Sympatric speciation through intraspecific SEE COMMENTARY social parasitism Riitta Savolainen* and Kari Vepsa¨ la¨ inen Department of Ecology and Systematics, University of Helsinki, P.O. Box 65, FIN-00014 Helsinki, Finland Edited by Edward O. Wilson, Harvard University, Cambridge, MA, and approved March 28, 2003 (received for review November 8, 2002) Sympatric speciation through intraspecific social parasitism has and field studies all suggest that a recurrent theme in sympatric been proposed for the evolution of Hymenopteran workerless speciation is divergent selection that leads to assortative mating parasites. Such inquilines exploit related host taxa to produce their through direct mate choice, or through choice of mating habitat own sexual offspring. The relatedness of inquilines to their hosts or host plant. Also, during early phases of divergence in sym- has been generalized in Emery’s rule, suggesting that social par- patry, factors acting against hybrids are ecological rather than asites are close or the closest relatives to their host species. If the genetic (15). closest relative of each parasite is its host, then multiple indepen- So far, the ecological conditions thought to facilitate sympatric dent origins of the parasite species are implied even within a single speciation include sympatric potential for habitat and host shifts genus, probably through sympatric speciation. To test the plausi- (4). An alternative scenario applies to the case of intraspecific bility of sympatric speciation in inquilines, we conducted a mito- parasitism in social Hymenoptera (27–32). Societies of many ant chondrial DNA phylogenetic analysis in three inquiline–host pairs species accept surplus queens into the nest. The advantage of of Myrmica ant species. We show that congeneric inquilines have such polygyny is ecological (29). Its disadvantage springs from originated independently several times. We also show that two of the possibility that some of the surplus queens may produce the inqulines are more closely related to their hosts than to any almost exclusively sexual offspring raised by workers of nest- other species. Our results suggest sympatric speciation of Myrmica inquilines. Sympatric speciation is probably facilitated by the social mate queens, thus acting as intraspecific parasites (29). biology and ecology of Myrmica, with polygyny as a prerequisite It has been suggested that completely or nearly workerless for the evolution of intraspecific parasitism. social parasites, inquilines, arose from intraspecific parasites, which are likely cases of sympatric speciation (32). The sugges- tion is based on the observation that all inquiline ants are either ithin the framework of the New Evolutionary Synthesis, closely related to their hosts (loose form of Emery’s rule), or are Wdeveloped in the 1930s and early 1940s, speciation pro- ceeds through accumulation of genetic differences during ex- the closest relatives to their hosts (strict form of Emery’s rule) tensive periods in allopatry, resulting ultimately in genetic (33). Although the evidence for the loose form of Emery’s rule incompatibility and reproductive isolation between populations is convincing (34), phylogeny-based studies on inquiline ants, (1, 2). The Synthesis was built on the foundations of population bumblebees, and wasps have rejected the strict form of Emery’s genetics which described the evolutionary processes within pop- rule (35–38); consequently, the studied inquilines cannot support ulations and the restrictions gene flow imposes on divergent sympatric speciation. evolution. Gene flow seemed such a fundamental obstacle to The validity of the strict form of Emery’s rule and sympatric divergence in sympatry that the goal of speciation studies was ‘‘to speciation has, however, been suggested repeatedly for Myrmica search for genetic reasons that necessitate geographic isolation inquilines (28, 29). Here we test the strict form of Emery’s rule during speciation’’ (2). in Myrmica ants, and examine phylogenetic support for the The allopatric speciation dogma contradicts, however, with evolution of inquilines in sympatry. In phylogenetic terms, we recent evidence for rapid evolution of reproductive isolation as test the following three alternative hypotheses. a result of divergent selection in sympatry (3, 4). Consequently, during the past decade, speciation studies have shifted from Hypothesis 1 focusing on geography, back to Darwin’s (5) emphasis on the The inquilines are polyphyletic and obey Emery’s rule. Because role of ecology and selection in species formation (4, 6–10); the inquilines and their hosts in this study all belong to the genus correspondingly, the plausibility of sympatric speciation has Myrmica, the loose form of Emery’s rule maintains by definition. been accepted (3, 4, 9, 11, 12). Although ecological speciation Adherence to the strict form of Emery’s rule, i.e., each inquiline need not be restricted to sympatry, it seems now likely that most in this study is the closest relative of its host, would support the sympatric speciation is ecological, mediated by competition for interpretation that each inquiline originated as an intraspecific habitat or resources, or by host shifts and host race formation (7, social parasite; such evolution of inquilinism would imply mul- 8, 13–15). tiple sympatric speciation. Under the alternative, allopatric Owing to the multifarious nature of speciation, verbal models model, a new prospective inquiline species should first colonize and generalizations about data are superior to mathematical the range of its present closest relative and host species, then theory (16). In recent mathematical models of sympatric spe- evolve social parasitism within its new range, whereas its free- ciation through natural or sexual selection (17–20), however, the living immediate ancestor would go extinct (32). Even more EVOLUTION combination of reality and generality strongly supports the interpretation that diverse sympatric sets of related taxa and ecological forms have resulted from divergence in sympatry; for This paper was submitted directly (Track II) to the PNAS office. example, closely related lake fish species (21–22), sympatric host Abbreviations: COI, cytochrome oxidase one; COII, cytochrome oxidase two; Cyt b, cyto- races of herbivorous insects (4, 14, 15, 23, 24), and snail chrome b. ecomorphs (25). Sympatric speciation is further supported by Data deposition: The sequences reported in this paper have been deposited in the GenBank laboratory studies concluding that it is likely via pleiotropy or database [accession nos. AY280591–AY280606 (COI and COII) and AY280575–AY280590 physical linkage disequilibrium where there is strong divergent (Cyt b)]. selection relative to gene flow (26), a conclusion corroborated by See commentary on page 6896. quantitative trait locus mapping (15). Thus, theory, experiments, *To whom correspondence should be addressed. E-mail: riitta.savolainen@helsinki.fi. www.pnas.org͞cgi͞doi͞10.1073͞pnas.1036825100 PNAS ͉ June 10, 2003 ͉ vol. 100 ͉ no. 12 ͉ 7169–7174 Downloaded by guest on September 24, 2021 complicated alternative allopatric scenarios can easily be Table 1. Oligonucleotide primers used for the three derived. mitochondrial genes Ј Ј Hypothesis 2 Primer name Primer sequence 5 –3 Ref. The inquilines are polyphyletic, but are located essentially COI randomly within the phylogeny. Such polyphyly would suggest LCO1490 GGTCAACAAATCATAAAGATATTGG 48 that each inquiline has arisen independently without any corre- HCO2198 TAAACTTCAGGGTGACCAAAAAATCA 48 lation either to its host or to the other inquilines; consequently, C1-J-1751 GGATCACCTGATATAGCATTCCC 49 the strict form of Emery’s rule would be rejected, and the mode C1-J-2183 CAACATTTATTTTGATTTTTTGG 49 of speciation would remain open. TL2-N-3014T CCAATGCACTAATCTGCCATATTA 49 COII Hypothesis 3 C2-N-3389 TCATAAGTTCARTATCATTG 49 The inquilines group monophyletically. Only if their positions in Cyt b the phylogeny are within the clade including all their known CB1 TATGTACTACCATGAGGACAAATATC 50 hosts, would the loose form of Emery’s rule (but not the strict CB2 ATTACACCTCCTAATTTATTAGGAAT 50 form) maintain. Only if the inquiline clade would be the closest CB5 GAAAATCCCCCTCAGATTCA* 50 relative to one of the host species would a single sympatric CB7 CTCCCAACTCCTATTAATATTTCTT 51 speciation event through intraspecific parasitism be supported; tRs TATTTCTTTATTATGTTTTCAAAAC 51 radiation and speciation of the common ancestor of the present *Original primer modified for Myrmica by R.S. inquilines through host shifts could then explain the evolution of the present inquilines. A modification of this hypothesis states that the inquilines form two clades; the interpretation of such a reagents in a 20-␮l PCR were 0.75ϫ Taq buffer͞0.09 mM pattern would depend on the positions of the inquilines in the ͞ ͞ ␮ ͞ dNTP 3.1 mM MgCl2 0.5 M of each primer 0.5 units of Taq phylogeny relative to their hosts, following the logic of the first polymerase. DNA was amplified through 30 cycles of 30 s at two hypotheses. Similarly, in case of parapatry, ad hoc interpre- 94°C,45sat46–49°C, and 2 min at 72°C. The PCR products were tation of the results would be necessary, depending on the purified with GFX PCR DNA and Gel Band Purification kit pattern of paraphyly. (Amersham Pharmacia). In the sequencing reaction, BigDye Materials and Methods (Original) Terminator Cycle Sequencing kit (Applied Biosys- tems) was used. The cycle sequencing reactions were purified Myrmica and Its