
USOO6156309A United States Patent (19) 11 Patent Number: 6,156,309 Miller et al. (45) Date of Patent: Dec. 5, 2000 54 INSECTICIDAL COMPOSITIONS AND Gearing and Possee (1990) “Functional Analysis of a 603 METHODS Nucleotide Open Reading Frame Upstream of the Polyhe drin Gene of Autographa Californica Nuclear Polyhedrosis 75 Inventors: Lois K. Miller, Athens, Ga.; Bruce C. Virus” Journal of General Virology 71:251–262. Black; Peter M. Dierks, both of Kumar and Miller (1987) “Effects of Serial Passage of Yardley, Pa.; Nancy C. Fleming, Autographa Californica Nuclear Polyhedrosis Virus in Cell Plainsboro, N.J. Culture’ Virus Research 7:335-349. 73 Assignees: University of Georgia Research Lee and Miller (1978) “Isolation of Genotypic Variants of Foundation, Athens, Ga.; American Autographa californica Nuclear Polyhedrosis Virus” Jour Cyanamid Corporation, Madison, N.J. nal of Virology 27:754–767. O'Reilly and Miller (1991) “Improvement of a Baculovirus 21 Appl. No.: 09/228,861 Pesticide by Deletion of the Egt Gene' Bio/Technology 9:1086-1089. 22 Filed: Jan. 12, 1999 Passarelli and Miller (1993) “Three Baculovirus Genes Involved in Late and Very Late Gene Expression: ie-l, ie-in, Related U.S. Application Data and lef-2” J. Virol. 67:21.49–2158. 63 Continuation-in-part of application No. 08/460,725, Jun. 2, Popham et al. (1988) “Characterization of a Variant of 1995, Pat. No. 5,858,353, which is a continuation of appli Autographa californica Nuclear Polyhedrosis Virus With a cation No. 08/281,916, Jul. 27, 1994, Pat. No. 5,662,897. Nonfunctional ORF 603” Biological Control 12:223–230. 51 Int. Cl." ............................. A01N 63/00; C12O 1/68; Possee et al. (1993) “Genetically Engineered Viral Insecti C12N 15/63; C12N 15/82; CO7H 21/04 cides: New Insecticides With Improved Phenotypes' Pesti 52 U.S. Cl. ............................. 424/93.7; 424/405; 435/6; cide Science 39:109-115. 435/320.1; 435/468; 536/23.1 Possee et al. (1991) “Nucleotide Sequence of the 58 Field of Search ................................... 424/93.7, 405; Autographa Californica Nuclear Polyhedrosis 9.4 kbp 435/6, 320.1, 468; 536/23.1 EcoRI-I and -R(Polyhedrin Gene) Region” Virology 185:229-241. 56) References Cited Vail et al. (1971) “Cross Infectivity of a Nuclear Polyhe U.S. PATENT DOCUMENTS drosis Virus Isolated from the Alfalfa Looper, Autographa californica” Proc. IVth Intl. Colloq. Insect Pathol, College 5,180,581 1/1993 Miller et al. ........................... 424/93.2 Park, MD, pp. 297.304. 5,246,936 9/1993 Treacy et al. ... ... 514/256 5,266,317 11/1993 Tomalski et al. ... 424/93.2 5,352,451 10/1994 Miller et al. ..... ... 424/93.2 Primary Examiner Robert A. Schwartzman 5,858,353 1/1999 Miller et al. ........................... 424/93.6 ASSistant Examiner William Sandals Attorney, Agent, or Firm-Greenlee, Winner and Sullivan FOREIGN PATENT DOCUMENTS P.C. 2005658 6/1990 Canada. 57 ABSTRACT OTHER PUBLICATIONS Insect Viruses capable of killing at least one target insect pest Crook et al. Replication, Molecular biology, and genetic quicker than previously described viruses and methods for engineering of granulosis viruses. Phytoparasitica. Vol. conferring that phenotype of faster killing are provided. 20:Suppl.,33s-38s, Jan. 1992. Further improvement in the speed of killing is obtained Palmer et al. Genetic modification of a entomopoxvirus: when the virus of this invention also contains a nonfunc deletion of the Spheroidin gene does not affect virus repli tional egt gene to reduce feeding by the infected larvae, cation in vitro. J. Gen Virol. vol. 76:15–23, Jan. 1995. inhibit growth and further mediate the earlier death of the Arif, B. Recent advances in the molecular biology of ento infected insect and/or it also contains and expresses a DNA mopoxviruses. J. Gen Virol. vol. 76:1-13, Jan. 1995. Sequence encoding an insect-specific toxin. The faster kill Croizier et al. (1988) “Recombination of Autographa cali ing phenotype is achieved by inactivating an ORF 603 of fornica and Rachiplusia ou Nuclear Polyhedrosis Viruses in AcMNPV or an ORF 603 homolog of a different species of Galleria mellonella L. J. Gen. Virol. 69:177-185. baculovirus. Improved insecticidal compositions and Federici and Hice (1997) “Organization and Molecular improved methods of controlling insects are also included Characterization of Genes in the Polyhedrin Region of the within the scope of this invention. Anagrapha falcifera Multinucleocapsid NPV Arch. Virol. 142:333-348. 5 Claims, 11 Drawing Sheets U.S. Patent Dec. 5, 2000 Sheet 2 of 11 6,156,309 O O D e O O o X - O (f C O h Od O OO C. O Hes N Ss CMO O U.S. Patent Dec. 5, 2000 Sheet 3 of 11 6,156,309 l.93 m.u. 3.27m.u. .7 kb MUI Mlul Nael EcoRV Esp L F.G. 3A MyI HindIII NaeI Espi W-8 F.G. 3B MyI HindIII Ngel FP L-IV-8Hybrid t F.G. 3C MyI HindIII Sk Espl Hybrid FS F.G. 3D U.S. Patent Dec. 5, 2000 Sheet 6 of 11 6,156,309 L-1 3419 aaaatcattttcaaatgattCaCagitta atttgCga CaatataattittaC 3468 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | W-8 3419 aaaatCattttcaaatgattCaCagttaatttgcgaCagtataattttgt 3468 L-1 3469 tttCaCataaactaga CQCCt. tgtc..gtCttCttCttCg tattoC 3512 | | | | | | | | | | | | | || | | | | | | | | | | | | | | | | | | || W-8 3469 tttCaCataaactagacgCCtttatctgtctgtcgtcttcttCg tattot 3518 L-1 3513 ttctCtttittcatttittCtcCtcataaaaattaa.catagttattatcgta 3562 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | V-8 3519 ttttCtttttcatttttctOttoataaaaattcacata attattatcgta 3568 L-1 3563 to CatatatgtatCtatCQtatagagtadatttitttgttgtCatadatat 3612 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | W-8 3569 toCatatatgtatCtgtcgtadagagtadatttitttgttgtCatadatat 3618 L-l 36l3 atatgtCtttitttaatggggtgtatagtaCCgCtgCgCatagtttittctg 3662 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | V-8 3619 atatgtttitttttaatggggtgtatagtaccgctg.cgCatagtttittCtt 3668 L-1 3663 taatttacaa CagtgCtatttitCtgg tagttcttCggagtgtgttgcttt 3712 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | || W-8 3669 taatttaaacCagtgctattttctggta attCttCggagtgtgttgcttt 3718 L-1 3713 a attattaa atttatataatcaatgaatttgggatCgtCGgttttgtaca 3762 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | W-8 3719 aattattaaatttatataatcaatgaatttgggatCgtCggttttgtaca 3768 Nae L-l 3763 atatgttgCCggCatagta CgCagCttCttCtd. 3795 | | | | | | | | | | | | | | | | | | | | | | | | | || W-8 3769 atatgttgCCggCatagtacgcagotggctCtaaatCad tattttittada 3818 AAa - 3796 . gttcaatta Caccattttttagcagoa CCggatta acataa 3836 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | || V-8 3819 Caacgactggatcaa.cattacCattttittagCaaCaCtggattaaCatad 3868 L-1 3837 CtttCCaaaatgttgtaCgaaCCgittadaCaaaaa.cagttca CCtCCCtt 3886 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | V-8 3869 ttttCcaaaatgctgtacga agcgtttaacaaaaaCagttcacttCC9tt 3918 FG4C U.S. Patent Dec. 5, 2000 Sheet 7 of 11 6,156,309 L-l 3887 ttCtatactattgtctg.cgagcagttgtttgttgttaaaaataacagoca<-- 3936 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | W-8 3919 ttctatactatogtotgcgagCagttgCttgttgttaaaaataacggcca 3968 * (603 ORF) L-1 3937 ttgtaatgagacqCacaaactaatatoacaaactggaaatgtctato. 3983 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | W-8 3969 ttgtaatgaaacgCacaaactaatattacaCactaaaaaaatCtatCatt 4018 - ECORV L-1 3984 . datatatagttgCtgatatDatggagataattaaaatgataaC 4026 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | V-8 4019 toggcttaatatatagttgctgatattatgtaaataattaaaatgataac 4068 L-1 4027 CatCtcgcaaataaataagtattittaCtgttttCgta acagttttgtaat 4076 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | V-8 4069 CatctogcaaataaataagtattttactgttttCgta acagttttgtaat 4118 * (polh) --> L-1 4077 aaaaaaacctataaatatgcCggattattoataCCgtCCCaCCatCgggC 4126 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | V-8 4119 aaaaaaaCCtataaatatgcCggattattoataCCgtCCCaCCatCgggC 4168 L-1 4127 gtaCCtaCgtgtacgaCaacaagtactaCaaaaatttaggtgCCgttatC 4176 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | V-8 4l 69 gtacctacgtgtacgacaacaaatattacaaaaatttaggtgCCgttatc. 4218 - ESDI L-1 4177 aagaacgctaagC 4189 | | | | | | | | | | | | | V-8 4219 aagaacgctaagC 4231 FG.4D U.S. Patent Dec. 5, 2000 Sheet 8 of 11 6,156,309 AN SN SY S.SY SY(SY Vs &is is& SS& SS& Sa isvs. SSSS S S S. s' & L1 ORF 5 HindIII Bam H. Milu NgoAIV HindIII V8 lef.2 { ORF 5 ORF 603' FIG. 5A wV8EGTEcoRacz Se8387 Bsu36 Bsu36I { hsp ORF 603 prom Se8387 Bsu36 K to 34 wV8EE6.9tOX34SB { p6.9 ORF 603" prom —kSse8387 as I Bsu36I- vv8EEhsptox34SB { hsp pron ORF 603" FIG. 5B U.S. Patent Dec. 5, 2000 Sheet 9 of 11 6,156,309 GTCGACGCGC TTCTGCGTAT AATTGCACAC TAACATCTTG CCCTTTGAAC TTGACCTCGA TTGTGTTAAT TTTTCGCTAT AAAAAGGTCA, CCCTTTAAAA TTTCTTACAT AATCAAATTACCACTACACT TATTCCCTTT Olg CAACCAAAAT GACTATTCTC TGCTCCCTTC CACTCCTGTC TACGCTTACT GCTGTAAATG CCCCCAATAT ECTDEL ammum as ATTGGCCGTG TTTCCTACGC CACCTTACAG CCACCATATA GTGTACAAAG TGTATATTGA AGCCCTTCCC GAAAAATGTC ACAACGTTAC GCTCGTCAAG CCCAAACTGT TTGCGTATTC AACTAAAACT TATTGCGGTA EcoRI ATATCACGGA AATTAATGCC GACATGTCTG TTGACCAATA CAAAAAACTA GTGGCGAATT CCCCAATGTT TAGAAACCCC GGAGTCGTGT CCGATACAGA CACGCTAACC GCCGCTAACT ACCTACGCTT GATTGAAATG TGAAAAACTACCCAACAACGTCCAATTCCTTTTCCTAAAC CTCCATCCCAIATTTGACAA CACCCACCCA1094 bp GCTCATCAATCATGATAAAG CAACGTTTCC GCCTCTAGAT AAAGCCATCA AATTCACAGA
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages37 Page
-
File Size-