Generate Metabolic Map Poster
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Indications for a Central Role of Hexokinase Activity in Natural Variation of Heat Acclimation in Arabidopsis Thaliana
Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 14 June 2020 doi:10.20944/preprints202006.0169.v1 Article Indications for a central role of hexokinase activity in natural variation of heat acclimation in Arabidopsis thaliana Vasil Atanasov §, Lisa Fürtauer § and Thomas Nägele * LMU Munich, Plant Evolutionary Cell Biology, Großhaderner Str. 2-4, 82152 Planegg, Germany § Authors contributed equally * Correspondence: [email protected] Abstract: Diurnal and seasonal changes of abiotic environmental factors shape plant performance and distribution. Changes of growth temperature and light intensity may vary significantly on a diurnal, but also on a weekly or seasonal scale. Hence, acclimation to a changing temperature and light regime is essential for plant survival and propagation. In the present study, we analyzed photosynthetic CO2 assimilation and metabolic regulation of the central carbohydrate metabolism in two natural accessions of Arabidopsis thaliana originating from Russia and south Italy during exposure to heat and a combination of heat and high light. Our findings indicate that it is hardly possible to predict photosynthetic capacities to fix CO2 under combined stress from single stress experiments. Further, capacities of hexose phosphorylation were found to be significantly lower in the Italian than in the Russian accession which could explain an inverted sucrose-to-hexose ratio. Together with the finding of significantly stronger accumulation of anthocyanins under heat/high light these observations indicate a central role of hexokinase activity in stabilization of photosynthetic capacities within a changing environment. Keywords: photosynthesis; carbohydrate metabolism; hexokinase; heat acclimation; environmental changes; natural variation; high light; combined stress. 1. Introduction Changes of growth temperature and light intensity broadly affect plant molecular, physiological and developmental processes. -
Restriction Endonucleases
Molecular Biology Problem Solver: A Laboratory Guide. Edited by Alan S. Gerstein Copyright © 2001 by Wiley-Liss, Inc. ISBNs: 0-471-37972-7 (Paper); 0-471-22390-5 (Electronic) 9 Restriction Endonucleases Derek Robinson, Paul R. Walsh, and Joseph A. Bonventre Background Information . 226 Which Restriction Enzymes Are Commercially Available? . 226 Why Are Some Enzymes More Expensive Than Others? . 227 What Can You Do to Reduce the Cost of Working with Restriction Enzymes? . 228 If You Could Select among Several Restriction Enzymes for Your Application, What Criteria Should You Consider to Make the Most Appropriate Choice? . 229 What Are the General Properties of Restriction Endonucleases? . 232 What Insight Is Provided by a Restriction Enzyme’s Quality Control Data? . 233 How Stable Are Restriction Enzymes? . 236 How Stable Are Diluted Restriction Enzymes? . 236 Simple Digests . 236 How Should You Set up a Simple Restriction Digest? . 236 Is It Wise to Modify the Suggested Reaction Conditions? . 237 Complex Restriction Digestions . 239 How Can a Substrate Affect the Restriction Digest? . 239 Should You Alter the Reaction Volume and DNA Concentration? . 241 Double Digests: Simultaneous or Sequential? . 242 225 Genomic Digests . 244 When Preparing Genomic DNA for Southern Blotting, How Can You Determine If Complete Digestion Has Been Obtained? . 244 What Are Your Options If You Must Create Additional Rare or Unique Restriction Sites? . 247 Troubleshooting . 255 What Can Cause a Simple Restriction Digest to Fail? . 255 The Volume of Enzyme in the Vial Appears Very Low. Did Leakage Occur during Shipment? . 259 The Enzyme Shipment Sat on the Shipping Dock for Two Days. -
Labeled in Thecourse of Glycolysis, Since Phosphoglycerate Kinase
THE STATE OF MAGNESIUM IN CELLS AS ESTIMATED FROM THE ADENYLATE KINASE EQUILIBRIUM* BY TRWIN A. RoSE THE INSTITUTE FOR CANCER RESEARCH, PHILADELPHIA Communicated by Thomas F. Anderson, August 30, 1968 Magnesium functions in many enzymatic reactions as a cofactor and in com- plex with nucleotides acting as substrates. Numerous examples of a possible regulatory role of Mg can be cited from studies with isolated enzymes,'- and it is known that Mg affects the structural integrity of macromolecules such as trans- fer RNA" and functional elements such as ribosomes.'0 The major problem in translating this information on isolated preparations to the functioning cell is the difficulty in determining the distribution of Mg and the nucleotides among the free and complexed forms that function in the region of the cell for which this information is desired. Nanningall based an attempt to calculate the free Mg2+ and Ca2+ ion concentrations of frog muscle on the total content of these metals and of the principal known ligands (adenosine 5'-triphosphate (ATP), creatine-P, and myosin) and the dissociation constants of the complexes. However, this method suffers from the necessity of evaluating the contribution of all ligands as well as from the assumption that all the known ligands are contributing their full complexing capacity. During studies concerned with the control of glycolysis in red cells and the control of the phosphoglycerate kinase step in particular, it became important to determine the fractions of the cell's ATP and adenosine 5'-diphosphate (ADP) that were present as Mg complexes. Just as the problem of determining the distribution of protonated and dissociated forms of an acid can be solved from a knowledge of pH and pKa of the acid, so it would be possible to determine the liganded and free forms of all rapidly established Mg complexes from a knowledge of Mg2+ ion concentration and the appropriate dissociation constants. -
Generated by SRI International Pathway Tools Version 25.0, Authors S
An online version of this diagram is available at BioCyc.org. Biosynthetic pathways are positioned in the left of the cytoplasm, degradative pathways on the right, and reactions not assigned to any pathway are in the far right of the cytoplasm. Transporters and membrane proteins are shown on the membrane. Periplasmic (where appropriate) and extracellular reactions and proteins may also be shown. Pathways are colored according to their cellular function. Gcf_000238675-HmpCyc: Bacillus smithii 7_3_47FAA Cellular Overview Connections between pathways are omitted for legibility. -
United States Patent (19) 11 Patent Number: 5,981,835 Austin-Phillips Et Al
USOO598.1835A United States Patent (19) 11 Patent Number: 5,981,835 Austin-Phillips et al. (45) Date of Patent: Nov. 9, 1999 54) TRANSGENIC PLANTS AS AN Brown and Atanassov (1985), Role of genetic background in ALTERNATIVE SOURCE OF Somatic embryogenesis in Medicago. Plant Cell Tissue LIGNOCELLULOSC-DEGRADING Organ Culture 4:107-114. ENZYMES Carrer et al. (1993), Kanamycin resistance as a Selectable marker for plastid transformation in tobacco. Mol. Gen. 75 Inventors: Sandra Austin-Phillips; Richard R. Genet. 241:49-56. Burgess, both of Madison; Thomas L. Castillo et al. (1994), Rapid production of fertile transgenic German, Hollandale; Thomas plants of Rye. Bio/Technology 12:1366–1371. Ziegelhoffer, Madison, all of Wis. Comai et al. (1990), Novel and useful properties of a chimeric plant promoter combining CaMV 35S and MAS 73 Assignee: Wisconsin Alumni Research elements. Plant Mol. Biol. 15:373-381. Foundation, Madison, Wis. Coughlan, M.P. (1988), Staining Techniques for the Detec tion of the Individual Components of Cellulolytic Enzyme 21 Appl. No.: 08/883,495 Systems. Methods in Enzymology 160:135-144. de Castro Silva Filho et al. (1996), Mitochondrial and 22 Filed: Jun. 26, 1997 chloroplast targeting Sequences in tandem modify protein import specificity in plant organelles. Plant Mol. Biol. Related U.S. Application Data 30:769-78O. 60 Provisional application No. 60/028,718, Oct. 17, 1996. Divne et al. (1994), The three-dimensional crystal structure 51 Int. Cl. ............................. C12N 15/82; C12N 5/04; of the catalytic core of cellobiohydrolase I from Tricho AO1H 5/00 derma reesei. Science 265:524-528. -
Synthesis and Structural Characterization of Glucooligosaccharides and Dextran from Weissella Confusa Dextransucrases
YEB Recent Publications in this Series Dextran from and and Structural Characterization of Glucooligosaccharides QIAO SHI Synthesis 4/2016 Hany S.M. EL Sayed Bashandy Flavonoid Metabolomics in Gerbera hybrida and Elucidation of Complexity in the Flavonoid Biosynthetic Pathway 5/2016 Erja Koivunen Home-Grown Grain Legumes in Poultry Diets 6/2016 Paul Mathijssen DISSERTATIONES SCHOLA DOCTORALIS SCIENTIAE CIRCUMIECTALIS, Holocene Carbon Dynamics and Atmospheric Radiative Forcing of Different Types of Peatlands ALIMENTARIAE, BIOLOGICAE. UNIVERSITATIS HELSINKIENSIS 21/2016 in Finland 7/2016 Seyed Abdollah Mousavi Revised Taxonomy of the Family Rhizobiaceae, and Phylogeny of Mesorhizobia Nodulating Glycyrrhiza spp. 8/2016 Sedeer El-Showk Auxin and Cytokinin Interactions Regulate Primary Vascular Patterning During Root QIAO SHI Development in Arabidopsis thaliana 9/2016 Satu Olkkola Antimicrobial Resistance and Its Mechanisms among Campylobacter coli and Campylobacter Synthesis and Structural Characterization of upsaliensis with a Special Focus on Streptomycin 10/2016 Windi Indra Muziasari Glucooligosaccharides and Dextran from Impact of Fish Farming on Antibiotic Resistome and Mobile Elements in Baltic Sea Sediment Weissella confusa Dextransucrases 11/2016 Kari Kylä-Nikkilä Genetic Engineering of Lactic Acid Bacteria to Produce Optically Pure Lactic Acid and to Develop a Novel Cell Immobilization Method Suitable for Industrial Fermentations 12/2016 Jane Etegeneng Besong epse Ndika Molecular Insights into a Putative Potyvirus RNA Encapsidation -
(12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun. -
Transferable Step-Potentials For
© 2013 ANTHONY COFFMAN ALL RIGHTS RESERVED PRODUCTION OF CARBOHYDRASES BY FUNGUS TRICHODERMA REESEI GROWN ON SOY-BASED MEDIA A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Anthony Coffman December, 2013 PRODUCTION OF CARBOHYDRASES BY FUNGUS TRICHODERMA REESEI GROWN ON SOY-BASED MEDIA Anthony Coffman Thesis Approved: Accepted: ___________________________________ ___________________________________ Advisor Department Chair Dr. Lu-Kwang Ju Dr. Lu-Kwang Ju ___________________________________ ___________________________________ Committee Member Dean of The College Dr. Gang Cheng Dr. George K. Haritos ___________________________________ ___________________________________ Committee Member Dean of the Graduate School Dr. Chelsea N. Monty Dr. George R. Newkome ___________________________________ Date ii ABSTRACT Trichoderma reesei RUT-C30 was cultivated in shaker flasks and pH-controlled, agitated batch fermentations to study the effects of soy-based media on the production of cellulase, xylanase, and pectinase (polygalacturonase) for the purposes of soybean polysaccharide hydrolysis. Growth on defatted soybean flour as sole nitrogen source was compared to the standard combination of ammonium sulfate, proteose peptone, and urea. Carbon source effect was also examined for a variety of substrates, including lactose, microcrystalline cellulose (Avicel), citrus pectin, soy molasses, soy flour hydrolysate, and soybean hulls (both pretreated and natural). Flask study results indicated exceptional enzyme induction by Avicel and soybean hulls, while citrus pectin, soy molasses, and soy flour hydrolysate did not promote enzyme production. Batch fermentation experiments reflected the flask system results, showing the highest cellulase and xylanase activities for systems grown with Avicel and soybean hulls at near-neutral pH levels, and the highest polygalacturonase activity resulting from growth on lactose and soybean hulls at lower pH levels, 4.0 to 4.5. -
Genomic Analyses of Unique Carbohydrate and Phytohormone Metabolism in the Macroalga Gracilariopsis Lemaneiformis (Rhodophyta)
Sun et al. BMC Plant Biology (2018) 18:94 https://doi.org/10.1186/s12870-018-1309-2 RESEARCH ARTICLE Open Access Genomic analyses of unique carbohydrate and phytohormone metabolism in the macroalga Gracilariopsis lemaneiformis (Rhodophyta) Xue Sun1, Jun Wu2, Guangce Wang3, Yani Kang1,2, Hong Sain Ooi4, Tingting Shen2, Fangjun Wang1, Rui Yang1, Nianjun Xu1* and Xiaodong Zhao2* Abstract Background: Red algae are economically valuable for food and in industry. However, their genomic information is limited, and the genomic data of only a few species of red algae have been sequenced and deposited recently. In this study, we annotated a draft genome of the macroalga Gracilariopsis lemaneiformis (Gracilariales, Rhodophyta). Results: The entire 88.98 Mb genome of Gp. lemaneiformis 981 was generated from 13,825 scaffolds (≥500 bp) with an N50 length of 30,590 bp, accounting for approximately 91% of this algal genome. A total of 38.73 Mb of scaffold sequences were repetitive, and 9281 protein-coding genes were predicted. A phylogenomic analysis of 20 genomes revealed the relationship among the Chromalveolata, Rhodophyta, Chlorophyta and higher plants. Homology analysis indicated phylogenetic proximity between Gp. lemaneiformis and Chondrus crispus. The number of enzymes related to the metabolism of carbohydrates, including agar, glycoside hydrolases, glycosyltransferases, was abundant. In addition, signaling pathways associated with phytohormones such as auxin, salicylic acid and jasmonates are reported for the first time for this alga. Conclusion: We sequenced and analyzed a draft genome of the red alga Gp. lemaneiformis, and revealed its carbohydrate metabolism and phytohormone signaling characteristics. This work will be helpful in research on the functional and comparative genomics of the order Gracilariales and will enrich the genomic information on marine algae. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
SUPPLEMENTARY INFORMATION in Silico Signature Prediction
SUPPLEMENTARY INFORMATION In Silico Signature Prediction Modeling in Cytolethal Distending Toxin-Producing Escherichia coli Strains Maryam Javadi, Mana Oloomi*, Saeid Bouzari Department of Molecular Biology, Pasteur Institute of Iran, Tehran 13164, Iran http://www.genominfo.org/src/sm/gni-15-69-s001.pdf Supplementary Table 6. Aalphabetic abbreviation and description of putative conserved domains Alphabetic Abbreviation Description 17 Large terminase protein 2_A_01_02 Multidrug resistance protein 2A0115 Benzoate transport; [Transport and binding proteins, Carbohydrates, organic alcohols] 52 DNA topisomerase II medium subunit; Provisional AAA_13 AAA domain; This family of domains contain a P-loop motif AAA_15 AAA ATPase domain; This family of domains contain a P-loop motif AAA_21 AAA domain AAA_23 AAA domain ABC_RecF ATP-binding cassette domain of RecF; RecF is a recombinational DNA repair ATPase ABC_SMC_barmotin ATP-binding cassette domain of barmotin, a member of the SMC protein family AcCoA-C-Actrans Acetyl-CoA acetyltransferases AHBA_syn 3-Amino-5-hydroxybenzoic acid synthase family (AHBA_syn) AidA Type V secretory pathway, adhesin AidA [Cell envelope biogenesis] Ail_Lom Enterobacterial Ail/Lom protein; This family consists of several bacterial and phage Ail_Lom proteins AIP3 Actin interacting protein 3; Aip3p/Bud6p is a regulator of cell and cytoskeletal polarity Aldose_epim_Ec_YphB Aldose 1-epimerase, similar to Escherichia coli YphB AlpA Predicted transcriptional regulator [Transcription] AntA AntA/AntB antirepressor AraC AraC-type -
Curriculum Vitae Vern Lee Schramm
September 2011 CURRICULUM VITAE VERN LEE SCHRAMM Department of Biochemistry Albert Einstein College of Medicine of Yeshiva University 1300 Morris Park Avenue Bronx, New York 10461 Phone: (718) 430-2813 Fax: (718) 430-8565 E-mail: [email protected] Personal Information: Date of Birth: November 9, 1941 Place of Birth: Howard, South Dakota Citizenship: U.S.A. Home Address: 68 Hampton Oval New Rochelle, NY 10805 Home Telephone: (914) 576-2578 Education: Sept 1959 – June 1963 B.S. in Bacteriology (chemistry emphasis), South Dakota State College Sept 1963 – June 1965 Masters Degree in Nutrition (biochemistry emphasis), Harvard University Research Advisor, Dr. R.P. Geyer Oct 1965 – April 1969 Ph.D. in Mechanism of Enzyme Action, Department of Biochemistry, Australian National University Research Advisor, Dr. John Morrison Postdoctoral Experience: Aug 1969 – Aug 1971 NRC-NSF Postdoctoral Research Associate at NASA Ames Research Center, Biological Adaptation Branch Appointments: July 1999 – Present University Professor of the Albert Einstein College of Medicine July 1995 – Present Ruth Merns Endowed Chair of Biochemistry Aug 1987 – Present Professor and Chairman, Department of Biochemistry, Albert Einstein College of Medicine July 1981 - July 1987 Professor of Biochemistry, Temple University School of Medicine July 1976 - June 1981 Associate Professor of Biochemistry, Temple University School of Medicine Aug 1971 - July 1976 Assistant Professor of Biochemistry, Temple University School of Medicine Vern L. Schramm 2 Fields of Interest: Enzymatic