Role of Thromboxane Receptor-Alpha in Prostate Cancer Progression Prasanna Ekambaram Wayne State University

Wayne State University

Wayne State University Dissertations

1-1-2012 Role Of Thromboxane Receptor-Alpha In Prostate Cancer Progression Prasanna Ekambaram Wayne State University,

Follow this and additional works at: http://digitalcommons.wayne.edu/oa_dissertations

Recommended Citation Ekambaram, Prasanna, "Role Of Thromboxane Receptor-Alpha In Prostate Cancer Progression" (2012). Wayne State University Dissertations. Paper 591.

This Open Access Dissertation is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Dissertations by an authorized administrator of DigitalCommons@WayneState. ROLE OF THROMBOXANE RECEPTOR-ALPHA IN PROSTATE CANCER PROGRESSION

PRASANNA EKAMBARAM

DISSERTATION

Submitted to the Graduate School

of Wayne State University,

Detroit, Michigan

in partial fulfillment of the requirements

for the degree of

DOCTOR OF PHILOSOPHY

2012

MAJOR: CANCER BIOLOGY

Approved by:

______Advisor Date

______

PRASANNA EKAMBARAM

2012

DEDICATION

I would like to dedicate this dissertation to my wife, Arulselvi and my kids Tejas and

Abhi for standing strong by my side at good times and difficult times in life and helping me work hard toward achieving my goal of being a research scientist; To my parents for their blessings, and prayers and for helping to come to Unites States to complete my graduate studies.

ACKNOWLEDGMENTS

Foremost, I would like to extend my gratitude to my mentor, Dr. Honn for giving me this wonderful opportunity to work in his laboratory and to be my mentor for my PhD program. I would like to thank him for his immense patience, the support and guidance through the years. I would like to thank Dr. Honn once again for letting me attend and participate in many different scientific meetings and conferences. I would also like to thank him for his trust in my research work and for giving me the independence to work on various projects in our laboratory apart from mine. I would also like to thank him for his continuous support in helping me finding a Job.

I take this opportunity to thank my committee members Dr. Avraham Raz, Dr.

Rafael Fridman and Dr. Hyeong-Reh Kim for their advice, comments and time. They helped me a lot with their suggestions and critique during my annual committee meetings, which helped me steer, my research project in a better way. Also I would like to thank Dr. Kim for her continuous input regarding my project and for providing reagents for my experiments.

I would also like to thank Dr. Larry Matherly and Dr. Robert Pauley to be a part of the cancer biology graduate program of Wayne State University School of Medicine. I also specially thank Dr.Matherly for all his patience with me and for supporting me when

I needed help. I also thank our graduate advisor Dr.George Brush for taking time and meeting with me to know my progress with my project. I am extremely thankful to Ms.

Lanette Rowland for all the help she has done for me in the first few years of my PhD

Program. I can never forget her timely reminders and helpful suggestions regarding all my academic endeavors during my graduate program. I am extremely thankful to Ms.

iii

DeJesus Jill for all the help she has done for me to reach up to my graduation and successfully complete it. She has been immensely patient with me during all my times when I needed her help for my graduate ad Visa paperwork.

I express my sincere thanks to Dr. Rafael Fridman, Dr. George Brush, Dr. James

Eliason, and Dr.Arun Rishi for their constructive criticisms and suggestive inputs for the talks, I presented for the journal club and seminar sessions. I also take this opportunity to thank all my course teachers in helping me understand the subject matter in an easy and comprehensive manner.

I express my sincere thanks to Dr. Stephanie Tucker for taking so much time in helping me to get through my thesis research. She had spent a lot of time in meeting with me to help me focus on my research. She also was very helpful in correcting our thesis and getting us ready for various committee meetings and seminar presentations.

I would also like to thank our collaborator Dr.Anthony Ashton for his support in providing me with the reagents for my research and for editing my review article. Also for acting as a sounding board for my various questions on thromboxane and patiently answering them and helping me troubleshoot the issues with my experiments.

My thanks also go to Dr. Krishna Rao Maddipati for his help and providing me with great ideas and suggestions. He has helped me on numerous occasions in designing experiments for taking time to run my samples in mass spectrometry. I would also want to thank Dr.Menq Jer Lee for his help in helping me with the tissue array analysis and providing valuable input during lab meetings and my individual meeting with him. I also thank him for providing me with primers and their sequences for my Real-time PCR. I also thank Dr.Mustapha Kandouz for providing valuable input during lab meetings and

my individual meeting with him. I would also thank him for providing some lab supplies and reagents when I needed it.

Words are not enough to express my gratitude towards my laboratory colleagues. I would like to take this opportunity to thank Mr. Yinlong Cai who taught me various techniques and helped me in doing my experiments. I would also want to thank

Dr. Ashok Dilly for helping me with my experiments. I am also thankful to him for various discussions we had and helping me with the phosphorylation experiments. I also thank

Ms. Sangeeta Joshi, who joined at the same time as me in the PhD program and chose the same Lab for our dissertation. We had gone through the ups and downs of the PhD research helping each other. We had done a lot of group studies in the first two years for various exams and had talked about our experiments. I really enjoyed working with

Dr. Yande Guo, Mr. Sen-Lin Zhou, Sahiti, Wenlian and all other past and present members of the Honn lab group. Thank you for all for your encouragement and immense help. I would also like to thank Dr. Sriram Krishnamoorthy who was very much instrumental in me choosing Dr.Honn Lab for my PhD research. He also taught me various techniques and helped me in doing my experiments.

I would like to thank Mr. Christopher Harris, our Lab Administrator for helping me in placing my lab orders in a timely fashion and made sure that everything went for me in a smooth manner. I would like to extend my appreciation to Bonnie, Liz, and Greg of science stores who helped me get my lab orders in a timely fashion. Thanks to the

Karmanos Cancer Institute Pathology Core Facility for assisting with different immunohistochemistry assays.

I express my heartfelt gratitude to my friend Gowrishankar Jaganathan for being

there for me, giving me valuable advices at critical times and great company during happy and sad moments. I thank my friends Gitanjali Kundu, Arulmurugan, Selvakumar and Farooq for all their help, friendship, and company during my stay in Wayne State

University.

I am greatly thankful to my wife, Arulselvi, who helped and for supporting me during all times even when I was not at home most of the time. She was kind enough to bear the brunt of hard work of taking care of home and my kids when I was working in the lab and came late to home. I would also thank my daughter Tejas for her patience and support for my PhD program, even when I was not at home most of the times to play with her. She was kind enough to sacrifice her “Playing time” in order to help me focus on completing my PhD program. I would also thank my daughter Abhisha, who was willing to sacrifice her “Daddy time” in helping me to complete my PhD program. I would also want to thank my sister, Viveka and my brother Bala, for their affection and continued support. Finally I would like to thank my parents for their unconditional love and support. They belived in my abilities and were foremost responsible for me to realize my dream of doing graduate studies in the United States and for supporting me throughout my stay here.

TABLE OF CONTENTS

Dedication ……………………………………………………………………………………….ii

Acknowledgements……………………………………………………………………………..iii

List of Tables………………………………..……...…………………………….……...... viii

List of Figures ……………………………………………………………………………...... ix

Abbreviations ……………………………………………………………………….…...... xi

CHAPTER 1 – Introduction: Background …………………...………………...... ….…..…1

CHAPTER 2 – Materials and Methods……………………...………..……………………..36

CHAPTER 3 – TPα mediated over expression of amphiregulin is mediated by AMP-activated protein kinase (AMPK) in prostate cancer ………....45 CHAPTER 4 – Summary and Discussion …………...... ……...... 96

Appendix…………………………………………………………...... 107

References ………………………………………………………………………..…..…….108

Abstract……………………………………………………………………………………..…139

Autobiographical Statement…………………………………………………………………141

vii

LIST OF TABLES

Table 1: Cells in which thromboxane A2 receptors have been identified based on ligand binding studies ……………...... ……13 Table 2: EGFR family of receptors and their ligands...... …………...... ……….....28

Table 3: List of Human specific primers used for RT-PCR...... …………...... ……….....38

Table 4: List of primers used for Real-time PCR SYBR Green assay....….....………….40

viii

LIST OF FIGURES

Figure 1.1: Gleason grading system …………...... 3

Figure 1.2: Schematic overview of major bioactive lipids derived from arachidonic acid metabolism ………………….....………..…………………....6

Figure 1.3: Generation of the prostanoids through metabolism of arachidonic acid by the COX pathway ...... ………...... 9

Figure 1.4: Structures of TPα and TPβ Receptor Proteins ……...... ……11

Figure 1.5: G protein coupling of thromboxane receptor and signal transduction...... 16

Figure 1.6: Activation of MAPK pathways by TP receptor involves transactivation of EGFR in an Src kinase dependent manner...... …...... 22

Figure 1.7: Crosstalk between Thromboxane and EGFR signaling by shedding of EGFR ligands by MMPs...... …...... 23

Figure 1.8: Members of Epidermal Growth Factor receptor Factor family....…...... 25

Figure 1.9: EGFR tyrosine phosphorylation sites...... ……………….....27

Figure 1.10: TP receptor activation in DU145 cells increased expression of AREG, a ligand for EGFR...... …...... 34

Figure 3.1: Screen for expression of TPα in PCa cell lines by RT-PCR...... 46

Figure 3.2: Screen for expression of TPα in PCa cell lines by immunoblot...... 47

Figure 3.3: TPα expression was high in PCa cells compared to prostate epithelial cells (RWPE1, PREC)...... …...... 48

Figure 3.4: Endogenous TPα expression in PCa cells can elicit a functional response in terms of second messenger (cAMP) synthesis...... 49

Figure 3.5: Database search using MSKCC genomics database indicates that TPR expression is amplified in prostate carcinoma...... 51

Figure 3.6: TPα expression levels correlate with grades of different cancer tissues that are classified based on its Gleason scores...... 53

Figure 3.7: Over expression of TPα receptor in PC3 cells...... 54

Figure 3.8: Activation of TPα in PC3 cells over expressing TPα resulted in an increase of AREG, a ligand for EGFR ...... 57

Figure 3.9: Activation of TPα in PC3 cells over expressing TPα resulted in an increase of AREG, a ligand for EGFR ...... 61

Figure 3.10: AREG secreted in response to TPα receptor activation is active and leads to EGFR phosphorylation...... 63

Figure 3.11: Activation of TPα in PC3 cells over expressing TPα resulted in an increase of EGFR...... 67

Figure 3.12: Activation of TPα in PC3 cells over expressing TPα had little effect on expression of other EGFR Family members-ErbB2, ErbB3 and ErbB4...... 71

Figure 3.13: Add-back experiment proving that EGFR expressed in PC3 transfectants is functional...... 76

Figure 3.14: Upregulation of AREG by TPα is not dependent on PKA pathway...... 78

Figure 3.15: Upregulation of AREG by TPα is dependent on AMPK pathway ……....…81

Figure 3.16: Activation of TPα signaling by IBOP stimulation results in increased invasiveness of PCa ...... 84

Figure 3.17: Mice bearing PC3-TPα cells showed greater tumor growth compared to the control group...... 88

Figure 3.18: Size and weight Comparison of tumors originating from PC3 vector controls and PC3 cells overexpressing TPα ...... 88

Figure 3.19: Increased neo vascularization and proliferation was observed in tumors from mice harboring PC3-TPα cells compared to those given vector controls...... 91

Figure 3.20: Increased expression of downstream target genes in PC3-TPα mice that is known to affect tumor growth...... 93

Figure 3.21: Induction of angiogenesis in Matrigel by TPα transfectants...... 95

Figure 4: Project Summary...... 104

ABBREVIATIONS

PCa...... Prostate cancer

PSA...... Prostate-Specific Antigen

AA...... Arachidonic Acid

COX...... Cyclooxygenase

LOX...... Lipoxygenase

LT...... Leukotrienes

HETEs...... Hydroxyeicosatetraenoic acids

TXA2...... Thromboxane A2

TXA2S...... Thromboxane synthase

TP...... TXA2 receptor, or T-Prostanoid, receptor

GPCR...... G-Protein Coupled Receptors

NSAIDS...... Nonsteroidal Anti-Inflammatory drugs

EGFR...... Epidermal Growth Factor Receptor

ErbB...... Erythroblastic Leukemia Viral Oncogene Homolog

HER...... Heregulins

EGF...... Epidermal Growth Factor

HB-EGF...... Heparin binding-Epidermal Growth Factor

TGF-alpha...... Transforming Growth Factor-Alpha

EREG...... Epiregulin

AREG...... Amphiregulin

NRG...... Neuregulins

ERK...... Extracellular signal Regulated Kinase

MAPK...... Mitogen-Activated Protein Kinase

Src...... Sarcoma

CD...... Cluster of differentiation

RHO-A...... Ras homolog gene family, member A

HEK...... Human Embryonic Kidney

PKA...... cAMP dependent Protein kinase

AMPK...... AMP-activated protein kinase

FFPE...... Formalin-Fixed Paraffin-embedded

xii 1

CHAPTER 1: INTRODUCTION

Prostate Cancer:

Prostate cancer is one of the most common cancers among American men and

is the second leading cause of death among them in the United States [1]. Prostate

cancer is slow growing and the majority of deaths are from metastatic disease.

Metastatic prostate cancer generally localizes in the bones and lymph nodes [2]. The

causes leading to prostate cancer metastasis and the mechanisms by which cells

escape from the primary site and intravasate into the circulation to spread to distant

organs, e.g. bone, is poorly understood [2].

Diagnosis of Prostate Cancer:

Recent advances in diagnostic methods have enabled detection of prostate

cancer at an early stage thereby reducing the number of deaths from metastasis. These

methods include the PSA test, Digital Rectal Examination (DRE), trans-rectal ultrasound

and trans-rectal biopsy [3]. Two of the most commonly used methods for diagnosis are

the PSA test and DRE [2, 4].

Blood Test for Prostate-Specific Antigen (PSA): PSA, also known, as Kallikrein is a

serine protease enzyme that was discovered by Dr. Richard J. Ablin and has been

approved by FDA for annual screening of prostate cancer in men of age 50 and older.

Serum PSA levels are higher in patients who have prostate cancer compared to men

with healthy prostates. PSA is measured from a blood sample by Enzyme Linked

Immuno-Absorbance Assay (ELISA), where the normal level of PSA in human blood is

4 ng/ml. Free PSA in blood beyond 10 ng/ml indicates additional tests are necessary to

2 check for cancer. As there were many false positives in some patients, PSA test is more of a predictive test that needs to be verified by additional tests. Success of the PSA test was one factor responsible for the decline in the number of deaths that occurs due to prostate cancer [5, 6].

Digital Rectal Examination: This is a physical examination of the prostate where the prostate is directly palpated for irregularities from inside the rectum. However, with this method only 10% of the gland can be examined. Furthermore performance in detecting abnormalities varies greatly, and agreement between examiners is low. Therefore additional markers are necessary to augment existing PCa tests. [2, 3, 7].

Prostate Cancer Pathology and Grading

Once diagnosed, prostate cancer is classified into different grades and stages that are used to predict responsiveness to a specific cancer therapy, such as radiotherapy or surgery. The Gleason grading system developed by Dr. Donald F. Gleason is the most commonly used method to grade prostate cancer tissues based on the histologic pattern of arrangement of cancer cells in Hematoxylin and Eosin (H&E) stained prostate tissue sections [8]. Gleason grades include five basic grade patterns (Figure 1.1). To generate a histologic score, ranging from 2 to 10, the primary and the secondary grade patterns are added. “Gleason grade has been linked to a number of clinical end points, including clinical stage, progression to metastatic disease, and survival” [6, 8, 9].

Figure 1.1: Gleason grading system. This was developed by Dr. Donald F. Gleason and is the most commonly used method to grade prostate cancer tissues based on the so called “architecture” of H&E-stained prostatic tissue sections [8].

Treatment Options:

There are several methods available for treating men with prostate cancer.

These include surgery, chemotherapy, cryotherapy, hormonal therapy, radiation, High

Intensity Focused Ultrasound (HIFU), and "watchful waiting” [10][2]. Treatment options vary between patients depending on the patient’s age, stage and grade of the disease.

The treatment that is best for one man may not be best for another, and yet another may have a combination of treatments [2].

Risks Factors for Prostate Cancer:

Common risk factors that are associated with prostate cancer include: age, race and diet [2, 11].

Age over 65: Age is the main risk factor for prostate cancer. In the United States, most men with prostate cancer are over 65. This disease is rare in men under 45. There is a racial component and African-American men should be screened earlier for prostate cancer at age 40 [2, 11].

Race: Prostate cancer is more common among African-American men than Caucasians or Hispanic men. It is less common among Asian and Native American men. Also the rate of men dying from prostate cancer has varied, depending on their race and ethnicity where recent data shows that, African-American men were more likely to die of prostate cancer than any other ethnic group. Caucasian men had the second highest rate of deaths from prostate cancer, followed by Hispanic, Native American, Alaskan

Native, and Asian/Pacific Islander [12, 13].

Diet and Prostate Cancer: Diet is also considered an important risk factor for prostate cancer. Epidemiologic studies have suggested that high consumption of fat and red meat, and lower consumption of fruits and vegetables contributes to morbidity [11, 14-

17]. Animal fat is especially rich in arachidonic acid, whose metabolites have been shown to affect prostate cancer progression [16, 17].

Arachidonic Acid Metabolism:

Arachidonic acid (AA) is an essential component of mammalian cell membranes and plays a critical role in the synthesis of eicosanoids [18]. Arachidonic acid and its precursor, linoleic acid, are major components in animal fats and many vegetable oils

[17]. Arachidonic acid is mobilized by phospholipase A2 (PLA2) from cellular membrane glycerolipid pools in response to many stimuli such as cytokines and growth factors

(15). Arachidonic acid is present in membrane phospholipids and is released by phospholipase A2 and can be oxidized by three distinct enzymes Cyclooxygenase

(COX), Lipoxygenase (LOX), or P450 epoxygenase into three distinct pathways to form a variety of eicosanoids as shown in Figure 1.2 [18]. “Eicosanoids are 20-carbon lipid molecules derived from the enzymatic breakdown of membrane lipid precursors, chiefly arachidonic acid” [18]. These bioactive metabolites of arachidonic acid are potent in several physiological and pathological processes such as inflammation, asthma, and cancer [19, 20]. Lipid mediators generated by these enzymes are involved in a wide variety of cellular and molecular pathways, including but not limited to apoptosis, cell survival, proliferation, chemotaxis and senescence [19, 20].

Lipoxygenease Pathway:

In the lipoxygenase pathway, AA is oxidized by several enzymes resulting in the formation of hydroxyeicosatetraenoic acids (HETEs), leukotrines, lipoxins, and hepoxilins. “The chief enzymes of the LOX pathway are the 5- LOX, 12-LOX, and 15-

LOX enzymes whose names are derived from the position in which molecular oxygen is inserted into the arachidonic acid backbone” [21].

Cancer Metastasis Rev (2010) 29:723–735 725

Stimulus Phospholipid

Arachidonic acid

Cytochrome P450 (CYP) Cyclooxgenase (COX) Lipooxygenases (LOX) (87 genes in humans) COX1 5-LOX Epoxygenases COX2 8-LOX CYP4A CYP2C COX3 MSPPOH 12-LOX CYP2J 15-LOX HET0016

“PROSTAGLANDINS”LEUKOTRIENES n-HETE EPOXYEICOSATRIENOIC ACID

Prostaglandins LT A4 12-HETE 5,6-EET EET agonist PGE2 LT B4 19-HETE 8,9-EET Prostacyclins Vasorelaxation PGD2 LT C4 20-HETE 11,12-EET Cardioprotection PGF2 PGI2 Thromboxanes LT D4 14,15-EET Proliferation 14, 15-EEZE Inflammation TXA2 Inflammation Vascular Inflammation Inflammation COX1 sEH sEH inhibitor Pain Proliferation Allergy function Platelet Bronchoconstriction aggregation 20-OH PGE2 DHET 20-OH PGI2

B Prostacyclins Leukotrienes C4 20-HETE 11,12-EET Figure 1.2: SchematicO overview of major bioactive lipids derived from arachidonic acid OH OH metabolism by three classes ofCOOH enzymes (CyclooxygenaseCOOH O , LipoxygenaseO and S CONHCH2COOH OH HO NHCO(CH2)2CHCOOH O Cytochrome P450) into three pathways NH[222 ].

The predominantHO bioactive products of the 5-LOX pathway are the leukotrienes

(LT). Leukotrienes include LTA4, LTB4, LTC4 and LTD4 [21]. LTA4 is the primary Fig. 1 a, b Bioactive eicosanoids derived from the arachidonic acid P450 enzymes. MS-PPOH is a selective inhibitor of a subset of cascade. Arachidonic acid is metabolized by three pathways—the epoxygenases. HET0016 is a selective inhibitor of the ω-hydroxlase cyclooxygenase (COX), lipoxygenase (LOX), and cytochrome P450 CYP4A. The sEH inhibitor (soluble epoxide hydrolase inhibitor) leukotriene(CYP formed) pathways. Schematic by action overview of of major 5-LOX mediators andon theirAA,increases which EET islevels then by acting hydrolyzed as an agonist of the to EET LTB4 pathway. by metabolites (blue); enzymes (black, boxed) and biological role (green). 14,15-EEZE is a putative EET receptor antagonist. PGE2 prostaglandin Inhibitors (red ovals) and agonists (green ovals). HETEs Hydroxyeico- E2, PGI2 prostacyclin, LTA4 leukotriene A4, DHET dihydroxyeicosa- LTA4 hydrolasesatetraenoic acids,[21EETs]. Aepoxyeicosatrienoicction of acids, LTC4CYP cytochrome synthasetrienoic on acid, LTA420-OH PGE can2 20-hydroxy-prostaglandin also give E 2 rise to the cysteinyl leukotrienes,bioactive eicosanoids namely [1]. Eicosanoids LTC4 are generated and LTD4 via the [21membrane, 23]. through the activation of phospholipase A2 [1]. oxidation of the 20-carbon chain present on arachidonic acid or Arachidonic acid is metabolized by the CYP ω-hydroxylases other related fatty acids [2]. During processes, such as to 7-, 10-, 12-, 13-, 15-, 16-, 17-, 18-, 19-, and 20-HETEs, the inflammation, arachidonic acid is released from the cell principal metabolite being the pro-inflammatory 20-HETE [4]. Another key enzyme of the LOX family is 12-LOX. The three important isoforms are platelet-type, epidermal, and leukocyte-type 12-LOX that act on AA to result in the synthesis of 12(S)-HETE [21]. It is known that 12-LOX and its product 12(S)-HETE is involved in the disease process of a variety of cancers including colon carcinoma,

7 melanoma, human glioma, prostate and breast cancer [18, 20]. Studies have also shown that 12(S)-HETE has a wide range of biological functions and has been implicated in prostate cancer metastasis through its action on endothelial cell retraction and integrin regulation [18, 24, 25]. Another key member of LOX family is 15-LOX, which exists as two isoforms; 15-LOX-1 and 15-LOX-2 [18, 20]. Action of 15-LOX on arachidonic acid gives rise to 15-HETE [21].

P450 Epoxygenase Pathway:

Cytochrome P450-dependent metabolism of AA includes two distinct pathways: the ω-hydroxylase and epoxygenase pathways [22]. The ω- hydroxylases of the 4A and

4F gene families of cytochrome P450 (CYP4A and CYP4F) convert arachidonic acid to autacoids such as hydroxyeicosatetraenoic acids (HETEs) [22, 26].

20-HETE is the principal isoform of this pathway and can be vasoconstrictive [27, 28].

The epoxygenase pathway occurs in several tissues including liver, kidney, and the cardiovascular system [26]. This latter pathway includes two enzymes, CYP2C and

CYP2J, which generate epoxyeicosatrienoic acids (EETs) that are known to have vasodilatory activity [22, 26]. Guo et al. have shown that 20-HETE can stimulate endothelial cell proliferation and VEGF expression in vitro suggesting that CYP ω- hydroxylase may play an important role in tumor growth and angiogenesis [29, 30]. In

Non Small Cell Lung Cancer (NSCLC) cells, CYP ω-hydroxylase enhanced cellular invasion in vitro as well as angiogenesis and metastasis in vivo and significantly increased the expression of VEGF and MMP-9 in vitro and in vivo [29, 30].

Cyclooxygenase Pathway:

Most prostate cancer biology has focused on the role of COX and LOX enzymes [18, 20, 31, 32]. Cyclooxygenase has two isoforms that differ mainly in regulation of their expression and tissue distribution. COX-1 is widely expressed in most tissues, whereas COX-2 expression is normally absent, but can be induced by numerous stimuli such as growth factors, TNFα and inflammation [33, 34]. COX-2 is over expressed in many human non-endocrine and endocrine tumors including those of the colon, breast, prostate, brain, thyroid, and pituitary [33, 35]. Cyclooxygenase catalyzes the conversion of AA into a prostaglandin intermediate, PGH2, which is in turn oxidized by several other enzymes that can form two classes of eicosanoid products, namely prostaglandins (PGI2, PGE2, PGD2, PGF2a) or thromboxanes (TXA2) (Figure-

1.3) [36-38].

Prostaglandin E2 (PGE2) is formed by the action of prostaglandin E synthase

(PGES) on Prostaglandin H2 (PGH2). Among the COX metabolites, PGE2 has been widely implicated in various steps of cancer development and progression such as angiogenesis, cell survival, proliferation, and chronic inflammation [21, 31, 35].

PGH2 can also be acted on by thromboxane synthase (TXA2S) that catalyzes its conversion to thromboxane A2 (TXA2), a potent vasoconstrictor and an inducer of platelet aggregation [39, 40] [36, 37, 41]. Additionally the enzyme prostacyclin synthase, antagonizes the effect of TXA2S by catalyzing the conversion of PGH2 to prostacyclin I2

(PGI2) that opposes the action of TXA2, namely causing vasodilation and inhibiting platelet aggregation [42, 43].

The New England 9Journal of Medicine

Membrane phospholipids

Phospholipase A2 Diverse physical, chemical,! inflammatory, and mitogenic stimuli

Arachidonic! Coxibs acid

Prostaglandin G COX Prostaglandin G Prostaglandin G/H! 2 2 Prostaglandin G/H! synthase 1! synthase 2! (cyclooxygenase-1) HOX (cyclooxygenase-2) Prostaglandin H2 Prostaglandin H2

Tissue-specific isomerases

Prostanoids Prostacyclin Thromboxane A2 Prostaglandin D2 Prostaglandin E2 Prostaglandin F2a

Receptors IP TPa, TPb DP1, DP2 EP1, EP2, EP3, EP4 FPa, FPb

Platelets,! Brain, kidney,! Uterus, airways,! Endothelium,! vascular smooth-! Mast cells,! vascular smooth-Ł vascular smooth-! kidney,! muscle cells,! brain,! muscle cells,! muscle cells,! platelets, brain macrophages,! airways platelets eye kidney

Figure 1. Production and Actions of Prostaglandins and Thromboxane. Arachidonic acid, a 20-carbon fatty acid containing four double bonds, is liberated from the sn2 position in membrane phospho-

lipids by phospholipase A2, which is activated by diverse stimuli. Arachidonic acid is converted by cytosolic prostaglandin G/H Figure 1.3synthases,: Gener whichation have both of cyclooxygenase the pros (COX)tanoids and hydroperoxidase through (HOX) metabolism activity, to the unstable of arachidonicintermediate prostaglandin acid by the H2. The synthases are colloquially termed cyclooxygenases and exist in two forms, cyclooxygenase-1 and cyclooxygenase-2. Coxibs selectively inhibit cyclooxygenase-2. Prostaglandin H2 is converted by tissue-specific isomerases to multiple prostanoids. These COX pathwaybioactive lipids. In activate the specific first cell-membrane step of the receptors generation of the superfamily of of TXA G-protein–coupled2, COX-1 receptors. and Some COX of- the2 tissuisoformses are in which individual prostanoids exert prominent effects are indicated. IP denotes prostacyclin receptor, TP thromboxane receptor, DP prostaglandin D receptor, EP prostaglandin E receptor, and FP prostaglandin F receptor. responsible for the conversion2 of AA to2 PGH2. Thromboxane2a synthase (TXA2S) then catalyzes the conversion of the COX product, PGH2 to TXA2 [44].

different. The dependence of the lesions on cycloox- The biochemical selectivity of a particular drug, as ygenase-1 has been established, but it is uncertain assessed in vitro, is critically dependent on its con- whether the finding of lesions on endoscopy is actu- centration. One can summarize such selectivity pro- Thromboxane Synthase and TXA2: ally predictive of the likelihood of serious gastroin- files by plotting the drug concentrations necessary testinal complications, such as perforation, obstruc- to inhibit the activity of cyclooxygenase-2 and cyclo- tion, and bleeding. Indeed, the hemorrhagic nature oxygenase-1 by 50 percent (Fig. 2).23-26 However, giv- Thromboxane synthase (TXA2S) is an ER membrane protein that belongs to the of most serious gastrointestinal end points makes it en the concentration dependence of these estimates, likely that they primarily reflect the inhibition of cy- it is not useful to attempt to discriminate between P450 epoxygenaseclooxygenase-1 activity family in platelets, and rather catalyzes than in gas- theexisting conversion NSAIDs on the of basis PG ofH small to differences TXA in[45]. The tric mucosa. Finally, the low incidence of these events biochemical selectivity with the use2 of terms such2 as means that many patients must be studied for pro- “preferential cyclooxygenase-2 inhibitor.” enzyme longed plays periods a roleof treatment in several to detect the pathophysiological differences How well do processes the results of includingthese in vitro hemostasis,assays between drugs reliably.21,22 predict selectivity when the measurements are per- cardiovascular434 · N Engl disease, J Med, Vol. 345, andNo. 6 · strokeAugust 9, 2001 [46· www.nejm.org]. TXA2S is a 60 KDa protein that was first

The New England Journal of Medicine identified as a microsomalDownloaded from nejm.org enzyme at WAYNE STATE UNIVERSITY in pl LIBRARIESatelets on June 23, [ 2012.46 For, personal47] use. only.TXA No other2 usesS without expression permission. is detectable Copyright © 2001 Massachusetts Medical Society. All rights reserved. in lung, platelets, kidney, stomach, duodenum, colon and spleen [46, 48]. Its expression

10 is reported to be closely associated with cardiovascular, renal, and inflammatory diseases [49].

TXA2 is very unstable in aqueous solution, and becomes hydrolyzed within 30s to the biologically inactive TXB2 [36, 50]. Due to its very short half-life, TXA2 functions as an autocrine or paracrine mediator in the nearby tissues surrounding its site of production [48]. TXA2 is responsible for multiple biological processes through the cell surface TXA2 receptor, or T-Prostanoid, receptor (TP) [46]. TXA2S, and TP are the two important components necessary for the functioning of this potent bioactive lipid signaling pathway [46].

Thromboxane A2 Receptor:

Ushikubi et al. first purified TXA2 receptor protein from human blood platelets in

1989 [51]. In 1991, a cDNA for the human TP receptor was originally cloned from placenta and the platelet-like MEG-01 cell line by Hirata et al. [52, 53]. Raychowdhury et al. later isolated a cDNA encoding a second isoform of the TP receptor from a human umbilical vein endothelial cell (HUVEC) cDNA library [53, 54]. Thus, to date there are two receptors for TXA2 in humans, termed TPα from human placenta and TPβ from endothelial cells [53, 55, 56]. In humans, these cDNAs represent alternative splice products of the same TXA2 receptor gene. In all other species, it is only expressed as a single isoform, TPα [52, 54, 57]. The physiological significance of the existence of two receptors for TXA2 in humans, but not in other species is still not well understood.

Human TPα and TPβ are typical G-protein coupled receptors (GPCR) that share the first 328 amino acids but differ in their C-terminal tail, where TPα has a shorter C- terminal cytoplasmic tail than the TPβ isoform (15 versus 79 residues) [52-54] (Figure-

1.4). Ligand binding sites on the TP receptor are in its extracellular region and are

identical in both splice variants. Therefore, differences in function between TPα and

TPβ likely reside in the complement of G-proteins associated with their C-termini [57-

59].

Cancer Metastasis Rev (2011) 30:397–408 399

Fig. 2 Structures of TPα and TPβ receptor proteins. The TXA2 receptor (TP) is a typical G-protein-coupled receptor that is expressed as two different isoforms in humans—TPα and TPβ. TP isoforms share the first 328 amino acids but differ in the length of the C-terminal cytoplasmic tail with TPα shorter than the TPβ isoform (15 versus 79 residues) [24, 25]

multiple cancers indicating the extensive nature of these TXA2 biosynthesis in PCa cells [45]. Increased TXA2S effectsFig and theure widespread. 1.4: Structures clinical applicability of ofTP targetingα and expressionTPβ Receptor and activity Proteins in PCa cells. TP augmentedα and T cellPβ are encoded by the these pathways as adjunct therapy in cancer [30–32, 34]. migration but had minimal effect on cell cycle progression single TP receptor gene, on chromosomeor survival 19p13n3 indicating that[31], TXA and2S activity arise might by contribute a novel differential splicing 2.1 Role of thromboxane A2 signaling in prostate cancer to PCa progression through modulating cell motility [45]. mechanism within exon 3, whereby nucleotidesIn a study conducted 984 on– tissue1642 samples of from the 46 TP patients,α mRNA behave as an Prostate cancer (PCa) is one of the most common cancers with well-documented histological and molecular data, amongintron men in the(intron USA and 2b) is the within second leadingthe TP causeβ mRNA of increased [52-54 TXA].2 S and COX-2 expression were observed death in this population [35]. Strong correlations exist in tumors. In the same study, TP expression was higher in between diets high in fat (especially from red meat) and malignant tissues (high-grade prostatic intraepithelial neo- PCa [36–38]. As red meat is rich in AA, the presence of plasia and cancer glands) [46]. Similarly, TXA S mRNA TXA2 is responsible for multiple biological processes2 through its cell surface enzymes associated with AA metabolism might result in and protein expression were higher in prostate carcinomas increased synthesis of downstream lipid mediators. Several compared to matched normal tissues. In contrast, epithelial metabolites of AA, such as 5-HETE and 12-HETE, have cells in non-tumoral glands displayed almost non-existent already been studied widely for their roles in PCa [39–42]. TXA2S and TP expression [46]. The degree of TXA2S Numerous studies demonstrate increased COX-2 mRNA expression correlated with the severity of prostate carcinoma and protein expression in PCa correlate with poor prognosis lesions, with advanced stages and poorly differentiated forms [43, 44]. TXA2 is derived from the COX product PGH2 having the highest expression levels [45, 46]. Moreover, a and, as a consequence, both TXA2S and TP have long been significant association between the expression of COX-2/ hypothesized to have a possible role in prostate cancer TXA2S/TP and higher Gleason score/pathologic stage of the progression. tumors was observed [46]. Within the cancer tissue,

Prostate tumor progression involves several key steps expression of TXA2S and TP were localized to areas of including cell survival, cell migration, cell invasion, and perineural invasion, a known mechanism by which PCa cells metastasis. Human PCa cells express functionally active penetrate the prostatic capsule and spread to other tissues.

TXA2S and biosynthesize TXA2 [45]. As the expression of Strong expression of TXA2S along perineural tracts might be COX-2 and COX-1 in prostate cancer has been reported an indicator for its potential involvement in tumor cell previously, Nie and colleagues investigated their role in invasion and metastasis [45–47]. The enzyme was found to synthesis of TXA2 [45]. Treatment of PC-3 cells with both be involved in motility, but not proliferation or survival, of COX-1 and COX-2 inhibitors reduced TXA2 synthesis by PCa cells [45]. 95%, similar to the level achieved by direct TXA2S Tumor cell migration is an important step in the antagonism. These data suggest that human PCa cells metastatic cascade. At this time, tumor cells leave the express TXA2S and that both COX-1 and COX-2 are primary organ, enter the circulation, and colonize distant essential for providing the substrate for TXA2S mediated tissues [48]. Rho GTPases are critical for the dynamic 12

receptor TP. Previous studies have shown that activation of TP by TXA2 or its stable synthetic analog, U46619, will result in platelet aggregation [50], contraction of vascular smooth muscle cells [60] or release of prostacyclin from endothelial cells [61]. Ligation of TP by TXA2 can evoke the activation of multiple downstream pathways including phospholipase C activation and a subsequent rise in the intracellular Ca2+ concentration, leading to vasoconstriction and platelet aggregation [48, 57]. TXA2 has been implicated in the pathology of a variety of cardiovascular diseases, including atherosclerosis [62], stenosis after vascular injury [63], and hypertension [64] [49].

Distribution of Thromboxane A2 Receptor (tissues and cells)

TP can be found in a large number of tissues, and cell types include platelets, lung, vascular smooth muscle, endothelial cells, kidney, brain, spleen, thymus, monocytes, uterus, and placenta [46, 57, 65].

Table 1: Cells in which TP receptors have been identified based on ligand binding studies [57, 65].

Thromboxane A2 Receptor–Ligand Interaction:

It was previously shown that the transmembrane (TM) region of TP contributes to its ligand binding since point mutations of amino acids in the TM region resulted in diminished ligand-binding activity [66]. The second extracellular loop (eL2) of TP is important for ligand binging, especially amino acids Cys183 to Asp193 [67]. The NMR study demonstrated that Val176, Leu185, Thr186 and Leu187 in eL2 of TP are putative ligand contact points [68]. Point mutations within eL2 of TP indicated that Asp193 is a key amino acid for ligand binding (both for binding to agonist and antagonist) [69]. This study also reported that Phe184, Thr186 and Ser191 are key residues for antagonist

binding [66]. Pharmaceutical companies have successfully designed TXA2 competitive antagonists for TP that target this region thereby affecting its functional role.

Agonists and Antagonists:

TXA2 is very unstable in aqueous solution, where it is hydrolyzed with a half-life of 30s to form the biologically inactive thromboxane B2 (TXB2) [36]. More stable functional analogs have been synthesized because of the short half-life of TXA2 and characterized. Notable agonists include U-46619 [70] [71] and I-BOP [72] [73]. The antagonists include PTA2 [74], SQ-29,548 [75], Ramatoroban (Bay U3405) [76, 77], and seratrodast [78, 79]. The failure of existing TXA2S inhibitors and TXA2 antagonists to show robust clinical benefit in treatment of cardiovascular disorders has largely been due to co-incident use of Nonsteroidal anti-inflammatory drugs (NSAIDs), such as aspirin, as part of the standard of care. Conversely, current therapeutic regimens for cancer incorporate few agents from this class making TXA2S/TP antagonism an attractive target with potentially significant therapeutic benefit. Moreover, in contrast to

NSAIDs, TXA2S/TP inhibitors do not prevent other COX-derived anti-tumor products with beneficial effects, such as PGI2, from being synthesized.

Thromboxane A2 Receptor and its Signal Transduction

Stimulation of TP receptors in platelets leads to an increase in intracellular free calcium, activation of Phospholipase C, generation of IP3 and diacylglycerol, activation of protein kinase C, stimulation of myosin light chain kinase and exposure of integrin

IIb/IIIa binding sites [53]. In platelets, stimulation of the TPα receptor isoform results in an increase in cAMP formation. The same observation was made with CHO and COS -

7 cells transfected with TPα [53, 58]. Ushikubi et al. showed that the presence of TPβ

15 coupled to Gαi2 in reconstituted vesicles resulted in decreased cAMP formation [80].

Contribution of G proteins in TP Signaling:

TXA2 signaling through TPα and TPβ occurs when they couple with G proteins, such as Gq, G11, G12, G13, G15, G16, Gi, Gs and Gh, which in turn regulate effectors such as phospholipase C, guanine nucleotide exchange factor of the small G protein

Rho (RhoGEF) and adenyl cyclase (Figure 1.5) [57, 58, 66]. Activation of TP by TXA2 can evoke the activation of phospholipase C leading to phosphatidylinositol turnover and a subsequent rise in the intracellular calcium ion concentration, which in turn leads to vasoconstriction and platelet aggregation (Figure 1.5) [57, 66]. However signaling through Gq and G12/13 appears most relevant to TP function [66]. Gq couples to platelet TP receptors, as evidenced by increases in agonist stimulated GTPase activity

[66]. TP-mediated morphological changes in platelets are mainly dependent on G12/13.

Platelet aggregation by TXA2 is dependent on Gq (Figure 1.5) [81] [57-59].

Figure 1.5: G protein coupling of thromboxane receptor and signal transduction

[66].

TP isoforms have both common and distinct signaling pathways depending on the G protein subunits bound to their C-terminal tail. Therefore, differences in function between TPα and TPβ must manifest due to the complement of G-proteins associated with it [46]. One of the major differences between the two isoforms is the cAMP pathway. When each TP isoform was expressed in CHO cells, IBOP, a TP agonist, increased intracellular cyclic AMP levels in TPα-expressing cells, but decreased cyclic

AMP levels in TPβ expressing cells (Figure 1.5) [55]. These studies suggest that the coupling of TPα with Gs-stimulating adenylyl cyclase and of TPβ with Gi-inhibiting adenyl cyclase both induce changes in cyclic AMP levels, and this can be exploited [53].

Furthermore, Gh functionally interacts with TPα, but not TPβ [82]. It has been also shown that TPβ, but not TPα expression is required for the inhibition of vascular endothelial growth factor (VEGF)-induced migration and angiogenesis [83], suggesting that the downstream signaling pathways differ between TP isoforms [57-59].

Role of Thromboxanes in Cardiovascular Disorders:

Both TXA2 biosynthesis and thromboxane receptor (TP) expression is elevated in numerous cardiovascular and inflammatory diseases [49, 56, 84, 85]. By signaling through its receptors, TXA2 plays a very important role in the pathogenesis of acute coronary artery syndrome, vessel remodeling, thrombosis, renal, pulmonary and atherosclerotic cardiovascular diseases, primarily through its action as a potent vasoconstrictor and an inducer of platelet aggregation and activation [56, 62, 79, 85-88].

Therefore, inhibition of TXA2S and TP has become central to the therapy of many diseases including myocardial infarction, hypertension, stroke and renal dysfunction [89-

91]. Aspirin is the most common drug used to prevent TXA2 production. Other thromboxane modulators which have been either approved for therapeutic use or under clinical trials for the above mentioned diseases includes terbogrel [92], Ridogrel [93],

SQ-29548 [75], Ramatoroban (Bay U3405) [76, 77], and seratrodast [78, 79]. In recent years, several studies revealed an additional functional role for both TXA2S and TP, namely in cancer progression [46, 94-103].

Role of Thromboxanes in Cancer Progression:

Increased COX-2 expression has been described in a variety of diseases [33, 34] and also documented in various cancers including pancreatic cancer [104], lung cancer

[105-107], breast cancer [108], colon cancer [109] and prostate cancer [106, 110-112].

Though several reports have documented the antitumor effects of NSAIDs, it is not well understood how COX promotes tumorigenesis and cancer progression. As TXA2 is a downstream metabolite of the COX pathway, this has elicited interest as to whether

COX-2 actions are mediated by TXA2 signaling [113]. The eicosanoid products of the

COX pathway have dramatically different, sometimes contrasting or antagonizing, biological activities [114-116]. Therefore, the actual profile of the downstream COX metabolites is more relevant than the level of COX protein since the COX metabolites such as TXA2 and PGI2 have diverse and opposing functions [46].

One of the first study to look into the role of downstream metabolites of COX, such as TXA2 in cancer progression and metastasis was by Honn et al., where they had shown inhibition of either TXA2S or TXA2 receptor reduced cancer metastasis in vivo from tail vein injected B16a lung cancer cells. Inhibition of TXA2S also decreased tumor cell proliferation and inhibits DNA synthesis in B16 melanoma cells [116, 117]. Several years later, a study by Nie et al. in 2003, also indicated a functional role for TXA2S in prostate cancer progression. Since then, there have been several reports indicating a functional role for not only TXA2S but also for TP in several cancers that includes breast, bladder, lung and colon cancer [46, 94-103]. Cancer progression involves several key steps such as angiogenesis, cell survival, cell migration, cell invasion and metastasis, and studies have shown that both TXA2S and TP play important roles in one or more of these key process [46, 95, 96, 100, 118-120].

Role of Thromboxanes in Prostate Cancer:

Nie et al. had shown that human PCa cells express TXA2S and that this enzyme may contribute to PCa progression through modulation of cell motility [94]. As the expression of COX-2 and COX-1 in prostate cancer has been reported previously, data suggest that human PCa cells express functionally active TXA2S and that both COX-1 and COX-2 are essential for providing the substrate for TXA2S mediated TXA2 biosynthesis in PCa cells [94]. Increased TXA2S expression and activity in PCa cells augmented cell migration, but had minimal effect on cell cycle progression or survival

[94]. Increased TXA2S expression and TXA2 biosynthesis in PCa cells highlighted further a possible functional role for TP in PCa tissues, as the actions of TXA2 are mediated by its interactions with TP receptors.

In a study conducted on tissue samples from 46 patients, with well-documented histological and molecular data, increased TP, TXA2S and COX-2 expression were observed in malignant tissues (High-Grade Prostatic Intraepithelial Neoplasia (HGPIN)

[46, 97]. Similarly, TXA2S mRNA and protein expression were higher in prostate carcinomas compared to matched normal tissues [97]. In contrast, epithelial cells in non-tumoral glands displayed almost no TXA2S or TP expression [46]. Moreover, a significant association between the expression levels of COX-2, TXA2S, and TP and higher Gleason score/pathologic stage of the tumors was observed [97]. Though this study confirms that TP expression is higher in prostate cancer tissues, it did not identify which isoform, TPα or TPβ, was predominantly expressed [46].

Tumor cell migration is an important step in the metastatic cascade, at which

2 0 time the tumor cells leave the primary organ to enter the circulation, so as to colonize distant tissues [121]. Prostate tumor progression involves several key steps including cell survival, cell migration, cell invasion and metastasis, and studies have shown that

TXA2S or TP play a key role in either one of these processes [46]. Rho GTPases are critical for the dynamic changes in cell shape and adhesion that drive cell migration. Nie and colleagues demonstrated that the TXA2-TP signaling axis regulated cell migration and cytoskeleton reorganization by promoting Rho-A activation [101]. Recent studies have indicated that the Gα12 family of heterotrimeric G proteins (Gα12 and Gα13) is upregulated in PCa and that activation of Gα12 signaling, through a Rho-dependent pathway, promotes PCa cell invasion. Also Gα12 signaling via Rho is required for

TXA2-stimulated invasion of PCa cells [122]. Therefore, as TP is known to couple to the

Gα12 family of heterotrimeric G-proteins, the up-regulation of both TP and Gα12 in PCa suggests a possible role for TP in driving the cell migration and invasion observed in high grade PCa.

There is also a novel constitutive interaction between TPα and TPβ with the

Protein kinase C-related kinases (PRK1) [123]. PRK1 is a RhoA effector that has been widely implicated in androgen-associated PCa and ovarian serous carcinomas [123]. It was established that PRK1 directly interacts with endogenously expressed TPα and

TPβ in both PC3 and LNCaP cells, and that disruption of PRK1 by siRNA substantially impairs cell migration in response to TXA2 agonist U46619 in these cells [123]. These findings are all suggestive of a functional role of TP receptor in cell migration in prostate cancer [46].

Crosstalk between Thromboxane and EGFR Signaling Pathways:

Mitogen-activated protein kinases (MAPK) play a central role in regulating cell growth and differentiation. The activation of MAPK may result from stimulation of either

Receptor Tyrosine Kinases (RTK), which possess intrinsic tyrosine kinase activity, or G-

Protein-Coupled Receptors (GPCR) [124, 125]. The signaling pathways that link

GPCRs to MAPK involve both receptor and non-receptor tyrosine kinases as well as

Protein Kinase C (PKC) [126]. The Epidermal Growth Factor Receptor (EGFR) tyrosine kinase as an essential link in the GPCR-mediated MAPK activation in Rat-1 fibroblasts,

HaCaT keratinocytes, primary mouse astrocytes, and COS-7 cells [127] [128, 129].

Studies also have shown that TP-mediated activation of MAPK signaling involves EGFR by two possible mechanisms: Ligand-Independent (Src kinase-dependent) [127], and

Ligand-dependent (shedding of EGFR ligands) [130].

Transactivation of EGFR by TP receptor in a Ligand Independent Manner:

Gao et al. have shown that EGFR plays an essential role in the TP-mediated

MAPK activation in a ligand-independent manner. Activation of the Gq-coupled TP receptor by the TXA2 mimetic IBOP in ECV304 cells (bladder cancer cell-line) was found to induce ERK phosphorylation through tyrosine phosphorylation of EGFR in an

Src dependent manner (Figure 1.6) [127]. Tyrosine kinases of the Src family are involved in mediating both the tyrosine phosphorylation of EGFR, and MAPK activation from both Gq and Gi coupled receptors [127] [124, 125]. Furthermore, TP receptor activation also increases Src kinase activity, which is blocked by Src Inhibitor PP1, but not by AG1478, indicating that Src activation occurs before phosphorylation of EGFR

[127].

Figure 1.6: Activation of MAPK pathways by TP receptor involves transactivation of EGFR in a Src kinase-dependent manner. A proposed model by Gao et al., suggests that stimulation of TPα and TPβ by TXA2 leads to phosphorylation of ERK (ERK-P), and involves transactivation of EGFR in a Src-kinase-dependent manner in TPα or TPβ-transfected cells [127].

TP receptor mediated Transactivation of EGFR through the shedding of EGFR Ligands:

The work of Galet et al. has shown the existence of an additional mechanism by which TXA2 stimulation of TPα and TPβ in human aortic smooth muscle cells (hASMC) cells leads to EGFR transactivation resulting in phosphorylation of ERK1/2 in a ligand dependent manner. Transactivation of EGFR is dependent on the cleavage of pro-

Heparin-binding EGF-like growth factor (HB-EGF) by matrix metallo proteinase (MMPs) in response to TP receptor stimulation thereby allowing the binding of HB-EGF to its receptor [126]. A broad spectrum inhibitor of MMPs, i.e. BB2516 decreased ERK and

EGFR phosphorylation in TPα or TPβ-transfected cells indicating the important role of

MMPs in TP-mediated EGFR transactivation (Figure-1.7) [126]. They also demonstrated

23 that both TP isoforms activated ERK phosphorylation in an Src-kinase-dependent manner in HEK293 cells. This confirms the existence of both ligand-dependent and ligand-independent mechanisms of EGFR transactivation [126].

Figure 1.7: Crosstalk between Thromboxane and EGFR signaling by shedding of EGFR ligands by MMPs. A proposed model by Galet et al., suggests that stimulation of TPα and TPβ by TXA2 results transactivation of EGFR that is dependent on the cleavage of pro-HB-EGF by extracellular MMPs thereby freeing HB-EGF to bind to its receptor [126].

In another study by Uchiyama et al. TP-mediated EGFR transactivation is partially caused by shedding of EGFR ligands such as HB-EGF, which involves furin and ADAM via novel types of PKCs (PKC-δ and PKC-ε) through Gαq/11 proteins in an extracellular

Ca2+-dependent manner [130]. Activation of TP activated the EGFR pathway by Src- dependent phosphorylation, and also activates EGFR by causing shedding of EGFR ligands. These studies strengthen further the idea that TP receptor mediates EGFR signaling.

EGFR Family of Receptor tyrosine Kinases:

The EGFR family of RTKs consists of four members: EGFR/ErbB1, HER2/ErbB2,

HER3/ErbB3 and HER4/ErbB4 [131-138]. All EGFR family members share a similar structure that consists of three regions: an extracellular ligand-binding domain, a single trans membrane segment, and a large intracellular domain with protein kinase activity

(Figure-1.8) [139-144]. Upon activation by a number of EGF-like growth factor ligands,

ErbB receptors form homo or heterodimeric complexes that, which leads to the autophosphorylation of cytoplasmic tyrosine residues in the kinase domain. This leads to activation of down-stream signaling cascades, such as the Ras activated MAPK pathway, and the phosphoinositide 3-kinase (PI3-K)/Akt pathway (Figure-1.8) [139-145].

ErbB receptors regulate multiple cellular responses, including cell proliferation, survival, migration, and differentiation [146]. EGFR and ErbB4 can homodimerize when bound to ligands, or heterodimerize with any of the other ErbB receptors, with ErbB2 being the preferred heterodimeric partner [147]. ErbB2 and ErbB3 each require heterodimerization in order to transduce signals, because ErbB3 does not have an intrinsic kinase, while ErbB2 is not bound by any known ligand (Figure-1.8) [147]. Hence

ErbB2 constitutively exists in the active conformation state. Therefore, it is always available for dimerization with other EGFR family members [147]. ErbB signaling is important for normal biological function, but unregulated signaling by EGFR and ErbB2 has been shown to contribute to cancer progression [139-144]. Members of the EGFR family have frequently been implicated in various forms of human cancers and serve both as prognostic markers and as therapeutic targets [139-144].

Figure 1.8: Members of Epidermal Growth Factor Receptor (EGFR) Family: The ErbB receptor family consists of four closely related type 1 transmembrane tyrosine kinase receptors, EGFR, ErbB2, ErbB3, and ErbB4. EGFR and ErbB4 have active tyrosine kinase domains and known ligands. ErbB3 can utilize several neuregulins as ligands, but lacks tyrosine kinase activity. By contrast, ErbB2 possesses an active tyrosine kinase domain, but no ligand has been identified [148].

Epidermal Growth Factor Receptor:

ErbB1 was the first RTK to be sequenced by Ullrich et al. [22]. EGFR is a

170 kDa transmembrane glycoprotein that is present on all epithelial and stromal cells as well as on select glial and smooth muscle cells, though not on hematopoietic cells

[131, 141, 143]. EGFR can be activated by binding to growth factors of the EGF-family that are produced by the same cells that express EGFR (autocrine secretion) or by surrounding cells (paracrine secretion) [139, 143]. Upon binding of an extracellular

26 ligand, the receptor transforms the inactive monomers into homodimers that activate its intracellular tyrosine kinase domain and autophosphorylate its C-terminal tyrosine residues. This stabilizes the active receptor conformation and creates phosphotyrosine- docking sites for proteins that transduce signals within the cell leading to activation of several downstream signaling pathways (Figure-1.9)[131, 141, 143].

The EGFR homodimer possesses multiple sites of tyrosine phosphorylation and couples to multiple downstream signaling effectors (Figure-1.9) [137, 140]. EGFR is most often upregulated in a wide variety of human tumors such as bladder, breast, head and neck, kidney, non-small cell lung, and prostate cancer, and is associated with advanced disease and poor clinical prognosis [141, 146, 149, 150]. Studies of various tumors have revealed that many express either EGFR or one of its common ligands, such as the epidermal growth factor (EGF), Amphiregulin (AREG) and transforming growth factor-α (TGFα). Some tumor cells express both the receptor and one of the ligands [142, 144, 150]. Activation of EGFR by its ligands either in an autocrine or paracrine manner has been shown to play an important role in prostate cancer progression from localized PCa to metastatic disease [141, 146, 149, 150].

Figure 1.9: EGFR tyrosine phosphorylation sites. A schematic representation of the

EGFR homodimer binding to its ligand is shown. Sites of cytoplasmic tyrosine (Y) phosphorylation are indicated, as are cytosolic effector proteins that bind to these phosphorylated tyrosine residues, and some of the effector signaling pathways [137,

140].

EGFR Ligands:

EGFR family members are activated by a large group of EGF-related growth factors. Major EGF family members includes EGF, Amphiregulin (AREG), Epiregulin

(EREG), Transforming Growth Factor-α (TGF-α), Heparin-binding EGF-like growth factor (HB-EGF), Betacellulin (BTC), Epigen and Neuregulins (NRG-1, NRG-2, NRG-3,

NRG-4) (Table-2) (Figure-1.8) [131, 132]. Common to all these growth factors is the

4 N. Normanno et al. / Gene 366 (2006) 2–16

cytoplasmic tyrosine kinase-containing domain (Olayioye et al., (PTB) domains, the recruitment of which leads to activation of 2000). The intracellular tyrosine kinase domain of ErbB intracellular signaling pathways. Studies on the crystal receptors is highly conserved although the kinase domain of structures of EGFR, ErbB-2 and ErbB-3’s extracellular domains ErbB-3 contains substitutions of critical amino acids and have led to new insights in the process of ligand-induced therefore lacks kinase activity (Guy et al., 1994). In contrast, receptor dimerization (Cho and Leahy, 2002; Cho et al., 2003; the extracellular domains are less conserved among the four Garrett et al., 2003; Garrett et al., 2002; Ogiso et al., 2002). The receptors, suggesting that they have different specificity in extracellular domain of each ErbB receptor consists of four ligand binding (Olayioye et al., 2000; Yarden, 2001; Yarden and subdomains (I–IV). Subdomains I and III (also called L1 and Sliwkowski, 2001). ErbB receptors are activated by binding to L2) have a beta helical fold and are important for ligand growth factors of the EGF-family that are produced by the same binding. Moreover, direct receptor–receptor interaction is cells that express ErbB receptors (autocrine secretion) or by promoted by a beta hairpin (also termed dimerization loop) in surrounding cells (paracrine secretion) (Fig. 1)(Olayioye et al., subdomain II. In the crystal structure of the extracellular domain 2000; Yarden and Sliwkowski, 2001). Proteins that belong to of EGFR bound to EGF, the dimerization loop protrudes from this family are characterized by the presence of an EGF-like EGFR and mediates interaction with another EGFR molecule domain composed of three disulfide-bonded intramolecular leading to the formation of a dimer composed of two 1:1 groups, which confers binding specificity, and additional receptor/ligand complexes (Garrett et al., 2002; Ogiso et al., structural motif such as immunoglobulin-like domains, hepa- 2002). In contrast, the structure of inactive EGFR or ErbB-3 is rin-binding sites and glycosylation sites. With respect to ErbB- characterized by intramolecular interactions between domains II receptor binding, EGF-related growth28 factors can be divided and IV (Cho and Leahy, 2002; Ferguson et al., 2003). The into three groups (Table 1)(Normanno et al., 2003a; Yarden and structure of ErbB-2 extracellular region differs significantly EGF domainSliwkowski, with six 2001 conserved). The first cysteine group includes residues EGF, characteristically transforming spacedfrom that to of form EGFR and ErbB-3. In the absence of a ligand, growth factor α (TGF-α) and amphiregulin (AR) which bind ErbB-2 has a conformation that resembles the ligand-activated three intramolecularspecifically to disu the EGFR.lphide The bridges second [141 group, 142 includes, 144, betacellu-150]. In general,state with EGF a-like protruding dimerization loop (Cho et al., 2003; lin (BTC), heparin-binding growth factor (HB-EGF) and Garrett et al., 2003). In this conformation, domains L1 and L2 ligands epiregulinare synthesize (EPR),d which as glycosylated show dual specificity transmembrane by binding precursors,are very which close are and this interaction makes ligand binding both EGFR and ErbB-4. The third group is composed of the impossible, explaining why ErbB-2 has no ligand (Garrett et al., proteolyticallyneuregulins cleaved (NRGs) from andthe cancell besurface divided by in MMPs two subgroups to yield basedthe mature2003 growth). Furthermore, factor these findings explain why ErbB-2 has upon their capacity to bind ErbB-3 and ErbB-4 (NRG-1 and enhanced capacity of heterodimerization and why it is the [141, 142NRG-2), 144, 150 or] only. ErbB-4 (NRG-3 and NRG-4) (Carraway et al., preferred dimerization partner for the other activated ErbB 1997; Chang et al., 1997; Harari et al., 1999; Zhang et al., receptors (Graus-Porta et al., 1997; Tzahar et al., 1996). Among With1997 respect). None to of ErbB the EGFreceptor family binding, of peptides EGF- bindsrelated ErbB-2. growth factorsall can possible be divided ErbB-2-contaning heterodimeric receptor complexes, the most potent signaling module in terms of cell into three2.2. groups Receptor (Table activation-2) [141]. The first group includes EGF, TGFproliferation-α and AREG and, in vitro transformation is represented by ErbB- 2/ErbB-3 heterodimers (Citri et al., 2003). The remarkable which bind Bindingspecifically of to ligands the EGFR to the [141 extracellular, 142, 144 domain, 150] (Table of ErbB-2). Thesignaling second potencygroup of ErbB-2/ErbB-3 heterodimers derives from receptors induces the formation of receptor homo- or hetero- the fact that this dimer has the capacity to signal very potently includes dimers,BTC, HB and-EGF subsequent, and EREG activation, which show of the dual intrinsic specificit tyrosiney by bindingboth both through EGFR the ras/raf/mitogen-activated protein kinase kinase domain (Fig. 1)(Olayioye et al., 2000). All possible (MAPK) pathway for proliferation and through the phosphati- and ErbBhomo-and4 [141, 142 heterodimeric, 144, 150] receptor(Table-2) complexes (Figure-1.8) between. The members third group dylinositolis composed 3-kinase of (PI3K)/Akt pathway for survival (Ben- of the ErbB family have been identified in different systems Levy et al., 1994; Citri et al., 2003; Prigent and Gullick, 1994). the Neuregulins (NRGs) and can be divided into two subgroups based upon their (Olayioye et al., 2000; Gullick, 2001; Schlessinger, 2000). In addition, ErbB-2/ErbB-3 heterodimers evade downregulation capacity Receptor to bind ErbB activation3 and Erb leadsB-4 to (NRG phosphorylation-1 and NRG-2) of, or specific only ErbBmechanisms4 (NRG-3 and leading to prolonged signaling (Lenferink et al., tyrosine residues within the cytoplasmic tail (Fig. 1). These 1998; Sorkin and Waters, 1993; Worthylake et al., 1999). NRG-4). phosphorylatedNone of the EGF residues family serveof peptides as docking binds ErbB sites- for2 [138 proteins, 141, 151-153] (Table-2) containing Src homology 2 (SH2) and phosphotyrosine binding 2.3. ErbB mediated signaling (Figure-1.8). Signal transduction pathways are initiated when activated Table 1 ErbB tyrosine kinase receptors recruit signaling proteins, such The ErbB receptors and their cognate ligands as Shc, Grb7, Grb2, Crk, Nck, the phospholipase Cγ (PLCγ), ErbB Receptors EGFR ErbB-2 ErbB-3 ErbB-4 the intracellular kinases Src and PI3K, the protein tyrosine Cognate ligands EGF None NRG 1 NRG 1 phosphatases SHP1 and SHP2 and the Cbl E3 ubiquitin ligase TGF-α NRG 2 NRG 2 (Fig. 1)(Marmor and Yarden, 2004; Yaffe, 2002). All ErbB AR NRG 3 EP NRG 4 ligands and receptors induce activation of the ras/raf/MEK/ BTC Tomoregulin MAPK pathway through either Grb2 or Shc adaptor proteins HB-EGF HB-EGF (Carpenter, 2003; Citri et al., 2003; Jorissen et al., 2003). ErbB BTC receptors also activate PI3K by recruitment of the p85 EP regulatory subunit to the activated receptors (Soltoff and

Table.2: EGFR family of receptors and their ligands [154].

Amphiregulin- an EGFR Ligand:

Amphiregulin (AREG) is a glycoprotein that is originally synthesized as a transmembrane precursor that undergoes ectodomain cleavage and is released as a secreted protein [155, 156]. EGFR is believed to be the sole cell surface receptor for

AREG in epithelial cells, as AREG has not been shown to interact directly with other members of the EGFR family such as ErbB2, ErbB3 and ErbB4 [157]. AREG binds

EGFR with a lower affinity than EGF, and induces receptor autophosphorylation and downstream activation of the ERK signaling cascade [156, 158]. AREG mRNA is expressed in many normal tissues including the placenta and ovary, where it is abundant, as well as in the skin, testis, pancreas, spleen, kidney, lung, breast, and gastrointestinal tract [159].

Several studies identified an active cAMP-Responsive Element (CRE) in the

AREG promoter [160, 161]. Other conserved response elements have been identified in the human AREG promoter such as the Serum Responsive Element (SRE), the highly conserved Specificity Protein-1 element (SP1), the WT-1 responsive element (WRE) and the TATA box that all may have roles in regulation of AREG expression [156, 159,

162-166]. AREG can also be regulated by the EGFR itself, where activation of EGFR leads to AREG expression in several cell types [155] [163, 165, 167]. For instance, stimulation of EGFR in prostate stromal cells with mitogenic levels of EGF and HB-EGF increased AREG mRNA expression more than 15-fold [166]. However, the specific pathway leading from EGFR activation to AREG transcription has not been elucidated prior to our study. Similar to EGFR, AREG also has been associated with several types of human cancer [155, 158, 168, 169].

Role of EGFR and their ligands in Prostate Cancer:

EGF family members and their membrane receptor, the EGFR are involved in the pathogenesis of different tumors, including prostate cancer [170, 171]. Overexpression of EGF family members and their receptors results in the progression of normal prostate epithelial cells to a hyper proliferative cancer cell which is a key step in the multi-step process of development of prostate cancer [171, 172]. Changes in gene expression of growth factors and the corresponding changes in their receptor signaling pathways in epithelial and stromal cells, contributes to enhancing tumor cell growth, survival, migration and invasiveness [173, 174].

Studies have confirmed the important role played by the EGFR-driven autocrine pathway in prostate cell growth, as it has been shown that prostate cancer cells express the EGFR in vitro and in vivo, and that TGF or EGF are potent mitogens for prostate cancer cells [154, 171]. Activated EGFR signaling may induce the stimulation of distinct mitotic cascades, including those of the MAPK, PI3K/Akt, and Phospholipase-C (PC) signaling pathways These in turn participate in the stimulation of proliferation, survival, motility and invasion of PCa [174]. There are a number of mechanisms by which growth factors of the EGF family, such as EGF, AREG, and TGF-α could contribute through autocrine and paracrine mechanisms to prostate cancer cell growth and proliferation

[154, 158]. The enhanced expression of EGFR and its ligands, EGF, TGF-α, HB-EGF and AREG, has been reported to correlate with high grades of PCa malignancies [158,

174].

Role of Amphiregulin in Prostate Cancer:

AREG has been studied extensively for its role in breast cancer progression but there have been few studies about its possible involvement in prostate cancer until now

[155, 168, 169]. Previous studies showed increased expression of AREG in both androgen-dependent and independent PCa cell lines [157, 175].

One of the first hints of a possible role for AREG in PCa was in a study by Sehgal et al. where it was shown that expression of AREG message and peptide in both androgen-sensitive and androgen-independent prostate cancer cell-lines. Androgen- dependent PCa cells, such as LNCaP cells, do express amphiregulin mRNA and peptide and this expression is elevated by androgenic stimulation [157]. Furthermore,

TGF-α stimulation of EGFR induces AREG expression in LNCaP cells suggesting the mechanism of androgen-induced AREG expression is dependent on EGFR signaling.

Therefore androgenic effect of AREG synthesis may occur through androgen upregulation of the EGFR expression [157].

Another study by Torring et al. has shown a selective upregulation of some ligands belonging to the EGF family in androgen-independent prostate cancer cell lines.

Expression of mRNA for the ligands TGF-α, AREG, HB-EGF and EREG were increased

10 to 100 fold in androgen-independent cells and as compared to LNCaP and

PNT1A cells (Immortalized normal prostate epithelium) [175]. Similar results were obtained when examining the protein levels as confirmed by ELISA [175].

Bostwick et al. analyzed prostate tissue sections from 93 prostate cancer patients with pathologic stage T2N0M0 intermediate to high-grade (Gleason 6 and higher, by design) and found that AREG expression in prostate increases progressively

32 from benign epithelium to PIN and to prostate cancer. They were able to conclude that increased expression of AREG might contribute to the development of prostatic adenocarcinoma [158]. There have not been any studies looking further into the mechanisms that result in increased AREG expression in both androgen-dependent and independent cell lines. We have revealed herein a link between TP receptor signaling and AREG in prostate cancer.

Statement, Hypothesis and Specific aims:

Statement and Rationale:

Most of the work performed on TP receptor in prostate cancer thus far has not focused on which of the two TP isoforms is indeed responsible for TP’s role in prostate cancer. Previous studies have indicated different functional roles for both TP isoforms [46, 83]. In lung cancer, TPα is thought to promote angiogenesis [176],

Whereas TPβ expression promotes increased proliferation, migration, and invasion in bladder cancer cells. It is over-expressed in bladder cancer patients and associated with poorer prognosis in those patients [99]. Expression status of TP isoforms is largely uncharacterized in prostate cancer cells and tissues. One of the objectives of this study is to profile TP isoform expression in prostate cancer cells and tissues, and determine their functional contribution in prostate cancer.

As previous studies had shown that the TPα receptor isoform could promote angiogenesis by up regulating VEGF in the lung cancer cell line A549 overexpressing

TPα receptor [176], we initially focused on whether TP signaling could promote VEGF expression and subsequent angiogenesis in PCa cells.

Activation of endogenous TP in DU145 cells by TXA2 agonist led to an increase in VEGF expression as expected, and revealed for the first time, a novel link to the expression of amphiregulin (AREG) (1.5 Fold increase) in response to TP receptor stimulation. AREG is a specific ligand of EGFR that activates its downstream signaling pathways such as the MAP kinase pathways. We also looked at effect of TPα

34 stimulation on the predominant ligand for EGFR namely EGF, and found no effects

(Figure- 1.10).

Figure 1.10: TP receptor activation in DU145 cells increased expression of AREG, a ligand for EGFR. DU145 cells were serum starved and treated with IBOP 50nM (A) or ETOH (B) for 16 hrs. Before the conditioned medium was collected to measure the impact of TP receptor signaling on angiogenesis modulators. IBOP activation of TP receptor increased VEGF expression (2 fold) as well as expression of AREG (1.5 fold).

TP receptor activation can lead to transactivation of EGFR through phosphorylation in a both ligand dependent (HB-EGF) or ligand independent (Src kinase) manner thereby implicating TP receptor as a regulatory point in the signaling pathways that are stimulated by EGFR [127] [126]. Both TP and EGFR are highly expressed in PCa and this has been shown to play a role in its progression [46, 101,

174]. Previous studies also have found increased expression of AREG in prostate cells and tissues but the specific pathways leading to AREG expression have not yet been elucidated [157, 158, 175]. Increased expression of AREG in response to TP stimulation can lead to an alternate mechanism of EGFR activation in PCa cells. To the best of our knowledge, this is the first study to explore the direct link between TP signaling and

AREG expression in prostate cancer or any other cancer. As both TP receptor and

TXA2S enzyme are expressed in a wide range of cells and tissues including PCa tissues and endothelial cells [46, 94, 101], increased expression of AREG in response to TP receptor stimulation could lead to constitutive activation of EGFR signaling that could increase tumor growth and progression. These findings led us to hypothesize that the functional role of TP in PCa progression is mediated through activation of EGFR signaling brought about by overexpression of its ligand, AREG.

Hypothesis

TP Receptor signaling plays a role in prostate cancer by promoting AREG activation of

EGFR signaling.

Specific Aims:

n Characterization of thromboxane receptor isoforms in PCa cell lines (in vitro) and

human tissues (in vivo).

n Determine whether stimulation of TP lead to AREG and EGFR overexpression

and activation of downstream signaling pathways.

n Determine the functional implications of TP activation in PCa invasion, tumor

growth and angiogenesis in vivo

CHAPTER-2: MATERIALS AND METHODS

Materials and Reagents:

TXA2 agonist (I-BOP) and TXA2 antagonist (SQ29548, BM567) were purchased from Cayman Chemicals (Ann Arbor, MI). PKA inhibitor H89, MEKK inhibitor U0126,

EGFR inhibitor AG1478, Src Inhibitor PP2 were obtained from Calbiochem (San Diego,

CA). EGFR inhibitor Gefitinib was kindly provided by the laboratory of Dr. Mustapha

Kandouz (Department of Pathology, Wayne State University). AMPK inhibitor

Compound-C was purchased from Millipore (Billerica, MA). Other chemicals were obtained from Sigma–Aldrich (St. Louis, MO). RPMI-1640 culture medium and heat- inactivated fetal bovine serum (FBS) were purchased from Hyclone (Thermo Fisher,

Rockford, IL). Human PCa cells PC3, DU145 and RWPE1 cells were supplied and validated by the American Type Culture Collection (ATCC, Manassas, VA) and PC3M

Cells were obtained from Dr. Isaiah J. Fidler (University of Texas, MD Anderson Cancer

Center, Houston, TX). ECL Western blotting detection system was purchased from

Thermo Scientific (Rockford, IL) as were the horseradish peroxidase (HRP)-linked goat anti-mouse and -rabbit IgGs.

Cell Culture:

PC3, DU145, PC3M and LNCaP cells were grown in RPMI (Hyclone

Laboratories, Inc., Logan, UT) containing 10% FBS at 37°C in 5% CO2 incubators.

RWPE-1 cells were grown in Keratinocyte Serum-Free Medium (K-SFM) that contained two growth factors - 0.05 mg/ml BPE and 5 ng/ml EGF. Cell lines were frequently monitored for mycoplasma contamination by mycoplasma PCR detection kit (Sigma–

Aldrich, St. Louis, MO).

Generation of Stable Transfectants:

PC3 cells were transfected with plasmids encoding TPα (PC3-TPα), TPβ (PC3-

TPβ) or pcDNA 3.1 empty vectors (PC3-Neo) using the TransIT transfection reagent for prostate (Mirus Bio LLC, Madison, WI) as per the manufacturer’s instructions. After 48h, cells were grown for selection with G418 (400µg/ml) over two weeks. Clones expressing high levels of TPα were pooled for total protein isolation as were empty vector control cells (Neo). PC3-TPα and PC3-Neo cells were maintained in RPMI-1640 with 10% FBS in the presence of 0.2 mg/ml of G418 (Geneticin, Life Technologies, Grand Island, NY).

Real time PCR was done with TP receptor isoform specific Taqman probes (Life

Technologies, Grand Island, NY) to validate stable transfectants.

Antibodies:

Rabbit polyclonal antibodies to human TPα and TPβ were kindly provided by Dr.

Anthony Ashton (University of Sydney, Sydney, Australia). Rabbit polyclonal antibodies to Pan TP were purchased from Cayman Chemicals or GeneTex, Inc. (Irvine, CA).

Rabbit monoclonal antibody specific to EGFR, ErbB2, ErbB3, ErbB4, p-ERK, ERK, p-

SRC, SRC, p-AMPK, AMPK and CD31 were from Cell Signaling Technology, Inc.

(Danvers, MA). Antibody specific for beta-Actin was purchased from Millipore (Billerica,

MA). Horseradish peroxidase (HRP)-linked goat anti-mouse and rabbit IgG were supplied by Thermo Fisher (Rockford, IL).

Primer Design and RT-PCR:

The gene specific primers for human TPα and TPβ and GAPDH were ordered from Invitrogen. Thermo cycling PCR conditions: 95 °C for 2 min (Hot Start), (95°C for

30s, 60°C for 30s, 72°C for 45s) for 40 cycles. Corresponding PCR products were run on a 1.6% Agarose gel with Ethidium bromide and pictures of the gel were taken under

UV illumination using a Flour Chem Alpha-Imager Imaging system (Santa Clara, CA).

Table 3: List of Human specific primers used for RT-PCR For-Forward Rev-Reverse

Primer Sequence

TP-For [54] 5'- TGTTTCCGGCCCACAAACATTA -3'

TP-Rev [52] 5'- GATACCCAGGTAGCGCTCTGA -3'

TP-For 5'- CCTTCCTGCTGAACACGGTCA -3'

TP-Rev 5'- GATATACACCCAGGGGTCCAG -3'

TPα-For [177] 5'- TTCCTGCTGAACACGGTC -3'

TPα-Rev [177] 5' -CGGAGCGCTGCGTGAGCT-3'

TP-For [99] 5’-ACGGAGAAGGAGCTGCTCATCT-3’

TPα-Rev [99] 5’-CCAGCCCCTGAATCCTCA-3’

TPβ-Rev [99] 5’-CAAAAGGAAGCAACTGTACCCC-3’

GAPDH-For 5’-GAGTCAACGGATTTGGTCGT-3’

GAPDH-Rev 5’-TTGATTTTGGAGGGATCTCG-3’

B-Actin-For 5’-GGACTTCGAGCAAGAGATGG-3’

B-Actin-Rev 5’-AGCATGTGTTGGCGTACAG-3’

Real-time PCR Taqman Gene Expression Assay:

Total RNA was isolated from sub confluent cells (60-80% confluent) using

Nucleospin-2 kit (Macherey-Nagel, Inc., Bethlehem, PA) following the manufacturer’s protocol and reverse-transcribed into cDNA using the ABI High Capacity RT Kit (Life

Technologies, Grand Island, NY). For real time detection of target gene expression,

TaqMan® Gene Expression Assays (Life Technologies, Grand Island, NY) were used.

Taqman Gene expression assays for TPα and TPβ were performed with custom designed probes made with the help of ABI Primer Express software (Life Technologies,

Grand Island, NY). The GAPDH housekeeping gene internal control was a commercial assay (Life Technologies, Grand Island, NY). PCR was performed using Applied

Biosystems 7500 Fast Real-Time PCR System in a total reaction mixture of 20 μl containing 25 ng of cDNA, 1 x ABI TaqMan PCR Master Mix, and 1.25 μl of probe/primers mixture (TaqMan® Gene Expression Assays). After denaturation at 95 °C for 10 min, 40 cycles were performed at [95 °C for 10 s, 60 °C for 1 min] (universal cycling conditions as per the manufacturer). The values for ΔΔCT were determined and final relative expression analyses were performed using 2 –ΔΔCT (ΔΔCt = ΔCtsample –

ΔCtreference) as described previously [178].

SYBR Green Assay (AREG, EGF, EGFR, CD31, IL6, ErbB2, ErbB3, ErbB4):

Total RNA was isolated from sub confluent cells (70-80% confluent) (Nucleospin-

2, Macherey-Nagel, Inc., Bethlehem, PA) and reverse-transcribed into cDNA using the

ABI High Capacity RT Kit (Life Technologies, Grand Island, NY). Primers were designed then synthesized by Invitrogen (Life Technologies, Grand Island, NY) or purchased from

Real Time Primers (Elkins Park, PA). Real- time PCR was performed in 10 ul reactions using 96-well plates, 10-25 ng cDNA, and the 2X SYBR Green PCR Master Mix (Life

Technologies, Grand Island, NY). Reactions were performed in triplicate using the

Applied Biosystems ABI 7500 real-time PCR machine (Life Technologies, Grand Island,

NY).

Table 4: List of primers used for Real-time PCR SYBR Green assay For-Forward Rev-Reverse

Primer Sequence

AREG-For [167] 5’-GTGGTGCTGTCGCTCTTGATA-3’

AREG-Rev [167] 5’-ACTCACAGGGGAAATCTCACT-3’

EGFR-For 5’-CTCAGCCACCCATATGTACC-3’

EGFR-Rev 5’-CGTCCATGTCTTCTTCATCC-3’

GAPDH-For 5’-GAGTCAACGGATTTGGTCGT-3’

GAPDH-Rev 5’-TTGATTTTGGAGGGATCTCG-3’

B-Actin-For 5’-GGACTTCGAGCAAGAGATGG-3’

B-Actin-Rev 5’-AGCATGTGTTGGCGTACAG-3’

VEGFA-For 5’-AGACACACCCACCCACATAC -3’

VEGFA-Rev 5’-TGCCAGAGCCTCTCATCTCC-3’

EGF-For [167] 5’-CGCAGGAAATGGGAATTCTA-3’

EGF-Rev [167] 5’-TCCACCACCAATTGCTCATA -3’

IL6 For 5’-AGCGCCTTCGGTCCAGTTGC-3’

IL6 Rev 5’-GTGGCTGTCTGTGTGGGGCG-3’

IL8 For 5’-TAGCAAAATTGAGGCCAAGG-3’

IL8 Rev 5’-AGCAGACTAGGGTTGCCAGA-3’

CD31 For 5’-ATTGCAGTGGTTATCATCGGAGTG-3’

CD31 Rev 5’-CTCGTTGTTGGAGTTCAGAAGTGG-3’

EREG-For [167] 5’- CTGCCTGGGTTTCCATCTTCT3 -3’

EREG-Rev [167] 5’- GCCATTCATGTCAGAGCTACACT -3’

ErbB2-For 5’-'CAGGCACCGCAGCTCATCTA -3’

ErbB2-Rev 5’-TCCCAGGTCACCATCAAATACATC -3’

ErbB3-For 5’-CCCAGCATCTGAGCAAGGGTA-3’

ErbB3-Rev 5’-TTTAGGCGGGCATAATGGACA-3’

ErbB4-For 5’-TTTAGGCGGGCATAATGGACA-3’

ErbB4-Rev 5’-CCAGGTAGACATACCCAATCCAGTG-3’

SDS-PAGE and Western Blotting

Cells were extracted in cell lysis buffer, and proteins were loaded on 10% SDS-

PAGE gels and transferred onto nitro-cellulose membranes. Blots were then probed with indicated antibodies and developed by enhanced chemi-luminescence (Pierce,

Thermo Fisher, Rockford, IL) according to the manufacturer’s instructions.

Tissue cDNA Arrays:

Commercial cDNA arrays containing representative sets of normal and cancerous human tissue cDNAs (TissueScan™) were purchased from Origene

Technologies, Inc. (Rockville, MD) and used as per manufacturer’s instructions.

Cell Treatments:

For treatments, cells were plated in complete growth medium in 100 mm cell culture dishes until they are 50-70% confluent. After 24-48 hrs, spent medium was aspirated and replaced in serum-free medium for serum starvation overnight. Inhibitors were dissolved either in DMSO or ethanol, diluted in serum free medium, and added to the cells at appropriate concentrations for a given amount of time. Once the cells were pre-treated at appropriate concentrations with the inhibitors (EGFR inhibitors- AG1478,

gefitinib, AMPK inhibitor- Compound-C, PKA inhibitor-H89), TXA2 agonist I-BOP (50 nM) was dissolved in ethanol and added to the cells in serum-free medium for the indicated times.

Measurement of cAMP:

Following treatment with I-BOP or antagonist, media samples from cultured cells were collected and stored at -80o C for 1-2 weeks before its assayed. The cAMP enzyme immunoassay (EIA) kit was purchased from Cayman Chemical (Ann Arbor, MI) and used according to the manufacturer’s instructions.

Antibody Array:

The relative levels of expression of 55 angiogenesis-related proteins were simultaneously detected using the commercial angiogenesis array (Catalog No:

ARY007) (R&D Systems, Minneapolis, MN). DU145 cells and PC3 transfectants were cultured in 100 mm dishes, serum-starved overnight, and subsequently treated with either IBOP (50nm) or ETOH (Vehicle) for 18hr as described. Conditioned culture medium was then screened by antibody array for angiogenesis related proteins as per manufacturer’s instructions.

Modified Boyden Chamber Cell Invasion Assay

Cell invasion assays were done in modified Boyden chambers fitted with 8-µm transwell filters as described [179]. PC3 parental or transfected cells were seeded in the top of transwells of the 24 well plates at a density of (2x105 cells) / (0.5 ml of 1% BSA in

RPMI medium with ETOH, IBOP or SQ29548). Fetal bovine serum at 1% was used as a

43 chemo attractant in the bottom chambers. After 18 h, residual, non-migrating cells on the upper side of the membranes were removed using Kim-wipes, and the membranes were fixed and stained according to manufacturer’s instructions for the Diff Quick staining kit (IMEB, Inc., San Marcos, CA). Five fields of 100 cells, from random areas were counted.

Animal Model and in vivo Studies:

All animal procedures were performed in accordance with the NIH and institutional guidelines established for the Department of Laboratory Animal Research

(DLAR) at Wayne State University. Male aythymic NCr nude mice were purchased from

Taconic Farms, Inc. (Germantown, NY). A total of 2 X 106 PC3-TPα cells or PC3-Neo control cells in 200 µl of HBSS were injected sub cutaneous (s.c.) into the right flank of

4-6-week-old male NCr nude mice (Six mice per group). Tumor measurements were made using a vernier caliper, and tumor volume was calculated using the formula:

Volume = (width)2 x length/2 [180].

Mice were sacrificed six to seven weeks after injection, and tumors were resected for further analysis [181]. Resected tumors were weighed and split into 10% formalin for immunohistochemistry and in Ambion’s RNAlater reagent (Life

Technologies, Grand Island, NY) (frozen at -80oC) for subsequent RNA isolation.

Immunohistochemistry

Serial sections from formalin-fixed, paraffin-embedded (FFPE) tissues were processed for immunohistochemistry analysis of CD31 and ki67 through core services provided by University Pathology Research Services (Wayne State University and

Barbara Ann Karmanos Cancer Institute, Detroit, MI)

Matrigel Implantation Assay for Tumor Cell-induced Angiogenesis.

The Matrigel implantation assay was performed as described by Ito et al. [182] with the following modifications. Male SCID mice were purchased from Taconic Farms

(New York, NY). A total of 2 X 106 PC3-TPα cells or PC3-Neo control cells in 100 µl of

HBSS were mixed with 300 µl of Matrigel BME (Trevigen, Gaithersburg, MD) and injected s.c. into the right flank of 4-6-week-old male SCID mice (six mice per group).

Mice were sacrificed 12 days after injection and dissected to expose the implants for recording [183].

Measurement of AREG in Culture Media:

Cells were cultured in 6-well plates for measuring secreted AREG and other angiogenic cytokines. Cells were plated at a density of 2 x 105 cells per well of a 6-well plate. After 24 h, cells were serum starved overnight and then treated with TP agonists, antagonists and chemical inhibitors. Following treatment, spent medium was collected and the levels of AREG were determined using ELISA immunoassay kits from Ray

Biotech (Norcross, GA), based on manufacturer’s instructions.

Statistical Analysis:

Student's t test (two tailed) was used to analyze the difference between two groups. Differential P values <0.05 were considered significant.

CHAPTER-3: TPα-MEDIATED OVER EXPRESSION OF AMPHIREGULIN IS

MEDIATED BY AMP-ACTIVATED PROTEIN KINASE (AMPK)

Prostate cancer cells express TPα receptor:

Though the existence of two TP isoforms was known as early as 1994, most of the earlier studies on TP did not distinguish the functional roles between the two isoforms in cardiovascular disorders and cancer progression [46, 53, 58, 66]. However recent findings suggest a novel role for TPβ in cancer progression especially in bladder cancer [99]. TPα might play a role in tumor growth by promoting angiogenesis in lung cancer [176], whereas TPβ expression promotes increased rate of proliferation, migration, and invasion in bladder cancer cells and over-expressed in bladder cancer patients and associated with poorer prognosis in those patients [99, 184]. In our earlier studies, where we have shown TP receptor plays a role in cell motility by activating

Rho-A in prostate cancer was documented using antibodies/probes that bind the N- terminal domain that is common to both TP receptor isoforms. Expression status of TP receptor isoforms and downstream signaling in response to TXA2 binding is largely uncharacterized in prostate cancer cells and tissues. In this study, we first want to determine which TP isoform is expressed in prostate cancer cell lines and tissues.

To evaluate the potential role of TP receptors in prostate cancer, prostate epithelial cells and PCa cells were screened so as to identify which receptor isoforms are present and to determine their expression levels. RT-PCR (Figure 3.1) and immunoblots (Figure 3.2) on whole cell extracts of the prostate cancer cell lines PC3,

DU145, PC3M and LNCaP, revealed that these PCa cells only express the TPα

46 receptor isoform and not the TPβ receptor isoform. Real-time PCR data also indicated that DU145 had the highest level of TPα expression (10-11 fold) followed by PC3 (3-4 fold) and PC3M (3 fold) compared to RWPE1 or PREC cells (Figure 3.3). TPα expression in LNCaP cells was similar to RWPE1 cells. These data reveal that TPα expression is higher in PCa cells compared to prostate epithelial cells, and that of the cell lines tested, DU145 had the highest expression levels of this isoform.

Expression profile of TPα (mRNA) receptor in PCa cell-lines with TP isoform specific Primer sets (RT-PCR)

A: TP isoform specific Primer set-1

B: TP isoform specific Primer set-2

Figure 3.1: Screen for expression of TPα receptor in prostate cancer cell lines by RT-PCR. Expression of TPR was verified in several PCa cell lines such as PC3, DU145, PC3M and LNCaP cells and prostate epithelial cells (RWPE1) using RT-PCR. cDNA from PCa cell lines was analyzed with two sets of isoform specific primers designed to detect: TPα, or TPβ (A, B). PCR products were validated as TPα by sequencing. Non-RT samples (samples in which no reverse transcriptase was added) were used as Negative controls. Recombinant TPα and TPβ plasmids were used as positive controls (PC) for TP expression as indicated. Shown here is a representative result from three independent experiments.

A: Expression profile of TPα (protein) receptor in PCa cell-lines (Immunoblot)

B: Expression profile of TPβ (protein) receptor in PCa cell-lines (Immunoblot)

Figure 3.2: Screen for expression of TPα in prostate cancer cell lines by immunoblot. Expression of TPR was verified in several PCa cell lines: PC3, DU145, PC3M and LNCaP cells using Western blot. Total cell lysates prepared from these cell lines were probed with isoform specific TP antibodies that can detect TPα (A) and TPβ (B). Recombinant TPα protein expressed in SF-9 cells using baculovirus system was used as the positive control for TPα, [185] and HUVEC cell lysates served as the positive control for TPβ. β-Actin served as a loading control. The asterisks in A and B indicate non-specific bands. Shown here is a representative result from three independent experiments.

Figure 3.3: TPα expression was high in PCa cells compared to prostate epithelial cells. Real-time PCR was done to compare the expression of TPα mRNA levels between PCa cell lines (PC3, DU145, PC3M and LNCaP) and normal prostate epithelial cells (RWPE1, PREC). Expression of TPα was higher among the PCa cells when compared with prostate epithelial cells (RWPE1, PREC). Among the PCa cell lines, DU145 cells expressed the highest levels of endogenous TPα mRNA expression. Values expressed represent the mean fold change ± SEM, compared to PREC cells and is derived from three experiments normalized in each case to GAPDH gene expression. Similar results were observed in a further two independent experiments.

Functional status of TPα receptor expressed in PCa cells:

The multiplicity of effects by TXA2 stems from its receptor isoforms TPα and TPβ coupling to several and distinct G-protein subunits leading to differences in function between the two isoforms. TPα receptor isoform binds to Gs subunit thereby stimulating adenylate cyclase, resulting in increased levels of the second messenger cAMP, whereas TPβ receptor isoform binds to Gi subunit and inhibits adenylate cyclase, thereby reducing cAMP levels [66]. Therefore, the differential response by two TP

49 isoforms in terms of second messenger cAMP accumulation can be used as a tool to confirm the expression and functional status of TPα expression in PCa cells. Our data demonstrates that cAMP levels are higher in DU145 cells compared to PC3, PC3M and

LNCaP cells which aligns with our earlier PCR and Immunoblotting results (Figure 3.4).

Although PC3 and PC3M cells exhibit expression of TPα protein and mRNA, the level of cAMP accumulation in response to IBOP was lower in these cells compared to DU145 cells.

Figure 3.4: Endogenous TPα expression in PCa cells can elicit a functional response in terms of second messenger. To verify whether TPα expression was enough to elicit a functional response, PC3, DU145, PC3M and LNCaP cells were treated with vehicle (ETOH) and agonist (IBOP) alone or pretreated with antagonist (SQ29548) before addition of agonist for 20min, and the effect on cAMP synthesis was measuredby cAMP specific Enzyme ImmunoAssay (EIA). Results were DU145 had higher cAMP levels in response to IBOP when compared with other PCa cells. The results shown are mean ± standard deviation of triplicate wells, *p <0.05, **p <0.01; Student’s t test. This experiment was repeated at least three times with similar results.

Data-mining analysis confirms increased expression of TPR in Human PCa tissues

TPα plays a critical role in tumor growth, angiogenesis, invasion and inflammation

[46, 176, 186, 187]. Moreover, expression of TXA2S, a rate-limiting enzyme for TXA2 biosynthesis, is significantly up regulated in prostate cancer tissues and correlates positively with aggressiveness of the disease based on Gleason score [94]. In a study by Dassasse et al., significant association between the expression levels of COX-2,

TXA2S, and TP and higher Gleason score/pathologic stage of the tumors was observed

[97]. Increased TP expression in PCa tissues documented in this study was done using antibodies that bind to the common domain of TP, hence did not provide sufficient information about which of the two TP isoforms is predominantly expressed [46].

To further examine the expression of TP isoform in prostate tumor tissues, we have performed data mining analysis for TP expression in the cBio Cancer Genomics

Portal from Memorial Sloan-Kettering Cancer Center (MSKCC) that has published the most comprehensive genomic prostate cancer database available to date [188, 189].

Several important observations resulted from these analyses, namely that TP receptor expression appeared to be upregulated in 19% of prostate cancer patients studied

(n=85) (Figure 3.5), and was higher in PCa tissues compared to normal patient samples

(Figure 3.5). If the Z-score threshold is lowered to 1.5, then TP expression appeared to be up regulated in 31% (n=26) of prostate cancer patients studied. However, the

MSKCC studies also do not discriminate between the TPα and TPβ isoforms as the probes designed were for the common domain of TP [188].

Figure 3.5: Database search using Memorial Sloan-Kettering Cancer Center genomics database indicates that TPR expression is amplified in prostate carcinoma. TP expression is upregulated in 19% (14 samples) of total PCa samples (n=85) tested by microarray analysis with a Z-Score threshold of 2 that is statistically significant. Microarray analysis for TP receptor was done with probes that were designed for the common domain of TP and hence do not discriminate between the TPα and TPβ isoforms (n=85) [188]

TPα expression correlates positively with aggressiveness of prostate tumors.

All the work done so far showing increased expression of TP in PCa does not discriminate between the two TP isoforms. We have shown that the PCa cell lines do only express the TPα isoform and not the TPβ isoform. Since we know that TP is overexpressed in PCa tissues based on our database analysis, we hypothesized that it might be the TPα that is up regulated. Human PCa tissue was profiled for TPα utilizing commercial cDNA expression arrays that included representative samples of both

52 normal and prostate cancer tissues. Tissue cDNAs of each array were synthesized from high quality total RNAs from pathologist-verified tissues, normalized and validated with

ß-actin in two sequential qPCR analyses. The manufacturer provided these with clinical information and QC data. As there were no isoform-specific Taqman probes available for TPα and TPβ through ABI, the arrays were screened with custom probes that were designed using ABI Sequence detection software. Utilizing the accompanying clinical information TPα expression levels were associated with grades of different tissue samples based on Gleason scores [8] (Figure 3.6).

The TPα isoform was elevated in higher grade, more aggressive prostate cancer seen in patients with a Gleason score greater than 7 (n = 9) versus Gleason 7 (n = 21) or Gleason 6 and below (n = 11) and matched normal tissues (n=8) (Figure 3.6). Based on the difference in primary and secondary patterns, the sum Gleason score 7 can be depicted as GS (4+3) or GS (3+4), where the primary grade must be >50% of the total cancer observed, and the secondary grade must be <50% but at least 5% of the observed cancer [9]. Therefore, even within the same Gleason score differences in gene expression are known to exist [9]. A significant finding from these data was that

TPα expression was elevated in GS7 (4+3) (n=7) compared to GS7 (3+4) (n=17), which suggests that differences in TPα expression between primary and secondary patterns

(Figure 3.6) can potentially be exploited as a biomarker for discriminating GS7 subtypes when making prognostic determinations. It also implicates TPα as a therapeutic target.

Collectively, the data-mining results and the data from qPCR analysis of human tissue arrays make a strong case for the association of TPα expression with the aggressiveness and progression of prostate tumors.

Figure 3.6: TPα expression levels correlate with grades of different cancer tissues that are classified based on its Gleason scores. Real-time PCR for TPα was done on Human Prostate Cancer tissue cDNA arrays using custom designed TPα specific taqman assay probes. The TPα isoform was elevated significantly in higher grade, more aggressive prostate cancer seen in patients with a Gleason score greater than 7 (n=9). TPα expression is elevated significantly in GS7 (4+3) (n=7) compared to GS7 (3+4) (n=17), suggesting stratification of TPα expression between primary and secondary patterns. Values expressed represent the mean fold change ± SEM, compared to Normal prostate tissues and is derived from two experiments normalized in each case to β-Actin gene expression.

Overexpression of TPα receptor in PC3 cells:

To further understand whether TPα signaling mediates increased expression of

AREG, that might be responsible for its functional role in PCa, we used two different

Cell line models: 1. Wild-type DU145 cells (High endogenous TPα expression, Low

TXA2S expression) 2. PC3 cells overexpressing TPα. PC3 cells do express thromboxane synthase (TXA2S) and are a widely used model for in vivo studies. While

PC3 cells appeared to express endogenous TPα, the level of expression was insufficient to elicit functional responses of TPα signaling such as cAMP activation and phosphorylation of ERK compared to DU145 cells. In order to increase the expression of TPα in PC3 cells to elicit better functional responses, we stably transfected TPα plasmid in PC3 cells to examine the effect of TPα overexpression.

Stable trasfectants were generated and confirmed by Real-time PCR with TPα- specific taqman assay probes (Figure 3.7A), and by Western blotting (Figure 3.7B). TPα transfected PC3 cells became responsive to 50 nM I-BOP induction of cAMP synthesis

(Figure 3.7C). Whereas, minimal activation of cAMP was measured in control PC3-Neo cells (Figure 3.7C). These data demonstrated that the IBOP-responsive phenotype of

DU145 cells could be recapitulated in PC3 cells expressing ectopic TPα.

3.7 B: Over-expression of TPα receptor (protein) in PC3 cells (Immunoblot)

Figure 3.7: Over expression of TPα receptor in PC3 cells. PC3 cells were transfected with TPα or TPβ expression plasmids, or empty vector (pcDNA 3.1) transfectants referred to as PC3- TPα, PC3-TPβ and PC3-Neo were tested for over expression using: real-time PCR with Taqman gene expression probes specific for TPα (A); Values expressed represent the mean fold change ± SEM, compared to vector control and is derived from three experiments

56 normalized in each case to GAPDH gene expression. Similar results were observed in a further two independent experiments. Western blotting was done with antibodies specific for TPα and platelets cell lysates were used as positive control for TPα (B). The asterisks in B indicate non- specific bands (B) Immunoblotting for each protein was performed at least three times using independently prepared lysates, and representative data from one such experiment are shown. The functional status of TPα receptor was verified by measuring cAMP accumulation by cAMP Enzyme Immunoassay (EIA)(C) The results shown are mean ± standard deviation of triplicate wells, **p <0.01; Student’s t test. This experiment was repeated at least three times with similar results.

Activation of TPα signaling promotes overexpression of AREG in PC3 cells over expressing TPα:

Subsequently, PC3 prostate cancer cells expressing various levels of TPα were employed to examine the role of TPα in prostate cancer progression. We treated PC3-

Neo cells, PC3-TPα transfectants with either ETOH (Vehicle) or TXA2 agonist IBOP for

16hrs and conditioned medium was collected for further analysis. Supernatants were screened for growth factors such as AREG in response to TXA2 signaling using a commercial antibody array (R&D Systems, Minneapolis, MN). In comparison to PC3-

Neo cells, PC3-TPα transfectants responded to IBOP activation of TPα by overexpressing AREG (Figure 3.8 A-D).

To verify the findings of elevated levels of AREG expression in PC3-TPα transfectants from the antibody array, ELISA for AREG was performed on the conditioned medium collected earlier from PC3 transfectants. Our results confirmed a higher secretion of AREG (5 fold) by the PC3-TPα cells in response to IBOP compared to vector control cells (PC3-Neo) (Figure 3.8E). Pretreatment with TXA2 antagonist

SQ29548 before addition of IBOP inhibited the increase in AREG expression and levels were comparable to ETOH treated cells (Figure 3.8E). Using Real-time PCR, the effect of TPα stimulation (IBOP) or inhibition (SQ29548) on AREG mRNA expression was tested more directly. The results indicate that AREG mRNA levels increased 6 fold in response to IBOP compared to ETOH treatment (Figure 3.8F). Pretreatment with TXA2 antagonist SQ29548 before addition of IBOP inhibited the increase in AREG mRNA and levels were comparable to ETOH treated cells (Figure 3.8F).

To verify the findings from the TPα transfected cells, wild-type DU145 cells were treated with either ETOH (Vehicle) or TXA2 agonist IBOP or TXA2 antagonist SQ29548 for 16hrs. Elevated levels of AREG expression both at the protein (ELISA) and mRNA levels (1.5 fold) in response to IBOP were also confirmed by in DU145 cells (Figure 3.8

G, H). These findings proved that TPα does play a direct role in increased expression of

Amphiregulin, a ligand for EGFR in prostate cancer cells.

3.8 A-D: Effect of TPα stimulation by IBOP on AREG (protein) expression in PC3 transfectants (Antibody Array)

Figure 3.8: Activation of TPα in PC3 cells over expressing TPα increases AREG, a ligand for EGFR. PC3-TPα and PC3-Neo cells were serum-starved overnight followed by treatment with ETOH (A, C) or IBOP (B, D). Conditioned medium was collected and screened by an angiogenesis antibody array. Activation of TPα by IBOP in PC3-TPα cells led to an increase in AREG expression levels but had little effect on EGF expression levels. PC3-TPα and PC3-Neo transfectants were serum-starved overnight and were treated either with ETOH or IBOP (50 nM) only, or they were pretreated with SQ29548 (10 µM) for 30 min before addition of IBOP. Conditioned medium was collected and cDNA isolated from the cell lysates. Data from Real- time PCR (F) and ELISA (E) also confirms the increase in expression of AREG mRNA and protein expression in PC3-TPα cells treated with IBOP when compared with ETOH or SQ29548 treated cells. Similar results were obtained with parental DU145 cells when treated with IBOP (G, H). Real-time PCR values expressed represent the mean fold change ± SEM, compared to

60 vector control and are derived from three experiments normalized in each case to GAPDH gene expression. Similar results were observed in a further two independent experiments. The ELISA results shown are mean ± standard deviation of triplicate wells, *p <0.05, **p <0.01; Student’s t test. This experiment was repeated at least three times with similar results

Activation of TPα signaling had little effect on EGF expression in PC3 cells over expressing TPα:

We also looked at the effect of TPα receptor on EGF, which is the predominant ligand for EGFR, and did not find any change in EGF levels (Figures 3.8 A, B, C, D). To determine whether TPα receptor stimulation could lead to increased expression of EGF mRNA, we did Real-time PCR on cDNA samples from PC3-TPα transfectants treated with vehicle (ETOH), agonist (IBOP) or antagonist (SQ29548). We did not find any change in EGF mRNA expression in response to IBOP by Real-time PCR in PC3-TPα transfectants (Figure 3.9A). Similar results were obtained in parental DU145 cells that express higher levels of endogenous TPα (Figure 3.9B). These results indicate that activation of TPα by IBOP selectively upregulates AREG expression at the level of protein and mRNA but has little effect on EGF expression.

Figure 3.9: Activation of TPα in PC3-TPα transfectant cells over expressing had little effect on expression of EGF, the predominant ligand for EGFR: PC3 transfectants (A) and DU145 cells (B) were serum starved overnight and cells were treated with ETOH or IBOP (50 nM) only or pretreated with SQ29548 (10 µM) for 30m before addition of IBOP. After 16 hrs. of treatment, cells were lysed in RNA lysis buffer for total RNA isolation. Expression of EGF mRNA in PC3-TPα (A) and DU145 cells (B) was minimally affected by treatment with IBOP. Values

62 expressed represent the mean fold change ± SEM, compared to vector control cells and is derived from three experiments normalized in each case to GAPDH gene expression. Similar results were observed in a further two independent experiments.

AREG produced through activation of TPα receptor is functional and can phosphorylate EGFR in PC3 cells:

AREG selectively binds to EGFR, following dimerization of EGFR, which leads to dimerization of the receptor itself as either a homodimer or as a heterodimer with other

EGFR family members. Subsequently EGFR undergoes phosphorylation at specific tyrosine residues within the intracellular domain that in turn activates downstream signaling pathways such as MAP kinase [ERK-1/2]. Therefore, we sought to determine whether the AREG that was induced in response to TPα receptor stimulation in PC3 transfectants was functional. We assayed AREG from PC3-TPα conditioned medium for its ability to bind EGFR and mediate phosphorylation at tyrosine residue (pY1068).

To test whether this led to subsequent activation of ERK1/2, we performed following addback experiments. Conditioned medium was collected from PC3-Neo cells or PC3-TPα transfectants treated with IBOP alone (PC3-TPα+IBOP, PC3-Neo+IBOP) for 16hrs. To determine if TPα mediated AREG production made a difference in the phosphorylation of EGFR or ERK1/2, we compared immunoblots of cells treated with

CM from PC3-TPα to that of CM from PC3-Neo cells. We also performed the addback experiments in parental PC3 cells that have endogenous EGFR but have lower TPα receptor levels. To avoid any trans activation of EGFR involving endogenous TPα receptor, PC3 cells were pretreated with TXA2 antagonist SQ29548 or ETOH for 30 minutes before addition of IBOP-treated-conditioned medium collected from PC3-TPα

63 transfectants. Whole cell lysates were prepared and subsequently analyzed for phosphorylation of EGFR and downstream targets such as ERK1/2 (Figure 3.10).

Our results support an active role for TPα receptor driven AREG production that leads to AREG activation of EGFR at pY1068 (Figure 3.10). Our results also support that AREG in the conditioned medium collected from PC3-TPα cells not only binds to

EGFR leading to its phosphorylation but can activate downstream signaling pathways such as MAP kinase pathway as evident by phosphorylation of ERK1/2 (Figure 3.10).

Therefore our studies reveal a novel means of indirect TPα receptor activation of EGFR through the effects of TPα receptor on AREG.

3.10 Functional status of AREG secreted in response to TPα receptor stimulation in the conditioned medium from PC3 transfectants (Immunoblot)

3.10 A: Effect of AREG on EGFR phosphorylation (Immunoblot)

3.10 B: Effect of AREG on EGFR phosphorylation (Immunoblot)

3.10 C: Effect of AREG on MAPK activation (Immunoblot)

3.10 D: Effect of AREG on MAPK activation (Immunoblot)

3.10 E: Effect of AREG on EGFR Phosphorylation – Loading control (Immunoblot)

Figure 3.10: AREG secreted in response to TPα receptor activation is active and leads to EGFR phosphorylation. PC3-TPα and PC3-Neo cells were serum-starved overnight and then treated with IBOP only. Conditioned medium was collected and secreted AREG activity post TPα stimulation was assayed. PC3 parental cells were serum-starved overnight and pretreated with TXA2 antagonist SQ29548 or ETOH for 30 min. These were subsequently treated with the conditioned medium collected from PC3 transfectants for 5min or 10min. Cell lysates were probed by immunoblot with phospho-specific antibodies for EGFR (A) and ERK1/2 (C). Total EGFR (B) and ERK1/2 (D) were used as loading controls for p-EGFR and p-ERK respectively. Actin served as a protein loading control (E). AREG in the conditioned medium from PC3-TPα cells stimulated increased phosphorylation of EGFR at pY1068 and ERK1/2 when compared to the conditioned medium from PC3-Neo cells. These findings indicate that AREG produced in response to activation of TPα is functional through binding of EGFR leading to its phosphorylation and activation of MAPK pathways. Immunoblotting for each protein was performed at least twice using independently prepared lysates, and representative data from one such experiment are shown.

Activation of TPα signaling promotes overexpression of EGFR in PC3 cells over expressing TPα:

After observing the relationship between TPα signaling and increased

AREG expression at the level of both protein and mRNA, we looked to see whether TPα affected the expression of EGFR itself from PC3-TPα and PC3-Neo cells that were treated with ETOH, IBOP and SQ29548. After 16 hr, cells were trypsinized and cell pellets were divided into two tubes for protein and cDNA analysis respectively. Real- time PCR and immunoblot analyses revealed that EGFR mRNA and protein expression was significantly elevated in PC3-TPα cells in response to IBOP when compared to the vector control cells (PC3-Neo) (Figures 3.11 A, B). Pretreatment with TXA2 antagonist

SQ29548 before addition of IBOP reduced EGFR expression to the level in untreated

67 cells, thereby confirming that TPα signaling also regulates EGFR expression in addition to AREG (Figures 3.11 A, B).

We opted to corroborate the findings from PC3 transfectants by examining parental cells that have naturally elevated levels of TPα. These were treated with either

ETOH (Vehicle) or TXA2 agonist IBOP or TXA2 antagonist SQ29548 for 16hr. DU145 cells stimulated with IBOP had a significant increase in EGFR mRNA (Figure 3.11C) and protein levels (Figure 3.11D) compared to ETOH treated cells. Pretreatment with

SQ29548 prior to addition of IBOP reduced EGFR expression back to levels achieved with ETOH alone (Fig 3.11 C, D). Collectively these data reveal that TPα activation with

IBOP in PC3-TPα transfectants as well as in parental DU145 cells stimulated AREG production, and also its cognate receptor, EGFR. This demonstrates for the first time that signaling events of the two receptors are coupled in prostate cancer.

3.11 B: Effect of TPα stimulation by IBOP on EGFR (protein) expression in PC3 transfectants (Immunoblot)

3.11 D: Effect of TPα stimulation by IBOP on EGFR (protein) expression in DU145 cells (Immunoblot)

Figure 3.11: Activation of TPα in PC3 cells over expressing TPα resulted in an increase of EGFR. PC3-TPα, PC3-Neo and DU145 cells were serum starved overnight and were either treated with ETOH, IBOP (50 nM) only or pretreated with SQ29548 (10 μM) for 30m before addition of IBOP for 16 hr. After treatment, cells were trypsinized, centrifuged and cell pellets were divided into two tubes for protein and cDNA analysis respectively. Data from Real-time

PCR reflects an increase in expression of EGFR mRNA expression in PC3-TPα cells treated with IBOP (A) when compared with ETOH or SQ29548 treated cells. Results from the immunoblotting suggest that activation of TPα by TXA2 mimetic IBOP in PC3-TPα cells resulted in an increase of EGFR (B) Similar results were obtained with DU145 cells that have higher endogenous TPα expression (C, D). Immunoblotting for each protein was performed at least three times using independently prepared lysates, and representative data from one such experiment is shown. Real-time PCR Values expressed represent the mean fold change ± SEM, compared to ETOH treated vector control cells and is derived from three experiments normalized in each case to GAPDH gene expression. Similar results were observed in a further two independent experiments.

Activation of TPα signaling had little effect on expression of ErbB2, ErbB3 and

ErbB4 in PC3 cells over expressing TPα

As EGFR was over expressed in response to TPα stimulation, we then sought to determine whether TPα could affect a change in expression of other EGFR family members such as ErbB2 (HER2), ErbB3 (HER3) and ErbB4 (HER4) that can indeed dimerize with EGFR. PC3 transfectants cells were serum-starved overnight and treated with ETOH, IBOP alone or pretreated with SQ29548 for 30 min followed by addition of

IBOP for 16 hr. After treatment, cells were trypsinized, centrifuged and cell pellets were divided into two tubes for protein and cDNA analysis respectively. Real-time PCR

(Figures 3.12 A, B, C) and Immunoblot analyses (Figure 3.12 D) revealed that there was very little effect on ErbB2, ErbB3 and ErbB4 mRNA and protein expression in PC3-

TPα cells in response to IBOP when compared to the vector control cells (PC3-Neo).

Pretreatment with TXA2 antagonist SQ29548 before addition of IBOP, did not affect the expression of EGFR family members (Figures 3.12A, B, C, D). These studies clearly demonstrate that TPα activation with IBOP in PC3-TPα transfectants resulted in increased expression of EGFR but not other EGFR family members.

3.12 D: Immunoblot: Effect of IBOP on ErbB2, ErbB3, ErbB4 expression in PC3 transfectants

Figure 3.12: TPα activation in PC3-TPα transfectants had little effect on expression of other EGFR Family members, ErbB2, ErbB3 and ErbB4. PC3-TPα and PC3-Neo cells were serum-starved overnight and were treated either with ETOH, IBOP (50 nM), only or pretreated with SQ29548 (10 µM) for 30m before addition of IBOP for 16 hr. After treatment, cells were trypsinized, centrifuged and cell pellets were divided into two tubes for both protein and total RNA isolation. Real-time PCR data indicate that activation of TPα by IBOP in PC3-TPα cells had little effect on expression of ErbB2, ErbB3 and ErbB4 mRNA (A, B, C) when compared with ETOH or SQ29548-treated cells. Additionally results from the immunoblotting suggest that activation of TPα by TXA2 mimetic IBOP in PC3-TPα cells had little effect on expression of other EGFR family members, ErbB2, ErbB3 and ErbB4 (D). Real-time PCR Values expressed represent the mean fold change ± SEM, compared to vector control cells and is derived from three experiments normalized in each case to GAPDH gene expression. Similar results were observed in a further two independent experiments. Immunoblotting for each protein was performed at least twice using independently prepared lysates, and representative data from one such experiment are shown.

EGFR upregulated as a result of TPα activation is functional and actively signals in PC3 transfectant cells:

As our data from real-time PCR and Immunoblot showed that PC3 cells do express EGFR but exhibited differential expression of other EGFR family members in

PC3 transfectant cells. Therefore, we wanted to confirm, whether the EGFR expressed in response to TPα stimulation in PC3 transfectants cells was functional. To test the functionality of EGFR produced by PC3-TPα transfectants in response to TPα stimulation, we treated PC3-Neo and PC3-TPα cells with either EGF or vehicle (PBS) for 5 min. Total protein was harvested from these cells and assayed for the levels of p-

EGFR, EGFR, p-ERK and ERK by Western blotting (Figure 3.13).

As evident on Figure 3.13, treatment of PC3-Neo and PC3-TPα cells with EGF resulted in increased phosphorylation of EGFR at pY1068, which is an indication of ligand dependent phosphorylation and a functional receptor (Figure 3.13). Furthermore, signaling pathways that are downstream of EGFR such as MAP kinase were activated as evident by phosphorylation of ERK1/2 (Figure 3.13).

3.13 Functional status of EGFR expressed in PC3 transfectants (Immunoblot)

Figure 3.13: Add-back experiment proving that EGFR expressed in PC3 transfectants is functional. PC3-TPα and PC3-Neo cells were serum-starved overnight and then treated with either PBS (vehicle) or EGF for 5min and cells were lysed, and immunoblotted with phospho- specific antibodies for EGFR (A) and ERK1/2 (C). Total EGFR (B) and ERK1/2 (D) were used as a loading control for p-EGFR and pERK1/2 respectively. Actin (E) served as a protein loading control. Our data indicate that EGF treated PC3-Neo and PC3-TPα cells showed increased phosphorylation of EGFR and ERK1/2 concluding that EGFR expressed in both PC3- Neo and PC3-TPα cells is functional. Immunoblotting for each protein was performed at least twice using independently prepared lysates, and representative data from one such experiment are shown.

Upregulation of AREG by TPα is not dependent on the PKA pathway:

The molecular mechanisms involved in the regulation of AREG expression by

TPα receptor are largely unknown. Our studies show that activation of TPα by IBOP in

PC3-TPα cells results in increased levels of the second messenger cAMP (Figure 3.4).

Recent studies have shown that the cAMP pathway can induce AREG in T cells as well as in cells of nonlymphoid origin such as H295R (adrenal) and MCF-7 cells (breast cancer) [160]. As it is known that one of the downstream targets of cAMP is PKA, we wondered whether PKA might be involved in the expression of AREG.

To look into the role of PKA and EGFR in TPα mediated AREG expression, we pretreated PC3-TPα and PC3-Neo cells with PKA inhibitor H89 (20 μM) for 30 min before incubation with TXA2 agonist IBOP for 18 hr. Following incubation, total RNA was isolated from these cells and processed for Real-time PCR analysis of AREG mRNA expression. Treatment with the PKA inhibitor H89 had no effect on AREG expression mediated by activation of TPα receptor (Figure 3.14). This suggests that upregulation of

AREG by TPα is not dependent on the PKA pathway.

Figure 3.14: Upregulation of AREG by TPα is not dependent on the PKA pathway. PC3- TPα and PC3-Neo transfectants were serum-starved overnight and were treated either with ETOH, IBOP (50 nM) only, or pretreated with SQ29548 (10 µM) and H89 before addition of IBOP for 16 hr. Data from Real-time PCR confirms that PKA inhibitor H89 had no effect on AREG expression mediated by activation of TPα receptor in PC3-TPα cells when compared to IBOP treated cells alone. Values expressed represent the mean fold change ± SEM, compared to ETOH treated vector control cells and is derived from three experiments normalized in each case to GAPDH gene expression. Similar results were observed in a further two independent experiments.

Upregulation of AREG by TPα is dependent on the AMPK pathway.

Though studies have shown that AREG can be induced by the cAMP pathway in in T cells as well as in cells of nonlymphoid origin such as H295R (adrenal) and MCF-7 cells (breast cancer) [160], our Real-time PCR data nonetheless showed that pretreatment of PC3 transfectant cells with PKA inhibitor (downstream mediator of cAMP) had no effect on expression of AREG, which suggested an alternate pathway involving cAMP [160]. We wondered whether AMP-activated protein kinase (AMPK), an alternate cAMP-signaling pathway is involved in the overexpression of AREG mediated by stimulation of TPα receptor. As we have previously shown that activation of TPα does increase cAMP levels, the relationship between thromboxane signaling, AMPK and AREG was studied in TPα overexpressing PC3 cells. AMPK is a sensor for changes in cellular energy state and is activated by an increase in the intracellular AMP- to-ATP ratios in response to various stresses such as hypoxia, oxidative stress and glucose deprivation [190-194]. Activation of AMPK requires phosphorylation of Thr172 in the activation loop of the α subunit by at least 2 upstream kinases, LKB1 and

2+ Ca /calmodulin-dependent kinase kinase (CaMKK)-β [190-194].

TPα activation increases cAMP levels, as well as intracellular Ca2+ concentration.

Therefore we investigated the role of AMPK in TPα mediated AREG expression.

Previous studies by Zhang et al. had shown that TP activates the AMPK in vascular smooth muscle cells via hydrogen peroxide [190].

Apart from cAMP being a regulator of AREG expression, studies have shown that AREG also can be regulated by the EGFR itself and activation of EGFR leads to

AREG expression in several cell types [155, 157, 160, 166]. As it is known that EGFR

80 can directly regulate AREG through EGFR-AREG autocrine loop, we questioned whether this might be true in TPα mediated AREG upregulation [155]

To investigate whether TPα mediates AREG upregulation via the AMPK pathway and to identify the role-played by EGFR in the expression of AREG, we pretreated the PC3-TPα and PC3-Neo cells with the AMPK inhibitor Compound-C (20

μM) and EGFR inhibitors Gefitinib (20 μM) or AG1478 (5 μM) for 30 min before incubation with TXA2 agonist IBOP for 18hrs. Gefitinib or AG1478 is an EGFR inhibitor that binds to the tyrosine kinase domain and inhibits downstream EGFR signaling.

Following incubation, total RNA was isolated from these cells converted to cDNA and

Real-time PCR was done for AREG mRNA expression. The amount of AREG transcript was estimated based on the Relative quantification method. Treatment with the AMPK inhibitor Compound-C in PC3-TPα cells led to an decrease in the level of AREG as shown in Figure 3.15A to the levels comparable to ETOH or SQ29548 treated cells.

This suggests that TPα upregulates AREG mRNA levels through cAMP by stimulating the AMPK pathway (Figure 3.15A).

Figure 3.15: Upregulation of AREG by TPα is dependent on AMPK pathway. PC3-TPα and PC3-Neo transfectants were serum starved overnight and were either treated with ETOH, IBOP 50nM only or pretreated with SQ29548 (10 µM), Gefitinib (20 μM), AG1478 (5 μM) and Compound-C (20 µM) for 30 min before incubation with IBOP for 18 hr. AMPK inhibitor

Compound-C strongly affects AREG expression mediated by TPα in PC3-TPα cells (A). EGFR inhibitors, Gefitinib and AG1478 reduced expression of AREG, mediated by TPα in PC3-TPα cells to a lesser extent than compound-C (A). Values expressed represent the mean fold change ± SEM, compared to vehicle treated vector control and is derived from three experiments normalized in each case to GAPDH gene expression. Data from ELISA supports the Real-time PCR data, that inhibition of the AMPK pathway reduces levels of AREG expression mediated by TPα activation (B). Similar results were observed in a further two independent experiments. The ELISA results shown are mean ± standard deviation of triplicate wells, *p <0.05, **p <0.01; Student’s t test. This experiment was repeated at least three times with similar results.

To verify our findings from Real-time PCR at the protein level, conditioned media was collected from PC3-TPα and PC3-Neo cells treated with AMPK inhibitor or EGFR inhibitors and the levels of AREG were assayed by ELISA and normalized to cell number. We observed that, Compound-C decreased AREG secretion from PC3-TPα cells when compared to IBOP treated cells (Fig 3.15B). Also treatment with EGFR inhibitors had a partial inhibition on expression of AREG mediated by TPα when compared with AMPK inhibitor (Fig 3.15B). The reduction of AREG secretion in PC3-

TPα overexpressing cells upon treatment with AMPK inhibitor suggests that the AMPK pathway is required for AREG secretion in these cells (Fig 3.15B). From these experiments, it is evident that AMPK pathway plays a key role in IBOP mediated increase in AREG secretion in the TPα overexpressing cells.

Activation of TPα signaling results in increased PCa cell invasion.

To determine whether TPα activity in PC3 cells translates to a more invasive phenotype and AREG does play a role in it, a modified Boyden chamber assay was performed where transwell chambers were coated with Matrigel, and PC3-TPα or PC3-

Neo cells were treated with either ETOH (Vehicle), IBOP (agonist), or SQ29548

(antagonist). Of all the treatments, only IBOP increased the invasiveness PC3-TPα cells

(Figures 3.16A, 3.16B). Similar results were obtained with DU145 cells that have higher endogenous TPα levels. Treatment of DU145 cells with IBOP also increased the invasive capacity of the cells when compared to treatment with either ETOH or pretreatment with the antagonist SQ29548 (Figure 3.16C). Invasiveness of PC3-TPα and PC3-Neo cells were similar in response to 5% FBS stimulation.

Studies have shown that EGFR signaling pathway plays an important role in cell migration and invasion [195, 196], we wondered whether AREG or EGFR might be involved in increasing the invasive capacity of the cells mediated by TPα. Over expression of AREG mediated by TPα in PCa cells can then activate EGFR and then activate signaling pathways that result in increasing the invasive nature of these cells.

To study whether AREG or EGFR has a role to play in it, we pretreated PC3-TPα and

PC3-Neo cells with EGFR inhibitor gefitinib (25 μM) or AMPK inhibitor-Compound-C (20

μM) for 30min, before incubation with IBOP for 18 hr and cells were fixed and pictures of invasive cells were taken with a Nikon TE200 inverted microscope (Figure 3.16A, C,).

Gefitinib is an EGFR inhibitor that binds to its tyrosine kinase domain and inhibits signaling through the EGFR pathway and Compound-C is an AMPK inhibitor. Binding of gefitinib to EGFR also will prevent AREG to activate EGFR and thereby affecting its role in cellular invasion whereas AMPK inhibitor should affect the overexpression of AREG mediated by TPα receptor. Treatment with Gefitinib or AMPK inhibitor did reduce the invasiveness of these cells, induced by IBOP, indicating that EGFR signaling is involved in TPα mediated invasion (Figure 3.16A, B, C, D). Similar results were obtained with

DU145 cells that have higher endogenous TPα levels when treated with EGFR inhibitor gefitinib or AMPK inhibitor (Figure 3.16E, F).

8 4

3.16 A: Effect of EGFR and AMPK inhibitors on TPα mediated cell invasion in

PC3-TPα cells (Modified Boyden chamber assay)

3.16 C: Effect of EGFR and AMPK inhibitors on TPα mediated cell invasion in PC3-Neo cells (Modified Boyden chamber assay)

3.16 E: Effect of EGFR and AMPK inhibitors on TPα mediated cell invasion in parental DU145 cells (Modified Boyden chamber assay)

Figure 3.16: Activation of TPα signaling by IBOP stimulation results in increased invasiveness of PCa. Modified Boyden chamber assay was done where transwell chambers were coated with matrigel and PC3-TPα and PC3-Neo cells that were serum starved overnight and were either treated with ETOH, IBOP (50 nM) only or pretreated with SQ29548 (10 μM) Gefitinib (20 μM) or AMPK inhibitor Compound-C (20 μM), before IBOP was added to the chamber. After 16 hr of treatment, cells that invaded to the bottom of transwell chamber were fixed and photographed. IBOP treatment stimulated the invasive capability of PC3-TPα cells in

87 the in vitro invasion assay, whereas the vehicle, antagonist, Gefitinib, Compound-C reduced the invasive capability of PC3-TPα cells (A, B). Similar results were obtained with DU145 cells that have higher endogenous TPα expression (C). Representative phase contrast microscope pictures are shown in correlation with the invasion assay from three independent experiments. It was also quantified by counting the number of cells that invaded to the lower side of the filter in three representative fields in each independent experiment.

TPα signaling results in larger tumors in a mouse model:

To examine the physiological relevance of increased colony formation and invasion brought on by TP-α expression and signaling in PCa cells, we introduced PC3-

TPα or PC3-Neo cells into athymic mice in an established subcutaneous (s.c.) xenograft tumor model to assess tumor growth in vivo. Prostate cancer cell proliferation in vitro was largely comparable between PC3-TPα and PC3-Neo cells. This suggested that

PC3-TPα transfectants did not have a growth advantage over PC3-Neo cells in vitro

(Data not shown).

However mice that received PC3-TPα cells formed larger tumors compared to mice injected with PC3-Neo cells, indicating that TPα transfected PC3 cells had an in vivo growth advantage compared to Neo controls. (Figures 3.17, 3.18 A, B). Weekly measurements over a 7-8 week period, revealed that tumors originating from PC3-TPα cells injected into nude mice grew faster compared to PC3-Neo mice. (Figure 3.17)

After 7-8 weeks, mice were sacrificed as per the animal protocol, and tumors resected from the mice receiving PC3-TPα were larger and found to weigh approximately twice that of tumors originating from PC3-Neo-injected mice. (Figure 3.18 A, B, C, D)

Figure 3.17: Mice bearing PC3-TPα cells showed greater tumor growth compared to the control group. Increases in tumor growth in mice injected with PC3-TPα transfectants were observed compared to PC3-Neo controls. Tumor growth was plotted for 7-8 weeks and a growth curve was obtained.

3.18: Size and weight Comparison of tumors originating from PC3 vector controls and PC3 cells overexpressing TPα

Figure 3.18: Size and weight Comparison of tumors originating from PC3 vector controls and PC3 cells overexpressing TPα. PC3 cells over expressing TPα yielded larger tumors in vivo compared to PC3 parental cells carrying the expression vector alone. Mice (n=6) receiving PC3-TPα (A) and mice (n=6) receiving PC3-Neo (B) were photographed on Day-56 after they were sacrificed. Tumors excised from mice injected with PC3-TPα cells were larger in size compared to the PC3-Neo controls (C). Tumors excised from mice injected with PC3-TPα cells displayed twice the weight (D) compared to the PC3-Neo controls. Weight of the mice displayed on the graph is average weight of each group of mice (n=6) (D).

Angiogenesis plays an important role in tumor growth and is considered a key step in tumor development. We found significant vascularization in tumors derived from

TPα transfected PC3 cells, whereas the PC3-Neo control tumors showed little vessel

90 penetration. (Figure 3.19A) Paraffin-embedded tumor sections from mouse xenografts of PC3-TPα cells or PC3-Neo cells were immunostained using antibodies specific for

CD31, which is an endothelial cell marker (Fig 3.19C). Real-time PCR on the cDNA from tumors also confirmed the increased expression of CD31 in PC3-TPα tumors compared to controls (Fig 3.19B).

To confirm whether increase in proliferation due to EGFR signaling was responsible for increased tumor size seen in PC3-TPα mice, Paraffin-embedded tumor sections from mouse xenografts of PC3-TPα cells or PC3-Neo cells were immunostained using antibodies specific for KI67, which is an proliferation marker (Fig

3.19C). Immunohistochemistry analysis of the tumors sections also confirmed the stronger staining for Ki67 in PC3-TPα tumors compared to controls (Fig 3.19D).

Our in vitro data revealed that IBOP activation of TPα enhanced cellular AREG and EGFR levels. Therefore, mouse tumors were examined for expression of these downstream targets. Analysis of cDNA generated from the tumor samples revealed that

EGFR, as well as AREG, VEGF and IL6 were in fact over expressed in tumors originating from PC3-TPα transfectants (Figure. 3.20B). Furthermore, it was confirmed that PC3-TPα cells maintained elevated expression levels of TPα compared to PC3-

Neo controls over the duration of the six week in vivo growth experiment. (Figure.

3.20A)

Figure 3.19: Increased neo vascularization and proliferation was observed in tumors from mice harboring PC3-TPα cells compared to those given vector controls. Comparison of vessel density of tumors ex vivo from PC3-TPα mice compared to control mice (A). Presence of CD31, a prominent angiogenesis marker, was increased at the mRNA levels in mice injected with PC3-TPα compared to PC3-Neo controls (B). Immunohistochemical analysis for CD31, an endothelial marker, showed that sections from PC3-TPα tumors were strongly positive for CD31 (C). Arrowheads show the staining regions for CD31. Immunohistochemical analysis for Ki67, a proliferation marker, showed that sections from PC3-TPα tumors were strongly positive for Ki67 (D). Arrowheads show the staining regions for Ki67.

Figure 3.20: Increased expression of downstream target genes known to affect tumor growth. In order to determine whether increased tumor growth in PC3-TPα, injected mice is due to increased expression of either pro angiogenic factors or growth factors, RNA isolated from mouse tumors was converted to cDNA and gene expression was quantified using Real-time PCR. PC3-TPα transfectants maintained high TPα receptor levels in mouse tumors for the duration of the study (A). Elevated TPα levels were associated with increased expression of target genes such as AREG, EGFR, VEGF-A and IL6 (B). Values expressed represent the mean fold change ± SEM, compared to vector control mice and is derived from three experiments normalized in each case to GAPDH gene expression. Similar results were observed in a further two independent experiments.

Activation of TPα also promotes increased angiogenesis in a mouse model:

Increased neo vascularization was seen in PC3-TPα tumors as well as increased expression of VEGF-A mRNA. This implied TPα might also lead to tumor growth by playing a role in angiogenesis.

The increased angiogenicity due to TPα mediated VEGF expression in PC3-TPα tumors was confirmed by the Matrigel implantation assay in an in vivo xenograft mouse model. As shown in Fig. 3.21, within 12 days, TPα transfected PC3 cells (PC3-TPα) in matrigel induced increased angiogenesis, indicated by the accumulation of blood in the gel, compared to the neo control (PC3-Neo). The results clearly illustrate that the TPα transfected PC3 cells are more angiogenic than their neo controls.

Figure 3.21: Induction of angiogenesis in Matrigel by TPα transfectants: PC3-TPα cells or PC3-Neo control cells (2xI06) were mixed with matrigel BME and injected s.c. into the right flank of 4-6-week-old male SCID mice (n=6). In Mice injected with PC3-TPα cells mixed with Cultrex BME, there was increased vessel penetration into the gel and considerable blood accumulation was observed (A). In contrast, mice injected with PC3-Neo cells mixed with Matrigel BME, the vessel penetration into the gel was minimal, with little blood accumulation (B).

Chapter-4: Summary and Discussion:

Development of prostate cancer (PCa) is a multistep process. A key step in this process is the overexpression of growth factors and their receptors that results in the progression of normal prostate epithelial cells to a hyper proliferative cancer cell [171,

172]. Changes in gene expression of growth factors and their corresponding receptors in epithelial and stromal cells during the different developmental stages of prostate cancer contribute to enhanced tumor cell growth, survival, migration and invasiveness

[171, 172]. Among these, the ErbB family of receptors and their ligands, the EGF family of peptide growth factors, has a central role in the pathogenesis and progression of different carcinoma types [141, 144, 146, 150]. In particular, epidermal growth factor receptor (EGFR) signaling has been associated with a wide variety of tumors and causes PCa to progress by becoming invasive and metastatic [170, 171] [173, 174].

In this study, we report for the first time that activation of TPα signaling can lead to over expression of AREG, a ligand of EGFR in prostate cancer cells. Our data also indicate that activation of TPα not only upregulates AREG expression, but also increases the expression of its cognate receptor EGFR. We also have demonstrated that of the two TP receptor isoforms, only TPα receptor is expressed in PCa cells and tissues. These findings suggest an alternate mechanism by which TPα can activate

EGFR signaling pathways leading to increased tumor growth. The experimental evidence from this study has revealed molecular mechanisms underlying the enhanced expression of AREG in prostate cancer. Our data indicate that the AMPK pathway plays an important role in the expression of AREG mediated by TPα in PCa cells.

Recent studies have shown that GPCRs are able to utilize the EGFR as a downstream signaling partner in the generation of growth signals that might play an important role in various cancers [124, 125, 128]. Studies have identified that EGFR as an essential link in the GPCR-mediated activation of downstream signaling pathways such as MAPK pathways in several cell types treated with the GPCR agonists [128,

197-199]. The TP receptor also uses EGFR as an essential link in the activation of downstream signaling pathways. Two mechanisms i.e. ligand-dependent (shedding of

HB-EGF by MMPs) or ligand-independent (Src kinase mediated) have been proposed that involve transactivation of EGFR by phosphorylation that leads to activation of downstream signaling pathways [127] [126]. These models were established in HEK cells over-expressing TP receptor-EGFR crosstalk has been established using HEK cells overexpressing TP receptor and they have not examined in cancer cells. Therefore alternate pathways involved in activation of EGFR by TP receptor are possible.

In this study we have proposed a novel mechanism by which EGFR can be activated in PCa cells through GPCR. Our data show for the first time that increased expression of AREG in response to TP stimulation by its agonist can lead to EGFR activation in PCa cells. Our data also confirm that increased levels of AREG, seen in response to stimulation of TPα, result in functional binding to EGFR, leading to EGFR phosphorylation and activation of downstream MAPK pathways. Elevated AREG could then lead to constitutive EGFR signaling and activation of downstream signaling pathways involved in cellular proliferation, cell migration, cell survival, and angiogenesis. Overexpression of AREG has been reported in both androgen dependent and independent prostate cell lines as well as tissues. However the specific pathways

98 leading to AREG expression have not yet been elucidated [157, 158, 175]. Our study sheds light on a novel pathway, where we found that activation of TPα led to increased expression of AREG. This presents a mechanistic explanation for those findings, as we also determined that TPα is over-expressed in PCa cell lines.

We discovered that TPα activation also led to over expression of EGFR. It is known that AREG acts exclusively through EGFR, where it binds EGFR with a lower affinity than EGF, and induces receptor autophosphorylation and downstream activation of the ERK signaling cascade [156, 158]. One of the most studied receptor tyrosine kinases i.e. EGFR and its signaling pathway is central to both physiological and pathophysiological process [139, 140, 143, 144, 150]. Over-expression of EGFR or upregulation of its signaling pathway has been associated with several cancers and has led to uncontrolled cellular proliferation and autocrine stimulation of tumors producing their own growth factors [141, 146, 149, 150, 200]. The enhanced expression of EGFR and its ligands, EGF, TGF-α, HB-EGF and AREG, has been reported to correlate with high grades of PCa malignancies [158, 174].

The mechanisms responsible for AREG upregulation in transformed cells are not fully understood and might vary from one tumor subtype to another. Recent studies have shown that AREG can be induced by cAMP pathway in various cell types

[160]. A cAMP-responsive element (CRE) has been described in the AREG promoter and expression of AREG is regulated by cAMP [160, 161]. AREG can also be regulated by EGFR itself, and activation of EGFR leads to AREG expression in several cell types

[155, 157, 166, 168]. We investigated and determined that activation of TPα clearly increases the cAMP levels in PCa cell lines. These findings and other studies point to a

99 possible role for cAMP and EGFR in over expression of AREG that is induced by TPα signaling.

As our data indicate, blocking EGFR activation with EGFR inhibitors (Gefitinib,

AG1478) actually reduced AREG levels in TPα over-expressing cells, that TPα upregulates AREG mRNA by direct activation of EGFR via EGFR phosphorylation.

Inhibition of PKA (downstream mediator of cAMP) prior to EGFR inhibition did not affect the expression of AREG. The possibility of an alternate pathway involving cAMP [160] led us to consider whether the AMPK pathway was involved. The thromboxane receptor reportedly can activate the AMP-activated protein kinase in vascular smooth muscle cells via hydrogen peroxide [190]. Treatment with the AMPK inhibitor (Compound-C) led to a decrease in AREG both at the level of mRNA and protein (Figure 3.15). Therefore we have identified the AMPK pathway as the key signaling pathway triggered by TPα to increase AREG expression in human prostate cancer cells.

Aberrant EGFR and AREG signaling has been recognized to affect cellular proliferation, cell migration, cell survival, and angiogenesis [141, 144, 146, 150]. Many of these key steps in cancer progression are also regulated by TP receptor. Previous studies from our lab have shown that activation of TPα receptor by IBOP induces cell motility through the Rho-A pathway [101]. As AREG had been shown to upregulate several genes known to be involved in motility and invasion in breast cancer cells [155,

156, 168], we investigated whether TPα-AREG-EGFR signaling plays a role in PCa cell invasion. Our invasion assays showed that TPα does in fact play a role in cell invasion, and is mediated by EGFR signaling. Our data also confirm that increased expression of

AREG induced by TPα receptor promoted cell invasion, as blocking AREG expression

100 with AMPK inhibitors reduced invasion. These data indicate that PCa cells expressing

AREG in response to TPα receptor stimulation require autocrine signaling through

EGFR for cell invasion to occur.

Activation of TPα receptor in PC3-TPα cells by IBOP promoted increased expression of growth factors such as AREG and its receptor EGFR thereby playing a role in tumor growth. Using a xenograft mouse model, we demonstrated that TPα transfected PC3 cells formed larger tumors than vector controls, and that the increased tumor volume was positively correlated with enhanced tumor angiogenesis. Tai et al., have shown that overexpression of TPα in A549 lung cancer cells also led to enhanced tumor angiogenesis and growth in a xenograft animal model [201]. Taken together, these studies suggest that expression of TPα in cancer cells can enhance their angiogenic potential through expression of growth factors leading to tumor growth. We found significant vascularization in tumors derived from PC3-TPα cells, compared to

PC3-Neo tumors. Formalin fixed paraffin-embedded tumor sections from these mice showed very strong CD31 staining. Analysis of tumors from PC3-TPα mice by real-time

PCR showed increased expression of pro-angiogenic growth factors and cytokines such

VEGF and IL6.

Angiogenesis is a multistep process that requires the concerted action of numerous growth factors. VEGF is an important angiogenic factor that had been correlated with poor prognosis and improved survival of solid tumors. Expression and secretion of VEGF is triggered by a vast multitude of factors and signaling pathways in cancer cells [202, 203]. In solid tumors, the VEGF and EGFR pathways are linked with respect to angiogenesis [204, 205]. EGFR ligands such as EGF and TGF-α can induce

101

VEGF expression via activation of EGFR in cell culture models and have proangiogenic properties [204, 205]. It is likely that the EGFR pathway modulates angiogenesis by up- regulating VEGF or other key mediators in the angiogenic process [206]. The increased angiogenicity due to TPα mediated VEGF expression in PC3-TPα tumors was confirmed by the Matrigel implantation assay in an in vivo xenograft mice model indicating that increased EGFR signaling mediated by TPα to be responsible for it.

In this study, we identified which TP receptor isoform is predominantly expressed in PCa cells and tissues. Though the existence of two TP isoforms was described as early as 1994, most of the earlier studies on TP did not distinguish the functional roles between the two isoforms and it was assumed that most of the functional effects of TP to be mediated by TPα. Recent findings though provide a novel role for TPβ in bladder cancer progression [99]. Until now the expression status of TP isoforms was largely uncharacterized in prostate cancer cells and tissues. Identification of the active isoform in prostate cancer will help us to design isoform-specific antagonists or inhibitors that uniquely target this pathway for greater therapeutic impact.

One of the technical challenges in working with TP isoforms is the lack of isoform-specific antibodies. The only difference between TPα and TPβ is that TPα has a shorter C-terminal cytoplasmic tail than the TPβ isoform (15 versus 79 residues) [52-

54]. Currently there are no commercially available antibodies that can discriminate these two isoforms. To distinguish them, we designed Taqman gene expression assays specific for each TP isoform and were able to differentiate their expression level in PCa cells and tissues. Within the detection boundaries of this assay, TPα appeared to be solely expressed isoform in PCa cell lines and tissues. We used several approaches

102

(Immunoblot, RT-PCR, Real-time PCR, cAMP enzyme Immunoassay) to look into the possible expression of both TP isoforms in PCa, but our data strongly pointed that only

TPα expression is seen in PCa cells. Data from our tissue array analysis show that TPα expression is higher in prostate cancer tissues compared to normal prostate tissues.

Collectively, the data-mining results and the data from Real-time PCR analysis of human tissue arrays make a strong case for the association of TPα expression with the aggressiveness and progression of prostate tumors. Previous studies by Bostwick et al. were able to conclude that increased expression of AREG might contribute to the development of prostatic adenocarcinoma [158].

EGFR protein was found by Marks et al. to be frequently expressed in tissue from prostate cancer patients undergoing hormone therapy [207]. In 57 of 71 patients undergoing hormonal therapy, there was demonstrable EGFR expression by immunostaining. More studies will be needed to focus on the co-expression levels of both TPα and AREG in prostate cancer tissues in relation to EGFR so as to determine their connectivity. In gastric cancer cell lines, Cetuximab responsiveness against EGFR was associated with AREG levels, and Cetuximab treatment attenuated AREG, while

EGF elevated AREG. This implies that the EGFR pathway itself appears to regulate

AREG[208]. It is known that TPR activation includes the expression of a nuclear receptor called Nurr1 that can stimulate proliferation of lung cancer cells [119]. In turn,

Nurr1 has been shown to regulate pro-inflammatory mediators, including AREG, in synovial fibroblasts [209]. As both TPα and AREG are over expressed in PCa tissues, it will be interesting if links such as those implied by the Nurr1 studies play a role in TPα- mediated expression of in human PCa tissues.

103

Conclusion:

In summary, our study has identified a novel link between TPα signaling and

AREG expression in prostate cancer cells. We report for the first time that activation of

TPα signaling in PCa cells can lead to increased expression of AREG and its receptor

EGFR, and that AMPK plays an important role in regulation of AREG by TPα. EGFR signaling has been recognized to be at the forefront of aberrant signal transduction pathways, involved in cellular proliferation, cell migration, cell survival, and angiogenesis. Over expression of TPα in PC3 cells can result in increased invasiveness of PCa cells, which might be mediated by EGFR signaling pathways.

Over expression of TPα in PC3 cells led to increased tumor growth and angiogenesis in a xenograft mouse model that is likely associated with increased expression of AREG, VEGF and EGFR signaling. We report for the first time that TPα mRNA expression is elevated in the prostate cancer tissues and conclude that TPα expression in PCa tissues correlates with aggressiveness of the disease. These findings suggest that the functional role of TPα in prostate cancer progression might involve increased expression of AREG leading to increased activation of EGFR signaling promoting angiogenesis, cell invasion and tumor growth.

104

Project Summary

Figure 4: Summary of TPα receptor mediated AREG expression and EGFR signaling in prostate cancer cells

Future Directions:

Recent emphasis in prostate cancer research has been on identification of candidate genes that are good prognostic or predictive markers. As defined by Busser et al., “Prognostic factors provide information on the outcome of the disease, whereas predictive factors are used to prospectively select responsiveness or resistance to a specific treatment” [169]. TPα appears to be an ideal candidate to be considered as a prognostic marker in prostate cancer. TPα was more highly expressed in aggressive

105 forms of PCa and correlated with Gleason scores. A significant finding from our studies was that TPα expression was elevated in GS7 (4+3) compared to GS7 (3+4), which suggests that differences in TPα expression exist between primary and secondary patterns. Further studies are needed in statistically relevant sample set to see whether this can potentially be exploited as a biomarker for discriminating GS7 subtypes when making prognostic determinations.

Further in vivo studies will clarify the actual role of EGFR and AREG in TPα- mediated tumor growth. This could be approached by knocking down either AREG or

EGFR in PC3 cells over expressing TPα, injecting them into mice, and following tumor growth. Further elucidation of TPα-mediated pathways that elevate expression of AREG and lead to subsequent tumor cell growth will provide insights into the key steps involved in prostate cancer progression. Inhibition of growth factors and their receptor signaling pathways has proven to be an effective approach to block tumor growth.

Therefore, inhibition of TPα signaling by antagonists, or prevention of TXA2 synthesis by inhibiting TXA2S, may be a novel approach to develop anticancer, anti-angiogenic therapy [210]. It remains to be determined if TPα and AREG expression in prostate cancer tissue can be correlated to each other.

The low cost of aspirin has kept it in the forefront of treatment in cardio vascular disorders, whereas TXA2S inhibitors and TXA2 antagonists have not been employed for clinical benefits. Conversely, current therapeutic regimens for cancer incorporate few agents of the NSAID class, which makes TXA2S/TP antagonism an attractive target with potentially significant therapeutic benefit. Moreover, in contrast to

NSAIDs, TXA2S/TP inhibitors do not interfere with synthesis of other beneficial COX-

106

derived anti-tumor products, such as PGI2 [211-216]. Hence, future work should focus on the advantages of directly targeting TXA2S and/or developing TP antagonists or taking advantage of the anti tumor effects of PGI2.

107

APPENDIX

108

REFERENCES

1. U.S.C.S.W.Group: United States Cancer Statistics: 1999–2007 Incidence and

Mortality Web-based Report: Atlanta: U.S. Department of Health and Human

Services, Centers for Disease Control and Prevention and National Cancer

Institute. 2010.

2. Health NIo: What You Need To Know About: Prostate cancer. NIH Publication

No 08-1576.

3. Pinto F, Totaro A, Calarco A, Sacco E, Volpe A, Racioppi M, D'Addessi A, Gulino

G, Bassi P: Imaging in prostate cancer diagnosis: present role and future

perspectives. Urol Int 2011, 86(4):373-382.

4. Margreiter M, Stangelberger A, Valimberti E, Herwig R, Djavan B: Biomarkers

for early prostate cancer detection. Minerva Urol Nefrol 2008, 60(1):51-60.

5. Croswell JM, Kramer BS, Crawford ED: Screening for prostate cancer with

PSA testing: current status and future directions. Oncology (Williston Park)

2011, 25(6):452-460, 463.

6. Honn KV, Aref A, Chen YQ, Cher ML, Crissman JD, Forman JD, Gao X, Grignon

D, Hussain M, Porter AT et al: Prostate Cancer - Old Problems and New

Approaches. (Part II. Diagnostic and Prognostic Markers, Pathology and

Biological Aspects). Pathol Oncol Res 1996, 2(3):191-211.

7. Humphrey PA, Andriole GL: Prostate cancer diagnosis. Mo Med 2010,

107(2):107-112.

8. Humphrey PA: Gleason grading and prognostic factors in carcinoma of the

prostate. Mod Pathol 2004, 17(3):292-306.

109

9. Tiguert R, Ravery V, Grignon DJ, Sakr W, Wood DP, Jr., Pontes JE: Main grade

of Gleason's 7 score of the surgical sample correlated with biologic

progression in patients treated for total prostatectomy. Prog Urol 2002,

12(1):31-36.

10. Blana A, Robertson CN, Brown SC, Chaussy C, Crouzet S, Gelet A, Conti GN,

Ganzer R, Pasticier G, Thuroff S et al: Complete high-intensity focused

ultrasound in prostate cancer: outcome from the @-Registry. Prostate

Cancer Prostatic Dis 2012.

11. Gronberg H: Prostate cancer epidemiology. Lancet 2003, 361(9360):859-864.

12. Powell IJ: Epidemiology and pathophysiology of prostate cancer in African-

American men. J Urol 2007, 177(2):444-449.

13. Powell IJ, Bock CH, Ruterbusch JJ, Sakr W: Evidence supports a faster

growth rate and/or earlier transformation to clinically significant prostate

cancer in black than in white American men, and influences racial

progression and mortality disparity. J Urol 2010, 183(5):1792-1796.

14. Bairati I, Meyer F, Fradet Y, Moore L: Dietary fat and advanced prostate

cancer. J Urol 1998, 159(4):1271-1275.

15. West DW, Slattery ML, Robison LM, French TK, Mahoney AW: Adult dietary

intake and prostate cancer risk in Utah: a case-control study with special

emphasis on aggressive tumors. Cancer Causes Control 1991, 2(2):85-94.

16. Rose DP, Connolly JM: Dietary fat, fatty acids and prostate cancer. Lipids

1992, 27(10):798-803.

110

17. Norrish AE, Skeaff CM, Arribas GL, Sharpe SJ, Jackson RT: Prostate cancer

risk and consumption of fish oils: a dietary biomarker-based case-control

study. Br J Cancer 1999, 81(7):1238-1242.

18. Nie D, Che M, Grignon D, Tang K, Honn KV: Role of eicosanoids in prostate

cancer progression. Cancer Metastasis Rev 2001, 20(3-4):195-206.

19. Funk CD: Prostaglandins and leukotrienes: advances in eicosanoid biology.

Science 2001, 294(5548):1871-1875.

20. Nie D, Tang K, Szekeres K, Trikha M, Honn KV: The role of eicosanoids in

tumor growth and metastasis. Ernst Schering Res Found Workshop

2000(31):201-217.

21. Krishnamoorthy S, Honn KV: Eicosanoids in tumor progression and

metastasis. Subcell Biochem 2008, 49:145-168.

22. Panigrahy D, Kaipainen A, Greene ER, Huang S: Cytochrome P450-derived

eicosanoids: the neglected pathway in cancer. Cancer Metastasis Rev 2010,

29(4):723-735.

23. Goetzl EJ, An S, Smith WL: Specificity of expression and effects of

eicosanoid mediators in normal physiology and human diseases. Faseb J

1995, 9(11):1051-1058.

24. Nie D, Krishnamoorthy S, Jin R, Tang K, Chen Y, Qiao Y, Zacharek A, Guo Y,

Milanini J, Pages G et al: Mechanisms regulating tumor angiogenesis by 12-

lipoxygenase in prostate cancer cells. J Biol Chem 2006, 281(27):18601-

18609.

111

25. Nie D, Hillman GG, Geddes T, Tang K, Pierson C, Grignon DJ, Honn KV:

Platelet-type 12-lipoxygenase regulates angiogenesis in human prostate

carcinoma. Adv Exp Med Biol 1999, 469:623-630.

26. Zeldin DC: Epoxygenase pathways of arachidonic acid metabolism. J Biol

Chem 2001, 276(39):36059-36062.

27. Hardwick JP, Song BJ, Huberman E, Gonzalez FJ: Isolation, complementary

DNA sequence, and regulation of rat hepatic lauric acid omega-hydroxylase

(cytochrome P-450LA omega). Identification of a new cytochrome P-450

gene family. J Biol Chem 1987, 262(2):801-810.

28. Miyata N, Roman RJ: Role of 20-hydroxyeicosatetraenoic acid (20-HETE) in

vascular system. J Smooth Muscle Res 2005, 41(4):175-193.

29. Guo AM, Arbab AS, Falck JR, Chen P, Edwards PA, Roman RJ, Scicli AG:

Activation of vascular endothelial growth factor through reactive oxygen

species mediates 20-hydroxyeicosatetraenoic acid-induced endothelial cell

proliferation. J Pharmacol Exp Ther 2007, 321(1):18-27.

30. Yu W, Chen L, Yang YQ, Falck JR, Guo AM, Li Y, Yang J: Cytochrome P450

omega-hydroxylase promotes angiogenesis and metastasis by

upregulation of VEGF and MMP-9 in non-small cell lung cancer. Cancer

Chemother Pharmacol 2011, 68(3):619-629.

31. Wang D, Dubois RN: Eicosanoids and cancer. Nat Rev Cancer 2010,

10(3):181-193.

32. Nie D, Honn KV: Cyclooxygenase, lipoxygenase and tumor angiogenesis.

Cell Mol Life Sci 2002, 59(5):799-807.

112

33. Agarwal S, Reddy GV, Reddanna P: Eicosanoids in inflammation and cancer:

the role of COX-2. Expert Rev Clin Immunol 2009, 5(2):145-165.

34. Fitzpatrick FA: Cyclooxygenase enzymes: regulation and function. Curr

Pharm Des 2004, 10(6):577-588.

35. Marnett LJ, DuBois RN: COX-2: a target for colon cancer prevention. Annu

Rev Pharmacol Toxicol 2002, 42:55-80.

36. Hamberg M, Svensson J, Samuelsson B: Thromboxanes: a new group of

biologically active compounds derived from prostaglandin endoperoxides.

Proc Natl Acad Sci U S A 1975, 72(8):2994-2998.

37. Moncada S, Needleman P, Bunting S, Vane JR: Prostaglandin endoperoxide

and thromboxane generating systems and their selective inhibition.

Prostaglandins 1976, 12(3):323-335.

38. Kuehl FA, Jr., Humes JL, Beveridge GC, Van Arman CG, Egan RW:

Biologically active derivatives of fatty acids: prostaglandins,

thromboxanes, and endoperoxides. Inflammation 1977, 2(4):285-294.

39. Haurand M, Ullrich V: Isolation and characterization of thromboxane

synthase from human platelets as a cytochrome P-450 enzyme. J Biol Chem

1985, 260(28):15059-15067.

40. Radomski M: The biological role of thromboxane A2 in the process of

hemostasis and thrombosis; pharmacology and perspectives of

therapeutical use of thromboxane synthetase inhibitors and receptor

PGH2/TXA2 antagonists. Acta Physiol Pol 1985, 36(3):153-164.

113

41. Needleman P, Moncada S, Bunting S, Vane JR, Hamberg M, Samuelsson B:

Identification of an enzyme in platelet microsomes which generates

thromboxane A2 from prostaglandin endoperoxides. Nature 1976,

261(5561):558-560.

42. Caughey GE, Cleland LG, Penglis PS, Gamble JR, James MJ: Roles of

cyclooxygenase (COX)-1 and COX-2 in prostanoid production by human

endothelial cells: selective up-regulation of prostacyclin synthesis by COX-

2. J Immunol 2001, 167(5):2831-2838.

43. Tanabe T, Ullrich V: Prostacyclin and thromboxane synthases. J Lipid Mediat

Cell Signal 1995, 12(2-3):243-255.

44. FitzGerald GA, Patrono C: The coxibs, selective inhibitors of

cyclooxygenase-2. N Engl J Med 2001, 345(6):433-442.

45. Wang LH, Kulmacz RJ: Thromboxane synthase: structure and function of

protein and gene. Prostaglandins Other Lipid Mediat 2002, 68-69:409-422.

46. Ekambaram P, Lambiv W, Cazzolli R, Ashton AW, Honn KV: The thromboxane

synthase and receptor signaling pathway in cancer: an emerging paradigm

in cancer progression and metastasis. Cancer Metastasis Rev 2011, 30(3-

4):397-408.

47. Ohashi K, Ruan KH, Kulmacz RJ, Wu KK, Wang LH: Primary structure of

human thromboxane synthase determined from the cDNA sequence. J Biol

Chem 1992, 267(2):789-793.

48. Shen RF, Tai HH: Thromboxanes: synthase and receptors. J Biomed Sci

1998, 5(3):153-172.

114

49. Smyth EM: Thromboxane and the thromboxane receptor in cardiovascular

disease. Clin Lipidol 2010, 5(2):209-219.

50. Needleman P, Minkes M, Raz A: Thromboxanes: selective biosynthesis and

distinct biological properties. Science 1976, 193(4248):163-165.

51. Ushikubi F, Nakajima M, Hirata M, Okuma M, Fujiwara M, Narumiya S:

Purification of the thromboxane A2/prostaglandin H2 receptor from human

blood platelets. J Biol Chem 1989, 264(28):16496-16501.

52. Hirata M, Hayashi Y, Ushikubi F, Yokota Y, Kageyama R, Nakanishi S, Narumiya

S: Cloning and expression of cDNA for a human thromboxane A2 receptor.

Nature 1991, 349(6310):617-620.

53. Kinsella BT: Thromboxane A2 signalling in humans: a 'Tail' of two receptors.

Biochem Soc Trans 2001, 29(Pt 6):641-654.

54. Raychowdhury MK, Yukawa M, Collins LJ, McGrail SH, Kent KC, Ware JA:

Alternative splicing produces a divergent cytoplasmic tail in the human

endothelial thromboxane A2 receptor. J Biol Chem 1994, 269(30):19256-

19261.

55. Hirata T, Ushikubi F, Kakizuka A, Okuma M, Narumiya S: Two thromboxane A2

receptor isoforms in human platelets. Opposite coupling to adenylyl

cyclase with different sensitivity to Arg60 to Leu mutation. J Clin Invest

1996, 97(4):949-956.

56. Katugampola SD, Davenport AP: Thromboxane receptor density is increased

in human cardiovascular disease with evidence for inhibition at therapeutic

115

concentrations by the AT(1) receptor antagonist losartan. Br J Pharmacol

2001, 134(7):1385-1392.

57. Halushka PV, Allan CJ, Davis-Bruno KL: Thromboxane A2 receptors. J Lipid

Mediat Cell Signal 1995, 12(2-3):361-378.

58. Halushka PV: Thromboxane A(2) receptors: where have you gone?

Prostaglandins Other Lipid Mediat 2000, 60(4-6):175-189.

59. Halushka PV, Mais DE, Mayeux PR, Morinelli TA: Thromboxane,

prostaglandin and leukotriene receptors. Annu Rev Pharmacol Toxicol 1989,

29:213-239.

60. Ellis EF, Oelz O, Roberts LJ, 2nd, Payne NA, Sweetman BJ, Nies AS, Oates JA:

Coronary arterial smooth muscle contraction by a substance released from

platelets: evidence that it is thromboxane A2. Science 1976, 193(4258):1135-

1137.

61. Hunt JA, Merritt JE, MacDermot J, Keen M: Characterization of the

thromboxane receptor mediating prostacyclin release from cultured

endothelial cells. Biochem Pharmacol 1992, 43(8):1747-1752.

62. Kobayashi T, Tahara Y, Matsumoto M, Iguchi M, Sano H, Murayama T, Arai H,

Oida H, Yurugi-Kobayashi T, Yamashita JK et al: Roles of thromboxane A(2)

and prostacyclin in the development of atherosclerosis in apoE-deficient

mice. J Clin Invest 2004, 114(6):784-794.

63. Cheng Y, Austin SC, Rocca B, Koller BH, Coffman TM, Grosser T, Lawson JA,

FitzGerald GA: Role of prostacyclin in the cardiovascular response to

thromboxane A2. Science 2002, 296(5567):539-541.

116

64. Francois H, Athirakul K, Mao L, Rockman H, Coffman TM: Role for

thromboxane receptors in angiotensin-II-induced hypertension.

Hypertension 2004, 43(2):364-369.

65. Miggin SM, Kinsella BT: Expression and tissue distribution of the mRNAs

encoding the human thromboxane A2 receptor (TP) alpha and beta

isoforms. Biochim Biophys Acta 1998, 1425(3):543-559.

66. Nakahata N: Thromboxane A2: physiology/pathophysiology, cellular signal

transduction and pharmacology. Pharmacol Ther 2008, 118(1):18-35.

67. Turek JW, Halmos T, Sullivan NL, Antonakis K, Le Breton GC: Mapping of a

ligand-binding site for the human thromboxane A2 receptor protein. J Biol

Chem 2002, 277(19):16791-16797.

68. So SP, Wu J, Huang G, Huang A, Li D, Ruan KH: Identification of residues

important for ligand binding of thromboxane A2 receptor in the second

extracellular loop using the NMR experiment-guided mutagenesis

approach. J Biol Chem 2003, 278(13):10922-10927.

69. Khasawneh FT, Huang JS, Turek JW, Le Breton GC: Differential mapping of

the amino acids mediating agonist and antagonist coordination with the

human thromboxane A2 receptor protein. J Biol Chem 2006, 281(37):26951-

26965.

70. Malmsten C: Some biological effects of prostaglandin endoperoxide

analogs. Life Sci 1976, 18(2):169-176.

71. Coleman RA, Humphrey PP, Kennedy I, Levy GP, Lumley P: Comparison of

the actions of U-46619, a prostaglandin H2-analogue, with those of

117

prostaglandin H2 and thromboxane A2 on some isolated smooth muscle

preparations. Br J Pharmacol 1981, 73(3):773-778.

72. Morinelli TA, Mais DE, Oatis JE, Mayeux PR, Okwu AK, Masuda A, Knapp DR,

Halushka PV: I-BOP, the most potent radiolabelled agonist for the

TXA2/PGH2 receptor. Adv Prostaglandin Thromboxane Leukot Res 1990,

20:102-109.

73. Saussy DL, Jr., Mais DE, Dube GP, Magee DE, Brune KA, Kurtz WL, Williams

CM: Characterization of a thromboxane A2/prostaglandin H2 receptor in

guinea pig lung membranes using a radioiodinated thromboxane mimetic.

Mol Pharmacol 1991, 39(1):72-78.

74. Nicolaou KC, Magolda RL, Smith JB, Aharony D, Smith EF, Lefer AM: Synthesis

and biological properties of pinane-thromboxane A2, a selective inhibitor of

coronary artery constriction, platelet aggregation, and thromboxane

formation. Proc Natl Acad Sci U S A 1979, 76(6):2566-2570.

75. Ogletree ML, Harris DN, Greenberg R, Haslanger MF, Nakane M:

Pharmacological actions of SQ 29,548, a novel selective thromboxane

antagonist. J Pharmacol Exp Ther 1985, 234(2):435-441.

76. Francis HP, Greenham SJ, Patel UP, Thompson AM, Gardiner PJ: BAY u3405

an antagonist of thromboxane A2- and prostaglandin D2-induced

bronchoconstriction in the guinea-pig. Br J Pharmacol 1991, 104(3):596-602.

77. Rosentreter U, Boshagen H, Seuter F, Perzborn E, Fiedler VB: Synthesis and

absolute configuration of the new thromboxane antagonist (3R)-3-(4-

fluorophenylsulfonamido)-1,2,3,4-tetrahydro-9-carbazolepropan oic acid

118

and comparison with its enantiomer. Arzneimittelforschung 1989,

39(12):1519-1521.

78. Ashida Y, Matsumoto T, Kuriki H, Shiraishi M, Kato K, Terao S: A novel anti-

asthmatic quinone derivative, AA-2414 with a potent antagonistic activity

against a variety of spasmogenic prostanoids. Prostaglandins 1989,

38(1):91-112.

79. Gresele P, Deckmyn H, Nenci GG, Vermylen J: Thromboxane synthase

inhibitors, thromboxane receptor antagonists and dual blockers in

thrombotic disorders. Trends Pharmacol Sci 1991, 12(4):158-163.

80. Ushikubi F, Nakamura K, Narumiya S: Functional reconstitution of platelet

thromboxane A2 receptors with Gq and Gi2 in phospholipid vesicles. Mol

Pharmacol 1994, 46(5):808-816.

81. Shenker A, Goldsmith P, Unson CG, Spiegel AM: The G protein coupled to the

thromboxane A2 receptor in human platelets is a member of the novel Gq

family. J Biol Chem 1991, 266(14):9309-9313.

82. Vezza R, Habib A, FitzGerald GA: Differential signaling by the thromboxane

receptor isoforms via the novel GTP-binding protein, Gh. J Biol Chem 1999,

274(18):12774-12779.

83. Ashton AW, Ware JA: Thromboxane A2 receptor signaling inhibits vascular

endothelial growth factor-induced endothelial cell differentiation and

migration. Circ Res 2004, 95(4):372-379.

84. Neri Serneri GG, Gensini GF, Abbate R, Mugnaini C, Favilla S, Brunelli C,

Chierchia S, Parodi O: Increased fibrinopeptide A formation and

119

thromboxane A2 production in patients with ischemic heart disease:

relationships to coronary pathoanatomy, risk factors, and clinical

manifestations. Am Heart J 1981, 101(2):185-194.

85. Fitzgerald DJ, Roy L, Catella F, FitzGerald GA: Platelet activation in unstable

coronary disease. N Engl J Med 1986, 315(16):983-989.

86. Mehta JL, Lawson D, Mehta P, Saldeen T: Increased prostacyclin and

thromboxane A2 biosynthesis in atherosclerosis. Proc Natl Acad Sci U S A

1988, 85(12):4511-4515.

87. Willerson JT, Yao SK, Ferguson JJ, Anderson HV, Golino P, Buja LM: Unstable

angina pectoris and the progression to acute myocardial infarction. Role of

platelets and platelet-derived mediators. Tex Heart Inst J 1991, 18(4):243-

247.

88. Fuse S, Kamiya T: Plasma thromboxane B2 concentration in pulmonary

hypertension associated with congenital heart disease. Circulation 1994,

90(6):2952-2955.

89. Willerson JT, Golino P, Eidt J, Yao SK, Buja LM: Potential usefulness of

combined thromboxane A2 and serotonin receptor blockade for preventing

the conversion from chronic to acute coronary artery disease syndromes.

Am J Cardiol 1990, 66(16):48G-53G.

90. Willerson JT, Buja LM: Potential of combined thromboxane A2 and serotonin

antagonists to prevent the development of unstable angina and acute

myocardial infarction. Tex Heart Inst J 1990, 17(3):157-164.

120

91. Lariviere R, Moreau C, Rodrigue ME, Lebel M: Thromboxane blockade

reduces blood pressure and progression of renal failure independent of

endothelin-1 in uremic rats. Prostaglandins Leukot Essent Fatty Acids 2004,

71(2):103-109.

92. Guth BD, Narjes H, Schubert HD, Tanswell P, Riedel A, Nehmiz G:

Pharmacokinetics and pharmacodynamics of terbogrel, a combined

thromboxane A2 receptor and synthase inhibitor, in healthy subjects. Br J

Clin Pharmacol 2004, 58(1):40-51.

93. Dogne JM, Hanson J, de Leval X, Pratico D, Pace-Asciak CR, Drion P, Pirotte B,

Ruan KH: From the design to the clinical application of thromboxane

modulators. Curr Pharm Des 2006, 12(8):903-923.

94. Nie D, Che M, Zacharek A, Qiao Y, Li L, Li X, Lamberti M, Tang K, Cai Y, Guo Y

et al: Differential expression of thromboxane synthase in prostate

carcinoma: role in tumor cell motility. Am J Pathol 2004, 164(2):429-439.

95. Moussa O, Yordy JS, Abol-Enein H, Sinha D, Bissada NK, Halushka PV,

Ghoneim MA, Watson DK: Prognostic and functional significance of

thromboxane synthase gene overexpression in invasive bladder cancer.

Cancer Res 2005, 65(24):11581-11587.

96. Watkins G, Douglas-Jones A, Mansel RE, Jiang WG: Expression of

thromboxane synthase, TBXAS1 and the thromboxane A2 receptor,

TBXA2R, in human breast cancer. Int Semin Surg Oncol 2005, 2:23.

97. Dassesse T, de Leval X, de Leval L, Pirotte B, Castronovo V, Waltregny D:

Activation of the thromboxane A2 pathway in human prostate cancer

121

correlates with tumor Gleason score and pathologic stage. Eur Urol 2006,

50(5):1021-1031; discussion 1031.

98. Sakai H, Suzuki T, Takahashi Y, Ukai M, Tauchi K, Fujii T, Horikawa N,

Minamimura T, Tabuchi Y, Morii M et al: Upregulation of thromboxane

synthase in human colorectal carcinoma and the cancer cell proliferation

by thromboxane A2. FEBS Lett 2006, 580(14):3368-3374.

99. Moussa O, Ashton AW, Fraig M, Garrett-Mayer E, Ghoneim MA, Halushka PV,

Watson DK: Novel role of thromboxane receptors beta isoform in bladder

cancer pathogenesis. Cancer Res 2008, 68(11):4097-4104.

100. Moussa O, Riker JM, Klein J, Fraig M, Halushka PV, Watson DK: Inhibition of

thromboxane synthase activity modulates bladder cancer cell responses to

chemotherapeutic agents. Oncogene 2008, 27(1):55-62.

101. Nie D, Guo Y, Yang D, Tang Y, Chen Y, Wang MT, Zacharek A, Qiao Y, Che M,

Honn KV: Thromboxane A2 receptors in prostate carcinoma: expression

and its role in regulating cell motility via small GTPase Rho. Cancer Res

2008, 68(1):115-121.

102. Leung KC, Li MY, Leung BC, Hsin MK, Mok TS, Underwood MJ, Chen GG:

Thromboxane synthase suppression induces lung cancer cell apoptosis

via inhibiting NF-kappaB. Exp Cell Res 2010, 316(20):3468-3477.

103. Cathcart MC, Gately K, Cummins R, Kay E, O'Byrne KJ, Pidgeon GP:

Examination of thromboxane synthase as a prognostic factor and

therapeutic target in non-small cell lung cancer. Mol Cancer 2011, 10:25.

122

104. Molina MA, Sitja-Arnau M, Lemoine MG, Frazier ML, Sinicrope FA: Increased

cyclooxygenase-2 expression in human pancreatic carcinomas and cell

lines: growth inhibition by nonsteroidal anti-inflammatory drugs. Cancer

Res 1999, 59(17):4356-4362.

105. El-Bayoumy K, Rose DP, Papanikolaou N, Leszczynska J, Swamy MV, Rao CV:

Cyclooxygenase-2 expression influences the growth of human large and

small cell lung carcinoma lines in athymic mice: impact of an

organoselenium compound on growth regulation. Int J Oncol 2002,

20(3):557-561.

106. Tremblay C, Dore M, Bochsler PN, Sirois J: Induction of prostaglandin G/H

synthase-2 in a canine model of spontaneous prostatic adenocarcinoma. J

Natl Cancer Inst 1999, 91(16):1398-1403.

107. Han S, Sidell N, Roser-Page S, Roman J: Fibronectin stimulates human lung

carcinoma cell growth by inducing cyclooxygenase-2 (COX-2) expression.

Int J Cancer 2004, 111(3):322-331.

108. Hwang D, Scollard D, Byrne J, Levine E: Expression of cyclooxygenase-1 and

cyclooxygenase-2 in human breast cancer. J Natl Cancer Inst 1998,

90(6):455-460.

109. Kutchera W, Jones DA, Matsunami N, Groden J, McIntyre TM, Zimmerman GA,

White RL, Prescott SM: Prostaglandin H synthase 2 is expressed abnormally

in human colon cancer: evidence for a transcriptional effect. Proc Natl Acad

Sci U S A 1996, 93(10):4816-4820.

123

110. Gupta S, Srivastava M, Ahmad N, Bostwick DG, Mukhtar H: Over-expression of

cyclooxygenase-2 in human prostate adenocarcinoma. Prostate 2000,

42(1):73-78.

111. Tjandrawinata RR, Dahiya R, Hughes-Fulford M: Induction of cyclo-

oxygenase-2 mRNA by prostaglandin E2 in human prostatic carcinoma

cells. Br J Cancer 1997, 75(8):1111-1118.

112. Hussain T, Gupta S, Mukhtar H: Cyclooxygenase-2 and prostate

carcinogenesis. Cancer Lett 2003, 191(2):125-135.

113. Cailleteau C, Liagre B, Battu S, Jayat-Vignoles C, Beneytout JL: Increased

cyclooxygenase-2 and thromboxane synthase expression is implicated in

diosgenin-induced megakaryocytic differentiation in human

erythroleukemia cells. Anal Biochem 2008, 380(1):26-34.

114. Honn KV, Menter DG, Onoda JM, Taylor JD, Sloane BF: Role of prostacyclin

as a natural deterrent to hematogenous tumor metastasis. Symp Fundam

Cancer Res 1983, 36:361-388.

115. Cathcart MC, Reynolds JV, O'Byrne KJ, Pidgeon GP: The role of prostacyclin

synthase and thromboxane synthase signaling in the development and

progression of cancer. Biochim Biophys Acta 2010, 1805(2):153-166.

116. Honn KV: Inhibition of tumor cell metastasis by modulation of the vascular

prostacyclin/thromboxane A2 system. Clin Exp Metastasis 1983, 1(2):103-

114.

117. Honn KV, Meyer J, Neagos G, Henderson T, Westley C, Ratanatharathorn V:

Control of tumor growth and metastasis with prostacyclin and

124

thromboxane synthetase inhibitors: evidence for a new antitumor and

antimetastatic agent (BAY g 6575). Prog Clin Biol Res 1982, 89:295-331.

118. Leung KC, Hsin MK, Chan JS, Yip JH, Li M, Leung BC, Mok TS, Warner TD,

Underwood MJ, Chen GG: Inhibition of thromboxane synthase induces lung

cancer cell death via increasing the nuclear p27. Exp Cell Res 2009,

315(17):2974-2981.

119. Li X, Tai HH: Activation of thromboxane A(2) receptors induces orphan

nuclear receptor Nurr1 expression and stimulates cell proliferation in

human lung cancer cells. Carcinogenesis 2009, 30(9):1606-1613.

120. Schmidt NO, Ziu M, Cargioli T, Westphal M, Giese A, Black PM, Carroll RS:

Inhibition of thromboxane synthase activity improves glioblastoma

response to alkylation chemotherapy. Transl Oncol 2010, 3(1):43-49.

121. Pantel K, Brakenhoff RH: Dissecting the metastatic cascade. Nat Rev Cancer

2004, 4(6):448-456.

122. Kelly P, Stemmle LN, Madden JF, Fields TA, Daaka Y, Casey PJ: A role for the

G12 family of heterotrimeric G proteins in prostate cancer invasion. J Biol

Chem 2006, 281(36):26483-26490.

123. Turner EC, Kavanagh DJ, Mulvaney EP, McLean C, Wikstrom K, Reid HM,

Kinsella BT: Identification of an interaction between the TPalpha and TPbeta

isoforms of the human thromboxane A2 receptor with protein kinase C-

related kinase (PRK) 1: implications for prostate cancer. J Biol Chem 2011,

286(17):15440-15457.

125

124. Daub H, Wallasch C, Lankenau A, Herrlich A, Ullrich A: Signal characteristics

of G protein-transactivated EGF receptor. EMBO J 1997, 16(23):7032-7044.

125. Daub H, Weiss FU, Wallasch C, Ullrich A: Role of transactivation of the EGF

receptor in signalling by G-protein-coupled receptors. Nature 1996,

379(6565):557-560.

126. Gallet C, Blaie S, Levy-Toledano S, Habib A: Epidermal-growth-factor

receptor and metalloproteinases mediate thromboxane A2-dependent

extracellular-signal-regulated kinase activation. Biochem J 2003, 371(Pt

3):733-742.

127. Gao Y, Tang S, Zhou S, Ware JA: The thromboxane A2 receptor activates

mitogen-activated protein kinase via protein kinase C-dependent Gi

coupling and Src-dependent phosphorylation of the epidermal growth

factor receptor. J Pharmacol Exp Ther 2001, 296(2):426-433.

128. Fischer OM, Hart S, Gschwind A, Ullrich A: EGFR signal transactivation in

cancer cells. Biochem Soc Trans 2003, 31(Pt 6):1203-1208.

129. Della Rocca GJ, van Biesen T, Daaka Y, Luttrell DK, Luttrell LM, Lefkowitz RJ:

Ras-dependent mitogen-activated protein kinase activation by G protein-

coupled receptors. Convergence of Gi- and Gq-mediated pathways on

calcium/calmodulin, Pyk2, and Src kinase. J Biol Chem 1997, 272(31):19125-

19132.

130. Uchiyama K, Saito M, Sasaki M, Obara Y, Higashiyama S, Nakahata N:

Thromboxane A2 receptor-mediated epidermal growth factor receptor

transactivation: involvement of PKC-delta and PKC-epsilon in the shedding

126

of epidermal growth factor receptor ligands. Eur J Pharm Sci 2009,

38(5):504-511.

131. Higashiyama S, Iwabuki H, Morimoto C, Hieda M, Inoue H, Matsushita N:

Membrane-anchored growth factors, the epidermal growth factor family:

beyond receptor ligands. Cancer Sci 2008, 99(2):214-220.

132. Prigent SA, Lemoine NR: The type 1 (EGFR-related) family of growth factor

receptors and their ligands. Prog Growth Factor Res 1992, 4(1):1-24.

133. Coussens L, Yang-Feng TL, Liao YC, Chen E, Gray A, McGrath J, Seeburg PH,

Libermann TA, Schlessinger J, Francke U et al: Tyrosine kinase receptor with

extensive homology to EGF receptor shares chromosomal location with

neu oncogene. Science 1985, 230(4730):1132-1139.

134. Guy PM, Platko JV, Cantley LC, Cerione RA, Carraway KL, 3rd: Insect cell-

expressed p180erbB3 possesses an impaired tyrosine kinase activity. Proc

Natl Acad Sci U S A 1994, 91(17):8132-8136.

135. Kraus MH, Issing W, Miki T, Popescu NC, Aaronson SA: Isolation and

characterization of ERBB3, a third member of the ERBB/epidermal growth

factor receptor family: evidence for overexpression in a subset of human

mammary tumors. Proc Natl Acad Sci U S A 1989, 86(23):9193-9197.

136. Plowman GD, Culouscou JM, Whitney GS, Green JM, Carlton GW, Foy L,

Neubauer MG, Shoyab M: Ligand-specific activation of HER4/p180erbB4, a

fourth member of the epidermal growth factor receptor family. Proc Natl

Acad Sci U S A 1993, 90(5):1746-1750.

127

137. Ullrich A, Coussens L, Hayflick JS, Dull TJ, Gray A, Tam AW, Lee J, Yarden Y,

Libermann TA, Schlessinger J et al: Human epidermal growth factor receptor

cDNA sequence and aberrant expression of the amplified gene in A431

epidermoid carcinoma cells. Nature 1984, 309(5967):418-425.

138. Prenzel N, Fischer OM, Streit S, Hart S, Ullrich A: The epidermal growth factor

receptor family as a central element for cellular signal transduction and

diversification. Endocr Relat Cancer 2001, 8(1):11-31.

139. Bazley LA, Gullick WJ: The epidermal growth factor receptor family.

Endocrine-related cancer 2005, 12 Suppl 1:S17-27.

140. Foley J, Nickerson NK, Nam S, Allen KT, Gilmore JL, Nephew KP, Riese DJ,

2nd: EGFR signaling in breast cancer: bad to the bone. Semin Cell Dev Biol

2010, 21(9):951-960.

141. Normanno N, Bianco C, Strizzi L, Mancino M, Maiello MR, De Luca A, Caponigro

F, Salomon DS: The ErbB receptors and their ligands in cancer: an

overview. Curr Drug Targets 2005, 6(3):243-257.

142. Olayioye MA, Neve RM, Lane HA, Hynes NE: The ErbB signaling network:

receptor heterodimerization in development and cancer. The EMBO journal

2000, 19(13):3159-3167.

143. Wells A: EGF receptor. Int J Biochem Cell Biol 1999, 31(6):637-643.

144. Yarden Y, Sliwkowski MX: Untangling the ErbB signalling network. Nat Rev

Mol Cell Biol 2001, 2(2):127-137.

128

145. Sundvall M, Iljin K, Kilpinen S, Sara H, Kallioniemi OP, Elenius K: Role of ErbB4

in breast cancer. Journal of mammary gland biology and neoplasia 2008,

13(2):259-268.

146. Roskoski R, Jr.: The ErbB/HER receptor protein-tyrosine kinases and

cancer. Biochem Biophys Res Commun 2004, 319(1):1-11.

147. Muraoka-Cook RS, Feng SM, Strunk KE, Earp HS, 3rd: ErbB4/HER4: role in

mammary gland development, differentiation and growth inhibition. Journal

of mammary gland biology and neoplasia 2008, 13(2):235-246.

148. Cooper O, Vlotides G, Fukuoka H, Greene MI, Melmed S: Expression and

function of ErbB receptors and ligands in the pituitary. Endocrine-related

cancer 2011, 18(6):R197-211.

149. Sebastian S, Settleman J, Reshkin SJ, Azzariti A, Bellizzi A, Paradiso A: The

complexity of targeting EGFR signalling in cancer: from expression to

turnover. Biochim Biophys Acta 2006, 1766(1):120-139.

150. Yarden Y: The EGFR family and its ligands in human cancer. signalling

mechanisms and therapeutic opportunities. Eur J Cancer 2001, 37 Suppl

4:S3-8.

151. Carraway KL, 3rd, Weber JL, Unger MJ, Ledesma J, Yu N, Gassmann M, Lai C:

Neuregulin-2, a new ligand of ErbB3/ErbB4-receptor tyrosine kinases.

Nature 1997, 387(6632):512-516.

152. Chang H, Riese DJ, 2nd, Gilbert W, Stern DF, McMahan UJ: Ligands for ErbB-

family receptors encoded by a neuregulin-like gene. Nature 1997,

387(6632):509-512.

129

153. Harari D, Tzahar E, Romano J, Shelly M, Pierce JH, Andrews GC, Yarden Y:

Neuregulin-4: a novel growth factor that acts through the ErbB-4 receptor

tyrosine kinase. Oncogene 1999, 18(17):2681-2689.

154. Ono M, Kuwano M: Molecular mechanisms of epidermal growth factor

receptor (EGFR) activation and response to gefitinib and other EGFR-

targeting drugs. Clin Cancer Res 2006, 12(24):7242-7251.

155. Willmarth NE, Ethier SP: Amphiregulin as a novel target for breast cancer

therapy. J Mammary Gland Biol Neoplasia 2008, 13(2):171-179.

156. Berasain C, Castillo J, Perugorria MJ, Prieto J, Avila MA: Amphiregulin: a new

growth factor in hepatocarcinogenesis. Cancer Lett 2007, 254(1):30-41.

157. Sehgal I, Bailey J, Hitzemann K, Pittelkow MR, Maihle NJ: Epidermal growth

factor receptor-dependent stimulation of amphiregulin expression in

androgen-stimulated human prostate cancer cells. Mol Biol Cell 1994,

5(3):339-347.

158. Bostwick DG, Qian J, Maihle NJ: Amphiregulin expression in prostatic

intraepithelial neoplasia and adenocarcinoma: a study of 93 cases. Prostate

2004, 58(2):164-168.

159. Plowman GD, Green JM, McDonald VL, Neubauer MG, Disteche CM, Todaro

GJ, Shoyab M: The amphiregulin gene encodes a novel epidermal growth

factor-related protein with tumor-inhibitory activity. Mol Cell Biol 1990,

10(5):1969-1981.

160. Johansson CC, Yndestad A, Enserink JM, Ree AH, Aukrust P, Tasken K: The

epidermal growth factor-like growth factor amphiregulin is strongly

130

induced by the adenosine 3',5'-monophosphate pathway in various cell

types. Endocrinology 2004, 145(11):5177-5184.

161. Shao J, Lee SB, Guo H, Evers BM, Sheng H: Prostaglandin E2 stimulates the

growth of colon cancer cells via induction of amphiregulin. Cancer Res

2003, 63(17):5218-5223.

162. Du B, Altorki NK, Kopelovich L, Subbaramaiah K, Dannenberg AJ: Tobacco

smoke stimulates the transcription of amphiregulin in human oral epithelial

cells: evidence of a cyclic AMP-responsive element binding protein-

dependent mechanism. Cancer Res 2005, 65(13):5982-5988.

163. Kansra S, Stoll SW, Johnson JL, Elder JT: Src family kinase inhibitors block

amphiregulin-mediated autocrine ErbB signaling in normal human

keratinocytes. Molecular pharmacology 2005, 67(4):1145-1157.

164. Lee SB, Huang K, Palmer R, Truong VB, Herzlinger D, Kolquist KA, Wong J,

Paulding C, Yoon SK, Gerald W et al: The Wilms tumor suppressor WT1

encodes a transcriptional activator of amphiregulin. Cell 1999, 98(5):663-

673.

165. Normanno N, Selvam MP, Qi CF, Saeki T, Johnson G, Kim N, Ciardiello F,

Shoyab M, Plowman G, Brandt R et al: Amphiregulin as an autocrine growth

factor for c-Ha-ras- and c-erbB-2-transformed human mammary epithelial

cells. Proc Natl Acad Sci U S A 1994, 91(7):2790-2794.

166. Sorensen BS, Torring N, Bor MV, Nexo E: Quantitation of the mRNA

expression of the epidermal growth factor system: selective induction of

heparin-binding epidermal growth factor-like growth factor and

131

amphiregulin expression by growth factor stimulation of prostate stromal

cells. J Lab Clin Med 2000, 136(3):209-217.

167. Baillo A, Giroux C, Ethier SP: Knock-down of amphiregulin inhibits cellular

invasion in inflammatory breast cancer. J Cell Physiol 2011, 226(10):2691-

2701.

168. Willmarth NE, Ethier SP: Autocrine and juxtacrine effects of amphiregulin on

the proliferative, invasive, and migratory properties of normal and

neoplastic human mammary epithelial cells. J Biol Chem 2006,

281(49):37728-37737.

169. Busser B, Sancey L, Brambilla E, Coll JL, Hurbin A: The multiple roles of

amphiregulin in human cancer. Biochim Biophys Acta 2011, 1816(2):119-131.

170. Hernes E, Fossa SD, Berner A, Otnes B, Nesland JM: Expression of the

epidermal growth factor receptor family in prostate carcinoma before and

during androgen-independence. Br J Cancer 2004, 90(2):449-454.

171. Mimeault M, Pommery N, Henichart JP: New advances on prostate

carcinogenesis and therapies: involvement of EGF-EGFR transduction

system. Growth Factors 2003, 21(1):1-14.

172. Zellweger T, Ninck C, Bloch M, Mirlacher M, Koivisto PA, Helin HJ, Mihatsch MJ,

Gasser TC, Bubendorf L: Expression patterns of potential therapeutic targets

in prostate cancer. Int J Cancer 2005, 113(4):619-628.

173. Di Lorenzo G, Tortora G, D'Armiento FP, De Rosa G, Staibano S, Autorino R,

D'Armiento M, De Laurentiis M, De Placido S, Catalano G et al: Expression of

epidermal growth factor receptor correlates with disease relapse and

132

progression to androgen-independence in human prostate cancer. Clin

Cancer Res 2002, 8(11):3438-3444.

174. Mimeault M, Batra SK: Recent advances on multiple tumorigenic cascades

involved in prostatic cancer progression and targeting therapies.

Carcinogenesis 2006, 27(1):1-22.

175. Torring N, Jorgensen PE, Sorensen BS, Nexo E: Increased expression of

heparin binding EGF (HB-EGF), amphiregulin, TGF alpha and epiregulin in

androgen-independent prostate cancer cell lines. Anticancer Res 2000,

20(1A):91-95.

176. Wei J, Yan W, Li X, Ding Y, Tai HH: Thromboxane receptor alpha mediates

tumor growth and angiogenesis via induction of vascular endothelial

growth factor expression in human lung cancer cells. Lung Cancer 2010,

69(1):26-32.

177. Shirasaki H, Kikuchi M, Seki N, Kanaizumi E, Watanabe K, Himi T: Expression

and localization of the thromboxane A2 receptor in human nasal mucosa.

Prostaglandins Leukot Essent Fatty Acids 2007, 76(6):315-320.

178. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using

real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods

2001, 25(4):402-408.

179. Ustach CV, Taube ME, Hurst NJ, Jr., Bhagat S, Bonfil RD, Cher ML, Schuger L,

Kim HR: A potential oncogenic activity of platelet-derived growth factor d in

prostate cancer progression. Cancer Res 2004, 64(5):1722-1729.

133

180. Jacob D DJ, Fang B:: Xenograftic tumor models in mice for cancer research,

a technical review. Gene Therapy And Molecular Biology 2004, 8:213-219.

181. Yamaoka M, Yamamoto T, Ikeyama S, Sudo K, Fujita T: Angiogenesis

inhibitor TNP-470 (AGM-1470) potently inhibits the tumor growth of

hormone-independent human breast and prostate carcinoma cell lines.

Cancer Res 1993, 53(21):5233-5236.

182. Ito Y, Iwamoto Y, Tanaka K, Okuyama K, Sugioka Y: A quantitative assay

using basement membrane extracts to study tumor angiogenesis in vivo.

Int J Cancer 1996, 67(1):148-152.

183. Nie D, Hillman GG, Geddes T, Tang K, Pierson C, Grignon DJ, Honn KV:

Platelet-type 12-lipoxygenase in a human prostate carcinoma stimulates

angiogenesis and tumor growth. Cancer Res 1998, 58(18):4047-4051.

184. Moussa O, Ciupek A, Watson DK, Halushka PV: Urinary thromboxane B2 and

thromboxane receptors in bladder cancer: opportunity for detection and

monitoring. Prostaglandins Other Lipid Mediat 2011, 96(1-4):41-44.

185. Ruan KH, Cervantes V, Wu J: A simple, quick, and high-yield preparation of

the human thromboxane A2 receptor in full size for structural studies.

Biochemistry 2008, 47(26):6819-6826.

186. Nie D, Lamberti M, Zacharek A, Li L, Szekeres K, Tang K, Chen Y, Honn KV:

Thromboxane A(2) regulation of endothelial cell migration, angiogenesis,

and tumor metastasis. Biochem Biophys Res Commun 2000, 267(1):245-251.

187. Wei J, Yan W, Li X, Chang WC, Tai HH: Activation of thromboxane receptor

alpha induces expression of cyclooxygenase-2 through multiple signaling

134

pathways in A549 human lung adenocarcinoma cells. Biochem Pharmacol

2007, 74(5):787-800.

188. Taylor BS, Schultz N, Hieronymus H, Gopalan A, Xiao Y, Carver BS, Arora VK,

Kaushik P, Cerami E, Reva B et al: Integrative genomic profiling of human

prostate cancer. Cancer Cell 2010, 18(1):11-22.

189. Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, Jacobsen A,

Byrne CJ, Heuer ML, Larsson E et al: The cBio cancer genomics portal: an

open platform for exploring multidimensional cancer genomics data.

Cancer Discov 2012, 2(5):401-404.

190. Zhang M, Dong Y, Xu J, Xie Z, Wu Y, Song P, Guzman M, Wu J, Zou MH:

Thromboxane receptor activates the AMP-activated protein kinase in

vascular smooth muscle cells via hydrogen peroxide. Circ Res 2008,

102(3):328-337.

191. Green AS, Chapuis N, Lacombe C, Mayeux P, Bouscary D, Tamburini J:

LKB1/AMPK/mTOR signaling pathway in hematological malignancies: from

metabolism to cancer cell biology. Cell Cycle 2011, 10(13):2115-2120.

192. Green AS, Chapuis N, Maciel TT, Willems L, Lambert M, Arnoult C, Boyer O,

Bardet V, Park S, Foretz M et al: The LKB1/AMPK signaling pathway has

tumor suppressor activity in acute myeloid leukemia through the

repression of mTOR-dependent oncogenic mRNA translation. Blood 2010,

116(20):4262-4273.

193. Gruzman A, Babai G, Sasson S: Adenosine Monophosphate-Activated

Protein Kinase (AMPK) as a New Target for Antidiabetic Drugs: A Review

135

on Metabolic, Pharmacological and Chemical Considerations. Rev Diabet

Stud 2009, 6(1):13-36.

194. Schneider A, Gartenhaus RB: AMPK signaling: a targetable tumor

suppressor pathway? Cancer Biol Ther 2010, 10(11):1178-1181.

195. Chen P, Gupta K, Wells A: Cell movement elicited by epidermal growth

factor receptor requires kinase and autophosphorylation but is separable

from mitogenesis. J Cell Biol 1994, 124(4):547-555.

196. Chen P, Xie H, Sekar MC, Gupta K, Wells A: Epidermal growth factor

receptor-mediated cell motility: phospholipase C activity is required, but

mitogen-activated protein kinase activity is not sufficient for induced cell

movement. J Cell Biol 1994, 127(3):847-857.

197. Thomas SM, Bhola NE, Zhang Q, Contrucci SC, Wentzel AL, Freilino ML,

Gooding WE, Siegfried JM, Chan DC, Grandis JR: Cross-talk between G

protein-coupled receptor and epidermal growth factor receptor signaling

pathways contributes to growth and invasion of head and neck squamous

cell carcinoma. Cancer Res 2006, 66(24):11831-11839.

198. Moghal N, Sternberg PW: Multiple positive and negative regulators of

signaling by the EGF-receptor. Curr Opin Cell Biol 1999, 11(2):190-196.

199. Hackel PO, Zwick E, Prenzel N, Ullrich A: Epidermal growth factor receptors:

critical mediators of multiple receptor pathways. Curr Opin Cell Biol 1999,

11(2):184-189.

136

200. Kim HG, Kassis J, Souto JC, Turner T, Wells A: EGF receptor signaling in

prostate morphogenesis and tumorigenesis. Histol Histopathol 1999,

14(4):1175-1182.

201. Connolly JM, Rose DP: Enhanced angiogenesis and growth of 12-

lipoxygenase gene-transfected MCF-7 human breast cancer cells in

athymic nude mice. Cancer Lett 1998, 132(1-2):107-112.

202. Carmeliet P, Jain RK: Angiogenesis in cancer and other diseases. Nature

2000, 407(6801):249-257.

203. Ferrara N: Vascular endothelial growth factor: basic science and clinical

progress. Endocr Rev 2004, 25(4):581-611.

204. Lichtenberger BM, Tan PK, Niederleithner H, Ferrara N, Petzelbauer P, Sibilia M:

Autocrine VEGF signaling synergizes with EGFR in tumor cells to promote

epithelial cancer development. Cell 2010, 140(2):268-279.

205. Tabernero J: The role of VEGF and EGFR inhibition: implications for

combining anti-VEGF and anti-EGFR agents. Mol Cancer Res 2007, 5(3):203-

220.

206. Perrotte P, Matsumoto T, Inoue K, Kuniyasu H, Eve BY, Hicklin DJ, Radinsky R,

Dinney CP: Anti-epidermal growth factor receptor antibody C225 inhibits

angiogenesis in human transitional cell carcinoma growing orthotopically

in nude mice. Clin Cancer Res 1999, 5(2):257-265.

207. Marks RA, Zhang S, Montironi R, McCarthy RP, MacLennan GT, Lopez-Beltran

A, Jiang Z, Zhou H, Zheng S, Davidson DD et al: Epidermal growth factor

receptor (EGFR) expression in prostatic adenocarcinoma after hormonal

137

therapy: a fluorescence in situ hybridization and immunohistochemical

analysis. Prostate 2008, 68(9):919-923.

208. Kneissl J, Keller S, Lorber T, Heindl S, Keller G, Drexler I, Hapfelmeier A, Hofler

H, Luber B: Association of amphiregulin with the cetuximab sensitivity of

gastric cancer cell lines. Int J Oncol 2012, 41(2):733-744.

209. Davies MR, Harding CJ, Raines S, Tolley K, Parker AE, Downey-Jones M,

Needham MR: Nurr1 dependent regulation of pro-inflammatory mediators in

immortalised synovial fibroblasts. J Inflamm (Lond) 2005, 2:15.

210. Ashton AW, Cheng Y, Helisch A, Ware JA: Thromboxane A2 receptor

agonists antagonize the proangiogenic effects of fibroblast growth factor-

2: role of receptor internalization, thrombospondin-1, and alpha(v)beta3.

Circ Res 2004, 94(6):735-742.

211. Honn KV, Cicone B, Skoff A: Prostacyclin: a potent antimetastatic agent.

Science (New York, NY) 1981, 212(4500):1270-1272.

212. Menter DG, Onoda JM, Taylor JD, Honn KV: Effects of prostacyclin on tumor

cell-induced platelet aggregation. Cancer Res 1984, 44(2):450-456.

213. Honn KV, Cavanaugh P, Evens C, Taylor JD, Sloane BF: Tumor cell-platelet

aggregation: induced by cathepsin B-like proteinase and inhibited by

prostacyclin. Science 1982, 217(4559):540-542.

214. Menter DG, Harkins C, Onoda J, Riorden W, Sloane BF, Taylor JD, Honn KV:

Inhibition of tumor cell induced platelet aggregation by prostacyclin and

carbacyclin: an ultrastructural study. Invasion Metastasis 1987, 7(2):109-128.

138

215. Menter DG, Onoda JM, Moilanen D, Sloane BF, Taylor JD, Honn KV: Inhibition

by prostacyclin of the tumor cell-induced platelet release reaction and

platelet aggregation. J Natl Cancer Inst 1987, 78(5):961-969.

216. Schneider MR, Tang DG, Schirner M, Honn KV: Prostacyclin and its

analogues: antimetastatic effects and mechanisms of action. Cancer

Metastasis Rev 1994, 13(3-4):349-364.

139

ABSTRACT

ROLE OF THROMBOXANE RECEPTOR-ALPHA IN PROSTATE CANCER PROGRESSION

PRASANNA EKAMBARAM

December 2012

Advisor: Dr. Kenneth.V.Honn

Major: Cancer Biology

Degree: Doctor of Philosophy

Thromboxane A2 (TXA2) is a major arachidonic acid metabolite that signals through TXA2 receptors (TP) to induce platelet aggregation and smooth muscle contraction. TXA2 receptors are expressed as two different isoforms in humans, namely

TP-alpha (TPα) and TP-beta (TPβ), which have common and distinct signaling pathways. Of the two TP receptor isoforms, studies have shown that TPα impacts tumor growth and progression of lung cancer. Previously our studies demonstrated that activation of Thromboxane receptor by TXA2 agonists could regulate prostate cancer

(PCa) cell motility and cytoskeletal reorganization through activation of Rho-A. The primary objective of this study is to investigate the functional role of TPα in prostate cancer progression and metastasis.

Our data indicates that of the two TPR isoforms, human PCa cell lines only express TPα and that expression of TPα is higher in PCa cells compared to cultured normal prostate epithelial cells, such as RWPE1. Furthermore, expression of TPα was observed to be higher in clinical PCa specimens when compared with normal tissue,

140 and expression was higher in tumor tissues with Gleason scores of 7 and above. In response to the TXA2 mimetic, IBOP, DU145 cells that have higher endogenous levels of TPα compared to other cell lines, up regulated expression of the growth factor

Amphiregulin (AREG) and its receptor EGFR. Introduction of an expression plasmid encoding TPα into another PCa cell line, PC3 (PC3-TPα), led to a similar phenotype in response to IBOP, thereby confirming a link between TPα and over expression of AREG and EGFR.

Increase in AREG expression mediated by TPα seems to involve EGFR and

AMP activated protein kinase (AMPK) signaling pathways. PC3-TPα cells treated with

IBOP were also highly invasive compared to PC3-Neo cells; this invasiveness mediated by TPα was affected by pre treatment with an EGFR inhibitor. In a subcutaneous animal model, mice injected with PC3-TPα exhibited greater tumor growth and increased neo vascularization compared to mice with PC3-Neo cells. Also when mice was injected with

PC3-TPα cells and Matrigel BME, increased angiogenesis was observed as indicated by the accumulation of blood compared to mice with PC3-Neo cells. Collectively these data suggest that activation of TPα receptor in PCa cells increases the level of growth factors such as AREG and its receptor EGFR that might be mediated through AMPK, thereby implicating TPα in prostate cancer progression.

141

AUTOBIOGRAPHICAL STATEMENT

Prasanna Ekambaram

Education

Ph.D. – Cancer Biology, School of Medicine, Wayne State University, Detroit, MI

M.S. - Biotechnology, University of Texas at San Antonio, San Antonio, TX, USA

B.Sc. - Horticulture, Annamalai University, Tamilnadu, India

Awards and honors

¯ Third place prize in the annual Graduate Student Research Day (GSRD) XIII poster session II, September 2009, Detroit, MI

¯ Travel Award to participate in American Association for Cancer Research’s (AACR) 102nd Annual Meeting, held in Orlando, Fla., April 2-6, 2011.

¯ Travel Award to participate in Bioactive Lipids Eicosanoid International research conference, October 2009, Cancun, Mexico.

¯ Gold medalist in Plant Breeding and Genetics, BSc (Horticulture), Annamalai University, January 2001, Tamilnadu, India.

Publications

• Hsu A, Zhang W, Lee JF, An J, Ekambaram P, Liu J, Honn KV, Lee MJ. Sphingosine-1-phosphate receptor-3 signaling up-regulates epidermal growth factor receptor and enhances epidermal growth factor receptor-mediated carcinogenic activities in cultured lung adenocarcinoma cells. (International Journal of Oncology, 2012 May; 40(5): 1619-26)

• Ekambaram P, Lambiv W, Cazzolli R, Ashton AW, Honn KV. The thromboxane synthase and receptor signaling pathway in cancer: an emerging paradigm in cancer progression and metastasis. (Cancer Metastasis Reviews 2011 Dec30 (3-4):397- 408)

• Guo Y, Zhang W, Giroux G, Cai Y, Ekambaram P, Dilly AK, Hsu A, Zhou S, Maddipati KR, Liu J, Joshi S, Tucker SC, Lee MJ, Honn KV. Identification of the Receptor for the Human Lipoxygenase Product 12(S)-HETE that Regulates Prostate Tumors and their Progression (Journal of Biological Chemistry. 2011 Sep 30;286(39):33832-40)