 47). In contrast, species such as N. eutropha, which is commonly found in high ammonia environments, lacks the capability to utilize urea as an ammonia source (27, 33). It is hypothesized that AOB have undergone reductive genome evolution as they became specialized for specific niches in the environment (35). As more strains are isolated and genomes become available in the near future, further comparisons can be made between species isolated from similar environments to determine the genetic basis of these adaptations.

Survival and growth in the environment Growth in the laboratory and growth in the environment require rather different survival strategies. While laboratory growth often occurs in the presence of readily supplied, excess ammonia, growth in the natural environment exposes AOB to periods of ammonia depletion. The AOB have adapted to survive periods with low or no ammonia availability by being able to withstand days to months of starvation (48-50). Species including N. cryotolerans and N. briensis have been shown to survive periods of months up to a year of ammonia starvation and recover readily when exposed to a new ammonia supply (48, 50). During this time of starvation, the cells likely remain dormant, however little is known about the cellular changes (if any) that take place during this dormancy phase. It has been observed that N. briensis retains both amoA mRNA and 16S rRNA for several weeks of ammonia starvation (48). Retention of mRNA transcripts encoding proteins involved in energy generation may represent an adaptation to starvation, as starved AOB are able to respond rapidly to an influx of ammonia and therefore might be able to outcompete other organisms for access to ammonia (48). The dynamics and

12 functions of other specific cellular constituents during starvation have not been investigated thoroughly, and it is likely that there are several more adaptations that allow AOB to survive for so long without energy.

Ammonia-oxidizing Archaea History Evidence for a second group of microorganisms capable of biological aerobic ammonia oxidation arose from three separate findings in the early 2000s. Metagenomic data from the Sargasso Sea revealed a gene on a archaeal-associated scaffold that putatively encoded an ammonia monooxygenase (51). Genes similar to bacterial amoAB and methane monooxygeanse (pmo) were also found on a crenarchaeal-associated fosmid from a soil library. These amoAB genes were found to be actively transcribed in natural soils, and transcription increased when soils were incubated with ammonium (52). Taken together, these results indicated the existence of a previously undetected, uncultivated ammonia-oxidizing archaeon. Direct evidence for the existence of an AOA came in 2005, with the isolation of Nitrosopumilus maritimus (53). For several years prior, active nitrification had been occurring in an aquarium water purification system, however no AOB could be detected using standard molecular methods. At the time, it was assumed that this was due to primer bias, and the search was expanded to include archaeal 16S rRNA primers. Marine Group I Crenarchaea were found to be abundant in the sediments and enrichments from these aquaria, and with adjustments to cultivation medium, N. maritimus was eventually isolated and implicated as the nitrifier in these aquaria (53, 54). The Crenarchaeota were thought to be an extremophilic, thermophilic group of microbes with limited phylogenetic or metabolic diversity until the 1990s, when molecular microbial ecology shed light on their ubiquitous global distribution (55-57). Marine Group I Crenarchaeota are found in high abundance in marine environments, making up 20-40% of the total bacterioplankton (58, 59). In addition, they are also found to be the dominant archaeal group in soils, making up 1-5% of the total prokaryotes (60, 61). These mesophilic archaea are also commonly found in sediments (25, 62-64) and estuaries (65-67). The finding that many of these mesophilic Crenarchaea encoded putative ammonia monooxygenase genes sparked an interest in investigating their full metabolic potential and role in global ecosystems and biogeochemical cycling. Genome sequencing of N. maritimus and the uncultivated amoA-

13 encoding marine sponge symbiont Cenarchaeum symbiosum shed some light on the physiology and phylogenetic diversity of these organisms (68, 69). Based on differences in 16S rRNA sequence, other marker genes, ribosomal proteins, and information processing machinery, it has been proposed that this ubiquitous group of Crenarchaeota be redefined as a new phylum of Archaea, the Thaumarchaeota (70, 71). To date, all characterized AOA belong to this new phylum (54), and the only characterized members of this phylum are ammonia oxidizers (72). However, it is highly likely that additional growth modes exist in this phylum. amoA-encoding archaea have been found in waste water treatment plants that express amoA, but do not oxidize ammonia (73). Discovery of the metabolism of these organisms will be of interest in the future, to determine other functions of the archaeal ammonia monooxygenase enzyme.

Ammonia oxidation: biochemistry and genetics The basic energy-generating metabolism of the AOA is very similar to that of the AOB. Ammonia and oxygen are stoichiometrically converted to nitrite via a putative two-step process (8). The enzymes and biochemistry involved in this process are not well characterized as of yet. Genes encoding the first enzyme of the process, ammonia monooxygenase subunits A, B, and C, are present in all sequenced AOA genomes, however the operon order is not well conserved (68, 69, 74, 75). Amo in the AOA belongs to the family of copper-containing membrane-associated monooxygenases, and shares approximately 40% amino acid similarity to that found in the AOB. The biochemistry and genetics of the ammonia oxidation process in AOA is unknown after ammonia monooxygenase, however. To date, no genes putatively encoding a hydroxylamine oxidoreductase or c-type cytochromes have been identified in any AOA genome (68, 69, 75, 76). It was recently discovered that the intermediate of the ammonia oxidation pathway in AOA is hydroxylamine, however the enzymes involved in oxidation of hydroxylamine to nitrite are unknown (77). Possible candidates for this oxidation include multicopper oxidases, of which there are many in the sequenced AOA genomes (68, 69, 75, 76). Plastocyanin-like proteins may play a role in electron transport in place of c-type cytochromes, indicating a stronger reliance on copper, rather than iron, for the AOA (69). Regardless of the pathway, a predicted two net electrons are generated from the oxidation of each molecule of ammonia, which can then be used for reductant and energy.

14 Growth mode(s) Growth of two AOA isolates, N. maritimus and Nitrososphaera viennensis, is reliant upon the oxidation of ammonia for energy, however growth of these cultures is enhanced by small organic compounds, especially intermediates of the tricarboxylic acid (TCA) cycle, suggesting the possibility of a mixotrophic lifestyle (53, 80). N. viennensis could only be isolated into pure culture with the addition of pyruvate to the medium, and has growth yields up to 12 times higher when cultured with pyruvate compared to autotrophic growth medium (80). Radiolabeling studies have showed that only 10% of the carbon in the biomass comes from pyruvate, indicating a reliance on both organic and inorganic carbon for growth and biosynthesis (80). Genome sequencing indicates the presence of a modified 3-hydroxypropionate/4- hydroxybutyrate pathway for inorganic carbon fixation (68, 69). This data has been confirmed by catalyzed reporter deposition-fluorescence in situ hybridization/microautoradiography (CARD-FISH/MAR) experiments in which individual cells of the moderately thermophilic AOA Nitrososphaera gargensis were observed to take up labeled bicarbonate (81). Additionally, substrate tracking autoradiography fluorescence in situ hybridization (STARFISH) analysis has showed that up to 60% of naturally occurring archaeal communities in the Mediterranean and Pacific oceans have been observed to take up amino acids, indicating the potential for mixotrophic and/or heterotrophic growth modes in the natural environment (82).

Phylogeny and environmental distribution Since the isolation of N. maritimus, primers targeting the archaeal amoA sequence were developed and used to probe many environments for these novel nitrifiers. AOA have been demonstrated to occur ubiquitously in habitats including marine water (83-91), estuaries (66, 92- 96), freshwater (97), soils (52, 98-105), and hot springs (81, 106-108). In many of these environments, AOA often outnumber AOB (based on qPCR measurements of amoA gene copy numbers) by several orders of magnitude (81, 84, 98, 107, 109). These numbers may be misleading, though, as N. maritimus cells have 10-100 times less volume than AOB, and as a result have per cell ammonia oxidation rates approximately ten-fold lower than most AOB (8, 110). As a result, it is difficult to determine strictly from the relative abundance of AOA and AOB which group is the predominant ammonia oxidizer in a given environment.

15 Many attempts have been made to elucidate factors that might dictate whether AOA or AOB will be the predominant ammonia-oxidizer in any given environment by correlating the abundance of AOA and AOB in an environment with abiotic factors. These studies have shown that AOA are highly abundant and AOA amoA expression is high in environments with low ammonium concentrations, such as the marine and estuary environments, where ammonium is present at 0.03-115 µM (84, 86, 91-93). Beyond ammonium, however, other environmental factors are less clear. AOA have been detected at temperatures ranging from 0.2 – 97 ºC (81, 89, 96, 107, 108, 111, 112), in environments with pH ranging from 3.5 – 8.7 (6), in habitats with dissolved oxygen concentrations of 1 µM to fully oxic (85, 92), and in conditions of the highly saline open ocean to freshwater environments, with no changes in abundance reported along a salinity gradient in an estuary environment (92). Finding AOA in such drastically different environments is largely attributable to the great diversity of this group of organisms (113). It is now becoming clear that specific phylotypes of AOA are found more commonly in certain environments, which may explain the widespread occurrence of these organisms. In addition to discovering the ubiquity of a previously unknown group of microorganisms, environmental sequencing data has also revealed a huge diversity of the AOA. Based on amoA and 16S rRNA gene sequences that have been collected from environmental surveys and deposited into databases worldwide as of 2010, it is likely that there are at least 100 species of AOA detected (72). These species of AOA can be broadly grouped into four phylogenetic clusters: group I.1a, which are more commonly found in marine water and sediment environments, group I.1a-associated, which to date have only been identified in acidic soils, group I.1b, which are often found in soils and other environments, and the ThAOA, which have been found only in hot spring environments (Figure 3) (6, 114). While all of the organisms found contain sequences with high identity to ammonia monooxygenase, recent studies have demonstrated that not all of these archaea are true ammonia oxidizers (73). In a recent report, a wastewater treatment plant (WWTP) in Europe was investigated with respect to ammonia oxidizing populations. Archaeal amoA sequences were found to be highly abundant, outnumbering the AOB in the plant by up to 10,000 fold. However, modeling and radiolabeling data suggest that these archaea are not growing via ammonia oxidation or autotrophy at all. Rather, these ammonia monooxygenase-encoding archaea (AEA), are not obligate chemolithoautotrophs and are growing actively in this WWTP by utilizing an as-yet unknown

16

Figure 3. Neighbor-joining tree based on amoA gene nucleotide sequences of cultivated AOA species and environmental sequences. Environmental sequences are denoted by Genbank accession number and the environment from which they were detected.

17

18 metabolism (73). The finding that at least some AEA exist suggests that the number of true AOA may be overestimated in environmental sequencing studies, and correlations of abundances of these sequences with environmental data must be taken with caution. Therefore, it is critical to validate the identity of an AEA detected by environmental sequencing with laboratory cultivation to ensure that the species identified are truly ammonia oxidizers. Since the isolation of N. maritimus, several other species of AOA have been cultivated. From Group I.1a, Candidatii Nitrosoarchaeum limnia, Nitrosoarchaeum koreensis, and Nitrosopumilus salaria have been enriched from estuaries (Ca. N. limnia and N. salaria) and agricultural soils (Ca. N. koreensis) (75, 115, 116). A recently defined group of AOA, the Group I.1a-associated Thaumarchaeota that are common in acid soils, are represented by an enrichment of the only acidophilic ammonia-oxidizer in culture, Ca. Nitrosotalea devanaterra (117). Group I.1b Thaumarchaeota are comprised of soil and thermophilic members, including soil isolate Nitrososphaera viennensis, moderately thermophilic enrichment Ca. Nitrososphaera gargensis, and the thermophilic enrichment Ca. Nitrosocaldus yellowstonii (80, 81, 107). While the number of AOA available in culture has expanded since 2005, there are predicted to be over 100 additional, uncultivated species that are represented by amoA sequences (<85% nucleotide sequence identity) deposited into databases worldwide (72). With each additional characterized culture, it is rapidly becoming clear that the growth characteristics of AOA are as diverse as they are phylogenetically; therefore, modified enrichment and cultivation strategies must be employed to cultivate the uncultured representatives of this phylum.

Cultivation of ammonia oxidizers Cultivation-based data on ammonia oxidizers, particularly AOA, is lacking in general due to the difficult nature of growing these organisms in laboratory culture. While cultivation and isolation of the AOB may seem relatively easy based on the number of species and strains available in pure culture, these numbers are deceptive. It is only through patient and often times time-intensive ventures that these organisms can be successfully cultivated. Many AOB are very difficult, if not impossible, to grow on solid agar medium. A requirement for liquid culture is likely due to the very low energy metabolism of these organisms, which does not produce sufficient biomass for visible microcolonies to be formed on a solid medium before the available ammonium is fully consumed. Due to the obstinate nature of these organisms, many researchers

19 avoid cultivation and focus only on the ecological prevalence of the AOA and AOB. Despite this, several techniques have been developed for cultivation of AOA and AOB.

Enrichment and isolation Like other slow-growing organisms, ammonia oxidizers must be initially enriched from an environmental sample rather than isolated directly. Enrichment medium is usually a mineral salts base with trace elements and ammonium, buffered with either HEPES or a phosphate buffer (27, 118). The ammonium concentration used varies by enrichment effort and environment from which samples were taken. The ammonium concentration should have some relevance to the environment being investigated, however higher concentrations are often necessary to obtain sufficient biomass to detect growth, maintain the culture, and identify the relevant organisms present (118). While many AOB will begin to grow from an environmental sample rapidly when introduced into enrichment medium, the AOA are not so quick to respond and do not become enriched as a result. In order to allow AOA to grow without competing with the much faster AOB, antibiotics are often employed to inhibit the growth of the AOB (53, 80). During enrichment, cultures must be monitored regularly to determine how much ammonium remains in the medium. Upon consumption, additional ammonium must be added to maintain growth, or a portion of the culture must be used to inoculate fresh medium (usually at a 10% v/v inoculum) (118). After a period of weeks to months, the dominant ammonia oxidizer in the enrichment will outcompete all other strains, generating an enrichment that is predominantly ammonia oxidizer, with additional contaminating heterotrophic bacteria. Isolation of AOA and AOB is more difficult than initial enrichment, mostly due to the inability of AOA and AOB to grow on agar plates (118). Some AOB that are capable of growth at ammonium concentrations of 5 mM or higher can be isolated in pour plates; lower ammonium concentrations do not produce sufficient biomass for microcolony formation (118). Instead, the enrichment culture must be serially diluted in fresh medium until only the ammonia oxidizer remains. This process is frequently done in plastic microtiter plates for convenience, however with slower growing organisms, a larger volume in test tubes may be required. After creating a serial dilution of an enriched ammonia oxidizer, the cultures should be left to incubate for one to several months. Growth can be detected by the accumulation of nitrite in the medium. The most dilute culture with nitrite can then be serially diluted again and incubated. In general, three to

20 four rounds of dilution and incubation are required to isolate an AOB (118). Isolation of the AOA tends to be more difficult than for the AOB, as at least half of the isolated AOA are more fastidious and require one or more organic supplements to the medium (80). Unfortunately, the identity of the required organic carbon does not appear to be shared across all AOA, and an extensive effort is required to identify the medium component that will allow for successful isolation (115, 117, 119).

Maintenance of batch cultures After successful enrichment or isolation of an AOA or AOB, the culture must be maintained as a batch culture indefinitely. These organisms do not tolerate typical storage as glycerol stocks. While some species may survive standard freezing storage, many AOB will not recover. Freezing and storage tolerance of the AOA is not well documented, however it is widely accepted that they respond similarly, if not worse than the AOB. To maintain an ammonia oxidizer in batch culture, the culture must be periodically assayed for ammonium, often via a colorimetric assay. When ammonium has been consumed, the culture must be transferred to fresh medium. Oftentimes, stock cultures are incubated for up to one month between transfers (118).

Chemostat growth Continuous cultivation systems (chemostats) can also be used to enrich and further study AOA and AOB. In chemostat growth, the culture is kept under constant conditions, which are monitored by sensors in the medium and adjusted as necessary by computer-controlled pumps. The culture must be continually stirred to maintain homogenous conditions within the growth vessel. Sterile-filtered air can be bubbled in at various rates or from defined sources to maintain different oxygen concentrations within the growth vessel. Fresh medium with ammonium is added at a constant rate, and culture is removed at a constant rate to prevent the buildup of waste products and dead biomass. When a culture is growing at a steady state in a chemostat, the growth rate is controlled by the dilution rate of medium entering the chemostat (118). Chemostat growth can be used to both enrich and then further characterize previously enriched or isolated cultures. Enrichment of bacteria under extremely low substrate concentrations is possible in chemostats, and has been successfully employed to enrich a novel

21 AOB adapted to low ammonium concentrations (120, 121). Physiological experiments are often conducted in chemostats because constant growth can be maintained with cells kept in logarithmic growth under uniform conditions. This is advantageous when compared to batch cultures because conditions such as substrate concentration, oxygen, and pH do not change during growth (118). Additionally, chemostats are of particular use in conducting competition experiments, as multiple species can be grown together under constant conditions and the outcomes monitored to investigate interactions (118, 124). in situ growth In addition to laboratory growth, bacteria can be cultivated in the natural environment using a variety of techniques. The most commonly applied method is the use of a semi- permeable membrane to separate the microbial culture from the external environment (122). In this way, the organism of interest can be cultivated with access to diffusible nutrients from its natural environment while waste products diffuse away from the culture, allowing a close approximation of natural growth modes to be studied. This technique has been employed for many years, and was first used to investigate the production of toxins and antibiotics over one hundred years ago (122). This method has been employed to allow for successful cultivation of novel bacteria from contaminated subsurface sediments, which were previously unculturable by standard techniques (123). In the future, it is possible that this type of method could be employed for cultivation of AOA and AOB in aquatic environments. This technique may be valuable for cultivation and isolation of AOA, as nutrients from their natural environment that might be missing in mineral salts medium could be provided in a simple manner and may allow better growth that previously reported for laboratory cultivation.

Co-occurrence in the environment Competition for limiting nutrients Ammonia-oxidizing microorganisms must compete for access to free ammonia in the environment with photosynthetic and heterotrophic organisms for energy, as well as for assimilation (124-126). In addition, AOB and AOA must compete with each other for access to ammonia and other trace elements, including copper and iron. Because both organisms likely fill the same function in a habitat, they are in direct competition with one another to fill the

22 ammonia-oxidizer niche in that environment. Since the discovery of AOA in 2005, the major question in the field of nitrification has been to determine which type of organism, AOA or AOB, is the predominant ammonia-oxidizer in a given environment. While it has become clear that there are few generalizable features of the AOA and AOB that could answer this question, many studies have attempted to correlate environmental variables with the abundance of AOA and AOB in an attempt to elucidate niche differentiating factors (reviewed in 113). Recently, with the development of deep sequencing technology, these surveys have been expanded to examine the influence of environmental factors on the community composition of AOA and AOB (6). These studies have made clear that the sheer diversity of the AOA (which likely exceeds that of the AOB) allows for the presence of AOA in many different environments (72). In order to address whether AOA or AOB are the predominant ammonia-oxidizer, each environment of interest must be studied using a combination of molecular techniques and cultivation based techniques to characterize the competition between AOA and AOB in a particular environment. Environments that are high in ammonia, such as agricultural soils and wastewater treatment plants, are often dominated by AOB, while AOA are present in low numbers or not at all. In contrast, AOA are found in significantly higher abundance than AOB in environments with extremely low ammonium concentration, such as the open ocean and undisturbed soils. This division in habitat based on ammonium concentration is supported by laboratory kinetics experiments; the Km for ammonia of AOA is significantly lower than any characterized AOB and would allow for successful growth in much more oligotrophic conditions (8). In addition to ammonia, oxygen concentrations have been implicated in the niche separation of AOA and AOB. AOA have been detected at high abundance in marine oxygen minimum zones, and often significantly outnumber the AOB in these areas of the water column (127, 128). It is very likely that both oxygen and ammonium concentrations contribute to the niche separation of the AOA and AOB within the water column, however further physiological experiments are required to determine the extent to which these two variables interplay in this competition. A few differences have been noted between AOA and AOB regarding the mechanisms by which each group might access ammonia in the environment. Mesocosm and field experiments have indicated that AOB respond more strongly to additions of inorganic ammonia ((NH4)2SO4 or NH4HCO3) or urea (129, 130). In contrast, populations of AOA do not increase or change

23 with additions of inorganic ammonia, but increase with addition of organic sources of ammonia, indicating that the AOA preferentially utilize ammonia generated from mineralization (131). However, these experiments have only been performed with soil plots or mesocosms, and the influence of differing ammonia sources has not been tested for marine or freshwater environments, where the community composition of AOA and AOB is likely to differ. In addition to ammonia source, AOA and AOB also may differ in the acquisition and transport of ammonia into the cell. Many species of AOA and AOB possess genes encoding proteins with putative ammonia transporter functions. Little laboratory study has been performed to investigate the role that these transporters may play in accessing ammonia in the environment, however transcripts for the AOA ammonia transporters and permeases are found in high abundance in the environment, at levels approximately equivalent to those for amoA (132). High levels of transporter transcription may indicate that the AOA require active transport of ammonia into the cell for energy generation, and could aid in ammonia uptake in nutrient limited environments. In contrast, there are no published reports investigating transcription of AOB ammonia transporters in the environment, and some AOB such as N. eutropha lack genes encoding these transporters altogether. The Rh/Amt-like transporter in N. europaea has an unknown substrate, which could be ammonia or carbon dioxide, however mutants showed no growth phenotype in a range of laboratory culture conditions, suggesting that the transporter may be unnecessary for ammonia oxidation (35). Structural models using similar proteins characterized in methane oxidizing bacteria suggest that the transporter spans the periplasm to deliver ammonia to the cytoplasm (133); the active site of Amo is predicted to be in the periplasm, therefore the transporter may function only in assimilation (35). Further work will be required to determine how both the AOA and AOB acquire ammonia for energy in the environment, and whether any differences in this process may influence their competitive abilities.

Laboratory growth comparisons Laboratory cultivation of the AOA was prevented for many years due to the nature of cultivation practices used for studying the AOB. While basic microbiology practices are required to culture both groups, adjustments had to be made to the growth medium, especially ammonium concentration, in order to successfully grow AOA in the lab environment (54). For

24 many years, AOB had typically been cultivated at high ammonium concentrations (10-100 mM) that well exceeded environmentally relevant concentrations, but were required to produce sufficient biomass for biochemical and genetic studies (27, 134). The concentrations used, typically 50 mM and higher for N. europaea, are significantly higher than concentrations that have since been found to inhibit the growth of all cultured AOA (72). Growth of all characterized AOA thus far indicates that most species are inhibited or suppressed at ammonium concentrations as low as 5 mM, with growth of N. koreensis possible at up to 20 mM (72, 119). In contrast, some species of AOB can tolerate 250-600 mM ammonium before growth is inhibited (42). Growth experiments with N. maritimus and N. viennensis revealed that these AOA must be grown with 1 mM or less ammonium to achieve growth rates that are conducive to laboratory study (8, 80). Growth of AOA using current laboratory cultivation methods is also significantly slower than that of known AOB. Maximal growth rates of 0.2 - 0.8/day have been reported for cultivated AOA (53, 80, 81, 107, 117, 136). In comparison, maximum growth rates of a variety of AOB species have been measured and range from 0.72 – 1.2/day (Sedlacek and Bollmann, unpubl). These comparatively slow growth rates of the AOA are likely due to a number of differences in cellular physiology from the AOB. N. maritimus has a Km for ammonia of 3 nM, which is one of the highest substrate affinities recorded for any living organism (8). This observation was one of the first to indicate that N. maritimus, and likely other AOA, are adapted to life in conditions of extreme oligotrophy. Another notable difference is that of cellular division in N. maritimus; cells exist mostly in pre-replicative stage before replicating their genome and dividing. As a result, most cells in a population only have one copy of their genome, and shortly after genome replication will divide into two cells. Genome replication of N. maritimus requires 15-18h, and only occurs when ammonia is present (137). This growth strategy is hypothesized to conserve energy that might otherwise be wasted on division, and is considered to be an adaptation to life in oligotrophic environments (137). Further physiological and biochemical characterization of the growth and cellular processes of N. maritimus and other AOA in both artificial medium and natural conditions will be required to determine why the AOA grow so poorly in the laboratory setting. Based solely on comparisons of laboratory growth, it would appear that AOB are more efficient at the process of ammonia oxidation than AOA, and would thus be able to outcompete

25 AOA at ideal laboratory conditions. However, AOA are found in the environment, often at high abundance (even factoring in differences in per cell ammonia oxidation rates) (72, 113). It is impossible to determine the outcome of competition between AOA and AOB without directly measuring growth in the environment, or more precisely replicating environmental conditions in the laboratory. To date, only molecular microbial ecology and inhibitor studies have been used to address this question, with the outcome varying by habitat and specific species present.

Niche differentiation Since the discovery and isolation of the AOA in 2005, the field of nitrification has been intensely investigating the factors that may influence niche differentiation between the AOA and AOB. Laboratory studies of metabolism and physiology indicate that these two diverse groups of organisms are dependent upon, and therefore would compete for, ammonia as the singular source of energy in the environment. At the same time, molecular ecological surveys have found that AOA and AOB are often found in the same environment. This coexistence is in contrast to the niche perspective, which postulates that when two organisms compete for the same niche, one will drive the other out of the habitat (138). It is possible that, rather than always coexisting within an environment, molecular surveys are simply detecting co-occurrence, when two species are currently occupying the same habitat, but the relationship is not permanent (138). The co- occurrence hypothesis is unlikely due to the ubiquitous nature of both the AOA and AOB; it is more plausible that AOA and AOB do not occupy exactly the same niche in the environment, and their niches can be differentiated based on differences in their physiology. Niche differentiation arises due to differences between species in their metabolic requirements and interactions with the biotic and abiotic environment. Niche differentiating factors may include nutrient requirements, nutrient acquisition features, and/or abiotic habitat features (138). Previous work has indicated that ammonium and oxygen concentrations play a role in ammonia oxidizer niche differentiation, however the precise model by which this niche separation occurs is not clear (8). An alternative to the niche perspective to explain the often-observed coexistence of AOA and AOB is the neutral perspective, which postulates that AOA and AOB can persist together in an environment because they differ in how they respond to environmental change (1). The neutral perspective requires that species have differences in ecologically relevant characteristics

26 that influence how they respond to changes in environmental conditions. These tradeoffs in response to different parameters ultimately allow for the coexistence of similar species that seemingly compete directly in an environment (1). AOB represent a dichotomy between these two theories. While it is clear that some AOB have differentiated niches based on factors such as ammonium concentration, salinity, and temperature, there are many closely related species or strains within a species that coexist in an environment (27). Due to differences in substrate affinity, N. europaea and N. oligotropha are rarely found to be coexisting within an environment (27). However, species within the N. oligotropha cluster are often found together in low ammonium environments (27). Therefore, niche perspective may apply to more distantly related AOB, which have more distinct characteristics, while neutral perspective may explain the coexistence of more closely related AOB in many environments. The application of these perspectives is less clear for the co- occurrence of AOA and AOB. These two groups of organisms are clearly very distantly related, however the energy-generating metabolism of both groups is quite similar. Further investigation into the ecologically relevant characteristics of AOA and AOB that are found to co-occur, and how these two groups respond to changes in environmental conditions, are required to elucidate the mechanisms allowing this observed co-occurrence.

Project Goals The goals of this project were to cultivate novel ammonia-oxidizing archaea and bacteria to further investigate their growth behavior and to elucidate factors that influence niche differentiation between these two diverse groups. AOA and AOB were enriched from freshwater lake sediments and identified using 16S rRNA and amoA gene nucleotide sequences. Three AOA enrichments from Ohio and one AOB enrichment from The Netherlands were characterized using laboratory growth experiments in mineral salts medium. Abiotic factors including ammonium concentration, oxygen concentration, pH, and light exposure were manipulated to investigate AOA and AOB growth response. The starvation tolerance and recovery of AOA and AOB was tested to determine the capacity of these organisms to withstand ammonia starvation, which is likely to occur regularly in the environment. Chemostat competition experiments were conducted under ammonium-limited conditions with high and low oxygen to observe consequences of direct competition between AOA and AOB. I hypothesize

27 that one or more environmental variables will distinguish between the growth success of AOA and AOB enriched from freshwater environments. Based on the ubiquitous distribution of these organisms, it is highly likely that a change in conditions in one environment will allow either AOA or AOB to be the predominant ammonia oxidizer. Therefore, I hypothesize that temporal or spatial heterogeneity in environmental factors will allow for niche separation of the AOA and AOB in freshwater environments.

28 CHAPTER 1

Influence of Ammonium Concentration on the Enrichment of Ammonia-oxidizing Bacteria from Freshwater Sediments in Ohio

French, E., J.A. Kozlowski, A. Ohl, and A. Bollmann

In preparation for submission

29 Abstract

Ammonia-oxidizing bacteria (AOB) are one of two groups of microorganisms responsible for the first (and rate-limiting) step of nitrification, ammonia-oxidation, in freshwater environments. The model organism of the AOB, Nitrosomonas europaea, has been well studied for many years, but is not prevalent in most environments. Therefore, there is a need for cultivation of environmentally relevant AOB from freshwater environments to investigate the physiology of these critical nitrifiers. In this study, AOB were enriched from freshwater sediments from a range of trophic states at ammonium concentrations of 0.25mM and 2mM, which is much lower than conventional enrichment conditions for ammonia-oxidizing bacteria. The resulting enrichment cultures contained AOB commonly detected in freshwater environments, and were very similar to the majority of AOB sequences detected in the original

+ sediment samples using molecular methods. The use of low, environmentally relevant, NH4 concentrations improved the success of the enrichment as shown by the high number of closely related sequences found in both the original sediment samples and enrichment cultures. The distribution of the sequences in the original samples and enrichment cultures can be explained by the watershed land use and mineral nitrogen concentrations in the sediment.

30 Introduction Nitrification, the two-step oxidation of ammonium to nitrate via nitrite, is a key process in the global nitrogen cycle and an important step in the aquatic nitrogen cycle. The first step of this reaction is carried out by ammonia-oxidizing bacteria (AOB), and the recently discovered ammonia-oxidizing archaea (AOA) (11, 51-53, 139). AOB were first grown in laboratory culture at the end of the 19th century and have been studied in detail throughout the second half of the 20th century. Due to difficulties in cultivating AOB, few new species could be grown in laboratory culture for nearly half a century after the initial cultivation work. Most research on AOB, therefore, has been focused on the first AOB isolated, Nitrosomonas europaea. This

+ species is an AOB adapted to high NH4 concentrations not seen in most environments such as soils, freshwater and marine waters and sediments (11, 35, 124, 140-143) among many others. Additional cultivation techniques used to successfully isolate more than 16 AOB species involved the most probable number (MPN) method, which allows for the cultivation of only the most numerically dominant AOB in an environment (27). This practice, combined with the use of ammonium concentrations of 10-100 mM in enrichment and isolation media (39, 134), has likely prevented the cultivation of more rare, oligotrophic AOB from many environments. Recently, chemostats were used to enrich AOB at lower, more environmentally relevant

+ NH4 concentrations (120, 121). The enrichments produced AOB that belong to the Nitrosomonas oligotropha cluster, a group of AOB often found in freshwater environments and

+ adapted to low NH4 concentrations (7, 120, 121, 144). Those AOB were previously uncultivated, in large part due to the sensitivities of these isolates to ammonium concentrations that are considered standard for cultivation of N. europaea. Further studies may reveal whether these new species have physiological adaptations to low ammonium environments, or other differences to the well-studied model, N. europaea. Freshwater lakes in Ohio differ in their trophic state from hyper -eutrophic to meso/oligotrophic (23). Most of the more eutrophic lakes are in the western half of the state where agricultural practices are prevalent, resulting in increased nutrient input into the watershed from fertilizers. In the southeastern part of the state, many lakes have a forested watershed with far less anthropogenic inputs, and are more oligotrophic (23). Here, we present a study using an enrichment approach to investigate the diversity of cultivable AOB from a range of freshwater lake sediments with different trophic states. The

31 AOB were enriched in a mineral salt medium with two low, environmentally relevant ammonium concentrations. The diversity of the original sediment samples and resulting enrichment cultures were analyzed with molecular techniques to assess the success and effect of cultivation at lower ammonium concentrations. Additionally, we used sequences from the sediment samples and the resulting enrichment cultures to determine environmental factors that drive the diversity of the freshwater AOB.

32 Materials and Methods Sediment sampling We used sediment from six different lakes spanning the complete range of trophic states of lakes in Ohio: Acton (AC), Burr Oak (BO), Caesar’s Creek (CC), Delaware (DW), Piedmont (PL), and Pleasant Hill (PH) (23). Samples were taken in October 2007 from oxic near-shore

+ - - sediments. NH4 , NO2 , and NO3 concentrations in the sediments were determined in KCl extracts. The sediment samples were mixed with 1M KCl in a 1:10 ratio, shaken for 1 hour at 200 rpm, and centrifuged at 3500 x g for 10 min. All three N compounds were measured in the supernatants using colorimetric methods (118, 145-147). Dry weight was determined by drying the sediment for 24h at 110 ºC.

Enrichment of AOB Enrichment experiments were conducted in triplicate in mineral salt medium containing

+ 0.25 mM and 2 mM NH4 (118). Erlenmeyer flasks with 50 ml mineral salt medium were inoculated with 1 g (wet weight) sediment and incubated in the dark at 27 ºC without shaking.

+ Samples were taken on a weekly basis to determine the NH4 concentration and pH. When at + least 80% of the initial NH4 concentration had been consumed, the culture was supplemented + + with fresh NH4 to reach the initial NH4 concentration, and the pH was readjusted to 7.8. The + + NH4 concentrations were readjusted in the 0.25 mM NH4 cultures until the cultures had + + + consumed a total of 2 mM NH4 , and in the 2 mM NH4 cultures until a total of 6 mM NH4 had + been consumed. After complete consumption of the NH4 , the cultures (10-20 ml) were filtered on 0.2 µm nitrocellulose filters and stored at -80 ºC for further molecular analysis.

Molecular analysis DNA from the sediment samples was isolated using the PowerSoil DNA isolation kit according to the manufacturer’s recommendations (MoBio, Carlsbad, CA, USA) and from the filters using a combination of bead beating and phenol/chloroform/isoamyl alcohol extraction (121). GoTaq Green Master Mix (Promega, Madison, WI, USA) was used for all standard PCR according to the manufacturer’s recommendations using the primers and protocols summarized in Table 1. The extracted DNA was amplified using a nested PCR approach; the first PCR was conducted with AOB specific 16S rRNA primers and the second PCR with bacterial 16S rRNA

33 primers with a GC clamp for DGGE analysis (Table 1). The resulting PCR products were separated on denaturing gradient gel electrophoresis (DGGE) (148, 149). Based on the DGGE patterns, clone libraries from selected samples that were representative of all bands from a specific lake were constructed with the PCR products obtained with the AOB specific 16S rRNA primers using the pGEM-T easy vector system (Promega, Madison, WI, USA) and TOP10 competent Escherichia coli cells (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s recommendations. Approximately 18 - 36 clones per clone library were screened by colony PCR and subsequently analyzed by DGGE. Representative clones were chosen from each sample for sequencing. The chosen clones were amplified with M13 primers (Table 1), the PCR products were cleaned using the QIAquick PCR purification kit (Qiagen, Valencia, CA) and sequenced using the BigDye Terminator V3.1 cycle sequencing kit (Life Technology Corporation, Carlsbad, CA) on an Applied Biosystems 3730x1 DNA analyzer (Life Technology Corporation, Carlsbad, CA) at the Center for Bioinformatics and Functional Genomics at Miami University.

Sequence analysis and statistics All sequences were edited with 4Peaks (A. Griekspoor and T. Groothuis, The Netherlands Cancer Institute), aligned using the program ARB (150) and used to determine the identity between the sequences in the sediment and enrichment cultures and previously cultivated AOB. The software package CANOCO (151) was used for Principal Component Analysis (PCA) and Canonical Correspondence Analysis (CCA). All sequences were deposited in Genbank under the accession numbers: JX844518-JX844590.

34 Table 1. Primers and PCR conditions used in this study.

Primer Anneal. temp # cycles

CTO 189F-A: 5’-GGA GAA AAG CAG GGG ATC G-3’ CTO 189F-B: 5’-GGA GGA AAG CAG GGG ATC G-3’ AOB-16S rRNA (152) CTO 189F-C: 57.5 ºC 35 5’-GGA GGA AAG TAG GGG ATC G-3’ CTO 654R: 5’-CTA GCY TTG TAG TTT CAA ACG C- 3’ touch down: 357F: 5’-CCT ACG GGA GGC AGC AG-3’ Bacterial 16S rRNA 65 ºC to 55 ºC with GC clamp 15 (148) and add. 518R: 5’-ATT ACC GGG GCT GCT GG-3’ cycles at 55 ºC M13-F: 5’-GTA AAA CGA CGG CCA G-3’ M13-cloning M13-R: 5’-CAG GAA ACA GCT ATG AC- 50 ºC 30 3’

35 Results

+ NH4 was detected in all sediment samples and was highest in Acton and Caesars Creek, which are both eutrophic lakes, and lowest in Delaware, which is also a eutrophic lake (Table 2).

+ The NH4 concentrations in the sediments ranged from 0.6 – 12.6 µg N/g dw, which corresponds + - to 0.16 – 2.4 mM NH4 in the sediment pore water. NO2 was not detected in any of the samples - (results not shown), and NO3 was at approximately the same concentration in all six sediment samples (Table 2). In the enrichment cultures, a total of 70 operational taxonomic units (OTUs) were detected (97% identity), of which 36 were also found in the original sediment samples. No sequences could be amplified from the sediment sample from Caesar’s Creek, which was primarily due to the rocky nature of this sample. Only five sequences that were found in the original samples were not detected in the enrichment cultures. Phylogenetic analysis showed that most AOB in the enrichment cultures and the original samples belonged to Nitrosomonas cluster 6a, Nitrosomonas cluster 8, and the Nitrosospira cluster (Table 3). Nitrosomonas cluster 6a and members of the Nitrosospira cluster were detected in all samples. Nitrosomonas cluster 8 was only found in two samples from eutrophic lakes. Sequences in the Nitrosomonas sp. Nm143 lineage were only present in samples from an oligotrophic environment. Nitrosomonas aestuarii, a member of Nitrosomonas cluster 6b, was only detected in Piedmont. Principal Component Analysis (PCA) was used to determine the effect of enrichment conditions on the community composition (Figure 4). Most enrichment cultures clustered together with the original samples, indicating that the community composition of the AOB did not change considerably during the enrichment experiments. The different ammonium concentrations used during enrichment also did not have a significant effect on the resulting community composition enriched. The community composition of enrichments and sediment samples from the four eutrophic lakes (Acton, Caesar’s Creek, Delaware, and Pleasant Hill) were more similar to each other than to those communities from Burr Oak and Piedmont. The AOB communities detected in sediment samples and enrichment cultures from Burr Oak and Piedmont were also not similar to each other. Canonical correspondence analysis (CCA) was used to investigate the environmental factors driving the community composition in the lakes based on sequences amplified from the original samples and those present in enrichment cultures. The proportion of watershed land that

36 Table 2. Characteristics of the lakes/sediments.

Primary Nitrogen content Chl A1) Watershed land use 1) production 1) of sediment [µg/l] [mgC m-2 d-1] [µg/g dw]

+ - Agriculture Forest NH4 NO3

Acton (AC) 88.8 9.3 800-1400 40-75 7.1±0.3 1.2±0.1

Burr Oak (BO) 13.6 80.9 100-250 10-15 1.6±0.2 0.8±0.0

Caesar Creek (CC) 84.3 12.5 500 10 12.6±0.8 1.4±0.1

Delaware (DW) 84.2 13.5 600-800 25-40 0.6±0.3 1.4±0.0

Pleasant Hill (PH) 50.8 44.8 600-800 25-40 3.4±0.4 1.2±0.0

Piedmont (PL) 36.7 56.2 400 10 1.6±0.8 1.1±0.0 1Data from Knoll et al 2003 (23)

37 Table 3. Closest cultured relatives of the enriched AOB. The 16S rRNA sequences were clustered based on 97% identity after

+ + alignment in ARB (S: sediment; E1: enrichment at 0.25 mM NH4 ; E2: enrichment at 2 mM NH4 ; AC, Acton; BO, Burr Oak; CC, Caesar’s Creak; DW, Delaware; PL, Piedmont; PH, Pleasant Hill) Closest cultured relative Identity AC BO CC DW PH PL

[%] S E1 E2 S E1 E2 E1 E2 S E1 E2 S E1 E2 S E1 E2

Nitrosomonas sp. JL21 96.7-97.9 + + + + + + + + + + + +

Nitrosomonas sp. JL21 94.6-95.3 + +

Nitrosomonas sp. Nm84 98.1-99.8 + + + + + + + + + + + + +

Nitrosomonas sp. Nm59 97.6 + +

Nitrosomonas sp. Is79 98.3-99.8 + + + + + + + +

Nitrosomonas sp. Is79 98.4-98.8 + + + +

Nitrosomonas sp. Nm86 97.6 + + +

Nitrosomonas sp. Nm86 97.5-98.8 + + + +

Nitrosomonas sp. Nm86 95.9 + +

Nitrosomonas ureae 97.2 + +

Nitrosomonas oligotropha 97.4-99.1 + + + + + + +

Nitrosomonas sp. Is32 97.2 + +

Nitrosomonas sp. Is32 96.9-97.4 + + + +

Nitrosomonas aestuarii 98.6 + +

38 Nitrosomonas sp. Nm143 95.5 + +

Nitrosomonas communis 93.6 + +

Nitrosospira sp.Nv6 98.6-99.1 + + + + + +

Nitrosovibrio tenuis 99.1 + +

Nitrosospira multiformis 99.8 + +

Nitrosospira sp. Nsp1 98.8-99.1 + + + + +

Nitrosospira sp. En284 97.4-97.8 + +

Nitrosospira sp. Nsp5 98.5-99.8 + + + + + +

39

Figure 4. Principal Component Analysis (PCA) of the community composition in the enrichment cultures and the original sediment samples ( AOB species and  samples; abbreviations: Nsm6a: Nitrosomonas cluster 6a; Nsm6b: Nitrosomonas cluster 6b; Nsm8: Nitrosomonas cluster 8; Nsm143: Nitrosomonas sp. 143; Nsp: Nitrosospira cluster); AC, Acton; BO, Burr Oak; CC, Caesar’s Creak; DW, Delaware; PL, Piedmont; PH, Pleasant Hill; E1,

+ + enrichment at 0.25 mM NH4 ; E2, enrichment at 2 mM NH4 ; S, original sediment sample.

40

41 + - was used for agricultural practices and sediment NH4 and NO3 concentrations were the primary drivers of the community composition of the AOB from Acton, Caesar’s Creek, Delaware, and Pleasant Hill (Figure 5). These lakes are considered to be eutrophic environments with 50% to 80% agricultural watershed land use. The AOB communities in the sediments of Burr Oak and Piedmont clustered apart from the other lakes (Figure 5). The influence of the forest watershed land use is somewhat similar for both Burr Oak and Piedmont, which are considered to be

+ - meso/oligotrophic, however watershed land use, and sediment NH4 and NO3 concentrations were not strong drivers of AOB community diversity in these lakes.

42

Figure 5. Canonical Correspondence Analysis (CCA) of the relationship between the distribution of the AOB species (Δ), the sediment samples () and the environmental factors (→). Sequences from the original sediment sample and the enrichment cultures were summarized into one sample from the particular sampling location. (Abbreviations: Nsm6a: Nitrosomonas cluster 6a; Nsm6b: Nitrosomonas cluster 6b; Nsm8: Nitrosomonas cluster 8; Nsm143: Nitrosomonas sp. 143; Nsp: Nitrosospira cluster).

43

44 Discussion In this study, a large diversity of oligotrophic AOB were enriched from freshwater lake sediments in Ohio using enrichment medium with ammonium concentrations much lower than traditional enrichment methods (39, 134). Almost all sequences were closely related (>97% identity on 16S rRNA basis) to AOB previously detected in freshwater systems using molecular methods (4, 27, 29, 144, 153, 154). Several sequences were also highly similar to AOB enriched

+ in chemostats with low NH4 concentrations (120, 121), indicating that these organisms may have an adaptation to low substrate concentrations. These organisms are of interest for further study, as little is known about the physiological and genetic adaptation of AOB to low nutrient environments. The recovery rate (36 sequences in the enrichment cultures out of 41 in the original

+ sediment) is very high (87.8%), indicating that decreasing the NH4 concentration of the enrichment medium, such as in this study, is a feasible way to enrich a greater diversity of AOB, including dominant environmentally relevant strains from freshwater lakes. Substrate concentration has often been described as one of the most important factors in achieving successful enrichments and isolation of environmentally important microbes such as Acidobacteria, Verrucomicrobia (155-157), and AOB (120, 121). Only five sequences detected in the original sediment samples could not be detected in enrichment culture, indicating that those organisms are likely not able to grow under the enrichment conditions used. This is not surprising as generally only a small number of microorganisms (1%) are known to be culturable with currently used laboratory enrichment techniques (158, 159) Nitrosomonas cluster 6a and members of the Nitrosospira cluster were detected in all samples. The remainder of the sequences detected in enrichment and the original samples were well correlated with physiological characteristics of related isolates and environmental conditions. Nitrosomonas cluster 8, whose members are commonly detected in and isolated from eutrophic freshwater environments (27), was only found in two samples from Acton and Pleasant Hill, which are considered to be eutrophic (23). Sequences in the Nitrosomonas sp. Nm143 lineage, which has been isolated only 4 times from oligotrophic marine environments (27, 160), was present only in samples from Burr Oak, a meso/oligotrophic environment. Nitrosomonas aestuarii, a member of Nitrosomonas cluster 6b that is commonly detected in

45 more saline freshwater environments (27, 29), was only detected in Piedmont, which is one of the more saline of the freshwater reservoirs in Ohio (Beth Mette, personal communication). PCA revealed that the community composition of AOB was not significantly changed from that detected in the original sample during enrichment (Figure 4). These results indicate that the two different ammonium concentrations used in this study were not sufficient to result in different AOB communities in enrichment. This finding is somewhat surprising, as AOB substrate affinity tends to correlate with phylogeny (29). It was hypothesized that a ten-fold increase in ammonium concentration (from 0.25 to 2.0 mM) would be a sufficient contrast to yield different AOB communities, but this result was not observed. Perhaps if an even higher ammonium concentration were used, such as a more traditional 10-100 mM, the ammonium concentration would have had an effect on the community composition. However, it is highly likely that enrichment cultures generated in such a high ammonium concentration would not have yielded environmentally relevant species, which is contradictory to the focus of this investigation. Taken together, the high recovery rate of environmentally relevant species and the

+ PCA indicate that the lower, environmentally more relevant, NH4 concentrations (0.25mM and + 2mM NH4 ) used improved the enrichment conditions and consequently increased the likelihood of enriching AOB that reflect the environment’s community composition. CCA was used to investigate the primary environmental drivers of AOB community composition in the lakes of interest. These results indicated that agricultural watershed land use as well as sediment ammonium and nitrate concentrations were significant factors influencing community composition of the AOB in Acton, Caesar’s Creek, Delaware, and Pleasant Hill. These factors were not significant drivers of AOB community composition in Burr Oak and Piedmont. Chlorophyll A concentration and primary productivity, which are factors that can be used as indicators of trophic state, also did not contribute to differences in diversity in the AOB communities in Burr Oak and Piedmont. It is highly likely that there are one or more other environmental factors that we did not measure that influence the AOB community diversity in these two lakes. Previous studies showed that trophic state of the source lake has a distinct influence on the community structure of the AOB; similar results have been observed in other environments such as soil (161-163). The community composition in other freshwater environments had a similar trend, with members of the Nitrosomonas oligotropha cluster and the

46 Nitrosospira cluster being present in all lakes and members of the Nitrosomonas communis cluster only present under eutrophic conditions (153, 154). Lake trophic state impacted the community structure of AOB in the original environments and the enrichment cultures. The use of environmentally relevant ammonium concentrations in enrichment cultures allowed for the cultivation of AOB that were commonly detected in freshwater environments with molecular methods. These AOB are likely to be adapted to lower ammonium concentrations than the model organism, N. europaea, and therefore may have considerable differences in physiology and activity. Further isolation and characterization of these species may provide insight into the adaptation of these AOB to oligotrophic, low nutrient conditions. Understanding the physiology of AOB active in nitrogen cycling in the environment is critical to our understanding of the global nitrogen cycle.

47 CHAPTER 2

Ecophysiological Characterization of Ammonia-oxidizing Archaea and Bacteria from Freshwater

French, E., J.A. Kozlowski, M. Mukherjee, G. Bullerjahn, and A. Bollmann

Applied and Environmental Microbiology. 2012. 78: 5773-5780

48 Abstract

Aerobic biological ammonia oxidation is carried out by two groups of microorganisms, ammonia-oxidizing bacteria (AOB), and the recently discovered ammonia-oxidizing archaea (AOA). Here we present a study using cultivation-based methods to investigate the differences in growth of three AOA cultures and one AOB culture enriched from freshwater environments. The enriched AOA belong to the Thaumarchaeal group I.1a; one enrichment culture has high identity to Candidatus Nitrosoarchaeum koreensis, and the other two represent a new genus of AOA. The AOB enrichment culture was also obtained from freshwater and had the highest identity to AOB from the Nitrosomonas oligotropha group (Nitrosomonas cluster 6a). We investigated the influence of ammonium, oxygen, pH, and light on the growth of AOA and AOB. The growth rate of the AOB increased with increasing ammonium concentrations, while the growth rates of the AOA decreased slightly. Increasing oxygen concentrations led to an increase in the growth rate of the AOB, while the growth rates of AOA were almost oxygen insensitive. Light exposure (white and blue wavelengths) inhibited the growth of AOA completely, and the AOA did not recover when transferred to the dark. The AOB were also inhibited by blue light, however, growth recovered immediately after transfer to the dark. Our results show that the tested AOB has a competitive advantage over the tested AOA under most investigated conditions. Further competition experiments will elucidate the niches of AOA and AOB in more detail.

49 Introduction

Nitrification, the microbial oxidation of ammonia to nitrate, is one of the key processes of the global nitrogen cycle. The first and rate-limiting step of nitrification is the oxidation of ammonia to nitrite. Until recently, aerobic ammonia oxidation was only attributed to a small subset of the Proteobacteria; most freshwater and terrestrial ammonia-oxidizing bacteria (AOB) belong to a distinct group in the Betaproteobacteria, while a few marine AOB species belong to the Gammaproteobacteria (27, 31, 47). The AOB have a chemolithoautotrophic metabolism, oxidizing ammonia to nitrite via the intermediate hydroxylamine, and fixing carbon from carbon dioxide via the Calvin cycle (11). Recently, genes encoding ammonia monooxygenase (amoA), the first enzyme in the process of ammonia oxidation, were discovered together with archaeal 16S rRNA genes in a metagenomic study (51) and a soil fosmid library (52). At the same time, Nitrosopumilus maritimus, the first archaeal ammonia oxidizer, was isolated into pure culture from a saltwater aquarium (53). Ammonia-oxidizing archaea (AOA) in pure and enrichment cultures have essentially the same metabolism as AOB; they oxidize ammonia stoichiometrically to nitrite and fix carbon from bicarbonate (8, 53, 80, 81, 107, 135). However, the genomes of N. maritimus and Candidatus Nitrosoarchaeum limnia revealed differences between AOA and AOB, such as the use of the 3-hydroxypropionate/4-hydroxybutyrate pathway for bicarbonate fixation, the absence of hydroxylamine oxidoreductase, and the presence of many copper-containing enzymes (69, 75). AOA and AOB often co-occur in the same environment, but the contributions of AOA and AOB to ammonia oxidation remain to be elucidated. Many previous studies have focused on the influence of environmental factors on niche differentiation between AOA and AOB using cultivation-independent molecular methods. From those studies it can be concluded that AOA are frequently found in environments with lower substrate (ammonia and oxygen) availability, and AOB in environments with higher substrate availability (83, 85, 91, 105, 129, 164) among others). However, most of these studies were conducted using methods that target the abundance and/or expression of archaeal and bacterial amoA genes. Unfortunately, it is not possible to draw direct conclusions about the activity of the AOA and AOB based on abundance and expression of the amoA gene, because amoA mRNA has been detected in AOB for weeks and 16S rRNA

50 (ribosomes) for up to a year after the onset of ammonia starvation (48, 50, 165). The response of AOA towards starvation and resuscitation has not yet been investigated. Additionally, it has been shown that not all amoA-encoding Thaumarchaeota are autotrophic ammonia oxidizers (73, 166). While studies focusing on the analysis of abundance and activity of microbes using molecular methods give very valuable insights, it is also necessary to investigate the response of microbes to environmental factors using cultivation based approaches, because these experiments will demonstrate changes in physiological activity more conclusively. Here we present a study that used a cultivation-dependent approach to investigate the responses of AOA and AOB to environmental factors. Three phylogenetically distinct AOA cultures were enriched from freshwater sediments in Ohio, USA and their growth was characterized under different conditions and compared with that of a freshwater AOB enrichment culture. Factors of interest include the ammonium concentration, pH, oxygen concentration, and light wavelength and intensity. These factors have strong effects on the physiology and niche differentiation of AOB (7, 167-169) and are therefore also very likely to influence the physiology and niche differentiation between AOA and AOB.

51 Materials and Methods

Sampling: Near shore sediment samples were taken from Lakes Acton (AC) (39°57’N, 84°74’W) and Delaware (DW) (40°39’N, 83°05’W) in Fall 2008. Additional sediment core samples were collected from Acton Lake in Summer 2009.

Medium: Mineral salts medium (MS medium) used to enrich and cultivate AOA and AOB -1 contained 10 mM NaCl, 1 mM KCl, 1 mM CaCl22H2O, 0.2 mM MgSO47H2O, and 1ml l trace elements solution (118, 124). HEPES buffer was added in a four-fold molar ratio to the + NH4 concentration, and the pH was adjusted to 7.5 before autoclaving. After autoclaving, sterile

KH2PO4 solution was added to obtain a final concentration of 0.4 mM (118, 124).

Enrichment of the AOA (AOA-AC2, AOA-AC5 and AOA-DW): Sediment samples (1 g) + were inoculated into 50 ml MS medium with 0.25 mM NH4 immediately upon arrival in the laboratory. The enrichments were incubated at 27°C in the dark. Ammonium concentrations were monitored weekly using a colorimetric assay (118, 145). When the cultures reached late + logarithmic phase (depletion of around 80% of the initial NH4 concentration) they were transferred to fresh medium using a 10% v/v inoculum. The cultures were passed through 0.45 µm filters for the first five to six transfers to exclude AOB (Annika Mosier, personal communication; (118). In addition to filtration, the enrichment cultures from DW were also treated with 100 µg ml-1 streptomycin to eliminate AOB. After several transfers, when the cultures depleted ammonium in regular intervals, 20 ml were collected on 0.1 µm nitrocellulose filters for molecular characterization. The filters were stored at -20°C.

AOB culture: We used the previously described AOB freshwater enrichment culture G5-7 (AOB-G5-7) to compare the growth of AOA to AOB (7, 121). The culture belongs to the Nitrosomonas oligotropha cluster and is adapted to low ammonium concentrations (7, 121). Members of this AOB cluster have been found in many freshwater environments around the world (4, 144, 153, 154, 170; French et al, unpubl).

Growth experiments: All growth experiments were conducted in MS medium with 0.5 mM + NH4 at pH 7.5 in 125 ml Erlenmeyer flasks with cotton stoppers unless otherwise noted. We

52 tested the influence of different factors (ammonium concentration, oxygen concentration, pH, and light) on the rate of nitrite or nitrate production of the three AOA enrichment cultures (AOA- AC2, AOA-AC5 and AOA-DW) and the AOB enrichment culture (AOB-G5-7). All cultures were inoculated with 10% v/v of a late log phase culture and incubated in the dark at 27°C. Samples (1 ml) were taken at regular intervals and centrifuged at 16,000 rpm for 20 min. The supernatant was stored at -20°C for further chemical analysis. To investigate the influence of + different ammonium concentrations, media with 15 µM - 5 mM NH4 were prepared with the corresponding HEPES concentrations. The influence of pH was investigated by adjusting the initial pH in the medium to values between 6 and 9. The influence of oxygen concentration was investigated by equilibrating the medium in serum bottles under anaerobic conditions overnight. After equilibration the bottles were sealed with rubber stoppers. Different calculated oxygen concentrations in the headspace were achieved by exchanging the corresponding volume of the headspace with sterile filtered air. The influence of light was investigated by incubating the cultures 18 cm above LED panels emitting 30 µmol photons m-2 s-1 at 5000 - 7000 K (white light), 623 ± 3 nm (red light), and 470 ± 5 nm (blue light); and 3 µmol photons m-2 s-1 at 470 ± 5 nm (blue light). The light intensity inside the glass bottles was 25 µmol photons m-2 s-1 (high light) and 2.5 µmol photons m-2 s-1 (low light conditions) as measured with a LI-250A light meter (LI-COR Biosciences, Lincoln, NE), indicating that the glass filtered approximately 15% of the light. To investigate the influence of light-to-dark and dark-to-light transitions on the growth of AOA and AOB, cultures were incubated in the dark until 50% of the ammonium was consumed and then transferred to the light. At the same time, cultures that were incubated in the light were transferred from the light to the dark. Controls were incubated for the complete cycle in the dark.

Evaluation of growth experiments: Nitrite and nitrate concentrations were determined in the supernatants using colorimetric assays (118, 147). Concentrations were log transformed and plotted against time (Figure 6). Growth rates were calculated from the linear increase (slope) of - - - - the log-transformed NO2 /NO3 concentrations over time, assuming that NO2 /NO3 production in - the cultures is correlated with the growth of AOA and AOB (53, 118, 171). The increase in NO2 - /NO3 production was linear for several days to one week and the correlation coefficients were always ≥ 0.97 but in most cases even ≥ 0.99.

53 Molecular analysis DNA isolation from the AOA enrichment cultures: DNA was isolated from the nitrocellulose filters using the Qiagen DNeasy Blood and Tissue Kit (Valencia, CA) with the following modifications. Acid-washed zirconium beads (1g) and 500 µl high salt buffer (1 M NaCl, 5 mM

MgCl22H2O, 10 mM Tris, pH 8) (172) were added to the nitrocellulose filters. The filters were homogenized using a bead beater (Biospec Products, Bartlesville, OK) at 4800 rpm for 30 s. This was repeated three times and the samples were stored in between cycles on ice for 10 min. After bead beating, 500 µl Qiagen Buffer AL and 50 µl proteinase K were added and the mixture was incubated at 56°C for 30 min. The reaction mixture was spun down at 8000 rpm for 1 min and transferred to spin columns supplied by the manufacturer. The spin columns were treated according to the manufacturer’s recommendations and the DNA was eluted with 100 µl elution buffer AE.

PCR: GoTaq Green Master Mix (Promega, Madison WI) was used for all standard PCR according to the manufacturer’s recommendations using the primers and protocols summarized in Table 4.

Cloning and sequencing: PCR products were cleaned using the Wizard SV Gel and PCR Product Clean up system (Promega, Madison, WI) and cloned into the pGEM-T easy vector system (Promega, Madison, WI). Transformants were screened for inserts using PCR with M13 primers and the PCR products were cleaned up and sequenced using the BigDye Terminator V3.1 cycle sequencing kit (Life Technology Corporation, Carlsbad, CA) on an Applied Biosystems 3730x1 DNA analyzer (Life Technology Corporation).

DNA sequence analysis: All sequences were edited with 4Peaks (A. Griekspoor and T. Groothuis, The Netherlands Cancer Institute). The sequences were aligned using ARB (150). Phylogenetic trees were constructed using the neighbor-joining algorithm in ARB, and parsimony and maximum likelihood methods using PHYLIP (173). Trees constructed with all three methods showed the same overall grouping, therefore only the tree constructed with neighbor-joining method has been presented. All sequences were deposited in Genbank under the numbers: JQ669389-JQ669394.

54 Fluorescence in-situ Hybridization (FISH): The CARD-FISH protocol (174, 175) was used with the following modifications: the hybridization temperature was 46°C, the first wash was performed at 48°C, followed by an amplification step at 46°C. All probes (Table 5) were labeled at their 5’ end with horseradish peroxidase and used at a final concentration of 50 ng µl-1. All filters were counterstained with DAPI for total cell counts. Direct microscopic counts by fluorescence microscopy (Zeiss Axiophot HB0100, Carl Zeiss Inc, North America) were performed at 1000X magnification.

55

- - - - Figure 6. NO2 /NO3 concentration and log (NO2 /NO3 concentration) in an enrichment culture over time. The growth rate of the culture is calculated as the linear increase of the log - - transformed the NO2 /NO3 concentration over time. The lag phase was determined as the time before the culture started to grow logarithmically.

56

lag phase log phase 1000 7

6 (NO log

M] 800

µ 5

2 - /NO 600 4 3 - concentration) 3 concentration [ - 400 3

/NO 2 - 2 200 NO 1

0 0 0 100 200 300 400 500

time [h]

57 Table 4. Primers and PCR conditions used in this study.

Primer Anneal. # cycles temp

AOA-amoA (83) Arch amoA F: 53 35 5’-STA ATG GTC TGG CTT AGA CG-3’ Arch amoA R: 5’-GCG GCC ATC CAT CTG TAT GT-3’ Archaeal 16S rRNA (55, Arch 109F: 46 30 176) 5’-ACK GCT CAG TAA CAC GT-3’ Arch 915R: 5’-YCC GGC GTT GAM TCC AAT T-3’ AOB-amoA (177) amoA-1F: 55 35 5’-GGG GTT TCT ACT GGT GGT-3’ amoA-2R KS: 5’-CCC CTC KGS AAA GCC TTC TTC-3’ AOB-16S rRNA (152) CTO 189F-A: 57.5 35 5’-GGA GAA AAG CAG GGG ATC G-3’ CTO 189F-B: 5’-GGA GGA AAG CAG GGG ATC G-3’ CTO 189F-C: 5’-GGA GGA AAG TAG GGG ATC G-3’ CTO 654R: 5’-CTA GCY TTG TAG TTT CAA ACG C-3’ M13-cloning M13-F: 5’-GTA AAA CGA CGG CCA G-3’ 50 30 M13-R: 5’-CAG GAA ACA GCT ATG AC-3’

58 Table 5. Oligonucleotide probes used for CARD-FISH

Probe Sequence (5’-3’) Reference

Eub338I (Bacteria) GCTGCCTCCCGTAGGAGT (178) Eub338II (Bacteria) GCAGCCACCCGTAGGTGT (179) Eub338III (Bacteria) GCTGCCACCCGTAGGTGT (179) Cren 554 (Crenarchaeota) TTAGGCCCAATAATCMTCCT (180) Ntspa712 (Nitrospira) CGCCTTCGCCACCGGCCTTCC (181) Competitor: CGCCTTCGCCACCGGTGTTCC

AOB NSO1225 CGCCATTGTATTACGTGTGA (182) AOB NSO156 TATTAGCACATCTTTCGAT (182)

59 Results Enrichment of AOA: AOA were enriched from the sediment of Lakes Acton (AOA-AC2 and AOA-AC5) and Delaware (AOA-DW) under autotrophic conditions with ammonium as the sole electron donor in the medium. Based on the AOA amoA sequences, all enrichment cultures belong to the water column/sediment group I.1a of the Thaumarchaeota (Figure 7). AOA-AC2 was 81-81.7% (amoA) and 92.8-93.1% (16S rRNA gene) identical to the other two enrichment cultures, while AOA-AC5 and AOA-DW were 87.1% (amoA) and 97.9% (16S rRNA gene) identical to each other. The amoA sequences of AOA-DW were 98.2-98.5% identical to clones from the sediment of Lakes Acton, Delaware and Pleasant Hill (Li and Bollmann, unpubl), 98.5% identical to clones from the freshwater sediment in the San Francisco Bay (51, 95), and 98.1% identical to clones from a drinking water distribution system in the Netherlands (52, 183). The amoA sequences of AOA-AC5 were 99% identical to a clone from a paddy soil in Japan (53, 184). The third enrichment culture AOA-AC2 is closely related to Ca. Nitrosoarchaeum koreensis (99.8% identity on amoA basis and 99.6% identity on 16S rDNA basis) and Ca. Nitrosoarchaeum limnia (94.3% identity on amoA basis and 98.5% identity on 16S rRNA gene basis) (8, 53, 75, 80, 81, 107, 115, 135). In contrast to AOA-AC2, AOA-AC5 and AOA-DW were not closely related to described AOA isolates or enrichment cultures, such as N. maritimus and Nitrososphaera viennensis, among others (70-82% identity on amoA basis and 81-93% identity on 16S rRNA gene basis) (Table 6). Fluorescent in situ hybridization (CARD-FISH) was used to determine the proportion of AOA in the enrichment cultures at the end of the logarithmic growth phase. AOA-DW contained 85% AOA, AOA-AC2 91% and AOA-AC5 81% (Table 7). AOB and NOB (nitrite-oxidizing bacteria) were not detected as tested by PCR amplification with AOB-specific 16S rRNA and amoA primers (Table 4) (results not shown) and FISH using AOB- and NOB-specific 16S rRNA probes (Table 7 and Table 5).

Influence of ammonium concentration on the growth rates of AOA and AOB. During stratification in the summer, the ammonium concentration in Lake Acton increases up to 400 µM (185), which falls within the tested range of ammonium concentrations of 15 µM

60

Figure 7. Neighbor-joining phylogenetic tree of the AOA enrichment cultures based on amoA gene sequences (595bp). Bootstrap values > 50 of 100 replicates are shown at the nodes.

61

54 Enrichment AOA-AC2 59 Candidatus Nitrosoarchaeum koreensis MY1 DQ278585 (wastewater) 61 EU651166 (freshwater sediment -SF bay) >99 HQ317041 (wastewater - oil refinery) 59 HQ317037 (wastewater - oil refinery) 92 EU651167 (freshwater sediment - SF bay) >99 Candidatus Nitrosoarchaeum limnia 98 Clone BO-D07 >99 Clone BO-22 water column/sediment EU650806 (estuarine sediment - SF bay) EU651121 (estuarine sediment - SF bay) 65 Enrichment marine sediment Arctic (FJ656552) >99 Enrichment marine sediment South Korea (FJ656572) 54 Nitrosopumilus maritimus 97 DQ148692 (Black sea) >99 Enrichment marine water CN150 (JF521547) 93 Enrichment marine water CN25 (JF521548) 76 Clone AC−30 96 Clone PH−30 Clone DW−41 EU852677 (drinking water distribution system) Enrichment AOA-DW 63 EU651017 (freshwater sediment - SF bay) 59 FJ543353 (groundwater) >99 Clone PH−46 >99 FJ543354 (groundwater) AB516244 (paddy soil) 73 Enrichment AOA-AC5 >99 EU553412 (hot spring) >99 EU553410 (hot spring) >99 Candidatus Nitrosotalea devanaterra DQ148879 (soil, non-contaminated) soil/sediment >99 DQ312267 (soil with high nitrogen) ] 67 FJ227868 (estuarine sediment) 98 EU651130 (estuarine sediment - SF bay) DQ501047 (estuarine sediment) >99 Candidatus Nitrososphaera gargensis Nitrososphaera viennensis ] EU239968 (hot spring - Yellowstone) Candidatus Nitrosocaldus yellowstonii

0.1

62 Table 6. Identities [%] of AOA in the enrichment cultures AOA-AC2, AOA-AC5, and AOA-DW in comparison with previously cultivated AOA.

AOA-AC2 AOA-AC5 AOA-DW

amoA 16S amoA 16S amoA 16S

Nitrosopumilus maritimus (53) 88.6 96.2 79.8 92.9 78.8 92.9

Nitrososphaera viennensis (80) 69.6 82.7 70.4 83.7 71.1 83.7

Ca. Nitrososphaera gargensis (81) 70.9 81.9 72.7 82.7 72.1 82.2

Ca. Nitrosocaldus yellowstonii (107) 71.1 80.4 71.1 81.8 70.0 81.0

Ca. Nitrosoarchaeum limnia (75) 94.3 98.4 81.9 92.6 81.5 92.9

Ca. Nitrosoarchaeum koreensis (115) 99.8 99.6 81.6 92.9 81.2 92.8

Ca. Nitrosotalea devanaterra (117) 77.9 88.5 76.7 89.7 76.1 89.3

Comparisons are based on 16S rRNA genes (794 bp; corresponding to 109 to 915 in Escherichia coli numbering) and amoA genes (595 bp).

63 Table 7. Quantitative analysis of the composition of the enrichment cultures AOA-AC2; AOA-AC5 and AOA-DW.

AOA-AC2 AOA-AC5 AOA-DW

Crenarchaeota 91.0 81.2 85.4

Bacteria 9.5 3.3 9.2

Nitrospira (NOB) ND* ND ND

AOB ND ND ND

The cell numbers were determined using CARD-FISH [% of DAPI counts] (n=1). Samples were taken at the end of the logarithmic phase. *ND: not detected.

64 + + and 5 mM NH4 . Increasing ammonium concentrations up to 1 mM NH4 doubled the growth rate of AOB-G5-7, while the growth rates of the AOA enrichment cultures decreased or remained constant (Figure 8). The growth rate of AOA-DW at the lowest ammonium concentration (15 µM) was significantly higher than the growth rate at higher ammonium concentrations (Table 8). The same tendency was observed for the other two cultures, although the statistical support was less strong (Figure 8; Table 8). The AOA enrichment cultures exhibited different tolerances to high ammonium concentrations; AOA-DW grew at ammonium concentrations up to 1 mM, AOA-AC5 up to 2 mM and AOA-AC2 up to 5 mM (Figure 8). The lag phase of AOA and AOB differed; AOB-G5-7 became active 1-3 days after inoculation at all tested ammonium concentrations, whereas the lag phase of the AOA cultures increased with increasing initial ammonium concentrations up to more than two weeks before logarithmic + growth could be detected at ammonium concentrations between 1 mM and 5 mM NH4 (Figure 9; Table 9).

Influence of oxygen concentration on the growth of AOA and AOB: Lake Acton stratifies during the summer and has an anaerobic zone as well as a zone with low oxygen availability (1 -1 mg l O2) (185). We therefore investigated the response of our enrichment cultures to 0.5-2% O2

(calculated) in the headspace, as well as a 21% O2 (calculated) control, which corresponded to -1 -1 0.2-0.8 mg l O2 in the medium (8 mg l O2 control). The growth rate of AOB-G5-7 decreased with decreasing oxygen concentration and the growth rates at all different oxygen concentrations were significantly different from each other (Figure 10; Table 10). The AOA enrichment cultures grew at all oxygen concentrations in the headspace, with the exception of AOA-AC2 at 0.5% O2. The decrease of the growth rates with decreasing oxygen concentration in the AOA cultures was less severe than the decrease of the growth rates in AOB-G5-7. However, the growth rates at low oxygen concentrations in AOA-AC2 and AOA-AC5 were significantly lower than the growth rates at 21% O2 (Figure 10; Table 10).

Influence of pH on the growth of AOA and AOB: We investigated the growth of all cultures at pH 6-9, the range at which non-acidophilic ammonia oxidizers grow (7, 27, 29, 47, 121). The growth rates of all cultures showed bell-shaped curves in relation to the pH, with maximum growth rates at pH 7-7.5 (Figure 11). AOA-AC2 did not grow at pH 6, while the other AOA and AOB cultures did. The growth rates of AOA-AC5 and AOA-DW at pH 9 were similar to the

65

+ Figure 8. Influence of NH4 concentration on the growth rates of the enrichment cultures + AOA-AC2; AOA-AC5, AOA-DW, and AOB-G5-7 (mean ± SD; n=3). A: NH4 concentration + linear scale; B: NH4 concentration logarithmic scale

66

67 + -1 Table 8. Influence of the NH4 concentration on the growth rates [h ] of the enrichment culture AOA-AC2, AOA-AC5, AOA-DW and AOB-G5-7 (data are similar to data in Figure 8) (mean ± SD, n=3; different letters behind values indicate significant differences between values determined by one-way ANOVA followed by Tukey test; P < 0.05).

NH + 4 AOA-AC2 AOA-AC5 AOA-DW AOB-G5-7 [mM]

0.01 0.020 ± 0.002 a 0.023 ± 0.003 a

0.0158 0.023 ± 0.003 a 0.030 ± 0.002 a

0.05 0.019 ± 0.001 ab 0.021 ± 0.000 ab 0.017 ± 0.000 b 0.042 ± 0.000 b

0.1 0.017 ± 0.000 ab 0.020 ± 0.001 bcd

0.158 0.017 ± 0.000 b 0.051 ± 0.004 bc

0.25 0.017 ± 0.001 ab 0.020 ± 0.001 abc

0.5 0.017 ± 0.002 ab 0.018 ± 0.001 bcd 0.016 ± 0.000 b 0.057 ±0.005 cd

1 0.017 ± 0.001 ab 0.020 ± 0.001 ab 0.016 ± 0.000 b 0.059 ± 0.003 cd

2 0.015 ± 0.002 b 0.016 ± 0.001 cd 0.060 ± 0.005 cd

3 0.065 ± 0.004 d

5 0.016 ± 0.000 d 0.061 ± 0.003 d

68

+ Figure 9. Influence of NH4 concentration on the lag phase before onset of logarithmic growth in the enrichment cultures AOA-AC2; AOA-AC5, AOA-DW, and AOB-G5-7 (mean ± + + SD; n=3). A: NH4 concentration linear scale; B: NH4 concentration logarithmic scale.

69

70 + Table 9. Influence of NH4 concentration on the lag phase [h] before onset of logarithmic growth in the enrichment cultures AOA-AC2; AOA-AC5, AOA-DW, and AOB-G5-7 (data are similar to data in Figure 9; mean ± SD, n=3; different letters behind values indicate significant differences between values determined by one-way ANOVA followed by Tukey test; P < 0.05).

NH + 4 AOA-AC2 AOA-AC5 AOA-DW AOB-G5-7 [mM]

0.01 48.0 ± 0.0 a 48.0 ± 0.0 a

0.0158 43.0 ± 13.9 a 27.0 ± 0.0 a

0.05 48.0 ± 0.0 a 48.0 ± 0.0 a 75.5 ± 0.0 a 27.0 ± 0.0 a

0.1 64.0 ± 27.7 a 48.0 ± 0.0 a

0.158 51.0 ± 0.0 b 27.0 ± 0.0 a

0.25 96.0 ± 0.0 a 96.0 ± 0.0 ab

0.5 256.5 ± 27.3 b 48.0 ± 0.0 a 99.0 ± 0.0 c 51.0 ± 0.0 b

1 256.5 ± 27.3 b 144.0 ± 0.0 bc 243.0 ± 0.0 d 35.0 ± 13.9 ab

2 288.0 ± 0.0 b 192.0 ± 0.0 c 43.0 ± 13.9 ab

3 75.5 ± 0.0 c

5 512.0 ± 27.7 d 75.5 ± 0.0 c

71

Figure 10. Influence of the calculated O2 concentration in the headspace of the bottle on the growth rate of the enrichment cultures AOA-AC2; AOA-AC5, AOA-DW, and AOB-G5-7 (mean ± SD; n=3)

72

73 Table 10. Influence of the calculated O2 concentrations in the headspace of the bottle on the growth rates [h-1] of the enrichment cultures AOA-AC2, AOA-AC5, AOA-DW, and AOB-G5-7 (data are similar to data in Figure 10; mean ± SD, n=3; different letters behind values indicate significant differences between values determined by one-way ANOVA followed by Tukey test; P < 0.05).

O2 [%] AC2 AC5 DW G5-7

0.5 0.000 ± 0.000 a 0.005 ± 0.000 a 0.014 ± 0.004 a 0.010 ± 0.000 a

1 0.008 ± 0.001 b 0.008 ± 0.000 b 0.016 ± 0.000 a 0.018 ± 0.001 b

2 0.011 ± 0.001 bc 0.009 ± 0.001 c 0.015 ± 0.001 a 0.031 ± 0.003 c

21 0.013 ± 0.001 c 0.008 ± 0.000 bc 0.019 ± 0.003 a 0.045 ± 0.002 d

74

Figure 11. Influence of the pH of the medium on the growth rates of the enrichment cultures AOA-AC2, AOA-AC5, AOA-DW, and AOB-G5-7 (mean ± SD; n=3)

75

76 Table 11. Influence of the pH value on the growth rates [h-1] of the enrichment cultures AOA-AC2, AOA-AC5, AOA-DW, and AOB-G5-7 (data are similar to data in Figure 11; mean ± SD, n=3; different letters behind values indicate significant differences between values determined by one-way ANOVA followed by Tukey test; P < 0.05).

pH AC2 AC5 DW G5-7

6 0.000 ± 0.000 a 0.010 ± 0.000 ab 0.017 ± 0.001 a 0.034 ± 0.003 a

6.5 0.011 ± 0.001 bc 0.011 ± 0.001 abc 0.018 ± 0.001 ad 0.046 ± 0.004 b

7 0.013 ± 0.000 d 0.013 ± 0.001 c 0.024 ± 0.000 b 0.049 ± 0.000 b

7.5 0.012 ± 0.000 cd 0.011 ± 0.001 abc 0.022 ± 0.001 bc 0.051 ± 0.004 b

8 0.010 ± 0.000 b 0.012 ± 0.000 bc 0.020 ± 0.002 cd 0.047 ± 0.005 b

8.5 0.005 ± 0.000 e 0.008 ± 0.000 a 0.020 ± 0.001 cd 0.025 ± 0.001 c

9 0.006 ± 0.000 e 0.010 ± 0.002 ab 0.020 ± 0.001 cd 0.018 ± 0.001 c

77 growth rates at pH 7.5, while the growth rates of AOA-AC2 and AOB-G5-7 differed significantly to their respective rates at pH 7.5 (Figure 11; Table 11).

Influence of light on the growth of AOA and AOB: The investigated intensities represent a range at which phytoplankton in freshwater systems are able to grow, but below light saturation (186). White light (30 µmol photons m-2 s-1) strongly inhibited the growth of AOA-DW, AOA- AC2, and AOA-AC5, but had no effect on AOB-G5-7 (Figure 12). The three AOA did not grow in white light and did not begin to grow after being transferred from the light to the dark. However, growth continued when the AOA cultures were transferred from the dark to the light. To get a better insight into which wavelength of light had the strongest influence on the growth of AOA and AOB, we conducted similar experiments with red (623±3 nm) and blue (470±5 nm) light. All cultures grew in the red light, but while the growth of AOB-G5-7 was not influenced by the red light, the growth rates of the three AOA were significantly lower in the red light and after transfer from the light to the dark (Figure 12; Tables 12-15). Blue light at 30 µmol photons m-2 s-1 had the strongest effect on the growth of both cultures (Figure 12). In constant blue light none of the cultures grew, and growth of the three AOA did not recover after transfer from the light to the dark. In contrast, AOB-G5-7 recovered immediately after transfer from the light to the dark, but the growth rate was significantly lower than the growth rate in the continuous dark (Table 12). Transfer of the cultures from the dark into blue light stopped growth immediately. All cultures grew in the less intense blue light (3 µmol photons m-2 s-1), but the growth rates of the AOA were significantly lower in the low blue light than in the dark (Figure 12; Tables 13- 15).

78

Figure 12. Influence of white, red, and blue light with the intensity of 30 µmol photons m-2 s- 1 and blue light with the intensity of 3 µmol photons m-2 s-1 on the growth rates of the enrichment cultures AOB-G5-7, AOA-DW, AOA-AC2, and AOA-AC5 (mean ± SD; n=3)

79

80 Table 12. Influence of white, red, and blue light with the intensity of 30 µmol photons m-2 s- 1 and blue light with the intensity of 3 µmol photons m-2 s-1 on the growth rates [h-1] of the enrichment cultures AOB-G5-7 (data are similar to data in Figure 12; mean ± SD, n=3; different letters behind values indicate significant differences between values determined by one-way ANOVA followed by Tukey test; P < 0.05).

blue G5-7 white red blue low intensity

light 0.056 ± 0.001 a 0.051 ± 0.005 a 0.000 ± 0.000 a 0.057 ± 0.004 a

light -> dark 0.056 ± 0.004 a 0.047 ± 0.002 a 0.051 ± 0.002 b 0.068 ± 0.004 b

dark -> light 0.058 ± 0.001 a 0.049 ± 0.002 a 0.064 ± 0.004 c 0.055 ± 0.002 a

dark 0.055 ± 0.001 a 0.045 ± 0.002 a 0.066 ± 0.004 c 0.063 ± 0.003 ab

81 Table 13. Influence of white, red, and blue light with the intensity of 30 µmol photons m-2 s- 1 and blue light with the intensity of 3 µmol photons m-2 s-1 on the growth rates [h-1] of the enrichment cultures AOA-DW (data are similar to data in Figure 12; mean ± SD, n=3; different letters behind values indicate significant differences between values determined by one-way ANOVA followed by Tukey test; P < 0.05).

blue white red blue low intensity

light 0.000 ± 0.000 a 0.012 ± 0.000 a 0.000 ± 0.000 a 0.011 ± 0.001 a

light -> dark 0.000 ± 0.000 a 0.012 ± 0.001 a 0.000 ± 0.000 a 0.013 ± 0.001 bc

dark -> light 0.018 ± 0.000 b 0.018 ± 0.001 b 0.018 ± 0.001 b 0.012 ± 0.001 ab

dark 0.017 ± 0.001 b 0.016 ± 0.000 c 0.020 ± 0.000 c 0.015 ± 0.001 c

82 Table 14. Influence of white, red, and blue light with the intensity of 30 µmol photons m-2 s- 1 and blue light with the intensity of 3 µmol photons m-2 s-1 on the growth rates [h-1] of the enrichment cultures AOA-AC2 (data are similar to data in Figure 12; mean ± SD, n=3; different letters behind values indicate significant differences between values determined by one-way ANOVA followed by Tukey test; P < 0.05).

blue white red blue low intensity

light 0.000 ± 0.000a 0.008 ± 0.002a 0.000 ± 0.000 a 0.006 ± 0.0007a

light -> dark 0.000 ± 0.000a 0.009 ± 0.0005a 0.000 ± 0.000 a 0.010 ± 0.0002b

dark -> light 0.012 ± 0.002b 0.015 ± 0.0002b 0.000 ± 0.000a 0.009 ± 0.0005a

dark 0.012± 0.0003b 0.015 ± 0.0003b 0.007 ± 0.003b 0.010 ± 0.0004b

83 Table 15. Influence of white, red, and blue light with the intensity of 30 µmol photons m-2 s- 1 and blue light with the intensity of 3 µmol photons m-2 s-1 on the growth rates [h-1] of the enrichment cultures AOA-AC5 (data are similar to data in Figure 12; mean ± SD, n=3; different letters behind values indicate significant differences between values determined by one-way ANOVA followed by Tukey test; P < 0.05).

blue white red blue low intensity

light 0.000 ± 0.000a 0.002 ± 0.0003a 0.000 ± 0.000 a 0.008 ± 0.0005a

light -> dark 0.000 ± 0.000a 0.003 ± 0.000a 0.000 ± 0.000 a 0.014 ± 0.0007a

dark -> light 0.005 ± 0.001b 0.007 ± 0.0007b 0.014 ± 0.001b 0.013 ± 0.0003b

dark 0.009± 0.002c 0.010 ± 0.002b 0.015 ± 0.001b 0.014 ± 0.0006b

84 Discussion Enrichment of AOA cultures AOA-DW, AOA-AC2, and AOA-AC5: We enriched and characterized the growth of three different freshwater AOA enrichment cultures belonging to the Thaumarchaeal group I.1a within the newly described phylum Thaumarchaeota (70, 71). One of the cultures, AOA-AC2, is closely related to Ca. Nitrosoarchaeum koreensis, while the other two strains, AOA-AC5 and AOA-DW, are only 70-82% (amoA) and 81-93% (16S rRNA gene) identical to other cultivated isolates and enrichment cultures such as N. maritimus and Nitrososphaera viennensis (Table 6). This finding indicates that these two enriched AOA belong to a new genus of the ammonia-oxidizing Thaumarchaeota, assuming that the identity between two genera is on average 96.4% identical based on the 16S rRNA gene (187). This new genus/group includes many ribotypes from non-salt water systems such as freshwater (95; Li and Bollmann, unpubl) and drinking water systems (183), as well as soil and hot spring environments (189), as indicated by highly identical clones (Figure 7).

Pure cultures: No pure cultures of the AOA enriched in this study have been obtained thus far. It is safe to assume that the heterotrophic satellite community is providing some compound that enabled the AOA to grow in enrichment culture. Similar observations have been made for other AOA as well as for AOB. Potential compounds that positively influence the growth of AOA could be small organic compounds such as pyruvate, which improved growth and enabled isolation of N. viennensis (80). However, the addition of pyruvate during serial dilution did not lead to isolation of any of these strains to date, indicating that different compounds might be important for different AOA. Further research will be necessary to elucidate the interactions between AOA (and AOB) and the heterotrophic satellite bacteria in ammonia oxidizing enrichment cultures.

Growth of AOA and AOB: Overall the growth experiments showed that the growth rates of the AOA were almost always lower than the growth rates of the AOB. All of our experiments have been conducted under chemolithoautotrophic conditions. These results indicate that AOB-G5-7 had an advantage over the three tested AOA strains under the conditions investigated. In nature, however, conditions are often less defined with respect to energy generating processes. It has been suggested that not all Thaumarchaeota are chemolithoautotrophic ammonia oxidizers; some

85 carry the amoA gene but do not actively oxidize ammonium, and others utilize mixotrophic or heterotrophic lifestyles in pure and enrichment cultures (73, 80, 190). Based on these observations and our data, one could speculate that AOA in natural samples utilize mixotrophic and/or heterotrophic, rather than a strictly autotrophic life style, which could explain their success in nature compared to the laboratory. Increasing ammonium concentrations have different influences on the growth rates and lag phases of AOA and AOB, with AOB growing faster and having shorter lag phases than AOA (Figure 8; Figure 9; Tables 8 and 10). After comparing these results with data provided by other + studies that determined the Km of AOA for NH3/NH4 to be approximately 1000 times lower than the Km of AOB (8, 115, 135) we suggest that AOB have an advantage over AOA at higher ammonium concentrations (> 10µM). This assumption is supported by the detection of high abundances of AOB environments with higher ammonium input due to fertilization and other processes, while AOA are more abundant in low ammonium and unfertilized environments (83, 99, 129, 166, 191). The enrichment cultures AOA-DW and AOA-AC5 showed lower tolerance to high ammonium concentrations than AOA-AC2; the highest concentrations that supported growth + + were 1 mM NH4 (AOA-DW) and 2 mM NH4 (AOA-AC5). These concentrations are lower than the highest tolerances towards ammonium observed for N. viennensis (15 mM), Ca. Nitrosoarchaeum koreensis (10 mM) and enrichment AOA-AC2 (5 mM), a strain closely related to Ca. Nitrosoarchaeum koreensis (80, 115). These results indicate that AOA-DW and AOA- AC5 are less tolerant to high ammonium concentrations when compared with other AOA isolates and enrichment cultures. Similar observations have been made for AOB; members of the Nitrosomonas oligotropha cluster, which are also commonly found in freshwater environments, are less tolerant to high ammonium concentrations and better adapted to low ammonium concentrations, while members of the Nitrosomonas europaea/eutropha cluster are found primarily in environments with high ammonium concentrations (7, 27, 29, 47, 121). AOA and AOB responded differently when cultured over a range of oxygen concentrations. AOA-AC5 and AOA-DW grew at all tested oxygen concentrations at the same rate, while AOA-AC2 did not grow at 0.5% O2, and the growth rate of AOB-G5-7 decreased with decreasing oxygen concentrations (Figure 10; Table 10). Environmental surveys in aquatic environments often detect AOA at the oxic-anoxic interface (83, 85, 91, 192), indicating an

86 adaptation to low oxygen conditions. The low Km for O2 found for N. maritimus as well as other AOA (8, 115, 135) and the environmental data support the hypothesis that AOA are very likely better adapted to low oxygen than AOB and may therefore have a competitive advantage at the oxic-anoxic interface, while AOB are active under more aerobic conditions. AOA and AOB grew at most of the tested pH values, with AOA growing at almost the same rate over a wide pH range and AOB showing a more bell-shaped curve with the highest growth rate at pH 7-7.5 (Figure 11; Table 11). AOA are found over a wide pH range in different environments such as soils and hot springs (99, 102, 107, 108, 188), but most cultivated AOA such as N. maritimus, N. viennensis, Ca. Nitrosoarchaeum koreensis and Ca. Nitrosotalea devanaterra have rather narrow pH ranges for growth and activity compared with the tested AOA enrichment cultures (53, 80, 110, 115). AOB-G5-7 was more tolerant to light than the three AOA enrichment cultures and also recovered faster after exposure, while the AOA did not fully recover from light exposure (Figure 12; Table 12-15). In the environment, maxima of Thaumarchaeal amoA and 16S rRNA copies have been detected in the water column below where photosynthetically active radiation (PAR) had dropped to zero, indicating that no light was penetrating to this depth (91, 192). In the same study, AOB and AOA were detected in low abundance in more shallow waters of the Pacific, indicating that AOB as well as some AOA strains could be more tolerant to light than those that are most abundant in the lower parts of the water column (192). The light response of AOA and AOB could be due to differences in the reaction of the copper-containing enzymes to light. AOB are very sensitive to blue near UV light (167, 193). The authors discussed that this inhibition could be attributed to the absorption of light by the oxygenated state of the copper- containing ammonia monooxygenase, which leads to inactivation of the enzyme (193). Genome studies of AOA showed a large number of copper containing enzymes such as multi-copper oxidases and blue copper proteins (69, 75), suggesting that some of the copper-containing enzymes in AOA could be sensitive to light as well, leading to inhibition of overall metabolism in AOA by light. During the preparation of this manuscript, Merbt et al. (2012) published a study investigating the response of two AOB (Nitrosomonas europaea and Nitrosospira multiformis) and two AOA (N. maritimus and Ca. Nitrosotalea devanaterra) to white light (194). The study confirmed our findings.

87 Conclusion The results of this study predict that AOB would be able to outcompete AOA under almost all tested conditions. These findings are in accordance with other cultivation-based studies, as well as observations made in the environment using molecular approaches. Further investigation must be done using other cultivation-based experiments such as continuous cultures, which enable us to cultivate AOA and AOB under more stringently controlled conditions, and in situ incubations which enable us to investigate the response of AOA and AOB to environmental changes in conditions which allow AOA and AOB to utilize metabolic functions as they would naturally in the environment.

88 Acknowledgements We thank Annika Mosier (UC Berkeley) for helpful discussions at the beginning of the project; Michael Vanni and Beth Mette (Department of Zoology, Miami University) for support with sampling; Lynn Johnson (Instrumentation Laboratory, Miami University) for construction of the light installations; Anne Bernhard (Connecticut College, New London) for providing her AOA amoA ARB alignment file, and Anne Morris Hooke (Department of Microbiology; Miami University) for critical reading of the manuscript. This work was supported by startup funds of Miami University and by the National Science Foundation grants no: DEB-1120443 to AB and OCE-0927277 to GB. This paper is dedicated to the memory of Dr. John W. Hawes (Center for Bioinformatics and Functional Genomics and Department of Chemistry and Biochemistry, Miami University).

89 CHAPTER 3

Starvation and Competition: Survival Capabilities of Ammonia-oxidizing Archaea and Bacteria

E. French and A. Bollmann

Submitted in part to the journal Environmental Microbiology Reports

90 Abstract In the environment, nutrients are rarely available in constant concentrations, and therefore organisms must adapt to survive during periods of nutrient starvation and compete for limiting nutrients. Ammonia-oxidizing archaea (AOA) and bacteria (AOB) must be able to compete with heterotrophic bacteria, photosynthetic organisms, and one another for ammonia in order to generate energy. The competition between AOA and AOB has not yet been directly studied, and will provide substantial insight into their niche differentiation. In this study, we investigated the competition for ammonia that occurs between these organisms through chemostat competition growth experiments. Additionally, we present experiments exploring the tolerance and survival of AOA and AOB during starvation conditions in batch culture. In chemostat competition experiments under ammonia-limited, high oxygen conditions, AOA were better able to compete for ammonia, and successfully outcompeted AOB for this substrate. Similar results were seen under ammonia-limited, low oxygen conditions. Both AOA and AOB are able to survive and recover from nearly two months of starvation, though AOB recover more quickly than AOA. In addition, both groups retained 16S rRNA and amoA mRNA throughout the starvation period. These data indicate that in conditions of low ammonia, AOA will be able to access ammonia that is unavailable to AOB due to differences in substrate affinity, and AOB will starve. However, AOB are better able to recover from starvation, and will respond more quickly to fresh inputs of ammonia into the environment.

91 Introduction In the environment, microorganisms live in conditions of constant nutrient fluctuation, including nutrient limitation and starvation (195). Due to low nutrient availability, microorganisms must compete with one another and multicellular organisms for access to limiting nutrients (125, 126). When an organism is not able to successfully access a limiting resource, it will either be outcompeted from the environment, or must be able to persist during periods of starvation (196). To cope with this type of lifestyle, through evolution, bacteria have acquired a variety of responses to deal with nutrient and energy starvation (197). While some Gram positive bacteria can enter dormant states by the formation of endospores, many Gram negative and Gram positive bacteria must utilize alternative mechanisms, such as the stringent response, to deal with stress and starvation (198, 199). To persist in the environment, some microorganisms have adapted to utilize a wide variety of energy generating substrates, while others are more specialized for a particular niche and are dependent upon a single substrate for energy generation (5). Ammonia oxidizing microorganisms are one such group of organisms that often encounters fluctuating substrate concentrations within the environment (195). Both ammonia-oxidizing bacteria (AOB) and archaea (AOA) are solely dependent upon the oxidation of ammonia to nitrite for the generation of energy (11, 54). In AOB, this process is catalyzed via the enzymes ammonia monooxygenase (Amo) and hydroxylamine oxidoreductase (Hao) (11). The first step of ammonia oxidation is catalyzed by Amo in AOA; however, the subsequent enzymes involved in this reaction remain uncharacterized (69). While AOB exhibit phylogeny-specific differences in their affinity for ammonia and the ability to compete for this energy substrate, strains studied to date share an ability to withstand extended periods of ammonia starvation (7, 47, 50, 200). The complete mechanism of starvation tolerance in AOB has not yet been fully elucidated, however previous work has demonstrated that mRNA stability during energy starvation may play a role in starvation capabilities (48). Currently, it is unknown how well AOA tolerate and recover from energy starvation, if at all. Ammonia-oxidizing microorganisms face competition for their sole energy generating substrate, ammonia, with plants, photosynthetic microorganisms, heterotrophic bacteria, and each other (7, 124-126). Previous chemostat competition experiments have been conducted with a eutrophic AOB, Nitrosomonas europaea, and heterotrophic bacteria (124), and with N.

92 europaea and an oligotrophic AOB, Nitrosomonas sp. Is79 (in the enrichment culture AOB-G5- 7) (7). In the latter experiments, Nitrosomonas sp. Is79 was found to be a superior competitor for ammonia under ammonia-limiting conditions (7). These results suggest that ammonia- oxidizing microorganisms that are adapted to low, environmentally relevant ammonium concentrations, may be better competitors for ammonia than the model organism, N. europaea (7). To date, no work has been done to investigate the competition between AOA and AOB, largely due to the inability to grow AOA in chemostats (8). Here we present a study in which we used chemostat cultivation to investigate the competition for ammonia that occurs between AOA and AOB under ammonia-limited/high oxygen (21%), and ammonia-limited/low oxygen (1%) conditions. Additionally, we also examined the capacity for starvation tolerance and recovery of AOA and AOB. We hypothesized that, due to the low-energy adaptation of archaea in general (201), the AOA would be superior competitors for ammonia in all ammonia-limited conditions, and that the AOA would be better able to tolerate and survive starvation than the AOB. Data from these experiments will be critical to understanding the relative contribution of AOA and AOB to the process of nitrification in freshwater environments, and will provide evidence regarding the environmental conditions that allow for niche separation between these two groups of organisms. The results from these experiments also have significant implications for the field of ammonia-oxidizer ecology, because so many studies use the abundance of AOB and AOA amoA mRNA as a measurement of in situ activity, which could lead to an overestimation of the role of AOA or AOB in an environment. In contrast to the AOB, which can survive ammonia starvation for weeks to months and retain amoA mRNA for weeks during starvation (48, 165), no data are currently available regarding the starvation response and recovery of AOA. Due to the use of measurements of amoA mRNA abundance as a representation of active populations of nitrifiers, it is critical to determine whether starved AOA have a similar RNA stability profile as AOB.

93 Materials and Methods

Growth medium + All cultivation was done in mineral salts medium containing: 0.5 mM NH4 (as

(NH4)2SO4), 10 mM NaCl, 1 mM KCl, 0.2 mM MgSO4 ⋅ 7 H2O, 1 mM CaCl2 ⋅ 2H2O, 0.4 mM -1 KH2PO4, and 1 ml L trace elements solution (124). In batch cultures used for starvation experiments, the medium was buffered with 2 mM HEPES [4-(2-hydroxyethyl) piperazine-1- ethanesulfonic acid] and the pH was adjusted to 7.5 with 1 M NaOH. In chemostat cultivation, the medium was not buffered and the pH was auto-adjusted with 2% w/v sodium carbonate. In all cases, the cultures were incubated at 27 ºC in the dark.

Cultures The enrichment cultures AOA-AC1 and AOB-G5-7 (121) were used to conduct these experiments. The enrichment culture AOA-AC1 contains an AOA 99% identical to the AOA in the enrichment culture AOA-DW based on the amoA nucleotide sequence, as well as a nitrite- oxidizing bacterium and heterotrophic bacteria (202). Growth experiments have shown that this culture behaves similarly to the previously characterized enrichment cultures AOA-DW, AOA- AC2, and AOA-AC5 (202).

Chemostat setup Chemostats (vessel volume 5 L) were assembled and autoclaved with 2 L unbuffered

+ mineral salts medium with 0.5 mM NH4 . Chemostats were inoculated with 1 L of late log phase

AOA-AC-1 or AOB-G5-7. Oxygen and CO2 were provided by bubbling sterile filtered atmospheric air at a low rate (<5 ml min-1) for the high oxygen experiment, or by bubbling sterile filtered prepared air (1% O2, 380 ppm CO2, remainder N2) for the low oxygen experiment. One 10 ml sample was removed from each chemostat every day and filtered through a 0.22 µm polycarbonate filter. The resulting filtrate was stored at -20 ºC for chemical analysis. Upon the consumption of at least 90% of the initial ammonium concentration, fresh unbuffered mineral

+ salts medium containing 0.5 mM NH4 was added to each chemostat at a dilution rate of approximately 550 ml day-1 while maintaining a culture volume of 3 L. Growth of individual ammonia-oxidizers was maintained in the chemostats for at least seven days. Once every six days (equivalent to one volume change), two 100 ml samples were

94 removed from each chemostat. Two 50 ml aliquots of each sample were filtered on 0.1 µm polycarbonate membranes and stored at -80 C for molecular analysis. After at least seven days of growth under constant chemostat conditions, 1 L was removed from each growth vessel and transferred to the other, to create a 1:2 and 2:1 vol/vol mixing of both organisms. Every day following mixing, one 10 ml sample was removed from each chemostat, filtered as before, and the filtrate saved for chemical analysis. Additionally, two 100 ml samples for molecular analysis were removed immediately following mixing, and then 24, 48, and 144 hours after mixing. After the 144 hour time point, two 100 ml samples for molecular analysis were removed every 6 days for the duration of the experiment. As before, two 50 ml aliquots of each sample were filtered on 0.1 µm polycarbonate membranes and stored at -80 ºC for molecular analysis.

Starvation The ammonia oxidizing enrichment cultures AOA-AC-1 and AOB-G5-7 (202) were

+ inoculated in triplicate at 10% v/v into 1 L mineral salts medium with 0.5 mM NH4 in 2 L Erlenmeyer flasks sealed with cotton stoppers. When approximately 80% of the initial substrate had been consumed, it was presumed that the cultures were in late logarithmic phase. Cells were harvested by filtering a 50 ml aliquot over a 0.1 µm nitrocellulose filter (AOA) or a 0.22 µm nitrocellulose filter (AOB) and stored at -80 ºC for molecular analysis. Starvation was defined when the ammonium concentration was below the limit of detection for 24 hours. At 24 hour (AOA) or 48 hour (AOB) intervals for ten days following the onset of starvation, a 50 ml sample was removed and cells were collected on nitrocellulose filters and stored at -80 ºC for molecular analysis. Simultaneously, 5 ml was used to inoculate 45 ml

+ mineral salts medium containing 0.5 mM NH4 . These recovery cultures were monitored daily via colorimetric assay for the production of nitrate. After the first ten days of starvation, additional samples were taken for molecular analysis and recovery cultures were inoculated once per week for six weeks.

Chemical analysis Ammonium, nitrite, and nitrate concentrations were determined in cell-free supernatants using colorimetric methods (118, 145-147). Growth rates were determined by calculating the

- - - - slope of the log-transformed NO2 /NO3 concentrations plotted against time. NO2 /NO3

95 production in cultures of AOA and AOB is assumed to be correlated with growth (53, 118, 171). The lag phase was defined as the time required before a culture began to grow exponentially (202).

DNA extraction DNA was extracted from two filters per chemostat per time point. Filters were homogenized using the provided sodium phosphate buffer, MT buffer, and Lysing Matrix E, using a Mini BeadBeater (Biospek, Bartlett, OK) three times for 30 s at 4800 rpm, storing on ice for 5 minutes in between. Homogenized filters were centrifuged for 15 minutes at 14,000 x g and DNA was isolated from the resulting supernatant using the Fast DNA Spin Kit for Soil (MP Biomedicals, Solon, OH) according to the manufacturer’s instructions.

RNA extraction For starvation experiments, RNA was extracted from nitrocellulose filters using a Qiagen RNeasy RNA kit according to the manufacturer’s protocol, with the following modifications. Cells were lysed by adding 1 g of acid-washed zirconium beads (BioSpec Products, Bartlesville, OK ) and 1 ml of the provided Buffer RTL to the filter. The filters were homogenized by bead beating for 30 s at 4800 rpm in a Mini Bead Beater. Additional lysis was performed by shaking the tubes on a titer plate shaker at maximum speed for 10 minutes. All wash buffers were incubated on the column for two minutes prior to centrifugation. Purified RNA was eluted with 30 µl RNase-free water. For samples from chemostats, RNA was extracted from two filters per chemostat per time point. Filters were homogenized using the provided RNA Pro solution with Lysing Matrix B, using a Mini BeadBeater (Biospek, Bartlett, OK) two times for 30 s at 4800 rpm, storing on ice for 5 minutes in between. Homogenized filters were centrifuged for 10 minutes at 12,000 x g and RNA was isolated from the resulting supernatant using the Fast RNA Pro Blue kit (MP Biomedicals, Soloh, OH) according to the manufacturer’s instructions. Purified RNA was dissolved in 30-100 µl DEPC-treated water. All purified RNA samples were treated with Ambion DNaseI for 60 minutes at 37 ºC according to the manufacturer’s recommendations before storage at -20 C. Absence of DNA contamination was verified using polymerase chain reaction PCR) with primers specific for AOA and AOB amoA (Table 16). RNA quality was verified by agarose gel electrophoresis. The

96 Promega GoScript Reverse Transcriptase System was used with random primers in a 20 µl reaction volume to generate cDNA. qRT-PCR The copy number of 16S rRNA or amoA genes or transcripts or were quantified using the Bioline SensiFAST SYBR No-ROX Kit in a 5 µl reaction volume in an Illumina Eco real-time PCR machine. Standard curves were constructed using serial dilutions (101 to 107 copies/µl) of the pGEM-T-Easy plasmid (Promega) containing AOA-AC-1 or AOB-G5-7 amoA or 16S rRNA gene sequences. The primers and conditions used were as described in Table 16. Determination of cells ml-1 based on amoA gene copy number was based on the assumption of one copy of amoA per genome in AOA (69), and three copies of amoA per genome in AOB-G5-7 (203).

97 Table 16. Primers and PCR conditions used in this study

Primer Anneal. # cycles temp

AOA-amoA (83) Arch amoA F: 53 40 5’-STA ATG GTC TGG CTT AGA CG-3’ Arch amoA R: 5’-GCG GCC ATC CAT CTG TAT GT-3’ Archaeal 16S rRNA (55, Arch 109F: 46 40 176) 5’-ACK GCT CAG TAA CAC GT-3’ Arch 915R: 5’-YCC GGC GTT GAM TCC AAT T-3’ AOB-amoA (177) amoA-1F: 55 35 5’-GGG GTT TCT ACT GGT GGT-3’ amoA-2R KS: 5’-CCC CTC KGS AAA GCC TTC TTC-3’ AOB-16S rRNA (152) CTO 189F-A: 57.5 35 5’-GGA GAA AAG CAG GGG ATC G-3’ CTO 189F-B: 5’-GGA GGA AAG CAG GGG ATC G-3’ CTO 189F-C: 5’-GGA GGA AAG TAG GGG ATC G-3’ CTO 654R: 5’-CTA GCY TTG TAG TTT CAA ACG C-3’

98 Results

Chemostat competition: ammonia-limited high oxygen The enrichment cultures AOA-AC1 and AOB-G5-7 were inoculated separately into

+ chemostats containing mineral salts medium with 0.5 mM NH4 and bubbled with atmospheric air. AOB-G5-7 was inoculated 42 days prior to mixing, had a lag phase of four days, and began to grow by 37 days prior to mixing at a rate of 0.038 hour-1. All of the ammonia in the growth vessel had been consumed by 35 days before mixing (Figure 13A). Upon complete ammonia consumption, fresh medium containing 0.5 mM NH+ was pumped into the growth vessel at a constant rate of 0.008 hour-1. AOA-AC1 was inoculated 40 days prior to mixing and began to oxidize some ammonia immediately upon inoculation, however it did not begin to grow exponentially, at a rate of 0.009 hour-1, until 31 days before mixing (Figure 14A). AOA-AC1 had consumed all of the ammonia in the growth vessel by 25 prior to mixing, at which point

+ fresh medium containing 0.5 mM NH4 was pumped into the growth vessel at a rate of 0.008 hour-1. For the duration of the experiment, the ammonium concentration in both growth vessels remained less than 50 µM, and was detected at or less than the detection limit of the assay (5 µM) for most time points (Figure 13A, 14A). After the medium pump was turned on, the nitrate concentration in both vessels remained constant, indicating that all of the ammonia being added was fully oxidized (Figure 13A, 14A). Nitrite accumulation was not observed for the duration of the experiment (Figure 13A, 14A). During constant growth, the pH in both growth vessels was maintained at 7.5 (data not shown). AOB-G5-7 was present at an abundance of 7.5 x 106 cells/ml culture (Figure 13B), while AOA-AC1 was present at a constant abundance of 1.4 x 108 cells/ml culture (Figure 14B). After eighteen days of constant growth, denoted as time point day 0 (Figure 13 and 14), one liter of culture was removed from each chemostat and inoculated into the other, to mix the cultures at two vol/vol mixing ratios. After mixing, AOA-AC1 maintained the same abundance at a mixing ratio of 2:1 (Figure 14B), and reached a similar abundance after twelve days post-mixing, at a mixing ratio of 1:2 (Figure 13B). In contrast, AOB-G5-7 declined in abundance at a mixing ratio of 2:1 immediately following mixing, and was not detected in the chemostat by 24 days post- mixing (Figure 13B). At a mixing ratio of 1:2, AOB-G5-7 initially reached a cell density of 1 x 106 before declining by the second day after mixing, and was not be detected in the chemostat by 18 days after mixing (Figure 14B).

99

Figure 13. Chemical and microbial composition of the chemostat initially inoculated with AOB-G5-7 in ammonia-limited/high oxygen conditions. (A) Ammonium, nitrite, and nitrate concentrations in the chemostat throughout the experiment. The concentrations prior to inoculation are represented at time point -43 days; the chemostat was inoculated with AOB-G5-7 at time point -42 days. Fresh medium was added at a constant rate beginning at -35 days (denoted with arrow). (B) Abundance of AOA-AC1 and AOB-G5-7 in the chemostat, as measured by qPCR of the amoA gene. Competition between AOA and AOB occurs beginning with the time point denoted 0 days post-mixing. AOB-G5-7 was not detected at 24 days post- mixing.

100

A

B

101

Figure 14. Chemical and microbial composition of the chemostat initially inoculated with AOA-AC1 in ammonia-limited/high oxygen conditions. (A) Ammonium, nitrite, and nitrate concentrations in the chemostat throughout the experiment. The concentrations prior to inoculation are represented at time point -41 days; the chemostat was inoculated with AOA-AC1 at time point -40 days. Fresh medium was added at a constant rate beginning at -25 days (denoted with arrow). (B) Abundance of AOA-AC1 and AOB-G5-7 in the chemostat, as measured by qPCR of the amoA gene. Competition between AOA and AOB occurs beginning with the time point denoted 0 days post-mixing. AOB-G5-7 was not detected at 18 or 24 days post-mixing.

102

A

B

103 Expression of amoA by AOB-G5-7 and AOA-AC1 was monitored via qRT-PCR throughout the competition experiment (Figure 15). Expression of amoA by AOB-G5-7 was detected at about 4 x102 copies/ml culture prior to mixing, and decreased after mixing (Figure 15). AOB-G5-7 amoA mRNA transcripts were not detected in the chemostat initially inoculated with AOB-G5-7 by twelve days after mixing, even though the AOB-G5-7 amoA gene was detected 18 days after mixing (Figure 15A, Figure 13B). In the chemostat that was initially inoculated with AOA-AC1, the expression of amoA by AOB-G5-7 after mixing was very low, and was never detected above 100 copies/ml culture (Figure 15B). Expression of amoA by AOA-AC1 was detected at higher levels than it was for AOB-G5-7 throughout the competition experiment. Prior to mixing, AOA-AC1 amoA mRNA was detected at 4.5 x 105 copies/ml culture (Figure 15B). This expression decreased after mixing with AOB-G5-7, remained nearly constant for six days, and then increased to levels equivalent to expression measured before mixing (Figure 15B). In the chemostat initially inoculated with AOB-G5-7, expression of amoA by AOA-AC1 was detected at 3 x 103 copies/ml immediately after mixing, and increased to 1.5 x 105 copies/ml by 24 days after mixing (Figure 15A).

Chemostat competition: low ammonia, low oxygen The enrichment cultures AOA-AC1 and AOB-G5-7 were inoculated separately into

+ chemostats containing mineral salts medium with 0.5 mM NH4 . Fourteen days before mixing, a sterile-filtered, low oxygen gas mixture (1% O2, 380 ppm CO2, remainder N2) was bubbled into both chemostats. AOB-G5-7 began grow exponentially 11 days before mixing, at a rate of 0.025 hour-1 (Figure 16A). Upon consumption of all ammonia in the growth vessel, fresh medium

+ - containing 0.5 mM NH4 was continuously pumped into the growth vessel at a rate of 0.008 hour 1. AOA-AC1 began to oxidize ammonia immediately upon inoculation at a rate of 0.008 hour-1 (Figure 17A). AOA-AC1 had consumed all of the ammonia in the growth vessel by 15 days

+ prior to mixing, at which point fresh medium containing 0.5 mM NH4 was pumped into the growth vessel at a rate of 0.008 hour--1. For the duration of the experiment, the ammonium concentration in both growth vessels remained less than 100 µM (Figure 16A, 17A). During initial exponential growth of AOB-G5-7 in ammonia-limited low oxygen conditions, nitrate was not detected, rather nitrite was produced. Nitrite accumulated for six days, until reaching a

104

Figure 15. Expression of amoA by AOB-G5-7 and AOA-AC1 during chemostat growth and competition under ammonia-limited, high oxygen conditions. Chemostats were initially inoculated with either AOB-G5-7 (A) or AOA-AC-1 (B) and mixed at the time point denoted 0 days post-mixing.

105

A

B

106 concentration of about 400 µM, when it was then stoichiometrically converted to nitrate (Figure 16A). By the time of mixing, all ammonia had been fully oxidized to nitrate. For the duration of the experiment, no nitrite was detected in that chemostat, and the nitrate concentration reached a steady concentration of approximately 500 µM (Figure 16A). In the chemostat initially inoculated with AOA-AC1, no nitrite was detected over the course of the experiment. All ammonia was oxidized to nitrate, and once the medium pump was turned on, nitrate levels remained constant for the duration of the experiment (Figure 17A). During constant growth, the pH in both growth vessels was maintained at 7.5 (data not shown). Prior to mixing, AOB-G5-7 was present at an initial abundance of 7.5 x 106 cells/ml, and declined to 2.3 x 106 cells/ml by 18 days after mixing. AOB-G5-7 was no longer detected in the chemostat into which it was initially inoculated by 23 days after mixing (Figure 16B). In the chemostat initially inoculated with AOA-AC1, AOB-G5-7 never reached a cell density higher than 5 x 106, and was not detected in the chemostat by 12 days after mixing (Figure 17B). AOA- AC-1 was initially present at a constant abundance of about 5.4 x 108 cells/ml culture (Figure 17B). After mixing, AOA-AC1 decreased in abundance for two days following mixing at a mixing ratio of 2:1, fluctuating between 1 - 4 x 108 cells/ml (Figure 17B). By the sixth day after mixing, however, the abundance of AOA-AC1 had increased, and reached a final abundance of 4.9 x 108 cells/ml by 23 days after mixing (Figure 17B). In the chemostat initially inoculated with AOB-G5-7, the abundance of AOA-AC1 fluctuated after mixing, and reached a final abundance of 3.9 x 108 cells/ml by 23 days after mixing (Figure 16B). Expression of amoA by AOB-G5-7 and AOA-AC1 was monitored via qRT-PCR throughout the competition experiment. Expression of amoA by AOB-G5-7 was detected at about 1.5 x105 copies/ml culture prior to mixing, and decreased after mixing (Figure 18A). In the chemostat that was initially inoculated with AOA-AC1, the expression of amoA by AOB-G5- 7 was detected at about 6.5 x 104 copies/ml culture immediately following mixing, and decreased at every time point thereafter, until it could no longer be detected at 18 days after mixing (Figure 18B). AOB-G5-7 amoA mRNA transcripts were detected in the chemostat initially inoculated with AOA-AC1 at 12 days after mixing, even though the AOB-G5-7 amoA gene was not detected 12 days after mixing (Figure 16B, Figure 18B). Expression of amoA by AOA-AC1 was detected at higher levels than it was for AOB-G5-7 throughout the competition experiment. Prior to mixing, AOA-AC1 amoA mRNA was detected at 2 x 106 copies/ml culture (Figure 18B)

107

Figure 16. Chemical and microbial composition of the chemostat initially inoculated with AOB-G5-7 in ammonia-limited/low oxygen conditions. (A) Ammonium, nitrite, and nitrate concentrations in the chemostat throughout the experiment. The concentrations prior to inoculation are represented at time point -23 days; the chemostat was inoculated with AOB-G5-7 at time point -22 days. Fresh medium was added at a constant rate beginning at -8 days (denoted with arrow). (B) Abundance of AOA-AC1 and AOB-G5-7 in the chemostat, as measured by qPCR of the amoA gene. Competition between AOA and AOB occurs beginning with the time point denoted 0 days post-mixing. AOB-G5-7 was not detected at 24 days post-mixing.

108

A

B

109 This expression fluctuated somewhat after mixing with AOB-G5-7, but returned to pre-mixing levels by 18 days after mixing (Figure 18B). In the chemostat initially inoculated with AOB-G5- 7, expression of amoA by AOA-AC1 was detected at 8 x 105 copies/ml immediately after mixing, and increased to 1.4 x 106 copies/ml by 18 days after mixing (Figure 18A).

Starvation and recovery of AOA and AOB enrichment cultures Growth rates and lag phase of recovering cultures of AOB-G5-7 and AOA-AC1 were determined over the course of an extended starvation period. We did not observe significant differences in the length of lag phase or growth rate of any AOB-G5-7 recovery cultures, regardless of the length of the starvation period (Figure 19A, Table 17, Table 18). During the first ten days of the starvation period, the growth of the recovery cultures of AOA-AC1 did not differ significantly from those generated from early stationary phase inocula (time point denoted day -1, Figure 19B). Recovery cultures inoculated with culture that had been starved for 10 days or longer had a significantly longer lag phase than recovery cultures inoculated with early stationary phase cultures (Figure 19B, Table 18). The growth rates of AOA-AC1 recovery cultures decreased after day 10 of starvation, reaching a stable, lower value around day 20 of starvation (Figure 19B, Table 17).

RNA stability during starvation RNA (16S rRNA and amoA mRNA) abundance was determined in selected samples over the course of the starvation period. AOB-G5-7 and AOA-AC1 retained both amoA mRNA as well as 16S rRNA for the duration of the starvation period (Figure 20, Table 19-20). While the 16S rRNA abundance decreased slightly over time in both cultures, the abundance of amoA mRNA in both cultures decreased rapidly during the first day of starvation, and continued to decline in AOB-G5-7. The abundance of amoA mRNA in AOA-AC1 remained approximately constant throughout the starvation period (Figure 20, Table 19- 20).

110

Figure 17. Chemical and microbial composition of the chemostat initially inoculated with AOA-AC1 in ammonia-limited/low oxygen conditions. (A) Ammonium, nitrite, and nitrate concentrations in the chemostat throughout the experiment. The concentrations prior to inoculation are represented at time point -23 days; the chemostat was inoculated with AOA-AC1 at time point -22 days. Fresh medium was added at a constant rate beginning at -15 days (denoted with arrow). (B) Abundance of AOA-AC1 and AOB-G5-7 in the chemostat, as measured by qPCR of the amoA gene. Competition between AOA and AOB occurs beginning with the time point denoted 0 days post-mixing. AOB-G5-7 was not detected at 12, 18, or 24 days post-mixing.

111 A

B

112

Figure 18. Expression of amoA by AOB-G5-7 and AOA-AC1 during chemostat growth and competition under ammonia-limited/low oxygen conditions. Chemostats were initially inoculated with either AOB-G5-7 (A) or AOA-AC-1 (B) and mixed at the time point denoted 0 days post-mixing.

113

A

B

114

Figure 19. Growth rate [h-1] and lag phase [h-1] during starvation of the AOB enrichment culture AOB-G5-7 (A) and the AOA enrichment culture AOA-AC1 (B) (mean + SD, n=3).

115

growth rate lag phase A 0.07 25

0.06

24.5 0.05 ]

[h] phase lag -1 0.04 24 0.03

growth rate [h 0.02 23.5 0.01

0 23 0 10 20 30 40 50 Starvation time [days]

B growth rate lag phase 0.03 200

0.025 150

]

0.02 [h] phase lag -1

0.015 100

0.01 growth rate [h 50 0.005

0 0 0 10 20 30 40 50 Starvation time [days]

116 Table 17. Influence of starvation time [days] on growth rate [h-1] of the enrichment cultures AOB-G5-7 and AOA-AC1 (data are similar to Figure 19) (mean + SD, n=3; different letters behind values indicate significant differences between values determined by one-way ANOVA followed by Tukey test; P<0.05). Starvation time [days] AOB-G5-7 AOA-AC1 a a -1 0.0461+0.0038 0.0201±0.0016 ab 0 0.0171±0.0008 a ab 1 0.0504±0.0031 0.0170±0.0007 ab 2 0.0182±0.0023 a ab 3 0.0463±0.0013 0.0162±0.0006 ab 4 0.0165±0.0002 a ab 5 0.0509±0.0032 0.0163±0.0017 a ab 7 0.0397±0.0137 0.0163±0.0014 a bc 9 0.0525±0.0137 0.0147±0.0005 a 11 0.0433±0.0060 a 13 0.0492±0.0169 a 15 0.0445±0.0014 cd 16 0.0120±0.0005 a 19 0.0436±0.0012 cd 23 0.0112±0.0027 a 26 0.0472±0.0084 d 30 0.0107±0.0013 a 33 0.0523±0.0040 cd 37 0.0121±0.0004 a 40 0.0523±0.0035 d 44 0.0105±0.0009 a 47 0.0513±0.0031 cd 52 0.0118±0.0004

117 Table 18. Influence of starvation time [days] on lag phase [h] of the enrichment cultures AOB-G5-7 and AOA-AC1 (data are similar to Figure 19) (mean + SD, n=3; different letters behind values indicate significant differences between values determined by one-way ANOVA followed by Tukey test; P<0.05). Starvation time [days] AOB-G5-7 AOA-AC1 a a -1 24±0 24±0 a 0 32±13.9 a a 1 24±0 40±13.9 a 2 24±0 a a 3 24±0 32±13.9 a 4 32±13.9 a a 5 24±0 32±13.9 a a 7 24±0 40±13.9 a ab 9 24±0 72±0 11 24±0a 13 24±0a 15 24±0a bc 16 128±13.9 19 24±0a bc 23 152±99.9 26 24±0a bc 30 152±13.9 33 24±0a c 37 160±13.9 38 40 24±0a bc 44 144±0 47 24±0a bc 51 144±0

118

Figure 20. amoA mRNA and 16S rRNA abundance [copies/ng RNA] during starvation of the AOB enrichment cultures AOB-G5-7 (A) and the AOA enrichment culture AOA-AC1 (B) (mean + SD, n=3).

119

A amoA mRNA 16S rRNA 108

7 10

6 10

105

104

1000

100

copy numberRNA [copies/ng RNA] 10

1 0 10 20 30 40 50 starvation time [days]

B 108

107

106

5 10 104

1000

100

10 RNA copy numberRNA [copies/ng RNA]

1 0 10 20 30 40 50 Starvation time [days]

120 Table 19. Influence of starvation time [days] on amoA copy number [copies/ng RNA] of the enrichment cultures AOB-G5-7 and AOA-AC1 (data are similar to Figure 20) (mean + SD, n=3; different letters behind values indicate significant differences between values determined by one- way ANOVA followed by Tukey test; P<0.05). Starvation time [days] AOB-G5-7 AOA-AC1 a a -1 34200±11927 38963±6503 b b 1 2680±355 857±37 b 9 527±155 c 19 49±33 c 23 214±93 d 34 9.6±4.5 c 44 247±78 e 48 2.6±0.9

121 Table 20. Influence of starvation time [days] on 16S rRNA copy number [*106 copies/ng RNA] of the enrichment cultures AOB-G5-7 and AOA-AC1 (data are similar to Figure 20) (mean + SD, n=3; different letters behind values indicate significant differences between values determined by one-way ANOVA followed by Tukey test; P<0.05). Starvation time [days] AOB-G5-7 AOA-AC1 a a -1 10.58±2.83 2.08±0.15 a ab 1 11.33±3.53 1.32±0.20 ab 9 1.14±0.11 a 19 9.16±4.57 b 23 0.65±0.37 a 34 10.35±3.70 b 44 0.84±0.30 a 48 6.97±2.06

122 Discussion

The investigation of the ability of a microorganism to compete for limiting nutrients and survive during starvation periods when those nutrients are not available allows for a better insight into the growth mode and lifestyle of that organism in the environment (204). Competitive ability and starvation tolerance are generally well correlated with growth rate as well as substrate affinity (7, 204), and may allow for the generation of models to predict the niche of an organism in the environment. Ammonia-oxidizing bacteria and archaea often co- occur in the environment (reviewed in 113), and it is of great interest to determine which of these ammonia oxidizers contributes more to the process of ammonia oxidation in the environment. Previous research has indicated that the availability of the substrates ammonia and oxygen could be the strongest drivers of niche differentiation between AOA and AOB (202). Therefore, we conducted experiments to investigate the competition of the freshwater sediment enrichment cultures AOA-AC1 and AOB-G5-7 in ammonia-limited/high oxygen (21%) conditions, and ammonia-limited/low oxygen (1%) conditions using chemostats. Additionally, we investigated the ability of these organisms to survive and recover from starvation using batch cultivation techniques. During chemostat competition experiments, AOA-AC1 was able to outcompete AOB- G5-7 for ammonia, resulting in the loss of AOB-G5-7 from the chemostats by 24 days after the cultures had been mixed. These results indicate that AOA-AC1 is a superior competitor for ammonia under substrate limitation. Enzyme kinetic determinations conducted with related AOA Nitrosopumilus maritimus and Candidatus Nitrosoarchaeum koreensis suggest that these AOA have an affinity for ammonia 100-10,000 times higher than characterized AOB (8, 115), which likely explains the ability of AOA-AC1 to successfully outcompete AOB-G5-7 when the ammonia supply was limiting. These results are also in agreement with the Tilman model for interspecific competition, which indicates that the organism that is able to utilize a growth- limiting substrate at a lower concentration will be more successful in competition (196). According to this model, two species that compete for resources can coexist when they each utilize a different growth-limiting substrate to a lower concentration than the other (196). Therefore, AOA and AOB may be able to coexist in any given environment if AOA can utilize ammonia to a lower concentration than AOB, and AOB other can utilize another substrate, such as oxygen, to a lower concentration. The influence of the oxygen concentration on the growth

123 and competition of AOB-G5-7 and AOA-AC-1 in these experiments cannot be distinguished from that of the ammonia limitation, as AOB-G5-7 was eliminated from the chemostats at similar times during both high and low oxygen experiments. In the future, additional experiments to determine the competitive abilities of both organisms with only oxygen as the growth limiting substrate should be conducted to determine if oxygen is a niche differentiating substrate between AOA and AOB. The effect of population size on the outcome of the competition cannot be determined from these experiments due to the high cell yield of the AOA when growing in chemostats. While the chemostats were each mixed at a 2:1 and 1:2 vol/vol ratio (with respect to the organism initially inoculated into the respective chemostat), the AOA were always approximately 100 times more abundant than the AOB. Previous studies investigating the competition between heterotrophic and autotrophic bacterial nitrifiers suggested that the population size of each group contributed to the outcome of the competition (205). The cell yields of AOA-AC1 are similar to those of N. maritimus and Ca. N. koreensis grown under similar laboratory conditions (53, 115); however, in chemostats the abundance of AOA-AC1 was approximately 100 times higher than AOB-G5-7 and 10 times higher than the abundance of AOA and AOB detected in the water column of a eutrophic lake in Ohio, respectively (French and Bollmann, unpubl). Therefore in the future, the effect of AOB population size on the outcome of the competition should be investigated more thoroughly. Transcription of the gene encoding the first enzyme involved in the process of ammonia oxidation, ammonia monooxygenase (amoA), was monitored throughout the competition experiments. The pattern of amoA mRNA abundance follows the general trend of AOA and AOB cellular abundance, as measured by amoA gene abundance. These data reflect relatively low transcript abundance compared to cell abundance (<1 transcripts/cell). The per cell ratio of amoA mRNA:DNA was similar for both AOA and AOB in both competition experiments. It is possible that the RNA isolation method used in this study had a low extraction efficiency, and would need to be optimized for future work. Alternatively, these results may indicate that only a fraction of the AOA and AOB in an active community actually transcribe amoA during growth. Similar results were seen in an AOA community detected in the Pacific Ocean, in which amoA mRNA was detected at two orders of magnitude lower than amoA genes (206). While the physiological state of these cells is unknown, this may provide support for the hypothesis that

124 ammonia oxidizers transcribe amoA at quite low levels. Little work has been done to investigate the stability and turnover rate of the Amo protein in actively growing freshwater AOB, and no information is available as to the rate of Amo turnover in the AOA. It is possible that, as an adaptation to cope with the low energy metabolism of both the AOA and AOB, their Amo proteins are highly stable and do not require high levels of transcription during growth in order to maintain a constant level of activity. AOA may be the superior competitor for ammonia under substrate limited conditions, however the ability of AOA and AOB to tolerate and recover from starvation periods is also critical to their survival, particularly in environments such as freshwater lakes where nutrients such as ammonia may be abundant or nearly absent (2). We therefore tested the ability of AOB- G5-7 and AOA-AC1 to withstand several months of ammonia starvation and measured the recovery of these cultures upon inoculation into fresh medium. The data from this starvation experiment indicate that both AOA-AC1 and AOB-G5-7 are able to tolerate extended periods of ammonia starvation. These organisms did, however, differ in their rate of recovery. While the AOB-G5-7 recovered rapidly regardless of the ammonia starvation period, AOA-AC1 had a delayed response following periods of more than 10 days without ammonia. The lower affinity of AOB for ammonia (27) may prevent them from accessing this substrate when it becomes limiting in the environment, thereby forcing the AOB to starve. Upon input of ammonia to the environment, however, AOB are able to rapidly recover from starvation and access ammonia. Due to the higher affinity of AOA for ammonia (8, 115), these organisms will be able to access ammonia when it is limiting for the AOB, and may not be exposed to starvation conditions as frequently as AOB. Therefore, the AOA have not had to become adapted to tolerate and recover quickly from ammonia starvation. During the course of the starvation period, both AOA-AC1 and AOB-G5-7 retained 16S rRNA, as well as amoA mRNA. AOB-G5-7 and AOA-AC1 are not the only ammonia-oxidizing microorganisms known to retain RNA during starvation; similar observations were made with Nitrosospira briensis (48) and Nitrosomonas cryotolerans (49, 165), indicating that the retention of amoA mRNA may be a shared adaptive strategy of AOA and AOB to withstand periods of energy starvation. mRNA stability during starvation has also been reported for the marine bacterium Vibrio angustum S14, in which stable mRNAs encoding proteins required for immediate recovery from starvation enable this bacterium to respond to substrate addition within

125 minutes (207, 208). The long persistence of the amoA mRNA may also ameliorate the need for high levels of transcription of this gene, allowing AOA and AOB to maintain low levels of amoA transcripts such as those seen in the chemostat competition experiments. This adaptation of potentially low rates of transcription and protein synthesis may be an advantage in organisms that routinely starve for energy, and may allow for the rapid recovery from starvation seen in AOB-G5-7. Scientists often use the abundance of archaeal and bacterial amoA mRNA as a measure or at least indication of ammonia oxidizing activity in environmental samples (188, 192) . This approach might produce inaccurate and/or misleading results, because of the long persistence of the archaeal and bacterial amoA mRNA in starved cells. If using amoA mRNA as a measure of ammonia-oxidizing activity in the future, such measurements should only be made under very defined experimental conditions using AOA communities with known transcriptional response under conditions of full activity as well as starvation. These data may also have implications for future transcriptomic studies of AOA in the environment. The extent of RNA stability and regulation of transcription of critical genes involved in energy generation should be more thoroughly investigated in the laboratory, so the responses of these organisms to growth in the environment can be more precisely understood. The results from the chemostat competition and starvation experiments agree well with those of previous work characterizing the differences between an AOB adapted to high ammonium concentrations, N. europaea, and an AOB adapted to low ammonium concentrations, AOB-G5-7 (7). In these experiments, the AOB with a higher growth rate and lower affinity for ammonia (N. europaea) was a poor competitor for limiting ammonia in chemostat competition experiments, but better able to recover from starvation in batch culture than AOB-G5-7, which had lower growth rates and a higher affinity for ammonia (7). These results suggest that in comparison, more oligotrophic strains, such as AOB-G5-7 in the experiment from 2002, and AOA-AC1 in this experiment, might recover more slowly from starvation than other, more eutrophic strains, because they can persist at lower ammonium concentrations and are therefore less likely to experience ammonia starvation in the environment (7). Taken together, the results of the competition and starvation experiments allow for the classification of AOA and AOB from freshwater environments based on their lifestyles. These data indicate that, in comparison to the AOA, AOB can be considered copiotrophic, a growth

126 mode similar in definition to that of an r-strategist (204). Copiotrophic organisms typically display high growth rates, a low affinity for substrates, low cell yield, and short lag times during recovery from starvation (204). In contrast, the growth and survival characteristics of AOA-AC1 seen in these experiments indicate that AOA should be classified as oligotrophic organisms, which is similar to previous descriptions of organisms with K-strategist lifestyles (204). In comparison to the AOB, AOA have low growth rates, high substrate affinity, high cell yield (indicating a more efficient use of energy to produce biomass), and long lag times while recovering from starvation, which fits very well with the description of oligotrophic organisms (204). Using the copiotroph/oligotroph delineation as a model, we can predict the habitats in which AOA and AOB are most likely to be more successful, in the natural environment. Copiotrophic organisms are typically more successful in environments where resources are abundant (204). In the case of the AOA and AOB currently under investigation, this indicates that AOB would be better able to grow and oxidize ammonia in a eutrophic lake environment, where the supply of ammonia is often quite high (2). When ammonia becomes limiting for AOB in eutrophic environments, AOA may be able to access the remaining ammonia, while AOB would starve. However, input of fresh ammonia into a eutrophic lake, possibly during times of high agricultural activity (2), would allow for the rapid recovery of AOB and the decline of AOA. In contrast, oligotrophic organisms are predicted to be more successful in environments where resources are present in constant limiting concentrations (204). This suggests that AOA may be more successful in oligotrophic lake environments, where the supply of ammonia is not affected by fluctuations in agricultural activity and is present at low, constant concentrations (2). In these conditions, ammonium concentration and enzyme kinetics may preclude the growth and survival of AOB. In the future, further competition experiments should be conducted to determine the threshold ammonium concentration that would allow for the success of AOB-G5-7 over AOA- AC1. During chemostat growth, only one substrate can be growth limiting at one time, therefore once the ammonia threshold has been ascertained, the competition can be assessed with oxygen as the growth limiting substrate. From these data, a more precise mathematical model can be generated to more accurately predict the conditions in which AOA or AOB will be the predominant ammonia oxidizer. In addition, the use of other strains of AOB and AOA should be

127 considered, as the communities of ammonia oxidizers are likely to be influenced by the trophic state of the lake in which they reside (154); differences in enzyme kinetics and physiological properties of these different communities may also influence the threshold ammonium concentration that separates the niche of the AOA and AOB and therefore the outcome of competition. It is worth noting that, to our knowledge, this represents the first time that AOA have successfully been grown in chemostats, despite previous reports that other AOA, including N. maritimus, cannot be grown in chemostats due to their sensitivity to stirring (8). As such, this is also the first laboratory experiment investigating the direct competition between AOA and AOB, and can serve as a model for conducting such experiments to investigate the physiology of these organisms in the future.

128 Conclusions In the freshwater environment, both AOA and AOB are present and fill the role of ammonia oxidizer within the ecosystem. It is likely that when ammonium concentrations are sufficiently high, such as in a eutrophic lake, AOB will be the predominant ammonia oxidizer, while the AOA experience ammonia starvation and remain dormant. When the AOB have depleted the available ammonia, or when conditions change such that ammonia becomes limiting for the AOB and is present at concentrations accessible to the AOA, such as in an oligotrophic lake, the AOA can become the predominant ammonia oxidizer in the environment. The ability of both organisms to survive ammonia starvation aids in their long-term survival during times of competition that might otherwise drive one or the other out of the environment.

129 SUMMARY

Nitrification is a critical process in aquatic ecosystems that transforms nitrogen from its most reduced form (ammonium) to its most oxidized form (nitrate) (9). The first step of this process is ammonia oxidation, which oxidizes ammonia to nitrite, and is mediated by the ammonia-oxidizing archaea (AOA) and bacteria (AOB) (11, 53). These organisms share a similar chemolithoautotrophic growth mode, oxidizing ammonia to nitrite to generate energy, and fixing inorganic carbon for biosynthesis. While the specific biochemistry underlying these processes differs between the two groups, both are dependent upon ammonia as a sole energy source (35, 54). AOA and AOB can be found ubiquitously in the environment, occupying habitats within marine, freshwater, sediment and soil ecosystems (27, 113). The ecology of AOA and AOB is frequently studied by extracting nucleic acids from environmental samples, quantifying abundances of each group through quantitative polymerase chain reaction (qPCR) and identifying diversity through sequencing of marker genes such as ammonia monooxygenase subunit A (amoA) or 16S rRNA (113). From many of these studies, it has been demonstrated that AOA and AOB frequently co-occur in many environments (81, 87, 89, 92, 94, 95, 98-100, 104, 107-109, 209, 210). This finding raises a fundamental question in nitrifier ecology: given that AOA and AOB depend upon and therefore compete for the same substrate for energy generation in substrate-limited conditions, which group is responsible for ammonia oxidation in the environment? In order to answer this question, data from cultivation-based experiments are essential. The goal of this dissertation work was to cultivate and characterize novel AOA and AOB from freshwater environments using low, environmentally relevant ammonium concentrations. With these cultures, we were able to generate data regarding the environmental factors that influence their distribution and contribute to niche differentiation between AOA and AOB. We hypothesized that the use of ammonium concentrations lower than those traditionally used (0.25- 2 mM vs 100 mM) (27) would result in the successful cultivation of more environmentally relevant species of AOB (compared with the model organism, Nitrosomonas europaea, which is not representative of environmentally dominant species in most freshwater environments). In addition, we hypothesized that (i) AOA will be better able to grow in lower substrate conditions than the AOB, (ii) AOA will be more tolerant of starvation and energy limitation than AOB, and

130 (iii) at very low ammonium concentrations, AOA will be superior competitors for this limiting substrate (201). In order to investigate environmental drivers of diversity of freshwater AOB adapted to low ammonium concentrations, we enriched AOB from sediment collected from six different lakes in Ohio along a gradient of trophic state (ie, from mesotrophic to eutrophic) using low ammonium concentrations (23). The diversity of the resulting enrichment cultures was not different from the community composition detected in the original sediment samples, indicating that ammonium concentration did not influence the community composition. Sequences related to the Nitrosomonas cluster 6a group of AOB, which are commonly found in freshwater environments (27), were found in the enrichments and sediment samples from all lakes. Additionally, Nitrosomonas cluster 8, a eutrophic cluster (27), was enriched only from the most eutrophic lakes samples. In contrast, Nitrosomonas sp Nm143, an oligotrophic AOB (27), was only enriched from the most oligotrophic lake sampled. Canonical correspondence analysis revealed that agricultural watershed land use, along with ammonium and nitrate concentrations, were the strongest drivers of AOB diversity in lakes with agricultural or mixed watersheds. Strong drivers of diversity could not be determined from lakes with forest watersheds, indicating that some other variable(s) that were not measured here had a strong influence on AOB community composition. In the future, further enrichment and diversity investigations should be carried out over a broader range of true oligotrophic lakes to determine factors that drive AOB community composition in these low nutrient environments. The discovery and isolation of AOA in 2005 has led to an interest in determining which ammonia oxidizer contributes more to ammonia oxidation in the environment (51, 53, 211). A great number of studies have focused on the molecular ecology of these organisms (as reviewed in 113), but few have used cultivation-based experiments to investigate the growth differences between AOA and AOB (8, 115). We enriched three AOA from freshwater lake sediments in Ohio that belong to the Group I.1a Thaumarchaeota. To date, these represent the only AOA cultured from freshwater lake environments globally (72). One enrichment, AOA-AC2, is closely related to another cultivated strain, Candidatus Nitrosoarchaeum koreensis (115, 119). The other two enrichments, AOA-AC5 and AOA-DW, represent two species within a new, as of yet unnamed, genus within the phylum Thaumarchaeota.

131 Laboratory characterization of these AOA revealed that they grow slightly faster under conditions of decreasing ammonium concentration, have an optimum pH of 7-7.5 (but will grow throughout a range of 6-8), and are able to grow as well under low oxygen (0.5%) as in atmospheric oxygen (21%) conditions. Furthermore, the AOA are inhibited by exposure to white and blue light at an intensity of 30 µmol photons m-2 s-1 and do not recover following light exposure. The growth rates of the enriched AOA generally corresponded well to other related AOA in pure (8, 53) and enrichment culture when grown under comparable conditions (115, 136). When compared to a freshwater AOB enrichment, AOB-G5-7, all three AOA grew slower than AOB-G5-7 under all conditions tested. The AOA were also more sensitive to light exposure than AOB-G5-7, which was able to grow in the presence of white light and recovered from blue light exposure. Data from the growth experiments initially characterizing the three enriched AOA suggested that light, ammonium concentration, and oxygen concentration would have the strongest influence on niche differentiation between AOA and AOB. Therefore, we tested the ability of AOA-AC1, a close relative to AOA-DW, and AOB-G5-7 to compete directly with one another using continuous cultivation growth techniques under ammonia-limited, standard oxygen (21%) conditions as well as ammonia-limited, low oxygen (1%) conditions. In both cases, within twenty-four days after starting the competition, AOA-AC1 outcompeted AOB-G5-7, and AOB-G5-7 was washed from the chemostats. These results suggest that under the low ammonium concentration used here, AOA-AC1 is a superior competitor for ammonia. In the future, additional competition experiments should be conducted at higher ammonium concentrations, with oxygen as the growth limiting substrate, to determine if there is a threshold ammonium concentration above which AOB-G5-7 is able to outcompete AOA-AC1, and within a range of oxygen concentrations under ammonia limitation to more precisely determine the interplay between the influence of ammonium and oxygen. Due to the frequent fluctuations in nutrient availability in the environment, AOA and AOB must be able to tolerate periods of ammonia starvation, in which they are not able to generate any energy (212). Therefore, we tested the ability of AOA-AC1 and AOB-G5-7 to survive and recover from nearly two months of ammonia starvation. Both AOA-AC1 and AOB- G5-7 were able to recover from starvation; AOB-G5-7 showed no increase in lag time when recovering, regardless of the starvation duration. However, AOA-AC1 had increased lag times

132 when recovering from starvation periods longer than 10 days. During the starvation period, both AOA-AC1 and AOB-G5-7 maintained 16S rRNA at a nearly constant level and amoA mRNA, though the abundance of these transcripts decreased with time. These results suggest that AOA and AOB may employ the use of stable mRNA to tolerate and recover from starvation, and that AOB are better able to recover from prolonged starvation periods. Taken together, our results indicate that while AOA are superior competitors for ammonia at low substrate concentrations, AOB are able to grow better under most laboratory conditions tested, and are able to better survive and recover from starvation. Our results partly confirm our hypotheses: AOA appear to be well suited to growth at very low substrate concentrations that may represent starvation for AOB; however, AOA are not able to tolerate starvation as well as AOB, which is in contrast to our predictions. It is highly probable that AOA are not as well adapted to recover from starvation because they are not frequently exposed to starvation conditions in the environment. While the AOB-G5-7 recovered immediately regardless of starvation duration, and had no increase in lag phase during recovery, the AOA required a longer lag phase before exponential growth after ten or more days of starvation. These results suggest that AOB may have a competitive advantage when recovering from energy starvation. However, AOA in general have an affinity for ammonia 100-10,000 times higher than that of AOB, and should be able to grow at ammonium concentrations lower than those accessible by AOB (8, 27, 115). Given this information, it is reasonable to hypothesize that AOA may be able to continue to grow when ammonia in the environment has been consumed to very low concentrations, while AOB would starve. Therefore, AOA may not need to be adapted to recover quickly from starvation, as they are exposed to starvation conditions far more infrequently than AOB.

Outlook and Future Directions Within a freshwater environment, the community dynamics and competition between AOA and AOB are highly complex. This interaction will be influenced first by the community members present from each group, which will vary by lake type (154). As seen in the data from Chapter 1, the watershed land use and trophic state of a lake has a strong influence on the AOB community composition. Previous work has also indicated that the lake trophic state also influences AOA community composition (154), however it is not clear whether specific

133 phylotypes of AOA are associated with oligotrophic or eutrophic lakes. The competition between AOA and AOB was investigated here with an AOA enriched from a eutrophic environment, and an AOB that belongs to Nitrosomonas cluster 6a, an oligotrophic freshwater group. The competition between the AOA enriched here and an AOB from a eutrophic freshwater cluster, such as Nitrosomonas cluster 8, which were detected in Lakes Acton and Pleasant Hill, is likely to be different due to differences in enzyme kinetics (27) and merits further investigation for the development of a precise model to predict niche separation between AOA and AOB. The data from our initial characterization of the response of AOA and AOB to changing environmental conditions suggests that each group of ammonia oxidizer experiences different limitations in the environment. The AOA studied here experience strong light inhibition, which would preclude the effect of any other environmental parameter (e.g., ammonium concentration). In contrast, AOB are not as photosensitive, but respond more strongly to low concentrations of oxygen and ammonium. It is highly likely that a complex interplay between these three environmental parameters, along with several others not studied here, are involved in delineating the niche separation of AOA and AOB in freshwater environments. In a eutrophic lake, the inputs of nitrogen from activities such as agricultural fertilizing practices can be quite high. As a result, photosynthetic organisms can bloom, resulting in a rapid attenuation of light from the water column (2). Additionally, the high nutrient concentrations associated with eutrophication result in high levels of heterotrophic activity in the upper water column, where oxygen is available. This activity results in the decrease in oxygen with depth, which leaves a portion of the lower water column and sediment anoxic (2). These parameters of eutrophic lakes are likely to allow for strong niche separation of AOA and AOB. In the upper water column, AOA are likely to be strongly inhibited by light, and the ammonium concentrations being supplied to the lake will allow the growth of the AOB (Figure 21). Below the euphotic zone when light has been sufficiently attenuated, the primary factor influencing the competition between AOA and AOB will be the oxygen concentration. As the growth of the AOB becomes oxygen-limited, the AOA will be better able to compete for ammonium and become active. Therefore, when oxygen begins to decrease, the AOA are likely to have their highest activity, when a gradient of low oxygen inhibits the AOB (Figure 21). In the anoxic lower water column, AOA and AOB are not able to oxidize ammonia. During stratification

134

Figure 21. Conceptual model of niche separation of AOA and AOB in a eutrophic freshwater lake. Nutrient and light concentration/intensity (increasing along the x-axis) with depth in the water column (increasing down the y-axis) are noted with colored lines; blue, ammonium; red, nitrate; green, oxygen; black, light. Diagram for the concentration of abiotic factors with depth adapted from (2). The zone of highest AOB activity is indicated by the orange box, the zone of highest AOA activity is indicated by the green box.

135

136 when the sediments of a eutrophic lake are anoxic, the sediment layer will not be a habitat for aerobic ammonia oxidation. Conditions in an oligotrophic lake will be much different from those seen in a eutrophic lake, therefore the niche separation of AOA and AOB will be influenced more strongly by other factors. Oligotrophic lakes have much lower nutrient, and therefore ammonium, concentrations (2). As a result, blooms of photosynthetic organisms occur infrequently if at all, and light penetrates much further into the water column. Additionally, the oxygen concentration is not depleted, as nutrient concentrations are not sufficient to allow the high levels of heterotrophic activity as seen in eutrophic lakes (2). In oligotrophic lakes, the primary driver of niche separation of AOA and AOB will be light penetration (Figure 22). AOA will be strongly inhibited by light in the upper water column, and will not be able to oxidize ammonia until sufficient light has been attenuated. As a result, AOB will be the predominant ammonia oxidizers in the euphotic zone. With sufficiently low light, the AOA will become more competitive with the AOB, and the primary factor influencing the competition between AOA and AOB will be the ammonium concentration. The area of highest AOA activity will be dependent upon the threshold ammonium concentration that drives niche separation between oligotrophic AOA and AOB communities. Under this concentration, the AOA will be the predominant ammonia oxidizer in an oligotrophic lake. As the oxygen concentration remains relatively high in these environments (2), oxygen will likely not play a large role in niche differentiation in oligotrophic lakes. In addition to the water column, there is likely to be competition between AOA and AOB in the oxic sediment layer of oligotrophic lakes. This environment is highly complex, and while the organisms investigated in this study were originally enriched from the sediment, our understanding of how they interact within that environment remains poorly understood. AOA and AOB have been observed to adhere to laboratory surfaces (121), and are likely to associate with soil particles, nitrite-oxidizing bacteria, and heterotrophic bacteria within the sediment (27). The presence of microhabitats on sediment particles and in pore channels creates an additional dynamic for niche separation that has gone unstudied thus far. Therefore, further work will be required to determine how AOA and AOB interact with a matrix environment such as sediment, and how that environment influences competition.

137

Figure 22. Conceptual model of niche separation of AOA and AOB in an oligotrophic freshwater lake. Nutrient and light concentration/intensity (increasing along the x-axis) with depth in the water column (increasing down the y-axis) are noted with colored lines; blue, ammonium; red, nitrate; green, oxygen; black, light. Diagram for the concentration of abiotic factors with depth adapted from (2). The zone of highest AOB activity is indicated by the orange box, the zone of highest AOA activity is indicated by the green box.

138

139 Whether the data observed in this study regarding the niche separation and competition between AOA and AOB is applicable to other habitats remains to be seen. The basic environmental factors most strongly influencing competition, light, ammonium and oxygen, are expected to have the strongest influence on niche differentiation, however there are other variables to consider. Marine, soil, and sediment environments are influenced by different types of nutrient input, and are inhabited by other organisms with different lifestyles and growth modes than freshwater lakes. Therefore, an understanding of how all of these components interact to shape the ammonia oxidizer habitat will be important for determining the competition of AOA and AOB in other environments. In marine environments, nutrient concentrations are usually much lower than in lake environments (86, 91, 209), and as such, light penetration occurs several hundred meters into the water column (192). AOA have been detected well within the euphotic zone in marine environments, indicating that light may not be as strong of a driver of niche separation as in lake environments (192). While recent findings indicate that a predominant marine AOA, N. maritimus, displays similar light sensitivity as the three AOA enriched here (194), it is possible that other species of AOA are not as photosensitive as N. maritimus and could thrive in conditions of higher light intensity. Several reports have detected distinct phylotypes of AOA in the upper water column compared with different groups found deeper in the water column (88, 91, 192). While these different phylotypes may be differentiated by their response to other factors, such as oxygen concentrations, differential photosensitivity cannot be excluded. The extremely low nutrient availability of the open ocean may favor AOA entirely, and in fact many studies of the open ocean find AOA in abundances significantly higher than AOB, if AOB are detected at all (81, 83, 89, 94, 98-100, 104, 107-109, 209, 210, 213). Additionally, several studies have found that the maximal abundance of AOA is well correlated with the nitrite/nitrate maxima, indicating a role of AOA in nitrification in marine environments (85, 88, 91). Another factor that must be considered in the open ocean environment (as well as in other aquatic environments) is the interaction with photosynthetic and heterotrophic organisms. The AOA grown in culture to date seem to have a requirement for some small amount of organic carbon (80, 115, 117), which can be supplied by heterotrophic bacteria in co-culture. The association of AOA and AOB with heterotrophic and/or photosynthetic organisms in aquatic and other

140 environments should be more thoroughly investigated to determine how these interactions may influence niche differentiation. Soil environments are a stark contrast to marine habitats, representing a heterogeneous habitat that is often rich (relative to the open ocean) in nutrients. In soil environments, light is not likely to play a strong role in separating the niche of AOA and AOB. One factor that was not further investigated in influencing the direct competition of AOA and AOB in this study was pH. The pH of soils is highly likely to play a role in driving the dominant ammonia oxidizer community, as many soils are acidic (6, 214), and the only acidophilic ammonia oxidizer known is the AOA Candidatus Nitrosotalea devanaterra (117). In addition, pH was found to be the strongest driver of AOA diversity in a survey of a wide variety of soil types (6). Acid soils are likely to be dominated by AOA, due to the absence of any known acidophilic AOB (27, 117). In neutral soils, the source (organic or inorganic) and concentration of ammonia is predicted to be the strongest driver of competition between AOA and AOB (131). Competition experiments between soil-derived AOA and AOB should be explored in the future due to the differences in ammonium tolerance of the characterized soil isolate N. viennensis (80). It is highly probable that the ammonium threshold separating the niche of soil AOA and AOB is much different than that of the water column/sediment AOA and freshwater AOB investigated in this study. Additionally, the capacity of soil AOA and AOB to tolerate periods of anoxia may contribute to their relative success in soil environments that are periodically exposed to flooding conditions. In addition to factors directly influencing the ammonia-oxidizing activity of AOA, it is quite probable that they have additional metabolic growth mode(s) that have not yet been fully investigated. It has previously been demonstrated that N. viennensis grows mixotrophically (80), and that archaea, some of which could be AOA, in natural marine environments have mixotrophic and heterotrophic growth modes (82). Therefore, it is likely that in natural environments, some AOA could conceivably grow by mechanisms that are not dependent upon strictly autotrophic ammonia oxidation. While this is probably not the case for AOA such as N. maritimus, which requires the presence of ammonia for energy generation (8, 53), it is likely that a large fraction of the amoA-encoding Archaea detected in the environment by sequencing investigations merely possess the amoA gene, and are not dependent upon this lifestyle for growth (73).

141 The ammonia monooxygenase enzyme in AOB and the highly similar methane monooxygenase in methane-oxidizing bacteria (MOB) are promiscuous (215); both are able to oxidize the substrate of the other, as well as aliphatic hydrocarbons, sulfides, and other compounds (11). Oxidation reactions with alternative substrates do not generate energy, however, therefore AOB and MOB are dependent upon ammonia and methane for growth, respectively (11). It is likely that the Amo enzyme of AOA is also not highly specific to ammonia oxidation, thereby allowing archaea expressing this protein to oxidize alternative substrates. Demonstration of these alternative metabolic capabilities will require cultivation of more strains of Thaumarchaeota, and will be dependent upon cultivation strategies that allow for the possibility of mixotrophic requirements and alternative energy generating substrates. Klotz and Stein have proposed that the substrate for energy generation for AOB and MOB (and by extension, AOA) is dependent more upon the downstream suite of enzymes that further transform intermediates and perform electron transfer, rather than the initial promiscuous monooxygenase (79). In this context, alternative substrates for the AOA are entirely plausible, as no other enzymes have been conclusively identified to be involved in energy generation or electron transport after the initial oxidation of ammonia to hydroxylamine by Amo (54, 69, 75). A myriad of multi-copper oxidases have been identified through genome sequencing, and to date few have been assigned putative functions (69, 75). Investigating the function of these enzymes will be critical to fully elucidate the metabolic capabilities of the AOA. Future work to investigate the competition and environmental activities of AOA and AOB should include a deep sequencing effort to determine the differences in community composition throughout the water column and sediment layers in eutrophic and oligotrophic lakes. While some work has been done to characterize the influence of trophic state and watershed land use on the community composition of AOB here, sequencing technology has advanced considerably since this work was done, rendering the data generated here paltry in comparison to what could be achieved today. Additionally, fluorescence in situ hybridization should be used to probe the interactions of AOA and AOB with other microorganisms throughout the water column. These experiments could provide crucial insight into the requirement of AOA to be cultured with a heterotrophic bacterium. The full investigation of activity by AOA and AOB throughout the water column could be done through the use of dialysis incubations in both eutrophic and oligotrophic freshwater

142 environments. Preliminary experiments of this nature have been conducted in our lab, and indicate that both AOA and AOB will grow when enclosed in dialysis tubing and incubated in a eutrophic lake. There is a tendency for the growth of AOB to decrease with depth, and the growth of AOA to increase with depth, supporting the models presented here (Figures 21 and 22) (French and Bollmann, unpubl). However, these experiments were conducted while the water column was mixing, therefore the gradients of ammonia and oxygen were not established and a precise determination of the specific zones of maximal AOA and AOB activity could not be determined. These types of experiments could provide clear evidence regarding the growth and activity of AOA and AOB in the predicted zones of highest activity (orange and green boxes, Figures 21 and 22). Additionally, samples from such experiments could be used to conduct transcriptomic and proteomic investigations into the metabolism employed by AOA in the environment, and give a greater insight into the role these organisms play in biogeochemical cycling in the environment. In addition to aerobic nitrification, it would be of interest to investigate the potential for anammox bacteria to be involved in nitrogen cycling in freshwater sediments. Very little work has been done on the freshwater ecology of these organisms (216), and their role in ammonia oxidation in anaerobic freshwater habitats is of interest for a full understanding of nitrogen cycling, particularly in eutrophic environments. Furthermore, previous work has demonstrated the potential for an interaction to take place between AOA and anammox bacteria, in which AOA in marine oxygen minimum zones may provide the nitrite necessary for anaerobic ammonia oxidation by the anammox bacteria (217). An investigation of ammonia oxidation in freshwater sediments may yield interesting data regarding the competition and cooperation of nitrogen cycling microorganisms.

143 REFERENCES

1. Chesson P. 2000. Mechanisms of maintenance of species diversity. Annual Review of Ecology and Systematics 31:343–366. 2. Wetzel RG. 2001. Limnology, 3rd ed. Academic Press, San Diego, CA. 3. Kowalchuk G, Bodelier P, Heilig G, Stephen J. 1998. Community analysis of ammonia-oxidising bacteria, in relation to oxygen availability in soils and root- oxygenated sediments, using PCR, DGGE and oligonucleotide probe hybridisation. FEMS Microbiology Ecology 27:339–350. 4. Coci M, Bodelier PLE, Laanbroek HJ. 2008. Epiphyton as a Niche for Ammonia- Oxidizing Bacteria: Detailed Comparison with Benthic and Pelagic Compartments in Shallow Freshwater Lakes. Applied and Environmental Microbiology 74:1963–1971. 5. Carbonero F, Oakley BB, Hawkins RJ, Purdy KJ. 2011. Genotypic Distribution of a Specialist Model Microorganism, Methanosaeta, along an Estuarine Gradient: Does Metabolic Restriction Limit Niche Differentiation Potential? Microbial Ecology 63:856– 864. 6. Gubry-Rangin C, Hai B, Quince C, Engel M, Thomson BC, James P, Schloter M, Griffiths RI, Prosser JI, Nicol GW. 2011. Niche specialization of terrestrial archaeal ammonia oxidizers. Proceedings of the National Academy of Sciences 108:21206– 21211. 7. Bollmann A, Baer-Gilissen M, Laanbroek H. 2002. Growth at Low Ammonium Concentrations and Starvation Response as Potential Factors Involved in Niche Differentiation among Ammonia-Oxidizing Bacteria. Applied and Environmental Microbiology 68:4751–4757. 8. Martens-Habbena W, Berube PM, Urakawa H, La Torre De JR, Stahl DA. 2009. Ammonia oxidation kinetics determine niche separation of nitrifying Archaea and Bacteria. Nature 461:976–979. 9. Ward BB. 2011. Nitrification: An introduction and overview of the state of the field, pp. 3–8. In Nitrification. ASM Press. 10. Francis CA, Beman JM, Kuypers MMM. 2007. New processes and players in the nitrogen cycle: the microbial ecology of anaerobic and archaeal ammonia oxidation. The

144 ISME Journal 1:19–27. 11. Arp D, Sayavedra-Soto L, Hommes N. 2002. Molecular biology and biochemistry of ammonia oxidation by Nitrosomonas europaea. Archives of Microbiology 178:250–255. 12. Kartal B, Keltjens JT, Jetten MSM. 2011. Metabolism and genomics of ANAMMOX bacteria, pp. 181–200. In Nitrification. ASM Press. 13. Galloway JN, Cowling EB. 2002. Reactive nitrogen and the world: 200 years of change. AMBIO: A Journal of the Human Environment 31:64–71. 14. Dybas CL. 2005. Dead zones spreading in world oceans. BioScience 55:552–557. 15. Lipschultz F, Zafirious OC, Wofsy SC, McElroy MB, Valois FW, Watson SW.

1981. Production of NO and N2O by soil nitrifying bacteria. Nature 294:641–643. 16. Santoro AE, Buchwald C, McIlvin MR, Casciotti KL. 2011. Isotopic Signature of N2O Produced by Marine Ammonia-Oxidizing Archaea. Science 333:1282–1285. 17. Stein LY. 2011. Heterotrophic nitrification and nitrifier denitrification, pp. 95–114. In Nitrification. ASM Press. 18. Carpenter SR, Stanley EH, Vander Zanden MJ. 2011. State of the World's Freshwater Ecosystems: Physical, Chemical, and Biological Changes. Annual Review of Environment and Resources 36:75–99. 19. Baron JS, Poff NLR, Angermeier PL, Dahm CN, Gleick PH, Hairston NG Jr, Jackson RB, Johnston CA, Richter BD, Steinman AD. 2002. Meeting ecological and societal needs for freshwater. Ecological Applications 12:1247–1260. 20. Kimmel BL, Lind OT, Paulson LJ. 1990. Reservoir primary production, pp. 133–193. In Thornton, KW, Kimmel, BL, Payne, FE (eds.), Reservoir limnology: Ecological persepctives. Wiley. 21. Wetzel RG. 1990. Reservoir ecosystems: Conclusions and speculations, pp. 227–238. In Thornton, KW, Kimmel, BL, Payne, FE (eds.), Reservoir limnology: Ecological perspectives. Wiley. 22. Carlson RE. 1977. A trophic state index for lakes. Limnology and Oceanography 22:361–369. 23. Knoll L, Vanni M, Renwick W. 2003. Phytoplankton primary production and photosynthetic parameters in reservoirs along a gradient of watershed land use. Limnology and Oceanography 48:608–617.

145 24. Laanbroek HJ, Bollmann A. 2011. Nitrification in inland waters, pp. 385–403. In Nitrification. ASM Press. 25. Schleper C, Holben W, Klenk HP. 1997. Recovery of crenarchaeotal ribosomal DNA sequences from freshwater-lake sediments. Applied and Environmental Microbiology 63:321–323. 26. Ye W, Liu X, Lin S, Tan J, Pan J, Li D, Yang H. 2009. The vertical distribution of bacterial and archaeal communities in the water and sediment of Lake Taihu. FEMS Microbiology Ecology 70:263–276. 27. Koops H-P, Purkhold U, Pommerening-Röser A, Timmermann G, Wagner M. 2006. The Lithoautotrophic Ammonia-Oxidizing Bacteria, pp. 778–811. In The Prokaryotes. Springer. 28. Pauer JJ, Auer MT. 2000. Nitrification in the water column and sediment of a hypereutrophic lake and adjoining river system. Water Research 34:1247–1254. 29. Koops H, Pommerening-Roeser A. 2001. Distribution and ecophysiology of the nitrifying bacteria emphasizing cultured species. FEMS Microbiology Ecology 37:1–9. 30. Chain P, Lamerdin J, Larimer F, Regala W, Lao V. 2003. Complete Genome Sequence of the Ammonia-Oxidizing Bacterium and Obligate Chemolithoautotroph Nitrosomonas europaea. Journal of Bacteriology 185:2759–2773. 31. Klotz MG, Arp DJ, Chain PSG, El-Sheikh AF, Hauser LJ, Hommes NG, Larimer FW, Malfatti SA, Norton JM, Poret-Peterson AT, Vergez LM, Ward BB. 2006. Complete Genome Sequence of the Marine, Chemolithoautotrophic, Ammonia- Oxidizing Bacterium Nitrosococcus oceani ATCC 19707. Applied and Environmental Microbiology 72:6299–6315. 32. Norton JM, Klotz MG, Stein LY, Arp DJ, Bottomley PJ, Chain PSG, Hauser LJ, Land ML, Larimer FW, Shin MW, Starkenburg SR. 2008. Complete Genome Sequence of Nitrosospira multiformis, an Ammonia-Oxidizing Bacterium from the Soil Environment. Applied and Environmental Microbiology 74:3559–3572. 33. Stein LY, Arp DJ, Berube PM, Chain PSG, Hauser L, Jetten MSM, Klotz MG, Larimer FW, Norton JM, Op Den Camp HJM, Shin M, Wei X. 2007. Whole- genome analysis of the ammonia-oxidizing bacterium, Nitrosomonas eutropha C91: implications for niche adaptation. Environmental Microbiology 9:2993–3007.

146 34. Hommes N, Sayavedra-Soto L, Arp D. 2003. Chemolithoorganotrophic Growth of Nitrosomonas europaea on Fructose. Journal of Bacteriology 185:6809–6814. 35. Arp DJ, Chain PSG, Klotz MG. 2007. The impact of genome analyses on our understanding of ammonia-oxidizing bacteria. Annual Review of Microbiology 61:503– 528. 36. Smith AJ, Hoare DS. 1977. Specialist phototrophs, lithotrophs, and methylotrophs: a unity among a diversity of procaryotes? Bacteriological Reviews 41:419–448. 37. Wood A. 2004. A challenge for 21st century molecular biology and biochemistry: what are the causes of obligate autotrophy and methanotrophy? FEMS Microbiology Reviews 28:335–352. 38. Hooper, AB. 1969. Biochemical Basis of Obligate Autotrophy in Nitrosomonas europaea. Journal of Bacteriology 97:776–779. 39. Koops HP, Böttcher B, Möller UC, Pommerening-Roser A, Stehr G. 1990. Description of a new species of Nitrosococcus. Archives of Microbiology 154:244–248. 40. Head IM, Hiorns WD, Embley TM, McCarthy AJ, Saunders JR. 1993. The phylogeny of autotrophic ammonia-oxidizing bacteria as determined by analysis of 16S ribosomal RNA gene sequences. Microbiology 139:1147–1153. 41. Jones RD, Morita RY, Koops H-P, Watson SW. 1988. A new marine ammonium oxidizing bacterium, Nitrosomonas cryotolerans sp. nov. Canadian Journal of Microbiology 34:1122–1128. 42. Koops HP, Böttcher B, Möller UC, Pommerening-Roser A, Stehr G. 1991. Classification of eight new species of ammonia-oxidizing bacteria: Nitrosomonas communis sp. nov., Nitrosomonas ureae sp. nov., Nitrosomonas aestuarii sp. nov., Nitrosomonas marina sp. nov., Nitrosomonas nitrosa sp. nov., Nitrosomonas eutropha sp. nov., Nitrosomonas oligotropha sp. nov. and Nitrosomonas halophila sp. nov. Microbiology 137:1689–1699. 43. Pommerening-Röser A, Rath G, Koops H-P. 1996. Phylogenetic diversity within the genus Nitrosomonas. Systematic and Applied Microbiology 19:344–351. 44. Suwa Y, Sumino T, Noto K. 1997. Phylogenetic relationships of activated sludge isolates of ammonia oxidizers with different sensitivities to ammonium sulfate. Journal of General and Applied Microbiology 43:373–379.

147 45. Stehr G, Böttcher B, Dittberner P, Rath G, Koops H. 1995. The ammonia-oxidizing nitrifying population of the River Elbe estuary. FEMS Microbiology Ecology 17:177– 186. 46. Hiorns WD, Hastings RC, Head IM, McCarthy AJ, Saunders JR, Pickup RW, Hall GH. 1995. Amplification of 16S ribosomal RNA genes of autotrophic ammonia- oxidizing bacteria demonstrates the ubiquity of nitrosospiras in the environment. Microbiology 141:2793–2800. 47. Kowalchuk G, Stephen J. 2001. Ammonia-oxidizing bacteria: A model for molecular microbial ecology. Annual Review of Microbiology 55:485–529. 48. Bollmann A, Schmidt I, Saunders A, Nicolaisen M. 2005. Influence of starvation on potential ammonia-oxidizing activity and amoA mRNA levels of Nitrosospira briensis. Applied and Environmental Microbiology 71:1276–1282. 49. Johnstone BH, Jones RD. 1988. Effects of light and CO on the survival of a marine ammonium-oxidizing bacterium during energy source deprivation. Applied and Environmental Microbiology 54:2890–2893. 50. Jones RD, Morita RY. 1985. Survival of a marine ammonium oxidizer under energy- source deprivation. Marine Ecology - Progress Series 26:175–179. 51. Venter JC, K R, Heidelberg JF, Halpern AL, Rusch D, Eisen JA, Wu D, Paulsen I, Nelson KE, Nelson W, Fouts DE, Levy S, Knap AH, Lomas MW, Nealson K, White O, Peterson J, Hoffman J, Parsons R, Baden-Tillson H, Pfannkoch C, Rogers YH, Smith HO. 2004. Environmental Genome Shotgun Sequencing of the Sargasso Sea. Science 304:66–74. 52. Treusch AH, Leininger S, Kletzin A, Schuster SC, Klenk H-P, Schleper C. 2005. Novel genes for nitrite reductase and Amo-related proteins indicate a role of uncultivated mesophilic crenarchaeota in nitrogen cycling. Environmental Microbiology 7:1985–1995. 53. Könneke M, Bernhard AE, La Torre De JR, Walker CB, Waterbury JB, Stahl DA. 2005. Isolation of an autotrophic ammonia-oxidizing marine archaeon. Nature 437:543– 546. 54. Stahl DA, La Torre De JR. 2012. Physiology and Diversity of Ammonia-Oxidizing Archaea. Annual Review of Microbiology 66:83–101.

148 55. DeLong EF. 1992. Archaea in coastal marine environments. Proceedings of the National Academy of Sciences 89:5685–5689. 56. Fuhrman JA, McCallum K, Davis AA. 1992. Novel major archaebacterial group from marine plankton. Nature 356:148–149. 57. Massana R, DeLong EF, Pedros-Alio C. 2000. A Few Cosmopolitan Phylotypes Dominate Planktonic Archaeal Assemblages in Widely Different Oceanic Provinces. Applied and Environmental Microbiology 66:1777–1787. 58. Church MJ, DeLong EF, Ducklow HW, Karner MB, Preston CM, Karl DM. 2003. Abundance and distribution of planktonic Archaea and Bacteria in the waters west of the Antarctic Peninsula. Limnology and Oceanography 48:1893–1902. 59. Karner MB, DeLong EF, Karl DM. 2001. Archaeal dominance in the mesopelagic zone of the Pacific Ocean. Nature 409:507–510. 60. Lehtovirta LE, Prosser JI, Nicol GW. 2009. Soil pH regulates the abundance and diversity of Group 1.1c Crenarchaeota. FEMS Microbiology Ecology 70:367–376. 61. Ochsenreiter T, Selezi D, Quaiser A, Bonch-Osmolovskaya L, Schleper C. 2003. Diversity and abundance of Crenarchaeota in terrestrial habitats studied by 16S RNA surveys and real time PCR. Environmental Microbiology 5:787–797. 62. Hershberger KL, Barns SM, Reysenbach AL, Dawson SC, Pace NR. 1996. Wide diversity of Crenarchaeota. Nature 384:420. 63. MacGregor BJ, Moser DP, Baker BJ, Alm EW, Maurer M, Nealson KH, Stahl DA. 2001. Seasonal and Spatial Variability in Lake Michigan Sediment Small-Subunit rRNA Concentrations. Applied and Environmental Microbiology 67:3908–3922. 64. Vetriani C, Reysenbach AL, Doré J. 2006. Recovery and phylogenetic analysis of archaeal rRNA sequences from continental shelf sediments. FEMS Microbiology Letters 161:83–88. 65. Bernhard AE, Bollmann A. 2010. Estuarine nitrifiers: New players, patterns and processes. Estuarine, Coastal and Shelf Science 88:1–11. 66. Bernhard AE, Landry ZC, Blevins A, la Torre de JR, Giblin AE, Stahl DA. 2010. Abundance of Ammonia-Oxidizing Archaea and Bacteria along an Estuarine Salinity Gradient in Relation to Potential Nitrification Rates. Applied and Environmental Microbiology 76:1285–1289.

149 67. Crump BC, Baross JA. 2006. Archaeaplankton in the Columbia River, its estuary and the adjacent coastal ocean, USA. FEMS Microbiology Ecology 31:231–239. 68. Hallam SJ, Konstantinidis KT, Brochier C, Putnam N, Schleper C, Watanabe Y, Sugahara J, Preston C, La Torre De J, Richardson PM. 2006. Genomic analysis of the symbiotic marine crenarchaeon, Cenarchaeum symbiosum. Proceedings of the National Academy of Sciences 103:18296–18301. 69. Walker CB, la Torre de JR, Klotz MG, Urakawa H, Pinel N, Arp DJ, Brochier- Armanet C, Chain PSG, Chan PP, Gollabgir A, Hemp J, Hugler M, Karr EA, Konneke M, Shin M, Lawton TJ, Lowe T, Martens-Habbena W, Sayavedra-Soto LA, Lang D, Sievert SM, Rosenzweig AC, Manning G, Stahl DA. 2010. Nitrosopumilus maritimus genome reveals unique mechanisms for nitrification and autotrophy in globally distributed marine crenarchaea. Proceedings of the National Academy of Sciences 107:8818–8823. 70. Brochier-Armanet C, Boussau B, Gribaldo S, Forterre P. 2008. Mesophilic crenarchaeota: proposal for a third archaeal phylum, the Thaumarchaeota. Nature Reviews Microbiology 6:245–252. 71. Spang A, Hatzenpichler R, Brochier-Armanet C, Rattei T, Tischler P, Spieck E, Streit W, Stahl DA, Wagner M, Schleper C. 2010. Distinct gene set in two different lineages of ammonia-oxidizing archaea supports the phylum Thaumarchaeota. Trends in Microbiology 18:331–340. 72. Hatzenpichler R. 2012. Diversity, Physiology, and Niche Differentiation of Ammonia- Oxidizing Archaea. Applied and Environmental Microbiology 78:7501–7510. 73. Mußmann M, Brito I, Pitcher A, Damsté JSS, Hatzenpichler R, Richter A, Nielsen JL, Nielsen PH, Müller A, Daims H. 2011. Thaumarchaeotes abundant in refinery nitrifying sludges express amoA but are not obligate autotrophic ammonia oxidizers. Proceedings of the National Academy of Sciences 108:16771–16776. 74. Bartossek R, Spang A, Weidler G, Lanzen A, Schleper C. 2012. Metagenomic analysis of ammonia-oxidizing archaea affiliated with the soil group. Frontiers in Microbiology 3. 75. Blainey PC, Mosier AC, Potanina A, Francis CA, Quake SR. 2011. Genome of a Low-Salinity Ammonia-Oxidizing Archaeon Determined by Single-Cell and

150 Metagenomic Analysis. PLoS ONE 6:e16626. 76. Kim B, Jung M, Yu D, Park S, Oh TK, Rhee SK, Kim JF. 2011. Genome Sequence of an Ammonia-Oxidizing Soil Archaeon, “Candidatus Nitrosoarchaeum koreensis” MY1. Journal of Bacteriology 193:5539–5540. 77. Vajrala N, Martens-Habbena W, Sayavedra-Soto LA, Schauer A, Bottomley PJ, Stahl DA, Arp DJ. 2013. Hydroxylamine as an intermediate in ammonia oxidation by globally abundant marine archaea. Proceedings of the National Academy of Sciences 110:1006–1011. 78. Schleper C, Nicol GW. 2010. Ammonia-oxidising archaea: physiology, ecology and evolution. Advances in Microbial Physiology 57:1–41. 79. Klotz MG, Stein LY. 2011. Genomics of ammonia-oxidizing bacteria and insights into their evolution, pp. 57–94. In Nitrification. ASM Press. 80. Tourna M, Stieglmeier M, Spang A, Könneke M, Schintlmeister A, Urich T, Engel M, Schloter M, Wagner M, Richter A, Schleper C. 2011. Nitrososphaera viennensis, an ammonia oxidizing archaeon from soil. Proceedings of the National Academy of Sciences 108:8420–8425. 81. Hatzenpichler R, Lebedeva E, Spieck E, Stoecker K, Richter A, Daims H, Wagner M. 2008. A moderately thermophilic ammonia-oxidizing crenarchaeote from a hot spring. Proceedings of the National Academy of Sciences 105:2134. 82. Ouverney CC, Fuhrman JA. 2000. Marine planktonic Archaea take up amino acids. Applied and Environmental Microbiology 67:1023. 83. Francis C, Roberts K, Beman J, Santoro A. 2005. Ubiquity and diversity of ammonia- oxidizing archaea in water columns and sediments of the ocean. Proceedings of the National Academy of Sciences 102:14683–14688. 84. Wuchter C, Abbas B, Coolen M, Herfort L, van J. 2006. Archaeal nitrification in the ocean. Proceedings of the National Academy of Sciences. 85. Coolen MJL, Abbas B, Van Bleijswijk J, Hopmans EC, Kuypers MMM, Wakeham SG, Sinninghe Damsté JS. 2007. Putative ammonia-oxidizing Crenarchaeota in suboxic waters of the Black Sea: a basin-wide ecological study using 16S ribosomal and functional genes and membrane lipids. Environmental Microbiology 9:1001–1016. 86. Herfort L, Schouten S, Abbas B, Veldhuis MJW, Coolen MJL, Wuchter C, Boon

151 JP, Herndl GJ, Sinninghe Damsté JS. Variations in spatial and temporal distribution of Archaea in the North Sea in relation to environmental variables. FEMS Microbiology Ecology 62:242–257. 87. Lam P, Jensen MM, Lavik G, McGinnis DF, Müller B, Schubert CJ, Amann R, Thamdrup B, Kuypers MMM. 2007. Linking crenarchaeal and bacterial nitrification to anammox in the Black Sea. Proceedings of the National Academy of Sciences 104:7104–7109. 88. Mincer TJ, Church MJ, Taylor LT, Preston C, Karl DM, Delong EF. 2007. Quantitative distribution of presumptive archaeal and bacterial nitrifiers in Monterey Bay and the North Pacific Subtropical Gyre. Environmental Microbiology 9:1162–1175. 89. Nakagawa T, Mori K, Kato C, Takahashi R, Tokuyama T. 2007. Distribution of cold-adapted ammonia-oxidizing microorganisms in the deep-ocean of the northeastern Japan Sea. Microbes and Environments 22:365–372. 90. Agogué H, Brink M, Dinasquet J, Herndl GJ. 2008. Major gradients in putatively nitrifying and non-nitrifying Archaea in the deep North Atlantic. Nature 456:788–791. 91. Beman JM, Popp BN, Francis CA. 2008. Molecular and biogeochemical evidence for ammonia oxidation by marine Crenarchaeota in the Gulf of California. The ISME Journal 2:429–441. 92. Santoro AE, Francis CA, De Sieyes NR, Boehm AB. 2008. Shifts in the relative abundance of ammonia-oxidizing bacteria and archaea across physicochemical gradients in a subterranean estuary. Environmental Microbiology 10:1068–1079. 93. Beman J, Francis C. 2006. Diversity of Ammonia-Oxidizing Archaea and Bacteria in the Sediments of a Hypernutrified Subtropical Estuary: Bahia del Tobari, Mexico. Applied and Environmental Microbiology 72:7767. 94. Caffrey JM, Bano N, Kalanetra K, Hollibaugh JT. 2007. Ammonia oxidation and ammonia-oxidizing bacteria and archaea from estuaries with differing histories of hypoxia. The ISME Journal 1:660–662. 95. Mosier AC, Francis CA. 2008. Relative abundance and diversity of ammonia-oxidizing archaea and bacteria in the San Francisco Bay estuary. Environmental Microbiology 10:3002–3016. 96. Sahan E, Muyzer G. 2008. Diversity and spatio-temporal distribution of ammonia-

152 oxidizing Archaea and Bacteria in sediments of the Westerschelde estuary. FEMS Microbiology Ecology 64:175–186. 97. Herrmann M, Saunders AM, Schramm A. 2008. Archaea Dominate the Ammonia- Oxidizing Community in the Rhizosphere of the Freshwater Macrophyte Littorella uniflora. Applied and Environmental Microbiology 74:3279–3283. 98. Leininger S, Urich T, Schloter M, Schwark L, Qi J, Nicol GW, Prosser JI, Schuster SC, Schleper C. 2006. Archaea predominate among ammonia-oxidizing prokaryotes in soils. Nature 442:806–809. 99. He J-Z, Shen J-P, Zhang L-M, Zhu Y-G, Zheng Y-M, Xu M-G, Di H. 2007. Quantitative analyses of the abundance and composition of ammonia-oxidizing bacteria and ammonia-oxidizing archaea of a Chinese upland red soil under long-term fertilization practices. Environmental Microbiology 9:2364–2374. 100. Adair KL, Schwartz E. 2008. Evidence that Ammonia-Oxidizing Archaea are More Abundant than Ammonia-Oxidizing Bacteria in Semiarid Soils of Northern Arizona, USA. Microbial Ecology 56:420–426. 101. Boyle-Yarwood SA, Bottomley PJ, Myrold DD. 2008. Community composition of ammonia-oxidizing bacteria and archaea in soils under stands of red alder and Douglas fir in Oregon. Environmental Microbiology 10:2956–2965. 102. Hansel CM, Fendorf S, Jardine PM, Francis CA. 2008. Changes in Bacterial and Archaeal Community Structure and Functional Diversity along a Geochemically Variable Soil Profile. Applied and Environmental Microbiology 74:1620–1633. 103. Le Roux X, Poly F, Currey P, Commeaux C, Hai B, Nicol GW, Prosser JI, Schloter M, Attard E, Klumpp K. 2007. Effects of aboveground grazing on coupling among nitrifier activity, abundance and community structure. The ISME Journal 2:221–232. 104. Shen J-P, Zhang L-M, Zhu Y-G, Zhang J-B, He J-Z. 2008. Abundance and composition of ammonia-oxidizing bacteria and ammonia-oxidizing archaea communities of an alkaline sandy loam. Environmental Microbiology 10:1601–1611. 105. Tourna M, Freitag TE, Nicol GW, Prosser JI. 2008. Growth, activity and temperature responses of ammonia-oxidizing archaea and bacteria in soil microcosms. Environmental Microbiology 10:1357–1364. 106. Spear JR, Barton HA, Robertson CE, Francis CA, Pace NR. 2007. Microbial

153 Community Biofabrics in a Geothermal Mine Adit. Applied and Environmental Microbiology 73:6172–6180. 107. la Torre de JR, Walker CB, Ingalls AE, Könneke M, Stahl DA. 2008. Cultivation of a thermophilic ammonia oxidizing archaeon synthesizing crenarchaeol. Environmental Microbiology 10:810–818. 108. Reigstad LJ, Richter A, Daims H, Urich T, Schwark L, Schleper C. Nitrification in terrestrial hot springs of Iceland and Kamchatka. FEMS Microbiology Ecology 64:167– 174. 109. Beman J, Roberts K, Wegley L, Rohwer F, Francis C. 2007. Distribution and Diversity of Archaeal Ammonia Monooxygenase Genes Associated with Corals. Applied and Environmental Microbiology 73:5642. 110. Urakawa H, Martens-Habbena W, Stahl DA. 2011. Physiology and genomics of ammonia oxidizing archaea, pp. 117–155. In Nitrification. ASM Press. 111. Urakawa H, Tajima Y, Numata Y, Tsuneda S. 2008. Low Temperature Decreases the Phylogenetic Diversity of Ammonia-Oxidizing Archaea and Bacteria in Aquarium Biofiltration Systems. Applied and Environmental Microbiology 74:894. 112. Weidler GW, Dornmayr-Pfaffenhuemer M, Gerbl FW, Heinen W, Stan-Lotter H. 2006. Communities of Archaea and Bacteria in a Subsurface Radioactive Thermal Spring in the Austrian Central Alps, and Evidence of Ammonia-Oxidizing Crenarchaeota. Applied and Environmental Microbiology 73:259–270. 113. Erguder TH, Boon N, Wittebolle L, Marzorati M, Verstraete W. 2009. Environmental factors shaping the ecological niches of ammonia-oxidizing archaea. FEMS Microbiology Reviews 33:855–869. 114. Nicol GW, Leininger S, Schleper C. 2011. Distribution and activity of ammonia- oxidizing archaea in natural environments, pp. 157–178. In Nitrification. ASM Press. 115. Jung MY, Park S-J, Min D, Kim JS, Rijpstra WIC, Sinninghe Damste JS, Kim GJ, Madsen EL, Rhee SK. 2011. Enrichment and Characterization of an Autotrophic Ammonia-Oxidizing Archaeon of Mesophilic Crenarchaeal Group I.1a from an Agricultural Soil. Applied and Environmental Microbiology 77:8635–8647. 116. Mosier AC, Allen EE, Kim M, Ferriera S, Francis CA. 2012. Genome Sequence of “Candidatus Nitrosopumilus salaria” BD31, an Ammonia-Oxidizing Archaeon from the

154 San Francisco Bay Estuary. Journal of Bacteriology 194:2121–2122. 117. Lehtovirta-Morley L, Stoecker K, Vilcinskas A, Prosser JI, Nicol GW. 2011. Cultivation of an obligate acidophilic ammonia oxidizer from a nitrifying acid soil. Proceedings of the National Academy of Sciences 108:15892–15897. 118. Bollmann A, French E, Laanbroek HJ. 2011. Isolation, cultivation, and characterization of ammonia-oxidizing bacteria and archaea adapted to low ammonium concentrations. Methods in Enzymology 486:55–88. 119. Kim J-G, Jung M-Y, Park S-J, Rijpstra WIC, Sinninghe Damsté JS, Madsen EL, Min D, Kim J-S, Kim G-J, Rhee S-K. 2012. Cultivation of a highly enriched ammonia-oxidizing archaeon of thaumarchaeotal group I.1b from an agricultural soil. Environmental Microbiology 14:1528–1543. 120. Bollmann A, Laanbroek H. 2002. Influence of oxygen partial pressure and salinity on the community composition of ammonia-oxidizing bacteria in the Schelde estuary. Aquatic Microbial Ecology 28:239–247. 121. Bollmann A, Laanbroek H. 2001. Continuous culture enrichments of ammonia- oxidizing bacteria at low ammonium concentrations. FEMS Microbiology Ecology 37:211–221. 122. Schultz JS, Gerhardt P. 1969. Dialysis culture of microorganisms: design, theory, and results. Bacteriological Reviews 33:1. 123. Bollmann A, Lewis K, Epstein SS. 2007. Incubation of Environmental Samples in a Diffusion Chamber Increases the Diversity of Recovered Isolates. Applied and Environmental Microbiology 73:6386–6390. 124. Verhagen F, Laanbroek HJ. 1991. Competition for Ammonium Between Nitrifying and Heterotrophic Bacteria in Dual Energy-Limited Chemostats. Applied and Environmental Microbiology 57:3255–3263. 125. Verhagen F, Duyts H, Laanbroek HJ. 1992. Competition for Ammonium Between Nitrifying and Heterotrophic Bacteria in Continuously Percolated Soil Columns. Applied and Environmental Microbiology 58:3303–3311. 126. Verhagen F, Hageman P, Woldendorp J. 1994. Competition for ammonium between nitrifying bacteria and plant roots in soil in pots; Effects of grazing by flagellates and fertilization. Soil Biology and Biochemistry 26:89–96.

155 127. Beman JM, Popp BN, Alford SE. 2012. Quantification of ammonia oxidation rates and ammonia-oxidizing archaea and bacteria at high resolution in the Gulf of California and eastern tropical North Pacific Ocean. Limnology and Oceanography 57:711–726. 128. Bouskill NJ, Eveillard D, Chien D, Jayakumar A, Ward BB. 2012. Environmental factors determining ammonia-oxidizing organism distribution and diversity in marine environments. Environmental Microbiology 14:714–729. 129. Jia Z, Conrad R. 2009. Bacteria rather than Archaea dominate microbial ammonia oxidation in an agricultural soil. Environmental Microbiology 11:1658–1671. 130. Reed DW, Smith JM, Francis CA, Fujita Y. 2010. Responses of Ammonia-Oxidizing Bacterial and Archaeal Populations to Organic Nitrogen Amendments in Low-Nutrient Groundwater. Applied and Environmental Microbiology 76:2517–2523. 131. Levičnik-Höfferle Š, Nicol GW, Ausec L, Mandić-Mulec I, Prosser JI. 2012. Stimulation of thaumarchaeal ammonia oxidation by ammonia derived from organic nitrogen but not added inorganic nitrogen. FEMS Microbiology Ecology 80:114–123. 132. Hollibaugh JT, Gifford S, Sharma S, Bano N, Moran MA. 2010. Metatranscriptomic analysis of ammonia-oxidizing organisms in an estuarine bacterioplankton assemblage. The ISME Journal 5:866–878. 133. Lieberman RL, Kondapalli KC, Shrestha DB, Hakemian AS, Smith SM, Telser J, Kuzelka J, Gupta R, Borovik AS, Lippard SJ, Hoffman BM, Rosenzweig AC, Stemmler TL. 2006. Characterization of the Particulate Methane Monooxygenase Metal Centers in Multiple Redox States by X-ray Absorption Spectroscopy. Inorganic Chemistry 45:8372–8381. 134. Murray R, Watson SW. 1965. Structure of Nitrosocystis oceanus and Comparison with Nitrosomonas and Nitrobacter. Journal of Bacteriology 89:1594. 135. Park B-J, Park S-J, Yoon D-N, Schouten S, Sinninghe Damste JS, Rhee SK. 2010. Cultivation of Autotrophic Ammonia-Oxidizing Archaea from Marine Sediments in Coculture with Sulfur-Oxidizing Bacteria. Applied and Environmental Microbiology 76:7575–7587. 136. Mosier AC, Lund MB, Francis CA. 2012. Ecophysiology of an Ammonia-Oxidizing Archaeon Adapted to Low-Salinity Habitats. Microbial Ecology 64:955–963. 137. Pelve EA, Lindås A-C, Martens-Habbena W, La Torre De JR, Stahl DA,

156 Bernander R. 2011. Cdv-based cell division and cell cycle organization in the thaumarchaeon Nitrosopumilus maritimus. Molecular Microbiology 82:555–566. 138. Leibold MA, McPeek MA. 2006. Coexistence of the niche and neutral perspectives in community ecology. Ecology 87:1399–1410. 139. Wood PM. 1986. Nitrification as bacterial energy source, pp. 39–62. In Prosser, JI (ed.), Nitrification. IRL Press, Oxford, England. 140. Beaumont HJE, Lens SI, Reijnders W, Westerhoff HV, van Spanning RJM. 2004. Expression of nitrite reductase in Nitrosomonas europaea involves NsrR, a novel-nitrite sensitive transcription repressor. Molecular Microbiology 54:148–158. 141. Clark C, Schmidt EL. 1967. Uptake and utilization of amino acids by resting cells of Nitrosomonas europaea. Journal of Bacteriology 93:1309–1315. 142. Hommes NG, Sayavedra-Soto LA, Arp DJ. 2001. Transcript Analysis of Multiple Copies of amo (Encoding Ammonia Monooxygenase) and hao (Encoding Hydroxylamine Oxidoreductase) in Nitrosomonas europaea. Journal of Bacteriology 183:1096–1100. 143. Stein L, Arp D. 1998. Ammonium limitation results in the loss of ammonia-oxidizing activity in Nitrosomonas europaea. Applied and Environmental Microbiology 64:1514– 1521. 144. Speksnijder AGCL, Kowalchuk GA, Roest K, Laanbroek HJ. 1998. Recovery of a Nitrosomonas-like 16S rDNA Sequence Group from Freshwater Habitats. Systematic and Applied Microbiology 21:321–330. 145. Kandeler E, Gerber H. 1988. Short-Term Assay of Soil Urease Activity Using Colorimetric Determination of Ammonium. Biology and Fertility of Soils 6:68–72. 146. Keeney DR, Nelson DW. 1982. Nitrogen - Inorganic forms, pp. 643–698. In Page, AL (ed.), Methods in Soil Analysis - Part 2. American Society of Agronomy, Madison, WI, USA. 147. Shand C, Williams B, Coutts G. 2007. Determination of N-species in soil extracts using microplate techniques. Talanta 74:648–654. 148. Muyzer G, De Waal E, Uitterlinden A. 1993. Profiling of Complex Microbial Populations by Denaturing Gradient Gel Electrophoresis Analysis of Polymerase Chain Reaction-Amplified Genes Coding for 16S rRNA. Applied and Environmental

157 Microbiology 59:695–700. 149. Zwart G, Huismans R, van Agterveld MP, van de Peer Y, de Rijk P, Eenhoorn H, Muyzer G, van Hannen EJ, Gons HJ, Laanbroek HJ. 1998. Divergent members of the bacterial division Verrucomicrobiales in a temperate freshwater lake. FEMS Microbiology Ecology 25:159–169. 150. Ludwig W. 2004. ARB: a software environment for sequence data. Nucleic Acids Research 32:1363–1371. 151. Braak ter C, Smilauer P. 2002. CANOCO Reference manual and canodraw for windows users guide: Software for Cononical Community Ordination (Version 4.5). Microcomputer Power, Ithaca, NY, USA. 152. Kowalchuk G, Stephen J, DeBoer W, Prosser J, Embley T, Woldendorp J. 1997. Analysis of ammonia-oxidizing bacteria of the beta subdivision of the class Proteobacteria in coastal sand dunes by denaturing gradient gel electrophoresis and sequencing of PCR-amplified 16S ribosomal DNA fragments. Applied and Environmental Microbiology 63:1489–1497. 153. Chen G-Y, Qiu S-L, Zhou Y-Y. 2010. Diversity and abundance of ammonia-oxidizing bacteria in eutrophic and oligotrophic basins of a shallow Chinese lake (Lake Donghu). Research in Microbiologoy 160:173–178. 154. Herrmann M, Saunders AM, Schramm A. 2009. Effect of Lake Trophic Status and Rooted Macrophytes on Community Composition and Abundance of Ammonia- Oxidizing Prokaryotes in Freshwater Sediments. Applied and Environmental Microbiology 75:3127–3136. 155. Bussmann I, Philipp B, Schink B. 2001. Factors influencing culturability of lake water bacteria. Journal of Microbiological Methods 47:41–50. 156. Connon SA, Giovannoni SJ. 2002. High-throughput methods for culturing microorganisms in very-low-nutrient media yield diverse new marine isolates. Applied and Environmental Microbiology 68:3878–3885. 157. Stevenson BS, Eichorst SA, Wertz JT, Schmidt TM, Breznak JA. 2004. New strategies for cultivation and detection of previously uncultured microbes. Applied and Environmental Microbiology 70:4748–4755. 158. Keller M, Zengler K. 2004. Tapping into microbial diversity. Nature Reviews

158 Microbiology 2:141–150. 159. Staley JT, Konopka A. 1985. Measurement of in situ activities of nonphotosynthetic microorganisms in aquatic and terrestrial habitats. Annual Review of Microbiology 39:321–346. 160. Purkhold U, Wagner M, Timmermann G, Pommerening-Röser A, Koops H-P. 2003. 16S rRNA and amoA-based phylogeny of 12 novel betaproteobacterial ammonia- oxidizing isolates: extension of the dataset and proposal of a new lineage within the nitrosomonads. International Journal of Systematic and Evolutionary Microbiology 53:1485–1494. 161. Avrahami S, Conrad R. 2003. Patterns of Community Change among Ammonia Oxidizers in Meadow Soils upon Long-Term Incubation at Different Temperatures. Applied and Environmental Microbiology 69:6152. 162. Bruns M-A, Stephen JR, Kowalchuk GA, Prosser JI, Paul E. 1999. Comparative diversity of ammonia oxidizer 16S rRNA gene sequences in native, tilled, and successional soils. Applied and Environmental Microbiology 65:2994–3000. 163. Oved T, Shaviv A, Goldrath T, Mandelbaum R, Minz D. 2001. Influence of Effluent Irrigation on Community Composition and Function of Ammonia-Oxidizing Bacteria in Soil. Applied and Environmental Microbiology 67:3426. 164. Offre P, Prosser JI, Nicol GW. 2009. Growth of ammonia-oxidizing archaea in soil microcosms is inhibited by acetylene. FEMS Microbiology Ecology 70:99–108. 165. Johnstone B, Jones RD. 1988. Recovery of a marine chemolithotrophic ammonium- oxidizing bacterium from long-term energy-source deprivation. Canadian Journal of Microbiology 34:1347–1350. 166. Wells GF, Park H-D, Yeung C-H, Eggleston B, Francis CA, Criddle CS. 2009. Ammonia-oxidizing communities in a highly aerated full-scale activated sludge bioreactor: betaproteobacterial dynamics and low relative abundance of Crenarchaea. Environmental Microbiology 11:2310–2328. 167. Hooper, AB, Terry KR. 1974. Photoinactivation of Ammonia Oxidation in Nitrosomonas. Journal of Bacteriology 119:899–906. 168. Park HD, Noguera DR. 2007. Characterization of two ammonia-oxidizing bacteria isolated from reactors operated with low dissolved oxygen concentrations. Journal of

159 Applied Microbiology 102:1401–1417. 169. Suzuki I, Dular U, Kwok S. 1974. Ammonia or ammonium ion as substrate for oxidation by Nitrosomonas europaea cells and extracts. Journal of Bacteriology 120:556–558. 170. de Bie MJM, Speksnijder AGCL, Kowalchuk GA, Schuurman T, Zwart G, Stephen JR, Diekmann OE, Laanbroek HJ. 2001. Shifts in the dominant populations of ammonia-oxidizing ß subclass Proteobacteria along the eutrophic Schelde estuary. Aquatic Microbial Ecology 23:225–236. 171. Belser LW, Schmidt EL. 1980. Growth and oxidation kinetics of three genera of ammonia oxidizing nitrifiers. FEMS Microbiology Letters 7:213–216. 172. Bateson MM, Ward DM. 2008. Methods for extracting DNA from microbial mats and cultivated microorganisms: high molecular weight DNA from French press lysis, pp. 53–60. In Kowalchuk, GA, de Bruijn, FJ, Head, IM, Akkermans, ADL, van Elsas, JD (eds.), Molecular Microbial Ecology Manual. Springer, Dordrecht, The Netherlands. 173. Felsenstein J. PHYLIP (Phylogenetic Inference Package, 3rd ed. Department of Genome Sciences, University of Washingon, Seattle, WA. 174. Pernthaler A, Pernthaler J, Amann R. 2002. Fluorescence in situ hybridization and catalyzed reporter deposition for the identification of marine bacteria. Applied and Environmental Microbiology 68:3094–3101. 175. Sekar R, Pernthaler A, Pernthaler J, Warnecke F, Posch T, Amann R. 2003. An improved protocol for quantification of freshwater Actinobacteria by fluorescence in situ hybridization. Applied and Environmental Microbiology 69:2928–2935. 176. Grosskopf R, Janssen P, Liesack W. 1998. Diversity and Structure of the Methanogenic Community in Anoxic Rice Paddy Soil Microcosms as Examined by Cultivation and Direct 16S rRNA Gene Sequence Retrieval. Applied and Environmental Microbiology 64:960–969. 177. Rotthauwe J, Witzel K, Liesack W. 1997. The ammonia monooxygenase structural gene amoA as a functional marker: Molecular fine-scale analysis of natural ammonia- oxidizing populations. Applied and Environmental Microbiology 63:4704–4712. 178. Amann RL, Binder BJ, Olson RJ, Chisholm SW, Devereux R, Stahl DA. 1990. Combination of 16S ribosomal-RNA targeted oligonucleotide probes with flow-

160 cytometry for analyzing mixed microbial populations. Applied and Environmental Microbiology 56:1919–1925. 179. Daims H, Bruhl A, Amann R, Schleifer K-H, Wagner M. 1999. The domain-specific probe EUB338 is insufficient for the detection of all bacteria: Development and evaluation of a more comprehensive probe set. Systematic and Applied Microbiology 22:434–444. 180. Massana R, Murray AE, Preston C, DeLong EF. 1997. Vertical distribution and phylogenetic characterization of marine planktonic Archaea in the Santa Barbara Channel. Applied and Environmental Microbiology 63:50–56. 181. Daims H, Nielsen JL, Nielsen PH, Schleifer K-H, Wagner M. 2001. In situ characterization of Nitrospira-like nitrite-oxidizing bacteria active in wastewater treatment plants. Applied and Environmental Microbiology 67:5273–5284. 182. Mobarry BK, Wagner M, Urbain V, Rittmann BE, Stahl DA. 1996. Phylogenetic probes for analyzing abundance and spatial organization of nitrifying bacteria. Applied and Environmental Microbiology 62:2156–2162. 183. van der Wielen PWJJ, Voost S, van der Kooij D. 2009. Ammonia-Oxidizing Bacteria and Archaea in Groundwater Treatment and Drinking Water Distribution Systems. Applied and Environmental Microbiology 75:4687–4695. 184. Fujii C, Nakagawa T, Onodera Y, Matsutani N, Sasada K, Takahashi R, Tokuyama T. 2010. Succession and community composition of ammonia-oxidizing archaea and bacteria in bulk soil of a Japanese paddy field. Soil Science and Plant Nutrition 56:212–219. 185. Nowlin WH, Evarts JL, Vanni M. 2005. Release rates and potential fates of nitrogen and phosphorus from sediments in a eutrophic reservoir. Freshwater Biology 50:301– 322. 186. Sigee DC. 2005. Freshwater microbiology: biodiversity and dynamic interactions of microorganisms in the aquatic environment. John Wiley & Sons, Chichester, Great Britain. 187. Yarza P, Richter M, Peplies J, Euzeby J, Amann R, Schleifer K-H, Ludwig W, Glöckner FO, Rosselló-Móra R. 2008. The All-Species Living Tree project: A 16S rRNA-based phylogenetic tree of all sequenced type strains. Systematic and Applied

161 Microbiology 31:241–250. 188. Nicol GW, Leininger S, Schleper C, Prosser JI. 2008. The influence of soil pH on the diversity, abundance and transcriptional activity of ammonia oxidizing archaea and bacteria. Environmental Microbiology 10:2966–2978. 189. Zhang CL, Ye Q, Huang Z, Li W, Chen J, Song Z, Zhao W, Bagwell C, Inskeep WP, Ross C, Gao L, Wiegel J, Romanek CS, Shock EL, Hedlund BP. 2008. Global Occurrence of Archaeal amoA Genes in Terrestrial Hot Springs. Applied and Environmental Microbiology 74:6417–6426. 190. Xu M, Schnorr J, Keibler B, Simon HM. 2012. Comparative Analysis of 16S rRNA and amoA Genes from Archaea Selected with Organic and Inorganic Amendments in Enrichment Culture. Applied and Environmental Microbiology 78:2137–2146. 191. Verhamme DT, Prosser JI, Nicol GW. 2011. Ammonia concentration determines differential growth of ammonia-oxidising archaea and bacteria in soil microcosms. The ISME Journal 5:1067–1071. 192. Santoro AE, Casciotti KL, Francis CA. 2010. Activity, abundance and diversity of nitrifying archaea and bacteria in the central California Current. Environmental Microbiology 12:1989–2006. 193. Shears JH, Wood PM. 1985. Spectroscopic Evidence for a Photosensitive Oxygenated State of Ammonia Mono-Oxygenase. Biochemical Journal 226:499–507. 194. Merbt SN, Stahl DA, Casamayor EO, Martí E, Nicol GW, Prosser JI. 2012. Differential photoinhibition of bacterial and archaeal ammonia oxidation. FEMS Microbiology Letters 327:41–46. 195. Bodelier P, Libochant J, Blom C, Laanbroek H. 1996. Dynamics of Nitrification and Denitrification in Root-Oxygenated Sediments and Adaptation of Ammonia-Oxidizing Bacteria to Low-Oxygen or Anoxic Habitats. Applied and Environmental Microbiology 62:4100–4107. 196. Tilman D. 1977. Resource competition between plankton algae: an experimental and theoretical approach. Ecology 338–348. 197. Morita RY. 1988. Bioavailability of energy and its relationship to growth and starvation survival in nature. Canadian Journal of Microbiology 34:436–441. 198. Navarro Llorens JM, Tormo A, Martínez-García E. 2010. Stationary phase in gram-

162 negative bacteria. FEMS Microbiology Reviews 34:476–495. 199. Magnusson LU, Farewell A, Nyström T. 2005. ppGpp: a global regulator in Escherichia coli. Trends in Microbiology 13:236–242. 200. Tappe W, Laverman A, Bohland M, Braster M. 1999. Maintenance energy demand and starvation recovery dynamics of Nitrosomonas europaea and Nitrobacter winogradskyi cultivated in a retentostat with complete biomass retention. Applied and Environmental Microbiology 65:2471–2477. 201. Valentine DL. 2007. Adaptations to energy stress dictate the ecology and evolution of the Archaea. Nature Reviews Microbiology 5:316–323. 202. French E, Kozlowski JA, Mukherjee M, Bullerjahn G, Bollmann A. 2012. Ecophysiological Characterization of Ammonia-Oxidizing Archaea and Bacteria from Freshwater. Applied and Environmental Microbiology 78:5773–5780. 203. Bollmann A, Sedlacek CJ, Norton J, Laanbroek HJ, Suwa Y, Stein LY, Klotz MG, Arp D, Sayavedra-Soto L, Lu M, Bruce D, Detter C, Tapia R, Han J, Woyke T, Lucas SM, Pitluck S, Pennacchio L, Nolan M, Land ML, Huntemann M, Deshpande S, Han C, Chen A, Kyrpides N, Mavromatis K, Markowitz V, Szeto E, Ivanova N, Mikhailova N, Pagani I, Pati A, Peters L, Ovchinnikova G, Goodwin LA. 2013. Genome sequence of Nitrosomonas sp. Is79 - an ammonia-oxidizing bacterium adapted to low ammonium concentrations. Standards in Genomic Sciences 7:469–482. 204. Fierer N, Bradford MA, Jackson RB. 2007. Toward an ecological classification of soil bacteria. Ecology 88:1354–1364. 205. van Niel EWJ, Arts PAM, Wesselink BJ, Robertson LA, Kuenen JG. 1993. Competition between heterotrophic and autotrophic nitrifiers for ammonia in chemostat cultures. FEMS Microbiology Ecology 102:109–118. 206. Church MJ, Wai B, Karl DM, Delong EF. 2010. Abundances of crenarchaeal amoA genes and transcripts in the Pacific Ocean. Environmental Microbiology 12:679–688. 207. Marouga R, Kjelleberg S. 1996. Synthesis of immediate upshift (Iup) proteins during recovery of marine Vibrio sp. strain S14 subjected to long-term carbon starvation. Journal of Bacteriology 178:817–822. 208. Takayama K, Kjelleberg S. 2001. The role of RNA stability during bacterial stress

163 responses and starvation. Environmental Microbiology 2:355–365. 209. Wuchter C, Abbas B, Coolen M, Herfort L, Van Bleijswijk J, Timmers P, Strous M, Teira E, Herndl G, Middelburg J, Schouten S, Sinninghe Damste J. 2006. Archaeal nitrification in the ocean. Proceedings of the National Academy of Sciences 103:12317–12322. 210. Park S-J, Park B-J, Rhee S-K. 2008. Comparative analysis of archaeal 16S rRNA and amoA genes to estimate the abundance and diversity of ammonia-oxidizing archaea in marine sediments. Extremophiles 12:605–615. 211. Treusch AH, Kletzin A, Raddatz G, Ochsenreiter T, Quaiser A, Meurer G, Schuster SC, Schleper C. 2004. Characterization of large-insert DNA libraries from soil for environmental genomic studies of Archaea. Environmental Microbiology 6:970– 980. 212. Morita R. Bacteria in Oligotrophic Environments: Starvation Survival Lifestyle. Springer, New York. 213. Park HD, Wells GF, Bae H, Criddle CS, Francis CA. 2006. Occurrence of Ammonia- Oxidizing Archaea in Wastewater Treatment Plant Bioreactors. Applied and Environmental Microbiology 72:5643–5647. 214. He J-Z, Hu H-W, Zhang L-M. 2012. Current insights into the autotrophic thaumarchaeal ammonia oxidation in acidic soils. Soil Biology and Biochemistry 55:146–154. 215. Holmes A, Costello A, Lidstrom M, Murrell J. 1995. Evidence that particulate methane monooxygenase and ammonia monooxygenase may be evolutionarily related. FEMS Microbiology Letters 132:203–208. 216. Wu Y, Xiang Y, Wang J, Wu QL. 2012. Molecular Detection of Novel Anammox Bacterial Clusters in the Sediments of the Shallow Freshwater Lake Taihu. Geomicrobiology Journal 29:852–859. 217. Yan J, Haaijer SCM, Op Den Camp HJM, van Niftrik L, Stahl DA, Könneke M, Rush D, Sinninghe Damsté JS, Hu YY, Jetten MSM. 2012. Mimicking the oxygen minimum zones: stimulating interaction of aerobic archaeal and anaerobic bacterial ammonia oxidizers in a laboratory-scale model system. Environmental Microbiology 14:3146–3158.

164

165