International Journal of Molecular Sciences

Article Alpha-l-Locked -Modified Antisense Induce Efficient Splice Modulation In Vitro

Prithi Raguraman 1,2, Tao Wang 1,2, Lixia Ma 3, Per Trolle Jørgensen 4 , Jesper Wengel 4 and Rakesh N. Veedu 1,2,4,*

1 Centre for Molecular Medicine and Innovative Therapeutics, Murdoch University, Perth 6150 Australia; [email protected] (P.R.); [email protected] (T.W.) 2 Perron Institute for Neurological and translational Science, Perth 6005, Australia 3 School of Statistics, Henan University of Economics and Law, Zhengzhou 450001, China; [email protected] 4 Nucleic Acid Center, Department of Physics and Chemistry and Pharmacy, University of Southern Denmark, M 5230 Odense, Denmark; [email protected] (P.T.J.); [email protected] (J.W.) * Correspondence: [email protected]

 Received: 19 February 2020; Accepted: 29 March 2020; Published: 31 March 2020 

Abstract: Alpha-l-Locked nucleic acid (α-l-LNA) is a stereoisomeric analogue of locked nucleic acid (LNA), which possesses excellent biophysical properties and also exhibits high target binding affinity to complementary sequences and resistance to nuclease degradations. Therefore, α-l-LNA could be utilised to develop stable antisense oligonucleotides (AO), which can be truncated without compromising the integrity and efficacy of the AO. In this study, we explored the potential of α-l-LNA nucleotides-modified antisense oligonucleotides to modulate splicing by inducing Dmd exon-23 skipping in mdx mouse myoblasts in vitro. For this purpose, we have synthesised and systematically evaluated the efficacy of α-l-LNA-modified 20-O-methyl phosphorothioate (20-OMePS) AOs of three different sizes including 20mer, 18mer and 16mer AOs in parallel to fully-modified 20-OMePS control AOs. Our results demonstrated that the 18mer and 16mer truncated AO variants showed slightly better exon-skipping efficacy when compared with the fully-23 modified 20-OMePS control AOs, in addition to showing low cytotoxicity. As there was no previous report on using α-l-LNA-modified AOs in splice modulation, we firmly believe that this initial study could be beneficial to further explore and expand the scope of α-l-LNA-modified AO therapeutic molecules.

Keywords: α-l-LNA; locked nucleic acids; antisense oligonucleotides; DMD

1. Introduction Alpha-l-locked nucleic acid (α-l-LNA) is a stereoisomeric analogue of locked nucleic acid (LNA) with the inverted stereochemistry at C20, C30 and C40 positions (Figure1). Like LNAs, α-l-LNA also exhibits high binding affinity to complementary RNA and DNA oligonucleotides when incorporated into oligonucleotides [1,2]. Apart from this, α-l-LNA nucleotides also displayed a high degree of resistance to nucleases in addition to showing decreased cytotoxicity [3]. The favourable biophysical properties of α-l-LNA have led to several studies towards evaluating their potential, including for therapeutic applications [4–8].

Int. J. Mol. Sci. 2020, 21, 2434; doi:10.3390/ijms21072434 www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2020, 21, 2434 2 of 12 Int. J. Mol. Sci. 2020, 21, 2434 2 of 12

FigureFigure 1. Structural 1. Structural representation representation of theof the phosphorothioate phosphorothioa nucleicte nucleic acid acid analogues analogues used used in this in this study. study. Duchenne muscular dystrophy (DMD) is a serious muscle-wasting disorder, caused by lack of dystrophinDuchenne protein, muscular which dystrophy is essential (DMD) for the normalis a serious functioning muscle- ofwasting the muscle disorder, cells, caused including by musclelack of contractiondystrophin protein and movement., which is Dystrophinessential for actsthe normal as an anchor, functioning connecting of the themuscle cytoskeleton cells, including of the muscle fibrecontraction and the and extracellular movement. matrix. Dystrophin Lack of acts dystrophin as an anchor, protein connecting usually occurs the cytoskeleton due to mutations of the in muscle one or morefibre and exons the or extracellular deletion of exonsmatrix. of Lack the dystrophin of dystrophin gene protein [9]. Antisense usually oligonucleotideoccurs due to mutations (AO)-mediated in one spliceor more modulation exons or deletionhas been of well exons explored of the to dystrophin reinstate the gene reading [9]. Antisense frame in oligonucleotide order to produce (AO the)- partiallymediated functional splice modulation dystrophin has proteinbeen well [10 explored–12]. One to suchreinstate drug, the Exondys reading 51frame (Sarepta in order Therapeutics) to produce composedthe partially of phosphorodiamidate functional dystrophin protein oligomer [10–12] (PMO). One chemistry, such drug was, conditionallyExondys 51 approved (Sarepta inTherapeutics) 2016 by the composedUS Food and of Drug phosphorodiamidate Administration (FDA) morpholino for clinical oligomer use [13 (PMO)]. Although chemistry the, PMOwas drugconditionally is approved approved for DMD, in 2016 the productionby the US Food cost and of PMOs Drug isAdministration extremely high, (FDA) and importantly, for clinical use it is [13] not. compatibleAlthough the with PMO standard drug is phosphoramidite approved for DMD, chemistry. the production This problem cost could of PMO be addresseds is extremely by developing high, and shorterimportantly, phosphorothioate it is not compatible AOs, which with couldstandard help phosphoramidite reduce the cost of chemistry. the AOs. ItThis is worth problem adding could here be thataddressed a parallel by trialdeveloping conducted shorter for another phosphorothi AO candidateoate AOs Drisapersen, which could composed help ofreduc 20-OMePSe the cost chemistry of the (FigureAOs. It1 is) (BioMarinworth adding Pharmaceutical) here that a para wasllel rejected trial byconducted the FDA for [ 14 another]. Herein, AO we candidate report the Drisapersen systematic α l evaluationcomposed of of 2′--OMePS-LNA modifiedchemistry 2 (Figure0-OMePS 1) AOs(BioMarin and their Pharmaceutical) efficiency to inducewas rejected exon-skipping by the FDA in [14]mdx. mouse myotubes in vitro. Herein, we report the systematic evaluation of α-L-LNA modified 2′-OMePS AOs and their efficiency to induce exon-skipping in mdx mouse myotubes in vitro. 2. Results

2. ResultsFirst, we synthesised 20mer α-l-LNA-modified 20-OMePS AO (NAC 9078) containing three α-l-LNA nucleotides at positions 15, 18 and 20 and their corresponding fully-modified 2 -OMePS First, we synthesised 20mer α-L-LNA-modified 2′-OMePS AO (NAC 9078) containing0 three α- control AO (20mer, 3642). The AOs were then systematically truncated by removing one and two L-LNA nucleotides at positions 15, 18 and 20 and their corresponding fully-modified 2′-OMePS nucleotides respectively from the 5 and 3 ends to produce 18mer AOs (NAC 9079 with three α-l-LNA control AO (20mer, 3642). The AOs0 were0 then systematically truncated by removing one and two modification at positions 13, 15 and 18, and NAC 9080 with five α-l-LNA nucleotides at positions 2, nucleotides respectively from the 5′ and 3′ ends to produce 18mer AOs (NAC 9079 with three α-L- 7, 10, 14 and 17) and a 16mer AO (NAC 9081 with three modifications at positions 12, 14 and 16) as LNA modification at positions 13, 15 and 18, and NAC 9080 with five α-L-LNA nucleotides at well as their 2 -OMePS controls (18mer, 4036; 16mer, 4039). The binding affinity of the AOs against positions 2, 7, 010, 14 and 17) and a 16mer AO (NAC 9081 with three modifications at positions 12, 14 the complementary RNA target was examined by performing a thermal stability analysis (Table1). and 16) as well as their 2′-OMePS controls (18mer, 4036; 16mer, 4039). The binding affinity of the AOs The Dmd exon-23 skipping efficiency of the AOs was then analysed in vitro using the H-2Kb-tsA58 against the complementary RNA target was examined by performing a thermal stability analysis (H2K) mdx mouse myotubes. Briefly, the cells were plated on a 24-well plate and allowed to differentiate (Table 1). The Dmd exon-23 skipping efficiency of the AOs was then analysed in vitro using the H- into myotubes over 24 h. These cells were then transfected with the AOs using Lipofectin, a cationic 2Kb-tsA58 (H2K) mdx mouse myotubes. Briefly, the cells were plated on a 24-well plate and allowed lipid-based delivery agent, at 2.5, 5, 12.5, 25, 50 and 100 nM concentrations. The treated cells were to differentiate into myotubes over 24 h. These cells were then transfected with the AOs using collected after 24 h of incubation, and subsequently the RNA was isolated followed by RT-PCR Lipofectin, a cationic lipid-based delivery agent, at 2.5, 5, 12.5, 25, 50 and 100 nM concentrations. The analysis. The PCR products were later analysed by 2% agarose gel electrophoresis. The gel images treated cells were collected after 24 h of incubation, and subsequently the RNA was isolated followed were quantified by performing a densitometry analysis using the ImageJ software. by RT-PCR analysis. The PCR products were later analysed by 2% agarose gel electrophoresis. The 2.1.gel images Evaluation were of quantifiedα-l-LNA AOs by per to Induceforming Exon-23 a densitometry Skipping analysis using the ImageJ software.

The exon-23 skipping efficiency of α-l-LNA modified 20-OMePS AOs was evaluated in parallel to the corresponding 20-OMePS control unmodified AOs of similar lengths. The 20mer NAC 9078

Int. J. Mol. Sci. 2020, 21, 2434 3 of 12

Int. J. Mol. Sci. 2020, 21, 2434 Table 1. Sequences used in this study. 3 of 12

AO Name Sequence (5′-3′ direction) Tm (°C) NAC 9078 (20mer) GGC CAA ACC UCG GCαT UAαC CαT 65.2 containing three α-l-LNA nucleotides with a melting temperature (Tm) of 65.2 ◦C (Table1) showed efficient exon-23 skippingNAC 9079 (Figure (18mer)2 ). TheGCC exon AAA skipping CCU CGG e ffiαCciencyUαT AC wasαC similar64.2 or even better when NAC 9080 (18mer) GαCC AAA αCCU αCGG CαTU AαCC 68.8 directly compared with the corresponding 20-OMePS AOs (Figure2A). Highest exon skipping was NAC 9081 (16mer) CCA AAC CUC GGαC UαTA αC 59.6 observed at 50 nM and 100 nM with 66% and 74% of the 688 bp skipped transcript product (Figure2B). 2′-O-MePS (20mer) GGCCAAACCUCGGCUUACCU 60.8 2′-O-MePS (18mer) GCCAAACCUCGGCUUACC 57.7 Table 1. Sequences used in this study. 2′-O-MePS (16mer) CCAAACCUCGGCUUAC 53.1

ComplementaryAO Name synthetic RNA used in this Sequence study: 5′ (5-r(AG0-30 direction)GUA AGC CGA GGU UUGT GCC)m (◦C)-3′. The α-L-LNA modified nucleotides are represented in red underlined letters, and U,C,A,G are 2′-O- NAC 9078 (20mer) GGC CAA ACC UCG GCαT UAαC CαT 65.2 methyl-RNA nucleotides. NAC 9079 (18mer) GCC AAA CCU CGG αCUαT ACαC 64.2 2.1. EvaluationNAC of 9080 α-L- (18mer)LNA AOs to Induce GαC CExon AAA-23α SkippingCCU αC GG CαTUAαCC 68.8 The NACexon-23 9081 skipping (16mer) efficiency of CCA α-L AAC-LNA CUCmodified GGα C2′-UOMePSαTA α CAOs was evaluated59.6 in parallel to the corresponding 2′-OMePS control unmodified AOs of similar lengths. The 20mer NAC 9078 20-O-MePS (20mer) GGCCAAACCUCGGCUUACCU 60.8 containing three α-L-LNA nucleotides with a melting temperature (Tm) of 65.2 °C (Table 1) showed efficient 2exon0-O-MePS-23 skipping (18mer) (Figure 2). The GCCAAACCUCGGCUUACC exon skipping efficiency was similar or even 57.7 better when

directly compared20-O-MePS with (16mer) the corresponding CCAAACCUCGGCUUAC 2′-OMePS AOs (Figure 2A). Highest exon 53.1 skipping was observed at 50 nM and 100 nM with 66% and 74% of the 688 bp skipped transcript product (Figure Complementary synthetic RNA used in this study: 50-r(AG GUA AGC CGA GGU UUG GCC)-30. The α-l-LNA modified2B). nucleotides are represented in red underlined letters, and U,C,A,G are 20-O-methyl-RNA nucleotides.

Figure 2. (A) RT-PCR analysis of exon-23 skipping induced by antisense oligonucleotides (AO)

NAC 9078 and the corresponding 20-OMePS control AO in H2K mdx mouse myotubes (gel image A corresponds to one of the three gels used for data in (B)); (B) densitometry analysis of exon-23 skipping

induced by AO NAC 9078 and the corresponding 20-OMePS control AO (triplicates) in H2K mdx mouse myotubes. Concentration range 2.5–100 nM. Grey, full-length product exon 20–26; green, exon-23 skipped product; blue, dual exon 22/23 skipped product; UT, untreated; NC, negative control (Error bars represent the standard deviation of mean). Int. J. Mol. Sci. 2020, 21, 2434 4 of 12

Figure 2. (A) RT-PCR analysis of exon-23 skipping induced by antisense oligonucleotides (AO) NAC 9078 and the corresponding 2′-OMePS control AO in H2K mdx mouse myotubes (gel image A corresponds to one of the three gels used for data in (B)); (B) densitometry analysis of exon-23 skipping induced by AO NAC 9078 and the corresponding 2′-OMePS control AO (triplicates) in H2K mdx mouse myotubes. Concentration range 2.5–100 nM. Grey, full-length product exon 20–26; green, exon-23 skipped product; blue, dual exon 22/23 skipped product; UT, untreated; NC, negative control Int. J.(Error Mol. Sci. bars2020 represent, 21, 2434 the standard deviation of mean). 4 of 12

Similarly, both the 18mer AOs NAC 9079 with three α-L-LNA nucleotides and NAC 9080 with Similarly, both the 18mer AOs NAC 9079 with three α-l-LNA nucleotides and NAC 9080 with five five α-L-LNA nucleotides induced better exon skipping when compared with the corresponding 2′- α-l-LNA nucleotides induced better exon skipping when compared with the corresponding 20-OMePS OMePS AOs. Both the α-L-LNA modified AOs had higher Tm of 64.2 °C and 68.8 °C when compared AOs. Both the α-l-LNA modified AOs had higher Tm of 64.2 ◦C and 68.8 ◦C when compared with with the control 2′-OMePS unmodified AOs with a Tm of 57.7 °C (Table 1) and induced efficient exon- the control 20-OMePS unmodified AOs with a Tm of 57.7 ◦C (Table1) and induced e fficient exon-23 23 skipping at all tested concentrations (Figure 3A and Figure 4A). Notably, α-L-LNA modified AOs skipping at all tested concentrations (Figures3A and4A). Notably, α-l-LNA modified AOs NAC 9079 NAC 9079 (74% and 71%) and NAC 9080 (68% and 66%) induced better exon-23 skipping at 50 nm (74% and 71%) and NAC 9080 (68% and 66%) induced better exon-23 skipping at 50 nm and 100 nM and 100 nM respectively (Figure 4B) than the control 18mer 2′-OMePS AO (62% and 69% at 50 nM respectively (Figure4B) than the control 18mer 2 -OMePS AO (62% and 69% at 50 nM and 100 nM and 100 nM respectively, Figure 3B). 0 respectively, Figure3B).

Figure 3. (A) RT-PCR analysis of exon-23 skipping induced by AO NAC 9079 and the corresponding

Figure20-OMePS 3. (A control) RT-PCR AO analysis in H2K mdxof exonmouse-23 skipping myotubes induced (gel image by AO A corresponds NAC 9079 and to one the of corresponding the three gels 2′used-OMePS for data control in ( BAO); ( Bin) H2K densitometry mdx mouse analysis myotubes of exon-23 (gel image skipping A corresponds induced byto one AO of NAC the three 9079 gels and usedthe corresponding for data in (B); 2 (0B-OMePS) densitometry control analysis AO (triplicates) of exon-23 in skippingH2K mdx inducedmouse myotubes.by AO NAC Concentration 9079 and the correspondingrange 2.5–100 nM.2′-OMePS Grey, full-lengthcontrol AO product (triplicates) exon in 20–26; H2K mdx green, mouse exon-23 myotubes. skipped Concentration product; blue, range dual 2.5exon–100 22 /nM.23 skipped Grey, full product;-length UT, product untreated; exon 20 NC,–26; negative green, exon control-23 (Errorskipped bars product; represent blue, the dual standard exon deviation of mean).

Int. J. Mol. Sci. 2020, 21, 2434 5 of 12

22/23 skipped product; UT, untreated; NC, negative control (Error bars represent the standard Int. J.deviation Mol. Sci. 2020 of mean), 21, 2434. 5 of 12

Figure 4. (A) RT-PCR analysis of exon-23 skipping induced by AO NAC 9080 and the corresponding

Figur20-OMePSe 4. (A) control RT-PCR AO analysis in H2K of mdx exonmouse-23 skipping myotubes induced (gel image by AO A correspondsNAC 9080 and to onethe ofcorresponding the three gels 2′used-OMePS for datacontrol in (AOB)); in (B H2K) densitometry mdx mouse analysis myotubes of ( exon-23gel image skipping A corresponds induced to by one AO of NAC the three 9080 gels and

usedthe correspondingfor data in (B)) 2; 0(-OMePSB) densitometry control AOanalysis (triplicates) of exon in-23H2K skipping mdx mouse induced myotubes. by AO NAC Concentration 9080 and therange corresponding 2.5–100 nM. 2′ Grey,-OMePS full-length control productAO (triplicates) exon 20–26; in H2K green, mdx exon-23 mouse skipped myotubes. product; Concentration blue, dual rangeexon 222.5/–23100 skipped nM. Grey, product; full-length UT, untreated; product exon NC, negative20–26; green, control exon (Error-23 skipped bars represent product; the blue standard, dual exondeviation 22/23 ofskipped mean). product; UT, untreated; NC, negative control (Error bars represent the standard deviation of mean). The 16mer AO NAC 9081 containing three α-l-LNA nucleotides exhibited a much higher Tm of 59.6The◦ 16merC when AO compared NAC 9081 to containing the control three 16mer α-L- 2LNA0-OMePS nucleotides AO (T mexhibited: 53.1, Table a much1). higher In this T case,m of 59.6the °αC-l when-LNA compared modified to AO the demonstrated control 16mer to 2′ be-OMePS better AO in inducing(Tm: 53.1, exon-23Table 1). skipping In this case, atall the tested α-L- LNAconcentrations modified (2.5–100 AO demonstrated nM) compared to with be better the control in inducing 20-OMePS exon AO-23 (Figure skipping5A,B). at Interestingly, all tested concentrationsNAC 9081 demonstrated (2.5–100 nM) highest compared exon-23 with the skipping control e ffi2′-cacyOMePS at 50AO nM (Figure (40%) 5A, and B). 100Interestingly, nM (60%) NACconcentrations, 9081 demonstrated whereas, highest the corresponding exon-23 skipping 20-OMePS efficacy control at 50 AO nM only (40% yielded) and 100 35% nM and (60 50%%) concentrations,respectively, demonstrating whereas, the the corresponding impact of α-l -LNA2′-OMePS nucleotides control modifications AO only yielded (Figure 355B).% and 50% respectively, demonstrating the impact of α-L-LNA nucleotides modifications (Figure 5B).

Int. J. Mol. Sci. 2020, 21, 2434 6 of 12 Int. J. Mol. Sci. 2020, 21, 2434 6 of 12

Figure 5. (A) RT-PCR analysis of exon-23 skipping induced by AO NAC 9080 and the corresponding Figure 5. (A) RT-PCR analysis of exon-23 skipping induced by AO NAC 9080 and the corresponding 20-OMePS control AO in H2K mdx mouse myotubes (gel image A corresponds to one of the three gels used2′-OMePS for data control in (B AO); ( Bin) densitometryH2K mdx mouse analysis myotubes of exon-23 (gel image skipping A corresponds induced byto one AO of NAC the three 9080 andgels used for data in (B); (B) densitometry analysis of exon-23 skipping induced by AO NAC 9080 and the the corresponding 20-OMePS control AO (triplicates) in H2K mdx mouse myotubes. Concentration rangecorresponding 2.5–100 nM. 2′-OMePS Grey, full-length control AO product (triplicates) exon in 20–26; H2K green,mdx mouse exon-23 myotubes. skipped Concentration product; blue, range dual exon2.5–100 22 /nM.23 skipped Grey, full product;-length UT, product untreated; exon NC,20–26; negative green, controlexon-23 (Error skipped bars product; represent blue, the dual standard exon deviation22/23 skipped of mean). product; UT, untreated; NC, negative control (Error bars represent the standard deviation of mean). In addition to the exon-23 skipped transcript (688 bp), all the AOs also seemed to induce dual exonIn 22 /addition23 skipping to the (542 exon bp),-23 and skipped the intensity transcript of the (688 dual bp), (exon all the 22/ 23)AOs skipped also seemed bands to increased induce withdual theexon increasing 22/23 skipping concentrations. (542 bp), and The the undesired intensity dual of the exon dual skipping (exon 22/23) could skipped lead to bands a shorter increased dystrophin with transcript.the increasing In general, concentrations. the dual The exon undesired skipping yielddual exon was muchskipping lower could when lead compared to a shorter to the dystroph expectedin exon-23transcript. deletion In general, products the dual (Figure exon2B, skipping Figure3B, yield Figure was4B, much Figure lower5B and when Table compared2). The dual to the skipping expected inducedexon-23 bydeletionα-l-LNA products modified (Figure AOss was 2B, either 3B, 4B comparable, 5B and Table or even 2). lesserThe dual at certain skipping concentrations induced by when α-L- comparedLNA modified to the AOs corresponding was either controlcomparable 20-OMePS or even AOs lesser (Figures at certain2A,3A, concentrations4A and5A). The when e ffi comparedciency of exonto the skipping corresponding was also control evaluated 2′-OMePS by an EC50AOs assay(Figure (Figures 2A, 7).3A, 4A and 5A). The efficiency of exon skipping was also evaluated by an EC50 assay (Figure 7).

Int. J. Mol. Sci. 2020, 21, 2434 7 of 12

Table 2. Summary of the percentage of exon 23 skipping and dual exon 22/23 skipping induced by Int. J. Mol.the AOs.Sci. 2020 The, 21 mean, 2434 of three repeats are represented in the table. Standard deviation is mentioned7 of 12 in brackets. Table 2. Summary of the percentage of exon 23 skipping and dual exon 22/23 skipping induced by Percentage of Exon 23 Skipping (%) Percentage of Dual Exon 22/23 Skipping (%) AOthe NameAOs. The mean of three repeats are represented in the table. Standard deviation is mentioned in brackets. 2.5 12.5 25 50 100 2.5 12.5 25 50 100 5 nM 5 nM nM nM nM nM nM nM nM nM nM nM Percentage of Exon 23 Skipping (%) Percentage of Dual Exon 22/23 Skipping (%) 6 16 49 56 66 74 5 5 4 16 20 19 NAC 9078 AO Name 2.5 nM 5 nM (2.93)12.5 nM(2.23) 25(12.41) nM (11.68)50 nM (4.21)100 (11.92)nM 2.5(6.95) nM (3.36)5 nM (4.51)12.5 (5.33)nM (8.13)25 nM (8.50)50 nM 100 nM 13 12 44 24 74 71 2 4 12 10 13 14 NAC 9078 6 (2.93) NAC907916 (2.23) 49 (12.41) 56 (11.68) 66 (4.21) 74 (11.92) 5 (6.95) 5 (3.36) 4 (4.51) 16 (5.33) 20 (8.13) 19 (8.50) NAC9079 13 (13.23) 12 (7.51) (13.23)44 (15.76)(7.51) 24 (26.30)(15.76) (26.30)74 (15.27)(15.27) 71 (10.53)(10.53) 2(2.01) (2.01) (2.27)4 (2.27)(13.79) 12 (13.79)(9.26) 10(10.30) (9.26) (12.94)13 (10.30) 14 (12.94) 15 23 24 55 68 66 4 4 13 11 21 29 NAC 9080 15 (17.13)NAC 23 9080(15.42) 24 (18.90) 55 (15.52) 68 (11.23) 66 (17.12) 4 (3.62) 4 (2.53) 13 (8.43) 11 (8.79) 21 (5.55) 29 (18.86) NAC 9081 5 (4.08) 6 (4.35) (17.13)12 (8.10)(15.42) 19 (19.71)(18.90) (15.52)40 (9.13)(11.23) 60 (9.29)(17.12) 4(3.62) (5.02) (2.53)4 (5.26)(8.43) 6 (7.64)(8.79) 5(5.55) (4.37) (18.86)15 (2.95) 22 (8.75) 5 6 12 19 40 60 4 4 6 5 15 22 2′-O- NAC 9081 MePS 7 (3.10) 16 (15.06) (4.08)26 (20.88)(4.35) 46 (22.81)(8.10) (19.71)44 (29.25)(9.13) 60 (17.13)(9.29) 5(5.02) (7.68) (5.26)1 (0.34)(7.64) 1 (0.18)(4.37) 7(2.95) (5.06) (8.75)22 (6.65) 30 (16.92)

(20mer) 20-O-MePS 7 16 26 46 44 60 5 1 1 7 22 30 2′-O- (20mer) (3.10) (15.06) (20.88) (22.81) (29.25) (17.13) (7.68) (0.34) (0.18) (5.06) (6.65) (16.92) MePS 10 (7.96) 10 (6.83) 18 (17.62) 48 (16.86) 64 (15.38) 69 (12.22) 6 (7.39) 5 (5.99) 11 (2.41) 12 (9.07) 19 (13.45) 20 (11.89) 20-O-MePS 10 10 18 48 64 69 6 5 11 12 19 20 (18mer) (18mer) (7.96) (6.83) (17.62) (16.86) (15.38) (12.22) (7.39) (5.99) (2.41) (9.07) (13.45) (11.89) 2′-O- 20-O-MePS 4 4 11 28 35 50 8 4 9 23 19 20 MePS 4 (1.79) (16mer)4 (1.04) (1.79)11 (4.32)(1.04) 28 (27.75)(4.32) (27.75)35 (29.98)(29.98) 50 (21.53)(21.53) 8(11.34) (11.34) (5.10)4 (5.10)(5.06) 9 (5.06)(12.06) 23(14.58) (12.06) (14.81)19 (14.58) 20 (14.81) (16mer)

2.2. Evaluation of Cytotoxicity of AOs A dye (WST-1)-based cell viability assay was performed to assess the cytotoxicity of the α-l-LNA A dye (WST-1)-based cell viability assay was performed to assess the cytotoxicity of the α-L- modifiedLNA modified AOs onAOs the onH2K the mdxH2Kmouse mdx mouse myoblast. myoblast. In parallel, In parallel, the control the control 20-OMePS 2′-OMePS AOs AOs were were also analysedalso analysed for thefor the cell cell toxicity. toxicity. The The AOs AOs were were all all tested tested at at the the highesthighest concentrationconcentration of 400 nM. nM. Results clearly showed that α-l-LNA modified AOs were relatively less cytotoxic compared with Results clearly showed that α-L-LNA modified AOs were relatively less cytotoxic compared with the thecorresponding corresponding control control 2′-OMePS 20-OMePS AO AO controls controls (NAC (NAC 9078 9078,, 91% 91%;; NAC NAC 9079 9079,, 85% 85%;; NAC NAC 9080 9080,, 80% 80%;; NAC 9081 9081,, 80%;80%; c controls:ontrols: 20mer 20mer,, 86% 86%;; 18mer 18mer,, 84% and 16mer 16mer,, 73%,73%, as seen in Figure6 6)).. ToTo furtherfurther analyse the potential cytotoxicity (IC50) of the AOs,AOs, MTTMTT assayassay waswas performed.performed. As shown in the supplementary Fig Figureure S S11 (Supplementary Information) Information),, a a similar trend was recorded for all tested AOs in mdx mouse myoblasts.

FigureFigure 6. Percentage 6. Percentage of viableof viable cells cells observed observed after after transfection transfection quantified quantified using using a WST-1 a WST assay-1 assay (Error bars represent the standard(Error deviation bars represent of mean). the standard deviation of mean).

Int. J. Mol. Sci. 2020, 21, 2434 8 of 12

3. Discussion Modulation of RNA splicing using synthetic antisense oligonucleotide has been established as a viable therapeutic strategy for tackling diseases [15]. This approach has been well studied in DMD system in vitro and in vivo over the last two decades. In 2016, an antisense-drug named Eteplirsen (Exondys 51) composed of PMO chemistry was conditionally approved by the US FDA for the treatment of DMD [13]. Another drug candidate entered in Phase 3 trials, Drisapersen (20-OMePS chemistry), was rejected by the FDA due to the failure to meet the primary and secondary endpoints and also due to the increased renal and hepatotoxicity [14], which reinforces the requirement for alternative approaches to improve the efficacy of the 20-OMePS chemistry. Towards this goal, various chemically-modified nucleic acid analogues have been explored previously [16–23]. In this study, we explored the scope of α-l-LNA analogues to induce exon-skipping. Fluiter et al. showed that α-l-LNA AOs had better efficacy to downregulate H-Ras for tumour inhibition in vitro. Furthermore, the AOs were also found to be nontoxic. Also, these α-l-LNA-modified AOs effectively inhibited tumour growth in vivo at minimal dosage of 0.5 mg/kg [1]. In addition, our lab previously reported that systematically truncated LNA-modified AOs demonstrated very high efficacy to induce exon-23 skipping in the DMD system in vitro [18]. In line with that study, it was also important to evaluate the potential of α-l-LNA being a stereoisomeric analogue of LNA in splice modulation. In this study, we used α-l-LNA modified 20-OMePS sequences, which were systematically truncated and evaluated for their efficacy to induce exon-23 skipping in mdx mouse myoblasts in vitro in parallel to the corresponding 20-OMePS control AOs. For this purpose, we used previously reported 20mer AO (NAC 9078) designed to target mouse exon-23, which was modified by incorporating three α-l-LNA nucleotides [17]. The AOs were then truncated by removing one to two nucleotides from the 30 and 50 ends to obtain 18mer (NAC 9079) and 16mer (NAC 9081) truncated variants containing three α-l-LNA nucleotides. We also constructed an additional 18mer AO with five α-l-LNA incorporations (NAC 9080). The modifications were placed towards the 30-end of the sequences, in line with a previous report [17]. The results indicated that all the AOs were efficient in inducing exon-23 skipping in a dose-dependent manner at all tested concentrations (2.5 nM–100 nM). The 18mer AO NAC 9080 with five α-l-LNA modifications and NAC 9079 with three α-l-LNA modifications were found to be the best in inducing exon-23 skipping, which might reflect its targeting affinity (Tm of 68.8 ◦C and 64.2◦C respectively). Although at higher concentrations the exon-23 skipping efficiency of NAC 9078, NAC 9080 and NAC 9079 were comparable, NAC 9080 still is the more appealing due to its shorter sequence length and higher number of modifications when compared to NAC 9078 and NAC 9079. It was also observed that at lower concentrations, the 18mer AOs NAC 9079 and NAC 9080 performed better than the 20mer NAC 9078. Notably, the 16mer NAC 9081 performed much better than the corresponding 20-OMePS sequence but the exon skipping efficacy was not as high when compared with the other modified 20mer and 18mer AOs. The pattern of exon skipping observed in the AOs compared to their corresponding control 20-OMePS AOs can be found in Table2. In general, the α-l-LNA modified AOs induced better exon skipping when compared to the 20-OMePS AOs, and also showed less cytotoxicity (Figure6). To investigate the potential cell damage induced by the AOs NAC 9078, NAC 9079, NAC 9080 and NAC 9081 along with their respective controls, a cytotoxicity assay (IC50 analysis) was conducted using the mdx mouse myoblasts. As shown in Figure S1 (Supplementary Information), similar cytotoxicity was observed for all the AOs. With a concentration up to 1000 nM, a 50% inhibition rate (IC50) was not observed. These data indicated that all the compounds did not display prominent cytotoxicity in the dose ranges (from 2.5 nM to 100 nM) carried out in this study. To measure the exon skipping potency of the AOs, an EC50 assay was conducted using a series of concentrations from 2.5 nM to 100 nM. As shown in Figure7 (Figure S2; Supplementary Information), NAC 9080, with an EC50 of 12.79 nM, recorded the highest exon skipping efficacy, followed by NAC 9078 (14.3 nM), NAC 9079 (21.3 nM) and NAC 9081 (33.05 nM). This outcome is in accordance with our AO transfection and exon-23 skipping results. In parallel, we performed a two-factor variance analysis (% exon-23 skipping vs. dose), Int. J. Mol. Sci. 2020, 21, 2434 9 of 12 compared with the controls. Although only NAC 9081 displayed statistical significance (p = 0.00807) when compared to its corresponding control, the other compounds showed a general trend of better skipping than controls (Figure S3; Supplementary Information). H-2Kb-tsA58 mdx cell line does not express functional dystrophin protein due to a non-sense mutation in exon 23 of Dmd gene transcript and limits the feasibility of protein assays including western-blot and immunofluorescence to show the effects of the AO-mediated expression of dystrophin protein in vitro after 24–48 h of transfection. Typically, in vivo study was performed for this purpose using higher doses and prolonged treatment periods. For example, in a comprehensive study by Fletcher et al., the AO was injected into mdx mice with doses from 2–10 µg over a 4-week period to visualise dystrophin protein expression [24]. Int. J. Mol. Sci. 2020, 21, 2434 8 of 12

Figure 7. Evaluation of half maximal effective concentration (EC50) of the AOs vs. their corresponding Figure 7. Evaluation of half maximal effective concentration (EC50) of the AOs vs. their corresponding 2′-O-methyl phosphorothioate (2′-OMePS) control AO (Error bars represent the standard deviation of 20-O-methyl phosphorothioate (20-OMePS) control AO (Error bars represent the standard deviation mean). (A) NAC 9078 vs 2′-OMePS control AO (20mer); (B) NAC 9079 vs 2′-OMePS control AO of mean). (A) NAC 9078 vs 20-OMePS control AO (20mer); (B) NAC 9079 vs 20-OMePS control AO (18mer); (C) NAC 9080 vs 2′-OMePS control AO (18mer); (D) NAC 9081 vs 2′-OMePS control AO (18mer); (C) NAC 9080 vs 20-OMePS control AO (18mer); (D) NAC 9081 vs 20-OMePS control AO (16mer).(16mer).

3. DiscussionIn summary, we evaluated the potential of α-l-LNA modified 20-OMePS AOs in splice modulation, and our results demonstrated that the modified AOs were slightly more efficient to induce exon-23 Modulation of RNA splicing using synthetic antisense oligonucleotide has been established as a skipping compared with the corresponding control 2 -OMePS AOs. Our findings suggest that shorter viable therapeutic strategy for tackling diseases [15].0 This approach has been well studied in DMD α-l-LNA modified AOs are capable of increasing the efficiency of the 2 -OMePS AOs, and this analogue system in vitro and in vivo over the last two decades. In 2016, an antisense0 -drug named Eteplirsen could also be used for developing splice-modulating antisense therapeutics in combination with other (Exondys 51) composed of PMO chemistry was conditionally approved by the US FDA for the nucleotide chemistries. treatment of DMD [13]. Another drug candidate entered in Phase 3 trials, Drisapersen (2′-OMePS chemistry)4. Materials, was and rejected Methods by the FDA due to the failure to meet the primary and secondary endpoints and also due to the increased renal and hepatotoxicity [14], which reinforces the requirement for alternative4.1. Melting approaches Temperature to Analysis improve the efficacy of the 2′-OMePS chemistry. Towards this goal, various chemically-modified nucleic acid analogues have been explored previously [16–23]. In this study, we All the oligonucleotides were prepared at 2 µM concentration in a buffer solution containing explored the scope of α-L-LNA analogues to induce exon-skipping. Fluiter et al. showed that α-L- 0.01 mM EDTA and 10 mM NaCl. The buffer solution was adjusted to pH 7 using 10 mM sodium LNA AOs had better efficacy to downregulate H-Ras for tumour inhibition in vitro. Furthermore, the phosphate buffer. The prepared oligonucleotides were then mixed with an equal volume of the AOs were also found to be nontoxic. Also, these α-L-LNA-modified AOs effectively inhibited tumour complementary RNA sequence at the same concentration. The mixture was then denatured for 10 min growth in vivo at minimal dosage of 0.5 mg/kg [1]. In addition, our lab previously reported that systematically truncated LNA-modified AOs demonstrated very high efficacy to induce exon-23 skipping in the DMD system in vitro [18]. In line with that study, it was also important to evaluate the potential of α-L-LNA being a stereoisomeric analogue of LNA in splice modulation. In this study, we used α-L-LNA modified 2′-OMePS sequences, which were systematically truncated and evaluated for their efficacy to induce exon-23 skipping in mdx mouse myoblasts in vitro in parallel to the corresponding 2′-OMePS control AOs. For this purpose, we used previously reported 20mer AO (NAC 9078) designed to target mouse exon-23, which was modified by incorporating three α-L-LNA nucleotides [17]. The AOs were then truncated by removing one to two nucleotides from the 3′ and 5′ ends to obtain 18mer (NAC 9079) and 16mer (NAC 9081) truncated variants containing three α-L-LNA nucleotides. We also constructed an additional 18mer AO with five α-L-LNA nucleotide incorporations (NAC 9080). The modifications were placed towards the 3′- end of the sequences, in line with a previous report [17]. The results indicated that all the AOs were

Int. J. Mol. Sci. 2020, 21, 2434 10 of 12

at 95 ◦C and gradually cooled down to room temperature. The mixture was then loaded on a quartz cuvette of 1 mm path length, and the melting point was observed using Shimadzu UV-1800 fitted with a temperature controller. The temperature was maintained over the range of 20–90 ◦C with a ramp 1 rate of 1 ◦C min− . The melting points of all the oligonucleotides (Tm) were calculated by the first derivative. As we have used 20-OMePS/RNA with higher stability as a control, the delta Tm increase observed with α-l-LNA was lower than previously reported.

4.2. Cell Culture and Transfection H-2Kb-tsA58 (H2K) mdx mouse myoblasts were grown as described before [25,26]. The primary mdx myoblast cells were trypsinised when they were about 60–80% confluent and about 25 103 1 × cells were seeded in 24-well plates. The plates were pre-treated with 50 µg ml− poly-d-lysine (Sigma 1 Aldrich; Castle Hill, NSW, Australia) and 100 µg ml− Matrigel (In Vitro Technologies; Noble Park North, VIC, Australia). The cultures were then differentiated into myotubes in Dulbecco’s Modified Eagle Media (ThermoFisher Scientific; Riverstone, NSW, Australia) supplemented with 5% Horse serum by incubating in 5% CO2 at 37 ◦C for 24 h. The AOs were then complexed with lipofectin (ThermoFischer Scientific; Riverstone, NSW, Australia) at a ratio of 2:1 (lipofectin: AO) and was transfected at a final volume of 500 µl following the manufacturer’s protocols, except the solution was not removed after 3 h. The experiments were performed in three experimental repeats with replicas (Figures2–5).

4.3. RNA Extraction and RT-PCR RNA was extracted from the transfected cells using the Isolate II RNA Mini Kit (Bioline; Eveleigh, NSW, Australia) following the manufacturer’s protocols. The dystrophin transcripts were analysed then by a nested-PCR across exons 20–26. The PCR products were separated on a 2% agarose gel in Tris-acetate-EDTA buffer, and the images were captured on a Fusion Fx gel documentation system (Vilber Lourmat, Marne-la Vallee, France). Image J software was used for the densitometry analyses.

4.4. Cell Viability and Cytotoxicity Assay The cells were seeded at a density of 2 104 cells per well and transfected with AOs at 400 nM, as × mentioned before. After 24 h, the viability of the cells was analysed using a colorimetric assay (WST-1, Sigma Aldrich; Castle Hill, NSW, Australia). The WST-1 and optimum solution were added in the ratio 1:10 (v/v) in each well and incubated at 37 ◦C for 2 h, 5% CO2. Absorbance was measured at 450 nm with a microplate reader (FLUOstar Omega, BMG Labtech, Ortenberg, Germany). MTT assay was conducted as previously reported [27]. Briefly, cells (3 103 cells/well) in × 200 µl of culture mediums were seeded in 96-well plates and incubated for 24 h. After that, the culture medium was replaced by medium containing Lipofectin and indicated oligos at indicated concentrations. After 24 h incubation, 5 mg/mL MTT reagent (Sigma Aldrich; Castle Hill, NSW, Australia) in 1 PBS 20 µl/well (ThermoFisher Scientific; Riverstone, NSW, Australia) was added × − into the plates and incubated for 3 h. After incubation, the medium was aspirated and dimethyl sulfoxide 150 µl/well (Sigma Aldrich; Castle Hill, NSW, Australia) was added to stop the reaction. − The absorbance was quantified by a FLUOstar Omega multi-detection microplate reader (BMG Labtech, Ortenberg, Germany) at 570 nm wavelength. The cell viability was calculated by comparing the luminescent signal of treatment group to the signal obtained with untreated cells (setting as 100% viability). Each value represents the mean standard deviation from duplicates.

4.5. Evaluation of Efficiency of Exon Skipping H-2Kb-tsA58 (H2K) mdx mouse myoblasts were seeded in a 24-well plate pre-treated with 50 µg 1 1 ml− poly-D-lysine (Sigma Aldrich; Castle Hill, NSW, Australia) and 100 µg ml− Matrigel (In Vitro Technologies; Noble Park North, VIC, Australia) 24 h before transfection. Next, the cells were transfected with the AOs NAC 9078, NAC 9079, NAC 9080 and NAC 9081 using Lipofectin (ThermoFischer Int. J. Mol. Sci. 2020, 21, 2434 11 of 12

Scientific; Riverstone, NSW, Australia) transfection reagent according to the manufacturer’s protocol at a series of concentrations including 100 nM, 50 nM, 25 nM, 12.5 nM, 5 nM and 2.5 nM. Twenty-four hours after transfection, the cells were collected for RNA extraction using Isolate II RNA Mini Kit (Bioline; Eveleigh, NSW, Australia) as per the manufacturer’s protocol. The transcripts were amplified by a nested-PCR across exons 20–26. The products were then separated on a 2% agarose gel in Tris-acetate-EDTA buffer, stained with Gel Red (Vazyme Biotech; Nanjing, China) and visualised with the Fusion Fx gel documentation system (Vilber Lourmat, Marne-la-Vallée, France). Densitometry analysis was performed by the ImageJ software. EC50 was calculated using different treatment concentrations and corresponding ratio of exon skipping and the full length via Graphpad Prism 8 (program: log vs. response—Find EC50). The comparison between the efficacy of individual AO compounds and their corresponding controls were analysed by the R program using the ggplot 2 Package (MathSoft, Cambridge, MA, USA).

Supplementary Materials: The following are available online at http://www.mdpi.com/1422-0067/21/7/2434/s1, Figure S1: Evaluation of IC50 of the indicated compounds using mouse myoblasts, Figure S2: Evaluation of EC50 of the indicated compounds using mouse myoblasts, Figure S3: Graphs obtained after evaluation exon skipping efficiency of the control Vs the AOs using a two-factor variance analysis. Author Contributions: The research was conceptualised by J.W. and R.N.V. Methodology was performed by P.R., T.W., L.M. and supervised by R.N.V. Data analysis was performed by R.N.V., P.R., T.W., P.T.J. and J.W. The original draft was written by P.R. and reviewed and edited R.N.V., P.R., P.T.J. and J.W. All authors have read and agreed to the published version of the manuscript. Funding: P.R thanks the MIPS funding scheme of Murdoch University. R.N.V. acknowledges the funding provided by McCusker Charitable Foundation and the Perron Institute for Neurological and Translational Science. J.W. acknowledges the support from the European Union’s Horizon 2020 research and innovation program under grant agreement No 810685. Acknowledgments: We acknowledge MTL laboratory of Murdoch University headed by Steve Wilton and Sue Fletcher for providing H-2Kb-tsA58 mdx cells. We also thank Bao Tri Le (PNAT Laboratory, Murdoch University) for providing us with valuable technical assistance. Conflicts of Interest: The authors declare no conflicts of interests.

Abbreviations

AO Antisense oligonucleotide α-l-LNA Alpha-L-locked nucleic acid DMD Duchenne muscular dystrophy

References

1. Fluiter, K.; Frieden, M.; Vreijling, J.; Rosenbohm, C.; De Wissel, M.B.; Christensen, S.M.; Koch, T.; Ørum, H.; Baas, F. On the in vitro and in vivo properties of four locked nucleic acid nucleotides incorporated into an anti-H-Ras antisense oligonucleotide. ChemBioChem 2005, 6, 1104–1109. [CrossRef][PubMed] 2. Rajwanshi, V.K.; Håkansson, A.E.; Sørensen, M.D.; Pitsch, S.; Singh, S.K.; Kumar, R.; Nielsen, P.; Wengel, J. The eight stereoisomers of LNA (locked nucleic acid): A remarkable family of strong RNA binding molecules. Angew. Chem. Int. Ed. Engl. 2000, 39, 1656–1659. [CrossRef] 3. Jørgensen, A.S.; Hansen, H.H.; Vester, B.; Wengel, J. Improvement of a streptavidin-binding aptamer by LNA-and α-l-LNA-substitutions. Bioorg. Med. Chem. Lett. 2014, 24, 2273–2277. [CrossRef][PubMed] 4. Kumar, T.S.; Wengel, J.; Hrdlicka, P.J. 2’-N-(Pyren-1-yl) acetyl-2’-Amino-α-l-LNA: Synthesis and Detection of Single Nucleotide Mismatches in DNA and RNA Targets. ChemBioChem 2007, 8, 1122–1125. [CrossRef] [PubMed] 5. Kumar, T.S.; Madsen, A.S.; Østergaard, M.E.; Wengel, J.; Hrdlicka, P.J. Nucleic acid structural engineering using pyrene-functionalized 2’-amino-α-l-LNA monomers and abasic sites. J. Org. Chem. 2008, 73, 7060–7066. [CrossRef][PubMed] 6. Kumar, T.S.; Madsen, A.S.; Østergaard, M.E.; Sau, S.P.; Wengel, J.; Hrdlicka, P.J. Functionalized 2’-amino-α-l-LNA: Directed positioning of intercalators for DNA targeting. J. Org. Chem. 2008, 74, 1070–1081. [CrossRef] [PubMed] Int. J. Mol. Sci. 2020, 21, 2434 12 of 12

7. Li, Q.; Yuan, F.; Zhou, C.; Plashkevych, O.; Chattopadhyaya, J. Free-radical ring closure to conformationally locked α-l-carba-LNAs and synthesis of their oligos: Nuclease stability, target RNA specificity, and elicitation of RNase H. J. Org. Chem. 2010, 75, 6122–6140. [CrossRef] 8. Seth, P.P.; Allerson, C.R.; Berdeja, A.; Swayze, E.E. Replacing the 2’-oxygen with an exocyclic methylene group reverses the stabilization effects of α-l-LNA. Bioorg. Med. Chem. Lett. 2011, 21, 588–591. [CrossRef] 9. Bao, T.L.; Veedu, R.N.; Fletcher, S.; Wilton, S.D. Antisense oligonucleotide development for the treatment of muscular dystrophies. Expert Opin. Orphan Drugs. 2016, 4, 139–152. [CrossRef] 10. Mitrpant, C.; Fletcher, S.; Wilton, S.D. Personalised genetic intervention for Duchenne muscular dystrophy: Antisense oligomers and exon skipping. Curr. Mol. Pharmacol. 2009, 2, 110–121. [CrossRef] 11. Fairclough, R.J.; Wood, M.J.; Davies, K.E. Therapy for Duchenne muscular dystrophy: Renewed optimism from genetic approaches. Nat. Rev. Genet. 2013, 14, 373. [CrossRef][PubMed] 12. Kole, R.; Krieg, A.M. Exon skipping therapy for Duchenne muscular dystrophy. Adv. Drug Deliv. Rev. 2015, 87, 104–107. [CrossRef][PubMed] 13. Syed, Y.Y. Eteplirsen: First global approval. Drugs 2016, 76, 1699–1704. [CrossRef][PubMed] 14. Kyndrisa Approval Status. GSK and Prosensa Announce Primary Endpoint not Met in Phase III Study of Drisapersen in Patients with Duchenne Muscular Dystrophy; GSK: Brentford, UK, 2013. 15. Dominski, Z.; Kole, R. Restoration of correct splicing in thalassemic pre-mRNA by antisense oligonucleotides. Proc. Natl. Acad. Sci. USA 1993, 90, 8673–8677. [CrossRef] 16. Chen, S.; Le, B.T.; Rahimzadeh, K.; Shaikh, K.; Mohal, N.; Veedu, R.N. Synthesis of a morpholino nucleic acid (MNA)- phosphoramidite, and exon skipping using MNA/2’-O-methyl mixmer antisense oligonucleotide. Molecules 2016, 21, 1582. [CrossRef] 17. Le, B.T.; Adams, A.M.; Fletcher, S.; Wilton, S.D.; Veedu, R.N. Rational design of short locked nucleic acid-modified 2’-O-methyl antisense oligonucleotides for efficient exon-skipping in vitro. Mol. Ther. Nucleic Acids 2017, 9, 155–161. [CrossRef] 18. Le, B.T.; Filichev, V.V.; Veedu, R.N. Investigation of twisted intercalating nucleic acid (TINA)-modified antisense oligonucleotides for splice modulation by induced exon-skipping in vitro. RSC Adv. 2016, 6, 95169–95172. [CrossRef] 19. Le, B.T.; Murayama, K.; Shabanpoor, F.; Asanuma, H.; Veedu, R.N. Antisense oligonucleotide modified with serinol nucleic acid (SNA) induces exon skipping in mdx myotubes. RSC Adv. 2017, 7, 34049–34052. [CrossRef] 20. Le, B.T.; Chen, S.; Abramov, M.; Herdewijn, P.; Veedu, R.N. Evaluation of anhydrohexitol nucleic acid, cyclohexenyl nucleic acid and D-altritol nucleic acid-modified 2’-O-methyl RNA mixmer antisense oligonucleotides for exon skipping in vitro. Chem. Commun. 2016, 52, 13467–13470. [CrossRef] 21. Gebski, B.L.; Mann, C.J.; Fletcher, S.; Wilton, S.D. Morpholino antisense oligonucleotide induced dystrophin exon 23 skipping in mdx mouse muscle. Hum. Mol. Genet. 2003, 12, 1801–1811. [CrossRef] 22. Le, B.T.; Hornum, M.; Sharma, P.K.; Nielsen, P.; Veedu, R.N. -modified antisense oligonucleotides containing 5-(phenyltriazol)-2’-deoxyuridine nucleotides induce exon-skipping in vitro. RSC Adv. 2017, 7, 54542–54545. [CrossRef] 23. Chen, S.; Le, B.T.; Chakravarthy, M.; Kosbar, T.R.; Veedu, R.N. Systematic evaluation of 2’-Fluoro modified chimeric antisense oligonucleotide-mediated exon skipping in vitro. Sci. Rep. 2019, 9, 6078. [CrossRef] [PubMed] 24. Fletcher, S.; Honeyman, K.; Fall, A.M.; Harding, P.L.; Johnsen, R.D.; Wilton, S.D. Dystrophin expression in the mdx mouse after localised and systemic administration of a morpholino antisense oligonucleotide. J. Gene Med. 2006, 8, 207–216. [CrossRef][PubMed] 25. Rando, T.A.; Blau, H.M. Primary mouse myoblast purification, characterization, and transplantation for cell-mediated . J. Cell Biol. 1994, 125, 1275–1287. [CrossRef][PubMed] 26. Mann, C.J.; Honeyman, K.; Cheng, A.J.; Ly, T.; Lloyd, F.; Fletcher, S.; Morgan, J.E.; Patridge, T.A.; Wilton, S.D. Antisense-induced exon skipping and synthesis of dystrophin in the mdx mouse. Proc. Natl. Acad. Sci. USA 2001, 98, 42–47. [CrossRef] 27. Wang, T.; Larcher, L.M.; Ma, L.; Veedu, R.N. Systematic screening of commonly used commercial transfection reagents towards efficient transfection of single-stranded oligonucleotides. Molecules 2018, 23, 2564. [CrossRef]

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).