DOCSLIB.ORG

Sympatric Speciation Through Intraspecific Social Parasitism

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Sympatric Speciation Through Intraspecific Social Parasitism Sympatric speciation through intraspecific SEE COMMENTARY social parasitism Riitta Savolainen* and Kari Vepsa¨ la¨ inen Department of Ecology and Systematics, University of Helsinki, P.O. Box 65, FIN-00014 Helsinki, Finland Edited by Edward O. Wilson, Harvard University, Cambridge, MA, and approved March 28, 2003 (received for review November 8, 2002) Sympatric speciation through intraspecific social parasitism has and field studies all suggest that a recurrent theme in sympatric been proposed for the evolution of Hymenopteran workerless speciation is divergent selection that leads to assortative mating parasites. Such inquilines exploit related host taxa to produce their through direct mate choice, or through choice of mating habitat own sexual offspring. The relatedness of inquilines to their hosts or host plant. Also, during early phases of divergence in sym- has been generalized in Emery’s rule, suggesting that social par- patry, factors acting against hybrids are ecological rather than asites are close or the closest relatives to their host species. If the genetic (15). closest relative of each parasite is its host, then multiple indepen- So far, the ecological conditions thought to facilitate sympatric dent origins of the parasite species are implied even within a single speciation include sympatric potential for habitat and host shifts genus, probably through sympatric speciation. To test the plausi- (4). An alternative scenario applies to the case of intraspecific bility of sympatric speciation in inquilines, we conducted a mito- parasitism in social Hymenoptera (27–32). Societies of many ant chondrial DNA phylogenetic analysis in three inquiline–host pairs species accept surplus queens into the nest. The advantage of of Myrmica ant species. We show that congeneric inquilines have such polygyny is ecological (29). Its disadvantage springs from originated independently several times. We also show that two of the possibility that some of the surplus queens may produce the inqulines are more closely related to their hosts than to any almost exclusively sexual offspring raised by workers of nest- other species. Our results suggest sympatric speciation of Myrmica inquilines. Sympatric speciation is probably facilitated by the social mate queens, thus acting as intraspecific parasites (29). biology and ecology of Myrmica, with polygyny as a prerequisite It has been suggested that completely or nearly workerless for the evolution of intraspecific parasitism. social parasites, inquilines, arose from intraspecific parasites, which are likely cases of sympatric speciation (32). The sugges- tion is based on the observation that all inquiline ants are either ithin the framework of the New Evolutionary Synthesis, closely related to their hosts (loose form of Emery’s rule), or are Wdeveloped in the 1930s and early 1940s, speciation pro- ceeds through accumulation of genetic differences during ex- the closest relatives to their hosts (strict form of Emery’s rule) tensive periods in allopatry, resulting ultimately in genetic (33). Although the evidence for the loose form of Emery’s rule incompatibility and reproductive isolation between populations is convincing (34), phylogeny-based studies on inquiline ants, (1, 2). The Synthesis was built on the foundations of population bumblebees, and wasps have rejected the strict form of Emery’s genetics which described the evolutionary processes within pop- rule (35–38); consequently, the studied inquilines cannot support ulations and the restrictions gene flow imposes on divergent sympatric speciation. evolution. Gene flow seemed such a fundamental obstacle to The validity of the strict form of Emery’s rule and sympatric divergence in sympatry that the goal of speciation studies was ‘‘to speciation has, however, been suggested repeatedly for Myrmica search for genetic reasons that necessitate geographic isolation inquilines (28, 29). Here we test the strict form of Emery’s rule during speciation’’ (2). in Myrmica ants, and examine phylogenetic support for the The allopatric speciation dogma contradicts, however, with evolution of inquilines in sympatry. In phylogenetic terms, we recent evidence for rapid evolution of reproductive isolation as test the following three alternative hypotheses. a result of divergent selection in sympatry (3, 4). Consequently, during the past decade, speciation studies have shifted from Hypothesis 1 focusing on geography, back to Darwin’s (5) emphasis on the The inquilines are polyphyletic and obey Emery’s rule. Because role of ecology and selection in species formation (4, 6–10); the inquilines and their hosts in this study all belong to the genus correspondingly, the plausibility of sympatric speciation has Myrmica, the loose form of Emery’s rule maintains by definition. been accepted (3, 4, 9, 11, 12). Although ecological speciation Adherence to the strict form of Emery’s rule, i.e., each inquiline need not be restricted to sympatry, it seems now likely that most in this study is the closest relative of its host, would support the sympatric speciation is ecological, mediated by competition for interpretation that each inquiline originated as an intraspecific habitat or resources, or by host shifts and host race formation (7, social parasite; such evolution of inquilinism would imply mul- 8, 13–15). tiple sympatric speciation. Under the alternative, allopatric Owing to the multifarious nature of speciation, verbal models model, a new prospective inquiline species should first colonize and generalizations about data are superior to mathematical the range of its present closest relative and host species, then theory (16). In recent mathematical models of sympatric spe- evolve social parasitism within its new range, whereas its free- ciation through natural or sexual selection (17–20), however, the living immediate ancestor would go extinct (32). Even more EVOLUTION combination of reality and generality strongly supports the interpretation that diverse sympatric sets of related taxa and ecological forms have resulted from divergence in sympatry; for This paper was submitted directly (Track II) to the PNAS office. example, closely related lake fish species (21–22), sympatric host Abbreviations: COI, cytochrome oxidase one; COII, cytochrome oxidase two; Cyt b, cyto- races of herbivorous insects (4, 14, 15, 23, 24), and snail chrome b. ecomorphs (25). Sympatric speciation is further supported by Data deposition: The sequences reported in this paper have been deposited in the GenBank laboratory studies concluding that it is likely via pleiotropy or database [accession nos. AY280591–AY280606 (COI and COII) and AY280575–AY280590 physical linkage disequilibrium where there is strong divergent (Cyt b)]. selection relative to gene flow (26), a conclusion corroborated by See commentary on page 6896. quantitative trait locus mapping (15). Thus, theory, experiments, *To whom correspondence should be addressed. E-mail: riitta.savolainen@helsinki.fi. www.pnas.org͞cgi͞doi͞10.1073͞pnas.1036825100 PNAS ͉ June 10, 2003 ͉ vol. 100 ͉ no. 12 ͉ 7169–7174 Downloaded by guest on September 24, 2021 complicated alternative allopatric scenarios can easily be Table 1. Oligonucleotide primers used for the three derived. mitochondrial genes Ј Ј Hypothesis 2 Primer name Primer sequence 5 –3 Ref. The inquilines are polyphyletic, but are located essentially COI randomly within the phylogeny. Such polyphyly would suggest LCO1490 GGTCAACAAATCATAAAGATATTGG 48 that each inquiline has arisen independently without any corre- HCO2198 TAAACTTCAGGGTGACCAAAAAATCA 48 lation either to its host or to the other inquilines; consequently, C1-J-1751 GGATCACCTGATATAGCATTCCC 49 the strict form of Emery’s rule would be rejected, and the mode C1-J-2183 CAACATTTATTTTGATTTTTTGG 49 of speciation would remain open. TL2-N-3014T CCAATGCACTAATCTGCCATATTA 49 COII Hypothesis 3 C2-N-3389 TCATAAGTTCARTATCATTG 49 The inquilines group monophyletically. Only if their positions in Cyt b the phylogeny are within the clade including all their known CB1 TATGTACTACCATGAGGACAAATATC 50 hosts, would the loose form of Emery’s rule (but not the strict CB2 ATTACACCTCCTAATTTATTAGGAAT 50 form) maintain. Only if the inquiline clade would be the closest CB5 GAAAATCCCCCTCAGATTCA* 50 relative to one of the host species would a single sympatric CB7 CTCCCAACTCCTATTAATATTTCTT 51 speciation event through intraspecific parasitism be supported; tRs TATTTCTTTATTATGTTTTCAAAAC 51 radiation and speciation of the common ancestor of the present *Original primer modified for Myrmica by R.S. inquilines through host shifts could then explain the evolution of the present inquilines. A modification of this hypothesis states that the inquilines form two clades; the interpretation of such a reagents in a 20-␮l PCR were 0.75ϫ Taq buffer͞0.09 mM pattern would depend on the positions of the inquilines in the ͞ ͞ ␮ ͞ dNTP 3.1 mM MgCl2 0.5 M of each primer 0.5 units of Taq phylogeny relative to their hosts, following the logic of the first polymerase. DNA was amplified through 30 cycles of 30 s at two hypotheses. Similarly, in case of parapatry, ad hoc interpre- 94°C,45sat46–49°C, and 2 min at 72°C. The PCR products were tation of the results would be necessary, depending on the purified with GFX PCR DNA and Gel Band Purification kit pattern of paraphyly. (Amersham Pharmacia). In the sequencing reaction, BigDye Materials and Methods (Original) Terminator Cycle Sequencing kit (Applied Biosys- tems) was used. The cycle sequencing reactions were purified Myrmica and Its
Load more

Recommended publications
  • Iberomyrmex 7 2015.Pdf
    Asociación Ibérica de Mirmecología , diciembre 2015 ISSN 1989-7928 Asociación Ibérica de Mirmecología Iberomyrmex nº 7 www.mirmiberica.org Iberomyrmex. Número 7, diciembre 2015 IBEROMYRMEX Boletín de la Asociación Ibérica de Mirmecología Publicación anual de acceso gratuito. Disponible en “http://www.mirmiberica.org/iberomyrmex” Número 7. Fecha: 31 de diciembre de 2015. Asociación Ibérica de Mirmecología “www.mirmiberica.org” ISSN 1989-7928 Título clave: Iberomyrmex Tít. abreviado: Iberomyrmex Diseño y maquetación del presente volumen: Amonio David Cuesta Segura, excepto portada y contraportada: Natalia Arnedo Rodríguez. Editor del presente volumen: Sílvia Abril Meléndez. Asesor lingüístico: Pedro Peña Varó. Revisores de los trabajos del presente volumen (por orden alfabético de los apellidos): Sílvia Abril, Xavier Espadaler, Crisanto Gómez y Joaquín Reyes. Nota de copyright © AIM, 2015; © Los autores, 2015; Los originales publicados en la edición electrónica de Iberomyrmex son propiedad de la Asociación Ibérica de Mirmecología y de los propios autores, siendo necesario citar la procedencia en cualquier reproducción parcial o total. Salvo que se indique lo contrario, todos los contenidos de la edición electrónica se distribuyen bajo una licencia de uso y distribución “Creative Commons Reconocimiento- No Comercial 3.0 España” (CC-by-nc). Puede consultar desde aquí la versión informativa y el texto legal de la licencia. Esta circunstancia ha de hacerse constar expresamente de esta forma cuando sea necesario. Normas de publicación: http://www.mirmiberica.org/iberomyrmex Envío de manuscritos: “[email protected]” Los autores se responsabilizan de las opiniones contenidas en los artículos y comunicaciones. Artículos y notas Artículos y notas Artículos y notas Artículos y notas Artículos y notas Artículos y notas Artículos y notas Artículos Artículos y notasy notas Artículos y notas Artículos Iberomyrmex.
    [Show full text]
  • This Article Appeared in a Journal Published by Elsevier. the Attached
    This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution and sharing with colleagues. Other uses, including reproduction and distribution, or selling or licensing copies, or posting to personal, institutional or third party websites are prohibited. In most cases authors are permitted to post their version of the article (e.g. in Word or Tex form) to their personal website or institutional repository. Authors requiring further information regarding Elsevier’s archiving and manuscript policies are encouraged to visit: http://www.elsevier.com/copyright Author's personal copy Ecological Indicators 13 (2012) 303–313 Contents lists available at ScienceDirect Ecological Indicators jo urnal homepage: www.elsevier.com/locate/ecolind Life-history strategies as a tool to identify conservation constraints: A case-study ଝ on ants in chalk grasslands a,b,∗ c d a,b,1 C.G.E. (Toos) van Noordwijk , Peter Boer , A.A. (Bram) Mabelis , Wilco C.E.P. Verberk , b,d Henk Siepel a Bargerveen Foundation, Toernooiveld 1, 6525 ED Nijmegen, The Netherlands b Department of Animal Ecology and Ecophysiology, Institute of Water and Wetland Research, Radboud University Nijmegen, P.O. Box 9010, 6500 GL Nijmegen, The Netherlands c Gemene Bos 12, 1861 HG Bergen, The Netherlands d Centre for Ecosystem Studies, Alterra, Wageningen UR, P.O. Box 47, 6700 AA Wageningen, The Netherlands a r t i c l e i n f o a b s t r a c t Article history: Species’ life-history traits underlie species–environment relationships.
    [Show full text]
  • Radiation in Socially Parasitic Formicoxenine Ants
    RADIATION IN SOCIALLY PARASITIC FORMICOXENINE ANTS DISSERTATION ZUR ERLANGUNG DES DOKTORGRADES DER NATURWISSENSCHAFTEN (D R. R ER . N AT .) DER NATURWISSENSCHAFTLICHEN FAKULTÄT III – BIOLOGIE UND VORKLINISCHE MEDIZIN DER UNIVERSITÄT REGENSBURG vorgelegt von Jeanette Beibl aus Landshut 04/2007 General Introduction II Promotionsgesuch eingereicht am: 19.04.2007 Die Arbeit wurde angeleitet von: Prof. Dr. J. Heinze Prüfungsausschuss: Vorsitzender: Prof. Dr. S. Schneuwly 1. Prüfer: Prof. Dr. J. Heinze 2. Prüfer: Prof. Dr. S. Foitzik 3. Prüfer: Prof. Dr. P. Poschlod General Introduction I TABLE OF CONTENTS GENERAL INTRODUCTION 1 CHAPTER 1: Six origins of slavery in formicoxenine ants 13 Introduction 15 Material and Methods 17 Results 20 Discussion 23 CHAPTER 2: Phylogeny and phylogeography of the Mediterranean species of the parasitic ant genus Chalepoxenus and its Temnothorax hosts 27 Introduction 29 Material and Methods 31 Results 36 Discussion 43 CHAPTER 3: Phylogenetic analyses of the parasitic ant genus Myrmoxenus 46 Introduction 48 Material and Methods 50 Results 54 Discussion 59 CHAPTER 4: Cuticular profiles and mating preference in a slave-making ant 61 Introduction 63 Material and Methods 65 Results 69 Discussion 75 CHAPTER 5: Influence of the slaves on the cuticular profile of the slave-making ant Chalepoxenus muellerianus and vice versa 78 Introduction 80 Material and Methods 82 Results 86 Discussion 89 GENERAL DISCUSSION 91 SUMMARY 99 ZUSAMMENFASSUNG 101 REFERENCES 103 APPENDIX 119 DANKSAGUNG 120 General Introduction 1 GENERAL INTRODUCTION Parasitism is an extremely successful mode of life and is considered to be one of the most potent forces in evolution. As many degrees of symbiosis, a phenomenon in which two unrelated organisms coexist over a prolonged period of time while depending on each other, occur, it is not easy to unequivocally define parasitism (Cheng, 1991).
    [Show full text]
  • Hymenoptera: Formicidae)
    Heteropterus Revista de Entomología 2004 Heteropterus Rev. Entomol. 4: 81-83 ISSN: 1579-0681 NOTA Primer registro de Myrmica karavajevi (Arnoldi, 1930) en la Península Ibérica (Hymenoptera: Formicidae) X. ESPADALER1, I. ZABALEGUI2, F. CALVO SÁNCHEZ3 1Unitat d’Ecologia y CREAF; Universitat Autònoma de Barcelona; 08193 Bellaterra (Barcelona); E-mail: [email protected] 2Zikuñaga 44, 4º A; 20120 Hernani (Gipuzkoa); E-mail: [email protected] 3Avda. Galtzaraborda 97, 1º B; 20100 Errenteria (Gipuzkoa); E-mail: [email protected] Resumen Se menciona por primera vez la presencia de la especie parásita social Myrmica karavajevi (Arnoldi, 1930), en la Península Ibérica. Es la población más meridional que se conoce. La especie fue recolectada en un prado de monta- ña, a 1000 m de altitud, en la Sierra de Entzia (Álava). La especie huésped era Myrmica scabrinodis (Nylander, 1846). Palabras clave: Formicidae, Myrmicinae, parásita social, España, Myrmica scabrinodis. Laburpena Myrmica karavajeviren (Arnoldi, 1930) lehenengo aipua Iberiar Penintsulan Parasito soziala den Myrmica karavajevi (Arnoldi, 1930) espeziea lehenengo aldiz aurkitu da Iberiar Penintsulan. Populazio ezagunen artean, hegoaldekoena da. Espeziea Entzia Mendikateko (Araba) mendi-larre batean harra- patu zen, 1000 m-ko altitudean. Ostalaria Myrmica scabrinodis (Nylander, 1846) espeziea zen. Gako-hitzak: Formicidae, Myrmicinae, parasito soziala, Espainia, Myrmica scabrinodis. Abstract First record of Myrmica karavajevi (Arnoldi, 1930) in the Iberian Peninsula The presence of the social parasite Myrmica karavajevi (Arnoldi, 1930) is recorded for the first time in the Iberian Peninsula. The species was collected in a mountain meadow, at 1000 m altitude, in the Sierra de Entzia (Álava). The host species was Myrmica scabrinodis (Nylander, 1846).
    [Show full text]
  • Worldwide Spread of the Ruby Ant, Myrmica Rubra (Hymenoptera: Formicidae)
    Myrmecological News 14 87-96 Vienna, January 2011 Worldwide spread of the ruby ant, Myrmica rubra (Hymenoptera: Formicidae) James K. WETTERER & Alexander G. RADCHENKO Abstract The ruby ant, Myrmica rubra (LINNAEUS, 1758) (formerly Myrmica laevinodis NYLANDER, 1846), an aggressive Eur- asian species with a powerful sting, is now spreading through temperate North America. To document the worldwide distribution of M. rubra and evaluate its potential for further spread, we compiled published and unpublished specimen records from > 2000 sites. We report the earliest known M. rubra records for 71 geographic areas (countries, major is- lands, US states, Canadian provinces, and Russian federal districts), including three areas with no previously published records: Prince Edward Island, Washington State, and the Far Eastern Federal District of Russia. All earlier published records of M. rubra from East Asia, including the Far East of Russia, Japan, and China, appear to be misidentifications of Myrmica kotokui FOREL, 1911. Myrmica rubra is native to an enormous expanse extending from Ireland and Portugal in westernmost Europe across 8000 km to central Asia and eastern Siberia, and from 39 to 70° N in latitude. Exotic populations of M. rubra were first recorded in eastern North America more than 100 years ago. Myrmica rubra is now documented from five southeastern Canadian provinces (New Brunswick, Nova Scotia, Ontario, Prince Edward Island, and Quebec), six northeastern US states (Maine, Massachusetts, New Hampshire, New York, Rhode Island, and Vermont), and one northwestern state (Wash- ington) ranging from 41.5 to 47.6° N. Given the vast range of M. rubra in Eurasia, perhaps the most striking aspect about this species in North America is how little it has spread over the past century.
    [Show full text]
  • Arthropods in Linear Elements
    Arthropods in linear elements Occurrence, behaviour and conservation management Thesis committee Thesis supervisor: Prof. dr. Karlè V. Sýkora Professor of Ecological Construction and Management of Infrastructure Nature Conservation and Plant Ecology Group Wageningen University Thesis co‐supervisor: Dr. ir. André P. Schaffers Scientific researcher Nature Conservation and Plant Ecology Group Wageningen University Other members: Prof. dr. Dries Bonte Ghent University, Belgium Prof. dr. Hans Van Dyck Université catholique de Louvain, Belgium Prof. dr. Paul F.M. Opdam Wageningen University Prof. dr. Menno Schilthuizen University of Groningen This research was conducted under the auspices of SENSE (School for the Socio‐Economic and Natural Sciences of the Environment) Arthropods in linear elements Occurrence, behaviour and conservation management Jinze Noordijk Thesis submitted in partial fulfilment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. dr. M.J. Kropff, in the presence of the Thesis Committee appointed by the Doctorate Board to be defended in public on Tuesday 3 November 2009 at 1.30 PM in the Aula Noordijk J (2009) Arthropods in linear elements – occurrence, behaviour and conservation management Thesis, Wageningen University, Wageningen NL with references, with summaries in English and Dutch ISBN 978‐90‐8585‐492‐0 C’est une prairie au petit jour, quelque part sur la Terre. Caché sous cette prairie s’étend un monde démesuré, grand comme une planète. Les herbes folles s’y transforment en jungles impénétrables, les cailloux deviennent montagnes et le plus modeste trou d’eau prend les dimensions d’un océan. Nuridsany C & Pérennou M 1996.
    [Show full text]
  • Myrmecophily of Maculinea Butterflies in the Carpathian Basin (Lepidoptera: Lycaenidae)
    ettudom sz án é y m ológia i r n i é e h K c a s T e r T Myrmecophily of Maculinea butterflies in the Carpathian Basin (Lepidoptera: Lycaenidae) A Maculinea boglárkalepkék mirmekofíliája a Kárpát- medencében (Lepidoptera: Lycaenidae) PhD Thesis Tartally András Department of Evolutionary Zoology and Human Biology University of Debrecen Debrecen, 2008. Ezen értekezést a Debreceni Egyetem TTK Biológia Tudományok Doktori Iskola Biodiverzitás programja keretében készítettem a Debreceni Egyetem TTK doktori (PhD) fokozatának elnyerése céljából. Debrecen, 2008.01.07. Tartally András Tanúsítom, hogy Tartally András doktorjelölt 2001-2005 között a fent megnevezett Doktori Iskola Biodiverzitás programjának keretében irányításommal végezte munkáját. Az értekezésben foglalt eredményekhez a jelölt önálló alkotó tevékenységével meghatározóan hozzájárult. Az értekezés elfogadását javaslom. Debrecen, 2008.01.07. Dr. Varga Zoltán egyetemi tanár In memory of my grandparents Table of contents 1. Introduction......................................................................................... 9 1.1. Myrmecophily of Maculinea butterflies........................................................ 9 1.2. Why is it important to know the local host ant species?.............................. 9 1.3. The aim of this study.................................................................................... 10 2. Materials and Methods..................................................................... 11 2.1. Taxonomy and nomenclature.....................................................................
    [Show full text]
  • Myrmica Karavajevi (Arn.) (Hymenoptera, Formicidae) in Poland: a Species Not As Rare As It Is Thought to Be?
    Fragm enta Faunistica 56 (1): 17-24, 2013 PL ISSN 0015-9301 O M useum a n d I n s t i tu t e o f Z o o lo g y PAS Myrmica karavajevi (Arn.) (Hymenoptera, Formicidae) in Poland: a species not as rare as it is thought to be? MagdalenaW it e k , HannaB a b ik , Wojciech C z e c h o w s k i and WiesławaC z e c h o w s k a Museum and Institute o f Zoology, Polish Academy o f Sciences, Wilcza 64, 00-679 Warsaw, Poland; e-maiIs: mawitus@yahoo. co. uk, hbabik@miiz. waw.pl, wcz@miiz. waw.pl, w. czechowska@miiz. waw.pl Abstract:The antMyrmica karavajevi is an extremely rarely found and poorly known workerless social parasite of ants of the Myrmica scabrinodis species group. Hereafter detailed information of its previously published findings from four geographical regions in Poland (Bieszczady Mts, Pieniny Mts, Pomeranian Lakeland and Mazovian Lowland) as well as data on three new records from the Roztocze Upland, Lubelska Upland and Krakowsko- Częstochowska Upland is given. The latter suggests higher than hitherto suspected degree of host species infestation by M. karavajevi. Use of M. rugulosa as a host by M. karavajevi is also discussed. Key words: ants, fauna of Poland, inquilines,Myrmica rugulosa, Myrmica scabrinodis, new localities, social parasitism Introduction Myrmica karavajevi (Amoldi, 1930) is a European obligate socially parasitic workerless inquiline of otherMyrmica Latr. species. The parasite queen coexists with the host queen (or queens), and broods of both species are produced in a mixed colony.Myrmica scabrinodis Nyl., M.
    [Show full text]
  • Based Alpha-Taxonomy of Eusocial Organisms
    Myrmecological News 19 1-15 Vienna, January 2014 Application of Exploratory Data Analyses opens a new perspective in morphology- based alpha-taxonomy of eusocial organisms Bernhard SEIFERT, Markus RITZ & Sándor CSŐSZ Abstract This article introduces a new application of the Exploratory Data Analysis (EDA) algorithms Ward's method, Unweighted Pair Group Method with Arithmetic Mean (UPGMA), K-Means clustering, and a combination of Non-Metric Multidimen- sional Scaling and K-Means clustering (NMDS-K-Means) for hypothesis formation in morphology-based alpha-taxonomy of ants. The script is written in R and freely available at: http://sourceforge.net/projects/agnesclustering/. The characte- ristic feature of the new approach is an unconventional application of linear discriminant analysis (LDA): No species hypothesis is imposed. Instead each nest sample, composed of individual ant workers, is treated as a separate class. This creates a multidimensional distance matrix between group centroids of nest samples as input data for the clustering methods. We mark the new method with the prefix "NC" (Nest Centroid). The performance of NC-Ward, NC-UPGMA, NC-K-Means clustering, and a combination of Non-Metric Multidimensional Scaling and K-Means clustering (NC- NMDS-K-Means) was comparatively tested in 48 examples with multiple morphological character sets of 74 cryptic species of 13 ant genera. Data sets were selected specifically on the criteria that the EDA methods are likely to lead to errors – i.e., for the condition that any character under consideration overlapped interspecifically in bivariate plots against body size. Morphospecies hypotheses were formed through interaction between EDA and a confirmative linear discri- minant analysis (LDA) in which samples with disagreements between the primary species hypotheses and EDA classifica- tion were set as wild-cards.
    [Show full text]
  • Of the Czech Republic Aktualizovaný Seznam Mravenců (Hymenoptera, Formicidae) České Republiky
    5 Werner, Bezděčka, Bezděčková, Pech: Aktualizovaný seznam mravenců (Hymenoptera, Formicidae) České republiky Acta rerum naturalium, 22: 5–12, 2018 ISSN 2336-7113 (Online), ISSN 1801-5972 (Print) An updated checklist of the ants (Hymenoptera, Formicidae) of the Czech Republic Aktualizovaný seznam mravenců (Hymenoptera, Formicidae) České republiky PETR WERNER1, PAVEL BEZDĚČKA2, KLÁRA BEZDĚČKOVÁ2, PAVEL PECH3 1 Gabinova 823, CZ-152 00 Praha 5; e-mail: [email protected] (corresponding author); 2 Muzeum Vysočiny Jihlava, Masarykovo náměstí 55, CZ-586 01 Jihlava; e-mail: [email protected], [email protected]; 3 Přírodovědecká fakulta, Univerzita Hradec Králové, Rokitanského 62, CZ-500 03 Hradec Králové; email: [email protected] Publikováno on-line 25. 07. 2018 Abstract: In this paper an updated critical checklist of the ants of the Czech Republic is provided. A total of 111 valid names of outdoor species are listed based on data from museum and private collections. Over the past decade several faunistic and taxonomic changes concerning the Czech ant fauna have occurred. The species Formica clara Forel, 1886, Lasius carniolicus Mayr, 1861, Temnothorax jailensis (Arnol’di, 1977) and Tetramorium hungaricum Röszler, 1935 were recorded on the Czech territory for the first time. Further, the presence of Camponotus atricolor (Nylander, 1849) and Lasius myops Forel, 1894, formerly regarded as uncertain, was confirmed. Moreover, the status of Tetramorium staerckei Kratochvíl, 1944 was reviewed as a species. Besides outdoor species, a list of five indoor (introduced) species is given. Abstrakt: Práce obsahuje aktualizovaný seznam mravenců České republiky. Na základě údajů získaných z muzejních a soukromých sbírek je uvedeno celkem 111 volně žijících druhů.
    [Show full text]
  • Ants of Greece – Checklist, Comments and New Faunistic Data (Hymenoptera: Formicidae)
    Genus Vol. 23(4): 461-563 Wrocław, 28 XII 2012 Ants of Greece – checklist, comments and new faunistic data (Hymenoptera: Formicidae) LECH BOROWIEC1 & SEBASTIAN SALATA2 Department of Biodiversity and Evolutionary Taxonomy, University of Wrocław, Przybyszewskiego, 63/77, 51-148 Wrocław, Poland, e-mail: [email protected], [email protected] ABSTRACT. A list of 291 ant species recorded from Greece are given but approximately 15% of taxa need confirmation due to recent studies on European ants and reinterpretation of several taxa. The following 17 species are recorded from Greece for the first time:Camponotus sannini TOHMÉ & TOHMÉ, Crematogaster jehovae FOREL, Formica bruni KUTTER, Lasius jensi SEIFERT, Lasius nitidigaster SEIFERT, Lepisiota dolabellae (FOREL), Myrmica lonae FINZI, Myrmica tulinae ELMES, RADCHENKO & AKTAÇ, Temnothorax flavicornis (EMERY), Temnothorax sordidulus (MÜLLER), Temnothorax turcicus (SANTSCHI), Tetramorium hungaricum RÖSZLER, and five species not attributed to a named species:Camponotus cf. lateralis sp. 1, Camponotus cf. lateralis sp. 2, Lepisiota cf. melas sp. 1, Lepisiota cf. syriaca sp. 1, and Tetramorium cf. caespitum sp. 1. Camponotus candiotes is recorded as new species to Croatia. New faunistic data for 132 other species are given. Key words: entomology, zoogeography, catalogue, ants, Greece. INTroDUCTIoN The history of knowledge of Greek ants goes back to the early 19th century (BRUllÉ 1833) but due to the complicated history of Greece, for many years the ant fauna of the country was studied less intensively and by foreign entomologists. No regional monograph was published and the first key concerning also Greek fauna and the first checklist were papers by AGOSTI and COLLINGWOOD (1987 a, b).
    [Show full text]
  • Distribution Maps of the Outdoor Myrmicid Ants (Hymenoptera, Formicidae) of Finland, with Notes on Their Taxonomy and Ecology
    © Entomol. Fennica. 5 December 1995 Distribution maps of the outdoor myrmicid ants (Hymenoptera, Formicidae) of Finland, with notes on their taxonomy and ecology Michael I. Saaristo Saaristo, M. I. 1995: Distribution maps of the outdoor myrmicid ants (Hy­ menoptera, Formicidae) of Finland, with notes on their taxonomy and ecol­ ogy.- Entomol. Fennica 6:153-162. Twentytwo species of myrmicid ants maintaining outdoor populations are listed for Finland. Four of them, Myrmica hellenica Fore!, Myrmica microrubra Seifert, Leptothorax interruptus (Schenck), and Leptothorax kutteri Buschinger are new to Finland. Myrmica Zonae Finzi is considered as a good sister species of Myrmica sabuleti Meinert, under which name the species has earlier been known in Finland. Myrmica specioides Bondroit is deleted from the list as no samples of this species could be located in the collections. The distribution of each species in Finland is presented on 10 X 10 km square grid maps. The ecology of the various species is discussed. Also some taxonomic problems are dealt with. Michael I. Saaristo, Zoological Museum, University of Turku, FIN-20500 Turku, Finland This study was started during the autumn of 1983, Anergates atratulus. One of them, viz. H. sublaevis, by determing the extensive pitfall material of is a dulotic or slave keeping-species with a special­ ants in the collections of the Zoological Museum ized soldier-like worker caste, while others have no of the University of Turku (MZT). About the workers at all. As usual with workerless social same time the ant collections of the Finnish Mu­ parasites, there are quite few records of them be­ seum of Natural History, Helsinki (MZH) and cause they are difficult to collect except during the the Department of Applied Zoology, University relatively short time when they have alates.
    [Show full text]