The Pitx2 Homeobox Protein Is Required Early for Endoderm

Developmental Biology 229, 287–306 (2001) doi:10.1006/dbio.2000.9950, available online at http://www.idealibrary.com on

View metadata, citation and similar papers at core.ac.uk brought to you by CORE The Pitx2 Homeobox Protein Is Required Early forprovided by Elsevier - Publisher Connector Endoderm Formation and Nodal Signaling

Marion Faucourt,* Evelyn Houliston,* Lydia Besnardeau,* David Kimelman,† and Thierry Lepage*,1

*Observatoire Oceanologique, UMR 7009 CNRS, Universite´de Paris VI, 06230 Villefranche- sur-Mer, France; and †Department of Biochemistry, University of Washington, Seattle, Washington 98195-7350

Nodal and Nodal-related factors play fundamental roles in a number of developmental processes, including mesoderm and endoderm formation, patterning of the anterior neural plate, and determination of bilateral asymmetry in vertebrates. pitx2, a paired-like homeobox gene, has been proposed to act downstream of Nodal in the gene cascade providing left–right cues to the developing organs. Here, we report that pitx2 is required early in the Nodal signaling pathway for specification of the endodermal and mesodermal germ layers. We found that pitx2 is expressed very early during Xenopus and zebrafish development and in many regions where Nodal signaling is required, including the presumptive mesoderm and endoderm at the blastula and gastrula stages and the prechordal mesoderm at later stages. In Xenopus embryos, overexpression of pitx2 caused ectopic expression of goosecoid and sox-17␤ and interfered with mesoderm formation. Overexpression of pitx2 in Xenopus animal cap explants partially mimics the effects of Nodal overexpression, suggesting that pitx2 is a mediator of Nodal signaling during specification of the endoderm and prechordal plate, but not during mesoderm induction. We further demonstrate that pitx2 is induced by Nodal signaling in Xenopus animal caps and that the early expression of zebrafish pitx2 is absent when the Nodal signaling pathway is inactive. Inhibition of pitx2 function using a chimeric EnR-pitx2 blocked specification of the mesoderm and endoderm and caused severe embryonic defects resembling those seen when Nodal signaling is inhibited. Following inhibition of pitx2 function, the fate of ventral vegetal blastomeres was shifted from an endodermal to a more mesodermal fate, an effect that was reversed by wild-type pitx2. Finally, we show that inhibition of pitx2 function interferes with the response of cells to Nodal signaling. Our results provide direct evidence that pitx2 function is required for normal specification of the endodermal and mesodermal germ layers. © 2000 Academic Press Key Words: pitx2; homeobox; Nodal signaling; endoderm; sox-17; Xbra; goosecoid; antivin; Xenopus; zebrafish; Rieger syndrome.

INTRODUCTION mouse. nodal mutant embryos are characterized by a severe reduction in the amount of mesoderm formed and abnormal The Nodal signaling pathway plays crucial roles during migration of residual mesodermal cells (Conlon et al., 1994; vertebrate embryogenesis. Nodal signals have been impli- Zhou et al., 1993). The importance of nodal during early cated in germ-layer specification, patterning of the nervous development has been further demonstrated by studies in system, and determination of the bilateral asymmetry of Xenopus and zebrafish. Several Xenopus homologues of organs (reviewed by Schier and Shen, 2000). The nodal gene nodal have been isolated and two of them, Xnr-1 and Xnr-2, was first identified as a gene essential for gastrulation in are expressed transiently in the vegetal hemisphere at the blastula stage and in the region of the Spemann organizer

1 during gastrulation (Jones et al., 1995b; Lustig et al., 1996). To whom correspondence should be addressed at Observatoire Oceanologique, UMR 7009 CNRS, Universite´ de Paris VI, 06230 Both genes have activities similar to those of mouse nodal Villefranche-sur-Mer, France. Fax: (33) 4 93 76 37 92. E-mail: and act as potent mesoderm and endoderm inducers. More- [email protected]. over, inhibition of Xnr signaling using a dominant negative

0012-1606/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved. 287 288 Faucourt et al. cleavage mutant, Xnr-2, or the nodal antagonist cerberus heart and gut (reviewed by Capdevila et al., 2000). One blocks mesendoderm specification (Agius et al., 2000; important mediator of Nodal signaling in this process is the Osada and Wright, 1999). homeobox gene pitx2 (Campione et al., 1999; Logan et al., In zebrafish, analysis of mutations in the nodal-related 1998; Piedra et al., 1998; Ryan et al., 1998; Yoshioka et al., loci cyclops and squint clearly demonstrates a requirement 1998). In mouse, chick, Xenopus, and zebrafish embryos, for these factors in mesoderm and endoderm formation as pitx2 is expressed in the left lateral plate mesoderm in a well as in patterning of the nervous system. cyclops is pattern strikingly similar to that of nodal, and pitx2 expres- expressed in prospective mesendoderm at the beginning of sion in this tissue can be induced by nodal. Several Pitx2 gastrulation and then in the prechordal plate (Rebagliati et isoforms are generated by alternative splicing of 5Ј exons al., 1998; Sampath et al., 1998). cyclops mutant embryos and utilization of different promoters (Arakawa et al., 1998; have a severe deletion of ventral brain and neural tube Gage and Camper, 1997; Semina et al., 1996) and one of tissues, resulting in fusion of the two eyes anteriorly (Hatta these isoforms, pitx2c, has been implicated specifically in et al., 1991). The squint mutation causes a similar cyclopic the response to Nodal signaling (Essner et al., 2000; Schwe- phenotype, while the squint;cyclops double mutants dis- ickert et al., 2000). Functional experiments in which pitx2 play a striking loss of both endoderm and dorsal mesoderm, was ectopically expressed on the right side of vertebrate revealing a functional redundancy between these two genes embryos and analysis of pitx2 expression in different mouse in endoderm and mesoderm specification (Feldman et al., mutants with laterality defects suggest that this transcrip- 1998, 2000; Gritsman et al., 1999). Similarly, embryos tion factor acts downstream of nodal in the pathway lacking the product of the one-eyed pinhead gene, which controlling left–right asymmetry. encodes a cofactor essential for Nodal signaling, lack both In this paper, we describe the early expression pattern of endodermal and mesodermal tissues (Gritsman et al., 1999). pitx2 and analyze the role of this gene in the establishment A number of observations on Xenopus and zebrafish of the primary germ layers and of the body plan of the embryos further suggest that the level of Nodal signaling is embryo. We provide evidence that Pitx2, which has been directly responsible for the segregation between the implicated mainly in the establishment of bilateral asym- endodermal and the mesodermal germ layers. A high level metry, is also required in early development for the Nodal- of signaling is required for specification of the endoderm mediated induction of the endoderm. We report that in Xenopus pitx2 while a lower level of signaling promotes mesoderm forma- and zebrafish embryos, is expressed very early, with pitx2 transcripts accumulating in tissues which tion (Alexander et al., 1999; Clements et al., 1999; Erter et require Nodal signaling, including the presumptive mesen- al., 1998; Gritsman et al., 2000; Henry et al., 1996; Jones et doderm at the blastula stages and the prechordal mesoderm al., 1995a; Piccolo et al., 1999; Rodaway et al., 1999; Sun et in the late gastrula and neurula stages. Moreover, we show al., 1999; Yasuo and Lemaire, 1999). Recent studies have that in the early Xenopus embryo, Xnr-1 induces several revealed that normal specification of the mesoderm and pitx2 isoforms and that in zebrafish, the early phase of pitx2 endoderm indeed requires a fine regulation of the Nodal expression is strictly dependent on Nodal signaling. Over- signaling pathway. This modulation is achieved by a nega- expression of pitx2 in Xenopus reproduces a subset of the tive feedback mechanism which relies on secreted inhibi- molecular responses elicited by Nodal, inducing endoder- tors of Nodal/Activin signaling whose transcription is in- mal but not mesodermal markers. Moreover, inhibiting duced by Nodal/Activin signaling. When overexpressed, pitx2 function diverts vegetal cells from their endodermal these inhibitors completely suppress formation of endoder- fate, preventing or drastically reducing the expression of et al., mal and mesodermal derivatives (Bisgrove 1999; several endodermal markers and resulting in severe dor- Cheng et al., 2000; Thisse and Thisse, 1999). Conversely, soanterior deficiencies. Finally, we present evidence that mutations inactivating the genes encoding these inhibitors inhibition of pitx2 function blocks the ability of embryonic cause formation of an excess of mesoderm, a phenotype cells to respond to Nodal signaling. opposite to that of Nodal mutants (Meno et al., 1998). Our results indicate that pitx2 functions as a regulator of While differential Nodal signaling can be achieved by endodermal specification, as an important component of localized expression of the signals and cofactors as well as the Nodal signaling pathway. of the inhibitors of signaling, little is known regarding the role of downstream effector genes in segregation and patterning of the primordial germ layers. MATERIALS AND METHODS Nodal and Nodal-related factors are required not only during early patterning events, but also later in the pathway Isolation of the Xenopus and Zebrafish pitx2 and determining bilateral asymmetries in the embryo. In all Plasmid Construction vertebrate embryos examined so far, members of the nodal We identified zebrafish pitx2 in a PCR-based screen for new family such as nodal or Xnr-1 are expressed in the left, but homeobox genes of the paired-like family expressed at the gastrula not in the right, lateral plate where they control the stage. DNA fragments corresponding to conserved regions of asymmetric positioning of the visceral organs such as the paired-like type homeoproteins were amplified from gastrula stage

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved. pitx2 Is Required for Nodal Signaling 289 cDNA using RT-PCR and the following oligonucleotides: forward, In Situ Hybridization 5Ј-TTYSAIMKIAAYMYITAYCCIGAYTT, and reverse, 5Ј-CKRT- In situ TYTGRAACCAIAYYTGDATNC. hybridization was performed according to Harland (1991) et al. After cloning and sequencing, selected cDNA fragments were and Lemaire (1995) with antisense RNA probes corresponding Xenopus used as probes to screen a zebrafish gastrula cDNA library (T. to the whole sequence of the or zebrafish cDNAs and pitx2 Lepage, unpublished). One clone, which contained a 1927-bp insert, which thus recognize the different transcripts. In some cases, Xenopus was sequenced on both strands allowing identification of a unique embryos were bisected after fixation in order to facilitate pitx2, chordin 933-bp open reading frame. Comparison of the protein sequence access of the probes to the endodermal cells. (Sasai et al., sox-17␤ et al., cerberus encoded by this ORF with the protein sequences in GenBank 1994), (Hudson 1997), (Bouwmeester et al., goosecoid et al., showed that it was likely the zebrafish homologue of the mouse 1996), and (Niehrs 1994) were linearized Eco Xotx-2 et al., Pitx2b (Gage and Camper, 1997; Mucchielli et al., 1997; Semina et with RI and transcribed with T7. (Lamb 1993) was Not Xbra et al., 1996). The N-terminal sequence of this protein, which was linearized with I and transcribed with T7 and (Smith al., Cla nevertheless different from that of the mouse Pitx2b, was subse- 1991) was linearized with I and transcribed with T7. quently found to be very similar to the N-terminal region of the mouse Pitx2c isoform (Arakawa et al., 1998). This clone thus RNA Extraction and RT-PCR corresponds to a full-length zebrafish pitx2c transcript. Total RNA from staged embryos was extracted by the method of cDNA clones for the Xenopus pitx2 gene were isolated from a Chomczynski and Sacchi (1987). For RT-PCR, cDNA synthesis and Xenopus dorsalized early gastrula cDNA library (kindly provided PCR were performed as described by Hudson (1997). Primers pairs by P. Lemaire) using as probe the full-length zebrafish pitx2c cDNA for Xsox-17␤, histone H4, cerberus, XAG, otx-2, Xanf-1, Xanf-2, clone previously isolated. Full-length clones corresponding to Frzb-1, dkk-1, mixer, siamois, chordin, GATA-4, and antivin were pitx2b and pitx2c were obtained and sequenced on both strands. A synthesized according to previous published reports. third, pitx2d, transcript was sequenced partially. The coding se- Other primer pairs used in this study were (the 5Ј sequences in quence of Xenopus pitx2b or pitx2c isoforms was amplified by PCR brackets do not prime in the Xpitx2 gene) Xpitx2b forward, 5Ј- using the Pfu DNA polymerase and inserted at the EcoRI–XbaI [CCATCGAT]CTGGTAACAGAATGGACA (amplified fragment sites of pCS2 (Turner and Weintraub, 1994) to generate 214 bp), Xpitx2b reverse, 5Ј-[ACCGAGCTC]ACCGCCACTT- pCS2Xpitx2b or pCS2Xpitx2c. In the pCSXpitx2 K 3 E construct, TGGTGAATTC; Xpitx2c forward, 5Ј -[CGCGGAT- the AAG codon encoding a lysine residue in position 50 of the CC]ACCATGAACTCTATGAAAGAG (amplified fragment 225 homeobox was mutated to GAG using complementary oligonucle- bp), Xpitx2c reverse, 5Ј-[ACCGAGCTC]TGCAGCTTCTGGGCT- otides bearing a single mismatch. GGAG; Xpitx2d forward, 5Ј -ATAACAAGCCAAAC- The EnR-pitx2 (EnR on the N-terminus) construct was obtained by AGGACGAATG (amplified fragment 164 bp), Xpitx2d reverse, cloning the coding sequence of Xpitx2b in frame with the C-terminal 5Ј-AGTGCCAAGCAAAGGAAGACTGTC; zpitx2c forward, 5Ј- domain of the Drosophila Engrailed protein contained in plasmid CTCGGCTGAAACCGAGATATC (amplified fragment 292 bp), pCS2/N-EnR (details available upon request) using the following zpitx2c reverse, 5Ј-GGATAAGACAAGCGATTTACC; Xnr-1 for- oligonucleotides: 5Ј-ccatcgatCTGGTAACAGAATGGACA-3Ј (re- ward, 5Ј-AGAGAGATCAGCAGTGCAAGC, Xnr-1 reverse, 5Ј- striction site underlined, pitx2b sequence in capitals) and 5Ј- AATATTGTGTGATGGTTCAGTGTG (amplified fragment 431 agctctagaTTACACGGGTCTGTCTACTGC-3Ј. A second construct, bp); Xnr-2 forward, 5Ј-ATACCTCTCTCCAGAGATGGCAAG, pCS-EnR-Xpitx2/N frame shift, was constructed by subcloning the and Xnr-2 reverse, 5Ј-TACAGTAACATCCTGAGATCTTTC (am- full Xpitx2b coding sequence out of frame with the EnR protein, plified fragment 432 bp). Cycling parameters were the following: introducing a stop codon 17 amino acids after the end of the EnR initial denaturation at 94°C for 3 min, annealing at 60°C for 30 s, polypeptide. extension at 72°C for 30 s. Twenty-four cycles were used for His- tone H4 and Xbra; 28 cycles for sox-17␤ and chordin; 30 cycles for Xpitx2b, Xpitx2c, zpitx2c, goosecoid, and antivin; and 33 cycles for Zebrafish Strains, Embryo Manipulation, and RNA Xpitx2d, siamois, Xanf-2, Xnr-1, Xnr-2, and cerberus. Microinjection To test if induction of pitx2 by Nodal required protein synthesis, embryos were injected in the four animal blastomeres at the Adult zebrafish were maintained at 28.5°C and embryos were eight-cell stage with Xnr-1 mRNA and separated into two groups. collected by natural spawning from wild-type AB strains or from One group was kept as control untreated embryos and the other mutant lines by crossing heterozygous fish. Kathrin Helde kindly was treated with cycloheximide at 10 ␮g/ml starting at the begin- provided the one-eyed pinhead mutant lines (Schier et al., 1997). ning of stage 8. We used the following alleles: oepz1,a␥-ray-induced deletion allele, m134 and oep , a C-terminal truncation mutant. Similar results were RNA Extraction and Northern Blotting obtained with both lines. Xenopus were maintained at 18°C and manipulated by standard Total RNA from staged embryos was extracted by the method of methods. In vitro fertilization, embryo cultures, and microinjec- Chomczynski and Sacchi (1987). Samples of total RNA were tions were as described by Sive et al. (1994). Staging was according fractionated by electrophoresis on 1% agarose gels containing 1.2 to Nieuwkoop and Faber. Capped mRNAs for overexpression M formaldehyde and transferred to nitrocellulose filters by stan- studies were synthesized with a mMessage mMachine kit (Am- dard methods (Sambrook et al., 1989). The Northern blots of bion) using SP6 polymerase. All the pitx2-related constructs were Xenopus RNAs were probed with RNA probes corresponding either linearized with Asp718. Xnr-1 and Xnr-2 (Jones et al., 1995b) cloned to the 3Ј UTR of Xpitx2 or to the whole Xpitx2c cDNA sequence in pSP64T were linearized with SmaI. pSP64T NLS-␤-Gal was and both gave similar results. The Northern blot of zebrafish RNAs linearized with XbaI. was probed with the whole zpitx2c cDNA.

FIG. 1. Early expression of pitx2 transcripts during Xenopus development. (A) Deduced N-terminal sequences of three Pitx2 isoforms. The sequence common to the different Pitx2 isoforms is in green. The junction between the variable and the common regions coincides with the beginning of exon 5 in pitx2 (see Schweickert et al., 2000, for the genomic organization of the pitx2 locus). (B) Northern blot of total RNA prepared at the indicated stages. The blot was probed with an antisense RNA probe derived from the 3Ј UTR of the cDNA. Similar results were obtained with a probe containing the coding region. (C) RT-PCR analysis showing that in Xenopus, pitx2b, and pitx2d are expressed maternally and zygotically while pitx2c is expressed only after MBT. RT-PCR was performed with total RNA prepared at the indicated stages. (D) Expression of pitx2 in early Xenopus gastrulae (st 101/2) analyzed by dissection and RT-PCR. pitx2b and pitx2c are expressed predominantly in the vegetal and marginal regions while pitx2d is expressed uniformly. Material from a single embryo was used for the ϩRT control. Five embryos were used for the animal, vegetal, and equatorial explants and two for the dorsal and ventral fragments. (E–H) pitx2 in situ hybridizations showing an early broad expression at the blastula stage and expression in the dorsal mesoderm and endoderm at the gastrula stage. In situ hybridizations of bisected embryos are shown in E and G and of whole embryos in F and H. (E) Side view showing ubiquitous expression of pitx2 at the late blastula stage (stage 93/4). Note the punctate staining in the vegetal hemisphere. (F) Midgastrula (stage 11) vegetal view, dorsal side at top. (G) Lateral view, dorsal side on the right. pitx2 transcripts are transiently enriched in the involuting dorsal mesoderm. A slight dorsal–ventral gradient of pitx2 transcripts is apparent in the ectoderm, mesoderm, and, to a lesser extent, endoderm. (H) Cleared neurula (stage 15). The most prominent expression of pitx2 is in the anterior ectoderm and prechordal mesoderm.

FIG. 2. Early expression of pitx2 transcripts during zebraﬁsh development. (A) Northern blot of total RNA prepared at the indicated stages. The blot was probed with an antisense RNA probe corresponding to the whole zpitx2c cDNA. (B) RT-PCR analysis showing that pitx2c transcripts start to accumulate at the onset of zygotic transcription. (C–G) Whole-mount in situ hybridization with a probe recognizing all the pitx2 isoforms showing expression of pitx2 ﬁrst in the presumptive mesendoderm and then in prechordal mesoderm. (C) Sphere, (D) 30% epiboly, (E) germ ring, (F) shield, (G) 75% epiboly.

RESULTS the late blastula stage (Fig. 1E) in all three germ layers, although at relatively low levels. In the vegetal hemisphere, Early Expression of pitx2 in the Presumptive the pitx2 signals were perinuclear with the punctate appear- Endoderm and Mesoderm ance characteristic of genes expressed in the yolky endodermal cells (Fig. 1E). At midgastrulation (stage 11), pitx2 Several recent studies have described the expression transcripts appeared enriched in the dorsal ectoderm and pattern of pitx2 during late morphogenesis of the embryo involuting mesoderm above the blastopore lip (Fig. 1F) and and in adult tissues and organs (Campione et al., 1999; in situ hybridization of bisected embryos revealed a slight Essner et al., 2000; Gage and Camper, 1997; Logan et al., dorsal–ventral gradient of pitx2 transcripts in the endoderm 1998; Mucchielli et al., 1997; Piedra et al., 1998; Ryan et al., (Fig. 1G). This endodermal expression was not detectable 1998; Schweickert et al., 2000; Semina et al., 1996; Yan et after stage 11.5. Beginning in the stage 15 neurula, the al., 1999; Yoshioka et al., 1998) but the pattern and timing prechordal mesoderm region started to express pitx2 tran- of early expression of pitx2 had not been examined in detail. scripts (Fig. 1H). We isolated zebrafish and Xenopus pitx2 cDNAs in screens The temporal and spatial expression pattern of the ze- paired for new members of the -like family of homeobox brafish pitx2 was also examined and similar observations genes expressed during early embryogenesis. Full-length were made (Fig. 2). The pitx2 gene starts to be transcribed clones were sequenced on both strands, allowing identifi- soon after the onset of zygotic transcription. It produces one cation of the Xenopus pitx2b and pitx2c isoforms as well as major transcript of approximately 2 kb (Fig. 2A), the level of of a previously uncharacterized variant that we named which increases gradually during gastrulation, somitogen- pitx2d (Fig. 1A). A single isoform corresponding to pitx2c esis, and later larval development. Transcripts encoding the was isolated from our zebrafish gastrula stage cDNA li- early expressed Pitx2c isoform are first detected by RT-PCR brary. Another isoform, pitx2a, which begins to be ex- at the sphere stage, and their level increases during gastru- pressed at the end of gastrulation, has been described by lation and somitogenesis (Fig. 2B). In situ hybridization others (Essner et al., 2000; Yan et al., 1999) but was not with a probe recognizing all the pitx2 transcripts revealed a studied here. weak ubiquitous expression of pitx2 at sphere stage (Fig. Northern blot analysis of pitx2 transcripts in Xenopus 2C). Starting at 30% epiboly, pitx2 expression is restricted early embryos with a probe derived from the 3Ј UTR region to the cells close to the blastoderm margin which contain of the sequence revealed three major transcripts of approximately 2.0, 4.0, and 7 kb and a less abundant 2.5-kb mRNA the precursors of all the endoderm and part of the meso- (Fig. 1B). These multiple transcripts presumably represent derm (Fig. 2D) (Kimmel et al., 1990). At the germ ring stage, the different isoforms. In mouse, the pitx2 gene has been pitx2 is expressed in the first marginal cells that involute to shown to give rise to at least three different transcripts form the hypoblast and which contain mostly the precur- encoding different isoforms (Arakawa et al., 1998; Gage and sors of the endoderm (Fig. 2E) (Rodaway et al., 1999; Warga Camper, 1997). A low level of pitx2 mRNA is present in the and Nusslein-Volhard, 1999), and at the shield stage, pitx2 embryo at stage 7, before the midblastula transition (MBT). transcripts are found in a slight dorsal–ventral gradient in Zygotic transcripts then gradually accumulate from the late the involuted mesendodermal progenitors (Fig. 2F). Finally, blastula stage (stage 9) through gastrulation and morpho- by midgastrulation (75% epiboly), strong expression was genesis. RT-PCR analysis showed that pitx2b and pitx2d detected in the anterior mesendoderm that will form the isoforms are present as maternal mRNAs, while mRNA prechordal mesoderm (Fig. 2G). The expression domain of coding for the pitx2c isoform is absent before MBT and zebrafish pitx2 largely overlaps with the expression do- accumulates only after the start of zygotic transcription mains of cyclops and squint, the two nodal genes in (Fig. 1C). zebrafish (Erter et al., 1998; Feldman et al., 1998, 2000; The spatial distribution of pitx2 transcripts was first Gritsman et al., 2000; Sampath et al., 1998), and of goosec- analyzed by RT-PCR on explants dissected at stage 101/2 oid (Stachel et al., 1993; Thisse et al., 1994). Therefore, in (Fig. 1D). pitx2b and pitx2c transcripts were found enriched both zebrafish and Xenopus, pitx2 is expressed at the right in the vegetal and equatorial regions and present at much time and place to act as a mediator of Nodal signaling. lower levels in the animal regions. In addition, there is a The late expression patterns of pitx2 described in other graded distribution of these pitx2 transcripts along the reports were also observed in this study (data not shown). dorsal–ventral axis, with a higher level present in the dorsal Briefly, at the tail-bud stage (Xenopus) or at 24 h (zebrafish), half compared to the ventral region of the embryo. pitx2d pitx2 expression was initiated specifically in the left lateral transcripts were distributed homogeneously in the embryo. plate mesoderm, and at later stages expression was detected To further characterize the spatial distribution of pitx2 on the left sides of several visceral organs, including the transcripts, we performed in situ hybridization on whole heart and gut. Finally, strong expression of pitx2 was and bisected embryos using digoxigenin-labeled pitx2 anti- detected in the ventral diencephalon and in the craniofacial sense RNA probes that recognize all the pitx2 transcripts. region. Note that the regions where pitx2 is expressed, With these probes, pitx2 transcripts were first detected at including the presumptive endoderm and mesoderm terri-

To determine whether pitx2 transcription is dependent on Nodal signaling in zebrafish, we examined pitx2 expression in embryos mutant for the one-eyed pinhead (oep) gene, which is required for Nodal signaling (Gritsman et al., 1999). In zygotic oep mutant embryos, pitx2 transcripts were barely detectable at 30% epiboly (Fig. 4F) and completely absent at 40% epiboly and later on (Figs. 4G–4J). Expression of pitx2 is thus disrupted very early when Nodal signaling is attenuated. goosecoid expression is also initiated but not maintained in oep mutant embryos (Schier et al., 1997). Parallel in situ hybridization with goosecoid and pitx2 probes showed that pitx2 expression was affected before any defect in goosecoid expression was detectable (data not shown). We conclude that expression of pitx2 is absolutely dependent on Nodal signaling in the early embryo and is affected before goosecoid expression in the oep mutant. In further experiments to examine the role of pitx2 in FIG. 3. pitx2 expression in Xenopus is activated in response to Nodal. (A) Animal cap assay showing induction of pitx2 expression early development, we focused on Xenopus embryos, in in response to Xnr-1 overexpression. Embryos at the four-cell stage which the effects of ectopic expression of wild-type and were microinjected at the animal pole in each blastomere with 50 mutated RNAs into specific regions could be examined. pg of Xnr-1 mRNA. Animal caps were removed at stage 7, treated continuously with 10 ␮g/ml cycloheximide, and analyzed at stage 9 in parallel with untreated control caps for the expression of Xbra, pitx2 mRNA Partially Mimics the Molecular goosecoid, pitx2b, pitx2c, and histone H4. While Xnr-1 induces Xbra and goosecoid expression in absence of protein synthesis, Responses to Nodal Signaling treatment with cycloheximide prevents the strong activation of pitx2c and pitx2b expression. Nodal-related signals are required for both mesoderm and endoderm formation. To determine if pitx2 is an effector in the Nodal signaling pathway during germ-layer formation we injected mRNA encoding Xnr-1 or Pitx2 into early tories, the prechordal plate, the forebrain, the left lateral Xenopus embryos and measured the expression of a series of plate, and the craniofacial region are all regions in which genes known to be targets of the Nodal signaling pathway Nodal signaling has been suggested to be important for (Fig. 5). While overexpression of Xnr-1 efficiently induced normal development. both mesodermal and endodermal markers, neither pitx2b nor pitx2c was able to stimulate expression of the mesodermal markers Xbra and chordin. In contrast, overexpression Early pitx2 Expression Is Regulated by Nodal of either pitx2b or pitx2c dose-dependently induced goose- ␤ The close correlation between the expression patterns of coid, as well as modest levels of sox-17 and cerberus nodal and pitx2 in both zebrafish and Xenopus suggests that transcripts and of antivin, an inhibitor of Nodal signaling. pitx2 expression is under the control of the Nodal signaling Interestingly, the different pitx2 isoforms differed in their pathway. To determine whether Nodal can induce pitx2 ability to induce goosecoid or sox-17␤, with high doses of transcription, we measured the expression of pitx2 in ani- pitx2c inducing preferentially sox-17 while the same doses mal caps derived from control or Xnr-1-injected embryos. of pitx2b induced goosecoid. These observations support The pitx2b, pitx2c, and pitx2d isoforms were all induced the view that Pitx2 homeoproteins are involved in Nodal efficiently by Xnr-1 in this assay (Fig. 3 and data not shown). signaling and suggest that pitx2 acts in the molecular To determine whether this induction was an immediate- pathway leading to endoderm/prechordal mesoderm forma- early response of Nodal signaling or required protein syn- tion in response to Nodal-related signals. The lack of thesis, we treated embryos with cycloheximide to block induction of the trunk mesodermal genes Xbra and chordin, protein synthesis before MBT. As shown in Fig. 3, this however, suggests that this homeobox gene may not be treatment does not interfere with induction of Xbra or involved in general mesoderm induction. Note that pitx2, goosecoid by Xnr-1, as reported previously (Cho et al., 1991; like the paired-like gene mix-1 (Latinkic and Smith, 1999), Smith et al., 1991). In contrast, the strong induction of pitx2 does not fully induce endoderm formation because tran- expression was prevented. This result indicates that pitx2 is scripts of other genes involved in endoderm formation such a downstream target of Nodal signaling rather than an as mixer and gata-4 were not detected following overexpres- immediate-early response gene. sion of pitx2 in animal pole tissue (data not shown).

FIG. 4. pitx2 expression is disrupted very early in zebraﬁsh one-eyed pinhead (oep) mutant embryos. pitx2 expression in wild-type (A–E) and zygotic oepz1 mutant embryos (F–J). (A–F) 30% epiboly (4.7 h), (B, G) germ ring (5.7 h), (C, H) shield (6 h), (D, I) 75% epiboly (8 h), (E, J) bud (10 h). Note that only a weak pitx2 expression is initiated and that pitx2 transcripts rapidly disappear when the Nodal signaling pathway is inactive.

Overexpression of pitx2 Interferes with Mesoderm pigmented cells with the secretory characteristics of ce- Formation and Disrupts Gastrulation ment gland and another region containing a population of unpigmented cells. The yolky appearance and nonadhesive To study the biological activity of pitx2 mRNA in the character of cells in the unpigmented mass suggested that context of the embryo, we injected synthetic mRNA into they had acquired some characteristics of endodermal cells, dorsal (Fig. 6A) or ventral (Fig. 6B) blastomeres of cleavage consistent with the stimulation of endodermal but not stage Xenopus embryos. In both cases, overexpression of mesodermal gene expression in these caps (see above). pitx2 resulted in profound dose-dependent perturbations of To understand the phenotypes caused by dorsal overex- development. Ventral injections at the four- or eight-cell pression of pitx2 mRNA, we examined the expression of stage resulted in formation of large ectopic patches of mesodermal and dorsal organizer genes. In all the embryos pigmented secretory tissue in the ventroposterior regions injected in two vegetal blastomeres at the eight-cell stage, which expressed the cement gland marker XAG (Fig. 6A, expression of the panmesodermal marker Xbra was abol- n Ͼ 500, and data not shown). Dorsal equatorial injections ished in about half the marginal zone (Fig. 6H) (n ϭ 70). of wild-type pitx2 RNA into one cell at the four-cell stage Since Xbra is required for normal gastrulation (Conlon et produced embryos with very reduced trunk and tail regions al., 1996), this effect on Xbra expression could explain the (not shown). This phenotype was associated with a failure severe gastrulation defects described above. Furthermore, in of the blastopore to close fully and of the embryo to all the embryos injected with pitx2b or pitx2c in dorsoveg- elongate. An even stronger phenotype was observed after a etal blastomeres at the eight-cell stage, expression of chor- bilateral injection of pitx2 mRNA into dorsal vegetal blas- din (Figs. 6E and 6F) (n ϭ 36) was severely reduced or tomeres at the eight-cell stage (Fig. 6B) (n ϭ 130). Head absent, consistent with the lack of dorsal structures in development was completely inhibited and structures de- these embryos (Fig. 6B), while expression of cerberus was rived from dorsal mesoderm were severely reduced. Micro- not affected (data not shown). Consistent with the RT-PCR injection of pitx2 mRNA into UV-ventralized embryos did analysis of animal caps, injection of pitx2c mRNA in the not rescue axial development but instead induced develop- equatorial or animal region of embryos at the four-cell stage ment of cement glands and ﬁn-like structures (Fig. 6C) (n ϭ induced moderate levels of ectopic sox-17␤ detectable by 72). Finally, we examined the consequences of overexpress- whole-mount in situ hybridization in about half the in- ing pitx2 in ectodermal explants and noted that cultured jected embryos (Fig. 6J) (n ϭ 65), in agreement with the animal caps overexpressing pitx2 adopted a striking mor- results of RT-PCR. Similarly, ectopic patches of goosecoid phology (Fig. 6D) (n ϭ 70). By the neurula stage, they had expression were observed in most embryos injected with rounded up and were composed of two distinct regions pitx2b RNA in two ventral vegetal cells at the eight-cell separated by a sharp border: one region containing darkly stage (Figs. 6K and 6L) (n ϭ 53).

FIG. 5. The response of Xenopus animal caps to microinjection of pitx2 mRNA partially mimics the response to Xnr-1. Embryos at the eight-cell stage were microinjected at the animal pole in each blastomere with 25, 75, or 225 pg of pitx2c, pitx2b, or Xnr-1 mRNA. Animal caps were removed at stage 9 and analyzed at stage 11 by RT-PCR for expression of the marker genes indicated. ϪRT, control without reverse transcription. pitx2 dose-dependently induces goosecoid, sox17␤, cerberus, and antivin but not Xbra or chordin. These results are representative of four independent experiments.

Taken together these experiments demonstrate that pitx2 of the Drosophila Engrailed homeoprotein to the interferes with formation and normal patterning of the N-terminus of the whole Xenopus Pitx2b protein. We did mesoderm when misexpressed, while it favors the endoder- not test an equivalent construct for Pitx2c. Because both mal and anterior mesendodermal fates as judged by the Pitx2b and Pitx2c share the same DNA binding domain and induction of sox-17 and goosecoid following overexpression C-terminal region, it is likely that the repressor versions of of this gene. At later stages, pitx2 also favors anterior both isoforms would have similar biological activities. ectodermal fates as shown by the strong induction of Dorsal injections of relatively low doses of EnR-pitx2 cement gland tissue caused by ectopic expression of this mRNA (25–200 pg) caused defects ranging from mild cyclo- gene. pia to almost complete lack of structures derived from In these experiments, we used as control an RNA encod- endoderm and mesoderm (Figs. 7A–7C). Injection of 25–50 ing a mutant version of pitx2 in which lysine 50 of the pg of EnR-pitx2 mRNA caused microcephaly, cyclopia, and homeodomain was substituted by a glutamic acid (pitx2 abnormal gastrulation, producing embryos with reduced K 3 E). This residue is located in the recognition helix and trunks, tails, and cement glands. The most severe pheno- plays a crucial role for DNA binding specificity (Treisman types were observed after microinjection of 100–200 pg of et al., 1989). None of the phenotypes caused by pitx2 EnR-pitx2 per dorsal blastomere and included absence of injection into either ventral or dorsal blastomeres were the dorsal lip of the blastopore and very abnormal morpho- observed in embryos injected with the pitx2 K 3 E mutant genetic movements, producing embryos without heads or RNA (data not shown) (n ϭ 80). This shows that the DNA tails. Radial injection of 50 pg of EnR-pitx2 at the eight-cell binding specificity of pitx2 is crucial for its biological stage resulted in complete block of epiboly, the blastocoele activity and is responsible for the observed phenotypes. of the injected embryos being still visible as a prominent vesicle at the animal pole while control uninjected embryos were undergoing closure of the neural tube. Moreover, the A Chimeric Engrailed–Pitx2 Repressor Disrupts marginal zone did not involute inside the embryo but was Head Formation, Gastrulation, and Endoderm left on the outside where it formed a belt of unpigmented Specification cells (Fig. 7D). Molecular studies on the transcriptional properties of The gastrulation defects caused by dorsal-vegetal and pitx family members suggest that pitx2 is a transcriptional radial injections of EnR-pitx2 were reminiscent of those activator (Amendt et al., 1998; J. J. Tremblay et al., 2000). In described for embryos depleted of maternal VegT tran- order to interfere with the function of Pitx2, we constructed scripts and associated with a failure of the mesodermal and an inhibitory mutant form by fusing the repressor domain endodermal germ layers to be correctly specified (Kofron et

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved. 296 Faucourt et al. al., 1999; Zhang et al., 1998). To test the effects of EnR- gests that when pitx2 function is inhibited, the cells are pitx2 on germ-layer specification, we injected EnR-pitx2 diverted from the endodermal lineage. Intriguingly, a small mRNA and analyzed by in situ hybridization the expression percentage (Ͻ15%) of the embryos injected with EnR-pitx2 of several marker genes expressed early in the mesoderm or developed partial secondary axes, suggesting that while endoderm. In all embryos injected in two vegetal blas- EnR-pitx2 diverts cells from the endodermal lineage it tomeres at the eight-cell stage, expression of Xbra was favors axial mesodermal fates. We used as control an eliminated in half the marginal zone (Figs. 7E and 7F) (n ϭ EnR-pitx2 construct containing a frame-shift mutation at 55). The expression of the endodermal gene markers sox- the beginning of the pitx2 ORF such that only the EnR 17␤, cerberus, and frz-b at the early- to midgastrula stage protein was synthesized. Embryos injected with mRNA was similarly abolished or strongly reduced by EnR-pitx2 encoding the Engrailed repressor domain alone were indis- (Figs. 7G–7L and data not shown). To confirm these find- tinguishable from uninjected embryos (data not shown). ings, embryos were injected vegetally into each blastomere To test the specificity of the EnR-pitx2 construct, we at the four-cell stage with increasing doses of EnR-pitx2 tried to rescue these effects with the wild-type protein. mRNA, collected at stage 11, and analyzed by RT-PCR for When EnR-pitx2 was co-injected with wild type-pitx2 at a the expression of genes expressed specifically in each germ ratio 1:2.5, the induction of ectopic axes and the shift in cell layer (Fig. 8). EnR-pitx2 dramatically reduced the expres- fate caused by EnR-pitx2 alone were not observed and sion of sox-17␤, mixer, GATA-4 (panendodermal), edd instead ectopic cement glands were induced in ventral- (endoderm and axial mesoderm at this stage), and dkk-1 and posterior regions (Fig. 9F). This phenotype is identical to cerberus (anterior endomesoderm markers). The expression that obtained when wild-type pitx2 mRNA alone is injected of the mesodermal genes Xbra and chordin was also se- into these blastomeres (Fig. 9C), indicating that pitx2 had verely diminished by EnR-pitx2, while the levels of tran- compensated for the effects of EnR-pitx2. The successful scripts of ectodermal markers were either unaffected reversion of the phenotype caused by EnR-pitx2 demon- (Xanf-1) or slightly increased (Xanf-2) by inhibition of Pitx2 strates the specificity of the repressor form of pitx2 we used function. In contrast, Xnr-1 and siamois transcripts, which and suggests that EnR-pitx2 functions indeed as an inhibi- normally accumulate in the dorsal endodermal region un- tory version of pitx2. However, it should be noted that other der the control of the maternal VegT and/or the Wnt/␤- members of the pitx gene family could also be inhibited by catenin pathway, were expressed at normal levels in the EnR-pitx2. presence of EnR-pitx2. We conclude that EnR-pitx2 interferes specifically with the process of endoderm specifica- pitx2 Is Required in the Nodal Signaling Pathway tion and not generally with gene expression in the endodermal region. These results indicate that pitx2 plays an Based on the conserved early expression of pitx2 in essential role in mesoderm and endoderm development. mesendodermal progenitors (Figs. 1 and 2), the induction of pitx2 by Nodal (Fig. 3), the lack of pitx2 expression in zebrafish Nodal pathway mutants (Fig. 4), the biological EnR-Pitx2 Diverts Vegetal Blastomeres from the activity of pitx2 in the animal cap assay (Fig. 5), the Endodermal Lineage requirement for pitx2 and nodal in endoderm specification To further characterize the effect of EnR-pitx2 on the fate (Figs. 7–9), and the connection between pitx2 and nodal in of vegetal cells we performed cell lineage analyses. Single the left–right asymmetry pathway, we hypothesized that ventral vegetal blastomeres at the eight-cell stage were pitx2 might be required in the Nodal signaling pathway microinjected with ␤-Gal mRNA alone or in combination during germ-layer specification. To obtain more direct with EnR-pitx2 at low doses (25 to 75 pg), and the fates of evidence for the requirement for pitx2 in Nodal signaling, the labeled blastomeres were analyzed around stage 35 (Fig. we injected mRNA encoding Nodal-related factors alone or 9 and Table 1). When ␤-Gal mRNA was injected alone, the in combination with EnR-pitx2 (Fig. 10). We used ␤-Gal progeny of the injected blastomere were found most fre- RNA as a lineage tracer to follow the progeny of the injected quently in the posterior endoderm and posterior somites cells and monitored the expression of sox-17␤, goosecoid, and rarely in anterior locations, in agreement with the and brachyury as a readout of activation of the Nodal normal fate of these blastomeres (Figs. 9A and 9D) (Dale and signaling pathway and allocation to mesodermal and Slack, 1987). However, when EnR-pitx2 mRNA was co- endodermal fates. Injection of 100 pg of Xnr-1 or Xnr-2 injected with ␤-Gal, very few labeled cells were observed in resulted in a strong dorsalization of the embryos and robust the posterior endoderm (Figs. 9B and 9E). The progeny of the induction of sox-17␤ in injected and surrounding cells (Figs. labeled cells were found instead in more dorsal and axial 10A and 10C and data not shown) (n ϭ 72). Strikingly, structures. The apparent dorsoanterior migration of the when Xnr-1 or Xnr-2 was co-injected with EnR-pitx2 injected ventral blastomeres suggests that low doses of mRNA, no induction of sox-17␤ was observed in the EnR-pitx2 can change the behavior and fate of these blas- injected cells (Figs. 10B and 10D and data not shown) (n ϭ tomeres. Moreover, the low number of labeled cells in the 85). Induction of sox-17␤ still occurred in the surrounding endodermal region in the EnR-pitx2-injected embryos sug- cells, demonstrating that EnR-pitx2 inhibited Xnr signaling

only in the cells in which it was expressed. As little as 25 pg of the EnR-pitx2 mRNA was enough to inhibit sox-17␤ induction, arguing for the speciﬁcity of this effect (Fig. 10E) (n ϭ 27). Furthermore, co-injection of wild-type pitx2 with the EnR-pitx2 at a ratio of 8:1 restored induction of sox-17␤ by Xnr-1 (Fig. 10F) (n ϭ 25). Injection of 100 pg of Xnr-1 also induced the expression of goosecoid in the marked clone and in a close border of surrounding cells (Fig. 10G) (n ϭ 20). The EnR-pitx2 mRNA blocked the induction of goosecoid by Xnr-1 although this inhibition appeared less complete than that of sox-17␤ (Fig. 10H) (n ϭ 35). Injection of lower doses of Xnr-1 (50 pg) induced Xbra expression at the periphery of the marked clone and in cells immediately adjacent to it but cells in the center of the clone did not express the marker (Fig. 10I) (n ϭ 42), suggesting that Xbra expression is repressed by high levels of Nodal signaling as demonstrated previously with activin (Green et al., 1992). The same dose of Xnr-1 induced sox-17␤ only in cells at the center of the clone (data not shown), suggesting that endoderm and mesoderm are induced at different thresholds of signaling and/or by different mechanisms. Overall, the pattern of sox-17␤ and Xbra expression following injection of nodal mRNA is similar to the pattern resulting from ectopic expression of VegT, which acts upstream of Nodal (Clements et al., 1999), or of a constitutively active activin receptor (Rodaway et al., 1999), with the expression of endodermal genes restricted to the center of the clone and expression of the mesodermal

embryo was irradiated but not injected. (D) Animal cap explants prepared from stage 9 embryos and cultured until stage 20. The cap on the right was prepared from an embryo injected at the four-cell stage with 50 pg of pitx2c RNA into the animal pole of each blastomere. Extensive cement gland tissue was induced by pitx2c, and a mass of large, yolky, nonadhesive cells (y) is also present. A control explant, which has developed epithelial characteristics, is shown on the left. (E–L) pitx2b RNA (200 pg) was injected into one or two blastomeres at the four- or eight-cell stage and embryos were ﬁxed for whole-mount in situ hybridization at stage 10.5 or 11. (E, F) chordin expression in the organizer region of uninjected (E) and pitx2b-injected (F) embryos at stage 10.5. chordin expression is FIG. 6. Effects of overexpression of pitx2. (A) Induction of ectopic strongly reduced following injection of pitx2 into the two dorsal cement gland and mesenchymal tissue by microinjection of pitx2 vegetal blastomeres at the eight-cell stage. (G, H) Vegetal views of RNA into ventral blastomeres. Uninjected stage 34 embryo (top) xbra expression in the presumptive mesoderm of an uninjected (G) and two siblings injected with 300 pg of pitx2b RNA into one and pitx2b-injected (H) embryo at stage 10.5. Following injection of ventral cell at the four-cell stage. Lumps of tissue containing pitx2b RNA into the two dorsal vegetal blastomeres at the eight- pigmented and secretory cement gland tissue (cg) are visible in cell stage, half the Xbra expression has been abolished. (I, J) Lateral ventral/posterior regions. (B) Stage 41 embryos injected with 200 pg views of sox-17␤ expression in the endoderm of an uninjected (I) of pitx2b into the two dorsal vegetal cells at the eight-cell stage and a pitx2-injected (J) embryo at stage 11. sox-17␤ is expressed (uninjected embryo at top). Anterior and dorsal axial structures are ectopically following injection of pitx2 into one blastomere at the absent or greatly reduced, while some additional tail-like struc- four-cell stage. (K, L) Vegetal views of goosecoid expression in tures have formed. (C) Embryos exposed to ultraviolet irradiation at uninjected embryo (K) or following injection of pitx2 RNA into the the one-cell stage. Injection of 200 pg of pitx2c RNA into one cell two ventral vegetal blastomeres at the eight-cell stage. Ectopic at the four-cell stage induced formation of a cement gland and tail patches of goosecoid expression are visible in the vegetal and structures but did not rescue dorsal axial structures. The lower marginal regions.

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved. 298 Faucourt et al. genes induced at the periphery of the injected cells, prob- supporting the idea that pitx2 is involved in Nodal signaling ably by a relay mechanism. This suggests that induction of came from the analysis of pitx2 expression in zebrafish Xbra that we see outside the Nodal-expressing clone in- embryos mutant for the Nodal pathway. We found that the volves a relay mechanism as suggested by previous studies regulation of the pitx2 gene is indeed strictly dependent on using cell-autonomous activators of the Nodal pathway Nodal signaling at the early gastrula stage. In one-eyed (Rodaway et al., 1999). pinhead mutant embryos, pitx2 transcripts did not accumu- Co-injection of 50 pg of EnR-pitx2 with an equimolar late at the margin of the blastoderm as they normally did in amount of Xnr-1 only partially inhibited induction of Xbra control embryos at 30% epiboly. Our results therefore (not shown) while injection of 200 pg of EnR-pitx2 more extend those of Essner et al. (2000) who reported that pitx2 completely inhibited Xbra expression (Fig. 10J) (n ϭ 39). is not expressed in one-eyed pinhead mutant embryos at Note that Xbra was no longer induced outside the clone of 50% epiboly, although our results show that pitx2 expres- Nodal-overexpressing cells when EnR-pitx2 was co-injected sion is lost at an earlier stage. with nodal, consistent with the idea that EnR-Pitx2 also To address in a more direct manner the function of pitx2 interfered with a relay mechanism responsible for activa- in germ-layer formation and in the Nodal signaling path- tion of Xbra in neighboring cells. way, we compared the ability of Xnr-1 and of pitx2 isoforms These experiments demonstrate that pitx2 is required for to induce mesodermal or endodermal genes when overex- the induction of sox-17␤, goosecoid, and brachyury by the pressed in Xenopus animal caps. Like Nodal, Pitx2 isoforms Xnr factors. were able to upregulate the expression of sox-17, goosecoid, and cerberus. However, irrespective of doses, pitx2 was not able to induce the mesodermal markers chordin and Xbra. DISCUSSION These results suggest that pitx2 may participate in formation and patterning of the endoderm and prechordal plate We have cloned the zebrafish and Xenopus pitx2 genes but it may not be involved in general mesoderm induction and examined their expression and function during early by Nodal signals. Another line of evidence suggesting that development. We found that in both species, pitx2 tran- pitx2 is indeed a mediator of Nodal signaling is that pitx2, scripts are expressed at the late blastula stage when the like Nodal, induces expression of the Nodal antagonist germ layers are specified. Previous studies have implicated antivin (Fig. 5). In a parallel study, Essner et al. (2000) found pitx2 in the Nodal-mediated pathway responsible for left– that ectopic expression of zebrafish pitx2 leads to upregu- right development during late larval stages but it was not lation of lefty-2, another member of the Nodal antagonist known if this gene is required during gastrulation and family. These results suggest that pitx2, by regulating the germ-layer formation. We have now uncovered a link be- transcription of antivin and lefty-2, is involved in the tween the early expression of pitx2 in the presumptive negative feedback loop responsible for modulating Nodal mesoderm and endoderm and the Nodal signaling required signaling. early in development for specification of these germ layers While our results suggest that in Xenopus, pitx2 is an (Clements et al., 1999; Feldman et al., 2000; Hoodless et al., important regulator of early development required for 1999; Osada and Wright, 1999; Peyrieras et al., 1998; Nodal signaling, mice homozygote for a null mutation of Piccolo et al., 1999). Our analysis of the consequences on pitx2 (Gage et al., 1999; Kitamura et al., 1999; Lin et al., germ-layer formation of overexpressing pitx2 mRNA or 1999; Lu et al., 1999) do not display the severe gastrulation inhibiting Pitx2 activity during early development reveal a defects or anterior truncations caused by inhibition of novel, early requirement for pitx2 in endomesoderm speci- Nodal signaling in various vertebrate embryos (Conlon et fication. First, we found that pitx2, like the Xenopus, Xnr-1, al., 1994; Dyson and Gurdon, 1997; Feldman et al., 1998; and Xnr-2 genes, and the cyclops and squint genes in Hoodless et al., 1999; Osada and Wright, 1999). They zebrafish, is expressed early in the precursors of the mesen- instead suffer from craniofacial and pituitary defects which doderm. Second, we found that overexpression of Xnr-1 resemble the Rieger syndrome, as well as cardiac and induces pitx2 expression in Xenopus ectodermal explants, laterality defects identical to those caused by disruption of in agreement with previous reports (Campione et al., 1999; the type IIb activin receptor (Oh and Li, 1997). We speculate Schweickert et al., 2000). This suggests that this homeobox that the lack of early gastrulation defects in pitx2Ϫ/Ϫ mice gene is a downstream target gene and an effector in the is due to a functional redundancy between different pitx Nodal signaling pathway in the early embryo, as it is during family members as was demonstrated recently in the case the process establishing left–right asymmetry. We found of the activin receptors (Song et al., 1999 and our unpub- that induction of pitx2 by Nodal in Xenopus required lished results). protein synthesis, indicating that pitx2 is a secondary target of Nodal signaling. A different conclusion was reached by Schweickert et al. (2000), who reported that pitx2 is an pitx2 as a Regulator of Endoderm Development immediate-early target of Nodal signaling. The reasons for Recently, several important regulators of endoderm this discrepancy are currently unclear. A third argument development have been identified in Xenopus (reviewed

FIG. 7. pitx2-EnR RNA disrupts dorsoanterior development and prevents expression of many endoderm markers. (A–C) Phenotypes caused by injection of 100 pg of the EnR-pitx2 RNA into the two dorsal vegetal cells at the eight-cell stage, including microcephaly, reduction of the size of the cement gland, and mild cyclopia (A); mild cyclopia, shortening of the axis, and spinibiﬁda (B); and severe anterior and posterior truncations and presence of a collapsed blastocoele (b) (C). Uninjected embryos are included at the tops of A–C. (D) Embryos injected radially with 50 pg of the EnR-pitx2 RNA into each vegetal cell at the eight-cell stage and cultured until stage 27. No epiboly has occurred, gastrulation was prevented, and no dorsal or anterior structures have developed. (E–L) EnR-pitx2 RNA was injected into various blastomeres at the four- or eight-cell stage and embryos were ﬁxed for in situ hybridization at stage 10.5–11.5. (E) Xbra expression at stage 10.5 extinguished (arrow) in half the embryo following injection of 50 pg of EnR-pitx2 RNA into two vegetal cells at the eight-cell stage (compare with Fig. 2F). (F) Similar injection with lineage tracing of the injected blastomere. Note the presence of cells that do not express Xbra and do not contain the lineage label (arrow). (G) Bisected uninjected stage 11.5 embryos showing cerberus expression throughout the endoderm, concentrated on the dorsal side. (H) Expression of cerberus is greatly reduced in siblings injected with 50 pg of EnR-pitx2 RNA into the four vegetal cells at the eight-cell stage. (I) Bisected uninjected stage 10.5 embryos showing sox-17␤ expression throughout the endoderm. (J) Siblings injected with 50 pg of EnR-pitx2 RNA into the four vegetal cells at the eight-cell stage showing greatly reduced expression of sox-17␤. (K) Bisected uninjected stage 11 embryo showing expression of sox-17␤ throughout the endoderm. (L) A sibling injected with 50 pg of EnR-pitx2 mRNA into two vegetal cells at the eight-cell stage in which expression of sox-17␤ was abolished in half of the endoderm territory.

by Dale, 1999). The T-box transcription factor VegT, the endoderm first pointed to a role for pitx2 in endoderm mRNA of which is deposited at the vegetal pole of the development. As pitx2 is expressed in the endoderm only at egg, is at the top of the gene hierarchy controlling the late blastula/early gastrula stage, we hypothesized that specification of the endodermal fate. Endoderm forma- it was involved in the early steps of this process. The tion and its maintenance subsequently require the involvement of pitx2 in the pathway leading to endoderm action of zygotic genes which encode either signaling specification was further confirmed by the finding that factors, such as Xnr-1, Xnr-2, Xnr-4, Derrie`re, Activin B, pitx2 RNA induced ectopic expression of the endodermal and their receptors, or transcription factors, such as regulator sox-17␤, albeit at low levels. However, misexpres- Mix-1 and Mix-2, Mixer, Bix 1–4, GATA-4, and Sox-17, sion of pitx2 did not induce the expression of other endoder- most of which are downstream targets of VegT. The mal genes like mixer or GATA-4 in animal pole tissue, results presented in this study identify pitx2 as a par- suggesting either that these genes act upstream of or in ticipant in the gene network regulating endoderm parallel with pitx2 or that their expression in the animal development. cap cells requires other factors. mix-1, another paired-like The expression of pitx2 in presumptive endoderm cells homeobox gene implicated in endoderm development, also and the fact that animal caps from embryos injected with induces only low levels of sox-17␤ in animal caps (Latinkic pitx2 seemed to have acquired some characteristics of and Smith, 1999).

FIG. 8. EnR-pitx2 interferes with speciﬁcation of the mesendoderm. Embryos were injected vegetally into each blastomere at the four-cell stage with 50, 100, or 200 pg of EnR-pitx2 mRNA, collected at stage 11, and analyzed by RT-PCR for the expression of sox-17␤, mixer, GATA-4, and edd (panendodermal markers); dkk-1 and cerberus (anterior endomesoderm markers); Xbra (general mesoderm); chordin (dorsal mesoderm); Xanf-1 and Xanf-2 (ectodermal markers at this stage); siamois and Xnr-1 (dorsal endoderm); and histone H4 (loading control).

In order to test the requirement for pitx2 in endoderm EnR-pitx2 could be rescued by wild-type pitx2, thereby formation, we used EnR-pitx2, a repressor version of pitx2. demonstrating the speciﬁcity of this inhibitory mutant. In As expected for a molecule with a dominant negative fact, we found that overexpression of EnR-pitx2 suppressed activity, most of the phenotypes caused by overexpression the expression of all molecular markers of the endoderm of EnR-pitx2 were the opposite of those obtained with the that we tested. In contrast, the expression of Xnr-1 and of wild-type pitx2. For example, pitx2 favored endodermal siamois, which is activated by a maternal VegT and/or fates and apparently repressed mesodermal fates while Wnt/␤-catenin/Lef-1 pathway in dorsal vegetal blastomeres EnR-pitx2 had reciprocal effects preventing vegetal cells (Agius et al., 2000; Brannon and Kimelman, 1996; Hyde and from entering the endoderm and directing them to meso- Old, 2000), was unaffected. This is consistent with previous dermal tissues instead (Fig. 9). Similarly, wild-type pitx2 work showing that siamois is expressed at normal levels promoted sox-17␤ expression, while EnR-pitx2 had a potent when the Nodal signaling pathway is inhibited (Osada and repressive effect on the expression of this gene and also Wright, 1999) and argues for the selectivity of EnR-pitx2 on blocked its induction by Nodal. Importantly, this effect of Nodal target genes.

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved. pitx2 Is Required for Nodal Signaling 301 pitx2 and Mesoderm Development et al., 1998; Gritsman et al., 2000; Henry et al., 1996; Jones et al., 1995a; Piccolo et al., 1999; Rodaway et al., 1999; Sun pitx2 We have shown that does not induce mesoderm in et al., 1999; Yasuo and Lemaire, 1999). Inhibition of Pitx2 animal cap explants and that it has a potent repressive function by expressing EnR-pitx2 showed that Xbra and effect on the expression of mesodermal genes when overex- sox-17␤ differ in their responses to inhibition of Nodal pitx2 pressed in embryos. Since is likely a transcriptional signaling. Low doses of EnR-pitx2 were very effective in activator, this repressive effect on mesodermal gene expres- eliminating sox-17␤ expression in cells overexpressing a sion is probably indirect. One explanation for the repressive fourfold molar excess of Xnr-1, whereas goosecoid and Xbra pitx2 effect of on the expression of mesodermal genes is expression was only partially inhibited under these condi- that it activates endodermal gene expression in the mar- tions. Inhibition of goosecoid expression required a twofold sox-17␤ ginal zone. The ectopic expression of induced by molar excess of repressor while a fourfold molar excess was pitx2 the overexpression of may therefore divert marginal needed to downregulate expression of Xbra. Endodermal zone cells from the mesoderm fate, resulting in downregu- markers are thus more sensitive to EnR-pitx2 inhibition Xbra. lation of the expression of genes like A similar potent than prechordal plate and mesodermal markers. Intrigu- repressive effect on mesoderm formation has been docu- ingly, while EnR-pitx2 represses sox-17␤ expression cell mented for other regulators of endoderm development such autonomously, its effects on Xbra expression appear to be mix-1 et al., milk/Bix-2 et al., as (Lemaire 1998), (Ecochard partly cell nonautonomous, suggesting that it also affects a Bix-1 et al., pitx2 1998), and (Tada 1998). Alternatively, signaling relay induced by Nodal. Xbra goosecoid, could suppress expression by activating The observation that vegetal cells overexpressing EnR- Xbra which has been shown to be a repressor of transcrip- pitx2 preferentially adopt a mesodermal versus endodermal et al., tion (Latinkic and Smith, 1999; Latinkic 1997). fate fits with the idea that a functional pitx2 gene is Previous studies on the transcriptional regulation of required selectively for allocation of the endodermal fate. goosecoid have revealed that a zygotic transcription factor Such a shift in cell fates from endoderm to mesoderm is paired likely belonging to the -like class of homeoproteins is reminiscent of the observations made by K. D. Tremblay et goosecoid required for maintenance of activin-induced tran- al. (2000) on chimeric embryos with cells mutant in the et al., scription (McKendry 1998). The homeoprotein en- Smad2 gene, which is thought to mediate Nodal signaling. pitx2 coded by the transcript, which accumulates zygoti- In these embryos, the mutant Smad2 cells extensively cally in response to Nodal signaling, is an excellent populated the ectodermal and mesodermal germ layers but candidate for such a factor. were prevented from entering the definitive endoderm pitx2, EnR-pitx2, Like wild-type the repressor version of lineage. A similar transformation in cell fate was observed pitx2, Xbra also prevented expression of in the marginal in one-eyed pinhead mutant embryos that had reduced EnR-pitx2 zone. In this case, likely blocks the Nodal Nodal signaling. Following attenuation of Nodal signaling, signaling pathway which is critically required for induction cells normally fated to become prechordal plate (anterior Xbra et al., et and maintenance of (Bisgrove 1999; Cheng mesendoderm) adopt a more dorsal mesodermal fate (noto- al., et al., et al., 2000; Conlon 1994; Gritsman 1999, 2000; chord) (Gritsman et al., 2000). Osada and Wright, 1999; Thisse and Thisse, 1999). The Expression Pattern of pitx2 Correlates with pitx2 as an Effector of the Nodal Signaling Multiple Requirements for Nodal Signaling Pathway The expression pattern of pitx2 is correlated with the We have provided evidence in this study that pitx2 is multiple requirements for nodal factors in endoderm develop- needed for endoderm specification and the response to ment, anterior patterning of the CNS, craniofacial develop- Nodal signaling. Cells in which pitx2 function was antago- ment, and establishment of left–right asymmetry. Further- nized by injection of EnR-pitx2 were unable to express more, functional evidence links pitx2 to Nodal signaling sox-17␤ in response to Xnr-1 or Xnr-2, while their ability to during these four processes. The first evidence of such a link express goosecoid and Xbra was dramatically reduced. comes from the analysis of the left–right determination path- Importantly, we showed that the inhibitory effects of EnR- way. pitx2 is expressed specifically in the left lateral plate pitx2 on sox-17 induction by Xnr-1 could be reversed by mesoderm and in the left part of all the organs showing coexpression of wild-type pitx2. On the basis of these left–right asymmetry (Campione et al., 1999; Essner et al., results, we conclude that pitx2 acts downstream of signal- 2000; Logan et al., 1998; Piedra et al., 1998; Ryan et al., 1998; ing by the Nodal factors and is required for expression of Schweickert et al., 2000; Yan et al., 1999; Yoshioka et al., sox-17, goosecoid, and Xbra in response to those factors. 1998). This striking asymmetric expression pattern follows Previous studies in Xenopus and zebrafish have shown the expression of nodal and lefty-2 on the left side of verte- that induction of endodermal markers requires a higher brate embryos. Ectopic expression of mouse nodal or lefty-2 level of Nodal signaling than induction of mesodermal induces ectopic expression of pitx2. Furthermore misexpres- markers (Alexander et al., 1999; Clements et al., 1999; Erter sion of pitx2 on the right side is sufficient to cause perturba-

TABLE 1 Change of Cell Fate Induced by EnR-pitx2 and Reversion by wt pitx2a

mRNA microinjectedb

EnR-pitx2 (75 pg) EnR-pitx2 (75 pg) Number of embryos ␤-Gal wt pitx2 (200 pg) EnR-pitx2 (75 pg) ϩ wt pitx2 (50 pg) ϩ wt pitx2 (200 pg) showing ␤-Gal in (n ϭ 74) (n ϭ 112) (n ϭ 168) (n ϭ 71) (n ϭ 148)

Posterior somites ϩ 94% 95%c 13% 34%c 92%c posterior endoderm Dorsal anterior structures 6% 5% 87% 76% 8%

a Data from four independent experiments were combined. b The indicated RNAs together with ␤-Gal RNA were microinjected into one ventral blastomere of eight-cell stage embryos. Localization of ␤-Gal activity was scored at stage 35. c These embryos also had ectopic cement glands.

tions in bilateral asymmetry of the heart and gut, suggesting vating either gene result in severe cyclopia. A range of defects that the pitx2 homeobox gene is a key downstream target of including profound cyclopia and defects in left–right asymme- nodal during left–right morphogenesis. The later expression of try have also been observed in mice heterozygous for both pitx2 in the prechordal mesoderm and ventral forebrain can be nodal and the transcription factor smad-2, which is thought to correlated with the requirements for Nodal factors in fore- mediate Nodal signaling (Nomura and Li, 1998). Finally, pitx2 brain patterning. Nodal and Nodal-related factors, in addition expression in the craniofacial region and the craniofacial to Sonic hedgehog, are implicated in the process by which an abnormalities associated with the Rieger syndrome caused by initial single eye ﬁeld in the anterior neural plate is split by mutations in pitx2 have an intriguing parallel with the re- signals emitted from the prechordal mesoderm (see Li et al., quirement for Nodal signaling in craniofacial development. A 1997). Zebraﬁsh cyclops, which encodes a Nodal-related fac- fraction of the heterozygous smad-2;nodal mutant mouse tor, and one-eyed pinhead, which encodes an extracellular embryos display craniofacial abnormalities and lack man- cofactor for Nodal signaling, are expressed in the prechordal dibles, underlining the striking correlation between the re- mesoderm and play a crucial role in signaling to the anterior gions where Nodal is required and the regions where pitx2 is neural plate (Feldman et al., 1998; Gritsman et al., 1999; expressed. Sampath et al., 1998; Strahle et al., 1997). Mutations inacti- Taken together the results presented here suggest that

FIG. 9. Change in the fate of vegetal blastomeres injected with low doses of EnR-pitx2 and reversal by wild-type pitx2 mRNA. Embryos were injected into one ventral vegetal blastomere at the eight-cell stage with ␤-Gal RNA alone (A, D), ␤-Gal plus 75 pg EnR-pitx2 RNA (B, E), ␤-Gal plus 200 pg wt pitx2 RNA (C), or ␤-Gal plus 75 pg EnR-pitx2 RNA plus 200 pg of wt pitx2 RNA (F) and processed for detection of the lineage label around stage 34. The shift in position of the progeny of the injected cells caused by EnR-pitx2 is reversed by wild-type pitx2. (D, E) Histological sections from equivalent posterior positions through embryos injected with ␤-Gal RNA (D) or with EnR-pitx2 RNA (E). Note that while in the control embryo ␤-Gal-positive cells populate mesodermal and endodermal structures, ␤-Gal-positive cells are absent from the endoderm in the EnR-pitx2-injected embryo. FIG. 10. EnR-pitx2 RNA blocks expression of sox-17␤, goosecoid, and Xbra in response to Xnr-1. (A, B) Stage 11 embryos injected in two blastomeres at the four-cell stage with 100 pg of Xnr-1 RNA alone or together with 200 pg of EnR-pitx2 RNA. (A) Ectopic sox-17␤ (purple) induced by Xnr-1 (animal view). (B) Siblings in which 200 pg of EnR-pitx2 RNA was co-injected. Ectopic sox-17␤ transcripts are seen surrounding sharply delimited patches of unstained cells (arrows). (C, D) Lateral views of embryos from a similar experiment but ␤-Gal mRNA was included in the RNA mixture to allow lineage tracing (blue). (C) Injection of Xnr-1 alone induced sox-17␤ expression both in the progeny of injected cells and in surrounding cells. (D) EnR-pitx2 mRNA blocked cell-autonomously the induction of sox-17␤. (E, F) Rescue of sox-17␤ expression by wild-type pitx2 RNA. (E) Cell-autonomous inhibition of induction caused by co-injecting 25 pg of EnR-pitx2 RNA with 100 pg of Xnr-1 into one blastomere at the four-cell stage. (F) Reversal of the effect by co-injection of 25 pg of EnR-pitx2 RNA, 100 pg of Xnr-1, and 200 pg of wild-type pitx2 RNA. Expression of sox-17␤ in the clone of injected cells is rescued by co-injection of wild-type pitx2 RNA. (G) Ectopic goosecoid induced by Xnr-1 mRNA. (H) Sibling in which 200 pg of EnR-pitx2 RNA was co-injected. Lineage tracing of co-injected ␤-Gal RNA (blue) shows that ectopic goosecoid is not induced in the progeny of cells overexpressing Xnr-1 when the EnR-pitx2 RNA is present. (I) Ectopic Xbra induced at the periphery of the clone after injection of 50 pg of Xnr-1 into one blastomere at the four-cell stage. The same dose caused induction of sox-17␤ in the center of the clone (not shown). (J) Almost complete inhibition of Xbra induction at the border of the marked clone after co-injection of 50 pg of Xnr-1 and 200 pg of EnR-pitx2 mRNA.

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved. 304 Faucourt et al. pitx2, in addition to its known function in establishing signaling in mesoderm induction and L-R axis development in left–right asymmetry in response to Nodal signaling, plays Xenopus. Development 127, 1049–1061. an important role in specification of the endoderm as a Cho, K. W. Y., Blumberg, B., Steinbeisser, H., and De Robertis, downstream effector in the Nodal signaling pathway. E. M. (1991). Molecular nature of Spemann’s organizer: The role of the Xenopus homeobox gene goosecoid. Cell 67, 1111–1120. Chomczynski, P., and Sacchi, N. (1987). Single-step method of ACKNOWLEDGMENTS RNA isolation by acid guanidinium thiocyanate–phenol– chloroform extraction. Anal. Biochem. 162, 156–159. We thank Lauro Sumoy, Cynthia Yost, Sarah Pierce, Jennifer Clements, D., Friday, R. V., and Woodland, H. R. (1999). Mode of Northrop, Mark Brannon, Bess Melby, and Kevin Griffin for en- action of VegT in mesoderm and endoderm formation. Develop- couragement and fruitful discussions and our colleagues at the ment 126, 4903–4911. Marine Station of Villefranche for help and support. We thank Conlon, F. L., Lyons, K. M., Takaesu, N., Barth, K. S., Kispert, A., Christian Gache for careful reading of the manuscript, Patrick Herrmann, B., and Robertson, E. J. (1994). A primary requirement Lemaire for the generous gift of the gastrula cDNA library and for nodal in the formation and maintenance of the primitive nuclear ␤-gal plasmid, De Li Shi and Hitoyoshi Yasuo for advice streak in the mouse. Development 120, 1919–1928. with the in situ hybridization and RT-PCR techniques, Jim Smith Conlon, F. L., Sedgwick, S. G., Weston, K. M., and Smith, J. C. for the Xnr probes, Hugh Woodland for the sox-17 probes, Eddy de (1996). Inhibition of Xbra transcription activation causes defects Robertis for the chordin, frzb, and cerberus probes, Christoph in mesodermal patterning and reveals autoregulation of Xbra in Niehrs for the goosecoid probe, and Sebastien Motreuil for taking dorsal mesoderm. Development 122, 2427–2435. care of the animals. This work was supported by the CNRS, by the Dale, L. (1999). Vertebrate development: Multiple phases to Universite´ of Paris VI, by a grant from the Association pour la endoderm formation. Curr. Biol. 9, R812–815. Recherche sur le Cancer to Thierry Lepage, and by NSF Grant Dale, L., and Slack, J. M. (1987). Fate map for the 32-cell stage of 9722949 to David Kimelman. Xenopus laevis. Development 99, 527–551. Dyson, S., and Gurdon, J. B. (1997). Activin signalling has a necessary function in Xenopus early development. Curr. Biol. 7, REFERENCES 81–84. Ecochard, V., Cayrol, C., Rey, S., Foulquier, F., Caillol, D., Lemaire, Agius, E., Oelgeschlager, M., Wessely, O., Kemp, C., and De P., and Duprat, A. M. (1998). A novel Xenopus mix-like gene Robertis, E. M. (2000). Endodermal Nodal-related signals and milk involved in the control of the endomesodermal fates. mesoderm induction in Xenopus. Development 127, 1173–1183. Development 125, 2577–2585. Alexander, J., Rothenberg, M., Henry, G. L., and Stainier, D. Y. Erter, C. E., Solnica-Krezel, L., and Wright, C. V. (1998). Zebrafish (1999). Casanova plays an early and essential role in endoderm nodal-related 2 encodes an early mesendodermal inducer signal- formation in zebrafish. Dev. Biol. 215, 343–357. ing from the extraembryonic yolk syncytial layer. Dev. Biol. 204, Amendt, B. A., Sutherland, L. B., Semina, E. V., and Russo, A. F. 361–372. (1998). The molecular basis of Rieger syndrome. Analysis of Essner, J. J., Branford, W. W., Zhang, J., and Yost, H. J. (2000). Pitx2 homeodomain protein activities. J. Biol. Chem. 273, Mesendoderm and left–right brain, heart and gut development 20066–20072. are differentially regulated by pitx2 isoforms. Development 127, Arakawa, H., Nakamura, T., Zhadanov, A. B., Fidanza, V., Yano, T., 1081–1093. Bullrich, F., Shimizu, M., Blechman, J., Mazo, A., Canaani, E., Feldman, B., Dougan, S. T., Schier, A. F., and Talbot, W. S. (2000). and Croce, C. M. (1998). Identification and characterization of Nodal-related signals establish mesendodermal fate and trunk the ARP1 gene, a target for the human acute leukemia ALL1 neural identity in zebrafish. Curr. Biol. 10, 531–534. gene. Proc. Natl. Acad. Sci. USA 95, 4573–4578. Feldman, B., Gates, M. A., Egan, E. S., Dougan, S. T., Rennebeck, Bisgrove, B. W., Essner, J. J., and Yost, H. J. (1999). Regulation of G., Sirotkin, H. I., Schier, A. F., and Talbot, W. S. (1998). midline development by antagonism of lefty and nodal signaling. Zebrafish organizer development and germ-layer formation re- Development 126, 3253–3262. quire nodal-related signals. Nature 395, 181–185. Bouwmeester, T., Kim, S.-H., Sasai, Y., Lu, B., and DeRobertis, Gage, P. J., and Camper, S. A. (1997). Pituitary homeobox 2, a novel E. M. (1996). Cerberus is a head-inducing secreted factor ex- member of the bicoid-related family of homeobox genes, is a pressed in the anterior endoderm of Spemann’s organizer. Nature potential regulator of anterior structure formation. Hum. Mol. 382, 595–601. Genet. 6, 457–464. Brannon, M., and Kimelman, D. (1996). Activation of Siamois by Gage, P. J., Suh, H., and Camper, S. A. (1999). Dosage requirement the Wnt pathway. Dev. Biol. 180, 344–347. of Pitx2 for development of multiple organs. Development 126, Campione, M., Steinbeisser, H., Schweickert, A., Deissler, K., van 4643–4651. Bebber, F., Lowe, L. A., Nowotschin, S., Viebahn, C., Haffter, P., Green, J. B. A., New, H. V., and Smith, J. C. (1992). Responses of Kuehn, M. R., and Blum, M. (1999). The homeobox gene Pitx2: embryonic Xenopus cells to activin and FGF are separated by Mediator of asymmetric left–right signaling in vertebrate heart multiple dose thresholds and correspond to distinct axes of the and gut looping. Development 126, 1225–1234. mesoderm. Cell 71, 731–739. Capdevila, J., Vogan, K. J., Tabin, C. J., and Izpisua Belmonte, J. C. Gritsman, K., Talbot, W. S., and Schier, A. F. (2000). Nodal (2000). Mechanisms of left–right determination in vertebrates. signaling patterns the organizer. Development 127, 921–932. Cell 101, 9–21. Gritsman, K., Zhang, J., Cheng, S., Heckscher, E., Talbot, W. S., and Cheng, A. M., Thisse, B., Thisse, C., and Wright, C. V. (2000). The Schier, A. F. (1999). The EGF–CFC protein one-eyed pinhead is lefty-related factor Xatv acts as a feedback inhibitor of nodal essential for nodal signaling. Cell 97, 121–132.

Harland, R. M. (1991). In situ hybridization, an improved whole dorsal-vegetal cells of blastulae and able to induce a complete mount method for Xenopus embryos. In “Methods in Cell secondary axis. Cell 81, 85–94. Biology” (B. K. Kay and H. J. Peng, Eds.), Vol. 36, pp. 685–695. Li, H., Tierney, C., Wen, L., Wu, J. Y., and Rao, Y. (1997). A single Academic Press, San Diego. morphogenetic field gives rise to two retina primordia under the Hatta, K., Kimmel, C. B., Ho, R. K., and Walker, C. (1991). The influence of the prechordal plate. Development 124, 603–615. cyclops mutation blocks specification of the floor plate of the Lin, C. R., Kioussi, C., O’Connell, S., Briata, P., Szeto, D., Liu, F., zebrafish central nervous system. Nature 350, 339–341. Izpisua-Belmonte, J. C., and Rosenfeld, M. G. (1999). Pitx2 Henry, G. L., Brivanlou, I. H., Kessler, D. S., Hemmati-Brivanlou, regulates lung asymmetry, cardiac positioning and pituitary and A., and Melton, D. A. (1996). TGF-beta signals and a pattern in tooth morphogenesis. Nature 401, 279–282. Xenopus laevis endodermal development. Development 122, Logan, M., Pagan-Westphal, S. M., Smith, D. M., Paganessi, L., and 1007–1015. Tabin, C. J. (1998). The transcription factor Pitx2 mediates Hoodless, P. A., Tsukazaki, T., Nishimatsu, S., Attisano, L., Wrana, situs-specific morphogenesis in response to left–right asymmet- J. L., and Thomsen, G. H. (1999). Dominant-negative Smad2 ric signals. Cell 94, 307–317. mutants inhibit activin/Vg1 signaling and disrupt axis formation Lu, M. F., Pressman, C., Dyer, R., Johnson, R. L., and Martin, J. F. in Xenopus. Dev. Biol. 207, 364–379. (1999). Function of Rieger syndrome gene in left–right asymme- Hudson, C., Clements, D., Friday, R. V., Stott, D., and Woodland, try and craniofacial development. Nature 401, 276–278. H. R. (1997). Xsox17alpha and -beta mediate endoderm formation Lustig, K. D., Kroll, K., Sun, E., Ramos, R., Elmendorf, H., and in Xenopus. Cell 91, 397–405. Kirschner, M. W. (1996). A Xenopus nodal-related gene that acts Hyde, C. E., and Old, R. W. (2000). Regulation of the early in synergy with noggin to induce complete secondary axis and expression of the Xenopus nodal-related 1 gene, Xnr1. Develop- notochord formation. Development 122, 3275–3282. ment 127, 1221–1229. McKendry, R., Harland, R. M., and Stachel, S. E. (1998). Activin- Jones, C. M., Kuehn, M. R., Hogan, B. L., Smith, J. C., and Wright, induced factors maintain goosecoid transcription through a Dev. Biol. C. V. (1995a). Nodal-related signals induce axial mesoderm and paired homeodomain binding site. 204, 172–186. Meno, C., Shimono, A., Saijoh, Y., Yashiro, K., Mochida, K., dorsalize mesoderm during gastrulation. Development 121, Ohishi, S., Noji, S., Kondoh, H., and Hamada, H. (1998). lefty-1 is 3651–3662. required for left–right determination as a regulator of lefty-2 and Jones, C. M., Kuehn, M. R., Hogan, B. L. M., Smith, J. C., and nodal. Cell 94, 287–297. Wright, C. V. E. (1995b). Nodal-related signals induce axial Mucchielli, M. L., Mitsiadis, T. A., Raffo, S., Brunet, J. F., Proust, mesoderm and dorsalize mesoderm during gastrulation. Devel- J. P., and Goridis, C. (1997). Mouse Otlx2/RIEG expression in the opment 121, 3651–3662. odontogenic epithelium precedes tooth initiation and requires Kimmel, C. B., Warga, R. M., and Schilling, T. F. (1990). Origin and mesenchyme-derived signals for its maintenance. Dev. Biol. 189, organization of the zebrafish fate map. Development 108, 581–594. 275–284. Kitamura, K., Miura, H., Miyagawa-Tomita, S., Yanazawa, M., Niehrs, C., Steinbesser, H., and De Robertis, E. M. (1994). Meso- Katoh-Fukui, Y., Suzuki, R., Ohuchi, H., Suehiro, A., Motegi, Y., dermal patterning by a gradient of the vertebrate homeobox gene Nakahara, Y., Kondo, S., and Yokoyama, M. (1999). Mouse Pitx2 goosecoid. Science 263, 817–820. deficiency leads to anomalies of the ventral body wall, heart, Nieuwkoop, P. D. and Faber, J. (1967). Normal table of Xenopus extra- and periocular mesoderm and right pulmonary isomerism. laevis (Daudin). Elsevier/North Holland, Amsterdam. Development 126, 5749–5758. Nomura, M., and Li, E. (1998). Smad2 role in mesoderm formation, Kofron, M., Demel, T., Xanthos, J., Lohr, J., Sun, B., Sive, H., Osada, left–right patterning and craniofacial development. Nature 393, S., Wright, C., Wylie, C., and Heasman, J. (1999). Mesoderm 786–790. induction in Xenopus is a zygotic event regulated by maternal Oh, S. P., and Li, E. (1997). The signaling pathway mediated by the VegT via TGFbeta growth factors. Development 126, 5759–5770. type IIB activin receptor controls axial patterning and lateral Lamb, M. T., Knecht, A., Smith, W. C., Stachel, S. E., Econmides, asymmetry in the mouse. Genes Dev. 11, 1812–1826. A. N., Stahl, N., Yancopolous, G. D., and Harland, R. (1993). Osada, S. I., and Wright, C. V. (1999). Xenopus nodal-related Neural induction by the secreted polypeptide noggin. Science signaling is essential for mesendodermal patterning during early 262, 713–718. embryogenesis. Development 126, 3229–3240. Latinkic, B. V., and Smith, J. C. (1999). Goosecoid and mix.1 repress Peyrieras, N., Strahle, U., and Rosa, F. (1998). Conversion of Brachyury expression and are required for head formation in zebrafish blastomeres to an endodermal fate by TGF-beta-related Xenopus. Development 126, 1769–1779. signaling. Curr. Biol. 8, 783–786. Latinkic, B. V., Umbhauer, M., Neal, K. A., Lerchner, W., Smith, Piccolo, S., Agius, E., Leyns, L., Bhattacharyya, S., Grunz, H., J. C., and Cunliffe, V. (1997). The Xenopus Brachyury promoter is Bouwmeester, T., and De Robertis, E. M. (1999). The head activated by FGF and low concentrations of activin and sup- inducer Cerberus is a multifunctional antagonist of Nodal, BMP pressed by high concentrations of activin and by paired-type and Wnt signals. Nature 397, 707–710. homeodomain proteins. Genes Dev. 11, 3265–3276. [Published Piedra, M. E., Icardo, J. M., Albajar, M., Rodriguez-Rey, J. C., and erratum appears in Genes Dev., 1998, 12, 1240] Ros, M. A. (1998). Pitx2 participates in the late phase of the Lemaire, P., Darras, S., Caillol, D., and Kodjabachian, L. (1998). A pathway controlling left–right asymmetry. Cell 94, 319–324. role for the vegetally expressed Xenopus gene Mix.1 in endoderm Rebagliati, M. R., Toyama, R., Haffter, P., and Dawid, I. B. (1998). formation and in the restriction of mesoderm to the marginal cyclops encodes a nodal-related factor involved in midline sig- zone. Development 125, 2371–2380. naling. Proc. Natl. Acad. Sci. USA 95, 9932–9937. Lemaire, P., Garrett, N., and Gurdon, J. B. (1995). Expression Rodaway, A., Takeda, H., Koshida, S., Broadbent, J., Price, B., cloning of Siamois, a Xenopus homeobox gene expressed in Smith, J. C., Patient, R., and Holder, N. (1999). Induction of the

mesendoderm in the zebrafish germ ring by yolk cell-derived Sun, B. I., Bush, S. M., Collins-Racie, L. A., LaVallie, E. R., DiBlasio- TGF-beta family signals and discrimination of mesoderm and Smith, E. A., Wolfman, N. M., McCoy, J. M., and Sive, H. L. (1999). endoderm by FGF. Development 126, 3067–3078. derriere: A TGF-beta family member required for posterior devel- Ryan, A. K., Blumberg, B., Rodriguez-Esteban, C., Yonei-Tamura, opment in Xenopus. Development 126, 1467–1482. S., Tamura, K., Tsukui, T., de la Pena, J., Sabbagh, W., Green- Tada, M., Casey, E. S., Fairclough, L., and Smith, J. C. (1998). wald, J., Choe, S., Norris, D. P., Robertson, E. J., Evans, R. M., Bix1, a direct target of Xenopus T-box genes, causes formation Rosenfeld, M. G., and Izpisua Belmonte, J. C. (1998). Pitx2 of ventral mesoderm and endoderm. Development 125, 3997– determines left–right asymmetry of internal organs in verte- 4006. Nature brates. 394, 545–551. Thisse, C., and Thisse, B. (1999). Antivin, a novel and divergent Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). “Molecular member of the TGFbeta superfamily, negatively regulates meso- Cloning. A Laboratory Manual.” Cold Spring Harbor Laboratory derm induction. Development 126, 229–240. Press, Cold Spring Harbor, NY. Thisse, C., Thisse, B., Halpern, M. E., and Postlethwait, J. H. (1994). Sampath, K., Rubinstein, A. L., Cheng, A. M., Liang, J. O., Fekany, Goosecoid expression in neurectoderm and mesendoderm is K., Solnica-Krezel, L., Korzh, V., Halpern, M. E., and Wright, C. V. (1998). Induction of the zebrafish ventral brain and floor- disrupted in zebrafish cyclops gastrulas. Dev. Biol. 164, 420–429. plate requires cyclops/nodal signalling. Nature 395, 185–189. Treisman, J., Gonczy, P., Vashishtha, M., Harris, E., and Desplan, Sasai, Y., Lu, B., Steinbesser, H., Geissert, D., Gont, L. K., and C. (1989). A single amino acid can determine the DNA binding DeRobertis, E. M. (1994). Xenopus chordin: A novel dorsalizing specificity of homeodomain proteins. Cell 59, 553–562. factor activated by organizer-specific homeobox genes. Cell 79, Tremblay, J. J., Goodyer, C. G., and Drouin, J. (2000). Transcrip- 779–790. tional properties of ptx1 and ptx2 isoforms. Neuroendocrinology Schier, A. F., Neuhauss, S. C., Helde, K. A., Talbot, W. S., and 71, 277–286. Driever, W. (1997). The one-eyed pinhead gene functions in Tremblay, K. D., Hoodless, P. A., Bikoff, E. K., and Robertson, E. J. mesoderm and endoderm formation in zebrafish and interacts (2000). Formation of the definitive endoderm in mouse is a with no tail. Development 124, 327–342. Smad2-dependent process. Development 127, 3079–3090. Schier, A. F., and Shen, M. M. (2000). Nodal signalling in vertebrate Turner, D. L., and Weintraub, H. (1994). Expression of achaete- development. Nature 403, 385–389. scute homolog 3 in Xenopus embryos converts ectodermal cells Schweickert, A., Campione, M., Steinbeisser, H., and Blum, M. to a neural fate. Genes Dev. 8, 1434–1447. (2000). Pitx2 isoforms: Involvement of Pitx2c but not Pitx2a or Warga, R. M., and Nusslein-Volhard, C. (1999). Origin and devel- Pitx2b in vertebrate left–right asymmetry. Mech. Dev. 90, 41–51. opment of the zebrafish endoderm. Development 126, 827–838. Semina, E. V., Reiter, R., Leysens, N. J., Alward, W. L., Small, K. W., Yan, Y. T., Gritsman, K., Ding, J., Burdine, R. D., Corrales, J. D., Datson, N. A., Siegel-Bartelt, J., Bierke-Nelson, D., Bitoun, P., Price, S. M., Talbot, W. S., Schier, A. F., and Shen, M. M. (1999). Zabel, B. U., Carey, J. C., and Murray, J. C. (1996). Cloning and Conserved requirement for EGF–CFC genes in vertebrate left– characterization of a novel bicoid-related homeobox transcrip- right axis formation. Genes Dev. 13, 2527–2537. tion factor gene, RIEG, involved in Rieger syndrome. Nat. Genet. Yasuo, H., and Lemaire, P. (1999). A two-step model for the fate 14, 392–399. Sive, H., Grainger, R. M., and M., H. R. (1994). “Early Development determination of presumptive endodermal blastomeres in Xeno- of Xenopus laevis.” Cold Spring Harbor Laboratory Press, Cold pus embryos. Curr. Biol. 9, 869–879. Spring Harbor, NY. Yoshioka, H., Meno, C., Koshiba, K., Sugihara, M., Itoh, H., Smith, J. C., Price, B. M. J., Green, J. B. A., Weigel, D., and Ishimaru, Y., Inoue, T., Ohuchi, H., Semina, E. V., Murray, J. C., Herrmann, B. G. (1991). Expression of a Xenopus homolog of Hamada, H., and Noji, S. (1998). Pitx2, a bicoid-type homeobox brachyury (T) is an immediate-early response to mesoderm gene, is involved in a lefty-signaling pathway in determination of induction. Cell 67, 79–87. left–right asymmetry. Cell 94, 299–305. Song, J., Oh, S. P., Schrewe, H., Nomura, M., Lei, H., Okano, M., Zhang, J., Houston, D. W., King, M. L., Payne, C., Wylie, C., and Gridley, T., and Li, E. (1999). The type II activin receptors are Heasman, J. (1998). The role of maternal VegT in establishing the essential for egg cylinder growth, gastrulation, and rostral head primary germ layers in Xenopus embryos. Cell 94, 515–524. development in mice. Dev. Biol. 213, 157–169. Zhou, X., Sasaki, H., Lowe, L., Hogan, B. L., and Kuehn, M. R. Stachel, S. E., Grunwald, D. J., and Myers, P. Z. (1993). Lithium (1993). Nodal is a novel TGF-beta-like gene expressed in the perturbation and goosecoid expression identify a dorsal specifi- mouse node during gastrulation. Nature 361, 543–547. cation pathway in the pregastrula zebrafish. Development 117, 1261–1274. Strahle, U., Jesuthasan, S., Blader, P., Garcia-Villalba, P., Hatta, K., Received for publication July 28, 2000 and Ingham, P. W. (1997). one-eyed pinhead is required for Revised September 21, 2000 development of the ventral midline of the zebrafish (Danio rerio) Accepted September 21, 2000 neural tube. Genes Funct. 1, 131–148. Published online December 9, 2000