DOCSLIB.ORG

United States Patent (19) 11 Patent Number: 6,156,309 Miller Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
United States Patent (19) 11 Patent Number: 6,156,309 Miller Et Al USOO6156309A United States Patent (19) 11 Patent Number: 6,156,309 Miller et al. (45) Date of Patent: Dec. 5, 2000 54 INSECTICIDAL COMPOSITIONS AND Gearing and Possee (1990) “Functional Analysis of a 603 METHODS Nucleotide Open Reading Frame Upstream of the Polyhe drin Gene of Autographa Californica Nuclear Polyhedrosis 75 Inventors: Lois K. Miller, Athens, Ga.; Bruce C. Virus” Journal of General Virology 71:251–262. Black; Peter M. Dierks, both of Kumar and Miller (1987) “Effects of Serial Passage of Yardley, Pa.; Nancy C. Fleming, Autographa Californica Nuclear Polyhedrosis Virus in Cell Plainsboro, N.J. Culture’ Virus Research 7:335-349. 73 Assignees: University of Georgia Research Lee and Miller (1978) “Isolation of Genotypic Variants of Foundation, Athens, Ga.; American Autographa californica Nuclear Polyhedrosis Virus” Jour Cyanamid Corporation, Madison, N.J. nal of Virology 27:754–767. O'Reilly and Miller (1991) “Improvement of a Baculovirus 21 Appl. No.: 09/228,861 Pesticide by Deletion of the Egt Gene' Bio/Technology 9:1086-1089. 22 Filed: Jan. 12, 1999 Passarelli and Miller (1993) “Three Baculovirus Genes Involved in Late and Very Late Gene Expression: ie-l, ie-in, Related U.S. Application Data and lef-2” J. Virol. 67:21.49–2158. 63 Continuation-in-part of application No. 08/460,725, Jun. 2, Popham et al. (1988) “Characterization of a Variant of 1995, Pat. No. 5,858,353, which is a continuation of appli Autographa californica Nuclear Polyhedrosis Virus With a cation No. 08/281,916, Jul. 27, 1994, Pat. No. 5,662,897. Nonfunctional ORF 603” Biological Control 12:223–230. 51 Int. Cl." ............................. A01N 63/00; C12O 1/68; Possee et al. (1993) “Genetically Engineered Viral Insecti C12N 15/63; C12N 15/82; CO7H 21/04 cides: New Insecticides With Improved Phenotypes' Pesti 52 U.S. Cl. ............................. 424/93.7; 424/405; 435/6; cide Science 39:109-115. 435/320.1; 435/468; 536/23.1 Possee et al. (1991) “Nucleotide Sequence of the 58 Field of Search ................................... 424/93.7, 405; Autographa Californica Nuclear Polyhedrosis 9.4 kbp 435/6, 320.1, 468; 536/23.1 EcoRI-I and -R(Polyhedrin Gene) Region” Virology 185:229-241. 56) References Cited Vail et al. (1971) “Cross Infectivity of a Nuclear Polyhe U.S. PATENT DOCUMENTS drosis Virus Isolated from the Alfalfa Looper, Autographa californica” Proc. IVth Intl. Colloq. Insect Pathol, College 5,180,581 1/1993 Miller et al. ........................... 424/93.2 Park, MD, pp. 297.304. 5,246,936 9/1993 Treacy et al. ... ... 514/256 5,266,317 11/1993 Tomalski et al. ... 424/93.2 5,352,451 10/1994 Miller et al. ..... ... 424/93.2 Primary Examiner Robert A. Schwartzman 5,858,353 1/1999 Miller et al. ........................... 424/93.6 ASSistant Examiner William Sandals Attorney, Agent, or Firm-Greenlee, Winner and Sullivan FOREIGN PATENT DOCUMENTS P.C. 2005658 6/1990 Canada. 57 ABSTRACT OTHER PUBLICATIONS Insect Viruses capable of killing at least one target insect pest Crook et al. Replication, Molecular biology, and genetic quicker than previously described viruses and methods for engineering of granulosis viruses. Phytoparasitica. Vol. conferring that phenotype of faster killing are provided. 20:Suppl.,33s-38s, Jan. 1992. Further improvement in the speed of killing is obtained Palmer et al. Genetic modification of a entomopoxvirus: when the virus of this invention also contains a nonfunc deletion of the Spheroidin gene does not affect virus repli tional egt gene to reduce feeding by the infected larvae, cation in vitro. J. Gen Virol. vol. 76:15–23, Jan. 1995. inhibit growth and further mediate the earlier death of the Arif, B. Recent advances in the molecular biology of ento infected insect and/or it also contains and expresses a DNA mopoxviruses. J. Gen Virol. vol. 76:1-13, Jan. 1995. Sequence encoding an insect-specific toxin. The faster kill Croizier et al. (1988) “Recombination of Autographa cali ing phenotype is achieved by inactivating an ORF 603 of fornica and Rachiplusia ou Nuclear Polyhedrosis Viruses in AcMNPV or an ORF 603 homolog of a different species of Galleria mellonella L. J. Gen. Virol. 69:177-185. baculovirus. Improved insecticidal compositions and Federici and Hice (1997) “Organization and Molecular improved methods of controlling insects are also included Characterization of Genes in the Polyhedrin Region of the within the scope of this invention. Anagrapha falcifera Multinucleocapsid NPV Arch. Virol. 142:333-348. 5 Claims, 11 Drawing Sheets U.S. Patent Dec. 5, 2000 Sheet 2 of 11 6,156,309 O O D e O O o X - O (f C O h Od O OO C. O Hes N Ss CMO O U.S. Patent Dec. 5, 2000 Sheet 3 of 11 6,156,309 l.93 m.u. 3.27m.u. .7 kb MUI Mlul Nael EcoRV Esp L F.G. 3A MyI HindIII NaeI Espi W-8 F.G. 3B MyI HindIII Ngel FP L-IV-8Hybrid t F.G. 3C MyI HindIII Sk Espl Hybrid FS F.G. 3D U.S. Patent Dec. 5, 2000 Sheet 6 of 11 6,156,309 L-1 3419 aaaatcattttcaaatgattCaCagitta atttgCga CaatataattittaC 3468 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | W-8 3419 aaaatCattttcaaatgattCaCagttaatttgcgaCagtataattttgt 3468 L-1 3469 tttCaCataaactaga CQCCt. tgtc..gtCttCttCttCg tattoC 3512 | | | | | | | | | | | | | || | | | | | | | | | | | | | | | | | | || W-8 3469 tttCaCataaactagacgCCtttatctgtctgtcgtcttcttCg tattot 3518 L-1 3513 ttctCtttittcatttittCtcCtcataaaaattaa.catagttattatcgta 3562 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | V-8 3519 ttttCtttttcatttttctOttoataaaaattcacata attattatcgta 3568 L-1 3563 to CatatatgtatCtatCQtatagagtadatttitttgttgtCatadatat 3612 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | W-8 3569 toCatatatgtatCtgtcgtadagagtadatttitttgttgtCatadatat 3618 L-l 36l3 atatgtCtttitttaatggggtgtatagtaCCgCtgCgCatagtttittctg 3662 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | V-8 3619 atatgtttitttttaatggggtgtatagtaccgctg.cgCatagtttittCtt 3668 L-1 3663 taatttacaa CagtgCtatttitCtgg tagttcttCggagtgtgttgcttt 3712 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | || W-8 3669 taatttaaacCagtgctattttctggta attCttCggagtgtgttgcttt 3718 L-1 3713 a attattaa atttatataatcaatgaatttgggatCgtCGgttttgtaca 3762 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | W-8 3719 aattattaaatttatataatcaatgaatttgggatCgtCggttttgtaca 3768 Nae L-l 3763 atatgttgCCggCatagta CgCagCttCttCtd. 3795 | | | | | | | | | | | | | | | | | | | | | | | | | || W-8 3769 atatgttgCCggCatagtacgcagotggctCtaaatCad tattttittada 3818 AAa - 3796 . gttcaatta Caccattttttagcagoa CCggatta acataa 3836 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | || V-8 3819 Caacgactggatcaa.cattacCattttittagCaaCaCtggattaaCatad 3868 L-1 3837 CtttCCaaaatgttgtaCgaaCCgittadaCaaaaa.cagttca CCtCCCtt 3886 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | V-8 3869 ttttCcaaaatgctgtacga agcgtttaacaaaaaCagttcacttCC9tt 3918 FG4C U.S. Patent Dec. 5, 2000 Sheet 7 of 11 6,156,309 L-l 3887 ttCtatactattgtctg.cgagcagttgtttgttgttaaaaataacagoca<-- 3936 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | W-8 3919 ttctatactatogtotgcgagCagttgCttgttgttaaaaataacggcca 3968 * (603 ORF) L-1 3937 ttgtaatgagacqCacaaactaatatoacaaactggaaatgtctato. 3983 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | W-8 3969 ttgtaatgaaacgCacaaactaatattacaCactaaaaaaatCtatCatt 4018 - ECORV L-1 3984 . datatatagttgCtgatatDatggagataattaaaatgataaC 4026 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | V-8 4019 toggcttaatatatagttgctgatattatgtaaataattaaaatgataac 4068 L-1 4027 CatCtcgcaaataaataagtattittaCtgttttCgta acagttttgtaat 4076 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | V-8 4069 CatctogcaaataaataagtattttactgttttCgta acagttttgtaat 4118 * (polh) --> L-1 4077 aaaaaaacctataaatatgcCggattattoataCCgtCCCaCCatCgggC 4126 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | V-8 4119 aaaaaaaCCtataaatatgcCggattattoataCCgtCCCaCCatCgggC 4168 L-1 4127 gtaCCtaCgtgtacgaCaacaagtactaCaaaaatttaggtgCCgttatC 4176 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | V-8 4l 69 gtacctacgtgtacgacaacaaatattacaaaaatttaggtgCCgttatc. 4218 - ESDI L-1 4177 aagaacgctaagC 4189 | | | | | | | | | | | | | V-8 4219 aagaacgctaagC 4231 FG.4D U.S. Patent Dec. 5, 2000 Sheet 8 of 11 6,156,309 AN SN SY S.SY SY(SY Vs &is is& SS& SS& Sa isvs. SSSS S S S. s' & L1 ORF 5 HindIII Bam H. Milu NgoAIV HindIII V8 lef.2 { ORF 5 ORF 603' FIG. 5A wV8EGTEcoRacz Se8387 Bsu36 Bsu36I { hsp ORF 603 prom Se8387 Bsu36 K to 34 wV8EE6.9tOX34SB { p6.9 ORF 603" prom —kSse8387 as I Bsu36I- vv8EEhsptox34SB { hsp pron ORF 603" FIG. 5B U.S. Patent Dec. 5, 2000 Sheet 9 of 11 6,156,309 GTCGACGCGC TTCTGCGTAT AATTGCACAC TAACATCTTG CCCTTTGAAC TTGACCTCGA TTGTGTTAAT TTTTCGCTAT AAAAAGGTCA, CCCTTTAAAA TTTCTTACAT AATCAAATTACCACTACACT TATTCCCTTT Olg CAACCAAAAT GACTATTCTC TGCTCCCTTC CACTCCTGTC TACGCTTACT GCTGTAAATG CCCCCAATAT ECTDEL ammum as ATTGGCCGTG TTTCCTACGC CACCTTACAG CCACCATATA GTGTACAAAG TGTATATTGA AGCCCTTCCC GAAAAATGTC ACAACGTTAC GCTCGTCAAG CCCAAACTGT TTGCGTATTC AACTAAAACT TATTGCGGTA EcoRI ATATCACGGA AATTAATGCC GACATGTCTG TTGACCAATA CAAAAAACTA GTGGCGAATT CCCCAATGTT TAGAAACCCC GGAGTCGTGT CCGATACAGA CACGCTAACC GCCGCTAACT ACCTACGCTT GATTGAAATG TGAAAAACTACCCAACAACGTCCAATTCCTTTTCCTAAAC CTCCATCCCAIATTTGACAA CACCCACCCA1094 bp GCTCATCAATCATGATAAAG CAACGTTTCC GCCTCTAGAT AAAGCCATCA AATTCACAGA
Load more

Recommended publications
  • Autographa Gamma
    1 Table of Contents Table of Contents Authors, Reviewers, Draft Log 4 Introduction to the Reference 6 Soybean Background 11 Arthropods 14 Primary Pests of Soybean (Full Pest Datasheet) 14 Adoretus sinicus ............................................................................................................. 14 Autographa gamma ....................................................................................................... 26 Chrysodeixis chalcites ................................................................................................... 36 Cydia fabivora ................................................................................................................. 49 Diabrotica speciosa ........................................................................................................ 55 Helicoverpa armigera..................................................................................................... 65 Leguminivora glycinivorella .......................................................................................... 80 Mamestra brassicae....................................................................................................... 85 Spodoptera littoralis ....................................................................................................... 94 Spodoptera litura .......................................................................................................... 106 Secondary Pests of Soybean (Truncated Pest Datasheet) 118 Adoxophyes orana ......................................................................................................
    [Show full text]
  • Baculovirus Enhancins and Their Role in Viral Pathogenicity
    9 Baculovirus Enhancins and Their Role in Viral Pathogenicity James M. Slavicek USDA Forest Service USA 1. Introduction Baculoviruses are a large group of viruses pathogenic to arthropods, primarily insects from the order Lepidoptera and also insects in the orders Hymenoptera and Diptera (Moscardi 1999; Herniou & Jehle, 2007). Baculoviruses have been used to control insect pests on agricultural crops and forests around the world (Moscardi, 1999; Szewczk et al., 2006, 2009; Erlandson 2008). Efforts have been ongoing for the last two decades to develop strains of baculoviruses with greater potency or other attributes to decrease the cost of their use through a lower cost of production or application. Early efforts focused on the insertion of foreign genes into the genomes of baculoviruses that would increase viral killing speed for use to control agricultural insect pests (Black et al., 1997; Bonning & Hammock, 1996). More recently, research efforts have focused on viral genes that are involved in the initial and early processes of infection and host factors that impede successful infection (Rohrmann, 2011). The enhancins are proteins produced by some baculoviruses that are involved in one of the earliest events of host infection. This article provides a review of baculovirus enhancins and their role in the earliest phases of viral infection. 2. Lepidopteran specific baculoviruses The Baculoviridae are divided into four genera: the Alphabaculovirus (lepidopteran-specific nucleopolyhedroviruses, NPV), Betabaculovirus (lepidopteran specific Granuloviruses, GV), Gammabaculovirus (hymenopteran-specific NPV), and Deltabaculovirus (dipteran-specific NPV) (Jehle et al., 2006). Baculoviruses are arthropod-specific viruses with rod-shaped nucleocapsids ranging in size from 30-60 nm x 250-300 nm.
    [Show full text]
  • Lepidoptera: Noctuidae) on a Latitudinal Gradient in Brazil
    Revista Brasileira de Entomologia 65(1):e20200103, 2021 The influence of agricultural occupation and climate on the spatial distribution of Plusiinae (Lepidoptera: Noctuidae) on a latitudinal gradient in Brazil Sabrina Raisa dos Santos1 , Alexandre Specht2* , Eduardo Carneiro1 , Mirna Martins Casagrande1 1Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Estudos de Lepidoptera Neotropical, Curitiba, PR, Brasil. 2Embrapa Cerrados, Laboratório de Entomologia, Planaltina, DF, Brasil. ARTICLE INFO ABSTRACT Article history: Studies have reported the presence of certain Plusiinae species in both natural and agricultural landscapes, Received 16 October 2020 but their turnover in association with agricultural activities remains unexplored. Aiming to understand how Accepted 17 January 2021 the assemblages of Plusiinae are structured by agricultural occupation and climate, this study used automated Available online 24 February 2021 light traps sampled moths in 18 sites in Brazil, across a broad latitudinal gradient. Our data has demonstrated Associate Editor: Thamara Zacca that climate variables prevails as the most important variables influencing both the composition of Plusiinae and the abundance of its dominant species Chrysodeixis includens. On the other hand, the lack of significance found for the effect of variables representing agricultural occupation evidences that pest species are present Keywords: both in agricultural and natural ecosystems, also sharing similar abundances at those locations. In other words, Abundance instead of following a gradient of agricultural occupation (e.g. crop sizes around sample sites) the composition Assemblage structure of these extremely polyphagous insects is more clearly shaped by the latitudinal gradient, in which temperature Looper moths and precipitation are better predictors. Thus, in contrary to our expectations, pest species inhabits both natural Pest species and agricultural landscapes at similar latitudinal sites, probably due to their wide polyphagy spectrum.
    [Show full text]
  • (Guenée) (Lepidoptera: Noctuidae) Em Fumo (Nicotiana Tabacum L.) No Rio Grande Do Sul
    September - October 2006 705 SCIENTIFIC NOTE Ocorrência de Rachiplusia nu (Guenée) (Lepidoptera: Noctuidae) em Fumo (Nicotiana tabacum L.) no Rio Grande do Sul ALEXANDRE SPECHT1,2, JERSON V.C. GUEDES3, FELIPE SULZBACH3 E TATIANE G. V OGT1 1Depto. Ciências Exatas e da Natureza, UCS, Campus Universitário da Região dos Vinhedos, C. postal 32, 95700-000 Bento Gonçalves, RS 2Instituto de Biotecnologia, UCS, Cidade Universitária, C. postal 1352, 95070-560, Caxias do Sul, RS 3Depto. Defesa Fitossanitária, Univ. Federal de Santa Maria, 97105-900, Santa Maria, RS Neotropical Entomology 35(5):705-706 (2006) Occurrence of Rachiplusia nu (Guenée) (Lepidoptera: Noctuidae) on Tobacco (Nicotiana tabacum L.) in Rio Grande do Sul, Brazil ABSTRACT - The occurrence of Rachiplusia nu (Guenée) is registered for the first time in tobacco [Nicotiana tabacum L. (Solanaceae)]. The specimens were collected in a Virginia tobacco field, in Venâncio Aires, State of Rio Grande do Sul. Caterpillars occurred in large infestations, causing important damage to tobacco leaves, and demanding chemical control to minimize losses. This occurrence indicates that this species can feed on Virginia tobacco, which corresponds to 80% of the tobacco area of Rio Grande do Sul, and so presents high risk to become an important pest in tobacco fields. KEY WORDS: Insecta, Plusiinae, caterpillar, semi-looper RESUMO - É registrada pela primeira vez a ocorrência de Rachiplusia nu (Guenée) em Nicotiana tabacum L. (Solanaceae). Os espécimes foram coletados em uma lavoura de fumo tipo Virgínia, em Venâncio Aires, RS. As lagartas ocorreram em grande número, causando expressivo desfolhamento das plantas e demandando controle químico para minimizar os danos.
    [Show full text]
  • The Complete Genome of Rachiplusia Nu Nucleopolyhedrovirus (Ranunpv) and the Identification of a Baculoviral CPD-Photolyase Homolog T
    Virology 534 (2019) 64–71 Contents lists available at ScienceDirect Virology journal homepage: www.elsevier.com/locate/virology The complete genome of Rachiplusia nu nucleopolyhedrovirus (RanuNPV) and the identification of a baculoviral CPD-photolyase homolog T Luana Beló Trentina, Ethiane R. Santosa, Admilton G. Oliveira Juniorc, Daniel R. Sosa-Gómezd, ∗ Bergmann Morais Ribeirob, Daniel M.P. Ardisson-Araújoa, a Laboratory of Insect Virology, Department of Biochemistry and Molecular Biology, Federal University of Santa Maria, Santa Maria, RS, 97105-900, Brazil b Laboratory of Baculovirus, Cell Biology Department, University of Brasilia, Brasilia, DF, 70910-900, Brazil c Department of Microbiology, Londrina State University, Londrina, PR, 86057-970, Brazil d Embrapa Soja, Londrina, PR, 86001-970, Brazil ARTICLE INFO ABSTRACT Keywords: We described a novel baculovirus isolated from the polyphagous insect pest Rachiplusia nu. The virus presented Baculovirus genome pyramidal-shaped occlusion bodies (OBs) with singly-embed nucleocapsids and a dose mortality response of Alphabaculovirus 6.9 × 103 OBs/ml to third-instar larvae of R. nu. The virus genome is 128,587 bp long with a G + C content of Rachiplusia nu nucleopolyhedrovirus 37.9% and 134 predicted ORFs. The virus is an alphabaculovirus closely related to Trichoplusia ni single nu- Photolyase cleopolyhedrovirus, Chrysodeixis chalcites nucleopolyhedrovirus, and Chrysodeixis includens single nucleopo- Plusiinae lyhedrovirus and may constitute a new species. Surprisingly, we found co-evolution among the related viruses Evolution and their hosts at species level. Besides, auxiliary genes with homologs in other baculoviruses were found, e.g. a CPD-photolyase. The gene seemed to be result of a single event of horizontal transfer from lepidopterans to alphabaculovirus, followed by a transference from alpha to betabaculovirus.
    [Show full text]
  • Autographa Gamma
    Autographa gamma Scientific Name Autographa gamma L., 1758 Synonyms: Plusia gamma var. gammina Staudinger Previous older combinations: Phytometra gamma L., Plusia gamma L. Common Name Silver Y moth, beet worm, Figure 1. Autographa gamma adult (Julieta Brambila, USDA-APHIS- gamma owlet PPQ, Bugwood.org). Type of Pest Moth Taxonomic Position Class: Insecta, Order: Lepidoptera, Family: Noctuidae Reason for Inclusion in Manual CAPS Target: AHP Prioritized Pest List - 2006 through 2009 Pest Description Eggs: Eggs are semi-spherical and 0.57 mm 1 (< /32 in) in diameter. They are strongly and irregularly ribbed with 28 or 29 ribs (Paulian et al., 1975; Carter, 1984). Eggs are initially yellowish-white, but as they age, they turn yellowish-orange and later brown. They are laid singly or in small groups on the underside of leaves (Hill, 1987). Larvae: The larvae are “semiloopers” with only three pairs of prolegs: two pairs of Figure 2. Eggs of Autographa gamma (Jurgen abdominal prolegs and one pair of anal Rodeland, prolegs (abdominal segments 5, 6, and 10) http://www.rodeland.de/fotos/lepidoptera/autograph (Fig. 3) (Carter, 1984; Hill, 1987; a_gamma.htm). INRA/HYPP Zoology, 2011). The caterpillar ranges from bright green to dark olive green. There is a dark green dorsal line edged Last update: January 13, 2014 1 with white (Fig. 3) (Jones and Jones, 1984). The spiracular line is yellowish, edged above with green. There are several white transverse lines between the spiracular line and the dorsal dark green line (Jones and Jones, 1984). Some larval forms have white spots. The head has a dark patch under the ocelli or is entirely black and glossy (Emmett, 1980).
    [Show full text]
  • Autographa Californica Multiple Nucleopolyhedrovirus ODV-E56
    Entomology Publications Entomology 5-2010 Autographa californica multiple nucleopolyhedrovirus ODV-E56 envelope protein is required for oral infectivity and can be substituted functionally by Rachiplusia ou multiple nucleopolyhedrovirus ODV-E56 Robert L. Harrison United States Department of Agriculture Wendy O. Sparks Iowa State University Bryony C. Bonning Iowa State University, [email protected] Follow this and additional works at: http://lib.dr.iastate.edu/ent_pubs Part of the Entomology Commons The ompc lete bibliographic information for this item can be found at http://lib.dr.iastate.edu/ ent_pubs/22. For information on how to cite this item, please visit http://lib.dr.iastate.edu/ howtocite.html. This Article is brought to you for free and open access by the Entomology at Digital Repository @ Iowa State University. It has been accepted for inclusion in Entomology Publications by an authorized administrator of Digital Repository @ Iowa State University. For more information, please contact [email protected]. Journal of General Virology (2010), 91, 1173–1182 DOI 10.1099/vir.0.017160-0 Autographa californica multiple nucleopolyhedrovirus ODV-E56 envelope protein is required for oral infectivity and can be substituted functionally by Rachiplusia ou multiple nucleopolyhedrovirus ODV-E56 Robert L. Harrison,1 Wendy O. Sparks2 and Bryony C. Bonning2 Correspondence 1Invasive Insect Biocontrol and Behavior Laboratory, USDA Agricultural Research Service Robert L. Harrison (USDA-ARS), Plant Sciences Institute, 10300 Baltimore Avenue, Beltsville, MD 20705, USA [email protected] 2Department of Entomology and Interdepartmental Genetics Program, Iowa State University, Ames, IA 50010, USA The Autographa californica multiple nucleopolyhedrovirus (AcMNPV) odv-e56 gene encodes an occlusion-derived virus (ODV)-specific envelope protein, ODV-E56.
    [Show full text]
  • Ranumnpv, Biological Control, Host Range
    International Journal of Virology and Molecular Biology 2012, 1(3): 28-34 DOI: 10.5923/j.ijvmb.20120103.02 Isolation and Characterization of a Nucleopolyhedrovirus from Rachiplusia nu (Guenée) (Lepidoptera: Noctuidae) Vanina A. Rodrígue z1, Mariano N. Belaich1, Graciela Quintana2, Alicia Sciocco Cap2, 1,* Pablo D. Ghiringhelli 1Departamento de Ciencia y Tecnología, LIGBCM-AVI, Roque Sáenz Peña 352, Bernal, 1876, Argentina 2INTA, IMyZA-CCVyA, CC25, Castelar, 1712, Argentina Abstract Rachiplusia nu (Guenée) (Lepidoptera: Noctuidae) is an important pest of vegetable crops widely distributed in South America. At present, its control is based on the use of broad spectrum chemical insecticides. In order to develop a more selective alternative to be applied in integrated or organic pest management programs, we isolated and characterized a baculovirus that infects R. nu, denominated RanuMNPV (Rachiplusia nu multiple nucleopolyhedrovirus) in view of its morphology and pattern of infection. According to optical microscope images of in vitro infected cell cultures, data fro m bioassays carried out with various species of larvae, and DNA sequences from p74, polyhedrin, v-cathepsin, v-chitinase, lef8 and lef9 genes, this isolate could be considered as a variant of Autographa californica MNPV with a different host range. Ke ywo rds RanuMNPV, AcMNPV, Biological Control, Host Range the presence of gp64 gene[4]. 1. Introduction Among the NPVs isolated from noctuid larvae of the Subfamily Plusiinae, many have demonstrated a great The family Baculoviridae comprises a large number of potential as biopesticides and are successfully used in pest viruses which infect arthropods, mostly insects from the management programs[5-11]. Studies based on restriction order Lepidoptera and some others from Hymenoptera and endonuclease mapping, nucleic acid hybridization, and Diptera[1],[2].
    [Show full text]
  • The Plusiinae (Lepidoptera: Noctuidae) of America North of Mexico, Emphasizing Genitalic and Larval Morphology
    i The Plusiinae (Lepidoptera: Noctuidae) of America North of Mexico, Emphasizing Genitalic and Larval Morphology Technical Bulletin No. 1567 •:_.C^ ;-5C2 :—I m Agricultural Research Service UNITED STATES DEPARTMENT OF AGRICULTURE •^iyt$.i: The Plusiinae (Lépidoptera: Noctuidae) of America North of Mexico, Emphasizing Genitalic and Larval Morphology By THOMAS D. EICHLIN and HUGH B. CUNNINGHAM Technical Bulletin No. 1567 Agricultural Research Service UNITED STATES DEPARTMENT OF AGRICULTURE ABSTRACT T D. Eichlm and H. B. Cunningham. The Plusiinae (Lepidoptera: Noctui- dae) of America North of Mexico, Emphasizing Genitalic and Larval Morphology. U.S. Department of Agriculture Technical Bulletin 1567, 122 pp., 1978. Adults of 71 species and larvae of 35 species of the noctuid subfamily flusimae of America north of Mexico were studied. Included are keys to the genera based on adult structures, a key to the species for which larvae are known, with setal maps and illustrations of other taxonomic characters, and keys to the adults based on the external morphology and on the male and témale genitalia, with photographs and illustrations of the structures Two species are described, Syngrapha abstrusa n. sp. and S. cryptica n sp., which form a species complex with S. alias (Ottolengui). S. viridisiffma (Cxrote) IS elevated to species level, having previously been considered a variation of S. selecta (Walker). Caloplusia Smith and Anagrapha Mc- Dunnough are synonymized with Syngrapha Hübner. Biological data distributional information, and bibliographical notations are included A phylogeny for the species comprising the subfamily in North America is proposed. This phylogeny has been deduced by correlating characters of both adults and larvae and comparing it with similar studies of Palearctic species.
    [Show full text]
  • The Plusiinae (Lepidoptera: Noctuidae) of America North of Mexico, Empllasizing Genitalic and Larval Morpholog,Ry
    2 8 2 8 1/11/2.5 2 5 1.0 :; 11111 . 1.0 :!t 11111 . 11111 . I~ ~~13.2. .2 I~ l~p2 2.2 L:.l I" •.:.: 136 .::: I~ u:: """ \:,; &:. :f J~ u I~ 2.0 " .... " 1.1 ...t:lf,.:.1.I. 1.1 La,:,,," --- -- 111111.8 1 4 1 6 111111.25 111111.4 111111.6 111111.25 11111 . 11111 . MICROCOPY RESOLUTION TEST CHART MICROCOPY RESOLUTION TEST CHARl NATIONAL BUREAU OF STANDARDS·1963·A NATIONAL BUREAU Of STANDARDS·1963·A The Plusiinae (Lepidoptera: Noctuidae) of America North of Mexico, Empllasizing Genitalic and Larval Morpholog,ry By THOMAS D. EICHLIN and HUGH B. CUNNINGHAM Technical Bulletin No. 1567 Agricultural Research Service UNITED STATES DEPARTMENT OF AGRICULTURE ABSTRACT T. D. Eichlin and H. B. Cunningham. The Plusiinae (Lepidoptera: Noctui­ dae) of America North of Mexico, Emphasizing Genitalic and Larval Morphology. U.S. Department of Agriculture Technical Bulletin 1567, 122 pp., 1978. Adults of 71 species and larvae of 35 species of the noctuid subfamily Plusiinae of America north of Mexico were studied. Included are keys to the genera based on adult structures, a key to the species for which larvae are knovm, with setal maps and illustrations of other taxonomic characters, and keys to t:he a.dults based on the external morphology and on the male and female gemtalia, with photographs and illustrations ofthe structures. Two species are described, Syngrapha abstrusa n. sp. and S. cryptica n. sp., which form a species complex with S. alias (Ottolengui). S. viridisigma (Grote) is elevated to species level, having previously been considered a variation of S.
    [Show full text]
  • Zootaxa, Plusiinae (Lepidoptera: Noctuidae)
    Zootaxa 1032: 1–28 (2005) ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ ZOOTAXA 1032 Copyright © 2005 Magnolia Press ISSN 1175-5334 (online edition) The Plusiinae (Lepidoptera: Noctuidae) of Great Smoky Moun- tains National Park MICHAEL G. POGUE Systematic Entomology Laboratory, PSI, Agricultural Research Service, U. S. Department of Agriculture, c/o Smithsonian Institution, P.O. Box 37012, NMNH, MRC-168, Washington, DC 20013-7012, USA [email protected] Abstract Seventeen species of Plusiinae have been found in Great Smoky Mountains National Park, in Tennessee and North Carolina, USA. These species are documented with adult images, description, flight period, abundance, elevation range, Park and general distribution, and larval hosts from the literature. Maps illustrate the known distribution of each species within the Park. Sixteen of the 17 species occur above 4,000 feet in elevation. The most diverse locality in the Park has 14 species. Key words: systematics, All Taxa Biodiversity Inventory, North Carolina, Tennessee, moths Introduction Great Smoky Mountains National Park (GSMNP) is one of the most biologically diverse areas in the temperate region. The Park straddles the Southern Appalachians in eastern Tennessee and western North Carolina and encompasses over 800 square miles (2,200 sq. km), ranging in elevation from 875 to 6,643 feet (266–2,025 m). Ascending in altitude is equivalent to moving northward in latitude, which results in many northern and boreal moth species reaching their southern distribution in GSMNP. Global biodiversity is in crisis with the prediction of the fastest mass extinction in biological history currently in progress. A number of threats to the Park’s ecological integrity include invasive species in both terrestrial and aquatic habitats, very high deposits of nitrogen and sulfur, high ozone levels, and fragmentation of surrounding natural areas as a result of increased human development.
    [Show full text]
  • Polyhedral Envelope Protein Mutants of Rachiplusia Ou Multi-Nucleocapsid Nucleopolyhedrovirus" (2002)
    Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations 1-1-2002 Polyhedral envelope protein mutants of Rachiplusia ou multi- nucleocapsid nucleopolyhedrovirus Hailing Jin Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/rtd Recommended Citation Jin, Hailing, "Polyhedral envelope protein mutants of Rachiplusia ou multi-nucleocapsid nucleopolyhedrovirus" (2002). Retrospective Theses and Dissertations. 20111. https://lib.dr.iastate.edu/rtd/20111 This Thesis is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Polyhedral envelope protein mutants of Rachiplusia ou multi-nucleocapsid nucleopolyhedrovirus by Hailing Jin A thesis submitted to the graduate faculty in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Major: Genetics Program of Study Committee: Bryony C. Bonning, Major Professor Susan L. Carpenter Jeffrey K. Beetham Iowa State University Ames, Iowa 2002 11 Graduate College Iowa State University This is to certify that the master's thesis of Hailing Jin has met the thesis requirements of Iowa State University Signatures have been redacted for privacy 111 TABLE OF CONTENTS LIST OF FIGURES lV LIST OF TABLES v ABSTRACT Vl CHAPTERl.GENERALINTRODUCTION 1 LITERATURE REVIEW 1 Baculovirus biology 1 Baculoviruses as biological control agents 5 Recombinant baculoviruses in pest management 7 Strategies for reduction of lethal dose 10 THESIS ORGANIZATION 13 CHAPTER2. POLYHEDRAL ENVELOPE PROTEIN MUTANTS OF RACH/PLUS/A OUMULTI-NUCLEOCAPSID NUCLEOPOLYHEDROVIRUS 14 ABSTRACT 14 INTRODUCTION 15 MATERIALS AND METHODS 16 RESULTS 24 DISCUSSION 28 ACKNOWLEDGEMENTS 33 CHAPTER 3.
    [Show full text]