sign in sign up
<<
Home , Alexander disease, Lamin, Mandibuloacral dysplasia, Monilethrix, Nestin (protein), Neurite

IDENTIFICATION AND CHARACTERIZATION OF ISOFORMS IN AMYOTROPHIC LATERAL SCLEROSIS

by

Jesse Ryan McLean

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Graduate Department of Laboratory Medicine and Pathobiology University of Toronto

© Copyright by Jesse Ryan McLean 2009 Jesse Ryan McLean Identification and Characterization of Peripherin Isoforms in Amyotrophic Lateral Sclerosis Doctor of Philosophy Department of Laboratory Medicine and Pathobiology University of Toronto 2009

ABSTRACT Peripherin is a type III that is predominately expressed in the peripheral and in subsets of efferent projections in the central nervous systems. While the exact role of peripherin remains unclear, it is found upregulated after traumatic neuronal injury and in the devastating neurodegenerative disease amyotrophic lateral sclerosis (ALS). Interestingly, peripherin overexpressing transgenic mice succumb to motor disease with pathological hallmarks reminiscent of those found in ALS. Pathological peripherin abnormalities occur with high frequency in both familial and sporadic forms of ALS, with peripherin found associated with the majority intracellular inclusions present within degenerating populations. The findings of peripherin in sporadic ALS have reinforced the importance of peripherin as a prospective etiological or propagative factor of disease pathogenesis. Surprisingly, inherited peripherin mutations have not been identified; as such, understanding the post-transcriptional mechanism at which peripherin imparts its effect(s) is considered a key goal and represents a pathological point-of- convergence for an otherwise complex, multifaceted disease. Prior to the commencement of this work, our group identified the presence of an abnormal peripherin alternative splice variant upregulated in ALS. In doing so, we consistently observed the presence of a second peripherin species of ~45 kDa on immunoblots of lysates derived from full- length peripherin transfections. Here, we identified this protein as a constitutively expressed isoform, termed Per-45, that arises from alternative translation and that is required for normal filament assembly: changes to the normal isoform expression pattern are associated with malformed filaments and intracellular inclusions. In lieu of the

ii possibility of distinct peripherin intra-isoform associations, we identified isoform-specific expression and ratio changes in traumatic neuronal injury, in mouse models of motor neuron disease, and in ALS. Finally, we explored the interrelationships between peripherin isoform expression, protein aggregation, and neuritic outgrowth by linking these phenotypes with major pathogenic features associated with ALS, including in vitro models of oxidation, glutamate excitotoxicity, and neuroinflammation. Overall, this thesis provides exciting new insight into our knowledge of basic IF biology and the role of peripherin isoforms in injury and in motor neuron disease.

iii DEDICATION

To my love, Agnieszka, who makes me remember how young I am.

To my mother and father, Margaret and David:

for the freedom, for the haven,

and for your love and friendship.

iv ACKNOWLEDGEMENTS

I am truly indebted to my mentor, Dr. Janice Robertson, for allowing me the wonderful opportunity to learn in her laboratory. Her wisdom, enthusiasm, and compassion make her a great supervisor and an even better friend. Because of Dr. Robertson’s passion and influence, I look forward to a career dedicated to helping those afflicted with neurodegenerative diseases. I am honored to have had this opportunity to study as both her student and colleague, and hope to provide the same patience and generosity to others, as she has shown me.

I would like to thank Drs. JoAnne McLaurin, Ekaterina Rogaeva, and Gerold Schmitt-Ulms for their helpful discussions during the course of my work. Because of their extraordinary advice and guidance, my perspectives in critical thinking and scientific analysis have greatly matured. Their expertise and kindness has given me a first-hand look at how wonderful research can be. I look forward to future conversations and wish them all the best in their research.

I would also like to thank Drs. Denise Figlewicz, Jasna Kriz, Michael Strong, and Lorne Zinman for advice about my thesis, personal life, and future aspirations. Their love for ALS research is unparalleled and is a reflection of true dedication and hope.

I wish to thank everyone in the laboratory, past and present, who have made my stay welcome and enjoyable, including Joe Findlater, Sung-Hwan Hong, Shirley Liu, Denise Miletic, Keigo Miyazaki, Teresa Sanelli, April Sung, Sonja Tjostheim, and Shangxi Xiao. I would also like to acknowledge my friends in LMP and at the CRND, particularly Dr. Kevin DaSilva, Ms. Daniela Fenili, Ms. Beverely Francis, Dr. Cheryl Hawkes, Dr. Vivian Ng, and Dr. Joel Watts. I consider everyone here like a second family to me and look forward to working together as the next generation of neuroscience researchers.

v I wish to acknowledge the amazing staff of the Department of Laboratory Medicine and Pathobiology and the Centre for Research in Neurodegenerative Diseases at the University of Toronto. A special thank you to Ms. Louella D’Cunha, Ms. Yen Du, Dr. Harry Elsholtz, Ms. Kitty Lo, Ms. Marika Michael, and Dr. Doug Templeton; I will always remember and uphold the individual experiences of kindness and professionalism that I learned from each of you.

I would like to thank Dr. Agnieszka Hassa for her love and support throughout these years. When I started, she was my girlfriend, as I write this thesis, she is my fiancée, and when I am finished, we will be married - she was always my sweetheart. She continues to teach and learn (and debate) with me all that I seek to know about life’s adventures.

I am indebted to my loving family, David, Margarita, and Ryan for their support and understanding during these years. Their continued love and guidance through difficult periods has been an inspiration, that which I immeasurably value, and aspire to give in return.

Last, but not least, I wish to offer hope to the ALS patients in return for being the most kind and courageous people that I will ever know.

vi TABLE OF CONTENTS

ABSTRACT...... ii DEDICATION…………………………………………………………………………..iii ACKNOWLEDGEMENTS…………………………………………………………….iv TABLE OF CONTENTS………………………………………………………………vii LIST OF TABLES…………………………………………………………………….....x LIST OF FIGURES……………………………………………………………………..xi LIST OF ABBREVIATIONS…………………………………………………………xiii

CHAPTER 1: LITERATURE REVIEW………………………………………………1 1.1 Amyotrophic Lateral Sclerosis………………………………………………………..2 1.1.1 Epidemiological Considerations………………………………………….....2 1.1.2 Clinical Phenomenology, , and Genetics………………...... 5 1.1.3 Transgenic Mouse Models of ALS………………………………………...14 1.1.4 Mechanisms of Disease Pathogenesis……………………………………...18 1.2 Protein Aggregation………………………………………………………………….28 1.2.1 Mechanisms of Aggregation……………….……………………………....28 1.2.2 Protein Aggregation in ALS……………………………………………………….32

1.3 Intermediate Filaments……………………………………………………………….35 1.3.1 Structure, Function, and Molecular Genetics.……………………………..35 1.3.2 Peripherin…………………………………………………………………..39 1.3.2.1 Peripherin in ALS………………………………………………..48 1.4 Protein Isoforms……………………………………………………………………...51 1.4.1 Protein Diversity…………………………………………………………...51 1.4.2 ………………………………………………………..51 1.4.2.1 Alternative Splicing in ALS……………………………………..52 1.4.3 Alternative Translation……………………………………………………54 1.4.3.1 Alternative Translation in ALS………………………………….55

vii CHAPTER 2: RATIONALE, HYPOTHESIS, AND OBJECTIVES……………….58 2.1 Rationale……………………………………………………………………………..59 2.2 Hypothesis…………………………………………………………………………...60 2.3 Objectives……………………………………………………………………………60

CHAPTER 3: A NOVEL PERIPHERIN ISOFORM GENERATED BY ALTERNATIVE TRANSLATION IS REQUIRED FOR NORMAL FILAMENT NETWORK FORMATION……………………………………………………………62 3.1 Abstract………………………………………………………………………………63 3.2 General Introduction…………………………………………………………………64 3.3 Methods and Materials……………………………………………………………….65 3.4 Results………………………………………………………………………………..68 3.5 Discussion……………………………………………………………………………79

CHAPTER 4: DISTINCT BIOMOLECULAR SIGNATURES CHARACTERIZE PERIPHERIN ISOFORM EXPRESSION IN TRAUMATIC NEURONAL INJURY AND MOTOR NEURON DISEASE…………………………………………………..84 4.1 Abstract………………………………………………………………………………85 4.2 General Introduction…………………………………………………………………86 4.3 Methods and Materials…………………………………………………………….....87 4.4 Results………………………………………………………………………………..91 4.5 Discussion…………………………………………………………………………..104

CHAPTER 5: OXIDATION AND NEUROINFLAMMATION, BUT NOT EXCITOTOXICITY, EXERT DIFFERENTIAL EFFECTS ON PERIPHERIN ISOFORM EXPRESSION AND MORPHOLOGY………………………………...109 5.1 Abstract……………………………………………………………………………..110 5.2 General Introduction………………………………………………………………..111 5.3 Methods and Materials……………………………………………………………...112 5.4 Results………………………………………………………………………………116 5.5 Discussion…………………………………………………………………………..125

viii

CHAPTER 5: CONCLUSIONS AND FUTURE DIRECTIONS…………………..131 6.1 Preamble: Hypothesis Revisited……………………………………………………132 6.2 Conclusions…………………………………………………………………………132 6.2.1 Identification of Per-45 as the First Human Peripherin Variant (Chapter 3)... …………………………………………………………………………………..132 6.2.2 Characterization of Per-45 on Peripherin Filament Assembly (Chapter 3)………………………………………………………………………………..134 6.2.3 Peripherin Isoform Content as a Biochemical Signature (Chapter 4)……139 6.2.4. Peripherin Isoform Ratios, Outgrowth, and Aggregation (Chapter 5)..………………………………………………………………………………140 6.3 Future Directions…………………………………………………………………...142

APPENDIX I SUPPLEMENTAL FINDINGS………………………………………145 A.1. Density Dependent Spatial Localization of Per-45 in SW13 vim (-) Cells...... 146 A.2. Differential Labeling of Peripherin in Per-28-Generated Aggregates…………….147 A.3. Clinical and Pathological Information of ALS Patients…………………………..148

REFERENCES. ……………………………………………………………………….149

ix LIST OF TABLES 1.1.2.i Neuropathological Inclusions of ALS 1.1.2.ii Genetics of ALS 1.1.4.i Transgenic Mouse Models with Targeted Disruption of nIFs 1.2.1.i Protein Aggregation in Neurodegenerative Diseases 1.3.1.i Subfamily Classification of Intermediate Filaments 1.3.2.i Peripherin Expression in Culture and Tissue 1.4.2.i Human Neurologic Disease Associated with Alternative Splicing 1.4.3.i Human Pathologies Associated with Alternative Translation

x LIST OF FIGURES 1.1.3.i SOD1 Chemistry: Peroxidase and Peroxynitrite Hypotheses 1.2.1.i Theoretical Schematic Representation of Protein Aggregation 1.3.1.i Structure of Intermediate Filament 1.3.2.i Peripherin Protein Isoforms: Splicing Mechanism and Expression 3.4.i Use of a Downstream Alternate In-Frame Translation Initiation Codon Generates a Peripherin Species of ~45 kDa 3.4.ii Site-Directed Mutagenesis of ATG2 in Human and ATG3 in Mouse Identifies the ~45 kDa Peripherin Species 3.4.iii Characterization of Filament Network Requirements of Per-58 and Per-45 Isoforms 3.4.iv Per-45 is Integrated within the Normal Peripherin Network 3.4.v Western Blot Analysis of Peripherin Isoform Expression in Different Neuronal Tissues 4.4.i Sciatic Nerve Crush Western Blot Analysis 4.4.ii Middle Cerebral Arterial Occlusion Western Blot Analysis 4.4.iii Peripherin Overexpressing Mice Western Blot Analysis 4.4.iv Per;L-/- Mice Western Blot Analysis 4.4.v mtSOD1G93A Mice Western Blot Analysis 4.4.vi Neurological Controls and ALS Cases Western Blot Analysis

5.4.i N2a Cell Viability After H2O2, Glutamate, and LPS-Activated BV2 Supernatant Administration.

5.4.ii Peripherin Protein Expression After H2O2, Glutamate, and LPS-Activated BV2 Supernatant Administration in N2a Cells

5.4.iii Peripherin Protein and mRNA Expression in Response to H2O2 Administration in N2a Cells 5.4.iv Immunocytochemistry of N2a Cells Treated with LPS-Activated BV2 Supernatant

5.4.v Peripherin Filament Morphology Following H2O2 Administration

5.4.vi Cytoarchitecture of N2a Cells Following H2O2 Administration

xi 5.4.vii Immunohistochemical Localization of Protein Carbonyls in H2O2-Treated N2a Cells 6.1.i Diagram of the Interrelationships Among Peripherin Isoforms, Aggregation, and Stressors Associated with Neuronal Injury or ALS. 6.2.2.i Hypothetical Representation of Peripherin Filament Organization 6.2.2.ii Hypothetical Schematic of Peripherin Filament Modulation A1 Density Dependent Spatial Localization of Per-45 in SW13 vim (-) Cells A2 Differential Peripherin Morphology in Inclusions Generated by Per-3,4- and Per-3,4M82L-Transfected SW13vim (-) Cells A3 Clinical and Pathological Information of ALS Patients

xii LIST OF ABBREVIATIONS 8OH2'dG 8-hydroxy-2'-deoxyguanosine AD Alzheimer’s Disease AGEs Advanced Glycation End Products ALS Amyotrophic Lateral Sclerosis ALSbi Amyotrophic Lateral Sclerosis with Behavioral Impairment ALSci Amyotrophic Lateral Sclerosis with Cognitive Impairment AMPA α-amino-3-hydroxyl-5-methyl-4-isoxazole- propionate ANG Angiogenin Gene ANOVA Analysis of Variance APEX Apurinic/Apyrimidinic Endonuclease Gene Apo Metal-Free APOE Apolipoprotein E Gene ATP Adenosine Triphosphate AUGSTART Canonical Start Codon BBs Bunina Bodies BV-2 Immortalized Mouse Microglial Cell Line Cdk5 Cyclin-Dependent Kinase 5 cDNA Complementary DNA CMT Charcot-Marie-Tooth Disease CNS

CO2 Carbon Dioxide CS Contralateral Side CSF Cerebrospinal Fluid CT Computed Tomography DT Diffusion-Tensor DCTN1 1 DEPC Diethyl Pyrocarbonate

xiii DIC Differential Interference Contrast DNA Deoxyribonucleic Acid DNPH 2,4-dinitrophenylhydrazine dNTP Deoxynucleotide Triphosphates DRG Dorsal Root Ganglia DS Down Syndrome EAAT2/GLT1 Astroglial Glutamate Transporter ECA External Carotid Artery ECL Enhanced Chemiluminescence EDTA Ethylenediaminetetraacetic Acid ER fALS Familial ALS FBS Fetal Bovine Serum FGF Growth Factor f.o.v. Field-of-Views FTD Frontotemporal FTLD-U Frontotemporal Lobar Degeneration with Ubquition-Positive Inclusions FUS/TLS Fused in Sarcoma/Translated in Liposarcoma FUS/TLS FUS/TLS gene GAPDH Glyceraldehyde 3-Phosphate Dehydrogenase GEFs Guanine Exchange Factors GFAP Glial Fibrillary Acidic Protein GTP Guanosine Triphosphate, GWAS Genome Wide Association Study

H202 Hydrogen Peroxide hATG1 First Human Initiation Codon hATG2 Second Human Initiation Codon HCIs Hyaline Conglomerate Inclusions HD Huntington’s Disease

xiv HFE Haemochromatosis Gene HGP Project Holo Fully Metallated hPer-45 Human Peripherin-45 hPer-58 Full-Length Human Peripherin HRP Horse Radish Peroxidase hSOD1WT Wild-Type Human SOD1 ICA Internal Carotid Artery IEF Isoelectric Focusing IF Intermediate Filament IL-6 Interleukin-6 iNOS Inducible Nitric Oxide Synthase IP Ipsilateral Side IRES Internal Ribosomal Entry Site JAK Janus Protein Kinase LIF Leukaemia Inhibitory Factor LMN LPS Lipopolysaccharide MAO-B Monoamine Oxidase-B MAPK Mitogen-Actvated Protein Kinase mATG2 Second Mouse Initiation Codon mATG3 Third Mouse Initiation Codon MCAO Middle Cerebral Arterial Occlusion MND Motor Neuron Disease mPer-45 Mouse Peripherin-45 mPer-58 Full-Length Mouse Peripherin MR1H Proton Magnetic Resonance MRI Magnetic Resonance mRNA Messenger RNA mtSOD1 Mutant Human SOD1

xv MTT 3-(4,5-dimethylthiazol-2-yl)-2,5,diphenyl- tetrazolium Bromide N2a Neuro-2a Cells

N2O Nitrous Oxide

NaBH4 Sodium Borohydride NEFH High Molecular Weight Gene NF Neurofilament NF-H High Molecular Weight Neurofilament NF-L Low Molecular Weight Neurofilament NF-L (-/-) NFL Knockout NF-M Medium Molecular Weight Neurofilament NFTs Neurofibrillary Tangles NGF nIF Neuronal Intermediate Filament nNOS Neuronal Nitric Oxide Synthase NSE Neuron Specific Enolase

O2 Oxygen ORF Open Reading Frame P Post-Natal Day PAGE Polyacrylamide Gel Electrophoresis PBS Phosphate-Buffered Saline PI3K Phosphatidylinositol 3-Kinase PC12 Rat PCR Polymerase Chain Reaction PD Parkinson’s Disease PDC ALS-Parkinsonism-Dementia Complex Per Wild-Type Promoter Peripherin Overexpressing PET Positron Emission Tomography PNS Peripheral Nervous System PRPH Peripherin Gene

xvi PON Paraoxonase Gene PVDF Polyvinyldifluoride RIPA Radioimmunoprecipitation Assay Buffer RNA Ribonucleic Acid RNS Reactive Nitrating Species ROS Reactive Oxygen Species RT Reverse rt Room Temperature sALS Sporadic ALS SETX Senataxin gene SDS Sodium Dodecyl Sulfate siRNA Small Interfering RNA SMA SMN Survival of Motor Neuron sORF Short Open Reading Frame Small Nuclear Ribonucleoproteins SNPs Single Nucleotide Polymorphisms SOD1 Superoxide Dismutase 1 SOD1 SOD1 Gene SOD1 (-/-) SOD1 Knockout STAT Signal Transducers and Activators of Transcription TBE Tris-Borate-EDTA Buffer TBS Tris-Buffered Saline TDP-43 TAR DNA-Binding Protein-43 TARDBP TDP-43 Gene TNF-α Tumour Necrosis Factor-α Trk Receptor Kinase TPer Human Thy-1 Promoter Peripherin Overexpressing TPer;L-/- TPer x NFL (-/-)

xvii TSE Transmissible Spongiform Encephalopathy TX-100 Triton X-100 UBIs Ubiquitinated Inclusions UMN UTR Untranslated Region v/v Volume Per Volume VAPB Vesicle-Associated /Synaptobrevin-Associated Membrane Protein B Gene VEGF Vascular Endothelial Growth Factor VEGF VEGF Gene w/v Weight Per Volume wr/wr Wobbler wt (or WT) Wild-type

xviii 1

CHAPTER 1

LITERATURE REVIEW

Portions of Section 1.3 will be published in: McLean J.R. and Robertson J. (2010) Peripherin Pathology in Neurodegenerative Diseases. Nixon R. and Yuan D. (eds.) Handbook of Neurochemistry and Molecular Neurobiology: in the Nervous System (v. 13). Lajtha A (series ed.) Springer U.S., New York, chapter in press. With kind permission of Springer Science and Business Media. 2

1.0 INTRODUCTION

1.1 Amyotrophic Lateral Sclerosis As the population ages and the demographic birth shift known as the “Baby Boom Generation” enters into their fifth and sixth decades of life, more individuals are becoming afflicted with age-dependent neurodegenerative disorders. Among these illnesses, which include Alzheimer’s disease (AD) and Parkinson’s disease (PD), is amyotrophic lateral sclerosis (ALS), an invariably fatal disorder manifested by selective and progressive death of upper and lower motor of the central nervous system (CNS). Although the classical view of ALS as a single pathological state stems from its original clinical descriptions in the mid-19th century [Aran 1850a & 1850b, Charcot & Joffroy 1869, Duchenne (De Boulogne) 1860], it has only been through our recent understanding of the various pathological processes involved that we are beginning to appreciate the complex and heterogeneous nature of this disorder.

1.1.1 Epidemiological Considerations Descriptive Statistics: ALS, also known as Lou Gehrig’s disease or motor neuron disease (MND), is the most common form of motor neuron degeneration, with incidence and prevalence rates reported to range between 1.47-2.70 and 2.7-7.4 per 100,000 individuals, respectively (Worms 2001, Logroscino et al. 2008). The cumulative probability of developing the disease during a lifetime in the United States is about 1 in 100 for those reaching adulthood. Identification of ALS mortality rates from death certificates is considered, for the most part, reasonably accurate ranging between 1.51- 3.81 per 100,000 individuals (Román 1996), however, conclusions drawn from these rates should be taken cautiously, as the accuracy and quality of information reported on death certificates can be poor (Ragonese et al. 2004, Chio 2005) Gender differences are consistently reported in ALS, with an average male-to- female ratio of 1.4:1, however, this slight male preponderance is lost with increasing age, approaching parity after age 70 (Cashman 2001, Rowland 2003). Age-specific incidence rates indicate that the majority of ALS patients develop symptoms during their sixth and seventh decades of life; however, a significant proportion of patients (~10%) will develop 3

symptoms earlier than age 45 (Strong 2003). On average, individuals afflicted with the disease live less than five years from symptom onset, and, while survival curves are skewed towards the short-term, with a median of three years, there is a broad range of long-term survivorship among patients living greater than 10 years with the disease (Jablecki et al. 1989, Eisen et al. 1993). Longitudinal epidemiological studies from age- and sex-adjusted population- registries have identified patterns of increasing incidence and prevalence that cannot be accounted for by population aging or by increasing case ascertainment as a result of better diagnostic criteria (Beghi et al. 2006). These findings suggest that exogenous risk factors may play a role in the development and/or progression of the disease; however, because of the low prevalence of ALS, the unknown duration of the disease incubation period, as well as the possible impact of co-morbidity, no clear etiological factor has emerged. Among the numerous lifestyle and environmental risk factors that have been suggested, an increased risk of developing ALS is evident amongst individuals of lower socioeconomic status (Sutedja et al. 2007); amongst workers with occupations that require extensive physical activity (Granieri et al. 1988, Chio et al. 2005, Veldink et al. 2005); amongst individuals that have suffered from previous mechanical trauma (Gallagher & Sanders 1987, Kurland et al. 1992) or electrical shock (Gallagher & Talbert 1991, Jafari et al. 2001, Zoccolella et al. 2008); and amongst smokers (Kamel et al. 1999, Weisskopf et al. 2004). Only one protective factor, Vitamin E, has been identified to date (Ascherio et al. 2005). Several etiopathogenic theories have also been proposed to explain how the disease arises in a susceptible person. While mostly anecdotal and based largely on scant individual case reports, the viral (Ravits 2005, Verma & Berger 2006), prion (Worrall et al. 2000), autoimmune (Appel et al. 1995, Drachman et al. 1995), and paraneoplastic (Rosenfeld & Posner 1991) theories of ALS continue to draw interest. Variants of ALS: Three major clinical variants have been identified on the basis of epidemiologic and genetic features: (i) sporadic ALS (sALS), which accounts for 90-95% of the ALS population and has no apparent genetic linkage; (ii) familial or hereditary ALS (fALS); and (iii) a western Pacific form. While the sporadic form accounts for the majority of the ALS population (Broom et al. 2004), 5-10% of patients have at least one first- or second-degree relative with ALS (Mulder et al. 1986, Li et al. 1988, Williams et 4

al. 1988). fALS presents a broad range of heritability, from fully penetrant phenotypes with autosomal dominant Mendelian patterns of inheritance, to partial or incomplete penetrance with no apparent Mendelian segregation (Valdmanis & Rouleau 2008). In only rare cases, however, is the inheritance autosomal recessive (Hentati et al. 1994, Al- Chalabi et al. 1998, Hentati et al. 1998). Rare, large family pedigrees that range from 4- 20 affected individuals displaying full penetrance, have been used to identify shared genetic markers by linkage analysis for disease-causing . The discovery of mutations in the zinc copper superoxide dismutase 1 gene (SOD1) on 21q22.11 (Rosen et al. 1993) is currently the leading contributor to our understanding of ALS, thus far, with over 135 mutations identified in 15-20% of fALS cases (for an up to date listing of human SOD1 mutations, see http://alsod.iop.kcl.ac.uk/als). Section 1.1.2 provides more detail on SOD1 mutations, as well as other chromosomal loci and genes that have been implicated in fALS. The western Pacific variant includes the best known hyperendemic regions of ALS, occurring among three genetically distinct populations of indigenous residents in the western Pacific: the Chamorros of Guam in the Mariana Islands, the Auyu and Jakai of Irian Jaya (western New Guinea), and residents of the Kii Peninsula of southern Japan. Interestingly, many residents in these geographic isolates also show clinical and pathological characteristics consistent with AD and PD, referred to as a single entity known as parkinsonism-dementia complex (PDC) (Hirano et al. 1961a, Hirano et al. 1961b, Gajdusek & Salazar 1982, Kokubo et al. 2000). The extraordinarily high frequency of both ALS and PDC patients within these geographical isolates, where incidence, prevalence, and mortality rates are 50-100 times as high as those reported elsewhere (Kurland & Mulder 1954a, Kurland & Mulder 1954b), and with considerable overlap with regards to symptomatology and familial aggregation, support the view that ALS and PDC may be a single disease entity with a broad spectrum of phenotypic expression (Murakami 1999, Plato et al. 2003) Small clusters of non-fALS have also been reported, often as a result of community concerns over an endemic distribution of the disease; however, when rigorous methodological criteria are applied, only a few cases are often confirmed. As such, these clusters have yet to yield any epidemiological useful information about the causes of 5

ALS (Armon et al. 1991). One notable exception, however, is the recent findings of a near two-fold increase in incidence rates of military personnel who were deployed to the Persian Gulf War compared with those who were not deployed (Horner et al. 2003). While the significance of these findings remains to be determined, they have prompted the Department of Veteran Affairs in the United States to establish the National Registry of Veterans with ALS, a large-scale study to identify new environmental and genetic factors that may be associated with the disease.

1.1.2 Clinical Phenomenology Clinical Presentation: The clinical diagnosis of ALS is considered difficult due to the phenotypic heterogeneity of the disease, including the manifestation of extramotor symptoms (Strong et al. 1996, Strong et al. 1999), and possible clinical resemblance or overlap with other neurodegenerative diseases (Majoor-Krakauer et al. 1994, Wokke 2000, Annesi et al. 2005, Vance et al. 2006). The El Escorial diagnostic criteria for ALS was established by the World Federation of (Brooks 1994, Brooks et al. 2000b) to increase diagnostic consistency and to classify patients into various levels of certainty, ranging from possible to definite ALS. Although there is no single diagnostic marker or test available for differential diagnosis (Turner et al. 2009), physical and electrophysiological examinations are used in accordance with the guidelines to assess all levels of the motor system from the cortex to the anterior horn of the spinal cord to the motor end units. For a definitive diagnosis, patients must demonstrate signs of progressive upper motor neuron (UMN) and lower motor neuron (LMN) dysfunction in at least three anatomically defined regions of the neuroaxis: craniobulbar, cervical, thoracic, and lumbosacral (Brooks et al. 2000b). Less confident clinical diagnoses are later confirmed by post-mortem and pathological examination (Ross et al. 1998). Both sALS and fALS are clinically indistinguishable and the progression of symptoms will depend on the deterioration of regional combinations of UMNs and LMNs involved (Cwik 2005). Impaired central motor drive, indicative of UMN lesions, results from diminished firing rates and reduced motor unit recruitment (Kent-Braun et al. 1998) and is evaluated by the clinical assessment of rapid and selective muscle activation or signs of alterations in segmental reflex activity (Ashby et al. 1987). The progression of LMN 6

deterioration is primarily the result of atrophy and is readily visible upon clinical assessment as muscle weakness, cramps, and/or fasciculations (Cwik 2005). It is often with widespread LMN dysfunction that patient quality of life is drastically reduced, necessitating the need for medical attention and symptomatic treatment (Radunovic et al. 2007). Approximately 19-35% of patients present with onset in the bulbar territory, termed bulbar-onset, and can involve LMNs (bulbar palsy), UMNs (), or both (Gubbay et al. 1985, Traynor et al. 2000, Millul et al. 2005). Disturbances in speech or language () and difficulty swallowing () are often the initial symptoms, with progression to total loss of articulate speech (anarthria) and cranial nerve atrophy. The majority of patients present with either cervical- or lumbar-onset, which are associated with the degeneration of the anterior horn cells within the enlargements of the spinal cord, typically manifesting as asymmetric symptoms in the legs, shoulder girdle, arms, and hands (Gubbay et al. 1985, Traynor et al. 2000, McDermott & Shaw 2008). In all ALS cases, symptoms progress steadily, involving the spread of one anatomically contiguous region to another without overt exacerbations or cycles of remission. Extraocular movements, sensation, and bladder function are typically normal (Shoesmith & Strong 2006). Terminal stages of the disease are when patients experience respiratory insufficiency, inadequate nutrition and hydration, and severe physical discomfort and psychological distress (McCluskey 2007). Contrary to the traditional view that extramotor systems are spared during disease progression, it is now known that over half of all ALS patients display a range of cognitive and behavioral impairments (Phukan et al. 2007). The form of cognitive dysfunction in ALS is consistent with the clinical phenotype of frontotemporal dementia (FTD), where deficits in executive function, including verbal and nonverbal fluency, working memory, abstract reasoning, and attention, are the most frequently described symptoms (Chari et al. 1996, Strong et al. 1999, Abrahams et al. 2005). Long-term memory and visuospatial functions are largely preserved (Robinson et al. 2006). The debate to classify patients who are cognitively impaired (ALSci) with or separately from those who show behavioral abnormalities (ALSbi), including apathy, depression, irritability, and disinhibition continues; both are seen to coexist in at least 25% of ALS 7 patients (Woolley & Jonathan 2008), but the clinical presentation of ALSbi often does not meet Neary criteria for FTD (Lomen-Hoerth & Strong 2006), signifying a possible usefulness for identifying different pathogenic mechanisms and clinical courses between ALS and FTD. Recent advances in neuroimaging techniques have aided the recognition of cognitive and behavioral impairments in ALS. While static computed tomography (CT) and magnetic resonance imaging (MRI) scanning have been useful in identifying cortical atrophy in frontal and temporal lobes (Kato et al. 1993), functional imaging is used to identify hypometabolic areas and rates of cerebral blood flow (Dalakas et al. 1987, Tanaka et al. 1993). Advances in imaging technology and techniques, such as proton magnetic resonance imaging (MR1H) (Sarchielli et al. 2001), diffusion-tensor (DT) MRI (Agosta et al. 2009), and voxel-based morphometry (Grosskreutz et al. 2008), have been useful in identifying more precise anatomical correlates of cognitive and behavioral decline (Brooks et al. 2000a). Treatment Strategies: The clinical care of ALS patients is based on complex, multidisciplinary approaches aimed at managing symptoms, improving quality of life, and prolonging survival while respecting the autonomy of the patient. Although there is no cure for ALS, with disease-specific therapies remaining largely conceptual and/or ineffective, there are now several published guidelines that provide strategies for treating the various symptoms that arise as the disease progresses (Miller et al. 1999, Bradley et al. 2001, Bradley et al. 2004, Mitsumoto & Rabkin 2007). Good clinical management requires early diagnosis and effective communication among patients, family, friends, and healthcare practitioners. To date, Riluzole, a glutamate-release antagonist, remains the only drug approved for ALS. Several Riluzole-based clinical studies have shown a modest survival benefit of three months (Bensimon et al. 1994, Lacomblez et al. 1996), while recent retrospective analyses report even greater benefits ranging from 4-19 months (Turner et al. 2002, Traynor et al. 2003, Mitchell et al. 2006, Zoccolella et al. 2007). The use of both drug and non-pharmacological interventions are available for coping with impaired function, increasing disability, and end-of-life issues. For example, patients with overt may be treated with drugs such as Botulinum toxin type A injections (Winterholler et al. 2002), intrathecal delivery of Baclofen (Marquardt & Lorenz 1999), or physiotherapy (Drory et al. 2001), or combinations of these and more. Unfortunately, 8

drugs and non-pharmacological strategies offer only limited benefits and are ineffective in the later stages of disease. As the disease worsens, patients will often require gastronomic and respiratory intervention, such as enteric feeding (Langmore et al. 2006), ventilatory support (Cazzolli & Oppenheimer 1996, Aboussouan et al. 1997), and palliative care in hospice centers (Mandler et al. 2001, Bradley et al. 2004). Neuropathology: The El Escorial criteria for probable or definite ALS is estimated to be effective in over 95% of clinical diagnoses as determined by post-mortem autopsy (Rowland 1998). Examination of both gross and microscopic features not only confirms the diagnosis, which is essential for reassurance and closure for family members, but also provides important insights into the biology of the disease. Neuropathologically, the finding of motor neuron degeneration in the descending supraspinal motor pathways and their neurons of origin, of the brainstem, and of spinal motor neurons support the diagnosis (Smith 1960, Brownell et al. 1970, Hirano 1991). Frontotemporal atrophy with superficial linear spongiosis in frontal and precentral gyrus cortical layers II and III is the most consistent macroscopic feature reported in ALSci patients (Wilson et al. 2001, Matsusue et al. 2007). Secondary findings comprising of widespread neuroinflammation (Lampson et al. 1990, Kawamata et al. 1992, Nagy et al. 1994, Schiffer et al. 1996), pallor within the lateral and anterior spinal columns (Abe et al. 1997a, Hayashi et al. 2001), and neurogenic abnormalities in (Maselli et al. 1993, Yoshihara et al. 1998) are also found. While these findings all support the likelihood of ALS, none are specific for the disease. Rather, the morphological and histochemical descriptions of surviving nerve cells have provided the most powerful tools for an accurate differential diagnosis. The most well documented pathological hallmark in ALS is the presence of intracellular inclusions found in both the perikarya and neuritic processes of motor neurons. Unfortunately, the inappropriate use of nomenclature referring to inclusion bodies is found throughout ALS literature and gives rise to considerable confusion (Chou 1979). This problem arises largely because of the lack of uniform standards encompassing inclusion-based pathognomy. Inclusions are often described based on tinctorial or pathophysiological properties (e.g. “eosinophilic” or “basophilic” inclusions; “Lewy-like hyaline inclusions immunoreactive for SOD1”) and given a nomenclature 9

based on the findings attributable to other diseases (e.g. “spinal Lewy bodies”) (Wharton & Ince 2003). Here, we acknowledge four types of inclusion bodies that have been identified in all ALS variants and for which all other nomenclature encountered in the ALS literature can be assigned: (i) Bunina bodies (BBs); (ii) ubiquitinated inclusions (UBIs); (iii) hyaline conglomerate inclusions (HCIs); and (iv) axonal spheroids (Bunina 1962, Hirano et al. 1967, Carpenter 1968, Leigh et al. 1988, Ince et al. 1998). UBIs can be further sub-divided into three morphologically distinct groups of inclusions: (i) skein- like; (ii) compact; and (iii) -like (Kato et al. 1989, Leigh et al. 1991, Mizusawa et al. 1991). Finding inclusion bodies within motor neurons upon post-mortem examination is considered the ‘gold-standard’ for confirming the diagnosis of ALS, particularly of BBs and UBIs as they are highly specific for the disease despite varying prevalence and immunoreactivity (Table 1.1.2.i) (van Welsem et al. 2002, Piao et al. 2003). In addition to these inclusions, ALSci demonstrates -immunoreactive dystrophic and extracellular deposits in the extramotor cortices, including the frontal, temporal, and hippocampal regions, that are negative for tau, β-amyloid, and α-synuclein (Wilson et al. 2001, Yoshida 2004). PDC patients show similar ubiquitin immunoreactivity, but with tau-positive neurofibrillary tangles (NFTs) (Umahara et al. 1994, Oyanagi et al. 1997). Glial-cell inclusions have also been recognized to exist in ALS, but only a few studies have documented their prevalence and pathological significance (Stieber et al. 2000, Miller et al. 2004). Section 1.2 further discusses how neuronal and non-neuronal inclusions may contribute to ALS pathogenesis by looking at the mechanisms and consequences of inclusion formation. Genetics: The extent of our understanding to which genetic abnormalities contribute to the development and progression of ALS is growing. This is, in part, due to greater worldwide collaboration in identifying ALS families, a greater understanding of the microgenomics and pathogenesis of ALS, as well as the advent of genome wide association studies (GWAS). As mentioned, mutations in SOD1 are causative of disease in 15-20% of fALS cases and about 2% of total ALS cases (Rosen et al. 1993). Currently, over 135 mutations have been identified in humans, including 110 missense, 8 nonsense, 7 sense, % of surviving Immunoreactivity Ultrastructure % of ALS cases neurons Features Bunina Bodies eosinophilic; 1-6 µM; 65% to 95% sALS 1 H&E; toluidine- cystatin C; dense/granular; lucent 1 fALS ; case ~ 10% areas; vesicular and G127X blue; lipofuscin cysteine protease; (SOD1 ) laden filament structures; peripheral organelles

Ubiquitinated Inclusions Skein-like TDP-43; p38MAPK 80% to 100% sALS 8.5% to 28% dense fibrillar; eosinophilic; weak Compact (in one or other 15-20 nM filament H&E; toluidine- TDP-43; peripherin; forms, or combina- diameter substruc- blue p38MAPK tion) ture coated with granules LBLI TDP-43; neurofila- 0.5 % ment; peripherin; 14-3-3; Cdk5

Hyaline Conglomerate Inclusions

typical of >20 μM; nIF 1 slightly basophilic; neurofilament; fALS ; 3% of N/A argyrophilic; H&E; peripherin; SOD1; bundles; mitochon- sALS Bielshowsky nNOS; serpin dria; SER Axonal Spheroids 75% to 100% eosinophilic and neurofilament; >20 μM; nIF (also present, N/A basophilic;argyr peripherin; STOP; bundles; mitochon- but significantly ophilic; H&E; galectin; AGE dria; SER less, in controls) Bielshowsky

Table 1.1.2.i Neuropathological Inclusions of ALS. AGE, advanced glycation end products; ALS, amyotrophc lateral sclerosis; sALS, sporadic ALS; fALS1, familial ALS associated with SOD1 mutations; Cdk5, cell cycle-dependent kinase 5; H&E, hematoxylin and eosin; p38MAPK, p38-mitogen activated protein kinase; LBLI, Lewy body-like inclusion; nIF, neuronal intermediate filament; nNOS, neuronal nitric oxide synthase; SER, smooth endoplasmic reticulum; SOD1, superoxide dismutase 1; STOP, stable tubule on polypeptide; TDP-43, TAR DNA

binding protein. 10 11

and 3 inframe deletions in the coding sequence, as well as another 7 mutations occurring in the noncoding sequence. Despite similar clinical symptoms between sALS and fALS associated with SOD1 mutations, variability in penetrance, site or age-of-onset, disease progression, and survival are associated with specific mutations (Ratovitski et al. 1999, Andersen et al. 2000). The most common is A4V, which, unfortunately, also gives rise to the most aggressive form of fALS, with significantly reduced survival after onset (1.2 years as compared to 2.5 years for all other fALS patients) (Deng et al. 1993). In contrast, the H46R mutation is associated with prolonged survival of 18 years after disease onset (Aoki et al. 1993). SOD1 mutations are highly associated with fALS as these mutations have not been found in normal individuals or in other neurodegenerative diseases (Cudkowicz et al. 1997). Some reports have identified SOD1 mutations in apparent sALS, with incidence ranging from 1-7% (Jones et al. 1994, Jackson et al. 1997, Gellera et al. 2001), highlighting the importance of mutant SOD1 pathology as an underlying cause of motor neuron vulnerability. The role of SOD1-mediated neurotoxicity in ALS will be further discussed in Section 1.1.3. In addition to SOD1, 12 chromosomal loci have been implicated in ALS for which six genes have been identified, to date (Table 1.1.2.ii). Mutations in alsin at the ALS2 located on chromosome 2q33 (Hadano et al. 2001) and senataxin gene (SETX) at the ALS4 locus located on chromosome 9q34 (Chen et al. 2004) have been identified to cause juvenile onset subtypes of ALS. A single mutation (P56S) in the vesicle-associated membrane protein/synaptobrevin-associated membrane protein B gene (VAPB) at the ALS8 locus on chromosome 20q13 (Nishimura et al. 2004) and missense mutations in the angiogenin gene (ANG) at the ALS9 locus (Greenway et al. 2006) have been identified. The recent discovery of TAR DNA (deoxyribonucleic acid)-binding protein-43 (TDP-43) as one of the main constituents of UBIs (Arai et al. 2006, Neumann et al. 2006) led to the discovery of mutations in the gene encoding TDP-43, TARDBP, at the ALS10 locus on chromosome 1p36, which are now considered to account for about 1% to 3% of ALS cases (Kabashi et al. 2008, Sreedharan et al. 2008). Hot on the heels of the TARDP mutation discoveries, came the finding of several mutations in the fused in sarcoma/translated in liposarcoma gene (FUS/TLS) located on chromosome 16q12 (Kwiatkowski et al. 2009, Vance et al. 2009). 12

Familial ALS Alternative Locus Chromosome Gene Onset Inheritance Presentation ALS1 21q22.1 SOD1 Adult Dominant None (Pure) Spastic ALS2 2q33 Alsin Juvenile Recessive paraplegia ALS3 18q21 unknown Adult Dominant None ALS4 9q34 SETX Juvenile Dominant AOA ALS5 15q15-21.1 unknown Juvenile Recessive None ALS6 16q12 FUS/TLS Adult Dominant None ALS7 20p13 unknown Adult Dominant None ALS8 20q13.33 VAPB Adult Dominant SMA ALS9 14q11 ANG Adult Dominant None ALS10 1p36.22 TARDBP Adult Dominant FTD ALSFTD1 9q21-22 unknown Adult Dominant FTD ALSFTD2 9p13.3-21.3 unknown Adult Dominant FTD

Sporadic ALS (susceptibility and/or modifier genes) Pooled No. of Gene Chromosome Variant Assoc. Population ALS/Controls APOE 19q13.2 ε4 genotype Sporadic Israeli 100/133 APEX 14q12 D148E Sporadic British 303/228 ANG 14q11 G110G Sporadic Eur.; N.A. 2248/2347 CNTF 11q12.2 Null allele Familial German Case report DCTN1 2p13 Mutations Sporadic Eur.; N.A. 30/200 Familial EAAT2 11p13-p12 Decreased Sporadic N.A. 22/17 expression Familial HFE 6p21.3 H63D; Sporadic Eur.; N.A. 840/6466 C282Y NEFH 22q12.1-q13.1 KSP deletions Sporadic Eur. 530/379 PRPH 12q12-q13 Mutations Sporadic Eur.;N.A. 189/190 PON 7q21.3 Mutations Sporadic Aus.; Eur.; n/a N.A. SMN 1/2 5q12.2-q13.3 Copy number Sporadic Dutch; French 842/796 VEGF 6p12 Promoter Sporadic N.A.; Eur. 1703/2183 SNPs Table 1.1.2.ii Genetics of ALS. Information compiled from appropriate primary references (refer to text for com- plete reference listing and gene definitions). AOA, -oculomotor apraxia; Aus., Australian; Eur., European; FTD, frontal temporal dementia; KSP, - -proline repeat; N.A., North American; SMA, spinal muscular atrophy; SNPs, single nucleotide polymorphisms. 13

Mutations in ALS causing genes encode proteins that share no functional : alsin harbors domain characteristics of guanine nucleotide exchange factors (GEFs) and is thought to facilitate the activation of Ran, Rho and Rab GTPases during intracellular signaling, cytoskeletal organization, and vesicle trafficking (Otomo et al. 2003, Kunita et al. 2004, Hadano et al. 2007); senataxin contains a C-terminal domain found in the superfamily 1 of DNA/ribonucleic acid (RNA) helicases and shares similar gene homology with IGHMBP2, an RNA processor with mutations linked to spinal muscular atrophy (SMA) (Grignaschi & Samanin 1992); VAPB is a vesicle membrane protein thought to function in vesicular exocytosis as it is found to associate with synaptobrevins 1 and 2 (Weir et al. 1998); angiogenin is a mediator of angiogenesis, but has also been shown to be important for motor neuron development and survival (Subramanian & Feng 2007, Kieran et al. 2008); and both TDP-43 and FUS/TLS are nuclear factors that function as regulators of transcription and alternative splicing (Ou et al. 1995, Buratti et al. 2001, Lagier-Tourenne & Cleveland 2009). Despite extensive sequencing, the genes responsible for ALS at some of the remaining loci have yet to be found. The combination of identifying these unknown loci, along with data obtained from recent GWAS, may shed some light into the pathophysiology of both fALS and sALS. The identification of sALS-linked genetic variants through individual association studies and mutational screening is gaining considerable attention (Gros-Louis et al. 2006, Simpson & Al-Chalabi 2006). Several susceptibility genes have been reported for ALS, however, their roles remain ambiguous, often due to conflicting findings or lack of adequate power (see Table 1.1.2.ii) (Schymick et al. 2007b). These genes include: apolipoprotein E (APOE) (Moulard et al. 1996, Li et al. 2004); apurinic/apyrimidinic endonuclease (APEX) (Hayward et al. 1999); dynactin 1 (DCTN1) (Puls et al. 2003); haemochromatosis (HFE) (Yen et al. 2004, Goodall et al. 2005); high molecular weight neurofilament (NF) gene (NEFH) (Figlewicz et al. 1994); peripherin (PRPH) (Gros- Louis et al. 2004, Leung et al. 2004); paraoxonase (PON) (Slowik et al. 2006); survival of motor neuron (SMN) (Kuriyama & Taguchi 1984); vascular endothelial growth factor gene (VEGF) (Lambrechts et al. 2003). Moreover, these genes have not yet been corroborated with recent GWAS results, despite publically available data. While no 14

single locus has been definitively associated with increased risk of developing disease, several candidate single nucleotide polymorphisms (SNPs) have been significantly associated with this risk, including DPP6, FLJ10986, and ITPR2 genes (Schymick et al. 2007a, van Es et al. 2007, Cronin et al. 2008, Cronin et al. 2009). The most recent GWAS from these groups, however, failed to replicate these findings (Chio et al. 2009), suggesting greater genetic heterogeneity than previously recognized.

1.1.3 Transgenic Mouse Models of ALS: Wild-Type SOD1 Transgenic Mice: The discovery of 11 SOD1 missense mutations in 13 fALS families (Rosen et al. 1993) led to the development of several lines of transgenic SOD1 mice. A loss-of-function hypothesis for SOD1 was initially proposed based on the widespread distribution of SOD1 mutations and reports that patients heterozygous for these mutations demonstrated reduced dismutase activity in erythrocytes (Deng et al. 1993). Surprisingly, homozygote SOD1 knockout [SOD1 (-/-)] mice develop normally with no overt phenotype (Reaume et al. 1996). These mice, however, are not entirely free from motor neuron pathology, as they develop a mild, age- related hindlimb axonopathy (Flood et al. 1999, Shefner et al. 1999) with accelerated sarcopenia (Muller et al. 2006), and are vulnerable to enhanced motor neuron loss after axonal injury (Reaume et al. 1996, Kawase et al. 1999). The effects of SOD1 deficiency is also seen on a systemic scale, with SOD1 (-/-) mice displaying reduced fertility in females (Ho et al. 1998b), noise-induced hearing loss (Ohlemiller et al. 1999), cataracts and macular degeneration (Ohlemiller et al. 1999, Behndig et al. 2001), and hepatic carcinoma (Elchuri et al. 2005). Transgenic mice with a general overexpression of human wild-type (wt) SOD1 (hSOD1WT) were originally generated as a model for Down syndrome (DS), a disease arising from the triplication of ~200 to 300 genes along the distal axis of chromosome 21. Mice with increasing gene doses of hSOD1WT develop normally (Epstein et al. 1987), but later exhibit clinical and pathological correlates of DS, including impairments in serum serotonin uptake (Schickler et al. 1989), prostaglandin synthesis (Minc-Golomb et al. 1991), and haematopoiesis (Peled-Kamar et al. 1995). Like the SOD1 (-/-) mice, no wt SOD1 lines have yet to succumb to motor neuron symptoms despite subclinical motor 15 neuron degeneration later in life, characterized by a loss of anterior horn cells and spinal vacuolar pathology (Jaarsma et al. 2000, Jonsson et al. 2006). A report of hSOD1WT mice developing -like symptoms has also been debated (Rando et al. 1998, Almer et al. 1999). Currently, no satisfactory explanation has been able to account for the neuromuscular phenotypes that are observed from both the ablation and elevation of wt SOD1. The most recent theory, however, identifies that threshold levels of SOD1 may be important for normal homeostatic regulation, where intermediary expression is essential for long-term motor neuron maintenance, while lower or higher levels of expression become pro-oxidative or noxious, respectively (Xing et al. 2002). Mutant SOD1 Transgenic Mice: The generation of mice expressing human mutant SOD1 (mtSOD1) heralded a new era in ALS research. To date, there are 13 separate mtSOD1 mouse lines and one mouse mutant SOD1 line, each driven by their endogenous promoters. In general, the more copies of the transgene the mice express, the earlier the onset of disease and the more rapidly it progresses (Gurney 1997). Enzymatic activity appears to be irrelevant to the cytotoxic process, supporting the notion that mtSOD1 is cytotoxic through a gain-of-function process not related to dismutase activity. Although the mtSOD1 mice each have different age-of-onset and length of survival, the range of symptoms is similar among the different lines. The most commonly employed line in ALS research is mtSOD1G93A for its good transgene stability and expression, as well as a convenient life span for laboratory assessment, with mice reaching end stage of disease by four to five months-of-age (Gurney et al. 1994). Typically, the first clinical signs reported is a fine tremor in the limbs occurring at around 90 days [post-natal day (P) 90], followed by spastic paresis, weakness, and locomotor deficits that ultimately culminate in paralysis. Pathologically, these mice display early preclinical (P25) neuromuscular degeneration (Gould et al. 2006), SOD1-immunoreactive aggregates (P30) (Johnston et al. 2000), Golgi fragmentation (P31) (Mourelatos et al. 1996), and neuronal intermediate filament (nIF)-positive inclusions (Tu et al. 1996). Clinical weakness coincides with the appearance of vacuolated mitochondria, endoplasmic reticulum (ER) stress, and a significant loss of ventral root (P80) that precede motor neuron death (P90) (Fischer et al. 2004). Extraspinal pathology is also seen in the pyriform cortex, striatum, thalamus, olfactory bulb, brainstem reticular formation, and choroid plexus (Dal Canto & 16

Gurney 1995, Dal Canto & Gurney 1997, Kostic et al. 1997), with the degree of histopathological abnormalities in these regions being milder in lower copy expressing lines (Dal Canto & Gurney 1997). Prominent astrocytosis and microgliosis is observed in the lumbar and cervical spinal cord regions by P100 (Hall et al. 1998). Several other strains of mtSOD1 mice have been developed with cell-specific promoters in an effort to identify the importance of neuronal and non-neuronal mtSOD1 expression in disease pathogenesis. Interestingly, mtSOD1 expression in neurons, , Schwann cells, and , alone, is insufficient to cause disease onset (Gong et al. 2000, Pramatarova et al. 2001, Yamanaka et al. 2008a, Lobsiger et al. 2009), yet chimeric mice expressing a mixture of wt SOD1 and mutant SOD1 demonstrate delays in motor neuron degeneration and significant increases in survival (Clement et al. 2003). It is evident that the generation of these mice has been of unequivocal importance in unraveling the cytotoxic mechanism of mutant SOD1 in ALS (discussed in Section 1.1.4), as well as providing relevant models for therapeutic evaluation (Kato 2008). nIF Transgenic Mice: A major neuropathological hallmark in both fALS and sALS is the abnormal accumulation of nIFs - the NF proteins and peripherin - in the perikarya and axons of motor neurons (Averback 1981, Delisle & Carpenter 1984, Munoz et al. 1988, Murayama et al. 1990, Murayama et al. 1992, Wong et al. 2000, He & Hays 2004). As such, numerous transgenic mouse models targeting nIF expression have been generated (Table 1.1.4.i). Surprisingly, knockout mice for any of the nIFs develop normally and show no overt motor phenotype (Zhu et al. 1997, Elder et al. 1998a, Elder et al. 1998b, Lariviere et al. 2002). These knockout mice, however, are not innocuous to the effects of nIF disruption and, depending on the knockout line being examined, can display significant reductions in axonal caliber and conductivity, as well as impairments in and regeneration (Zhu et al. 1997, Elder et al. 1998a, Elder et al. 1998b, Zhu et al. 1998). Two striking features can be seen in the low molecular weight NF (NF-L) knockout mice [NF-L (-/-)]: (i) the abnormal accumulation of the medium molecular weight NF (NF-M) and NF-H in motor neuron perikarya, despite significant reductions in NF-M and NF-H expression levels (~90%); and (ii) reactive adjacent to inclusion-bearing motor neurons (McLean et al. 2005).

17

Transgenic Age Breeding Neuropathology Axonal Effects on nIFs Clinical mouse (mo.) Strain Loss Phenotype

NF-L m -/- 2-3 C57BL/6 ≥50% reduction in ~20% loss of NF-M and NF-H None; reduced rate of ventral root caliber; myelinated reductions regeneration post- altered gliosis axons m +/+ 6 B6AF1J Large perikaryal and None Increased NF Variable motor axonal aggregates of density; no nIF phenotype nIFs expression changes h +/+ C57BL/6 None None None Normal

NF-M m -/- 4 129 Sv/J X ≥50% reduction in ~10% loss of NF-L reductions; Normal C57BL/6 ventral root caliber large myeli- NF-H increase nated axons h +/+ 3-12 C57BL/6 Age-dependent NF n/a NF-L increase; NF-H Reference and aggregate formation memory task reduction; increased deficits NF density

NF-H m -/- 4 129 Sv/J X Reduction in large None NF-L reductions Normal C57BL/6 myelinated axons; increase in small axons m +/+ 12 C57BL/6 Dose-dependent Large NF-L and NF-M Normal aggregate formation; reductions reductions axonal caliber reductions h +/+ 4 C57BL/6 Aggregate formation; Severe NF-H increases Progressive X C3H retrograde axonopa- axonopathy motor thy neuropathy

Peripherin m -/- 4 C57BL/6 None ~34% loss α- increase Normal X C3H of sensory in ventral roots axons m +/+ 6-10 C57BL/6 Diffuse peripherin 35% loss NF-M reductions Late-onset X C3H expression increases; of motor motor neuron aggregate formation axons disease

Table 1.1.4.i Transgenic Mouse Models with Targeted Disruption of nIFs. -/-, knockout; +/+, overexpressing; h, human; m, mouse; NF-H, high molecular weight neurofila- ment; NF-L, low molecular weight neurofilament; NF-M, medium molecular weight neurofilament; mo., months at earliest report; n/a, not available; nIFs, neuronal intermediate filaments. Adapted from Strong, 2005. 18

Mice that overexpress wt NF do not display any motor symptoms, however, they do develop NF accumulations in motor neurons that are reminiscent of those found in ALS (Lee et al. 1992, Xu et al. 1993, Vickers et al. 1994). A progressive neuronopathy with muscle atrophy, as well as perikaryal NF inclusions, can be observed by three months-of-age in mice overexpressing human NF-H (Cote et al. 1993), and, in a dose- dependent manner, can reduce inclusion load and rescue the clinical phenotype by overexpressing human NF-L (Meier et al. 1999). Considering that NFs associate with each other to form mature filament networks, (Lee et al. 1993, Athlan et al. 1997, Giasson & Mushynski 1997), the concept that alterations in NF subunit stoichiometry that disrupt normal inter-isoform associations to provoke inclusion formation has provided an important utility from which to study the effects of intracellular inclusions in ALS. In contrast to NF transgenic mice, the sustained overexpression of wt peripherin causes a late-onset, selective motor neuron disease with characteristic pathologies of ALS, including the presymptomatic appearance of nIF inclusions (Beaulieu et al. 1999a). Coinciding with disease onset around two years-of-age, these mice display a ~35% loss of ventral roots. While few studies have used these mice to study motor neuron degeneration because of the long latency of disease onset, crossing these mice with NF-L (-/-) mice, mimicking more closely the neuronal IF conditions found in ALS (Bergeron et al. 1994), augment the formation of inclusions and disease onset to six months, with ventral root loss reported to be as early as four months (Beaulieu et al. 1999a). Moreover, the use of peripherin overexpressing embryonic neurons in vitro has been used to study the inter-relationships between inclusion-bearing neurons and non-neuronal cells (Robertson et al. 2001).

1.1.3 Mechanisms of Disease Pathogenesis: Several mechanistic theories have been proposed to account for the mutifactorial nature of ALS. Distinguishing pathogenic events that initiate and/or propagate motor neuron degeneration from other epiphenomena is a crucial goal for the ALS field. Select motor neuron vulnerability likely arises from several mechanisms acting in combination to provoke or contribute to degeneration; to date, six proposed mechanisms dominate the 19

ALS literature: oxidative stress, toxicity arising from protein misfolding and/or aggregation, mitochondrial dysfunction, defective axonal transport, and glial-mediated neurotoxicity. Oxidative Stress: Motor neurons appear to be at increased risk for oxidative injury in large part because of their high metabolic requirements for neurotransmission and structural integrity, high availability of unsaturated lipids in the neuronal membrane, and relatively lower levels of reduced glutathione (Morrison et al. 1998). The major intracellular source of reactive oxygen species (ROS) in motor neurons arise as by- products of aerobic metabolism from the mitochondria after incomplete reduction of

molecular oxygen to produce hydrogen peroxide (H2O2) and superoxide. Moreover, the highly reactive nitrating species (RNS), peroxynitrite, can be produced when superoxide itself reacts with nitric oxide free radicals produced by nitric oxide synthase. The remaining sources of ROS include xanthine and monoamine oxidase, hydroxyl radical formation from reduced metal catalysis, cytochrome oxidase, and nonneuronal cells such as microglia (Halliwell & Gutteridge 2007). The effects of increased ROS and RNS results in oxidative injury through unwanted protein, lipid, and nucleic acid modification (Castagne et al. 1999, Valko et al. 2007). There is considerable evidence of oxidative injury in ALS. Markers selective for protein oxidation mediated by superoxide and peroxynitrite reactivity [2,4- dinitrophenylhydrazine (DNPH); 3-nitrotyrosine, respectively] are elevated in post- mortem tissue of motor cortex and spinal cord, particularly of anterior horn cells, of ALS patients (Shaw et al. 1995, Abe et al. 1997b, Beal et al. 1997, Ferrante et al. 1997). Oxidative DNA damage and lipid peroxidation, as measured by 8-hydroxy-2'- deoxyguanosine (8OH2'dG) and 4-hydroxynonenal, respectively, are also found to be elevated in spinal cord tissue and cerebrospinal fluid (CSF) (Fitzmaurice et al. 1996, Shibata et al. 2001, Ihara et al. 2005). While oxidative injury is evident in motor neurons in ALS, the extent to which ROS and RNS contribute to impaired neuronal function is uncertain. Interestingly, one of the most severely oxidized proteins in mtSOD1G93A mice, is SOD1, itself (Andrus et al. 1998), and NF-L, with NF-L being one of the primary neuronal targets for oxidation mediated by nitration (Crow et al. 1997, Kim et al. 2004). 20

These results suggest that aberrant oxidation of SOD1 or NF-L could trigger protein misfolding and/or aggregate formation (Valentine & Hart 2003, Kim et al. 2004). Given that mutant SOD1 is considered to confer a gain-of-function toxic property, several researchers have suggested that mutant SOD1 chemically enhances the generation of toxic hydroxyl radicals (Figure 1.1.3.i). Here, mutations have been shown to induce protein conformational changes surrounding the copper and zinc catalytic sites. The

peroxidase and peroxynitrite hypothesis propose that H2O2 and peroxynitrite, respectively, are allowed access to the active copper catalytic site (Beckman et al. 1993, Wiedau-Pazos et al. 1996). A second peroxynitrite hypothesis proposes that zinc- depleted mutant SOD1, generated as a result of mutation effects on zinc binding or by competitive inhibition, catalyses the conversion of molecular oxygen to superoxide, which combines with nitric oxide to generate peroxynitrite (Estevez et al. 1999). Protein Misfolding and Aggregation: As discussed in Section 1.1.2, a major pathological hallmark of ALS is the presence of intracellular inclusions and/or aggregates localized within motor neurons of post-mortem tissue of ALS patients. Mutant SOD1 aggregates within both motor neurons and adjacent astrocytes (Shibata et al. 1996, Kato et al. 2000), in mtSOD1 mice (Watanabe et al. 2001), and in primary motor neurons microinjected with mutant SOD1 complimentary DNA (cDNA) (Durham et al. 1997). To date, the effects of proteinaceous aggregation is the only toxic property shared by all fALS SOD1 variants. While several theories predict an increased propensity for mutant SOD1 to form aggregates as a result of increased oxidation (Rakhit et al. 2002), hydrophobic interactions (Tiwari et al. 2005), and decreased stability of the metal-free (apo) and fully metallated (holo) SOD1 states (Rodriguez et al. 2002, Hough et al. 2004, Lindberg et al. 2005), the exact reason for SOD1 aggregation, thus far, remains elusive. As previously discussed in Sections 1.1.3 and 1.1.2, nIFs are one of the other major components of intraneuronal inclusions in ALS. Disturbances in inter-isoform associations as a result of abnormal alterations in nIF messenger RNA (mRNA) leads to protein accumulation and/or aggregation (Lariviere & Julien 2004, Lin & Schlaepfer 2006). Several upstream events have been observed to account for nIF stoichiometric changes, including pathogenic mutations and alternative splicing. For instance, the proof that NF abnormalities can cause motor neuron death in vivo came from the expression of 21

H2O Glutathione peroxidase catalase

H2O2 mtSOD1 Peroxidase hypothesis •OH

•O2- NO2-Tyr-Protein

mtSOD1 NO ONOO- Peroxynitrite hypothesis

Figure 1.1.3.i SOD1 Chemistry: Peroxidase and Peroxynitrite Hypotheses. Superoxide dismutase (SOD1) mediates the catalytic conversion of superoxide radicals (•O2-) into hydrogen peroxide (H2O2), which is then converted into water (H2O) (black). H2O2 has been proposed as an aberrant substrate of reduced mutant (mt)SOD1, which generates highly reactive hydroxyl radicals (OH•) (red). A second proposed aber- rant substrate of mtSOD1 is peroxynitrite (-OONO), which can result in abnormal protein nitration (blue). 22

an assembly-disputing NF-L transgene with a L394P missense mutation in the conserved rod domain (Lee et al. 1994). While mutations in NF-L have not been found in ALS [they are, however, a cause of the inherited neuropathy Charcot-Marie-Tooth disease (CMT)(Lupski 2000)], NF-LL394P mice show profound NF accumulations within degenerating motor neurons. The mechanism of aggregation, here, is believed to be the result of binding disruptions to an mRNA-stabilizing ribonucleoprotein complex along the 3’ untranslated region (UTR) of NF-L mRNA (Canete-Soler et al. 1998, Canete-Soler et al. 1999, Canete-Soler et al. 2001). A second proposed mechanism of aggregation is that abnormal alternative splicing in nIF mRNA generates aggregate-prone isoforms (Robertson et al. 2003, Xiao et al. 2008). While the reason for the latter theory remains less clear, these alternative isoforms are capable of disrupting both inter- and intra- isoform nIF associations. An unsolved puzzle in ALS is whether intracellular inclusions are damaging to motor neurons (or other cells in the spinal cord). While the toxicity of inclusion formation has been fiercely debated, and will be further discussed in Section 1.2, only a few studies have documented direct evidence for the functional consequences of SOD1 and nIF inclusions, including impaired axonal transport (Collard et al. 1995, Williamson & Cleveland 1999), proteasome and inhibition (Kabashi & Durham 2006), glutamate-mediated exocytosis (Bruijn et al. 1997, Sanelli et al. 2007a), mitochondrial or endoplasmic reticulum-Golgi dysfunction (Brownlees et al. 2002, Wagner et al. 2003, Pasinelli et al. 2004, Oh et al. 2008), and glial activation and enhanced toxicity (Weydt et al. 2004, McLean et al. 2005, Xiao et al. 2007). Interestingly, an extensive review of SOD1 instability and aggregation in ALS patients recently documented a positive correlation between increased aggregate load and decreased survival times (Wang et al. 2008). Mitochondrial Dysfunction: Ultrastructural and functional abnormalities of mitochondria have been extensively documented in ALS. The first among these reports was the observation of large, dense, and clustered mitochondria located along the subsarcolemmal Z line regions of atrophied muscle fibers (Afifi et al. 1966). Since then, others have documented a continuous stream of evidence suggesting abnormal mitochondrial involvement in both UMNs and LMNs (Afifi et al. 1966, Sasaki & Iwata 23

1996, Siklos et al. 1996, Sasaki & Iwata 1999, Wiedemann et al. 2002), liver (Masui et al. 1985, Nakano et al. 1987), blood lymphocytes (Curti et al. 1996), and muscle (Wiedemann et al. 1998) from ALS patients. Vacuolated mitochondria, with uncharacteristic short protrusions of the outer membrane, are often observed located within nIFs inclusions and within larger axonal spheroids in both fALS and sALS patients (Hirano et al. 1984). While such observations are important in implicating a role for mitochondria in the pathogenesis of ALS, these conclusions are limited in two ways: (i) only post-mortem examination of CNS tissue is available, thus, only end stage pathology is observed; and, (ii), artifactual changes may result from longer post-mortem intervals and poor tissue preservation. These issues have been circumvented in recent years by the development of mtSOD1 and nIF transgenic animal models of ALS (Robertson et al. 2002, Kato 2008). The mtSOD1 mice have provided an invaluable platform from which to study the causes and effects of mitochondrial dysfunction during motor neuron degeneration. Based on the clinical course of progressive muscle weakness in mtSOD1 mice, widespread vacuolated mitochondria are one of the earliest pathological events, even preceding any morphological nIF abnormalities (Kong & Xu 1998, Jaarsma et al. 2001). An important observation is that early mitochondrial changes are not associated with cytochrome oxidase impairment, nor apoptotic death (Bendotti et al. 2001), suggesting that mtSOD1 damage to mitochondria may be part of an initial set of events that trigger motor neuron degeneration (Dupuis et al. 2004, Hervias et al. 2006). Temporal studies have found that mitochondrial dysfunction becomes worse as the disease progresses (Jung et al. 2002). How mutant SOD1 directly interacts with mitochondria is of great interest. In addition to causing cellular damage produced by enhanced oxidative free radical generation (Mattiazzi et al. 2002), mutant SOD1 has also been shown to cause the expansion of the intermembrane space and to aggregate on the outer mitochondrial membrane (Higgins et al. 2003). In either case, mutant SOD1 is capable of damaging the mitochondrial membrane leading to increased membrane permeability (Ray et al. 2004). This association may be mediated by the anti-apoptotic protein, Bcl-2 (Pasinelli et al. 2004), and supports the observation that mutant SOD1 initiates -dependent motor neuron death (Takeuchi et al. 2002). 24

Defective Axonal Transport: The need for efficient transport mechanisms in motor neurons is highlighted by their extreme asymmetry (up to one meter long) and large volume (up to 5000 times that of a typical neuron). Slow and fast transport, at rates up to ~1 µm/day and ~1 mm/day, respectively, deliver cargoes, such as organelles, multivesicular and cytoskeletal components, and trophic factors to their appropriate destinations. Axonal transport is carried out in an anterograde direction by and in a retrograde direction by ; both are adenosine triphosphate (ATP)-dependent molecular motors that, along with other distinct adaptor proteins and regulatory molecules (Goldstein et al. 2008), maneuver along tracks of and (Hirokawa & Takemura 2005). The finding that axonal transport is compromised in mtSOD1 mice (Zhang et al. 1997, Williamson & Cleveland 1999, De Vos et al. 2007) comes as little surprise considering the conspicuous presence of intracellular inclusions and axonal spheroids in ALS patients. A plausible mechanism for motor neuron degeneration in these mice is the “strangulation” effect - an event in which axonal inclusions and spheroids interfere with the transport machinery, thereby severely disrupting the metabolic efficiency of the cell (Robertson et al. 2002, De Vos et al. 2008). While it may, therefore, seem that impairments in axonal transport is a secondary phenomenon of the disease process, mutations in the key molecular motors are known to cause progressive motor neuron degeneration (LaMonte et al. 2002, Hafezparast et al. 2003) and hereditary spastic paraplegia (Reid et al. 2002). How axonal transport is perturbed is not fully understood, but likely involves several different pathways, including damage to mitochondria (Miller & Sheetz 2004), inflammatory and excitotoxic signaling (Ackerley et al. 2000, De Vos et al. 2000, Hiruma et al. 2003), and damage or modification to cargoes (Ackerley et al. 2003, Jung et al. 2005). The nIFs that are intimately linked with intracellular inclusions and spheroids in ALS are also implicated in causing axonal transport dysfunction in vitro (Shea et al. 2004) and in the transgenic mouse models detailed in Section 1.1.3. One hypothesis is that in mtSOD1 mice, the mitogen-actvated protein kinases (MAPK), p38 and p35, through the activation of the cyclin-dependent kinase 5 (cdk5) (Nguyen et al. 2001, Tortarolo et al. 2003), abnormally phosphorylates NF sidearms causing a premature 25

release from the molecular motors (Shea et al. 2003, Sihag et al. 2007). Understanding the relationship between axonal transport and intracellular inclusions and spheroids is, thus, an important goal for ALS researchers. Glial-mediated Neurotoxicity: The observation that motor neuron degeneration in ALS is enhanced by the damage incurred by neighboring non-neuronal cells, such as microglia and astrocytes, is derived from a broader concept that ALS as a non-cell autonomous disorder and is readily apparent from the complex interrelationships that exist between neurons and (Boillee et al. 2006a). There is increasing recognition that neuroinflammatory and excitotoxic events, predominately mediated by microglia and astrocytes, respectively, significantly affect disease progression and survival (Barbeito et al. 2004, Sargsyan et al. 2005, Neusch et al. 2007). This is particularly highlighted by the recent development of mtSOD1 chimeric mouse models of ALS, in which microglia and astrocytes have been shown to be the major determinants of disease progression (Clement et al. 2003, Yamanaka et al. 2008a). Implicit in the idea of chronic progressive neuronal degeneration is the concept of glial proliferation and activation. A prominent histological feature in ALS is the accumulation of activated microglia, reactive astrocytes, infiltrating peripheral macrophages, lymphocytes, and dendritic cells in areas of motor neuron degeneration (Lampson et al. 1990, Troost et al. 1990, Appel et al. 1993, Nagy et al. 1994, Schiffer et al. 1996, Schwab et al. 1996, Henkel et al. 2004). The biochemical evidence comes from consistent increased expression of neuroinflammatory markers, including cytokines, chemokines, components of prostaglandin synthesis, and other proinflammatory molecules (Moisse & Strong 2006, Yen et al. 2006). Using positron emission tomography (PET) imaging with in vivo radio-labeled ligand ([(11)C](R)-PK11195) binding to the peripheral benzodiazepine site (as a marker of microglia) and [11C] (L)- deprenyl-D2 PET [as a marker for monoamine oxidase-B (MAO-B) in astrocytes], glial activation can also be observed in the motor cortex and brainstem of ALS patients and is correlated with the degree of symptom presentation at the time of the scan (Turner et al. 2004, Johansson et al. 2007). Mirroring these findings, immunohistochemical analysis of murine models of motor neuron disease, including the Wobbler mouse (wr/wr), the motor neuron degeneration mouse (mnd) mouse, the mtSOD1 mouse, and the NFL (-/-) mouse, 26 each exhibit a graded glial response of increasing activation prior to or proceeding extensive motor neuron loss (Alexianu et al. 2001, Boillee et al. 2001, Mennini et al. 2004, McLean et al. 2005). Microgliosis: Considering that the net effect of microglial activation may result in promotion of regenerative or degenerative conditions (Streit et al. 1999), the evidence for microglial-mediated neurotoxicity in ALS has been limited. In models of chronic motor neuron degeneration induced by monthly intracisternal inoculation of aluminum chloride, microglial activation was inhibited and allowed for a neuronal milieu permissive to motor neuron recovery and reversal of ALS-like pathology (Strong et al. 1995, He & Strong 2000). Further studies have found that motor neuron death in vitro is dependent on the actions of activated microglial-secreted factors acting synergistically with tumor necrosis factor-α (TNF-α) (He et al. 2002). Interestingly, Robertson and colleagues showed that primary dorsal root (DRG) neurons containing peripherin aggregates demonstrate enhanced when exposed to dissociated spinal cord cultures (Robertson et al. 2001). Considering that the majority of microglia contained within these dissociated cultures were activated, and that exposure to a TNF-α neutralizing rescued the DRG from an apoptotic fate, this suggested a predisposition of inclusion-bearing neurons to the deleterious effects of a proinflammatory environment (Robertson et al. 2001). In vivo studies have shown that selective motor neuron death in mtSOD1 mice can be triggered by a novel Fas-signaling pathway (Fas is a cell surface member of the “death receptor” family of ligands which includes TNF-α) that is dependent on neuronal nitric oxide synthase (nNOS) for cytotoxicity and transcriptional activation of caspase-8 (Raoul et al. 2002). These pathways may be relevant to the findings that motor neuron disease can be accelerated by chronic lipopolysaccharide (LPS)-induced stimulation of the immune system in the mtSOD1G37R mouse (Nguyen et al. 2004). Unfortunately, immunosuppressant drugs in ALS therapeutics has been ineffective, despite promising results in mtSOD1 mouse models (Weinhold et al. 1992). Questions still arise as to whether the neuroinflammatory response is protective and/or beneficial to motor neurons during degeneration (Wyss-Coray & Mucke 2002). The complex interrelationships between endogenous glia, peripheral immune infiltrate, and neurons, coupled with the fact that microglia are, by definition, immunocompetent 27

cells, suggests that motor neuron degeneration may arise from microglia senescence, rather than aggression (Moisse & Strong 2006, Streit et al. 2008). Indeed, compromised microglial responsiveness, through inhibition of neuroinflammation or alterations in normal function, have been shown to be either indifferent to or to markedly enhance disease progression (Beers et al. 2006, Gowing et al. 2008). Astrocytes and Excitotoxicity: Astrocytes are the most abundant non-neuronal cell in the nervous system and provide extensive neuronal support by monitoring and regulating the extracellular environment in which neurons function. The classical role of astrocytes in ALS is considered mainly in relation to excitotoxicity, with particular focus on abnormalities in glutamate transport. In sALS and fALS patients, there is selective loss of the astroglial glutamate transporter, EAAT2/GLT1, in the motor cortex and in the spinal cord (Rothstein et al. 1995, Fray et al. 1998, Sasaki et al. 2000), which is likely, although not proven, to be the result of abnormal alternative splicing of EAAT2/GLT1 pre-mRNA (Lin et al. 1998). In vitro, there has been a link between dysfunctional EAAT2/GLT1 function and SOD1 mutations (Trotti et al. 1999). The decreased clearance of glutamate by EAAT2/GLT1 may be particularly toxic to motor neurons as a result of two further considerations: (i) an increased proportion of Ca2+-permeable α- amino-3-hydroxyl-5-methyl-4-isoxazole-propionate (AMPA) receptors (Carriedo et al. 1996, Takuma et al. 1999, Van Den Bosch et al. 2000); and (ii) low Ca2+ buffering capacity (von Lewinski & Keller 2005). The combination of these effects, which likely occur as a result of mutually exclusive pathways (Van Den Bosch et al. 2006), creates an excitotoxic environment that may disturb a number of physiological processes, including mitochondrial function and axonal transport (Ackerley et al. 2000, Carriedo et al. 2000, Urushitani et al. 2001). As we have seen, ALS is likely a non-cell autonomous disease, and, with controversy over the nature of microglial involvement, several recent studies have implicated astrocytes as significant determinants of disease progression. Cleveland and colleagues using (lox)mtSOD1G37R mice, carrying the mutant SOD1 gene that is deleted by the action of Cre recombinase, were mated with glial acidic fibrillary protein (GFAP)- Cre mice to assess the effects of diminished mutant SOD1 expression in astrocytes (Yamanaka et al. 2008b). They found that while disease onset was not affected, the 28

progression of the disease (from early symptoms to end stage) was significantly delayed. In addition, microglial activation was delayed from onset through early disease and was accompanied by a marked reduction in the levels of inducible nitric oxide synthase (iNOS). Recently, an unidentified astrocytic soluble factor, derived only from mtSOD1- expressing astrocytes, was implicated in the selective death of motor neurons in vitro through a Bax-dependent mechanism (Nagai et al. 2007). From these studies, it is evident that astrocytes are emerging as important mediators of motor neuron damage in ALS and are relevant therapeutic targets for disease progression. Indeed, Riluzole, having anti-excitotoxic properties remains the only drug, to date, with proven efficacy in ALS treatment (Bensimon et al. 1994, Lacomblez et al. 1996).

1.2 Protein Aggregation 1.2.1 Mechanisms of Aggregation: A number of neurodegenerative diseases such as AD, ALS, Huntington’s disease (HD), PD, and prion diseases share common pathological characteristics of abnormal protein deposits (Ross & Poirier 2004). In each, the distribution and composition of these deposits are different, and can be found either as extracellular lesions or as intracellular inclusions (Table 1.2.1.i). These deposits are likely the result of aggregations of misfolded and/or unstable proteins (Soto 2003). Here, the initiating event arises as a result of disease-specific mutations and/or abnormal post- transcriptional modifications that can alter the structure or biochemistry of the native protein and create conditions that are favorable for aggregation. And while there is no evident sequence or structural homology among the aggregate’s constituent proteins (Soto et al. 2006, Armstrong et al. 2008), it is becoming increasingly clear that aggregation is a complex process involving several kinds of intermediate species. According to contemporary beliefs, unfavorable protein-protein interactions between monomers promote the formation of oligomeric species, which provide a nucleation seed on which to further catalyze the growth of higher-ordered polymers or (Figure 1.2.1.i) (Gajdusek 1994, Harper & Lansbury 1997, Glabe & Kayed 2006). In addition, several other types of intermediary structures have been described, including soluble oligomers, pores, annular stuctures, spherical micelles, and protofibrils (Caughey & Lansbury 2003, Haass & Selkoe 2007). These intermediates are thought to be in a 29

Disease Clinical Feature(s) Etiology/ Affected Characteristic Major Protein Genetic defect Region(s) Pathology Aggregate Composition Amyotrophic lateral Progressive muscle Sporadic Motor neurons; anterior LBLI and Bunina Unknown; sclerosis atrophy; cognitive horn; motor cortex bodies; hyaline (TDP-43; nIFs; impairment inclusions; spheroids hyperphosphorylated tau) (C)

Familial Same as sporadic Same as sporadic Same as sporadic SOD-1 (dominant) TDP-43 FUS/TLS Alsin Dynactin Senataxin

Alzheimer’s disease Progressive Sporadic Frontal cortex; hippocampus, Plaques; Amyloid-β peptide; dementia basal forebrain; brain stem neurofibrillary hyperphosphorylated tau tangles (E, C)

Familial Same as sporadic Same as sporadic Same as sporadic APP (dominant); Presenilin 1, 2 (dominant); ApoE2-4

Fronto-temporal Progressive Familial Frontal and temporal cortex; Pick bodies Hyperphosphorylated tau dementia dementia Tau mutations hippocampus (C); altered 3R/ 4R FTDP-17 expression

Tauopathies (AGD, Basal ganglia-type Familial Brainstem; basal ganglia; Neurofibrillary 4R (PSP, CBD, AGD); CBD, PiD, PSP) movement disorder; Tau mutations ; frontoparietal cortex; tangles; 3R (PiD) Progressive dementia MAPT amygdala; subthalamic threads; Pick bodies FTDP-17 nucleus; substantia nigra

Huntington’s disease Dementia; choreiform Familial Striatum; basal ganglia; Intranuclear inclusions, Huntingtin with movement disorder; Huntingtin (dominant) frontal cortex cytoplasmic aggregates polyglutamine expansion psychiatric problems (N)

Polyglutamine repeat Same as Huntington’s Familial Basal ganglia; brain stem; Intranuclear inclusions Atrophin-1; ataxins; diseases (DRPLA; KD; Atrophin-1, ataxin- cerebellum; spinal cord AR SCA1-3, 6-7, 17; 1-3; -7; CACNA1A; (N) SBMA) TBP; AR (dominant)

Parkinson’s disease Basal ganglia-type Sporadic Substantia nigra; frontal cortex Lewy bodies α-Synuclein movement disorder locus ceruleus; mid-brain raphe (C)

Familial Similar to sporadic, but Similar to sporadic Same as sporadic α-Synuclein more widespread (dominant) Parkin, DJ-1, PINK1 (recessive), PARK UCHL1

Prion diseases (Kuru, Dementia, ataxia, Sporadic; familial; Frontal cortex, thalamus, brain Spongiform Prion protein CJD, GSS disease) psychiatric disorders, infectious stem; cerebellum encephalopathy; (E) Insomnia PRNP amyloid fibrils

FENIB Progressive dementia Familial Frontal cortex; substantia nigra Collins bodies Neuroserpin w/ myclonic epilepsy SERPINI1 (C) (neuroserpin)

TABLE 1.2.1.i Protein Aggregation in Neurodegenerative Diseases. AGD, agyrophilic grain disease; AR, androgen receptor; ApoE, apolipoprotein E; APP, amyloid precursor protein; C, cytoplasmic; CBD, corticobasal degeneration; CJD, Creutzfeldt-Jakob disease; DRPLA, dentatorubral-pallidoluysian atrophy; E, extracellular; FENIB, familial encephalopathy with neuroserpin inclusion bodies; FUS/TLS; fused in sarcoma/translated in liposarcoma; GSS, Gerstmann-Straüssler-Scheinker; KD, Kennedy disease; LBLI, Lewy body-like inclusions; N, nuclear; PiD, Pick’s disease; PRNP, prion protein; PSP, progressive supranuclear palsy; SBMA, spinal and bulbar muscular atrophy; SCA, spinal-cerebellar ataxia 30

Confirmations and Intermediates N N C C Disease protein? Unfolded secondary N structure C

Disordered region Native protein

Covalent modification, phospho- rylation, cleavage, etc.

Possibly toxic Abnormal confirmation

Globular intermediates Likely toxic nucleation seeding

aggregation

Protofibrils Possibly toxic

Inclusions Toxic/Protective?

Figure 1.2.1.i Theoretical Schematic Representation of Aggregation. Genetic susceptibility and environmental factors may destablize the native protein confirma- tion resulting in toxic intermediates that aggregate and stabilize to form large, cellular inclu- sions. Modified from Ross and Poirier, 2004. 31

dynamic equilibrium with each other, with a rate of polymerization that depends on concentration, temperature, ionic strength, and pH (Levine 1995, Kusumoto et al. 1998, Teplow 1998, Harper et al. 1999). In general, protein aggregates are not associated with healthy, unstressed neurons due in part to the existence of cellular ‘quality control’ machineries, including chaperones, the ubiquitin-proteasome system, and autophagy/lysosomal systems (Ellgaard & Helenius 2003, Leidhold & Voos 2007). The failure of these systems to adequately degrade unwanted proteins, as a result of dysfunction or substrate overload, is often an early event in disease pathogenesis (Petrucelli & Dawson 2004, Ross & Pickart 2004, Layfield et al. 2005, Chu 2006). Moreover, it has been identified that there exists a close relationship between specific gene mutations causative of familial neurodegenerative diseases and their intrinsic propensity to form insoluble aggregates, which depends on a collection of different biophysical and physiochemical parameters such as net charge, hydrophobicity, native state stability, and β-sheet structure (Armstrong et al. 2008). Adverse cellular changes are thought to be downstream of the events associated with protein misfolding and aggregation, with direct correlations between the severity of clinical symptoms and aggregate burden (Mann & Esiri 1989, Davies et al. 1997, Scherzinger et al. 1999, Yamaguchi et al. 2001, Bucciantini et al. 2002). As such, protein aggregations are thought to be neurotoxic in nature and, thus, associated with brain damage. This hypothesis, however, has been challenged on the basis of several observations, most notably that: (i) aggregates have been found in neurologically normal people without neuronal loss (Katzman et al. 1988, Forno 1996); (ii) aggregate-bearing neurons can appear morphologically healthier than adjacent neurons without aggregates (Bondareff et al. 1989, Tompkins et al. 1997); and (iii), that in some animal models of AD, transmissible spongiform encephalopathy (TSE), HD, and , aggregates proceed cerebral damage and clinical symptoms (Klement et al. 1998, Moechars et al. 1999). The findings have led to the belief that, depending on the intermediary species present, the level of associated cellular toxicity may differ. In vitro, it seems that the oligomeric and protofibril species are responsible for neuronal dysfunction (Caughey & Lansbury 2003), while mature compact aggregates may act as a physiological reservoir to 32

sequester and isolate misfolded intermediates or other harmful species (Lansbury & Lashuel 2006). Nevertheless, the downstream mechanism for , regardless of what stage aggregates acquire a neurotoxic function, has been well described, including the activation of apoptotic pathways, inhibition of essential transcription factors, impairment of axonal transport, synaptic dysfunction, and oxidative stress (Aguzzi et al. 2007, Fiala 2007, Turner & Talbot 2008, Williams & Paulson 2008, Iqbal et al. 2009).

1.2.2 Protein Aggregation in ALS As described in Section 1.1.2, intracellular inclusions within motor neurons are a major neuropathological hallmark of ALS. While these inclusions are immunoreactive to a number of diverse proteins, only SOD1 and the nIFs demonstrate the capacity to form aggregates in both culture and in transgenic mouse models of motor neuron degeneration. SOD1 Aggregation: The SOD1 protein undergoes several post-translational modifications, including the acquisition of Cu2+ and Zn2+ ions to its active site, disulfide bond formation, and dimerization, before it reaches its mature, enzymatically active state (Furukawa & O'Halloran 2006). In vitro, SOD1 is an unusually stable protein, maintaining its holo structure at temperatures near the boiling point of water (Hayward et al. 2002, Rodriguez et al. 2002) and even its enzymatic activity after 1 hour (hr) in 4% sodium dodecyl sulfate (SDS) (Forman & Fridovich 1973). The conformational stability of SOD1 seems to be tightly linked to the apo structure, which is associated with disordered regions and reduced disulfide bond formation. Intrinsically disordered regions are known to initiate protein aggregation, and, in come cases, are thought to form the aggregate core (Dyson & Wright 2005). While some ALS-associated mutations have been shown to impair metal binding, the majority of mutant SOD1 proteins are virtually indistinguishable from their wt counterparts in terms of stability, but still show an increased propensity to aggregate. The thought, here, is that mutant SOD1 forms native- like oligomers from slight structural rearrangements directly from the native state. Local and global unfolding is attenuated through other determinants, such as net charge and subcellular localization, aberrant protein-protein or protein-ligand interactions, or exposure to ROS (Shaw & Valentine 2007). Because the biophysical and biochemical 33

properties of mutant SOD1 variants are extremely diverse, it is likely that initiation of aggregation arises from distinct combinations of reasons. Several oligomeric and intermediary fibrillar structures for mutant SOD1 have been described (DiDonato et al. 2003, Ray et al. 2004). Interestingly, while SOD1 immunoreactivity is strong and present in all inclusions in fALS, it is weaker and shows variable staining in sALS (Shibata et al. 1996). While the nature of SOD1 aggregates is under scrutiny, considerable data implicate oligomers and smaller aggregates (<100 Da) as the toxic species (Valentine & Hart 2003, Matsumoto et al. 2005). nIF Aggregation: The nIFs represent the other major aggregate-prone protein found associated with intracellular inclusions in ALS. The NFs and peripherin are found associated together in HCIs and axonal spheroids, while only peripherin is consistently reported in Lewy body-like and compact UBIs (Corbo & Hays 1992, Migheli et al. 1993, Wong et al. 2000, He & Hays 2004); neither has been reported in skein-like UBIs or BBs. nIF pathology represents a point of pathological convergence of both fALS and sALS, for what is otherwise a considered a disease of numerous etiologies. Unfortunately, because nIF genetic abnormalities account for <1% of ALS cases, and because nIFs heteropolymerize to form highly-ordered Triton X-100 (TX-100) insoluble filaments, the mechanism governing the formation of mature nIF aggregates is not well understood. Ultrastructurally, nIF-associated aggregates can be observed up to 10-15 µm in diameter as loose or compact filaments surrounding an electron dense core of granular or amorphous substance (Sasaki et al. 2005). The finding that serpin-serine proteases, advanced glycation end products (AGEs), and abnormally spliced peripherin isoforms are also localized to compact inclusions (Chou et al. 1998a, Chou et al. 1998b, Robertson et al. 2003, Xiao et al. 2008), suggest that post-transcriptional modification of nIFs, or other proteins associated with aggregation, may be involved in the initiating event. As we have seen in Section 1.1.3, the transgenic models of altered nIF expression have been used predominately to determine whether altering the relative expression ratios of the individual nIFs impacts disease pathology or phenotype. Despite massive cytoskeletal disorganization and inclusion formation in these models, a major question remains unanswered: does nIF aggregation proceed prior to filament formation or thereafter? The collapse of nIF networks in vitro after stoichiometric perturbation would 34

suggest that morphologically distinct inclusions represent a spectrum of the same pathology (Xiao et al. 2006). Recent work by Robertson and colleagues observed that UBIs in ALS demonstrated varying degrees of compaction, with TDP-43-positive skein- like inclusions wrapping around a compact, ubiquitinated target (Sanelli et al. 2007b). While the recent identification and charaterization of assembly-incompetent, aggregate- prone peripherin isoforms, Per-28 and Per-61, that disrupt nIF associations (Robertson et al. 2003, Xiao et al. 2008) would also suggest that aggregates arise from existing nIF networks, the mechanism of aggregation of these isoforms remains unknown. Considering that nIFs exist as multiple interconvertible forms that are under strict translational control, including mature filament networks, short filament structures termed ‘squiggles’, and non-filamentous soluble precursors (Helfand et al. 2003a, Chang et al. 2006), the prospect that abnormal nIF isoforms may trigger aggregation is also possible. Moreover, the recent observations of unidentified peripherin isoforms (Xiao et al. 2008) suggest more complex stoichiometric control at the intra-isoform level. The presence of nIF inclusions has been shown to directly influence both the internal and external neuronal environments in which they reside. For example, NF aggregate-bearing motor neurons isolated from primary cultures of transgenic human overexpressing NF-L mice show enhanced sensitivity to NMDA receptor activation and increased intracellular Ca2+ levels associated with enhanced cell death through caspase- dependent mechanisms (Sanelli et al. 2007a, Sanelli & Strong 2007). While only a few studies have examined the mechanistic details of nIF aggregation beyond the descriptions of an apoptotic end-point, several groups now postulate that degenerating motor neurons with nIF-bearing aggregates may release factors that initiate gliosis and/or sensitize motor neurons in such as way as to render the neuron susceptible to apoptosis (Robertson et al. 2001, Strong 2003, McLean et al. 2005, Xiao et al. 2006). In contrast, the observation that nIF aggregates are transient and/or reversible pathological events (McLean et al. 2005) suggests a biochemical role for their presence in degenerating neurons. This is best demonstrated from data showing that nIFs may function as a biological sink for reactive nitrating species, thereby limiting unregulated peroxynitrite- mediated injury (Strong et al. 1998). Because nIFs are subject to heavy phosphorylation and nitrotyrosination (Strong 1999, Sihag et al. 2007), and that these post-translational 35

modifications have been shown to disrupt filament associations causing inclusion formation (Xiao et al. 2006), caution must be taken before presuming nIF aggregates as pathological rather than beneficial, or vice versa.

1.3 Intermediate Filaments 1.3.1 Structure, Function, and Molecular Genetics: Intermediate filament (IF) proteins represent one of three major fibrous polymers of eukaryotic cells, so named for their filamentous form with a diameter of 10-12 nm- wide, which is intermediate between thinner actin (6-8 nm) and larger microtubules (25 nm). The IF family is encoded by 70 different genes organized into six subfamilies (or classes) based on gene substructure and nucleotide from a shared central region (Table 1.3.1.i). Apart from the nuclear , IFs encode cytoskeletal proteins that demonstrate a broad range of size, primary structure, and regulation within different tissue regions. All IF proteins share a common tripartite structure comprised of two non-α-helical amine (N)- and carboxyl (C)-terminal tail domains flanking a centrally conserved α-helical rod domain. The helical secondary structure of the rod domain is the result of a series of hydrophobic heptad repeats that are segmented into four coils (1A, 1B, 2A, and 2B) attached by linkers (Figure 1.3.1.i). The association of two paralleled helices along their lateral surface allows for polymerization to form coiled-coil dimers (42-44 nm in length), which, in turn, link together in a staggered and anti-parallel fashion via the rod domains to form apolar tetramers, which are the final soluble entities (Parry & Steinert 1999) before assembling both laterally and longitudinally into filamentous structures (Strelkov et al. 2003, Strelkov et al. 2004). Distinct boundaries mark the ends of the ~310 -long rod sequence (~352 amino acids in nuclear lamins) with highly conserved 15- to 20-amino acid regions that are essential for IF polymerization (Fuchs & Weber 1994). The N- and C-terminal tail domains are thought to impart functional specificity as they are the major sites for post- translational modification and interactions with other proteins and organelles, such as mitochondria (Fuchs & Weber 1994, Wagner et al. 2003, Toivola et al. 2005, Kim & Coulombe 2007).

36

Prot. No. of Gene Assembly Pred. Prot. Tissue Expression Associated Disease(s) Name Genes Name Group Size (kDa) Type I 28 KRT# A 40-64 Epithelia BCIE/EHKL; EBS; EPPK; (acidic) Hard Appendage Liver disease; PC; Pancreatitis Type II Keratin 26 KRT# A 52-68 Epithelia BCIE/EHKL; EBS; EPPK; IBD; (basic) Hard Appendage Liver disease; PC; Pancreatitis Type III 1 VIM B 55 Heterogeneous None reported 1 DES B 53 Muscle CMD; DCM-CD; MD; DM; RCM; SS-K GFAP 1 GFAP B 50-52 Astrocytes/glia Peripherin 1 PRPH B 54 PNS/neurons ALS Type IV NF-L 1 NEFL B 62 CNS neurons ALS; CMT; PD NF-M 1 NEFM B 102 CNS neurons ALS; PD NF-H 1 NEFH B 110 CNS neurons ALS; NIFID α-internexin 1 INA B 66 CNS neurons None reported 1 SYNC1 B 54 Muscle None reported 1 NES B 240 Heterogeneous None reported 1 DMN1 B 182 Muscle None reported Desmuslin 1 DMN2 B 140 Muscle None reported Type V A/C 2 LMNA/C C 72/62 Nucleus CMD; CMT; DM; EDDM; FPLD; HGPS; MADA; SMA; WRN Lamin β1 1 LMNB1 C 65 Nucleus ADLD Lamin β2 1 LMNB2 C 78 Nucleus APL Type VI Phakinin/ 1 BFSB2 D 46 Lens Cataracts (dominant) CP49 Filensin/ 1 BFSB1 D 83 Lens Cataracts (recessive) CP115 Table 1.3.1.i Subfamily Classification of Intermediate Filaments. ADLD, autosomal dominant ; ALS, amyotrophic lateral sclerosis; APL, acquired partial lipodystrophy; BCIE/EHK, bullous congenital ichthyosiform erythroderma, epidermolytic ; CMD, dilated type; CMT, Charcot-Marie-Tooth disease; CNS, central nervous system; DCM-CD, with conduction system defects; DM, muscular dystrophy; EBS, epidermolysis bullosa simplex; EDDM, Emery-Dreifuss muscular dystrophy; EPPK, epidermolytic palmoplantar ; FPLD, familial partial lipodystrophy; HGPS, Hutchinson-Gilford syndrome; IBD, irritable bowel disease; MADA, with type A lipodystrophy; MD, distal myopathy; NIFID, neuronal intermediate filament inclusion disease; PC, ; PD, Parkinson’s disease; PNS, peripheral nervous system; RCM, familial restrictive cardiomyopathy; SMA, spinal muscular atrophy; SS-K, scapuloperoneal syndrome type Kaeser; WRN, atypical Werner syndrome. Assembly group A: exclusive: obligate co-polymerization; B: homo- and/or heteropolymerization; C: exclusive homopolymerization; D, undefined. A E1 V1 H1 L1 L12 L2 S H2 V2 E2

NH2 COOH 1A 1B 2A 2B

Head domain coiled domains Tail domain

α-helix central rod domain

B Peripherin COOH

NF-L COOH

NF-M COOH

NF-H COOH

KSP repeats Figure 1.3.1.i Structure of Intermediate Filament Proteins. (A) All intermediate filaments have a long central α-helical region, known as the rod domain, flanked by amine- terminal (head) and carboxy-terminal (tail) domains. The rod domain is further divided into coils 1A, 1B, 2A, and 2B, which are separated by three linker sequences (L1, L2, L3). Structural variations can be recognized by a stutter (S) region, which may locally alter the character of the helix. (B) The non-helical head and tail domains contain highly variable sequences that may be important for functional properties distinguishing among different IFs. The neuronal IFs are good examples of variability within the tail domains, with NF-M and NF-H having longer tail domains than

peripherin and NF-L as a result of numerous potential phosphorylation sites. E; extreme subdomains; H, hypervariable 37 regions; KSP, lysine-serine-proline; L, linker sequences; S, stutter domain; V, variable subdomains. 38

While the N-terminal domain appears to be predominantly involved in modulating IF assembly, the exact role of the C-terminal domain remains elusive, although it likely is involved in lateral spacing of filament structures (Fuchs & Weber 1994). Phosphorylation is an important post-translational event that takes place primarily on serine/threonine residues of the N- and C-terminal ends and is thought to be an important regulator of IF function, including, for example, structural support and mechanoarchitecture (Kim & Coulombe, 2007), regulation of and death (Chou et al. 1989, Skalli et al. 1992), response to injury and stress (Omary et al. 2006), and associations with various IF binding proteins (Izawa & Inagaki 2006). The numerous secondary messenger-dependent (e.g. protein kinase C and A) and -independent kinases [e.g. glycogensynthase kinase 3 (GSK-3) and cdk/5] that are known to phosphorylate IFs have been well described (Julien & Mushynski 1998, Izawa & Inagaki 2006, Omary et al. 2006). For IFs, it seems that their function(s) is largely reflected in their form, which is, essentially, a long and stable scaffolding protein (Kim & Coulombe, 2007). While the exact function of IFs remains elusive, it is thought that they provide cytoskeletal stability to the cells in which they are expressed (Fuchs & Weber 1994, Parry & Steinert 1999). Interestingly, the morphology of different cytoplasmic IF networks will vary depending on the cell type and tissue; for example, desmin is found to be concentrated within the cross-striations of muscle Z-lines, while , markedly outnumbering microtubules in the of neurons, run in parallel arrays with jutting C-terminal projections that determine axonal caliber (Kim & Coulombe, 2007). Unfortunately, our limited knowledge of IF biology comes largely from our inability to crystallize their structure, owing, in part, to their infamous insolubility, lack of suitable assembly inhibitors, long half-life, and polymerization-prone characteristics in physiological conditions (Strelkov et al. 2001, Kim & Coulombe, 2007). Recently, however, intermediate filaments have taken the forefront of several research areas because of their highly dynamic properties (Helfand et al. 2004), ranging from signal transduction (Paramio & Jorcano 2002, Chang & Goldman 2004) to protein synthesis (Kim et al. 2006). Moreover, over 30 different diseases are now associated with IF gene mutations, including keratin in the so-called “keratinopathies” (Fuchs 1996, Omary et al. 39

2004), lamins in progeria and myotonic dystrophy (Sjakste & Sjakste, 2005), desmin in cardiac and skeletal myopathy (Goebel 1997, Paulin et al. 2004), GFAP in Alexander disease (Brenner et al. 2001, Li et al. 2002), NF-M in Parkinson's disease (Lavedan et al. 2002), NF-L in Charcot–Marie–Tooth Disease (Kochanski 2004), and peripherin in ALS (Gros-Louis et al. 2004, Leung et al. 2004). In addition, there are many more diseases in which IF proteins are associated with disease pathologies, including prominent immunoreactivity to disease-specific intracellular aggregations (see www.interfil.org for more information and listings). In Section 1.3.2, we address the regulation of peripherin and its specific relationship to ALS.

1.3.2 Peripherin Peripherin is a 58 kDa TX-100 insoluble IF protein first identified by its antigenic and filamentous similarity to the larger class of IF proteins (Portier et al. 1983). Along with vimentin, desmin, and GFAP, peripherin is classified as a type III IF protein, sharing >70% nucleotide sequence identity with each other (Fuchs & Weber 1994). Like other type III IFs, peripherin is capable of self-assembly into homopolymers and can be co- expressed with other IFs, particularly the type IV NFs, to form filamentous networks (Parysek et al. 1991, Cui et al. 1995, Athlan & Mushynski 1997, Beaulieu et al. 1999b). Peripherin assembly and organization into cytoplasmic networks is associated with the acquisition of a terminally differentiated neuronal phenotype. During development, peripherin, α-internexin, and vimentin are expressed early to form an initial IF protein scaffold that is temporally and spatially regulated (Chien et al. 1998, Merigo et al. 2005). Differentiation into a mature cytoskeletal network is a tightly integrated process that requires peripherin to form homopolymers or to heteroploymerize with NF subunit proteins (Athlan & Mushynski 1997, Athlan et al. 1997). The sequential and transitional appearance of different IF proteins during development is related to cytoskeletal plasticity during neurite outgrowth and is considered a mechanism to enhance the stability of existing filament networks (Giasson & Mushynski 1997). Unlike the ubiquitous neurofilaments, peripherin expression during development is limited to motor neurons, autonomic preganglionic and ganglionic neurons of the and optic nerves, sensory neurons of dorsal and cranial root ganglia, sympathetic neurons from the 40 neural crest, and some neuronal placodes, including olfactory axons and acoustic ganglia (Escurat et al. 1990). In the mature nervous system, peripherin is predominately expressed in small-caliber fibers of the peripheral nervous system (PNS), but is also present at lower levels in defined neuronal populations of the CNS, particularly of efferent spinal motor neurons and their projections (Table 1.3.2.i). Regulation and Function: The human peripherin gene (PRPH) contains nine spanning a ~3.9 kb region within q12-q13 of (Moncla et al. 1992, Foley et al. 1994). Gene sequencing of the human and other mammalian species has revealed several highly conserved coding, intragenic, and transcriptional motifs (Thompson & Ziff 1989, Karpov et al. 1992, Foley et al. 1994), suggesting important evolutionarily defined developmental and tissue-specific regulatory elements. The major contributor to neuron type-specific peripherin expression is the presence of an intact one sequence (Belecky-Adams et al. 1993, Uveges et al. 2002), while the activation of the peripherin gene, itself, appears to be the result of dynamic cis- and trans-acting interactions between different regions mapped to within a ~5.8 kb region upstream of the 5’-flanking sequence, with the strongest determinants of promoter activity situated just upstream of the transcriptional start site (Desmarais et al. 1992, Ferrari et al. 1995). The identification of a negative regulatory element (NRE) and two positive regulatory elements within the 5’ flanking region has fueled speculation that complete activation of peripherin is based on the dissociation of inhibitory elements at the NRE, and thus, derepression of the gene (Chang & Thompson 1996). The normal repression of peripherin in undifferentiated and nonneuronal cells may be regulated by several DNA-binding proteins, such as NF1-L, a member of the CTF/NF-1 transcription factor family (Adams et al. 1995) and Sp1 (Ferrari et al. 1995, Chang & Thompson 1996). As of yet, the identity of the repressor is unknown, however, blockage of axoplasmic transport in intact nerves with vincristine suggests a distal, retrogradely transported inhibitory signal (Terao et al. 2000). These findings highlight the importance of environmental cues and neuron-target interactions in peripherin regulation and, indeed, a few in vitro studies have identified nerve growth factor (NGF) (Portier et al. 1983, Leonard et al. 1987, Parysek & Goldman 1987, Aletta et al. 1988, Leonard et al. 1988, Thompson et al. 1992), fibroblast growth factor (FGF) (Choi et al. 2001), leukaemia 41

Tissue/culture Cell line Species Features Reference (common) Tumorogenesis Cutaneous lesions h Differential marker of -derived Prieto et al., 1997 NFib, SCH, PEN, and NMN Extraskeletal myxoid h Not expressed in epitheloid sarcoma Cummings et al., 1999 chondrosarcoma

Insulinoma RIN5F r Islet of Langerhans pancreatic beta cell line Escurat et al., 1991

Neuroblastoma NUB-7 h Variable expression; induced by dbcAMP and Pedersen et al., 1993 (NB) NB-1 RA; prominent perinuclear distribution IMR32 SK-N-BE(2)C PKCε activation induces peripherin aggregation Sunesson et al., 2008 and apoptosis NIE 115 m Lamin β as a binding partner Djabali et al., 1991 Landon et al., 2000 N1A-103 m Adriamycin induced expression Larcher et al., 1992 Neuro-2A m Djabali et al., 1999 Neuroendocrine (NE) Merkel cell h Perinuclear aggregation in large tumor cells Baudoin et al., 1993 Alvarez-Gago et al., 1996 Pheochromocytoma PC12 r Expression increased by IL-6 and Trk/NGF Sterneck et al., 1996 Neuroepithelioma NUB-20 h Variable expression; less expression than NB Pedersen et al., 1993 (NEp) SK-N-MC Central Nervous System Brainstem Cranial nerve roots r Fine and large-caliber nerve fibers and cell Parysek and Goldman, 1988 body expression Vestibular ganglion cells c, r, m Support notion that central axons through Lysakowksi et al., 1999 vestibular nucleus are afferents Vestibular tract and nucleus gb, r Supports notion that apex of the cristae Leonard and Kevettte, 2006 ampullaris are efferents Cerebellum r Granular layer and corticospinal tract Parysek and Goldman, 1988 Cerebrum Temporal/parietal ctx. mq Astrocytic expression during encephalitis Matthew et al, 2001 Hippocampal neurites m Increased expression after KA-induced Kriz et al., 2005 Thalamic neurons m Increased expression after lesion injury and Beaulieu et al., 2002 cerebral ischemia Cochlea Spiral ganglion neurons (SGNs) r Expressed in type II SGNs or neomycin-induced Wang et al., 2006 and projections type 1 and III SGNs Lallemend et al., 2007 Olfactory axons r Minimal labeling Escurat et al., 1990

Table continued on following page... 42

Spinal cord r Strong expression in dorsal columns; weak Parysek and Goldman, 1988 labeling in ventral colums Pituitary gland r Expression mostly in posterior lobe Back et al., 1995 fibers Retina and Optic Nerves r origin Escurat et al., 1990

Peripheral Nervous System Dorsal root ganglia (DRG) r Variable expression; mixed populations Parysek and Goldman, 1988 Enteric Nervous System Goldstein et al., 1991 Myenteric plexus to submucosa h, r, m Increased expression from esophagus to distal Faussone-Pellegrini et al., 1999 colon; temporal from E12.5 Rauch et al., 2006 Matini et al., 1997 Sciatic nerve (SN) r Intense small caliber fibre labeling; Parysek and Goldman, 1988 variable labeling for large caliber fibres Table 1.3.2.i Peripherin Expression in Culture and Tissue. c, chinchilla; dbcAMP, dibutyryl cyclic adenosine monophosphate; DRG, dorsal root ganglia; E12.5, embryonic day 12.5; gb, gerbil; h, human; IL-6, interleukin-6; KA, kainic acid; m, mouse; mq, macaque; NB, ; NE, neuroendocrine; NEp, neuroepithilioma; NFib, neuro broma; NMN, neurotized melanocytic nevi; PEN, palisaded encapsulated neuromas; PKCε, protein kinase C-epsilon; r, rat; RA, retinoic acid; SCH, schwannomas; SGNs, spiral ganglion neurons; SN, sciatic nerve; Trk/NGF, /nerve growth factor. 43 inhibitory factor (LIF) (Lecomte et al. 1998), and interleukin-6 (IL-6) (Sterneck et al. 1996) as transcriptional inducers of peripherin expression. These factors, acting alone or synergistically, have been shown to elicit peripherin-associated neurite outgrowth and differentiation by triggering the tyrosine kinase (Trk) receptor signaling cascade through the Janus protein tyrosine kinase (JAK) protein family, which in turn stimulates the activity of signal transducers and activator of transcription (STAT) proteins (Djabali et al. 1993, Sterneck et al. 1996, Lecomte et al. 1998). Although there are currently ~70 individual proteins constituting the IF superfamily (www.interfil.org) with an abundance of literature on their structural, biochemical, histochemical, regulatory, and interactive properties (Herrmann et al. 2007, Kim & Coulombe 2007, Goldman et al. 2008), surprisingly very little is known about their exact biological role. Unlike other cytoskeletal filaments, such as microtubules and actin that are, essentially, linear polymers of globular subunits, IFs as fibrillar complexes appear suited for maintaining the structural integrity of cells in response to mechanical stress. In addition, the widespread cellular distribution and associative properties of IFs make them ideally suited for signal transduction at the receptor and subcellular levels. Elucidating the role of peripherin in vitro has come from studies limiting peripherin expression through the use of antisense oligonucleotides and small interfering RNAs (siRNA) in rat pheochromocytoma cells (PC12) stimulated with NGF (Troy et al. 1992, Helfand et al. 2003b). These studies found that while peripherin is not required for neurite formation, its absence was associated with an inability to initiate, extend, and maintain neuritic outgrowth. The generation of peripherin knockout [Per (-/-)] mice by Julien and colleagues demonstrated that a complete loss of peripherin results in a substantial decline (~34%) of unmyelinated sensory fibers in the dorsal horn (Lariviere et al. 2002). While these mice developed normally, with no overt behavioral phenotype, a significant increase in α-internexin was observed in the ventral horn, suggesting that homeostatic mechanisms may be in place to minimize the effects of peripherin loss in response to abnormal congenital alterations. While the compensatory effect is merely speculative, and no comparable increase in α-internexin is seen in the in vitro knockdown experiments described above, future studies are encouraged to circumvent this possibility 44

by utilizing transgenes with inducible expressors; here, another major advantage is the reversibility of the knockdown should any phenotypes arise. Traumatic Neuronal Injury: Considering the importance of peripherin in providing cytoskeletal stability during development and in the adult nervous system, and that peripherin expression can be induced by and cytokines, several groups have assessed the effects of nerve injury on peripherin expression and assembly. Examination of DRG after unilateral sciatic nerve axotomy revealed that peripherin is substantially upregulated in both small and large DRG neurons (Oblinger et al. 1989b, Troy et al. 1990). Moreover, using 35S-methionine to label proteins in newly regenerating axons, Parysek and colleagues also demonstrated that, in primed conditions, where neurons are preconditioned with a prior axotomy, increased amounts of peripherin can be observed in transit en route to regenerating axonal sprouts (Oblinger et al. 1989b). These studies are in stark contrast to the NFs, where there is a significant downregulation in synthesis and transport following peripheral nerve injury (Hoffman et al. 1987, Wong & Oblinger 1987, Goldstein et al. 1988, Oblinger et al. 1989a). Despite being transcriptionally silent in the majority of neuronal populations in the brain, peripherin expression can be induced at the site of traumatic injury, including stab-like lesions and cerebral focal ischemia (Beaulieu et al. 2002). This response was shown to be enhanced in adjacent regions when IL-6 and LIF are administered at the site of injury. The relationship between peripherin and neuronal injury was subsequently extended to other diseases by systemic injections of the excitatory amino acid, kainate (Kriz et al. 2005), which invokes an epileptogenic-like response through limbic seizures (Ben-Ari & Cossart 2000). Increased peripherin expression can be observed after kainic acid (KA)-induced seizures in the cortex, hippocampus, and thalamus. Interestingly, in transgenic peripherin overexpressing mice (Beaulieu et al. 1999), KA induces an enhanced peripherin response, which is associated with alterations in synaptic plasticity, as measured by short- and long-term potentiation in the cornu ammonis (CA) fields of the hippocampus (Kriz et al. 2005). The significance of these findings is certainly not lost in humans, as increased peripherin expression is observed to occur in focal cortical dysplasia - the most common cause of intractable epilepsy among children. Here, peripherin increases occur predominately within dysplastic “ballooned” neurons, 45

suggesting that abnormal peripherin expression may contribute to the cytoarchitectural disorganization in the cortices of these patients (Taylor et al. 2001). Post-Transcriptional and -Translational Modifications: After transcription, the ability of peripherin to respond accordingly to the requirements of the neuron may, in part, be regulated through post-transcriptional modifications. Like other IFs, peripherin is constitutively phosphorylated, and, depending on the cell line or tissue of interest, different degrees of peripherin phosphorylation in both the N- and C-terminals are observed. (Aletta et al. 1989, Huc et al. 1989, Angelastro et al. 1998, Konishi et al. 2007). Enhanced peripherin phosphorylation can be demonstrated in PC12 cells when exposed to NGF, activators of protein kinases A and C, and even depolarizing levels of K+ (Aletta et al. 1989). Peripherin was recently identified to be a novel IF susbtrate for phosphatidylinositol 3-kinase (PI3K)-Akt-mediated phosphorylation at Ser66 in PC12 and HEK 293T cells, with phosphorylation being particularly pronounced in the cell body of damaged hypoglossal motor neurons undergoing regeneration (Konishi et al. 2007). Akt (also known as protein kinase B) is thought to mediate various cellular processes, such as cell survival, proliferation, and differentiation (Franke 2008). Considering that the phosphorylation of IF head domains has been associated with filament disassembly (Omary et al. 2006), Akt may provide a valuable mechanism for sensitive regulation of newly synthesized or existing peripherin. In addition to phosphorylation, peripherin residues Tyr17 and Tyr376 were recently shown to undergo nitration after NGF-induced differentiation in PC12 cells (Tedeschi et al. 2007). These authors found that nitration of peripherin is also correlated with increased stability even in the presence of depolymerizing agents, such as nocodazole. Peripherin is unique among neuronal IFs in that it is associated with the generation of protein isoforms. The constitutive, and most typically described peripherin isoform expressed from the peripherin gene, is Per-58, which is encoded by all nine exons of the gene (Thompson & Ziff 1989, Parysek et al. 1991, Karpov et al. 1992). The first non-descriptive identification of peripherin isoforms was made by Alletta and colleagues when several peripherin electrophoretic bands were localized on two- dimensional isoelectric focusing (IEF) x SDS polyacrylamide gel electrophoresis (PAGE) gels by a polyclonal antiserum (Aletta et al. 1989). While the identification of these 46

prospective isoforms was unknown, they noticed that isoform-specific expression was changed in response to NGF stimulation, suggesting that these isoforms play a role in peripherin function. In addition to Per-58, a second isoform has been identified in human (Per-28) and two others in mouse (Per-61 and Per-56). The splicing events generating these isoforms have been determined (Figure 1.3.2.i); briefly, Per-61 is generated by an in-frame retention of intron 4 that introduces a 32 amino acid insertion; Per-56 is generated by a cryptic acceptor site at the start of 9, resulting in an open reading frame (ORF)-shift that generates a unique 8-amino acid sequence at the COOH-terminal (Landon et al. 1989, Landon et al. 2000); and finally, Per-28 is a C-terminal truncated protein that arises from a premature stop codon from the retention of intron 3 (Xiao et al. 2008). There has also been a higher molecular weight disulfide peripherin dimer of ~130 kDa identified in rat sciatic nerve and DRG, and dramatically increased after sciatic crush (Chadan et al. 1994). Although the functional relevance of these isoforms is unknown, distinct morphologies and assembly properties can be observed when expressed in SW13 vim (-) cells (see Figure 1.3.2.i) (Robertson et al. 2003, Xiao et al. 2008), a human adrenal carcinoma cell line that lack endogenous cytoplasmic IF proteins (Sarria et al. 1990). While these findings are similar to the morphological changes that are observed in peripherin assembly studies using truncated or mutated cDNA transcripts to elucidate the functional roles of the head, tail and rod domains (Cui et al. 1995, Ho et al. 1995, Ho et al. 1998a), peripherin isoforms represent a relevant physiological process capable of modulating filament structure. Understanding the role of these isoforms may lie partly in the recognition that peripherin may be capable of forming intra-isoform associations. We have recently reported that the expression cDNA encoding the whole peripherin gene generates multiple peripherin species from lysates of SW13 vim (-) cells identified by a polyclonal antibody by SDS-PAGE. Significantly, Per-61 and Per-28 are abnormal splice variants that induce peripherin aggregation in vitro and are associated within abnormal intracellular inclusions found in mtSOD1 mice and in ALS, respectively (Robertson et al. 2003, Xiao et al. 2008). Such findings indicate that abnormalities in alternative splicing of peripherin may contribute to the neurodegenerative mechanism in ALS. A C PRPH 5’ 3’ Per-58 pre-mRNA editing/splicing

pre-mRNA translation

Per-28 Per-58 N 1a 1b 2a 2b C

B ALTERNATIVE PERIPHERIN ISOFORMS:

Per-28 Per-56 (intron retention) 1a 1b

Per-56 (exon 9 acceptor site) 1a 1b 2a 2b Per-61

Per-61 (intron retention) 1a 1b 2a 2b

Figure 1.3.2.i Peripherin Protein Isoforms Splicing Mechanisms and Expression. (A) The constitutively expressed, full-length peripherin isoform, Per-58: complete intron splicing produces typical intermediate filament protein structure with a molecular weight of ~58 kDa; (B) Alternative peripherin isoforms. Per-28: full retention of 3 and 4 with premature stop codon generates a ~28 kDa protein product; Per-56: a cryptic acceptor site in exon 9 leads to COOH-terminal replacement with unique 8-aa sequence; Per-61: full retention of intron 4 leads to amino acid insertion in coil 2a. (C) Variable morphology of peripherin isoforms expressed in SW13 vim (-) cells: Per-58 and Per-56 form filaments, while Per-28 and Per-61 form distinct aggregates. 47 48

1.3.2.1 Peripherin in ALS Peripherin is found to be one of the major protein constituents in UBIs, including compact and Lewy body-like structures, and is found associated with NFs in HCIs and axonal swellings called spheroids (Corbo & Hays 1992, Migheli et al. 1993, Wong et al. 2000, He & Hays 2004, Xiao et al. 2008). In addition, there is an overall general upregulation of peripherin mRNA and protein levels in spinal cords of ALS patients when normalized to neuron-specific markers (Robertson et al. 2003, Strong et al. 2004, Xiao et al. 2008), although inter-individual variations in expression have been reported (Corbo & Hays 1992, Wong et al. 2000). While the mechanism of inclusion formation in ALS remains unknown, cytoskeletal abnormalities are prominent features of most NF and peripherin transgenic mice (Robertson et al. 2002). It is believed that perturbations in the normal nIF stoichiometry through targeted or overexpression leads to unstable filament associations, ultimately causing a collapse in the filament network and the formation of cytoplasmic inclusions. While some of these mice demonstrate the co-occurrence of a number of specific pathologies reminiscent of ALS (Cote et al. 1993, Lee et al. 1994, Zhu et al. 1997, Kriz et al. 2000, McLean et al. 2005), only peripherin overexpressing mice, under the control of the wt (Per) and the human Thy-1 (TPer) gene promoters have been shown to develop an age-dependent motor neuron disease (Beaulieu et al. 1999a). Inclusions bodies appearing as disorganized 10-nm filaments entangled with various membranes and mitochondria were found in the presymptomatic stages, with disease onset occurring around two years-of-age and coinciding with a ~35% loss in motor neuron ventral roots. While few studies have used these mice to study motor neuron degeneration because of the long latency of disease onset, crossing these mice with NF-L (-/-) mice (Per;L-/-), mimicking more closely the neuronal IF conditions found in ALS (Bergeron et al. 1994), augment the formation of inclusions and disease onset to six to eight months-of-age, with ventral root loss observed as early as four months (Beaulieu et al. 1999a). The inclusion bodies in peripherin overexpressing mice were also abnormally immunoreactive for NF-M and NF-H, with the majority of NF-H being hyperphosphorylated. To further evaluate mechanism of peripherin-mediated motor neuron degeneration, Per;L-/- mice were crossed with mice overexpressing human NF-H, 49

a mouse model with massive perikaryal accumulations of human NF-H with no motor neuron loss (hH;TPer;L-/-) (Beaulieu & Julien 2003). While peripherin expression was not changed in these mice, there was a dramatic redistribution of peripherin accumulation from the axon to the perikarya, and a reorganization of peripherin ultrastructure, from 10- nm filaments in TPerL-/- mice to non-filamentous protein aggregates in hH;TPer;L-/- mice. The benefits of these changes may reflect a reduction in the burden of defective axonal transport seen in both the TPer and TPer;L-/- mice (Millecamps et al. 2006), however, this has yet to be confirmed. While the nature of these inclusions in transgenic neuronal IF mice and in ALS remains unknown, the in vivo associations of nIFs are crucial for motor neuron viability (Julien & Beaulieu 2000, Robertson et al. 2002, Bruijn et al. 2004, Xiao et al. 2006). Peripherin abnormalities are also found in mtSOD1 transgenic mice. In addition to the immunodetection of peripherin inclusions in mtSOD1G37R mice (Beaulieu et al. 1999a, Lariviere et al. 2003), there is also abnormal expression of the Per-61 isoform in motor neurons of these mice (Robertson et al. 2003). The expression of Per-61 is far from innocuous, having been shown to disrupt neuronal IF associations, induce neurofilament aggregation, and cause cell death when cDNA encoding Per-61 is microinjected into motor neurons in culture (Robertson et al. 2003). The proof that abnormalities in peripherin splicing occur in ALS came from our group when we discovered that peripherin mRNA transcripts retaining introns 3 and 4 was were found in ALS lumbar spinal cord and led to the generation of a C-terminally truncated protein of 28 kDa, termed Per-28 (Xiao et al. 2008). Per-28 was found to be aggregate-prone in SW13 vim (-) cells, associated with inclusion body formation, and was upregulated in ALS (Xiao et al. 2008). The findings of peripherin mutations in sALS have reinforced the importance of peripherin as a prospective etiological or propagative factor of ALS. Direct evidence for peripherin genetic changes in ALS has come from two studies that have identified at least two pathogenic mutations associated with sporadic ALS cases (Gros-Louis et al. 2004, Leung et al. 2004). One variant consists of a nucleotide deletion (PRPH228delC) resulting in a frameshift within exon 1 and a stop codon predicted to generate a truncated peripherin species of 85 aa encompassing the head domain; the second variant is a homozygous non-conservative D141Y mutation within the first linker sequence of the 50

rod domain. While it is not known whether these mutations are toxic, both mutations are associated with aggregate formation, which may disrupt normal protein associations within the cytoskeletal network. Our current understanding of the cause and propagation of ALS is now intimately linked to the non-cell autonomous theory of disease pathogenesis, which states that the selective vulnerability of motor neurons in ALS is derived from damage incurred to both neurons and their non-neuronal neighbouring cells (Boillee et al. 2006a, Rothstein 2009). From experiments using restricted promoters in transgenic mice to selectively express mtSOD1 in various cell types, it has been shown that astrocytes, Schwann cells, and microglia are determinants of disease progression, while toxicity arising within motor neurons initiates disease onset (Gong et al. 2000, Lino et al. 2002, Clement et al. 2003, Boillee et al. 2006b, Lobsiger et al. 2009). Recent evidence suggests that the activation of microglia and astrocytes in ALS leads to a disturbance in the normal interrelationships, or “crosstalk”, between glia and motor neurons (Van Den Bosch & Robberecht 2008). This has particular relevance to our discussion about peripherin in ALS as certain neurotrophins (NGF and FGF) and pro-inflammatory cytokines (LIF and IL-6) are capable of eliciting a peripherin response (Portier et al. 1983, Leonard et al. 1987, Parysek & Goldman 1987, Aletta et al. 1988, Leonard et al. 1988, Thompson et al. 1992, Choi et al. 2001). As these factors are robustly secreted by glial cells in ALS (Giess et al. 2000, Moreau et al. 2005, Pehar et al. 2005), it is reasonable to speculate that neuroinflammation may play a role in modulating either peripherin expression and/or function. In fact, Robertson et al. (2001) identified that inclusion-bearing DRG derived from TPer mice were uniquely susceptible to apoptosis upon exposure to the proinflammatory environment of dissociated spinal cord cultures, which are rich in activated microglia and astrocytes. The pro-apoptotic effect could be blocked by the administration of TNF-α neutralizing , showing that this selective effect was downstream of receptor-mediated signaling pathways. While the exact mechanisms of these interactions remain elusive, they suggest that peripherin maintains specific properties that lead to neuronal degeneration in both autonomous and non-cell autonomous ways. 51

Despite compelling evidence implicating peripherin in ALS, it is still unknown why peripherin abnormalities occur, and what their precise contribution is to disease pathogenesis. Peripherin abnormalities represent a pathological point-of-convergence for both fALS and sALS, thus, understanding both normal and abnormal peripherin biology is likely to reveal some of the shared underlying mechanisms that drive the different forms of the disease (Xiao et al. 2006). Several aspects of peripherin regulation remain an important objective in the study of ALS, namely the nature of peripherin upregulation and aggregation, as well as the role of peripherin isoforms in normal filament cytoarchitecture and in motor neuron degeneration.

1.4 Protein Isoforms 1.4.1 Protein Diversity: The extensive mapping of the human genome, known as the Human Genome Project (HGP), including prediction-based annotative studies and a detailed analyses of ~1% of the genome, identified an unexpectedly low number of genes (~20,000-25,000) (Lander et al. 2001, Venter et al. 2001, 2004, Birney et al. 2007), prompting speculation as to the source of human complexity in the face of genetic simplicity. Emerging from the HGP and other studies was the realization that the coding capacity of the human genome is significantly increased as a result of complex processes to generate functionally divergent isoforms. This increase in protein diversity can arise from over 200 different types of modifications occurring at post-transcriptional stages, such as alternative splicing of pre-mRNA, at post-translational stages, such as phosphorylation and , or both, such as alternative translation. The mapping of the human proteome in the post-genome era, including the identification and characterization of protein isoforms and their regulatory elements, represents a shift back to proteomics-based indexes proposed over 20 years ago (Anderson & Anderson 1982, Taylor et al. 1982). 1.4.2 Alternative Splicing: Current estimates indicate that ~75% of all multi-exon genes undergo alternative splicing - the process by which a single pre-mRNA transcript is edited to yield different mRNAs that lead to the production of protein isoforms (Garcia- Blanco et al. 2004). In addition to intron removal, facilitated by conserved sequence elements at the exon-intron junctions, there are several different types of alternative 52

splicing, including whole or partial intron retention, whole or partial exon excision, or alternative usage of splice donor or acceptor sites. Editing of pre-mRNA is an ordered, stepwise process that is facilitated by a complex of specialized small nuclear RNA proteins (snRNPs), called the . The activity of the spliceosome can be regulated by a number of cis-acting regulatory elements along the primary transcript, known as splicing enhancers or repressors, which interact directly or indirectly with trans-acting elements for efficient isoform output. Remarkably, some genes can yield thousands of unique isoforms; for example, the neuronal pre-synaptic surface receptor neurexin can generate ~3000 unique mRNAs as a results of a large number of promoters and exons present in the three neurexin genes (Missler & Sudhof 1998). The relative abundance of splicing in the nervous system compared to other tissues is likely the result of complex developmental processes and extreme plasticity (Yeo et al. 2004, Blencowe 2006). As such, aberrant splicing as a result of a number of well-characterized mechanisms, including gain- or loss-of-splicing-function mutations, splicing factor mutations, abnormal exon exclusion or intron retention, and altered isoform ratios (Garcia-Blanco et al. 2004), is likely to result in noticeable neurobiological changes (Blencowe 2005, Lipscombe 2005). Indeed, the importance of alternative splicing in the development and maintenance of the nervous system is reflected in the growing list of neurological diseases that are associated with splicing defects (Table 1.4.2.i) (Gallo et al. 2005, Licatalosi & Darnell 2006).

1.4.2.1 Alternative Splicing in ALS: Recent years have seen considerable attention directed towards alternative splicing in the pathogenesis of ALS. The recent discovery of mutations in the DNA/RNA-binding proteins TDP-43 and FUS/TLS in a significant proportion of fALS patients (Kabashi et al. 2008, Sreedharan et al. 2008, Kwiatkowski et al. 2009, Vance et al. 2009) may bring alternative splicing to the forefront of ALS research (Lagier- Tourenne & Cleveland 2009) as TDP-43 has been implicated in mediating abnormal splicing in cystic fibrosis (Ayala et al. 2006) and spinal muscular atrophy (SMA) (Bose et al. 2008), and FUS/TLS mediating abnormal splicing in (Sato et al. 2005).

53

Disease Spliced OMIM Splicing Abnormality Gene Number Alzheimer’s disease MAPT 157140 Inhibition of GSK3β increase inclusion of exon 10 in MAPT transcripts PSEN2 600759 Aberrant splicing of PSEN2 trasncripts mediated by overexpression of HMGA1a Amyotrophic lateral PRPH 170710 Aberrant inclusion of intron 3 of PRPH transcripts leads to scleorosis cytoskeletal disorganization Ataxia-telengiectasia ATM 607585 Point mutations within ATM cause aberrant splicing of ATM transcripts Fascioscapulohumoral Many Loss or overexpression of FRG1 leads to altered splicing dystrophy of many pr-mRNAs (eg. TNNT3, MTMR1) Fragile-X-associated Many Congenital CGG repeat expansions in FMR1 results in the tremor/ataxia syndrome sequestration of many RNA-binding splicing factors

Frontotemporal dementia MAPT 157140 Point mutations within MAPT (and/or other unknown AGD, CBD, FTDP-17; events) results in altered levels of MAPT transcripts (tau) containing exon 2 and 10 PiD, and PSP

Duschenne and Becker’s DMD 300377 Altered levels of DMD transcripts () due to muscular dystrophy deletions and mutations in the DMD gene Myotonic dystrophy (DM) DM1 Many Congenital CUG expansion in the 3’UTR of DMPK results in the misregulation of splicing factors (eg. MBNL) DM2 Many Congenital CCUG expansion in the ZNF9 intron results in misregulation of splicing factors (eg. CUG-BP1) Neurofibramatosis type 1 NF1 162200 Numerous mutations in NF-1 result in aberrant splicing Paraneoplastic neurologic Many Autoimmune antibodies recognize the NOVA and Hu disorders family of neuron specific RNA-binding splicing factors in POMA and PEM/SN Prader Willi syndrome HTR2C 312861 Loss of splicing regulatory snoRNA as a silencer element in the splicing of 5-HTR2C (serotonin receptor type 2c) Psyciatric disorders Many Accumulation of aberrantly spliced transcripts in schizophrenic patients Retinitis pigmentosa Many Mutation of genes encoding U snRNP-associated proteins Rett Syndrome Many Mutation of gene encoding MeCP2, which interacts with YB-1 RNA-binding protein Spinal Muscular Atrophy SMN2 601627 Loss-of-function mutation in SMN1 unmasks cis-acting splicing defect in SMN2 Spinocerebellar ataxias (SCA) Many RNA gain-of-function due to triplet repeat expansions; direct and indirect interactions with RNA-binding splicing SCA2, SCA8, SCA10, factors and SCA12 Table 1.4.2.i Human Neurologic Disease Associated with Alternative Splicing. AGD, Agyrophilic grain disease; CBD, corticobasal degeneration; CUG-BP1, CUG-binding protein 1; FTDP-17, frontotemporal dementia with Parkinsonism linked to ; FRG1, fascioscapulohumoral muscular dystrophy region 1; GSK-3β, glycogen synthase kinase 3-beta; HMGA1a, high mobility group at-hook group 1; MBNL, muscle-blind like protein; NOVA, neurooncologic ventral ; PEM/SN, paraneo- plastic encephalomyelitis / sensory neuronopathy; PiD, Pick’s disease; POMA, paraneoplastic opsoclonus myoclonus ataxia; PSP, progressive supranuclear palsy; snRNP, small nuclear ribonucleoprotein; YB-1, Y box-binding protein 1. Modified table from Licatalosi and Darnell, 2006. 54

While the ALS literature, itself, remains sparse on the subject, there is growing interest as a result of abnormal splicing of nNOS (Catania et al. 2001), EAAT2/GLT1 (Nagai et al. 1998, Meyer et al. 1999), mtSOD-1 (Zinman et al. 2009), and peripherin (Robertson et al. 2003, Xiao et al. 2008). Of these, peripherin remains the only protein where abnormal splicing is known to directly trigger motor neuron degeneration in vitro. As we have seen, the generation of aggregate-prone Per-28 and Per-61 in ALS and mtSOD1 mice, respectively, constitute the basis of our current knowledge of peripherin splicing abnormalities (Robertson et al. 2003, Xiao et al. 2008). The role of other peripherin isoforms in normal and pathological situations has yet to be determined, as does the effect of exogenous factors on peripherin splicing in light of evidence that environmental and pathological factors may mediate the efficiency and use of protein isoforms (Biamonti & Caceres 2009). Studies identifying and characterizing normally expressed peripherin isoforms would benefit the understanding of the role of alternative splicing in ALS.

1.4.3 Alternative Translation: The initiation of translation of eukaryotic mRNA occurs via a scanning mechanism, which predicts that the small (40S) ribosomal subunit advances linearly from the 5’ end until recognition of the intended start codon (AUGSTART). While prokaryotic mRNA scanning is dependent on Shine-Dalgarno rRNA-mRNA interactions and only three initiation factors (with an aggregate weight of ~125 kDa), mammalian cells require the co-ordination of at least 12 eukaryotic initiation factors (eIFs), as part of a initiation complex comprised of 28 different polypeptides (with an aggregate weight of > 1600 kDa). Of this latter complex, only the actions of the guanosine triphosphate (GTP)- binding protein, eIF2, which escorts Met-tRNAi onto the 40S subunit, and eIF5, which activates GTP hydrolysis by eIF2, have been clearly defined (Asano et al. 2001, Das et al. 2001). Many prokaryotes and viruses produce polycistronic mRNAs that allow for additional downstream open reading frames to be translated as a result of splicing, discontinuous transcription, or internal promoters. This mechanism of increased coding capacity is in contrast to mammalian cells, where the production of polycistronic mRNAs 55

is rare, and translation most readily initiates at the first in-frame start codon downstream of the 5’ cap (Both et al. 1975, Furuichi et al. 1975, Muthukrishnan et al. 1975). This is known as the position effect, but can be circumvented as a result of three ancillary mechanisms such that translation may occur from downstream AUG codons: (i) if the context of the local sequence surrounding the first AUGSTART, known as the Kozak sequence, is unfavorable; (ii) if the 5’ proximal initiation site is followed by a short ORF (sORF) there may be resumption of scanning and reinitiation of translation; and (iii) if there exists an internal ribosomal entry site (IRES) and/or there is a restucturing of the mRNA. A fourth proposal, known as “leaky scanning”, in which the AUGSTART is bypassed in order to initiate translation at a suboptimal downstream start site, appears to be a sanctioned mechanism for maintaining isoform ratios, however, remains controversial as the production of minor N-terminally truncated isoforms may be a reflection of errors from the translational machinery (Kozak 2002b). While the aforementioned mechanisms of the scanning model are not universal and do not explain every report of initiation from an internal position, they provide a basic framework from which to understand patterns of eukaryotic isoform expression. With a greater knowledge of the scanning rules, there has been an emerging link between translation initiation and human disease, wherein a mutation or change in mRNA structure is associated with a perturbation in the scanning mechanism (Table 1.4.3.i).

1.4.3.1 Alternative Translation in ALS: To date, there have been no reported studies implicating alternative translation in the pathogenesis of ALS. With respect to individual proteins in the ALS literature, alternative translation has been shown to occur in VEGF, EAAT2/GLT-1, and peripherin. With respect to VEGF and EAAT2/GLT-1 there are no known disease-specific isoforms associated with ALS, however, perturbations in the regulation of normal isoforms have been observed (Munch et al. 2002, Bornes et al. 2004). For both mRNA transcripts, translation initiation of an upstream ORF gives rise to the isoforms L-VEGF and mEAAT2/5UT2-5 immediately following splicing of the canonical AUGSTART in exon one. In presymptomatic mtSOD1G93A mice, there is increased expression of mEAAT2/5UT4 and a reduction of mEAAT2/5UT5. Reductions in circulating L-VEGF 56

Disease Translated OMIM Translation Abnormality Gene Number α-thalassemia HBA 141800 In a patient with α-thalassemia, a 2 nt deletion causes an A→C change in position -3 of the AUGSTART β-thalassemia HBB 141900 Disease-causing mutation creates a strong, upstream, out-of-frame AUG codon in HBB (β-globin) Androgen insensitivity AR 313700 In a family with partial androgen insensitivity syndrome, a syndrome G →A mutation was identified in position +4 of the AUGSTART Atherothrombotic disease Apo(a) 152200 An upstream AUG codon created by a polymorphism in Apo(a) [apolipoprotein (a)] reduces translation two-fold Neurohypophyseal AVP 192340 Mutation causes the destruction of the AUGSTART and insipidus translation from a downstream codon Thromboembolic disease F12 610619 Polymorphism in F12 (coagulation factor XII) creates a weak upstream initiation codon by changing the AUGSTART context, resulting in two- to three-fold decrease in translation Thrombocythaemia THPO 600044 Disease-causing mutations allow reinitiation of THPO transcripts to an internal AUG codon Tumorigenesis Acute Myeloid Leukemia C/EBPα 116897 Mutations in the transcription factor C/EBPα gene eliminate full-length isoform translation Colon cancer LEF1 153245 Selective promoter activation of the full-length transcrip- tion factor LEF1, but failure to translate the second, dominant-negative isoform Down syndrome-related GATA1 305371 Premature stop codon generated by mutations in the leukemia hematopoietic transcription factor GATA1 prevents full-length isoform translation Melanoma CDKN2A 600160 A mutation creates an inhibitory upstream AUG codon that is in a strong context and out-of-frame Squamous cell carcinoma HYAL1 607071 At least eight upstream active AUG codons are found in HYAL1 rendereing the transcript untranslatable Table 1.4.3.i Human Pathologies Associated with Alternative Translation. AUGSTART,, canonical start codon; LEF1, lymphoid enhancer-binding factor 1; nt, nucleotide. Information collected from Kozak , 2001 and 2002. 57 levels in certain haplotypes of the VEGF promoter/leader sequence is associated with a significant 1.8 times greater risk association of developing ALS (Lambrechts et al. 2003). While each of these isoforms show different properties with respect to receptor/ligand binding properties and spatiotemporal regulation, the significance of these changes in motor neuron disease is unknown. With respect to peripherin, the abnormal splice variants Per-61 and Per-28 have been associated with ALS (Robertson et al. 2003, Xiao et al. 2008), while normal human splice variants have yet to be identified. Interestingly, translation from a downstream AUG codon from rat peripherin cDNA has been shown, in culture, to yield a ~45 kDa isoform when the AUGSTART is suppressed by a de novo mutation. While the downstream codon leading to the generation of the ~45 kDa is thought to be translationally silent in normal mammalian systems, we have recently identified a species of the equivalent molecular mass expressed from human cDNA encoding the peripherin gene in SW13 vim (-) cells (Xiao et al. 2008). As such, further investigation into the origin of this ~45 kDa species is warranted. 58

CHAPTER 2

Rationale, Hypothesis, and Objectives 59

2.1 Rationale As we have seen, ALS is a complex, heterogeneous disease caused by multiple etiologies and pathologies in which the final common pathway is motor neuron death. While the cause of fALS is known in only 15-20% of inherited cases, the majority of ALS cases remain unknown and with little or no epidemiologic or genetic homology. Extensive research on post-mortem tissues of ALS patients and on transgenic animal models of motor neuron disease have yielded surprisingly few answers about the mechanisms motor neuron degeneration, despite a diverse array of pathology encompassing features of oxidative stress, protein misfolding and aggregation, excitotoxicity, mitochondrial and axonal transport dysfunction, and neuroinflammation (Cleveland & Rothstein 2001). And while the co-occurrence of these specific pathologies can be observed in all ALS variants, it may be argued that there is no other protein in the ALS literature that is more representative of a pathological point-of- convergence for both the familial and sporadic forms of the disease than peripherin (Xiao et al. 2006). As we have seen, abnormal peripherin upregulation (Robertson et al. 2003, Strong et al. 2004, Xiao et al. 2008) and its presence in the majority of perikaryal inclusions and axonal spheroids in motor neurons (Corbo & Hays 1992, Migheli et al. 1993, Wong et al. 2000, He & Hays 2004, Xiao et al. 2008) are post-mortem hallmarks of ALS. Importantly, peripherin transgenic mice succumb to motor neuron disease in transgenic overexpressing mice (Beaulieu et al. 1999a). As such, understanding the normal biology of peripherin, and its response to cellular stress and/or disease, may reveal important insights into the cause and/or propagation of ALS. Our current understanding of normal peripherin function is limited to speculation about its role as an IF protein, namely as a determinant of neuronal cytoarchitecture (Fuchs & Weber 1994, Kim & Coulombe 2007). However, in response to traumatic neuronal injury, peripherin responds in a manner inconsistent with other nIFs, maintaining the capacity to upregulate during both neuronal regeneration and degeneration (Oblinger et al. 1989b, Troy et al. 1990, Beaulieu et al. 2002, Kriz et al. 2005). While the reason for this dual response is unknown, peripherin expression is associated with the generation of functionally distinct isoforms (Landon et al. 2000, Robertson et al. 2003, Xiao et al. 2008). Surprisingly, no alternative isoform has been 60 identified under normal physiological conditions in human, while abnormal alternative splicing has been implicated in the pathogenesis of ALS (Robertson et al. 2003, Xiao et al. 2008). Moreover, the expression of the cDNA encoding PRPH and Per-28 in SW13 vim (-) cells has provided the first indirect evidence that normal peripherin expression may be characterized by the generation of multiple isoforms (Xiao et al. 2008). Just as the NFs are obligate heteropolymers requiring co-polymerization of NF-L, NF-M, and NF-H in specific inter-isoform ratios (Lee et al. 1993), it is reasonable to suggest that peripherin expression may be characterized by an intra-isoform ratio. Consequently, the following contents of this dissertation are focused on the identification and characterization of novel peripherin isoforms and their relationship to motor neuron disease.

2.2 Hypothesis Our primary hypothesis is that peripherin isoforms, through the generation of abnormal alternative splice variants or through disruptions in normal intra-isoform stoichiometry, play an important role in the normal biological function of peripherin and in the pathogenesis of ALS.

2.3. Objectives To define our primary hypothesis further, the following specific aims were undertaken: Chapter 3: • Identify and characterize novel peripherin isoforms expressed under normal physiological conditions. • Evaluate the effects of disrupting the expression of peripherin isoforms. • Assess the anatomical distribution of peripherin isoform expression. Chapter 4: • Determine the extent of isoform-specific ratio changes in traumatic neuronal injury, in mouse models of motor neuron disease, and in ALS. Chapter 5: 61

• Identify relevant ALS-linked pathological conditions, such as oxidation, neuroinflammation, and excitotoxicity that may modulate peripherin isoform expression. • Characterize the effects of peripherin isoform ratio changes on peripherin filament phenotype. 62

CHAPTER 3

A NOVEL PERIPHERIN ISOFORM GENERATED BY ALTERNATIVE TRANSLATION IS REQUIRED FOR NORMAL FILAMENT NETWORK FORMATION

The majority of this chapter is a published article: McLean, J.R., Xiao, S. and Miyazaki, K. and Robertson, J. (2008) A novel peripherin isoform generated by alternative translation is required for normal filament network formation. J Neurochem, 104, 1663-73. With kind permission of Blackwell Publishing. The definitive version is available at www.blackwell-synergy.com.

Mr. Jesse McLean performed 90% of the experiments and drafted the manuscript; Mr. Keigo Myazaki performed some immunoblot replicates to assess Per-45 distribution in the mouse brain; Dr. Shangxi Xiao provided technical advice with regards to the site- directed mutagenesis protocol. 63

3.1 ABSTRACT Peripherin is a type III nIF protein detected within the intraneuronal inclusions characteristic of ALS. The constitutively expressed peripherin isoform is encoded by all nine exons of the human and mouse peripherin genes to generate a protein species of ~58 kDa on SDS-polyacrylamide gels. Expression of this isoform, termed Per-58, generates a filament network in transfected SW13 vim (-) cells. On immunoblots of cell lysates derived from these transfected cells, we have consistently observed a second peripherin species of ~45 kDa. Here, we show that this species is a novel peripherin isoform generated through the use of an in-frame downstream initiation codon. This isoform, that we have designated Per-45, is co-expressed together with Per-58 and, thus, constitutive in both human and mouse. Using mutational analysis we show that Per-45 is required for normal network formation, with the absence of Per-45 leading to irregular filamentous structures and/or inclusion formation. We further show that peripherin expression in the normal nervous system is characterized by tissue-specific Per-58:Per-45 isoform ratios. Taken together, these results identify novel processing requirements for peripherin expression and indicate a hitherto unrecognized role for nIF network formation through intra-isoform associations.

64

3.2 GENERAL INTRODUCTION Peripherin is a type III member of the IF gene family and has the characteristic structure common to all IF proteins comprising of a predominantly α-helical rod domain flanked by non-α-helical N-terminal ‘head’ and C-terminal ‘tail’ domains (Steinert & Roop 1988). As with other type III IF proteins, peripherin filament assembly is dependent on the integrity of the rod and the N-terminal head domains (Cui et al. 1995, Ho et al. 1995), whereas the C-terminal domain, although not essential for the early stages of assembly, may play a role in regulating IF diameter and the lateral spacing of filaments (Kreplak et al. 2004). Peripherin is mainly expressed in the PNS but exhibits upregulated expression within motor neurons of the CNS after injury, a response that has been associated with both regeneration and degeneration (Oblinger et al. 1989b, Troy et al. 1990, Wong & Oblinger 1990, Beaulieu et al. 1999a). Significantly, peripherin is a component of the characteristic pathological inclusions present within affected motor neurons in ALS (Corbo & Hays 1992, Migheli et al. 1993, He & Hays 2004, Xiao et al. 2006), and mutations within the peripherin gene may be responsible for a small percentage of ALS cases (Gros-Louis et al. 2004, Leung et al. 2004). The constitutively expressed peripherin isoform is encoded by all nine exons of the peripherin gene and has a molecular weight of ~58 kDa on SDS-polyacrylamide gels in both human and mouse (Karpov et al. 1992). This isoform, termed Per-58, is capable of self-assembly to form homomeric filament networks, however, can also be co- expressed with other IFs to form heteromeric filament networks (Parysek et al. 1991, Cui et al. 1995, Beaulieu et al. 1999b). In transfection studies, we have consistently observed a ~45 kDa peripherin species on immunoblots of lysates derived from cells expressing the full-length human and mouse peripherin genes, as well as the respective cDNAs encoding Per-58. Here, we have identified this species as a constitutively expressed peripherin isoform, designated Per-45, generated through the use of an alternate downstream initiation codon in both the human and mouse genes. Although Per-45 lacks most of the N-terminal head domain, and thus unable to self-assemble into homomeric filament networks, it integrates normally to form networks in the presence of Per-58. Importantly, we have shown using site-directed mutagenesis of the relevant initiation 65

codons in the human and mouse Per-58 cDNAs, that in the absence of Per-45, Per-58 fails to form normal IF networks, instead appearing as non-elongated squiggles (Prahlad et al. 1998), irregular filamentous bundles, collapsed filaments and/or cytoplasmic inclusions . These findings indicate that although Per-58 has all the sequence motifs necessary for filament assembly, the establishment of organized filament networks depends on the presence of Per-45. Finally, we have found that Per-45 is expressed broadly in neuronal tissues and is the major isoform expressed in specific regions of the brain, indicating that Per-58:Per-45 isoform ratios are likely to have functional significance.

3.3 MATERIALS AND METHODS and Tissue Preparation. All procedures were performed in accordance with the Canadian Council on Animal Care Guidelines. Breeding colonies for C57BL/6 mice (Charles Rivers, St. Constant, QC) were maintained and established for female mice

aged up to four months (arbitrarily determined) and euthanized by carbon dioxide (CO2) inhalation followed by cervical dislocation. Human lumbar spinal cord, generously provided by Dr. Michael Strong (University of Western Ontario, ON), was used as the source for human protein. . The cDNA encoding mouse peripherin (mPer-58 cDNA) was described previously (Robertson et al. 2003). The cDNA encoding the human equivalent of Per-58 was obtained from Open Biosystems (Huntsville, AL) in the pCMV-SPORT6 mammalian expression vector (hPer-58 cDNA; BC032703). Both cDNAs were subcloned into the mammalian expression vector pcDNA 3.1 (-) (Invitrogen, Carlsbad, CA). Peripherin cDNA constructs lacking the canonical ATG start sites were derived by polymerase chain reaction (PCR) using primers located just upstream of the second and third ATG codons in human and mouse respectively. PCR was performed using hPer-58 cDNA and mPer-58 cDNA as templates and Pfu DNA Polymerase (Stratagene, La Jolla, CA) in standard reagent conditions for 25 cycles at 94 ºC for 45 s, 60 ºC for 45 s, and 72 ºC for 1.5 min followed by a final extension at 72 ºC for 10 min with 5’ EcoR1- linked sense primers [human: 5’- 66

GGAATTCCCTCGACTTCTCCATGGCCGAGGCCCTCAAC; mouse: 5’ - GGAATTCCGAGCGCCTCGATTTCTCCATGGC] and 3’ BamH1-linked antisense primers [human: 5’-CGGGATCCTCTTGACAGCATTTTATTTGGTTC; mouse: 5’- CGGGATCCGTCCTGGGTATCTTTATCCACCTC]. The resulting PCR products (hPer-45 cDNA and mPer-45 cDNA) were subcloned into pcDNA 3.1 (-) and sequenced using the T7 promoter and BGH reverse priming site. An in frame c-myc tag was added to the C-terminus of the mPer-45 cDNA by PCR using the corresponding sense primer sequence above with the following BamH1- linked antisense primer (the c-myc sequence is underlined): CGGGATCCCGTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCGTAGCTGTGG ATAGAAGAC. For addition of a c-myc tag to mPer-58 cDNA the same antisense primer was used together with the following EcoR1-linked sense primer: 5’- GGAATTCCCTAGTTCTGCCAAGCGCTGAATG. The mPer-45-c-myc and mPer-58- c-myc cDNAs were subcloned into pcDNA 3.1(-) and verified by sequencing The hPer-58M82L cDNA and mPer-58M86L cDNA mutants were generated using the QuickChange II XL site-directed mutagenesis kit (Stratagene) using the following respective primers with the target mutation (A→C) underlined: human: 5’- GGAGCGCCTCGACTTCTCCCTGGCCGAGGCCCTCAACCAGG; mouse: 5’- CCTCGGAGCGCCTCGATTTCTCCCTGGCCGAGGCCCTCAACC. The mutant cDNAs were subcloned into pcDNA 3.1 (-) and verified by sequencing. Transient Transfections. A human adrenal carcinoma cell line, SW13 vim-, that lacks cytoplasmic IFs (Sarria et al. 1990), was grown in Dulbecco’s Modified Eagle Medium (DMEM; Invitrogen) supplemented with 10% volume per volume (v/v) fetal

bovine serum at 37 ºC and 5% CO2. Cells were transiently transfected with appropriate DNA for 36 hr using the Lipofectamine 2000 Reagent kit (Invitrogen) according to the manufacturer’s protocol. Immunocytochemistry. Transfected SW13 vim (-) cells grown on glass coverslips were washed in phosphate-buffered saline (PBS) and fixed in methanol for 5 min at -20 ºC. Cells were rehydrated with PBS and blocked for 30 min in 5% weight per volume (w/v) BSA with 0.3% (v/v) TX-100 in PBS at room temperature (rt). Cells were incubated for 1h at rt with the following primary antibodies diluted in blocking solution: 67

polyclonal peripherin antibody (AB1530; 1:1000; Chemicon, Temecula, CA); monoclonal peripherin antibody (MAB1527; 1:1000; Chemicon); monoclonal anti-myc antibody (R950-25; 1:1000; Invitrogen). Per head rabbit polyclonal antibody was raised to a synthetic peptide (LPSERLDFS), corresponding to peripherin amino acid position 73-81 in human and 77-85 in mouse from ATG1, which is present in the N-terminal head domain of Per-58 but absent in Per-45, and used at a dilution of 1:500. For antibody detection, cells were labelled for 30 min with anti-mouse/anti-rabbit IgG conjugated to Alexa Fluor 488 (green) or Alexa Fluor 594 (red) diluted 1:300 in blocking solution and counterstained with DAPI Nucleic Acid Stain (Invitrogen) diluted 1:100 for 10 min at rt. Cells were viewed using a Leica DM6000 digital microscope (Leica Microsystems, Germany) and images visualized using a Hamamatsu Orca-ER digital camera and captured with Openlab software (Improvision, England). Immunoblotting. For total protein lysates, cells were harvested in 62.5 mM Tris- HCl, pH 6.8, containing 2% (w/v) SDS and protease inhibitor cocktail (P-8340; Sigma- Aldrich, St. Louis, MO). Potential degradation of peripherin during sample processing was assessed by incubating total cell lysates at rt for 0, 5, 10, 30 and 60 min in the presence or absence of protease inhibitors; at these time points, proteolysis was stopped by adding 2% (w/v) SDS and boiling the sample. For TX-100 preparations, cells were harvested in low salt TX-100 extraction buffer [20mM Tris-HCl (pH 7.5), 150 mM NaCl, 1mM ethylenediaminetetraacetic acid (EDTA), 1% (v/v) TX-100, and protease inhibitors] and incubated on ice for 30 min. The TX-100 soluble and insoluble fractions were separated by centrifugation at 16,000 g for 30 min at 4°C. The TX-100 insoluble pellets were solubilized in 2% (w/v) SDS and made to the equivalent volume of the soluble fraction with extraction buffer. For enrichment of neuronal IFs from human or mouse, approximately 50-100 mg of various neuronal tissues were homogenized at 4ºC in low salt extraction buffer [50 mM Tris (pH 7.5), 150 mM NaCl, 5 mM EDTA, and protease inhibitors]. The homogenates were then centrifuged at 16,000 g for 10 min at 4 ºC. The pellet fractions were further homogenized in high salt Triton X-100 extraction buffer [20mM Tris-HCl (pH 7.5), 750 mM NaCl, 1mM EDTA, 1% (v/v) TX-100, and protease inhibitors] centrifuged at 16,000 g for 10 min at 4 ºC. The resultant pellets were 68 treated to a final homogenization in high salt buffer containing 1 M sucrose and re- centrifuged to remove lipids. The final pellet was solubilized in 2% (w/v) SDS in PBS. Samples were assayed for protein concentration using the bicinchoninic acid assay and then diluted in 2x loading buffer [Tris-HCL, pH 6.8, 30% (w/v) glycerol, 4% (w/v) SDS, 10% (v/v) β-mercaptoethanol and 0.02% (w/v) bromophenol blue] and boiled for 5 min. Loadings of 10-15 µg were routinely analysed on 10% SDS-polyacrylamide gels and then blotted to polyvinyldifluoride (PVDF) membrane. For comparison of TX- 100 soluble versus insoluble fractions, equal volumes of sample were used. For immunoblotting, membranes were blocked with 3% (w/v) skimmed milk powder in Tris- buffered saline containing 0.2% (v/v) Tween-20 for 1 hour at rt, then with polyclonal peripherin antibody diluted 1:5000 in the blocking solution overnight at 4°C. A monoclonal glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody (H86504M; Biodesign, Saco, ME) diluted 1:5000 was used as the internal loading control. Antibody binding was revealed using horse radish peroxidase (HRP)-conjugated anti-rabbit or anti- mouse IgG and an enhanced chemiluminescence (ECL) detection system (NEN Life Science Products, Woodbridge, ON). Statistics. To quantitate inclusion formation in SW13 vim (-) expressing Per-58 or Per-58 CTG-substitution mutants, we analyzed 10 random field-of-views (f.o.v.) across three independent transfections and performed a students T-test, with p < 0.05 considered significant. To quantitate the relative isoform ratios of Per-58:Per-45 across different neuronal tissues, immunoblots of TX-preparations probed with peripherin antibody were scanned and exported to ImageJ (http://rsb.info.nih.gov/ij/) for analysis. Using the integrated density function after background subtraction, we measured the sum of the pixels in either Per-58 or Per-45 selections to obtain relative isoform levels. Isoform ratios were calculated by dividing each of these values by the total Per-58:Per-45 isoform content. Statistical tests were done with Prism 4.0 (GraphPad software, San Diego, CA). For comparisons of the changes in peripherin isoform ratios within different neuronal regions we used one-way analysis of variance (ANOVA) and Tukey’s post-test, with p < 0.05 considered significant.

3.4 RESULTS 69

Translation from downstream initiation codons in human and mouse peripherin cDNAs generates a peripherin species of ~45 kDa. The ORF of the mammalian peripherin gene contains several in-frame initiation codons, and therefore, potentially translate peripherin mRNA from different initiation sites (Thompson et al. 1989, Karpov et al. 1992, Thompson, 1989). Current experimental evidence implicates the first and second ATG triplets in human (M1 or hATG1) and mouse (M7 or mATG2), respectively, as the canonical translational start sites (herein referred to as ATGSTART; Figure 3.4.i, A) that generate the full-length, intronless peripherin isoform, Per-58 (Karpov et al. 1992, Foley et al. 1994, Ho et al. 1995). Although predicted to be less efficiently translated, the consensus sequence surrounding human ATG2 (M82 or hATG2) and mouse ATG3 (M86 or mATG3) are uniquely conserved (Figure 3.4.i, B) and may account for the unidentified mammalian peripherin isoforms with molecular weights of ~45 kDa; putative translation from hATG2 or mATG3 would generate peripherin isoforms with predicted molecular weights of ~45 kDa. To determine if downstream translation initiation would generate a peripherin species of the same molecular weight, we made Per-58 cDNA constructs that lack the ATGSTART by PCR amplification using forward primers just upstream of hATG2 (hPer-45 cDNA) or mATG3 (mPer-45 cDNA). Ectopic expression of these PCR-generated peripherin cDNA constructs in SW13 vim (-) cells generated a single peripherin isoform of the expected molecular mass of ~45 kDa, that migrated to the same position on SDS-PAGE as that expressed from the human or mouse Per-58 cDNAs or in human or mouse spinal cord tissue (Figure 3.4.i, C, arrows). Immunocytochemical analysis of cells expressing the mouse or human Per-58 cDNA revealed normal filament networks, as we have reported previously (Robertson et al. 2003) (Figure 3.4.i, D). Since the ~45 kDa isoform lacks the first 81 aa of the N-terminal head domain in human, and 85 aa in mouse, we would therefore expect the ~45 kDa isoform to be unable to form filament networks (Cui et al. 1995, Ho et al. 1995, Ho et al. 1998b); indeed, the ~45 kDa species was self-assembly incompetent, and did not generate any discernible filamentous structures, but rather a diffuse labelling pattern that appeared throughout the (Figure 3.4.i, D). A surprising finding to emerge from these studies was that the regional localization of the ~45 kDa protein was changed depending on the confluence of SW13 vim (-)-transfected 70

A M1 (hATG1; START) Human MSHHPSGLRAGFSSTSYRRTFGPPPSLSPGAFSYSSSSRFSSSRL... Mouse MPSSASMSHHHSSGLRSSISSTSYRRTFGPPPSLSPGAFSYSSSS... 2 M7 (mATG ; START) M82 (hATG2) Human ...LGSASPSSSVRLGSFRSPRAGAGALLRLPSERLDFSMAEALNQQE... Mouse ...RFSSSRLLGSGSPSSSARLGSFRAPRAGALRLPSERLDFSMAEAL... M86 (mATG3) B 1 2 Human (ATG ) GCCG CAATGA Human (ATG ) TTCTCCATGG Mouse (ATG2) GCCAGCATGA Mouse (ATG3) TTCTCCATGG Kozak GCCPCCATGP Kozak GCCPCCATGP

C i. ii. iii.

hPer -58 hPer-45 mPer-58 mPer-45 h lumbar hPer-45 m lumbar mPer-45 61.0 61.0 61.0 47.5 47.5 47.5

D hPer-58 hPer-45 mPer-58 mPer-45

Figure 3.4.i. Use of a Downstream Alternate In-Frame Translation Initiation Codon Generates a Peripherin Species of ~45 kDa. (A) The amino acid sequence of human and mouse peripherin features alternative in-frame initiating methionines, M82 (hATG2) and M86 (mATG3) (bold), respectively, downstream of the accepted canonical start site, M1 (hATG1) and M7 (mATG2) (bold), respectively. The underlined sequences correspond to the target epitope of the Per-head antibody used in this study. (B) The sequence flanking the downstream initation codons in human and mouse, hATG2 and mATG3, respectively, have uniquely conserved Kozak sequences, but are suboptimal for translation compared with the canonical start codons, hATG1 and mATG2, respectively. The high degree of sequence similarity near these downstream initiation codons implies a functional role for this region. The initiation codons are underlined and nucleic acids matching the Kozak consensus sequence are shown in bold. Purines (A or G) are denoted by P. (C) Immunoblots probed with polyclonal peripherin antibody corresponding to (i) transfected SW13 vim (-) cells expressing human or mouse Per-58 cDNAs (hPer-58 or mPer-58,respectively), in comparison with the respective Per-45 cDNAs (hPer-45 or mPer-45); (ii) TX-100 insoluble preparation from human lumbar spinal cord in comparison with SW13 vim (-) cell extracts expressing hPer-45; and (iii) TX-100 insoluble preparation from mouse lumbar spinal cord in comparison with SW13 vim (-) cell extract expressing mPer-45. Note that a peripherin species of the same molecular weight as that expressed from the mouse or human Per-45 cDNAs is expressed in all the paradigms tested (indicated by arrow in i, ii, and iii). (D) Immuno- fluorescence labeling of transfected SW13 vim (-) cells expressing hPer-58 or mPer-58 and the corresponding human or mouse Per-45 cDNAs. Cells were labeled with polyclonal peripherin antibody (green) and DAPI (blue). Note that hPer-58 and mPer-58 form filament networks whereas hPer-45 and mPer-45 are assembly incompetent. Bar: 20 µm. 71

cells. Here, hPer-45 was associated with a membranous phenotype when SW13 vim (-) cells were in contact with each other, but maintained a diffuse labelling pattern when cells were not in contact with each other (see Appendix I: Supplemental Findings, A1). Overall, these results indicate that translation from the downstream initiation codons hATG2 or mATG3 will generate an N-truncated ~45 kDa peripherin isoform that is unable to form proper filament networks.

Alternative translation is responsible for the generation of the constitutively expressed ~45 kDa isoform We have shown that expression of the cDNAs encoding human or mouse Per-58 in SW13 vim (-) cells also generates a second, ~45 kDa peripherin species that is also present in human and mouse (Figure 3.4.i, C). This peripherin species has an equivalent mass to the peripherin isoforms generated by downstream translation initiation from hATG2 or mATG3. Here, we performed site-directed mutagenesis to determine if the ~45 kDa peripherin species expressed from the human or mouse Per-58 cDNAs is generated by downstream translation from hATG2 or mATG3, respectively. Human ATG2 and mATG3 codons of the corresponding Per-58 cDNAs were mutated to CTG (leucine) to produce an in-frame M82L (hPer-58M82L; Figure 3.4.ii, A) or M86L (mPer-58M86L; Figure 3.4.ii, B) substitution, respectively; leucine was chosen for its structural similarity to methionine. A third M82L mutation was produced at hATG2 of the Per-3,4 cDNA construct generated by Xiao et al. (2008) (see Appendix I: Supplemental Results, A2). Sequence analysis of the constructs confirmed that only the desired change had been introduced (Figure 3.4.ii, A and B). In comparison with the non-mutated forms of Per-58, we show that site-directed mutagenesis of hATG2 or mATG3, precluding their use as initiation codons, abolished expression of the ~45 kDa species when expressed in SW13 vim (-) cells (Figure 3.4.ii, A and B, arrows). To ensure that the ~45 kDa peripherin species was not the product of a proteolytic event during sample processing, lysates of cells expressing the Per-58 cDNA, either in the presence or absence of protease inhibitors, were sampled at various times after harvesting (Figure 3.4.ii, C). Both the Per-58 and ~45 kDa species were apparent in samples

72

M82L A (ATG2)

hPer-58 hPer-58 hPer-58-cDNA 61.0

47.5 Per-58M82L-cDNA ~45 kDa (CTG)

(M82L) M86L B (ATG3)

mPer-58 mPer-58 mPer-58-cDNA 61.0

M86L Per-58 -cDNA 47.5 ~45 kDa (CTG) (M86L) C + + + + + ----- PI 0 5 10 30 60 0 5 10 30 60 min 61.0 mPer-58

47.5 mPer-45

Figure 3.4.ii Site-Directed Mutagenesis of ATG2 in Human and ATG3 in Mouse Identifies the ~45 kDa Peripherin Species. (A and B) Sequence confirmation and comparative immunoblot analyses of lysates from the appropriately trans- fected SW13 vim (-) cells probed with peripherin antibody. (A) Methionine-82 to leucine mutation (M82L) abol- ished the ~45 kDa protein band from human Per-58 cDNA expression (arrow). (B) Similarly, a methionine-86 to leucine mutation (M86L) abolished the ~45 kDa protein band from mouse Per-58 cDNA expression (arrow). (C) SW13 vim (-) cell lysates expressing mPer-58 cDNAs incubated over 60 min at room temperature with (+) or with- out (-) protease inhibitors (PI) and assessed by immunoblot probed with polyclonal peripherin antibody. Note reduction in intensities of Per-58 and the ~45 kDa species after 60 min in samples lacking PI. 73

processed immediately after harvesting (‘0’ timepoint; Figure 3.4.ii, C). However, there was a reduction in intensities of Per-58 and, more importantly, of the ~45 kDa species over time, that was most apparent after 60 min in the samples lacking protease inhibitors (Figure 3.4.ii, C, arrows), indicating that the ~45 kDa species is not the product of degradation. Taken together, these findings indicate that use of the alternative translation initiation codons, mATG3 or hATG2, are responsible for the ~45 kDa species expressed from the mouse or human Per-58 cDNAs; we have termed this novel peripherin isoform Per-45. The predicted molecular weight of Per-45 is 45.16 kDa in human (hPer-45) and 45.41 kDa in mouse (mPer-45).

Per-45 is required for establishment of normal filament networks To determine the contribution of Per-45 to filament formation, we compared by immunocytochemistry SW13 vim (-) cells expressing the non-mutated human or mouse Per-58 cDNAs with the corresponding hPer-58M82L or mPer-58M86L cDNAs (Figure 3.4.iii, A). In contrast to the filament networks generated by expression of Per-58 cDNA (Figure 3.4.iii, B, i), three irregular phenotypes in cells expressing hPer-58M82L or mPer- 58M86L were observed, including the presence of peripheral short fibrils, termed squiggles (Prahlad et al. 1998) (Figure 3.4.iii, B, ii), non-elongated filamentous bundles (Figure 3.4.iii, B, iii), and collapsed filaments (Figure 3.4.iii, B, iv). These structures were easily discernable by routine fluorescence microscopy. In many cells, the filamentous structure of the collapsed peripherin was not discernible, but rather formed compact inclusions; we quantified this phenotype and identified that 20-25% of hPer-58M82L- and mPer-58M86L- transfected cells contained inclusions as compared to ~5% for human and mouse Per-58- transfected cells (p < 0.0001; n = 3 x 10 f.o.v.; Figure 3.4.iii, C). To assess the degree of filament formation, TX-100 soluble and insoluble fractions from transfected SW13 vim (-) cells expressing mPer-58, mPer-45, or mPer- 58M86L were analysed by immunoblot (Figure 3.4.iii, C). In cells expressing mPer-58 cDNA, the Per-58 isoform was present largely in the insoluble fraction with a smaller amount in the soluble fraction, while the Per-45 isoform could only detected in the insoluble fraction (Figure 3.4.iii, C, lanes 1 and 2). In contrast, in cells expressing mPer- 45 cDNA, Per-45 was shifted largely to the soluble fraction, reflective of the 74 A hPer-58 hPer-58M82L

mPer-58 mPer-58M86L

B i. ii. iii. iv.

C

D mPer-58 mPer-45 mPer-58 M86L I S I S I S

61.0 mPer-58 47.5 mPer-45

Lane 1 2 3 4 5 6

Figure 3.4.iii. Characterization of Filament Network Requirements of Per-58 and Per-45 Isoforms. (A) detection of peripherin with a polyclonal peripherin antibody (green) and DAPI (blue) show that Per-58 cDNA-expressing SW13 vim (-) cells form extensive filament networks, while mutations that eliminate the ~45 kDa isoform (hPer-58M82L and mPer-58M86L) are associated with irregular filamentous structures. (B) Inverted, higher magnification of selected frames in (A), identify normal filament networks in cells expressing Per-58 (i), versus multiple structural phenotypes in cells expressing Per-58M86L, including short fibrils, termed squiggles (ii), non-elongated filament bundles (iii), and collapsed filaments (iv). (C) Collapsed filaments with no discernible structure and resembling compact intracellular inclusions were quantitified in human and mouse Per-58 and Per-58 ATG- substitution mutants (D) Immunoblot analysis of TX-100 insoluble (I) and soluble (S) fractions of SW13 vim cells expressing cDNAs encoding mPer-58 (Lanes 1 and 2); mPer-45 (Lanes 3 and 4); and mPer- 58M86L (Lanes 5 and 6) probed with polyclonal peripherin antibody. Bar: 5 µm; Error bars = standard error mean (S.E.M); * = p < 0.0001. 75

non-filamentous nature of Per-45 when expressed alone (Figure 3.4.iii, C, lanes 3 and 4). Interestingly, in the Per-58M86L-transfected cells, the Per-58 isoform shifted to a dominantly insoluble state (Figure 3.4.iii, C, lanes 5 and 6), indicating that the peripherin present in these cells, although unable to form extended filamentous networks (Figure 3.4.iii, C, ii-iv), does form higher-polymeric filament structures. These biochemical findings support our morphological observations and indicate that although Per-45 is not necessary for filament formation per se, its absence is associated with the formation of irregular, non-elongated filamentous structures.

Per-45 integrates within a heteromeric filament network Per-45 is an N-terminally truncated protein that is otherwise identical to Per-58, therefore, visualization of Per-45 from Per-58 is dependent on epitope-specific antibodies and the use of small-molecule affinity tags; in this study, we used both techniques to differentiate these isoforms. A synthetic peptide corresponding to a region within the peripherin N-terminal head domain present within Per-58 but not in Per-45 (residues LPSERLDFS, corresponding to amino acids 73-81 in human and 77-85 in mouse) was raised as a rabbit polyclonal antibody (Per-head antibody). Immunocytochemical labelling with a peripherin monoclonal antibody that recognizes the C-terminal domain, confirmed the expression of Per-58 and Per-45 in mPer-58 and mPer-45 cDNA-transfected cells, respectively (Figure 3.4.iv, A and D). Double labeling with the Per-head antibody revealed peripherin detection in mPer-58 cDNA-transfected SW13 vim (-) cells (Figure 3.4.iv, B), but not cells expressing mPer-45 (Figure 3.4.iv, E), confirming the specificity of the antibody for the head domain of peripherin. Although expression of the mPer-58 cDNA led to the generation of a filament network decorated both by the Per-head and monoclonal peripherin antibodies (Figure 3.4.iv, C, arrowheads), a small pool of apparently non-assembled Per-58 was also detected using the Per head antibody (Figure 3.4.iv, C, arrow). To directly visualize the mPer-45 isoform we generated mPer-45 cDNA incorporating a C-terminal c-myc tag. To check that the c-myc tag would not interfere with peripherin assembly properties, we also generated a C-terminal c-myc tagged 76

A B C

mPer-58

Mono Per Per head Merge + DAPI D E F

mPer-45

Mono Per Per head Merge + DAPI G H I

mPer-58-myc mPer-45-myc Per-58M86L J K L

mPer-58M86L + mPer-45-myc

Per head Anti-Myc Merge + DAPI Figure 3.4.iv Per-45 is Integrated within the Normal Peripherin Network. (A–F) SW13 vim (-) cells expressing mPer-58 or mPer-45 were double labeled with monoclonal peripherin antibody (green) or the Per-head antibody (red), with DAPI labeling (blue). In the mPer-58 cDNA expressing cells, the merged image (C) shows the overlap of the monoclonal peripherin (A) and Per-head antibody (B) labeling of filaments(arrowheads), with some non-filamentous Per-58 also apparent with the Per-head antibody (arrow). In contrast, in the mPer-45 cDNA expressing cells, the merged image (F) shows no overlap, as Per-45 only labeled with the monoclonal peripherin antibody (d) but not with the Per-head antibody (E). (G–H) A c-myc epitope tag on the C-terminal end of mPer-58 (G) and mPer-45 (H) allowed for direct visualization of both isoforms with anti-c-myc antibody (green). The c-myc tag did not appear to disrupt the assembly charac- teristics of either mPer-58 (filaments) or mPer-45 (diffuse). (I) Expression of Per-58M86L labeled with polyclonal peripherin antibody showing irregular filamentous networks. (J–L) Co-transfection of mPer-58M86L (detected by Per head antibody in red in J) and mPer-45-myc (detected by anti-myc antibody in green in K) in SW13 vim cells revealed that mPer-45 shifts from a non-filamentous state to integrate with the mPer-58 to form a heteromeric network (arrowheads). Non-filamentous mPer-58 (arrow) can be observed in the co-transfected cell (L). Bar: 20 µm. 77

mPer-58 cDNA. Expression of these constructs confirmed that the c-myc tag did not interfere with the assembly characteristics of either mPer-58, which formed proper filament networks (Figure 3.4.iv, G), or mPer-45, which gave diffuse labelling (Figure 3.4.iv, H). We have shown that in the absence of mPer-45, mPer-58M86L forms irregular filament networks (Figure 3.4.iii, A and B; Figure 3.4.iv, I); we have also shown that mPer-45 is assembly incompetent, unable to form a homomeric network (Figure 3.4.i, D; Figure 3.4.iv, H). We, therefore, attempted to rescue the mPer-58M86L phenotype by reconstituting with mPer-45 in a co-transfection that would restore the normal isoform profile seen in Per-58 cDNA-expressing SW13 vim (-) cells and peripherin immunoblots of neuronal tissue (Figure 3.4.iv, J-L). Indeed, co-expression of mPer-45 with mPer- 58M86L generated robust filament networks that integrated both the Per-58 and Per-45 isoforms (Figure 3.4.iv, L, arrowheads). Similarly, as shown in Figure 3.4.iv, C, a small pool of apparently non-assembled mPer-58 was revealed using the Per-head antibody (Figure 3.4.iv, L, arrow), indicating that a predetermined isoform ratio may be rate limiting in normal filament formation and network assembly. Collectively, these results show that not only does Per-45 integrate to form a normal peripherin network in SW13 vim (-) cells, but also its expression is a pre-requisite to establishing the normal cellular distribution of these networks.

Peripherin expression is characterized by tissue-specific isoform ratios Considering the importance of peripherin isoform expression in filament formation and that Per-58 and Per-45 expression appear interdependent towards establishing normal filament networks, we wanted to determine the extent of this expression in tissue representing different neuronal regions. Labelling of immunoblots of TX-100 extracts (soluble and insoluble fractions) with polyclonal peripherin antibody reveal that Per-45 is constitutively expressed in different brain, spinal cord, and PNS regions (Figure 3.4.v, A). Per-58 and Per-45 were almost completely present in the TX-100 insoluble fractions, with a relative lack of appearance in the TX-100 soluble fractions, indicating that they are integrated within higher polymeric structures. Interestingly, although Per-58 and Per-45 isoforms are 78 A Brain Spinal cord PNS

Cortex HippocampusSeptum Striatum OlfactoryCerebellum bulb BrainstemCervical ThoracicLumbar Sacral Sciatic nerveDRG GastrocnemiusLiver Insoluble Per 61.0 Per-58 47.5 Per-45

61.0 47.5 Soluble Per

GAPDH B * *

100 Per-58 Per-45

75

50 (Per-58:Per-45)

Relative Isoform Ratio 25

0

DRG Cortex Sacral Septum Lumbar Striatum CervicalThoracic Brainstem Cerebellum Sciatic nerve Hippocampus Olfactory bulb

Figure 3.4.v Western Blot Analysis of Peripherin Isoform Expression in Different Neuronal Tissues. (A) TX-100 insoluble/soluble preparations from various regions of the brain, spinal cord, and PNS, as well as the gastrocnemius muscle and liver, were probed by immunoblotting with polyclonal peripherin antibody and monoclonal glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody. Here, mPer-58 and mPer-45 were detected in all neuronal regions but with tissue-specific differences in the expression levels of each isoform. Other, as of yet, undefined peripherin species were consistently observed in certain tissues (hollow arrows). (B) Significantly higher levels of mPer-45 relative to mPer-58 were observed in the cortex, cerebel- lum, and hippocampus; conversely, mPer-58 was significantly higher relative to mPer-45 in the brainstem and regions of the spinal cord; other regions demonstrated similar levels of mPer-58 and mPer-45 isoform expression [sciatic nerve and dorsal root ganglia (DRG)]. Quantitation was performed on insoluble fractions only as the signal in many cases was below the level of detection in the soluble fractions. Bars represent standard error mean (SEM); * = p < 0.005. 79

constitutively expressed (Figure 3.4.v, A, arrows), the relative level of expression of each isoform is tissue-specific. We further quantified peripherin as a ratio of isoform expression (n = 3-4; Figure 3.4.v, B). Unexpectedly, Per-45 was the predominate peripherin isoform expressed in most regions of the brain, being significantly higher in the cortex, cerebellum, and hippocampus (p < 0.05), whereas Per-58 was the predominant species expressed in the brainstem and the spinal cord (cervical, thoracic, lumbar, sacral; p < 0.05), with approximate equivalent levels of Per-58 and Per-45 expression occurring in the sciatic nerve and DRG (Figure 3.4.v, A and B). Other peripherin species were also consistently detected in a tissue-specific manner, notably the hippocampus, sacral region of the spinal cord, sciatic nerve, and DRG (Figure 3.4.v, A, hollow arrows), suggesting that, as of yet, other undefined peripherin isoforms may further contribute to peripherin expression and an isoform ratio. Taken together, we have shown that Per-45 is broadly expressed across different regions of the nervous system and that Per-58:Per-45 isoform ratios shows regional specificity.

3.5 DISCUSSION The constitutive, and most typically described, peripherin isoform expressed from the peripherin gene is Per-58, which is encoded by all nine exons of the gene (Thompson & Ziff 1989, Parysek et al. 1991, Karpov et al. 1992). Here, we have identified a novel human and mouse peripherin isoform, designated Per-45, that is generated by translation from an internal initiation codon downstream from the canonical ATGSTART that generates Per-58. Alternative translation is in-frame and takes place at initiation codons hATG2 and mATG3, corresponding to human Met82 and mouse Met86 amino acid positions located just short of coil 1A, to generate a 5’ truncated protein lacking most of the N-terminal head domain. The potential use of an alternative initiation codon to generate a peripherin species of ~45 kDa was previously described in rat, however, this was dismissed as a non-preferred translation initiation site that is normally suppressed in the presence of the intact ATGSTART and with no physiological relevance (Cui et al. 1995, Ho et al. 1995). However, we have shown that this species is not only a constitutively expressed peripherin isoform in both human and mouse, but is also a pre-requisite for the establishment of normal filament networks. 80

Peripherin is a neuronally expressed type III IF protein and has the same tripartite structure common to all types of IF proteins, comprising of a predominantly α-helical rod domain flanked by non-α helical N-terminal head and C-terminal tail domains (www.interfil.org) (Steinert & Roop 1988). The rod domain is highly conserved between different IF proteins, and is subdivided into four coil domains (1a, 1b, 2a and 2b) that are joined together by three non-α-helical linker sequences (L1, L12, L2) (Steinert & Roop 1988). In contrast, the N- and C-terminal domains vary in size and composition between different IF proteins, imparting functional specificities through interactions with neighbouring filaments and other elements of the cell (Fuchs & Cleveland 1998). As with the other type III IF proteins, vimentin, desmin and glial fibrillary acidic protein, peripherin is able to self-assemble to form homopolymeric filaments, or to co-assemble with other types of IF protein, specifically the type IV neurofilament proteins, NF-L, NF- M and NF-H, to form heteropolymers (Parysek et al. 1991, Cui et al. 1995, Beaulieu et al. 1999b). Filament assembly is dependent on the integrity of the rod and N-terminal tail domains whereas the C-terminal domain, although dispensable for filament assembly per se, is thought to specify filament diameter and to regulate the lateral spacing of filaments (Ho et al. 1998a, Kreplak et al. 2004). Although peripherin is considered a homopolymer, formed by the self-assembly of a single polypeptide, Per-58 (Cui et al. 1995), here we have shown that an additional isoform, Per-45, is constitutively expressed together with Per-58 from the corresponding human and mouse cDNAs. As such, expression of Per-58 cDNA in SW13 vim- cells led to the formation of filament networks that were comprised of both Per-58 and Per-45. The stoichiometric contributions of Per-58 or Per-45 to the formation of filaments could not be assessed due to variations in the levels of expression from cell to cell. In addition, not all Per-58 protein expressed in these cells was integrated within the filament network, as non-assembled, potentially ‘surplus’ Per-58 could be detected with the Per-head antibody. As expected, Per-45 expressed alone was incapable of filament assembly, consistent with the fact that Per-45 lacks almost the entire N-terminal head domain. It was anticipated that Per-58, which has all the structural domains necessary for filament formation, would form normal filament networks in the absence of Per-45. Surprisingly, however, although able to self-assemble, Per-58 was unable to establish normal filament 81

networks, instead appearing as non-elongated squiggles or as irregular filamentous bundles that were easily distinguishable at the immunocytochemical level. In many cells, the filamentous phenotype was not discernible, but rather appearing as dense, compact inclusion bodies. Although it is possible that the human M82L or mouse M86L missense mutations, which preclude expression of Per-45 from the respective Per-58 cDNAs, may in themselves contribute to the disruption of filament assembly, this is unlikely as leucine was specifically selected for its structural similarity to methionine. Moreover, the Per-58 phenotype could be rescued by the co-expression of Per-45. These findings indicate that a normal peripherin filament network is dependent on the co-expression of both self- assembly competent (Per-58) and incompetent peripherin isoforms (Per-45), thus precluding the requirements of domain motifs as the exclusive determinants of the establishment of normal filament networks. A similar situation occurs for the neurofilament subunits, which are obligate heteropolymers, requiring the co-expression of NF-L together with either NF-M or NF-H to form filaments (Ching & Liem 1993, Lee et al. 1993). However this is the first report of such a requirement existing for a type III IF protein. Furthermore, although deletion mutants lacking the N-terminal head domains have been shown to integrate normally within pre-existing wt filament networks (Albers & Fuchs 1989, Raats et al. 1990, Chen & Liem 1994), this is the first time, to our knowledge, that a constitutively expressed ‘headless’ IF subunit has been shown to be required for establishment of normal filament networks. Per-45 exhibited broad expression throughout a variety of neuronal tissues. As Per-45 lacked a unique epitope necessary for categorical identification, the identity of Per-45 in neuronal tissues was based on its electrophoretic mobility on SDS- polyacrylamide gels and its lack of recognition by the Per-head antibody on immunoblots (not shown). Interestingly, there appeared to be regional heterogeneity in the Per-58:Per- 45 isoform ratio across different tissues, with Per-58 the predominant species expressed in the spinal cord and brainstem, and Per-45 the major peripherin species in regions of the brain. Per-45 was found mainly in the TX-100 insoluble fractions in these regions, indicating that it had assembled to form higher order structures (Soellner et al. 1985), presumably with the low levels of Per-58 that are present, or potentially with neurofilaments and/or α-internexin. However, whether Per-45 can co-assemble with 82

these other nIF types remains to be established. It is interesting to speculate why Per-45 is the major isoform expressed in the brain. It has recently been found that Akt, a serine/threonine protein kinase critical to the survival and regeneration of injured neurons, interacts with the N-terminal head domain of peripherin, phosphorylating Ser 66 (Konishi et al. 2007). Although the functional relevance of phosphorylation of peripherin by Akt is unknown, it is increasingly recognized that IF proteins are important mediators of cell signalling (Paramio & Jorcano 2002, Kim & Coulombe 2007). In this regard, it is evident that Per-45, which lacks the N-terminal head domain, would not be able to mediate Akt signaling and that this may have special significance in the brain versus the spinal cord and PNS. Per-45 represents the fourth peripherin isoform reported in mouse (with Per-58, Per-56, Per-61) (Landon et al. 1989, Landon et al. 2000, Robertson et al. 2003, Ko et al. 2005) and the second in human (with Per-58). Thus, in addition to alternative splicing, internal translation initiation serves as a physiologically relevant means of increasing the coding capacity of the peripherin gene. The requirements for Per-45 as a functionally divergent protein from Per-58 may be understood by assessing the context surrounding internal translation initiation. Factors influencing translation efficiency may account for peripherin isoform differences, as the nucleotide sequence surrounding ATGSTART contains a better Kozak consensus sequence for initiation of translation than other potential initiation sites (Kozak 1986, Ho et al. 1995). Although predicted to be less efficiently translated, the Kozak sequence surrounding the ATG codon that generates Per- 45 is conserved among mammals (TTCTCCATGG). The high degree of sequence similarity near these downstream initiation codons implies a functional role for this region, suggesting evolutionary-defined mechanisms for the selective translation of Per- 45, whose expression may be regulated by cis- and/or trans-acting elements important in the ribosomal scanning mechanism (Standart & Jackson 1994, Kindler et al. 2005). Such mechanisms for internal translation may help to explain a growing list of human diseases wherein fundamental complications vis-à-vis mutations, polymorphisms, alternative splicing, and trans-acting factors alter the normal ribosomal scanning mechanism to favour translation from a downstream ATG codon (Kozak 2002a). These changes in translation are often associated with either a disruption in the functioning of the 83 predominate isoform and/or the generation of abnormal protein variants (Kozak 2002b). In the current study, we identify peripherin among a growing list of genes that produce a second, shorter version of the encoded protein that have different functional effects. Importantly, we have been able to show that a change in peripherin translation is associated with changes to the peripherin phenotype. Since Per-45 is a normally expressed isoform that seems to require coupling to the Per-58 isoform to become integrated within a filament network, changes in the normal translation mechanism would be detrimental to proper cytoskeletal structure and may become pathologically relevant. Indeed, disruptions in both cytoskeletal stabilizing elements and IF variants that change the normal isoform ratio are associated with several neurodegenerative disorders (Houseweart & Cleveland 1999, Spillantini et al. 2000, Omary et al. 2004, Gallo et al. 2005). 84

CHAPTER 4

DISTINCT BIOCHEMICAL SIGNATURES CHARACTERIZE PERIPHERIN ISOFORM EXPRESSION IN BOTH TRAUMATIC NEURONAL INJURY AND MOTOR NEURON DISEASE.

The content of this chapter is in preparation to be submitted as a research manuscript: McLean, J.R., Liu, S. Miletic, D., Weng, Y.C., Kriz, J. and Robertson, J. (2008) Distinct biochemical signatures characterize peripherin isoforms in both traumatic neuronal injury and motor neuron disease.

Mr. Jesse McLean performed 80% of the experiments and drafted the manuscript; Dr. Shirley Liu performed the immunoprecipitation of Per-61; Ms. Denise Miletic provided assistance during sciatic mouse surgery; and Drs. Jasna Kriz and Yuan Cheng Weng (Université Laval, QC, Canada) performed the MCAO surgery. 85

4.1 ABSTRACT Peripherin is a type III intermediate filament protein that is upregulated during neuronal injury and is associated with pathological inclusions present within motor neurons of patients with ALS. The relationship between these inclusions and their protein constituents remains largely unknown. We have previously found that peripherin expression is characterized by tissue-specific, intra-isoform associations that contribute to filament structure; changes to the normal expression pattern of these isoforms is associated with malformed filaments and intracellular inclusions. Here, we profile peripherin isoform expression and ratio changes in traumatic neuronal injury, transgenic animal models of motor neuron disease, and ALS. Extensive western blot analyses of TX-100 soluble and insoluble fractions among these tissues revealed significant changes in peripherin isoform content, which could be differentiated by electrophoretic banding patterns to produce distinct peripherin biochemical signatures. Significantly, we identified that the pattern of peripherin expression in ALS most closely approximates that of peripherin overexpressing mice, but differs in inter-individual variations of isoform- specific expression. Overall, these results provide important insights into complex post- transcriptional processes that may underlie a continuum between peripherin-mediated neuronal repair and its role in the pathogenesis of motor neuron disease. 86

4.2 GENERAL INTRODUCTION Peripherin is a member of the type III class of IF proteins that are expressed predominantly in the PNS, and, to a lesser extent, in select neuronal populations of the CNS, particularly those with efferent projections (Parysek & Goldman 1988, Brody et al. 1989, Escurat et al. 1990, Rhrich-Haddout et al. 1997). Peripherin assembly and organization into mature cytoplasmic networks is a dynamic process that occurs through a series of sequential and overlapping stages through dimers, tetramers, and protofilaments to form 10-12 nm-wide mature filaments (Herrmann et al. 2007, Goldman et al. 2008). These complex, multistep processes are dependent upon variations in IF stoichiometry; for example, peripherin is capable of homopolymeric self-assembly or will integrate with other IFs to form heteromeric filament networks (Parysek et al. 1991, Cui et al. 1995, Beaulieu et al. 1999b, Xiao et al. 2006). While the precise biological function of peripherin remains unclear, peripherin is upregulated in response to traumatic neuronal injury, such as axotomy and focal lesioning (Oblinger et al. 1989b, Troy et al. 1990, Wong & Oblinger 1990, Beaulieu et al. 2002, Kriz et al. 2005), and in ALS (Robertson et al. 2003, Strong et al. 2004, Xiao et al. 2008) suggesting a capacity to participate in both regenerative and degenerative conditions. Significantly, peripherin is a component of the characteristic pathological inclusions present within affected motor neurons in ALS (Corbo & Hays 1992, Migheli et al. 1993, Wong et al. 2000, He & Hays 2004, Xiao et al. 2008) and mutations within the peripherin gene may be responsible for a small percentage of ALS cases (Gros-Louis et al. 2004, Leung et al. 2004). Understanding the role of peripherin may lie partly in the recognition that peripherin is capable of forming intra-isoform associations (see Chapter 3). Peripherin expression is unique among other neuronal IFs in that it is characterized by the generation of distinct protein isoforms that arise from alternative splicing or translation. In addition to the predominately expressed peripherin isoform, Per-58, which is encoded by all nine exons of the gene to generate the full-length ~58 kDa product, two isoforms have been reported in human (Per-28 and Per-45) (see Chapter 3, Xiao et al. 2008) and three in mouse (Per-45, Per-56, and Per-61) (see Chapter 3, Landon et al. 2000, Robertson et al. 2003). Although the precise role of these isoforms is unclear, Per-58, Per-56, and Per-45 87

associate to form filamentous networks, while Per-61 and Per-28 are abnormal splice variants that induce peripherin aggregation in vitro and are associated with intracellular inclusions found in mtSOD1 mice and in ALS, respectively. We have recently established that the co-expression of these isoforms, notably Per-58 and Per-45, constitute an intra-isoform ratio that is associated with the structural integrity of peripherin filament networks; changes to the normal expression pattern of these isoforms are associated with malformed filaments and intracellular inclusions (see Chapter 3, Xiao et al. 2008). Moreover, peripherin isoform expression exhibits regional variation, with, for example, Per-45 being the predominate species in the brain, while Per-58 is the major species in the spinal cord (see Chapter 3). Because peripherin expression is associated with the generation of functionally- distinct isoforms, and that disruptions to the isoform ratio and/or the generation of abnormal variants are capable of altering filament network properties, we investigated whether peripherin isoform changes could be observed in response to neuronal injury, in different mouse models of motor neuron disease, and in ALS. Here, we are able to consistently distinguish between normal, injurious, and disease-associated conditions by isoform-specific patterns of peripherin expression; as such, we have termed these distinct patterns ‘biochemical signatures’, with the profile of the signature changing depending on the context of injury or disease. These results provide important insight into complex post-transcriptional processes that may underlie a continuum between peripherin- mediated neuronal repair and the development of disease.

4.3 MATERIALS AND METHODS Animals and Tissue Preparation. All experimental and surgical procedures were performed in accordance with the Canadian Council on Animal Care Guidelines. Mice were housed at the Division of Comparative Medicine at the University of Toronto (Toronto, ON, Canada) with ad libitum access to water and food. Colony lighting followed a full spectrum 12/12 h light/dark cycle with the onset of lights at 0800 h. The mice in this study have been characterized previously: wt C57BL/6 mice were acquired from Charles Rivers Laboratories (St. Constant, QC); Per and Per;L-/- transgenic mice overexpressing peripherin (Beaulieu et al. 1999) were previous gifts 88

provided by Dr. Jean-Pierre Julien (Université Laval, Quebec City, QC); and mtSOD- 1G93A mice were acquired from Jackson Laboratories (Bar Harbor, ME). Transgenic lines were distinguished from non-transgenic littermates by PCR of mouse tail cDNA with the following primers: for Per mice, 5’- ATGGCCGAGGCCCTCAACCAAGAG (sense) and 5’- TAGGCGGGACAGAGTGGCGTCGTC (antisense); for NF-L knockout, 5’- GAAGCCGAGCTGTTGGTGCTG (sense) and 5’-TGGATCTGAGCCTGCAGCTCG (antisense); and for mtSOD1G93A mice, 5’-CATCAGCCCTAATCCATCTGA (sense) and 5’-CGCGACTAACAATCAAAGTGA (antisense). PCR was performed using Pfu DNA Polymerase (Stratagene) in standard reagent conditions, with an initialization step at 94°C for 4 min, then 25 cycles at 94ºC for 30 s, 60ºC for 30 s, and 72ºC for 1.5 min, followed by a final extension at 72ºC for 10 min. Human neurological control (NC) and ALS tissues were kindly provided by Drs. Juan Bilbao and Lorne Zinman of the ALS and Neuromuscular Clinic at Sunnybrook Health Sciences Centre (Toronto, ON) (see Appendix I, Supplemental Findings, A3). Lumbar spinal cord was provided embedded in Tissue-Tek Optimal Cutting Temperature Compound (Sakura Finetek USA Inc., Torrance, CA) kept frozen at -80°C. For protein extraction, lumbar sections corresponding to ~100 mg were cut at -20°C by cryostat. Sciatic Crush. Male, wt C57BL/6 mice (3-4 months-of-age; n = 7; 4 crush and 3 sham) were anaesthetized with 1-1.5% isoflurane in 70% nitrous oxide (N2O) and 30% oxygen. The left sciatic nerve was exposed 2 mm distal to the sciatic notch and axonotmesis achieved by crush using a non-serrated haemostat for 30 s. In sham- operated mice, the nerve was exposed, but not crushed. The muscle and skin were immediately closed using nylon suture and analgesic was administered (buprenorphine, 0.1 mg/kg, subcutaneously). All animals recovered uneventfully and were euthanized on

postoperative day 14 by CO2 inhalation followed by cervical dislocation. Middle Cerebral Arterial Occlusion. Male, wt C57BL/6 mice (3-4 months-of- age; n = 3) were anaesthetized with ketamine/xylazine (100/20 mg/kg, intraperitoneally) and underwent unilateral transient focal cerebral ischemia by middle cerebral arterial occlusion (MCAO) for 1 hr, followed by a 72 hr reperfusion period and then euthanized by CO2 inhalation followed by cervical dislocation (Belayev et al. 1999, Lalancette- 89

Hebert et al. 2007). Briefly, the left common carotid artery and ipsilateral (IP) external carotid artery (ECA) were exposed through a midline neck incision and isolated from surrounding nerves and fascia. The distal ECA and its occipital artery branches were dissected and coagulated, along with the terminal lingual and maxillary artery branches. The internal carotid artery (ICA) was isolated and separated from the adjacent vagus nerve, while the pterygopalatine artery was ligated close to its origin with a 5-0 nylon suture. The ICA was isolated and carefully separated from the adjacent tissue and a 12- mm-long 6-0 nylon monofilament coated with silicon was inserted via the proximal ECA into the ICA, and thence into the Circle of Willis, thus, occluding the middle cerebral artery. The extent and reproducibility of the infarct has been previously verified using a 2% solution of 2,3,5-triphenyltetrazolium chloride (tetrazolium red stain; Sigma-Aldrich, Inc.) (Lalancette-Hebert et al. 2007, Weng & Kriz 2007). Control tissue for the focal ischemia were the non-ischemic, contralateral brain hemisphere (CS) of operated animals. Immunoblotting. For enrichment of neuronal IFs from human or mouse, ~50-100 mg of lumbar spinal cord, sciatic nerve, or brain were homogenized at 4ºC in low salt extraction buffer [50 mM Tris (pH 7.5), 150 mM NaCl, 5 mM EDTA, and protease inhibitors (P-8340; Sigma-Aldrich, Inc)]. The homogenates were then centrifuged at 16,000 g for 10 min at 4ºC. The pellet fractions were further homogenized in high salt (HS) Triton X-100 (TX-100) extraction buffer [20mM Tris-HCl (pH 7.5), 750 mM NaCl, 1mM EDTA, 1% (v/v) TX-100, and protease inhibitors (P-8340; Sigma-Aldrich, Inc)] centrifuged at 16,000 g for 10 min at 4ºC. The resultant pellets were treated to a final homogenization in high salt buffer containing 1 M sucrose and re-centrifuged to remove contaminating lipids. The final pellet was solubilized in 2% (w/v) SDS in PBS. Sample protein concentration was measured using the bicinchoninic acid assay and then diluted in 2x loading buffer [160 mM Tris-HCl (pH 6.8), 30% (w/v) glycerol, 4% (w/v) SDS, 10% (v/v) β-mercaptoethanol and 0.02% (w/v) bromophenol blue] and boiled for 5 min. Loadings of 10-15 µg and 20-30 µg were routinely analysed on 10% SDS-polyacrylamide gels and then blotted to PVDF membranes. For comparison of TX- 100 soluble versus insoluble fractions, equal volumes of sample were used. For immunoblotting, membranes were blocked with 3% (w/v) skimmed milk powder in TBS 90

containing 0.2% (v/v) Tween-20 for 1 hr at room temperature, then incubated with the polyclonal peripherin antibody (AB1530, Chemicon International Inc.) or Per-28 antibody (Xiao et al. 2008) diluted 1:5000 and 1:3000, respectively, in the blocking solution overnight at 4°C. A polyclonal neuron specific enolase (NSE) antibody (16625; Polysciences, Inc., Warrington, PA) and a monoclonal NF-M antibody (N 5264; Sigma- Aldrich, Inc.), both diluted 1:5000, were used as internal loading controls depending on the experimental paradigm. Antibody binding was revealed using HRP-conjugated anti- rabbit or anti-mouse IgG, diluted 1:5000 in blocking solution, and visualized with an ECL detection system (PerkinElmer LAS, Inc., Boston, MA). ECL membranes were developed to Kodak BioMax XAR film (Eastman Kodak Co., Rochester, NY) and equivalent exposure times compared for analysis. Immunoprecipitation: Lumbar spinal cords of male, wt C57BL/6 and mtSOD- 1G93A mice (2-4 months-of-age; n = 3 per age group) were homogenized in a 10x mark-up of radioimmunoprecipitation assay buffer (RIPA) [50 mM (v/v) Tris-HCl, pH 7.5, 150 mM (w/v) NaCl, 1% (v/v) NP-40, 0.25% (v/v) Na deoxycholate, 1 mM (v/v) EDTA, 0.1% (w/v) SDS] containing protease inhibitors (11697498001, Roche Diagnostics, Indianapolis, IL, USA) and centrifuged at 15,000 g for 15 min at 4°C. Supernatants represented the soluble fractions and protein concentrations were determined by bicinchoninic acid assay. 5 mg of protein from the soluble fractions were incubated with 10 µl of rabbit polyclonal Per-61 antibody (Robertson et al. 2003) and 20 µl of 50% (w/v) Protein A-Agarose (Sigma-Aldrich, Inc.) overnight at 4°C. Immunoprecipitates were eluted with 2x SDS sample buffer [100 mM Tris-HCl pH 6.8, 4% (w/v) SDS, 20% glycerol (v/v), 0.2% (w/v) bromophenol blue, 8% (v/v) β-mercaptoethanol] and separated by 10% SDS-polyacrylamide gel. After transferring to PVDF membrane, the blot was blocked in 5% milk-TBS with 0.2% Tween-20 and then incubated with chicken polyclonal peripherin antibody (AB39374; Abcam Inc., Cambridge, MA) diluted 1:5000 in blocking solution, followed by secondary anti-chicken IgG-horse-radish peroxidase diluted 1:5000 (Sigma-Aldrich, Inc.). Peripherin was visualized with an ECL detection system (PerkinElmer LAS, Inc.) and developed to Kodak BioMax XAR film (Eastman Kodak Co.). Total SW13 vim (-) lysates transfected with Per-61 cDNA were used as positive controls (Robertson et al. 2003). A separate blot loaded with 0.05% of the 91

supernatant input was probed with the same chicken polyclonal peripherin antibody as above (1:5000 dilution) to show equalization of the samples used for immunoprecipitation. Quantification and Statistical Analysis. To quantitate peripherin isoform expression, immunoblots of TX-100 preparations probed with peripherin antibody were scanned and exported to ImageJ software (National Institutes of Health) for analysis. Using the integrated density function after background subtraction, we measured the sum of the pixels from the electrophoretic bands corresponding to Per-58, Per-45, or other detectable peripherin species, and divided these values by the sum of the pixels representing the internal loading controls (NSE or NF-M) to obtain relative isoform- specific levels. Isoform ratios were calculated by dividing the integrated density value of each isoform by the summed total of these isoforms, thus providing the percentage contribution of each isoform to the total isoform content. To avoid omitting any weakly expressed bands from underexposed blots, longer photo development and/or greater protein loadings were further analysed and statistically validated; where applicable, bands below relevant detectable limits are indicated (nd). Statistical tests were done with Prism 4.0 software (GraphPad). For comparisons of the changes in peripherin isoform expression we used the unpaired Student T-test with p < 0.05 considered significant. To measure changes in the isoform ratio, we used one-way analysis of variance (ANOVA) and Tukey’s post-hoc with p < 0.05 considered significant.

4.4 RESULTS Peripherin isoform expression and ratio changes distinguish between traumatic neuronal injury in the CNS and PNS. The effect of sciatic nerve crush and transient focal ischemia on the expression of peripherin has been previously evaluated by in-situ hybridization and (Oblinger et al. 1989b, Troy et al. 1990, Wong & Oblinger 1990, Beaulieu et al. 2002). As such, it has not been possible to ascertain peripherin isoform changes relative to the overall expression changes observed after traumatic neuronal injury. Moreover, because we recently reported tissue-specific differences in the expression of several peripherin isoforms (see Chapter 3), we wanted to examine whether 92

peripherin isoform and ratio changes could be observed after traumatic neuronal injury in both the CNS and PNS. Sciatic crush: The expression of peripherin isoforms was evaluated after sciatic nerve crush on post-operative day 14 between sham- and crush-operated wt C57BL/6 mice; at this time, maximal levels of peripherin expression have been reported (Oblinger et al. 1989b, Troy et al. 1990). TX-100 insoluble and soluble protein fractions of the sciatic nerve were assessed by Western blot with polyclonal peripherin antibody and normalized against NF-M; here, we used NF-M to control for neuronal specificity as a previous report has indicated no effect of sciatic axotomy on NF-M mRNA levels (Troy et al. 1990) In the insoluble fraction (Figure 4.4.i, A), isoform-specific expression of Per-58 and Per-45 (dark arrows), as well as other detectable peripherin species of ~135 and ~50 kDa (hollow arrows), remained unchanged between sham- and crush-operated mice. In the soluble fraction, however, peripherin expression was increased in the crush-operated mice (Figure 4.4.i, B) for Per-58 and Per-45 (dark arrows), as well as for other higher- molecular weight species of ~135, ~100, ~80 kDa (hollow arrows). Quantitative analysis of these changes, relative to NF-M expression, did not identify any significant changes in isoform-specific expression in the insoluble fraction of sham- and crush-operated mice, despite a slight increase in Per-58 (Figure 4.4.i, C, i.). No significant ratio changes were observed between crush- and sham-operated mice (Figure 4.4.i, C, ii.). In the soluble fraction, significant increases (p < 0.001) in Per-58 and Per-45, as well as in other detectable peripherin species, were identified in the crush- operated mice when compared to sham-operated mice (Figure 4.4.i, D, i.). Here, we observed a ~6-fold increase in Per-58; a ~5-fold increase in Per-45; and a ~4.5-fold increase in other, detectable peripherin species. Interestingly, despite increased expression, the isoform ratio was conserved, with no significant changes in the contribution of each isoform to the total isoform content between crush- and sham- operated mice (Figure 4.4.i, D, ii.). MCAO: Transient unilateral focal ischemia was achieved by MCAO for 60 min followed by a 72 hr reperfusion period. TX-100 insoluble and soluble brain homogenates corresponding to the IP hemisphere and the non-operated CS were assessed by Western 93 A Sham Crush (kDa)

135.0

85.0 Insoluble 61.0 fraction Per-58

47.5 Per-45

B 135.0

85.0

61.0 Soluble Per-58 fraction 47.5 Per-45

NFM C i. ii.

D i. ii.

Figure 4.4.i Sciatic Nerve Crush Western Blot Analysis. The sciatic nerve of sham- and crush-operated wild type mice were separated into Triton X-100 insoluble (A) and soluble (B) fractions and assessed by immunoblot probed with polyclonal peripherin and monoclonal medium-weight neurofilament (NF-M) antibodies. Per-58 and Per-45 are present as the major peripherin isoforms in the soluble and insoluble fractions (dark arrows), along with other, unidentified peripherin species of ~135, ~100, ~80, and ~50 kDa (hollow arrows). Densometric analysis of these bands relative to NF-M expression revealed no changes in the insoluble fraction in either isoform-specific expression (C, i) or ratio (C, ii). In contrast, there was significant increases in the soluble isoform-specific expression (D, i), but no change in the ratio (D, ii). Bars represent standard error mean (SEM); For the Student’s t-test: * = p < 0.05 (C, i; D, i). 94

blot with polyclonal peripherin antibody and normalized against NSE; here, we used NSE as an internal loading control to account for neuronal cell death following transient focal ischemia. We have previously identified Per-45 as the predominant peripherin isoform in the mouse brain (see Chapter 3) and, as expected, Per-45 is the major species in both the insoluble CS and IP fractions (Figure 4.4.ii, A, dark arrows). An unidentified peripherin species is also present at ~40 kDa (hollow arrows). In contrast to the soluble IP fraction, Per-58 is the predominate isoform in the CS soluble fraction (Figure 4.4.ii, B). Quantitative analysis of these changes relative to NSE expression identified a significant (p < 0.05) ~4-fold increase in the expression of the ~40 kDa species in the insoluble IP fraction as compared to the CS fraction, while Per-58 and Per-45 remained unchanged (Figure 4.4.ii, B, i.). Interestingly, a major shift in the isoform ratio is observed, whereby the contributions of Per-58, Per-45, and the ~40 kDa species to the total isoform content was significantly altered (p <0.05) in the insoluble IP fraction (Figure 4.4.ii, B, ii.). Here, Per-58 accounts for ~14% of the total isoform content in the IP fraction as compared to ~25% in the CS fraction; Per-45 accounting for ~48% as compared to ~60%; and other peripherin species accounting for ~38% as compared to ~15%. A significant decrease in the expression of soluble Per-58, Per-45, and the ~40 kDa species was observed in the IP fraction as compared to the CS fraction (p <0.05), in which isoform expression was beyond the level of detection (Figure 4.4.ii, C, i.). As some isoforms are not detectable in the soluble fraction, we are unable to provide a complete expression and ratio analysis.

Peripherin transgenic mice show presymptomatic intra-isoform expression and ratio changes in both insoluble and soluble fractions. The selective expression of nIFs that alter the normal nIF stoichiometry in transgenic mouse models is sufficient in several instances to produce neuropathological effects similar to ALS (Cote et al. 1993, Xu et al. 1993, Collard et al. 1995, Zhu et al. 1997, Beaulieu et al. 1999a, Elder et al. 1999, Kriz et al. 2000). Only in peripherin overexpressing mice, however, can selective motor neuron disease with characteristic 95

A MCAO CS MCAO IP (kDa) 61.0 Per-58 47.5 Insoluble Per-45 fraction

B 61.0 Per-58 Soluble 47.5 Per-45 fraction

NSE

C i. ii.

D i.

Figure 4.4.ii Middle Cerbral Arterial Occlusion Western Blot Analysis. The middle cerebral arterial occlusion (MCAO)-treated hemisphere [ipsilateral (IP)] and the contralateral control hemisphere (CS) were separated into Triton X-100 insoluble (A) and soluble fractions (B) and assessed by immunoblot probed with polyclonal antibodies directed against peripherin and neuron specific enolas (NSE). Per-58 and Per-45 are the predominate isoforms in the CS fractions (dark arrows), while an unidentified ~40 kDa band in the IP fraction is upregulated (hollow arrow). Densometric analysis of these bands relative to NSE expression identified a significant increase in only the ~40 kDa insoluble species (C, i), while there was an overall significant shift in the insoluble isoform ratio (C, ii). Analysis of the soluble fraction revealed a significant increase in Per-58 expression (D, i). Bars represent standard error mean (SEM). Fractions with non-detectable peripherin isoforms is indicated by “nd”. For the Student’s t-test: * = p < 0.05 (c, i; d, i). For the analysis of variance (ANOVA) with post-hoc: p < 0.05 for * = Per-58; † = Per-45; # = other (c, ii). 96

pathologies of ALS, including the presymptomatic appearance of IF inclusions, be induced (Beaulieu et al. 1999a). Interestingly, these mice in an NF-L deficient setting, believed to mimic more closely the neuronal IF conditions found in ALS (Bergeron et al. 1994), augment the formation of inclusions and the onset of disease through an unknown mechanism (Beaulieu et al. 1999a). Since we have previously demonstrated the requirements of a peripherin intra-isoform ratio for normal filament assembly, and that deregulation of this ratio is associated with the formation intracellular inclusions (see Chapter 3; Robertson et al. 2003, Xiao et al. 2008) we wanted to examine peripherin isoform expression patterns in presymptomatic Per and Per;L-/- mice. Peripherin isoform expression in wt C57BL/6, Per, and Per;L-/- mice were evaluated at 8-9 months-of-age with no apparent motor dysfunction. TX-100 insoluble and soluble protein fractions of the lumbar spinal cord were assessed by immunoblot with polyclonal peripherin antibody and normalized against NSE; we used NSE as an internal loading control to account for degenerating motor axons in these mice. Per mice: In the insoluble fraction (Figure 4.4.iii, A), isoform-specific expression of Per-58 and Per-45 (dark arrows), as well as unidentified peripherin species at ~50 and ~40 kDa (hollow arrows), were dramatically increased in Per mice as compared to wt mice. In the soluble fraction, peripherin expression was increased (Figure 4.4.iii, B) for Per-58 (dark arrow) in the Per mice, while other isoforms were below the level of detection. As expected, from the transgenic generation of Per mice (Beaulieu et al. 1999a), quantitative analysis of these changes relative to NSE expression identified significant increases (p < 0.05) in isoform-specific expression in the insoluble fraction of Per mice as compared to wt mice (Figure 4.4.iii, C, i.). Here, there was a ~3-fold increase in Per-58 expression; a ~6-fold increase in Per-45 expression; and a ~4-fold expression of other detectable peripherin species. These disproportional increases resulted in significant (p < 0.05) changes to the isoform ratio (Figure 4.4.iii, C, ii.). In Per mice, Per-58 accounts for ~47% of the total isoform content as compared to ~75% in the wt mice; Per-45 accounts for ~29% as compared to ~17%; and other detectable peripherin species account for ~24% as compared to ~8%.

97

A WT Per (kDa) 61.0 Per-58

47.5 Insoluble Per-45 fraction

B 61.0 Per-58 Soluble 47.5 fraction

NSE

C ii. i.

D i.

nd nd

Figure 4.4.iii Peripherin Overexpressing Mice Western Blot Analysis. The lumbar spinal cords of wild-type (WT) and peripherin overexpressing mice (Per) mice were separated into Triton X-100 insoluble (A) and soluble fractions (B) and assessed by immunoblot probed with polyclonal antibod- ies directed against peripherin and neuron specific enolase (NSE). Per-58 and Per-45 are the predominate isoforms present in WT mice (dark arrows) and are visibly up-regulated with the ~50 and ~40 kDa species (hollow arrows). Densometric analysis of these bands relative to NSE expression revealed significant changes in both fractions. In the insoluble fraction, the levels of Per-58, Per-45, and the ~50 and ~40 kDa bands are significantly increased (C, i); these increases resulted in significant alterations to the isoform ratio for all isoforms (C, ii). In the soluble fraction, Per-58 expression was increased (D, i). Bars represent standard error mean (SEM). Fractions with non-detectable peripherin isoforms is indicated by “nd”. For the Student’s t-test: * = p < 0.05 (C, i; D, i). For the analysis of variance (ANOVA) with post-hoc: p < 0.05 for * = Per-58; † = Per-45; # = other (C, ii). 98

In the soluble fraction, only Per-58 was detectable and was significantly increased (p <0.001) ~2.5-fold in the Per mice as compared to wt mice (Figure 4.4.iii, D, i.). As Per-45 and other peripherin species were beyond the level of detection, we are unable to provide a ratio analysis for the soluble fraction. Per;L-/- mice: In the insoluble fraction (Figure 4.4.iv, A), isoform-specific expression of Per-58 and Per-45 (dark arrows) remained unchanged as compared to wt mice, while a third peripherin species at ~50 kDa was increased (hollow arrow). In contrast to the increase in soluble Per-58 in Per mice, soluble Per-58 in Per;L-/- mice was not detected as compared to wt mice (Figure 4.4.iv, B). Quantitative analysis of these fractions relative to NSE expression revealed significant changes in isoform expression and ratios. In the insoluble fraction, a ~6-fold significant increase (p <0.05) in the ~50 kDa species was observed, while Per-58 and Per- 45 remained non-significant, despite a slight increase in Per-45 expression (Figure 4.4.iv, C, i.). These isoform-specific increases are reflected as significant changes (p < 0.05) in the insoluble isoform ratio for Per-58 and the ~50 kDa species; here, Per-58 accounts for ~70% of total isoform content in Per;L-/- mice as compared to ~87% in wt mice and the ~50 kDa isoform accounts for ~14% as compared to 3% (Figure 4.4.iv, C, ii.). In the soluble fraction, a significant (p < 0.001) ~4-fold decrease is observed for Per-58 in the Per;L-/- mice as compared to wt mice, while Per-45 and other peripherin species were beyond the level of detection (Figure 4.4.iv, D, i.); as such, we are unable to provide a complete expression and ratio analysis for the soluble fraction.

Temporal isoform expression and ratio changes in Per-58 of mtSOD-1G93A mice Although the cause of the majority of ALS cases remains unknown, ~5-10% of patients show familial inheritance patterns, of which ~15-20% have been linked to mutations in the gene coding SOD1 (Rosen et al. 1993) Several transgenic lines based on these mutations have been introduced into rodents and produce an adult-onset motor neuron disease through a gain of unknown toxic function (Gurney et al. 1994, Wong et al. 1995, Bruijn et al. 1997, Wang et al. 2002). Peripherin abnormalities are present in mtSOD1 mice, co-associating with NFs within intracellular inclusions in the perikarya and axons of degenerating motor neurons (Beaulieu et al. 1999a, Robertson et al. 2003). 99

A WT Per;L-/- (kDa) 61.0 Per-58 Insoluble 47.5 Per-45 fraction

B 61.0 Per-58 Soluble 47.5 fraction

NSE

C i. ii.

D i.

nd nd

Figure 4.4.iv Per;L-/- Mice Western Blot Analysis. The lumbar spinal cords of wild-type (WT) and peripherin overxpressing/low-weight neurofilament (NF-L) knockout (Per;L-/-) mice were separated into Triton X-100 insoluble (A) and soluble fractions (B) and assessed by immunoblot probed with polyclonal antibodies directed against peripherin and neuron specific enolase (NSE). Per-58 and Per-45 are the predominate isoforms present in WT and Per; L-/- mice (dark arrows) along with a ~50 kDa species in only the Per;L-/- mice (hollow arrows). Densometric analysis of these bands relative to NSE expression revealed significant changes in both fractions. In the insoluble fraction, despite slight increases in Per-45 and the ~50 kDa species, there were no significant changes (C, i). In contrast, the isoform ratio was altered for Per-58, Per-45, and the ~50 kDa species (c, ii). In the soluble fraction Per-58 expression was increased (D, i). Bars represent standard error mean (SEM). Fractions with non-detectable peripherin isoforms is indicated by “nd”. For the Student’s t-test: * = p < 0.05 (D, i). For the analysis of variance (ANOVA) with post-hoc: p < 0.05 for * = Per-58; † = Per-45; # = other (C, ii; D, ii). 100

In the present study, we investigated peripherin isoform expression in both pre- symptomatic and end stage lumbar spinal cords of mtSOD1G93A mice. As these mice display robust neuroinflammation in the presymptomatic stages of disease (Hall et al. 1998, Alexianu et al. 2001, Hensley et al. 2002, Yoshihara et al. 2002), we opted to use NSE as our internal loading control to account for neuronal degeneration, as well as microglial and astrocytic proliferation (Elliott 2001, Hensley et al. 2002, Yoshihara et al. 2002) In the insoluble fraction of presymptomatic mtSOD1G93A mice (Figure 4.4.v, A), Per-58 and Per-45 (dark arrows), as well as a third, unidentified peripherin species of ~50 kDa (hollow arrow), are present in both the wt and mtSOD1G93A mice. Here, there is a noticeable decrease in the levels of Per-58. In the soluble fraction (Figure 4.4.v, B), Per- 58 and Per-45 are minimally visible, while the ~50 kDa species is not detected. Interestingly, an analysis of the insoluble fraction of mtSOD1G93A mice near disease end stage (four months-of-age) revealed that peripherin expression had returned to levels comparable to that of wt mice (Figure 4.4.v, C). The neurotoxic splice variant, Per-61, which arises from the retention of intron four to generate an in-frame 32-amino acid insertion in coil two of the peripherin protein, has been previously identified in mtSOD1G37R mice (Robertson et al. 2003). Here, we looked at the Per-61 expression in both presymptomatic and symptomatic mice. As Per-61 expression was beyond the standard level of Western blot detection in mtSOD1G93A mice, we performed an immunoprecipitation to identify its temporal expression pattern. Per-61 was only seen during the symptomatic stages of the disease and was not present in wt or presymptomatic mice (Figure 4.4.v, D). Quantitative analysis of these fractions, relative to NSE expression, revealed a significant decrease (p < 0.05) in Per-58 in the insoluble (~1.5-fold; Figure 4.4.v, E, i.) and soluble fractions (~1.7-fold; Figure 4.4.v, F, i.). In the insoluble fraction, no changes were observed in Per-45 or the ~50 kDa species, despite a slight decrease in Per-45, and both were beyong the level of detection in the soluble fraction. Despite the change in insoluble Per-58, the isoform ratio was preserved (Figure 4.4.v, C, ii.), while peripherin isoforms beyond detectable limits prevented an analysis of the soluble ratio. Per-61 was

101

A G93A (kDa) WT mtSOD-1 61.0 Per-58 47.5 Insoluble Per-45 fraction

B 61.0 Per-58 Soluble 47.5 fraction Per-45

NSE C mtSOD-1G93A mt SOD-1G93A WT (4 mo) D (kDa) WT 2.5 mo 4 mo Per-61 (kDa) 61.0 Per-58 72.0 47.5 Per-45 55.0 Per-61

NSE Per input

E i. ii.

F i.

nd nd

Figure 4.4.v mtSOD1G93A Mice Western Blot Analysis. The lumbar spinal cords of wild-type (WT) and presymptomatic mtSOD1G93A mice were separated into Triton X-100 insoluble (A) and soluble fractions (B) and assessed by immunoblot probed with polyclonal antibodies directed against peripherin and neuron specific enolase (NSE). Per-58 and Per-45 are the predominate isoforms present in the WT and mtSOD1G93A mice (dark arrows) along with an unidentified ~50 kDa species (hollow arrows). Symptomatic mtSOD1G93A mice were also assessed by immunoblot with the same antibodies (C). An immunoprecipitation of Per-61 identified its presence in symptomatic mtSOD1G93A mice but not WT or presymptomatic mtSOD1G93A mice (D). Densometric analysis of peripherin bands, excluding Per-61, relative to NSE expression revealed significant changes in both fractions. In the insoluble (E, i) and soluble fractions (F, i) of presymptomatic mtSOD1G93A mice, Per-58 was significantly decreased. The isoform ratio in the insoluble fraction was preserved with no significant changes (E, ii). Bars represent standard error mean (SEM). Fractions with non-detectable peripherin isoforms is indicated by “nd”. For the Student’s t-test: * = p < 0.05 (E, i; F, i). 102 not included in the quantitative analysis as its detection was performed by immunoprecipitation.

Significant changes in peripherin isoform-specific expression and ratios in ALS. To identify the pattern of peripherin expression in ALS, TX-100 insoluble and soluble extractions were prepared from ~100 mg of lumbar spinal cord tissue taken from four neurological control cases, four sALS cases, and one fALS case linked to a recently identified mutation in SOD1 (Zinman et al. 2009). The NC cases were comprised of one AD case with Braak pathological stage V/VI, one case of chronic inflammatory demyelinating encephalomyelopathy with features of leukodystrophy, one typical FTD case, one atypical FTD case with motor neuron disease type inclusions but without motor neuron disease (FTLD-U) case, and one undefined chronic neurodegenerative case affecting lower and upper motor neurons without typical ALS pathology (Figure 4.4.vi, A and B, lanes 1-5, respectively). For both ALS and neurological control cases, a neuropathological final diagnosis was made in conjunction with clinical findings; post- mortem intervals did not exceed 12 h for any case. Protein extractions were assessed by Western blot with polyclonal peripherin antibody and normalized against NSE; we used NSE as an internal loading control to account for both neuronal degeneration, and microglial and astrocytic proliferation (Lampson et al. 1990, Kawamata et al. 1992, Rothstein 1995, Schiffer et al. 1996). In the insoluble fraction (Figure 4.4.vi, A), Per-58 and Per-45 (dark arrows), as well as other higher molecular weight species of ~130 and ~50 kDa (hollow arrows), are present in both the neurological control and ALS cases. The aggregate-prone Per-28 isoform (dark arrow) (Xiao et al. 2008) is present in three ALS cases. In each of the ALS cases, there is a noticeable increase in all peripherin isoforms as compared to neurological controls. In the soluble fraction, Per-58 and Per-45 (dark arrows), as well as the ~130 and a ~40 kDa species (hollow arrows), are also elevated relative to neurological controls. Quantitative analysis of these fractions, relative to NSE expression, revealed significant changes in isoform expression and ratio. In the insoluble fraction, Per-58, Per-45, Per-28, and the ~130 kDa and ~50 kDa species were significantly increased (p < 103 A (kDa) NC ALS

~130.0 61.0 Per-58 47.5 Insoluble Per-45 fraction

32.5 Per-28 B ~130.0 61.0 Per-58 Soluble 47.5 Per-45 fraction

NSE 1 2 3 4 5 6 7 8 9 10 C i. ii.

nd

D NC ALS E

nd nd nd

Figure 4.4.vi Neurological Controls and ALS Cases Western Blot Analysis. The lumbar spinal cords of neurological controls (NC) and amyotrophic lateral sclerosis (ALS) cases were separated into Triton X-100 insoluble (A) and soluble fractions (B) and assessed by immunoblot probed with polyclonal antibodies directed against peripherin and neuron specific enolase (NSE). Lanes 1-5 correspond to NC cases, comprised respectively of one Alzheimer’s disease case, a case of chronic inflammatory demyelinating encephalomyelopathy with features of leukodystrophy, two frontotempo- ral dementia (FTD) cases, with one showing atypical pathology (FTDL-U), and one chronic neurodegenerative case affecting lower and upper motor neurons without typical ALS pathology. Lanes 6-10 are ALS cases, with the first four lanes considered sporadic and the last case familial linked to an SOD1 mutation. Per-58, Per-45, Per-28 (dark arrows), and unknown peripherin species of ~130 and ~50 (hollow arrows), are present in NC and ALS, but are visibly up-regulated in ALS. Densometric analysis of these bands relative to NSE expression revealed significant isoform- specific expression changes in both fractions. Isoform-specific expression in the insoluble (C, i) and soluble fractions (D, i) revealed that Per-58, Per-45, and the ~130 and ~50 kDa species were all significantly increased; Per-28 is also visibly increased but select ALS cases. The isoform ratio in the insoluble (C, ii) fraction was significantly changed for Per-58, Per-28, and other species, but not for Per-45. Inter-individual differences of peripherin isoform expression among NC and ALS cases (D). In the soluble fraction Per-58 expression was increased (E). Bars represent standard error mean (SEM). Fractions with non-detectable peripherin isoforms are indicated by “nd”. For the Student’s t-test: * = p < 0.05 (C, i; E). ). For the analysis of variance (ANOVA) with post-hoc: p < 0.05 for * = Per-58; + = Per-28; # = other (C, ii). 104

0.01) in the ALS fractions as compared to neurological controls; here, there is a ~3-fold increase in Per-58, a ~3.4-fold increase in Per-45, and a ~10.5-fold increase in other peripherin species, wile Per-28 is present in lanes 7, 8, and 9 of the ALS cases, but is not detected in neurological controls (Figure 4.4.vi, C, i.). These expression increases are reflected as significant changes (p < 0.05) in the insoluble isoform ratio for all peripherin isoforms, with the exception of Per-45; here, Per-58 accounts for ~37% of total isoform content in ALS cases as compared to ~56% in neurological controls; Per-28 accounts for 9% as compared to 0%; and other peripherin isoforms account for ~32% as compared to 14% (Figure 4.4.vi, C, ii.). Moreover, among ALS patients, different profiles of peripherin expression could be observed (Figure 4.4.vi, D). Here, it is evident that while isoform-specific expression may vary among ALS patients, each demonstrates an alteration in the isoform ratio as compared to neurological controls. In the soluble fraction, there was also a significant increase (p < 0.001) in Per-58 (~4-fold; Figure 4.4.vi, E) in the ALS cases as compared to neurological controls. All other peripherin isoforms were beyond detectable levels in the neurological controls and, thus, we are unable to provide a complete expression and ratio analysis for the soluble fraction.

4.4 DISCUSSION Recent insights into peripherin expression and assembly have revealed complex intra-isoform associations that are tissue-specific and regulated through a number of different post-transcriptional processes, including alternative splicing and translation, nitrotyrosination, and phosphorylation (see Chapter 3; Aletta et al. 1989, Huc et al. 1989, Landon et al. 1989, Konishi et al. 2007, Tedeschi et al. 2007, Xiao et al. 2008). Normal peripherin filament network assembly is dependent on the constitutive interaction of at least two isoforms, Per-58 and Per-45, at defined stoichiometric ratios (see Chapter 3), with other, as of yet uncharacterized isoforms likely to play a role (see Chapter 3; Xiao et al. 2008). While the functional significance of these isoforms remains largely unknown, we have previously shown that by disrupting the normal isoform stoichiometry, through post-transcriptional deregulation or by generating abnormal splice variants, peripherin filament structures become destabilized leading to the formation of intracellular 105

inclusions (see Chapter 3; Robertson et al. 2003, Xiao et al. 2008). Considering that peripherin is thought to play an important role in traumatic neuronal injury and in ALS, and that peripherin filament stability is dependent on intra-isoform associations, we sought to identify whether changes in the expression patterns of peripherin isoforms could distinguish among traumatic neuronal injury, transgenic mouse models of motor neuron disease, and ALS. Here, extensive Western blot analyses of TX-100 soluble and insoluble fractions revealed significant peripherin isoform-specific expression and ratio changes, which could be differentiated by electrophoretic banding patterns to produce distinct biochemical signatures. In addition to the constitutively expressed Per-58 and Per-45 isoforms, as well as the Per-61 and Per-28 isoforms found in mtSOD1 mice and in ALS respectively, we observed other peripherin species in our biochemical profiles, including three minor species of ~130, ~50, and ~40 kDa. While the processing events that generate these additional peripherin species is unknown, they are consistently found within the biochemical signatures of the experimental paradigms employed in this study. The higher molecular weight species of ~130 kDa is likely a disulfide dimer previously identified in rat sciatic nerve and , and dramatically increased after sciatic crush (Chadan et al. 1994). The ~50 kDa species may be the mouse equivalent of a human ~50 kDa isoform that is generated by alternative splicing of exon one by a partial in-frame excision (our unpublished findings). While we are unable to speculate on the origin of the ~40 kDa species, it is unlikely to be the result of proteolytic event as a species of the equivalent molecular weight is generated in SW13 vim (-) cells transfected with the peripherin gene (Xiao et al. 2008). Whether or not the ~40 kDa species is a bona fide isoform or a degradation product remains to be established. Little is known about the relationship between peripherin up-regulation during neuronal injury (Oblinger et al. 1989b, Troy et al. 1990, Terao et al. 2000, Beaulieu et al. 2002, Robertson et al. 2003, Xiao et al. 2008) and its accumulation within pathological inclusions in the cytoskeleton of diseased motor neurons (Corbo & Hays 1992, Migheli et al. 1993, Wong et al. 2000, Robertson et al. 2003, He & Hays 2004, Xiao et al. 2008). The characteristics distinguishing peripherin’s role during these events may be driven partly by the specific sets of peripherin isoforms expressed by injured or diseased 106 neurons. Our previous findings have demonstrated that there are physiological requirements for the production and regulation of different peripherin isoforms. The concomitant expression of both Per-58 and Per-45, is, for example, a prerequisite for normal filament assembly (see Chapter 3), while the abnormal expression of aggregate- inducing isoforms, such as Per-61 and Per-28, is found associated with motor neuron disease (Robertson et al. 2003, Xiao et al. 2008). In addition, recent genetic studies have identified rare peripherin mutations in sALS cases that predict the generation of pathological peripherin isoforms (Gros-Louis et al. 2004, Leung et al. 2004). By examining the electrophoretic distribution of peripherin isoforms in tramautic neuronal injury, animal models of motor neuron disease, and ALS, we provide the first evidence that peripherin expression can be characterized by distinct biochemical signatures. In this study, we characterized the peripherin biochemical signature as a function of three interrelated qualitative or quantitative parameters: (i) the presence or absence of a given electrophoretic band, referred to throughout as isoform-specific expression; (ii) the intensity of protein expression, or isoform expression level; and (iii) the percentage contribution of any given peripherin species to the total isoform content, or isoform ratio. Surprisingly, we found that no two experimental models or ALS cases displayed similar biochemical signatures, suggesting that differences in peripherin isoform expression may reflect distinct functional requirements depending on the context underlying injury or disease. While we are unable to directly infer the specific nature of peripherin expression in these models, several important observations from each paradigm warrant further mention. In both the sciatic crush and MCAO models, there is a general increase in peripherin expression (Oblinger et al. 1989b, Troy et al. 1990, Terao et al. 2000, Beaulieu et al. 2002), however, we identify that these changes are largely attributable to increases in the soluble fraction, which reflects non-filamentous peripherin (Athlan & Mushynski 1997, Athlan et al. 1997). The reason for an increase in non-filamentous peripherin is difficult to assess as both PNS and CNS neurons initiate a stereotyped sequence of events after injury that involves both axonal degeneration and regeneration (Saxena and Caroni, 2007); thus, any increase may reflect a growing demand for soluble precurors to initiate filament assembly, or, conversely, may reflect filament disassembly 107

occurring as a consequence of cytoskeletal fragmentation. It is interesting, however, that that the sciatic crush model did not show a change in the isoform ratio, signifying that the disproportional changes in the MCAO model may reflect differences in the nature of CNS recovery versus PNS recovery after traumatic injury (Vargas & Barres 2007). Peripherin overexpressing and mtSOD1 mice have proven to be invaluable mouse models of motor neuron degeneration, showing age-dependent illness with intracellular inclusions reminiscent of those found in patients with ALS (Bruijn & Cleveland 1996, Beaulieu et al. 1999a). Pathologically, Per, Per;L-/-, and mtSOD-1G93A mice display similar abnormal peripherin accumulations in the perikarya and neurites, but can be distinguished by a variety of other cellular pathologies, as well as disease onset and progression (Beaulieu et al. 1999a, Beaulieu et al. 2002, Lariviere et al. 2003, Robertson et al. 2003). Here, we looked at presymptomatic isoform expression in the lumbar spinal cord of these mice in an attempt to profile any isoform differences. Perhaps the most striking difference between the peripherin overexpressing mice is the contribution of both insoluble and soluble Per-58 relative to the expression of other isoforms. In the Per mice, insoluble Per-58 contributes to roughly half of the total isoform content, while in the soluble fraction, Per-58 is the predominate species. In contrast, insoluble Per-58 in the Per;L-/- mice is the major isoform, but is barely detected in the soluble fraction. How deficiencies in NF-L exert an effect on both soluble and insoluble peripherin isoforms remains unclear, however, our findings suggest that the extent of motor neuron degeneration can be distinguished by unique changes in peripherin intra- and inter- isoform associations, with particular effects on the expression of Per-58. A unique biochemical signature is also identified in mtSOD1G93A mice. Like Per;L-/- mice, overall peripherin expression in presymptomatic mtSOD1G93A mice is decreased, however, mtSOD-1G93A mice are unique in that they generate the neurotoxic, aggregate-prone Per- 61 isoform during the symptomatic stages of the disease (Robertson et al. 2003), suggesting that the Per-61 may arise from alternative splicing defects as a result of disease progression. In lieu of distinct biochemical signatures that distinguish between traumatic neuronal injury and among different mouse models of motor neuron disease, we looked at peripherin isoform expression in ALS. While others have consistently reported 108

upregulated peripherin expression in ALS (Robertson et al. 2003, Strong et al. 2004, Xiao et al. 2008), this study is the first to make distinctions among inter-individual differences in ALS based on isoform expression. Most notably, the ALS biochemical signature, as a group, most closely approximates the biochemical signature of Per mice (save for the expression of Per-28 found in three patients), with significantly disproportional increases in the expression of each isoform. Further examination of each ALS patient revealed at least three biochemical signature “sub-types” were present, with each patient differing in the degree of isoform-specific expression and content. These individual differences highlight the fundamental variability encountered when analysing a complex, heterogeneous disease such as ALS, however, the importance of our observations lie in the recognition that peripherin isoform expression may reflect inter- individual differences in the clinical and pathological course of the disease, and, thus, may be useful as a marker for distinguishing groups of ALS patients. While we are just beginning to appreciate the possible utility of these biochemical signatures, delineating their significance to any variable of disease progression, severity, or aetiology remains elusive. 109

CHAPTER 5

OXIDATION AND NEUROINFLAMMATION, BUT NOT EXCITOTOXICITY, EXERT DIFFERENTIAL EFFECTS ON PERIPHERIN ISOFORM EXPRESSION AND MORPHOLOGY

Jesse R. McLean performed 60% of the experiments; Dr. Shirley Liu performed the LPS- activated microglial supernatant experiments and assisted with maintaining N2a cell cultures; Mr. Steven Doyle (Microscopy Imaging Lab, University of Toronto) prepared the treated cellular pellets for electron microscopy viewing. 110

5.1 ABSTRACT Peripherin, a type III intermediate filament protein, is upregulated during neuronal injury and is found associated with pathological aggregates present within motor neurons of patients with ALS. We have previously identified that peripherin expression is characterized by intra-isoform associations that contribute to filament structure at defined stoichiometric ratios; disruption of this ratio is associated with inclusion formation. Moreover, we have observed distinct biochemical signatures of peripherin isoform expression in traumatic neuronal injury and in motor neuron disease. In our efforts to identify relationships between peripherin isoform expression and inclusion formation, we provide evidence of peripherin isoform ratio changes in an oxidative or proinflammatory environment. Here, two different, dose-dependent peripherin phenotypes are observed:

(i) peripherin aggregation accompanying H2O2 administration; and (ii) increased neuritic outgrowth and growth-cone formation after treatment with LPS-activated microglial (BV2) supernatant. In the former, peripherin ratio changes are found within a unimodal curve of declining and increasing expression, while the generation of two unidentified peripherin species contribute to the ratio change in the latter. Interestingly, glutamate- induced excitotoxicity did not have an effect on peripherin isoform expression, signifying that different cellular stressors may incite peripherin-specific responses. Importantly, in the H2O2 paradigm, no peripherin mRNA changes are found and peripherin immunoreactive aggregates escape protein carbonylation, suggesting that aggregation may serve a physiologically relevant role during oxidative stress.

111

5.2 INTRODUCTION ALS is a devastating late-onset neurodegenerative disorder caused by the selective and progressive death of UMNs and LMNs. While little is known about the cause and propagation of the disease, it is becoming increasingly clear that ALS is the limited phenotypic expression of a heterogeneous group of pathological processes that encompass aspects of protein aggregation (Wood et al. 2003, Kabashi & Durham 2006), oxidative damage (Dupuis et al. 2004, Barber et al. 2006), glutamate excitotoxicity (Van Damme et al. 2005), and neuroinflammation (Moisse & Strong 2006). Studies of the interrelationships between these different pathologies, however, remain sparse. A major neuropathological hallmark of both familial and sporadic forms of ALS is the presence of perikaryal inclusions and axonal swellings immunoreactive for the type III IF protein peripherin (Corbo & Hays 1992, Migheli et al. 1993, Wong et al. 2000, He & Hays 2004). The mechanism underlying the cause of peripherin’s association with these inclusions is unknown, however, may be related to abnormal changes peripherin isoform expression (see Chapter 3, Robertson et al. 2003, Xiao et al. 2008). We have recently identified that normal peripherin expression is characterized by the generation of protein isoforms that associate together in specific stoichiometric ratios to form mature filament networks (see Chapter 3). Perturbations of this ratio, either through disproportional changes in normal isoform-specific expression or through the generation of abnormal splice variants, have been associated with the formation of peripherin inclusions (see Chapter 3, Robertson et al. 2003, Gros-Louis et al. 2004, Leung et al. 2004, Xiao et al. 2008). As a nIF protein, peripherin is thought to play an integral role in the development of the neuronal cytoskeleton and to provide mechanical support to terminally differentiated neurons (Troy et al. 1992, Helfand et al. 2003b). Peripherin expression is a highly regulated process mediated by a number of cis- and trans-acting factors acting throughout the gene region. While little is known about the influence of exogenous factors on normal peripherin expression, a few in vitro studies have identified certain neurotrophins (NGF and FGF) (Portier et al. 1983, Leonard et al. 1987, Parysek & Goldman 1987, Aletta et al. 1988, Leonard et al. 1988, Thompson et al. 1992, Choi et al. 2001) and proinflammatory cytokines (LIF and IL-6) (Sterneck et al. 1996, Lecomte et 112

al. 1998) as transcriptional inducers of peripherin expression. In this regard, it is not surprising that enhanced peripherin expression occurs after traumatic neuronal injury (see Chapter 4, Oblinger et al. 1989b, Troy et al. 1990, Beaulieu et al. 2002, Kriz et al. 2005), however, the nature of this response remains unknown. Considering that peripherin expression is upregulated in ALS (see Chapter 4, Robertson et al. 2003, Strong et al. 2004, Xiao et al. 2008), it is reasonable to suggest that some of the pathological features associated with disease progression may influence peripherin expression. We have observed isoform-specific expression and ratio changes in traumatic neuronal injury, in mouse models of motor neuron disease, including Per, Per;L-/- and SOD-1G93A mice, and in ALS (see Chapter 4); in each, aspects of oxidative stress, neuroinflammation, and glutamate excitotoxicity have been shown to render neurons susceptible to cell death (Hossmann 1994, Cleveland & Rothstein 2001, Robertson et al. 2002, Hensley et al. 2006, Saxena & Caroni 2007). As such, we sought to identify whether in vitro administration of H2O2, glutamate, or LPS-activated microglial (BV2) supernatant could modify peripherin isoform expression and filament morphology.

5.3 MATERIALS AND METHODS and Reagents. Mouse Neuro-2a (N2a) neuroblastoma cells were

maintained at 37 °C under an atmosphere of 5% CO2 in Opti-Modified Eagle’s medium (Opti-MEM, Invitrogen, Carlsbad, CA) supplemented with 10% (v/v) fetal bovine serum

(FBS) and 100 mg/mL streptomycin. H2O2 (30% w/v in PBS, pH 7.4) and glutamate were purchased from Sigma-Aldrich, Inc. An immortalized mouse microglial cell line, (BV2), that exhibits the morphological and functional characteristics of microglia (Blasi

et al. 1990; Bocchini et al. 1992), were maintained at 37 °C and 5% CO2 in RPMI 1640 (Gibco Laboratories, North Andover, MA), supplemented with 10% heat-inactivated FBS and 0.5% penicillin-streptomycin. BV2 cells were allowed to grow to confluence, and then exposed to 1 Ag/ml Escherichia coli 055:B5 LPS (Sigma-Aldrich, Inc.) for 24 hr at which point the supernatant was collected. Cell viability was assessed using the 3-(4,5- dimethylthiazol-2-yl)-2,5,diphenyl-tetrazolium bromide (MTT) assay. Briefly, N2a cells were incubated with MTT (5 mg/mL in PBS; Sigma-Aldrich) for 2 hr at 37 °C and the 113

absorbance at 550 nm determined following solubilization with isopropanol. Doses used in the study were based on previous literature and adjusted to reach a lethal dose of 50%

(LD50) for N2a cells or to illicit a peripherin biochemical change. Oxidative stress was induced by treating N2a cells with 0, 10, 25, 50, 100, 250 and 500 µM of H2O2 for 6 hr. Glutamate excitotoxicity was achieved by treating N2a cells with 0, 0.1, 0.5, 1, 10, 50, 250 mM glutamate (w/v) in PBS for 6 hr. Supernatant from LPS-stimulated microglia supernatant was administered to N2a cells with 0, 10, 100, 250, 500, 1000 ng/mL in PBS for 24 hr. Polymerase Chain Reaction. N2a RNA was extracted using the RNeasy Mini Kit (Qiagen, Germantown, MD) and reverse transcription (RT)-PCR performed using the SuperScript III First-Strand Synthesis System (Invitrogen). Denaturation of RNA (~1

µg) was achieved by incubation at 65 °C for 5 min with a mixture of Oligo(dT)20, 10 mM deoxynucleotide triphosphates (dNTP) mix, and diethyl pyrocarbonate (DEPC)-treated water. Annealing and cDNA synthesis was carried out by incubating a mixture of 10x

RT buffer, 25 mM MgCl2, 0.1 M DTT, RNase OUT, Superscript III RT, and DEPC- treated water at 50 °C for 50 min and then 85 °C for 5 min. RNA was removed by adding 1µL of RNase H at 37 °C for 20 min. PCR amplification was carried out with a Perkin Elmer Gene Amp 2400 PCR System at 62 ºC for 20 cycles for both peripherin [forward: 5’-GACCAGCTTTGCCAGCAG-3’ (exon one); reverse: 5’- CAGTTCTAGGCGGGACAGAG-3’ (exon three)] and GAPDH primer samples (forward: 5’-AACTTTGGCATTGTGGAAGG-3’; reverse: 5’- ACACATTGGGGGTAGGAACA-3’). Briefly, cDNA templates from RT were incubated with GeneAmp Fast PCR Master mix (Applied Biosystems), distilled H2O2, and forward and reverse primers (0.2-0.5 µM). Lane electrophoresis of PCR products was carried out in 0.5x TBE (10x TBE: 1 M Tris, 0.9 M boric acid, 0.01 M EDTA, pH 8.4) at 100 V in 1% agarose gel with ethidium bromide and Orange G loading dye. Immunoblotting. For total protein lysates, cells were harvested in 62.5 mmol/L Tris-HCl, pH 6.8, containing 2% (w/v) SDS and protease inhibitor cocktail (P-8340; Sigma-Aldrich, Inc.). Samples were assayed for protein concentration using the bicinchoninic acid assay and then diluted in 2x loading buffer [160 mmol/L Tris-HCl, pH 6.8, 30% (w/v) glycerol, 4% (w/v) SDS, 10% (v/v) β-mercaptoethanol, and 0.02% (w/v) 114 bromophenol blue] and boiled for 5 min. Loadings of 10-15 µg were analyzed on 10% SDS-polyacrylamide gels and then blotted to PVDF membrane. For immunoblotting, membranes were blocked with 3% (w/v) skimmed milk powder in TBS containing 0.2% (v/v) Tween 20 for 1 hr at rt, then with polyclonal peripherin antibody diluted 1:5000 in the blocking solution overnight at 4 °C. A monoclonal GAPDH antibody (H86504M; Biodesign, Saco, ME, USA), diluted 1:5000 in blocking solution, was used as the internal loading control. Antibody binding was revealed using HRP-conjugated anti-rabbit or anti-mouse IgG and an ECL detection system (NEN Life Science Products). To quantitate the expression of peripherin isoforms in the H2O2-treated condition, immunoblots of total-protein preparations were scanned and exported to ImageJ software (National Institute of Health) for analysis. Using the integrated density function, after background subtraction, we measured the sum of the pixels in either Per-58, Per-56, Per- 45, or other unidentified peripherin isoforms, as a function of GAPDH expression and the control (0 µM) condition. We also measured isoform ratios by calculating the expression level of each isoform and dividing each of these values by the total isoform content. Statistical tests were performed with Prism 4.0 software (GraphPad). For comparisons of the changes in peripherin isoform ratios we used one-way ANOVA and Tukey’s post- test, with p < 0.05 considered significant Immunocytochemistry. N2a cells grown on glass coverslips were washed in PBS (pH 7.4) and fixed in 4 % (w/v) paraformaldehyde for 30 min at room temperature. Cells were rehydrated with PBS and permeabilized with 0.1 % (v/v) TX-100 and 0.1 % (w/v) sodium citrate in PBS. Cells were then blocked for 30 min in 5 % (w/v) BSA with 0.3 % (v/v) TX-100 in PBS at room temperature. Following block, cells were labeled for DNA strand breaks by terminal deoxynucleotidyl transferase (TdT) using the In Situ Cell Death Detection Kit, Fluorescein (Roche Diagnostics, Laval, QC) for 1 hr at 37 °C. For detection of protein oxidation, carbonyl groups were converted into DNP hydrazones by reaction with 1 mg/mL DNPH prepared in 2N HCl for 30 min. Cells were double labeled with rabbit polyclonal peripherin (AB1530; 1:1000; Chemicon) and mouse monoclonal dinitrophenyl (DNP) (D8406; 1:500; Sigma-Aldrich, Inc.) or α- (T9026; 1:1000; Sigma-Aldrich, Inc.) for 1 hr at rt with a rabbit polyclonal peripherin antibody diluted in blocking solution. For antibody detection, cells were labelled for 30 min with mouse and 115

rabbit IgGs conjugated to Alexa Fluors 488 (green) and 594 (red), respectively diluted 1:300 in blocking solution and counterstained with DAPI Nucleic Acid Stain (Invitrogen) diluted 1:100 for 10 min at room temperature. Cells were viewed using a Leica DM6000 digital microscope (Leica Microsystems) and images captured using a Hamamatsu Orca- ER digital camera and Openlab software (Improvision). Chemical and immunochemical controls were used to define carbonyl-specific binding. Chemical reduction of free carbonyls was performed by incubating 500 µM-

treated H2O2 sections with 25 mM sodium borohydride (NaBH4) in 80% (v/v) methanol for 30 min at room temperature before incubation with DNPH (negative control).

Enhanced protein carbonylation was achieved in the 500 µM-treated H2O2 sections

treated with 100 µM FeSO4 (positive control). Immunospecificity of the DNP antibody was assessed by omitting the primary antibody.

Electron Microscopy. Pelleted N2a cells treated with 0, 100, and 500 µM of H2O2 were fixed for 1 hr with 2.5% glutaraldehyde in cacodylate buffer [0.1 M sodium cacodylate [(CH3)2AsO2Na•3H2O]; pH 7.3-7.4] and 5 mM CaCl2 (pH 6.8) at rt and then treated with 0.1% tannic acid in primary fixative for 30 min at rt. Samples were then washed in cacodylate buffer and postfixed in 1% cacodylate-buffered osmium tetroxide for 30 min at room temperature. After several washes with cacodylate buffer, each sample was dehydrated in a graded series of ethanol washes and embedded in Epon- Araldite epoxy resin at 37 °C (SPI Supplies/Structure Probe, Inc., West Chester, PA). Thin sections (80 nm thickness) were cut on a Reichert-Jung E microtome (Leica Microsystems) and collected on electrolytic copper 200 mesh grids (SPI Supplies/Structure Probe, Inc.). Sections were stained with uranyl acetate and lead citrate and examined with a Hitachi H7000 transmission electron microscope (Hitachi High- Technologies Canada, Inc., Toronto, ON) at an accelerating voltage of 75 Kv. For immunogold labeling, pelleted N2a cells were initially fixed in 0.2% glutaraldehyde, 4% (w/v) paraformaldehyde, and 2% (w/v) uranyl acetate in cacodylate buffer for 30 min at rt. Samples were washed and dehydrated as described above and embedded in LR White resin (SPI Supplies/Structure Probe, Inc.) at 45 °C. Thin sections were washed with TBS containing 1% BSA (pH 7.2) and then incubated with rabbit polyclonal peripherin antibody (AB1530; 1:1000; Chemicon) diluted 1:100 in 0.1% (w/v) 116

BSA in 0.1% (w/v) TBS (pH 7.2) overnight at 4 °C. The sections were washed in 0.1% (w/v) BSA in 0.1% (w/v) TBS with 0.1% (v/v) Tween-20 (pH 7.2) on a shaker, followed by a subsequent wash at pH 8.2 (to prevent dissociation of gold particles from the secondary antibody). Control grids omitting the primary antibody were included. The sections were then immersed in goat anti-rabbit IgG conjugated to 10 nm colloidal gold particles (Sigma-Aldrich, Inc.) diluted 1:50 in 1% (w/v) BSA in 0.1% (w/v) TBS for 1 hr. The grids were then washed in 0.1% (w/v) BSA in 0.2% (v/v) TBS with 0.1% (v/v) Tween 20 and washed again, but with 0.05% (w/v) sodium azide added. Thin sections were then fixed in 2.5% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.3) for 10 min at rt, washed in distilled water, and lightly counterstained with uranyl acetate and lead citrate.

5.4 RESULTS Peripherin isoform-specific expression and ratio changes accompany administration of

H2O2 and LPS-stimulated activated microglial supernatant, but not glutamate. We assessed peripherin isoform expression in response to cellular stress,

including oxidation from H2O2 and excitotoxicity from glutamate, as well from the supernatant of LPS-activated BV2 cells as an in vitro model of neuroinflammation. We used the mouse neuroblastoma N2a cell line for it’s robust peripherin expression (Portier et al. 1983, Djabali et al. 1999) and it’s sensitivity to each of the experimental conditions (Van der Valk & Vijverberg 1990, Calderon et al. 1999, Lindegren et al. 2003, Fernaeus

et al. 2005, Pan et al. 2008, Rojo et al. 2008). An LD50 was achieved in both differentiated and non-differentiated N2a cells after administration of ~250-500 µM of

H2O2 and 150 mM of glutamate (n=3; Figure 5.4.i, A, i-ii & iv-v); we were unable to achieve any significant change in cell viability after 1000 ng/mL of LPS-activated microglial supernatant in both differentiated and non-differentiated N2a cells (n=3; Figure 5.4.i, A, iii & vi). Visualization of the corresponding western blots indicated that peripherin expression was changed in both non-differentiated and differentiated conditions (n=3; Figure 5.4.ii, A, i and iv, respectively) and in differentiated N2a cells exposed to LPS-activated BV2 supernatant (n = 3; Figure 5.4.ii, A, vi). No peripherin isoform changes were observed in N2a cells receiving glutamate A LPS-activated N2a cells i. H 0 ii. Glutamate iii. 2 2 BV2 supernatant

Non- Differentiated

iv. v. vi.

Differentiated

Figure 5.4.i N2a Cell Viability After H2O2, Glutamate, and LPS-Activated BV2 Supernatant Administration. (A) MTT assays were performed on non-differentiated and retinoic acid (RA)-induced differentiated N2a cells to determine approopriate dosing strategies for biochemical analysis. A LD50 of N2a cells was achieved for H2O2 and glutamate administration (i-ii and iv-v, respectively), while N2a cells exposed to othw- erise high concentrations of LPS-activated BV2 supernatant were still viable (iii and vi). 117 A LPS-activated N2a cells i. H2O2 ii. Glutamate iii. BV2 supernatant kDa kDa kDa 60 60 60 Non- 47.5 47.5 47.5 Peripherin Differentiated

GAPDH

iv. v. vi. kDa kDa kDa 60 60 60 47.5 Peripherin 47.5 47.5 Differentiated

GAPDH

Figure 5.4.ii Peripherin Protein Expression After H2O2, Glutamate, and LPS-Activated BV2 Supernatant Administration in N2a Cells. (A) Western blot analysis using a polyclonal peripherin and GAPDH antibody was performed on non-differentiated and retinoic acid (RA)-induced differenti- ated N2a cells to determine the effects of H2O2, glutamate, and LPS-activated supernatant on peripherin isoform expression. Changes in peripherin expression are evident in the non-differentiated H2O2 condition (i) and in the differentiated H2O2 and LPS-activated BV2 supernatant conditions (iv and vi, respectively). Surpisingly, LPS-activated BV2 supernatant did not have an effect on peripherin expression in non-differentiated N2a cells (iii), while glutamate did not have any effect on peripherin expression in both non-differentiated and RA-induced differentiated N2a cells (ii and v, respectively). 118 119

(n=3; Figure 5.4.ii, A, ii and iv) or in non-differentiated N2a cells treated with LPS- activated BV2 supernatant (n=3; Figure 5.4.ii, A, iii). While the generation of two unidentified peripherin isoforms at ~50 kDa and ~53 kDa, as well as an up-regulation of Per-45 relative to Per-58, were indicative of changes in differentiated N2a cells treated with LPS-stimulated supernatant, we further quantified

the non-differentiated N2a cells treated with H2O2 as ratio changes were not as readily apparent as in differentiated N2a cells treated with H2O2 or LPS-activated BV2 supernatant. Furthermore, we chose the non-differentiated N2a cells over the

differentiated N2a cells treated with H2O2 herein for simplicity in order to minimize any possible confounding effects of RA on peripherin expression. A measure of total protein content showed a dose-dependent ~46% decrease in peripherin in the 0-100 µM range and then a recovery to ~79% of normal levels to 500 µM (Figure 5.4.iii, A, i and ii). Significant isoform ratio changes (p<0.001) were observed to accompany the change in protein levels in the 100-500 µM ranges (Figure 5.4.iii, A, ii). Here, Per-58 accounts for 57-61% of total isoform content in the 100-500 µM, as compared to 43-50% in the 0-50 µM ranges, while Per-45 accounts for 11-15% as compared to 16-26% in the same ranges. No peripherin mRNA changes were observed for any dose (Figure 5.4.iii, B), indicating that changes in peripherin protein levels are not likely at the transcriptional level.

Distinct peripherin morphologies are associated with neuroinflammation and oxidative stress. We have previously observed that changes to the normal peripherin isoform ratio is associated with malformed filaments and the formation of cytoskeletal inclusions in SW13 vim (-) cells (see Chapter 3). In the current study, we have observed changes in the peripherin isoform ratio in response to oxidation and neuroinflammation. As we have also seen distinct peripherin biochemical signatures in mouse models of traumatic neuronal injury and of motor neuron disease, as well as in ALS cases (see Chapter 4), we wanted to assess the morphological phenotype associated with novel ratio changes. While immunocytochemical analysis of peripherin expression in differentiated N2a cells treated with LPS-activated BV2 supernatant revealed no major abnormalities of 120

A i. kDa 0 H O µM 10 25 50 100 250 500 2 2 60

47.5 Peripherin

GAPDH

ii. iii.

B

0 H O µM 10 25 50 100 250 500 2 2 bp

200 Peripherin

200 GAPDH

Figure 5.4.iii. Peripherin Protein and mRNA Expression in Repsonse to H2O2 in N2a Cells. (A) Visual inspection of peripherin immunoblots with polyclonal peripherin and GAPDH antibodies revealed changes in the expression of total peripherin protein levels (i). Quantitation of peripherin protein expression, relative to GAPDH levels, revealed a unimodal decrease in expression followed by an increase in expression (ii). Significant isoform-specific ratio changes were observed after 100 µM H2O2 treatment with an overall increase in Per-58 levels and decrease in Per-56, Per-45, and other detected species (iii). (B) No changes in peripherin mRNA was observed by RT-PCR. Bars represent standard error mean (SEM). For the ANOVA with post hoc of total protein: * = p < 0.05 (A, ii). For the ANOVA with post hoc of isoform-specific expres- sion: p <0.05 for * = Per-58; † = Other. 121

peripherin filament structure, there was a dose-dependent increase in the number and length of neuritic processes (Figure 5.4.iv, A), including an increase in the labeling intensity of peripherin within neuritic growth cones (Figure 5.4.iv, B, arrows). In contrast, there was a loss of peripherin filamentous structure and the formation of peripherin-labeled cytoskeletal inclusions in the 100-500 µM ranges of the non-

differentiated N2a cells treated with H2O2 (Figure 5.4.v, A, i). Interestingly, by differential interference contrast (DIC), we observed a retraction of neuritic processes as early as early as 10 µM - a possible explanation for the loss of peripherin protein levels at lower H2O2 doses. It is also of note, that the DIC images indicate that the cytoskeleton of adherent cells at higher H2O2 doses remained intact (Figure 5.4.v, A, ii). Quantitation of the number of peripherin-immunoreactive inclusions indicate a dose-dependent increase, with significance achieved in the 250-500 µM ranges when compared to the 0 µM condition (Figure 5.4.v, B). We were interested in identifying a cytoskeletal marker that did not colocalize with peripherin within the inclusion structures. Double labeling of the microtubule, α-tubulin, at 500 µM, revealed widespread distribution of α-tubulin structures with no apparent structural abnormalities (Figure 5.4.v, C), indicating that inclusion formation is a specific event involving certain cytoskeletal proteins, including peripherin. To determine the ultrastructure of the intracellular inclusions visible at the microscopic level, we visualized the cells by electron microscopy at 0, 100, and 500 µM

H2O2 doses. As the H2O2 dose increases, the N2a cells become stressed, as is evident by cellular abnormalities, including membranous sheathing, as well as mitochondrial and internal vacuolization (Figure 5.4.vi, A). A prominent feature of cells treated with increasing doses of H2O2, was the formation of large focal inclusions within the cytoskeleton (Figure 5.4.vi, A, arrowheads). These inclusions were composed of aggregates of bundled filaments with the size of the aggregate increasing as a function of

increasing doses of H2O2 (Figure 5.4.vi, A, arrows). Individual filaments were discernable in the range of 10-15 nm in diameter suggesting the presence of intermediate filaments within these bundles. To confirm the presence of peripherin within these bundles, we performed an immunogold labeling and found that peripherin was highly

122

A 0 10 100

250 500 1000

B 0 1000

Figure 5.4.iv Immunocytochemistry of N2a Cells Treated with LPS- Activated BV2 Supernatant. (A) Increasing doses (ng/mL) of LPS-activated BV2 supernatant were added to cultures containing N2a cells and peripherin localized by immunocy- tochemistry using a polyclonal peripherin antibody (green). An increase in the number and length of peripherin immunoreactive neurites was observed. (B) While very few neurites are observed in N2a cells exposed to low dose condi- tions, an increase in peripherin labeling (green) was observed in the distal growth cones of most neuritic extensions at higher doses. Blue = DAPI; Bar = 20 µM. 123

A H202 µM 0 100 500

B C 500 H202 µM

α-tubulin peripherin merge + DAPI

Figure 5.4.v Peripherin Morphology Following H2O2 Administration. (A) A dose-dependent retraction of adherent N2a cell neurites is observed with increasing concentrations of H2O2, as shown by DIC imaging (grey panels). Immunocytochemistry of a polyclonal peripherin antibody (red), along with DAPI (blue), revealed the formation of peripherin immunoreactive cytoplasmic inclusions at higher H2O2 concentrations (arrows). (B) Quantitation of peripherin inclusions revealed a significant increase in their formation from 250-500 µM. (C) Double labeling of monoclonal α-tubulin (green) and polyclonal peripherin (red), as well as DAPI (blue), at 500 µM H2O2 show that other cytoarchitectural components are preserved despite the presence of large focal intracellular inclusions. Bars represent standard error mean (SEM); * = p < 0.05 124

A 0 µM 100 µM 500 µM

B 0 µM 500 µM 500 µM -ve Ab

Figure 5.4.vi. Cytoarchitecture of N2a Cells Following H2O2 Administration. (A) With increasing doses of H2O2, the normal scattered arrangement of 10-15 nm filaments (arrows, 0 μM condition) arrange into bundled linear sheets (arrows, 100 μM condition) in a dose-dependent manner to form aggregates 10-15 μm in diameter (arrows, 500 μM condition). Arrowheads in the top panel indicate area of N2a cells depicted in bottom panel. Note the effects of cellular stress from increasing doses of H2O2 on cellular morphology. (B) Immunogold labeling with polyclonal peripherin identifies peripherin as an immu- noreactive constituent of these aggregates in the 500 μM condition as compared to diffuse in the 0 μM condition. Specificity was confirmed by omitting the primary antibody (-ve Ab) in the 500 μM condition. Black bar: 10 μm; white bar: 100 nm. 125

specific for these structures (Figure 5.4.vi, B), indicating that the inclusions at the ultrastructural level were, indeed, peripherin aggregations.

Peripherin aggregations escape widespread oxidation. A major consequence of cellular oxidation by ROS, in the presence of redox metals (Cu+ and Fe2+), is the process of protein carbonylation, the non-enzymatic addition of aldehydes or ketones to specific amino acid residues. Protein carbonyls are likely to play a role in the pathogenesis of disorders with prolonged oxidative stress, as they have been shown to affect the function and/or metabolic stability of the modified proteins (Levine 2002). As the typical fate of most carbonylated proteins is either degradation or aggregation (Nystrom 2005), we wanted to identify whether peripherin aggregates in the current study were carbonylated. Using DNP as a marker for oxidation, we identified a dose-dependent increase in the number of carbonylated proteins with increasing doses of

H2O2 (Figure 5.4 vii, A). Surprisingly, both peripherin filaments and aggregates were not oxidized at higher H2O2 concentrations, despite widespread carbonyl labeling (Figure 5.4 vii, B).

5.5 DISCUSSION We have previously demonstrated that peripherin isoform ratio changes, specifically the disruption of Per-45 expression from Per-58 cDNA expression in SW13 vim (-) cells, results in the formation of abnormal filamentous structures and the formation of peripherin inclusions (see Chapter 3). We have also observed distinct peripherin isoform ratio changes following traumatic neuronal injury, in mouse models of motor neuron disease, and in ALS (see Chapter 4). Considering that increases in the extracellular concentrations of ROS, glutamate, and proinflammatory cytokines/chemokines are commonly associated with neuronal injury and motor neuron degeneration (Hossmann 1994, Cleveland & Rothstein 2001, Robertson et al. 2002, Crack & Taylor 2005, Hensley et al. 2006, Saxena & Caroni 2007), the current study sought to identify relevant exogenous factors capable of modifying peripherin isoform- specific expression and morphology. We present evidence of distinct peripherin isoform

ratio changes in response to H2O2 and from exposure to LPS-activated microglial 126 A 0 μM DNP 0 μM Per 0 μM Merge + DAPI

100 μM DNP 100 μM Per 100 μM Merge + DAPI

500 μM DNP 500 μM Per 500μM Merge + DAPI

500 μM -ve DNP 500:500 μMno-DNP NaBH4 500:500 μMno-DNP FeS04

B 500 μM DNP 500 μM DNP + Per + 500 μM DIC DAPI

Figure 5.4.vii. Immunohistochemical Localization of Protein Carbonyls in H2O2-Treated N2a Cells. (A) Images show increasing carbonylation detected by a monoclonal DNP antibody (red) in N2a cells treated with increasing concentrations of H2O2 at low magnification. More intense peripherin labeling was observed as a result of protein aggregation (Per, green). The primary antibody was omitted to identify non-specific DNP effects (-ve DNP). N2a cells were also treated with NaBH4 and FeSO4 to block or enhance carbonylation as positive and negative controls, respectively. (B) A higher magnification image shows that at 500 μM H2O2 concentrations, DNP (red) was distributed widely throughout the cells, however, pockets of non-DNP labeling was observed (chevron arrows). Double labeling of peripherin (green) with DNP (red) reveals that peripherin filaments (arrow) or aggregates (arrowheads) do not colocalize with DNP. DIC imaging (grey panel) confirms an intact cytoskeleton in the 500 μM condition. Blue = DAPI; bar = 20 µM. 127

supernatant that are associated with peripherin aggregation and neuritic outgrowth, respectively. Glutamate did not have an effect on peripherin isoform expression, signifying that specific stressors may modulate peripherin isoform levels. To our knowledge, this is the first in vitro model of peripherin aggregation without the use of transgenic manipulation. Interestingly, peripherin aggregation was not associated with protein carbonylation, suggesting that aggregation may serve a physiologically relevant role during oxidative stress. While the normal biological role of peripherin remains poorly understood, several studies suggest that peripherin is an integral component of neuritic regeneration following neuronal injury (Oblinger et al. 1989b, Troy et al. 1990). While maximal peripherin expression corresponds with periods of axonal regrowth and sprouting following injury in mouse sciatic crush models (Oblinger et al. 1989b, Troy et al. 1990), no direct evidence is yet available to support the conclusion that peripherin upregulation is regenerative in nature. Following injury, both PNS and CNS neurons initiate axonal degeneration that involves cytoskeletal disassembly, axon swelling, axon fragmentation, and myelin clearance by resident glia and recruited macrophages (Saxena & Caroni 2007). As such, peripherin upregulation as a requirement for the extension of neuritic processes, re-establishment of terminal contacts, and/or to provide stability during cytoskeletal turnover is, at the moment, entirely speculative. The finding that antisense- mediated depletion of peripherin in NGF-exposed PC12 cells has no effect on neuritic outgrowth (Troy et al. 1992, Helfand et al. 2003b), indicates that peripherin is not required for axonal growth, and, thus, any observed upregulation may be in response to degenerative changes of adjacent tissues. Moreover, the rapid upregulation of peripherin after insult to CNS neurons (Beaulieu et al. 2002, Kriz et al. 2005) and of findings of increased peripherin protein levels in ALS (Robertson et al. 2003, Strong et al. 2004, Xiao et al. 2008) support the idea that peripherin upregulation is a component of degenerative processes. Nevertheless, the current study provides evidence that, in a sub- lethal proinflammatory environment, the dose-dependent neuritic extension of N2a cells is associated with an increase in Per-45 and the generation of two unidentified peripherin species of ~50 and ~53 kDa. Thus, while our previous findings associate ratio changes with malformed filaments and/or inclusion formation (see Chapter 3), we are now able to 128

expand this work by identifying peripherin isoform ratio changes as a physiologically relevant mechanism. Our finding of increased peripherin labeling in the neuritic growth cones provides evidence that peripherin upregulation may be associated with axonal outgrowth. While further studies warrant the identification of peripherin modulatory factors and their corresponding downstream mechanism(s) capable of selective isoform expression, Robertson et al. (2001) have previously identified that peripherin aggregates from TPer mice enhance the sensitivity of DRG neurons to apoptosis when exposed to a proinflammatory environment and that this may act through a TNF-α-mediated pathway. As we have seen, peripherin isoform ratio changes is a prominent feature in Per mice (see Chapter 4), thus, it is likely that a proinflammatory milieu may have multiple effects on peripherin isoform expression. Protein carbonylation is considered to be a normal physiological process that prepares abnormally modified or misfolded proteins for degradation. To this end, cells are able to minimize the damaging effects of ROS in a non-enzymatic manner involving proteolysis, however, protein aggregation has also been observed as a consequence of increased carbonylation (Levine 2002, Nystrom 2005). Oxidative damage is suggested to be a contributory factor in the pathogenesis of both fALS and sALS (Robberecht 2000, Simpson et al. 2003). Extensive protein carbonylation has been reported in the mtSOD1G93A mouse and within motor neurons of ALS patients (Ferrante et al. 1997, Andrus et al. 1998, Niebroj-Dobosz et al. 2004). In the current study, oxidant-induced peripherin aggregation is associated with dose-dependent isoform expression and ratio changes. The ordered, bundled ultrastructure of these aggregate is similar to the ultrastucture of LBLIs reported in some ALS patients (Sasaki et al. 2005), however, is in contrast to the disorganized, granuler appearance of aggregations within mtSOD1G93A mice (Sasaki & Iwata 1996). While no studies have yet looked at the stability and structure of peripherin in vitro in response to oxidative stress, ROS have been shown increase the β-sheet content of the predominately α-helical secondary structure of NF proteins (Gelinas et al. 2000); these changes have been associated with the in vitro aggregation of NFs that display amyloid-like characteristics (Kim & Kang 2003). We looked to identify whether peripherin backbone moieties were targets of protein carbonylation. Surprisingly, peripherin aggregates and any remaining filaments 129

were largely free of carbonyl modification, despite widespread cellular DNP reactivity. While it is unlikely that carbonylated residues are buried within the aggregate - we are using a polyclonal peripherin antibody that recognizes multiple epitopes susceptible to carbonylation - we are cautious with the interpretation of these results. On the one hand, the aggregation of peripherin may serve a physiological relevant role during oxidative stress. As we have seen the relationship between aggregate formation and neurotoxicity is not clear, with emerging evidence suggesting that, in certain neurodegenerative diseases, protein aggregations may act to sequester toxic proteins when the normal proteolytic response of the cell is overwhelmed or has failed. Indeed, perikaryal nIF accumulations in most nIF transgenic mice are generally well tolerated by motor neurons and, except for mice overexpressing peripherin and for mice expressing a mutant NF-L transgene (Lee et al. 1994), do not provoke massive motor neuron death (Lee et al. 1992, Xu et al. 1993, Vickers et al. 1994, Zhu et al. 1997, Elder et al. 1998a, Elder et al. 1998b, Lariviere et al. 2002). In this respect, it is possible that peripherin isoform expression and/or ratio changes may provide a mechanism for aggregation in an effort to protect the neuron. On the other hand, we did not observe any mRNA changes, and, as such, without transcriptional regulation, it is hard to consider isoform-induced aggregation as a mechanism for oxidative protection. In this regard, however, it is of note that since our primers target mRNA sequences between exons one and three, isoforms generated without the need for these coding regions may not have be identified. Finally, it is possible that oxidative modification of proteins important in neuronal cytoarchitecture may generate conditions permissive to peripherin aggregation. For example,it is well known that IFs are intimately associated with cross-linking proteins, known as or cytolinkers (Green et al. 1992, Ruhrberg & Watt 1997, Wiche 1998). One of these plakins, known as BPAG1 or (Houseweart & Cleveland 1998), is the specific interaction partner of peripherin (Leung et al. 1999). Interestingly, mice carrying mutations in the BPAG1 gene develop dystonic movement and die before weaning (Duchen et al. 1963). While no studies, to our knowledge, have yet to look at the effects of oxidation on function, it is conceivable that any gain- or loss-of-function effects as a result plakin abnormalities may have adverse effects on peripherin network stability. 130

Indeed, the effects of oxidative stress on other cytoskeletal stabilizing proteins in neurodegeneration has been documented (Liu et al. 2005) strategies at the level of alternative splicing appear intimately linked with the cellular and metabolic status of the cell to modulate the isoform expression profile of various proteins (Biamonti & Caceres 2009). The selective activation or inhibition of alternative splicing in response to various environmental and pathological stresses have recently been noted for a number of proteins critical for neuronal function and/or survival after prolonged stress (Williams & Lipkin 2006, Maracchioni et al. 2007, Abumaria et al. 2008, Shaked et al. 2008). The current study provides an opportunity to characterize factors important in modulating peripherin isoform expression and to provide the first model central to the assessment of peripherin’s role during aggregation and neurite outgrowth. While the exact reasons for changes in isoform-specific expression remain unknown, our findings, having identified conditions relevant to ALS pathology capable of modifying peripherin isoform expression, is of great importance in our understanding of the pathogenesis of the disease. Moreover, the observation that not all conditions produced a biochemical response is an indication that changes in peripherin isoform expression is conditional upon a specific set of criteria and not necessarily a reflection of the effects of non-specific cellular stress. 131

CHAPTER 6

CONCLUSIONS AND FUTURE DIRECTIONS 132

6.1 Preamble: Hypothesis Revisited It may be argued that there is no other protein in the ALS literature that is more representative of a pathological point-of-convergence for both the familial and sporadic forms of the disease than peripherin. As we have seen, abnormal peripherin upregulation and its presence in the majority of perikaryal inclusions and axonal spheroids in motor neurons are post-mortem hallmarks of ALS. Peripherin overexpressing transgenic mice succumb to motor neuron disease with pathological hallmarks reminiscent of those found in ALS. Moreover, the findings of peripherin mutations in sALS have reinforced the importance of peripherin as a prospective etiological or propagative factor of disease pathogenesis. Surprisingly, inherited PRPH mutations have not, as of yet, been identified; as such, understanding the post-transcriptional mechanism at which peripherin imparts its pathological effect(s) is considered a key goal for many researchers. The formulation of the hypothesis presented in Chapter 2 is, thus, primarily in response to the lack of knowledge regarding the normal biological function of peripherin and its role in ALS. The research presented throughout this thesis identifies peripherin isoforms as important players in normal filament biology and in ALS. We have followed a rationale, step-wise approach from the identification of Per-45 as a novel peripherin isoform (see Chapter 1) to characterizing its involvement, along with other prospective isoforms, in the formation of normal filament networks, in traumatic neuronal injury, and in ALS (see Chapter 3 and 4). We have also provided a possible mechanism for peripherin- associated neuritic outgrowth and protein aggregation by linking these phenotypes with two major pathogenic features associated with ALS - neuroinflammation and oxidative stress (see Chapter 5) (Figure 6.1.i). Overall, we provide novel insight into the biology of IFs and show that peripherin expression in ALS is characterized by unique isoform- specific ratios.

6.2 Conclusions 6.2.1 Identification of Per-45 as the First Normal Human Peripherin Variant (Chapter 3). Along with the NFs, peripherin is thought to be important in establishing and maintaining the structural integrity of the neuron. However, unlike the NFs, which are Inflammation • Chapter 5 Oxidation • Chapter 5 Excitotoxicity

Protein Aggregation Neuron death / Peripherin Iso- injury / regeneration form Expression

• Chapter 4

Expression and Ratio Changes • Chapter 3 & 5 • Chapter 3 & 4

Figure 6.1.i. Diagram of the Interrelationships Among Peripherin Isoforms, Aggregation, and Stressors Associated with Neuronal Injury or ALS. The above diagram combines the major findings of this thesis into a conjecture relating peripherin isoform expression and the various pathologies associated with traumatic neuronal injury and ALS. After identifying and characterizing Per-45, we provided a novel mechanism for the formation of intracellular peripherin inclusions, which arise from perturbations to the normal intra-isoform stoichiometry (see Chapter 3). We then identified that distinct biochemical signatures of peripherin isoform expression exist in different models of traumatic neuronal injury and motor neuron disease, as well as in ALS (see Chapter 4). In lieu of these findings, we sought to identify relevant in vitro conditions that modify peripherin isoform expression by looking at the effects of oxidation, excitotoxicity, and neuroinflamamtion - events implicated in ALS pathogenesis - on peripherin isoform expression (see Chapter 5). Here, we found that distinct changes in isoform expression were accompanied by morphologically-distinct phenotypes, namely protein aggregation or neuritic outgrowth. While the nature of these changes remain unknown, it possible that the specific set of peripherin isoforms expressed in response to environmental stimuli may impart a functional role and contribute to neuronal fate during injury or disease. 133 134

obligate heteropolymers, peripherin self-assembles and is largely composed of homomeric structures. Prior to the commencement of this work, human peripherin filaments were viewed as being comprised solely of the full-length Per-58 isoform. While Per-28 was recently shown to be expressed in human ALS cases, there was a significant need for identifying new human peripherin isoforms that were part of normal peripherin biology. Three clues provided the bases for the identification of Per-45: the first, came from when we identified a peripherin species of ~45 kDa from cDNA expressing PRPH in SW13 vim (-) cells (Xiao et al. 2008); the second, came from Ho et al. (1995) whom, using rat cDNA with a mutation in the canonical AUGSTART, identified a putative ~45 kDa species thought to arise from downstream translation initiation; and, lastly, while Ho et al. (1995) concluded that downstream translation was preferentially inhibited by an intact AUGSTART, we consistently observed a ~45 kDa species in peripherin-expressing cell cultures and in both mouse and human neural tissues. Indeed, a retrospective examination of the peripherin literature finds a species of the equivalent molecular mass throughout (Kouklis et al. 1993, Leung et al. 1999, Terao et al. 2000, Robertson et al. 2001, Lariviere et al. 2002, Xing et al. 2002, Robertson et al. 2003, He & Hays 2004, Kriz et al. 2005, Millecamps et al. 2006). This species, along with other prospective isoforms, are often not mentioned and are likely considered degradative products. Similarly, researchers may underestimate peripherin isoform content as a result of low protein loading, short blot exposure, or the use of epitope-specific antibodies to hone the major peripherin species.

6.2.2 Characterization of Per-45 on Peripherin Filament Assembly (Chapter 3) In addition to Per-58, we identified Per-45 as the first normal human peripherin variant and the second in mouse (in addition to Per-56). While Per-56 has been shown to self-assemble and to form heteromeric filament structures with NFs (Robertson et al. 2003), relatively little is known about the requirements for Per-56 expression. In contrast, we show that Per-45 is required for peripherin assembly and that normal peripherin expression is characterized by a stoichiometric ratio of at least two peripherin isoforms - Per-58 and Per-45. Our findings are analogous to the inter-isoform stoichiometric associations of NFs, wherein NF-L, NF-M, and NF-H assemble in a 5:3:1 135

ratio, respectively (Lee et al. 1993). As such, the classical description of peripherin as a homopolymer is incomplete and somewhat misleading considering that we have observed intra-isoform associations within any given filament. The need for an N-terminally truncated isoform to form normal filament networks is surprising. A considerable amount of controversy exists over the requirements of different IF domains for effective polymerization into higher order filament structure. Typically, however, filament assembly is dependent on the integrity of the rod and N-terminal domains, whereas the C- terminal domain, although important for filament assembly per se, is thought to specify diameter and to regulate the lateral spacing of filaments (Ho et al. 1998a, Kreplak et al. 2004). Interestingly, studies that have prevented filament formation through deletions within the N-terminal domain of wt peripherin have reported similar non-filamentous cytoarchitecture when compared to our transfections with Per-45 cDNA (Cui et al. 1995, Ho et al. 1995). Our finding that Per-45 is required for normal filament assembly by co- integration with Per-58 indicates that while N-terminally truncated proteins are unable to self-assemble, they may provide a mechanism from which to assist in the formation and/or stabilization of filament networks. Considering that we have demonstrated distinct peripherin biochemical profiles throughout this thesis, including the demonstration of excess soluble Per-58 and Per-45 in transfected SW13 vim (-) cells, as well as upregulation of soluble isoform content in response to neuronal injury and disease, it is possible that some peripherin isoforms may serve as scaffolding elements from which to develop into higher order filament structures (Figure 6.2.2.i). While it is well known that IFs may utilize each other to elicit changes in their filament properties (Beaulieu et al. 1999b, Steinert et al. 1999, Schweitzer et al. 2001), only peripherin and GFAP (Perng et al. 2008) have been shown to achieve similar results through the production of multiple isoforms. Recently, a ratio was identified between the GFAP-δ and -α isoforms (Perng et al. 2008). GFAP-δ is an assembly-compromised isoform generated by a splicing replacement of it’s last two exons with a novel 41 aa C- terminus, while the assembly-competent CNS-specific GFAP-α isoform differs from the full-length GFAP-β isoform by the presence of an extended 5’ UTR region (Quinlan et al. 2007). Overexpressing GFAP-δ relative to GFAP-α results in abnormal protein

136

A C N

B C N

Figure 6.2.2.i: Hyopthetical Schematic Representation of Peripherin Filament Orga- nization. (A) Previous concept of peripherin protofilaments comprised solely of the full-length Per-58 isoform (blue). (B) The current work indicates that intra-isoform associations generate peripherin protofilaments comprised of at least two isoforms, Per-58 (blue) and Per-45 (red), possibly acting as scaffolds for polymerization. Other, as of yet unidentified peripherin isoforms (purple), may also be incorporated into filament networks. 137

interactions (eg. sequestration of αB-) and filament aggregation. These observations are strikingly similar to the effects of Per-45 on peripherin assembly and highlight the physiological importance of IF isoforms in modulating filament properties (Figure 6.2.2.ii). A surprising point to emerge from our studies was the observation that morphologically-distinct inclusions could be observed when Per-45 was abolished from the peripherin isoform profile during Per-3,4 cDNA transfection in SW13 vim (-) cells (see Appendix I, Supplemental Findings, A2). While the morphological phenotype associated with the Per-28 isoform is characterized by large, hyaline-like inclusions (Xiao et al. 2008), transfection with Per-3,4M82L cDNA, which is unable to translate the Per-45 isoform, forms smaller, punctate inclusions. These findings provide the first clues that not only can stoichiometric changes in the normal isoform ratio cause inclusion formation, but that different inclusion phenotypes can be observed depending on the isoform profile. These findings may have significant relevance to the mechanism of aggregation of nIFs in ALS and the observation that peripherin is intensely immunoreactive in various morphologically-distinct inclusions, including compact inclusions, LBLIs, and HCIs (Corbo & Hays 1992, Migheli et al. 1993, Wong et al. 2000, He & Hays 2004, Xiao et al. 2008). While we are unable to speculate on the nature of these different inclusions, recent work by Sanelli et al. (2007) showed that inclusion formation in ALS may represent a spectrum of the same underlying pathology. In essence, they showed that TDP-43-positive skein-like inclusions gave the appearance of wrapping around a ubiquitinated core to form compact inclusions. They also demonstrated that peripherin did not overlap with either ubiquitin or TDP-43 in the initial skein-like pathology, but rather, partitioned between the two elements within the inclusion core. As our work provides the first possible mechanism of morphologically- distinct peripherin inclusions, it is possible to speculate that peripherin isoform ratio changes are associated with the different stages of inclusion formation. Here, we provide evidence that peripherin isoforms may differentially localize throughout an individual inclusion. While this does not provide evidence for a peripherin-mediated spectrum of inclusion formation, it is possible that inclusions, themselves, are not uniformly

138 Per-58 Filaments

Filament precursors (soluble peripherin?) Post-transcriptional modifications (splicing, translation, etc.) Abnormalities (genetics, expression, ratio, protein interactions, etc.)

Scaffolding? Abnormal splice Stabilizing (eg. variant (eg. Per-28) Per-58:Per-45 ratio)

Increase in other isoforms? Assembly Network Compromised

Post-translational modification Filament collapse and/or (phosphorylation, aggregate formation nitration, protein interactions, etc.)

Distinct Aggregate Characteristics? Isoform dependent? Cellular stress, and/or disease

Filament Networks Aggregation

Neuron death, injury, regeneration, and/or disease

Figure 6.2.2.ii Hypothetical Schematic of Peripherin Filament Modulation. This thesis has presented evidence that normal peripherin filament networks require the cointegration of multiple isoforms. Tightly regulated post-transcriptional modification of peripherin gene expression products may generate isoforms important in filament scaffolding, stabilization, and/or growth. Further post-translational modification or protein-interactions may confer functional specificity to the filament network. As we have seem, cellular stress and/or disease may lead to cytoskeletal rearrangement in which physiologically relevant aggregation may occur. Alternatively, perturbations to any of the aforementioned modifications may generate assembly compromised and/or abnormal splice variants. Without the proper checks in place (eg. ubiquitin proteasome system), filaments may become destabilized and collapse, ultimately forming insoluble aggregates. In both pathways, it is not known whether the aggregates are toxic or beneficial. That is, they may disrupt normal cellular metabolism (eg. mitochondrial function, axonal transport) or act as biological sinks that sequester otherwise far more damaging by-products of injury and/or disease. 139 homogenous in peripherin content, whereby the expression and/or localization of distinct peripherin isoforms may serve distinct roles during inclusion formation.

6.2.3 Peripherin Isoform Content as a Biochemical Signature (Chapter 4). As we have seen, there are several ways to modulate peripherin filament properties in neurons. They include phosphorylation (Aletta et al. 1989, Huc et al. 1989, Angelastro et al. 1998, Konishi et al. 2007), nitration (Tedeschi et al. 2007), the incorporation of other IF proteins, such as NF-L (Beaulieu et al. 1999b), the association of peripherin with other interacting proteins, such as lamin and BPAG1-n (Djabali et al. 1991, Leung et al. 1999), and isoform-specific expression (Landon et al. 2000, Robertson et al. 2003, Xiao et al. 2008). While the functional significance of each modification remains poorly understood, the current study demonstrates that differences in isoform- specific expression are associated with anatomical regionalization, traumatic neuronal injury, mouse models of motor neuron disease, and ALS. The profile of the electrophoretic banding pattern of peripherin isoform expression - what we have designated as a peripherin biochemical signature - may provide valuable insight into the nature of peripherin expression in each of the aforementioned paradigms or diseases. And while it is not possible to speculate on the functional consequences of each biochemical signature without a greater understanding of basic peripherin biology, we identify that peripherin expression can now be characterized as a function of isoform- specific expression and ratio changes, as well through the generation of context- dependent isoforms (eg. Per-61 in mtSOD1G93A and Per-28 in ALS). Most significantly, we have identified sub-populations of ALS patients based on their respective peripherin biochemical signatures. While we have yet to identify whether these signatures correlate with disease-specific variables (eg. site-of-onset, duration, severity, etc.), it is important to recognize the utility of peripherin biochemical signatures as a prospective ALS biomarker. The development of diagnostic and/or nosologic biochemical profiles that characterize isoform expression in normal and neurodegenerative populations is gaining considerable attention. The most well characterized isoform profile involves the alternative splicing of in AD and the group of diseases collectively referred to 140 as FTLD that include corticobasal degeneration, progressive supranuclear palsy, and Pick’s disease (Buée & Delacourte 1999, Lee et al. 2001). Here, we show that an analysis of peripherin isoform expression can be employed to differentiate among neuronal injury and/or degeneration. Moreover, not only is peripherin one of the major pathological hallmarks of ALS, it is also thought to play a major role in other systemic human diseases, most notably for its role in diabetes as a major autoantigen for islet- infiltrating B lymphocytes (Boitard et al. 2002, Puertas et al. 2007, Carrillo et al. 2008). Peripherin is also used extensively as an enteric neuronal marker for human gastrointestinal diseases (Eaker & Sallustio, 1994, Szabolcs et al. 1996, Ganns et al. 2006) and for various cancer cell lines (Ho & Liem, 1996, Prasad et al. 1999), such as neuroendocrine carcinomas (Baudoin et al. 1993, Alvarez-Gago 1996), (Pedersen et al. 1993, Foley et al. 1994), and melanocytic lesions (Prieto et al. 1997; Kanitakis et al. 1998), among others. As such, it is evident that the use peripherin biochemical signatures may be helpful in extending more common descriptive studies to a greater understanding of its role in the pathogenesis of ALS, and, perhaps, other human diseases.

6.2.4. Peripherin Isoform Ratios, Neurite Outgrowth, and Aggregation (Chapter 5) The non-cell autonomous theory of ALS pathogenesis (see Glial-Mediated Neurotoxicity in Section 1.1.3 and Peripherin: ALS in Section 1.3.2) states that the selective vulnerability of motor neurons is derived from damage incurred to both neurons and non-neuronal neighbouring cells (Boillee et al. 2006a, Rothstein 2009). From experiments using restricted promoters in mice with cell-type-specific expression of mutant SOD1, it is generally believed that astrocytes, Schwann cells, or microglia are determinants of disease progression, while mutant actions within motor neurons initiates disease onset (Gong et al. 2000, Lino et al. 2002, Clement et al. 2003, Boillee et al. 2006b, Lobsiger et al. 2009). Recent evidence suggests that the activation of microglia and astrocytes in ALS leads to a disturbance in the normal interrelationships, or “crosstalk”, between glia and motor neurons (Van Den Bosch & Robberecht 2008). Currently, the cause of initial motor neuron injury and the triggering of neuronal degeneration in ALS is believed to be distinct from the propagation of the disorder 141

(Rothstein 2009). While the exact cause of these disturbances remains unknown, oxidative damage is believed to assist in disrupting neuron-glia crosstalk, leading to an unmitigated neuroinflammatory reaction that signals the release of a broad-spectrum of proinflammatory cytokines/chemokines and exicitotoxic neurotransmitters creating a paracrine milieu inconsistent with normal neuronal function (Mhatre et al. 2004, Reynolds et al. 2007). One prominent hypothesis of disease propagation is that inclusion-bearing neurons release factors that initiate gliosis and, thus, spread toxicity beyond the confines of the initial disease site (Strong 2003). While the heterogeneity of the disorder makes teasing apart specific interactions difficult, a few studies have documented relationships between nIF inclusion-bearing motor neurons and glia (Robertson et al. 2001, McLean et al. 2005). Prior to the work in Chapter 5, there had been no studies that looked at any relationships between the effects of neuroinflammation, excitotoxicity, or oxidation on nIF inclusion formation. In our study, we identified for the first time that the administration of exogenous factors, relevant to the conditions encountered in traumatic neuronal injury and in ALS, is capable of modifying peripherin isoform expression and filament morphology. While little is known about the influence of exogenous factors on normal peripherin expression, we have seen that certain growth factors (Portier et al. 1983, Leonard et al. 1987, Parysek & Goldman 1987, Aletta et al. 1988, Leonard et al. 1988, Thompson et al. 1992, Choi et al. 2001) and pro-inflammatory cytokines (Sterneck et al. 1996, Lecomte et al. 1998) are capable of modifying peripherin expression. Thus, it was not entirely surprising that we observed an increase in neuritic formation in N2a cells treated with supernatant from LPS-stimulated microglia. This increase in neurites may be an in vitro reflection of the conditions required for neuronal regeneration following injury or disease. Interestingly, while we were able to elicit a biochemical and

morphological response, we were unable to elicit an LD50 at higher doses. As such, the interpretation of our findings is limited, considering that LPS-stimulated microglial supernatant may not accurately recapitulate the in vivo conditions of injury or disease. In fact, other groups have shown that, at similar doses, N2a cells may also undergo neuritic retraction and cell death (Munch et al. 2003), providing evidence that the responsiveness of N2a cells and/or the contents of the supernatant being used may differ. 142

While it is widely known that oxidative damage is increased in ALS (Shaw et al. 1995, Abe et al. 1997b, Beal et al. 1997, Ferrante et al. 1997) and that protein carbonylation may cause aggregation of nIFs in vitro (Kim & Kang 2003, Kim et al. 2004), the effects of ROS on nIFs in vivo have not been studied. With a possible mechanism for aggregation identified in Chapter 3, we applied physiologically relevant

levels of H2O2 to N2a cells and observed widespread aggregation of peripherin into large filament bundles. From these observations, one would expect peripherin to be widely

oxidized, and, in response to any H2O2-mediated dysfunction of the ubiquitin-proteasome and/or autophagy/lysosomal systems, to form aggregates as a normal stress response (Nystrom 2005). We have observed that this is not the case, with peripherin forming aggregates without overt protein carbonylation. Our findings run contrary to both the in vitro work relating oxidative modification of NFs with aggregation (Kim et al. 2004) and general theories about cellular degradative mechanisms in response to ROS (Levine 2002, Nystrom 2005). While we provide a novel model for studying the effects of aggregates within oxidatively stressed cells, perhaps the most intriguing aspect of this work is that it provides a new avenue of thinking about the role of nIFs in protein aggregation. Not only has the concept of isoform ratio changes provided a new mechanism for peripherin aggregation, but it also indicates that peripherin aggregation, itself, may serve a physiological role in response to cellular stress. Considering that we do not see peripherin expression changes at the transcriptional level, this may be the first evidence that nIFs are inherently susceptible to aggregation at the protein level. If so, then the nature of peripherin aggregation may reflect a beneficial response, possibly providing a cytoskeletal scaffold from which other damaging proteins may be sequestered; unfortunately, such conclusions are merely speculative at this point in time.

6.3 Future Directions Peripherin abnormalities are present in both familial and sporadic forms of ALS; understanding how these abnormalities form remains an important objective in the study of ALS. In relation to the research contained herein, further work is warranted to understand the interrelationships between peripherin isoforms and their role in normal filament biology, in neuronal injury, and in ALS 143

The recent discovery of mutations in the DNA/RNA-binding proteins TDP-43 and FUS/TLS in a significant proportion of fALS cases (Kabashi et al. 2008, Sreedharan et al. 2008, Kwiatkowski et al. 2009, Vance et al. 2009) may bring alternative splicing to the forefront of ALS research. The precise roles of TDP-43 and FUS/TLS have not been fully elucidated, but both are multifunctional proteins implicated in transcription repression, nuclear organization, and alternative splicing (Lagier-Tourenne & Cleveland 2009). Our understanding of TDP-43 splicing regulation is limited to two studies: in one, TDP-43 was found to down-regulate splicing of the exon 9 cystic fibrosis transmembrane conductance regulator (CFTR) through specific binding to a UG-rich polymorphic region upstream of the 3' splice site (Ayala et al. 2006); and, in the second, TDP-43 ovexpression was shown to enhance exon 7 inclusion during the splicing of the survival of motor neuron pre-mRNA in spinal muscular atrophy (Bose et al. 2008). The fact that TDP-43 may be involved in the pathogenesis of SMA, a juvenile onset neuromuscular disease affecting both UMNs and LMNs, is certainly not lost on the course of this discussion about peripherin in ALS. Here, given that we have identified several alternative isoforms of peripherin in ALS, it would be prudent to identify whether TDP- 43 or FUS/TLS may affect the normal isoform ratio of peripherin. Changes in peripherin isoform expression in transgenic overexpressing or knock-down/out models of TDP-43 or FUS/TLS, or during transfections with ALS-linked TDP-43 or FUS/TLS mutations, are recommended. The discovery of functionally distinct peripherin isoforms confirms the pressing need to identify regulators of peripherin transcription and interacting proteins. Very few have been identified thus far, complicated primarily by the insolubility of peripherin in conventional buffers and our limited understanding of IF biology. In recent years, IFs have emerged not only as important mediators of cytoskeletal architecture, but also as important modulators of signal transduction, including the regulation cell growth and death through receptor-mediated mechanisms (Kim & Coulombe 2007). As we have seen, understanding the role of peripherin in health and disease may lie in the recognition that peripherin expression is characterized by the formation of distinct biochemical signatures. Our serendipitous finding of two distinct peripherin phenotypes in response to oxidation and neuroinflammation may allow the identification of novel aggregate binding 144 proteins and peripherin gene expression regulators, respectively. For both, one cannot overemphasize the importance of identifying how peripherin responds to both cell autonomous and non-cell autonomous mechanisms of disease. This knowledge is required to determine, for example, whether peripherin protein aggregations arise from the collapse of existing polymers or from abnormal interactions between soluble entities. Ultimately, the prospect of using and/or targeting peripherin as therapeutic strategy in the treatment of nerve injury of ALS requires our full understanding of the role of peripherin in response to stress or disease. As such, three experiments are warranted for the near future: (i) paraformaldehyde cross-linking and subsequent mass spectrometry of inclusion-bearing N2a cells to identify peripherin interacting proteins; (ii) a yeast two- hybrid screen of peripherin protein-protein interactions; and (iii) microinjection of in vitro-oxidized peripherin fibrils into normal and oxidized N2a cells. While the former two are attempts at identifying new peripherin interacting proteins, the latter is designed to test whether oxidized peripherin fibrils are noxious and the hypothesis that peripherin aggregates are beneficial in nature. Finally, while the importance of using inducible expresser technology in transgenic mice to further understand the role of peripherin in various mouse models was eluded to in Section 1.3.2, the use of species that are genetically tractable and amenable to live imaging, including C. elegans, Drosophila, and zebrafish models, may provide critical insight to our knowledge of peripherin, as well as to the larger family of IF proteins in vertebrate organisms (Cerda et al. 1998, Goldman 2001, Nielsen & Jorgensen 2003, Carberry et al. 2009). The lessons learned from our identification and characterization of peripherin isoforms has added a greater understanding to our knowledge of basic IF biology. The production of isoforms with functionally divergent roles will undoubtedly provide new clues into the specific functions of peripherin in neuroregenerative and neurodegenerative conditions. Moreover, what was recently a stagnant and underappreciated aspect of the ALS field, peripherin has now taken the forefront in the study of the interrelationships between the different pathological hallmarks of the disease. Indeed, this thesis provides the first inroads into what will undoubtedly be a clearer understanding of the role of peripherin isoforms in ALS pathogenesis. 145

APPENDIX I: SUPPLEMENTAL FINDINGS

146

A

mPer-45 i. ii. iii.

low confluence, high confluence, high confluence, high transfection low transfection high transfection

Appendix I, Supplemental Findings, A1: Density Dependent Spatial Localization of Per-45 in SW13 vim (-) Cells . (A) SW13 vim (-) cells were transfected with mouse Per-45 cDNA (described in Section 3.3) at varying culture densities. When the transfection efficiency of Per-45 is high (>90%, ) and SW13 vim (-) are not in contact with each other, Per-45 (polyclonal antibody, green) is distributed throughout the cytoplasm in a non-filamentous staining pattern (as described in Section 3.4) (i). Similar staining patterns are observed when cells are havested at high confluency and at low transfection efficiency (ii) . Interest- ingly, Per-45 was localized to what appeared to be the membrane in the majority of cells when transfec- tion rates were high (>90%) and the culture was at high cellular confluency (iii). These findings high- light the possibility of disinct peripherin isoform functions and the relevance of paracrine effects on peripherin isoforms. DAPI = blue; bar = 20 µm. 147

A ATG ATG ATG Per-3,4

M82L ATG ATG Per-3,4M82L

CTG

M82L B

hPer -45 Per-3,4 Per-3,4

C Per-3,4 Per-3,4M82L

Appendix I, Supplemental Findings, A2: Differential Peripherin Antibody Labeling in Aggregates Generated by Per-3,4M82L-transfected SW13 vim (-) cells. (A) Using the human Per-3,4 cDNA created by Xiao et al. (2008), which retains introns 3 and 4, inserted into pcDNA3.1 (-), we used site-directed mutagenesis (see Section 3.3) to mutate the canonical AUGSTART to CTG (Per- 3,4M82L). (B) SW13 vim (-) cells expressing the Per-3,4 cDNA construct generate several prospective protein isoforms of varying molecular weights, including an upregulation of Per-28. The hPer-45 cDNA expressed by SW13 vim (-) cells (see Section 3.3) generates a peripherin species of the same molecular weight as the peripherin ~45 kDa isoform lost from Per-3,4M82L-expressing SW13 vim (-) cells. (C) Large intracellular inclusions, immunoreactive for peripherin (green), are formed in Per-3,4-transfected SW13 vim (-) cells; in contrast, numerous small inclusions are observed in Per-3,4M82L SW13 vim (-). Blue = DAPI; bar = 20 µM 148 A

Peripherin Pathology***

Well Case Diagnosis Onset Duration Age* Gender MNs** TDP-43 Ub Spheroids Accumulations Inclusions (years) (years)

1 A07-38 AD N/A >10 91 F +++ n/a n/a + - -

2 A07-39 CND - N/A n/a 71 M UMN/LMN ++ - - + + -

3 A07-101 LD N/A 0.8 60 M +++ - - - - -

4 A07-103 FTDL-U N/A 1.7 62 M +++ - + - - -

N/A n/a 5 A07-141 FTDL-U 83 M +++ + + + - -

Bulbar 6 A07-52 ALS 1 70 M ++ + + +++ + -

7 A07-55 ALS Lumbar 2.9 63 F + + n/a + + -

8 A07-45 ALS Bulbar 2.1 63 F +++ + n/a +++ ++ +

9 A07-80 ALS Lumbar 0.7 71 F ++ + n/a +++ ++ -

10 A08-1 fALS Lumbar 4 55 F n/a n/a (ΔG27/P28) + +++ +++ +++ B NC A07-38 A07-52 A07-55

ALS A07-45 A07-80 A08-1

Appendix I, Supplemental Findings, A3: Clinical and Pathological Information of ALS Patients. (A) Clinical information and the assessment of non-peripherin pathology for each neurological control (NC) and ALS was provided by Drs. Lorne Zinman and Juan Bilbao at the Sunnybrook Research Institue in Toronto, ON. (B) Peripherin neuro- pathology of lumbar spinal cord sections of each case was evaluated with the polyclonal peripherin antibody and visualized using a biotinylated streptavidin-horseradish peroxidase (HRP) secondary antibody reacted with 3,3'-diaminobenzidine (DAB). Peripherin is upregulated in motor neurons of ALS patients, identifiable by perikaryal accumulations, inclusions (arrowheads) and/or spheroids (chevron arrows). AD, Alzheimer’s disease; ALS, amyotrophic lateral sclerosis; CND, chronic neurodgenerative disease; F, female; fALS, familial ALS; FTDL-U, frontotemporal lobar degeneration; LMN, lower motor neuron; LD, leukodystrophy; M, male; MNs, motor neurons; N/A, not applicable; n/a, not available; UPM, upper motor neuron. * At death; **Semi-quantitative rating of the average number of MNs present in the transverse section of lumbar spinal cord (minimal three sections per case); *** Semi-quantitative rating of the presence of peripherin pathological features in the transverse section of the lumbar spinal cord (minimal three sections per case); +++, high; ++, medium; + low; -, absent 149

REFERENCES (2004) Finishing the euchromatic sequence of the human genome. Nature, 431, 931-945.

Abe, K., Fujimura H., Kobayashi Y., Fujita N. and Yanagihara T. (1997a) Degeneration of the pyramidal tracts in patients with amyotrophic lateral sclerosis. A premortem and postmortem magnetic resonance imaging study. J Neuroimaging, 7, 208-212.

Abe, K., Pan L. H., Watanabe M., Konno H., Kato T. and Itoyama Y. (1997b) Upregulation of protein-tyrosine nitration in the anterior horn cells of amyotrophic lateral sclerosis. Neurol Res, 19, 124-128.

Aboussouan, L. S., Khan S. U., Meeker D. P., Stelmach K. and Mitsumoto H. (1997) Effect of noninvasive positive-pressure ventilation on survival in amyotrophic lateral sclerosis. Ann Intern Med, 127, 450-453.

Abrahams, S., Leigh P. N. and Goldstein L. H. (2005) Cognitive change in ALS: a prospective study. Neurology, 64, 1222-1226.

Abumaria, N., Ribic A., Anacker C., Fuchs E. and Flugge G. (2008) Stress upregulates TPH1 but not TPH2 mRNA in the rat dorsal raphe nucleus: identification of two TPH2 mRNA splice variants. Cell Mol Neurobiol, 28, 331-342.

Ackerley, S., Grierson A. J., Brownlees J., Thornhill P., Anderton B. H., Leigh P. N., Shaw C. E. and Miller C. C. (2000) Glutamate slows axonal transport of neurofilaments in transfected neurons. J Cell Biol, 150, 165-176.

Ackerley, S., Thornhill P., Grierson A. J., Brownlees J., Anderton B. H., Leigh P. N., Shaw C. E. and Miller C. C. (2003) Neurofilament heavy chain side arm phosphorylation regulates axonal transport of neurofilaments. J Cell Biol, 161, 489-495.

Adams, A. D., Choate D. M. and Thompson M. A. (1995) NF1-L is the DNA-binding component of the protein complex at the peripherin negative regulatory element. J Biol Chem, 270, 6975-6983.

Afifi, A. K., Aleu F. P., Goodgold J. and MacKay B. (1966) Ultrastructure of atrophic muscle in amyotrophic lateral sclerosis. Neurology, 16, 475-481.

Agosta, F., Rocca M. A., Valsasina P., Sala S., Caputo D., Perini M., Salvi F., Prelle A. and Filippi M. (2009) A longitudinal diffusion tensor MRI study of the cervical cord and brain in amyotrophic lateral sclerosis patients. J Neurol Neurosurg Psychiatry, 80, 53-55.

Aguzzi, A., Sigurdson C. and Heikenwalder M. (2007) Molecular Mechanisms of Prion Pathogenesis. Annu Rev Pathol.

Al-Chalabi, A., Andersen P. M., Chioza B. et al. (1998) Recessive amyotrophic lateral sclerosis families with the D90A SOD1 mutation share a common founder: evidence for a linked protective factor. Hum Mol Genet, 7, 2045-2050. 150

Albers, K. and Fuchs E. (1989) Expression of mutant keratin cDNAs in epithelial cells reveals possible mechanisms for initiation and assembly of intermediate filaments. J Cell Biol, 108, 1477-1493.

Aletta, J. M., Angeletti R., Liem R. K., Purcell C., Shelanski M. L. and Greene L. A. (1988) Relationship between the nerve growth factor-regulated clone 73 gene product and the 58-kilodalton neuronal intermediate filament protein (peripherin). J Neurochem, 51, 1317-1320.

Aletta, J. M., Shelanski M. L. and Greene L. A. (1989) Phosphorylation of the peripherin 58-kDa neuronal intermediate filament protein. Regulation by nerve growth factor and other agents. J Biol Chem, 264, 4619-4627.

Alexianu, M. E., Kozovska M. and Appel S. H. (2001) Immune reactivity in a mouse model of familial ALS correlates with disease progression. Neurology, 57, 1282-1289.

Almer, G., Rosoklija G., Hirano M., Hays A. P. and Przedborski S. (1999) Does increased superoxide dismutase activity really cause muscular dystrophy? Ann Neurol, 46, 135.

Alvarez-Gago, T., Bullón M. M., Rivera F., Velasco A. and Mayo A. (1996) Intermediate filament aggregates in mitoses of primary cutaneous neuroendocrine (Merkel cell) carcinoma. Histopathology, 28, 349-55.

Andersen, P. M., Morita M. and Brown Jr. R. H. (2000) Genetic of amyotrophic lateral sclerosis: an overview. In: Amyotrophic Lateral Sclerosis, (R. H. Brown Jr., V. Meininger and M. Swash eds.), pp. 223-250. Martin Dunitz, London.

Anderson, N. G. and Anderson L. (1982) The Human Protein Index. Clin Chem, 28, 739- 748.

Andrus, P. K., Fleck T. J., Gurney M. E. and Hall E. D. (1998) Protein oxidative damage in a transgenic mouse model of familial amyotrophic lateral sclerosis. J Neurochem, 71, 2041-2048.

Angelastro, J. M., Ho C. L., Frappier T., Liem R. K. and Greene L. A. (1998) Peripherin is tyrosine-phosphorylated at its carboxyl-terminal tyrosine. J Neurochem, 70, 540-549.

Annesi, G., Savettieri G., Pugliese P. et al. (2005) DJ-1 mutations and parkinsonism- dementia-amyotrophic lateral sclerosis complex. Ann Neurol, 58, 803-807.

Aoki, M., Ogasawara M., Matsubara Y., Narisawa K., Nakamura S., Itoyama Y. and Abe K. (1993) Mild ALS in Japan associated with novel SOD mutation. Nat Genet, 5, 323- 324.

Appel, S. H., Smith R. G., Alexianu M. F., Engelhardt J. I. and Stefani E. (1995) Autoimmunity as an etiological factor in sporadic amyotrophic lateral sclerosis. Adv Neurol, 68, 47-57. 151

Appel, S. H., Smith R. G., Engelhardt J. I. and Stefani E. (1993) Evidence for autoimmunity in amyotrophic lateral sclerosis. J Neurol Sci, 118, 169-174.

Arai, T., Hasegawa M., Akiyama H. et al. (2006) TDP-43 is a component of ubiquitin- positive tau-negative inclusions in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Biochem Biophys Res Commun, 351, 602-611.

Aran, F. A. (1850a). Recherches sur une maladie non encore décrite du systéme musculaire (atrophie musculaire progressive). Arch Gen Med, 24, 5-35.

Aran, F. A. (1850b). Recherches sur une maladie non encore décrite du systéme musculaire (atrophie musculaire progressive) (2e article-suite et fin). Arch Gen Med, 24, 172-214.

Armon, C., Daube J. R., O'Brien P. C., Kurland L. T. and Mulder D. W. (1991) When is an apparent excess of neurologic cases epidemiologically significant? Neurology, 41, 1713-1718.

Armstrong, R. A., Lantos P. L. and Cairns N. J. (2008) What determines the molecular composition of abnormal protein aggregates in neurodegenerative disease? Neuropathology, 28, 351-365.

Asano, K., Shalev A., Phan L., Nielsen K., Clayton J., Valasek L., Donahue T. F. and Hinnebusch A. G. (2001) Multiple roles for the C-terminal domain of eIF5 in translation initiation complex assembly and GTPase activation. EMBO J, 20, 2326-2337.

Ascherio, A., Weisskopf M. G., O'Reilly E J., Jacobs E. J., McCullough M. L., Calle E. E., Cudkowicz M. and Thun M. J. (2005) Vitamin E intake and risk of amyotrophic lateral sclerosis. Ann Neurol, 57, 104-110.

Ashby, P., Mailis A. and Hunter J. (1987) The evaluation of "spasticity". Can J Neurol Sci, 14, 497-500.

Athlan, E. S. and Mushynski W. E. (1997) Heterodimeric associations between neuronal intermediate filament proteins. J Biol Chem, 272, 31073-31078.

Athlan, E. S., Sacher M. G. and Mushynski W. E. (1997) Associations between intermediate filament proteins expressed in cultured dorsal root ganglion neurons. J Neurosci Res, 47, 300-310.

Averback, P. (1981) Unusual particles in motor neuron disease. Arch Pathol Lab Med, 105, 490-493.

Ayala, Y. M., Pagani F. and Baralle F. E. (2006) TDP43 depletion rescues aberrant CFTR exon 9 skipping. FEBS Lett, 580, 1339-1344. 152

Barbeito, L. H., Pehar M., Cassina P., Vargas M. R., Peluffo H., Viera L., Estevez A. G. and Beckman J. S. (2004) A role for astrocytes in motor neuron loss in amyotrophic lateral sclerosis. Brain Res Brain Res Rev, 47, 263-274.

Barber, S. C., Mead R. J. and Shaw P. J. (2006) Oxidative stress in ALS: a mechanism of neurodegeneration and a therapeutic target. Biochim Biophys Acta, 1762, 1051-1067.

Baudoin, C., Meneguzzi G., Portier M. M., Demarchez M., Bernerd F., Pisani A. and Ortonne J. P. (1993) Peripherin, a neuronal intermediate protein, is stably expressed by neuroendocrine carcinomas of the skin, their xenograft on nude mice, and the corresponding primary cultures. Cancer Res, 53, 1175-81

Beal, M. F., Ferrante R. J., Browne S. E., Matthews R. T., Kowall N. W. and Brown R. H., Jr. (1997) Increased 3-nitrotyrosine in both sporadic and familial amyotrophic lateral sclerosis. Ann Neurol, 42, 644-654.

Beaulieu, J. M. and Julien J. P. (2003) Peripherin-mediated death of motor neurons rescued by overexpression of neurofilament NF-H proteins. J Neurochem, 85, 248-256.

Beaulieu, J. M., Kriz J. and Julien J. P. (2002) Induction of peripherin expression in subsets of brain neurons after lesion injury or cerebral ischemia. Brain Res, 946, 153-161.

Beaulieu, J. M., Nguyen M. D. and Julien J. P. (1999a) Late onset of motor neurons in mice overexpressing wild-type peripherin. J Cell Biol, 147, 531-544.

Beaulieu, J. M., Robertson J. and Julien J. P. (1999b) Interactions between peripherin and neurofilaments in cultured cells: disruption of peripherin assembly by the NF-M and NF- H subunits. Biochem Cell Biol, 77, 41-45.

Beckman, J. S., Carson M., Smith C. D. and Koppenol W. H. (1993) ALS, SOD and peroxynitrite. Nature, 364, 584.

Beers, D. R., Henkel J. S., Xiao Q., Zhao W., Wang J., Yen A. A., Siklos L., McKercher S. R. and Appel S. H. (2006) Wild-type microglia extend survival in PU.1 knockout mice with familial amyotrophic lateral sclerosis. Proc Natl Acad Sci U S A, 103, 16021-16026.

Beghi, E., Logroscino G., Chio A., Hardiman O., Mitchell D., Swingler R. and Traynor B. J. (2006) The epidemiology of ALS and the role of population-based registries. Biochim Biophys Acta, 1762, 1150-1157.

Behndig, A., Karlsson K., Reaume A. G., Sentman M. L. and Marklund S. L. (2001) In vitro photochemical cataract in mice lacking copper-zinc superoxide dismutase. Free Radic Biol Med, 31, 738-744.

Belayev, L., Busto R., Zhao W., Fernandez G. and Ginsberg M. D. (1999) Middle cerebral artery occlusion in the mouse by intraluminal suture coated with poly-L-lysine: neurological and histological validation. Brain Res, 833, 181-190. 153

Belecky-Adams, T., Wight D. C., Kopchick J. J. and Parysek L. M. (1993) Intragenic sequences are required for cell type-specific and injury-induced expression of the rat peripherin gene. J Neurosci, 13, 5056-5065.

Ben-Ari, Y. and Cossart R. (2000) Kainate, a double agent that generates seizures: two decades of progress. Trends Neurosci, 23, 580-587.

Bendotti, C., Calvaresi N., Chiveri L., Prelle A., Moggio M., Braga M., Silani V. and De Biasi S. (2001) Early vacuolization and mitochondrial damage in motor neurons of FALS mice are not associated with apoptosis or with changes in cytochrome oxidase histochemical reactivity. J Neurol Sci, 191, 25-33.

Bensimon, G., Lacomblez L. and Meininger V. (1994) A controlled trial of riluzole in amyotrophic lateral sclerosis. ALS/Riluzole Study Group. N Engl J Med, 330, 585-591.

Bergeron, C., Beric-Maskarel K., Muntasser S., Weyer L., Somerville M. J. and Percy M. E. (1994) Neurofilament light and polyadenylated mRNA levels are decreased in amyotrophic lateral sclerosis motor neurons. J Neuropathol Exp Neurol, 53, 221-230.

Biamonti, G. and Caceres J. F. (2009) Cellular stress and RNA splicing. Trends Biochem Sci, 34, 146-153.

Birney, E., Stamatoyannopoulos J. A., Dutta A. et al. (2007) Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project. Nature, 447, 799-816.

Blasi, E., Barluzzi R., Bocchini V., Mazzolla R. and Bistoni F. (1990) Immortalization of murine microglial cells by a v-raf/v-myc carrying retrovirus. J Neuroimmunol, 27, 229-37

Blencowe, B. J. (2005) Splicing on the brain. Nat Genet, 37, 796-797.

Blencowe, B. J. (2006) Alternative splicing: new insights from global analyses. Cell, 126, 37-47.

Bocchini, V., Mazzolla R., Barluzzi R., Blasi E., Sick P., and Kettenmann H. (1992) An immortalized cell line expresses properties of activated microglial cells. J Neurosci Res, 31, 616-21

Boillee, S., Vande Velde C. and Cleveland D. W. (2006a) ALS: a disease of motor neurons and their nonneuronal neighbors. Neuron, 52, 39-59.

Boillee, S., Viala L., Peschanski M. and Dreyfus P. A. (2001) Differential microglial response to progressive neurodegeneration in the murine mutant Wobbler. Glia, 33, 277- 287.

Boillee, S., Yamanaka K., Lobsiger C. S., Copeland N. G., Jenkins N. A., Kassiotis G., Kollias G. and Cleveland D. W. (2006b) Onset and progression in inherited ALS determined by motor neurons and microglia. Science, 312, 1389-1392. 154

Boitard, C., Villa M. C., Becourt C., Gia H.P., Huc C., Sempe P., Portier M. M. and Bach J. F. (1992) Peripherin: an islet antigen that is cross-reactive with nonobese diabetic mouse class II gene products. Proc Natl Acad Sci U S A, 89, 172-6.

Bondareff, W., Mountjoy C. Q., Roth M. and Hauser D. L. (1989) Neurofibrillary degeneration and neuronal loss in Alzheimer's disease. Neurobiol Aging, 10, 709-715.

Bornes, S., Boulard M., Hieblot C., Zanibellato C., Iacovoni J. S., Prats H. and Touriol C. (2004) Control of the vascular endothelial growth factor internal ribosome entry site (IRES) activity and translation initiation by alternatively spliced coding sequences. J Biol Chem, 279, 18717-18726.

Bose, J. K., Wang I. F., Hung L., Tarn W. Y. and Shen C. K. (2008) TDP-43 overexpression enhances exon 7 inclusion during the survival of motor neuron pre- mRNA splicing. J Biol Chem, 283, 28852-28859.

Both, G. W., Furuichi Y., Muthukrishnan S. and Shatkin A. J. (1975) Ribosome binding to reovirus mRNA in protein synthesis requires 5' terminal 7-methylguanosine. Cell, 6, 185-195.

Bradley, W. G., Anderson F., Bromberg M., Gutmann L., Harati Y., Ross M. and Miller R. G. (2001) Current management of ALS: comparison of the ALS CARE Database and the AAN Practice Parameter. The American Academy of Neurology. Neurology, 57, 500- 504.

Bradley, W. G., Anderson F., Gowda N. and Miller R. G. (2004) Changes in the management of ALS since the publication of the AAN ALS practice parameter 1999. Amyotroph Lateral Scler Other Motor Neuron Disord, 5, 240-244.

Brenner, M., Johnson A. B., Boespflug-Tanguy O., Rodriguez D., Goldman J. E. and Messing A. (2001) Mutations in GFAP, encoding glial fibrillary acidic protein, are associated with Alexander disease. Nat Genet, 27, 117-120.

Brody, B. A., Ley C. A. and Parysek L. M. (1989) Selective distribution of the 57 kDa neural intermediate filament protein in the rat CNS. J Neurosci, 9, 2391-2401.

Brooks, B. R. (1994) El Escorial World Federation of Neurology criteria for the diagnosis of amyotrophic lateral sclerosis. Subcommittee on Motor Neuron Diseases/Amyotrophic Lateral Sclerosis of the World Federation of Neurology Research Group on Neuromuscular Diseases and the El Escorial "Clinical limits of amyotrophic lateral sclerosis" workshop contributors. J Neurol Sci, 124 Suppl, 96-107.

Brooks, B. R., Bushara K., Khan A., Hershberger J., Wheat J. O., Belden D. and Henningsen H. (2000a) Functional magnetic resonance imaging (fMRI) clinical studies in ALS--paradigms, problems and promises. Amyotroph Lateral Scler Other Motor Neuron Disord, 1 Suppl 2, S23-32. 155

Brooks, B. R., Miller R. G., Swash M. and Munsat T. L. (2000b) El Escorial revisited: revised criteria for the diagnosis of amyotrophic lateral sclerosis. Amyotroph Lateral Scler Other Motor Neuron Disord, 1, 293-299.

Broom, W. J., Parton M. J., Vance C. A. et al. (2004) No association of the SOD1 locus and disease susceptibility or phenotype in sporadic ALS. Neurology, 63, 2419-2422.

Brownell, B., Oppenheimer D. R. and Hughes J. T. (1970) The central nervous system in motor neurone disease. J Neurol Neurosurg Psychiatry, 33, 338-357.

Brownlees, J., Ackerley S., Grierson A. J., Jacobsen N. J., Shea K., Anderton B. H., Leigh P. N., Shaw C. E. and Miller C. C. (2002) Charcot-Marie-Tooth disease neurofilament mutations disrupt neurofilament assembly and axonal transport. Hum Mol Genet, 11, 2837-2844.

Bruijn, L. I., Becher M. W., Lee M. K. et al. (1997) ALS-linked SOD1 mutant G85R mediates damage to astrocytes and promotes rapidly progressive disease with SOD1- containing inclusions. Neuron, 18, 327-338.

Bruijn, L. I. and Cleveland D. W. (1996) Mechanisms of selective motor neuron death in ALS: insights from transgenic mouse models of motor neuron disease. Neuropathol Appl Neurobiol, 22, 373-387.

Bruijn, L. I., Miller T. M. and Cleveland D. W. (2004) Unraveling the mechanisms involved in motor neuron degeneration in ALS. Annu Rev Neurosci, 27, 723-749.

Bucciantini, M., Giannoni E., Chiti F. et al. (2002) Inherent toxicity of aggregates implies a common mechanism for protein misfolding diseases. Nature, 416, 507-511.

Buée, L. and Delacourte A. (1999) Comparative biochemistry of tau in progressive supranuclear palsy, corticobasal degeneration, FTDP-17 and Pick's disease. Brain Pathol, 9:681-93.

Bunina, T. L. (1962) [On intracellular inclusions in familial amyotrophic lateral sclerosis.]. Zh Nevropatol Psikhiatr Im S S Korsakova, 62, 1293-1299.

Buratti, E., Dork T., Zuccato E., Pagani F., Romano M. and Baralle F. E. (2001) Nuclear factor TDP-43 and SR proteins promote in vitro and in vivo CFTR exon 9 skipping. EMBO J, 20, 1774-1784.

Calderon, F. H., Bonnefont A., Munoz F. J., Fernandez V., Videla L. A. and Inestrosa N. C. (1999) PC12 and neuro 2a cells have different susceptibilities to acetylcholinesterase- amyloid complexes, amyloid25-35 fragment, glutamate, and hydrogen peroxide. J Neurosci Res, 56, 620-631.

Canete-Soler, R., Schwartz M. L., Hua Y. and Schlaepfer W. W. (1998) Characterization of ribonucleoprotein complexes and their binding sites on the neurofilament light subunit mRNA. J Biol Chem, 273, 12655-12661. 156

Canete-Soler, R., Silberg D. G., Gershon M. D. and Schlaepfer W. W. (1999) Mutation in neurofilament transgene implicates RNA processing in the pathogenesis of neurodegenerative disease. J Neurosci, 19, 1273-1283.

Canete-Soler, R., Wu J., Zhai J., Shamim M. and Schlaepfer W. W. (2001) p190RhoGEF Binds to a destabilizing element in the 3' untranslated region of light neurofilament subunit mRNA and alters the stability of the transcript. J Biol Chem, 276, 32046-32050.

Carberry, K., Wiesenfahrt T., Windoffer R., Bossinger O. and Leube R. E. (2009) Intermediate filaments in Caenorhabditis elegans. Cell Motil Cytoskeleton.

Carrillo, J., Puertas, M. C., Planas R., Pastor X., Alba A., Stratmann T., Pujol-Borrell R., Ampudia R. M., Vives-Pi M. and Verdaguer J. (2008) Anti-peripherin B lymphocytes are positively selected during diabetogenesis. Mol Immunol, 45, 3152-62

Carpenter, S. (1968) Proximal axonal enlargement in motor neuron disease. Neurology, 18, 841-851.

Carriedo, S. G., Sensi S. L., Yin H. Z. and Weiss J. H. (2000) AMPA exposures induce mitochondrial Ca(2+) overload and ROS generation in spinal motor neurons in vitro. J Neurosci, 20, 240-250.

Carriedo, S. G., Yin H. Z. and Weiss J. H. (1996) Motor neurons are selectively vulnerable to AMPA/kainate receptor-mediated injury in vitro. J Neurosci, 16, 4069- 4079.

Cashman, N. R., Cudkowicz, M.E., Davidson, M.C., Pioro, E.P., Rosenfeld, J., and the ALS Patient Care Database (2001) Gender effects on duration and onset of age of amyotrophic lateral sclerosis. In: Proceedings of the 12th International Symposium on ALS/MND, Vol. 2, pp. 41-42.

Castagne, V., Gautschi M., Lefevre K., Posada A. and Clarke P. G. (1999) Relationships between neuronal death and the cellular redox status. Focus on the developing nervous system. Prog Neurobiol, 59, 397-423.

Catania, M. V., Aronica E., Yankaya B. and Troost D. (2001) Increased expression of neuronal nitric oxide synthase spliced variants in reactive astrocytes of amyotrophic lateral sclerosis human spinal cord. J Neurosci, 21, RC148.

Caughey, B. and Lansbury P. T. (2003) Protofibrils, pores, fibrils, and neurodegeneration: separating the responsible protein aggregates from the innocent bystanders. Annu Rev Neurosci, 26, 267-298.

Cazzolli, P. A. and Oppenheimer E. A. (1996) Home mechanical ventilation for amyotrophic lateral sclerosis: nasal compared to tracheostomy-intermittent positive pressure ventilation. J Neurol Sci, 139 Suppl, 123-128. 157

Cerda, J., Conrad M., Markl J., Brand M. and Herrmann H. (1998) Zebrafish vimentin: molecular characterization, assembly properties and developmental expression. Eur J Cell Biol, 77, 175-187.

Chadan, S., Moya K. L., Portier M. M. and Filliatreau G. (1994) Identification of a peripherin dimer: changes during axonal development and regeneration of the rat sciatic nerve. J Neurochem, 62, 1894-1905.

Chang, L. and Goldman R. D. (2004) Intermediate filaments mediate cytoskeletal crosstalk. Nat Rev Mol Cell Biol, 5, 601-613.

Chang, L., Shav-Tal Y., Trcek T., Singer R. H. and Goldman R. D. (2006) Assembling an intermediate filament network by dynamic cotranslation. J Cell Biol, 172, 747-758.

Chang, L. and Thompson M. A. (1996) Activity of the distal positive element of the peripherin gene is dependent on proteins binding to an Ets-like recognition site and a novel inverted repeat site. J Biol Chem, 271, 6467-6475.

Charcot, J. M. and Joffroy A. (1869). Deux cas d’atrophie musculaire progressive avec lésions de la substance grise et des faisceaux antérolatéraux de la moelle épiniére. Arch Physiol Norm Pathol, 2, 354-744.

Chari, G., Shaw P. J. and Sahgal A. (1996) Nonverbal visual attention, but not recognition memory of learning, processes are impaired in motor neurone disease. Neuropsychologia, 34, 377-385.

Chen, W. J. and Liem R. K. (1994) The endless story of the glial fibrillary acidic protein. J Cell Sci, 107 ( Pt 8), 2299-2311.

Chen, Y. Z., Bennett C. L., Huynh H. M. et al. (2004) DNA/RNA helicase gene mutations in a form of juvenile amyotrophic lateral sclerosis (ALS4). Am J Hum Genet, 74, 1128-1135.

Chien, C. L., Lee T. H. and Lu K. S. (1998) Distribution of neuronal intermediate filament proteins in the developing mouse olfactory system. J Neurosci Res, 54, 353-363.

Ching, G. Y. and Liem R. K. (1993) Assembly of type IV neuronal intermediate filaments in nonneuronal cells in the absence of preexisting cytoplasmic intermediate filaments. J Cell Biol, 122, 1323-1335.

Chio, A. (2005) Mortality trends in ALS: an increasingly intricate puzzle. Lancet Neurol, 4, 453-454.

Chio, A., Benzi G., Dossena M., Mutani R. and Mora G. (2005) Severely increased risk of amyotrophic lateral sclerosis among Italian professional football players. Brain, 128, 472-476. 158

Chio, A., Schymick J. C., Restagno G. et al. (2009) A two-stage genome-wide association study of sporadic amyotrophic lateral sclerosis. Hum Mol Genet.

Choi, D. Y., Toledo-Aral J. J., Lin H. Y. et al. (2001) Fibroblast growth factor receptor 3 induces gene expression primarily through Ras-independent signal transduction pathways. J Biol Chem, 276, 5116-5122.

Chou, S. M. (1979) Pathognomy of intraneuronal inclusions in ALS. In: Amyotrophic Lateral Sclerosis, (T. Tsubaki ed.), pp. 135-177. University Tokyo Press, Tokyo.

Chou, S. M., Taniguchi A., Wang H. S. and Festoff B. W. (1998a) Serpin=serine protease-like complexes within neurofilament conglomerates of motoneurons in amyotrophic lateral sclerosis. J Neurol Sci, 160 Suppl 1, S73-79.

Chou, S. M., Wang H. S., Taniguchi A. and Bucala R. (1998b) Advanced glycation endproducts in neurofilament conglomeration of motoneurons in familial and sporadic amyotrophic lateral sclerosis. Mol Med, 4, 324-332.

Chou, Y. H., Rosevear E. and Goldman R. D. (1989) Phosphorylation and disassembly of intermediate filaments in mitotic cells. Proc Natl Acad Sci U S A, 86, 1885-1889.

Chu, C. T. (2006) Autophagic stress in neuronal injury and disease. J Neuropathol Exp Neurol, 65, 423-432.

Clement, A. M., Nguyen M. D., Roberts E. A. et al. (2003) Wild-type nonneuronal cells extend survival of SOD1 mutant motor neurons in ALS mice. Science, 302, 113-117.

Cleveland, D. W. and Rothstein J. D. (2001) From Charcot to Lou Gehrig: deciphering selective motor neuron death in ALS. Nat Rev Neurosci, 2, 806-819.

Collard, J. F., Cote F. and Julien J. P. (1995) Defective axonal transport in a transgenic mouse model of amyotrophic lateral sclerosis. Nature, 375, 61-64.

Corbo, M. and Hays A. P. (1992) Peripherin and neurofilament protein coexist in spinal spheroids of motor neuron disease. J Neuropathol Exp Neurol, 51, 531-537.

Cote, F., Collard J. F. and Julien J. P. (1993) Progressive neuronopathy in transgenic mice expressing the human neurofilament heavy gene: a mouse model of amyotrophic lateral sclerosis. Cell, 73, 35-46.

Crack, P. J. and Taylor J. M. (2005) Reactive oxygen species and the modulation of stroke. Free Radic Biol Med, 38, 1433-1444.

Cronin, S., Berger S., Ding J. et al. (2008) A genome-wide association study of sporadic ALS in a homogenous Irish population. Hum Mol Genet, 17, 768-774. 159

Cronin, S., Tomik B., Bradley D. G., Slowik A. and Hardiman O. (2009) Screening for replication of genome-wide SNP associations in sporadic ALS. Eur J Hum Genet, 17, 213-218.

Crow, J. P., Ye Y. Z., Strong M., Kirk M., Barnes S. and Beckman J. S. (1997) Superoxide dismutase catalyzes nitration of by peroxynitrite in the rod and head domains of neurofilament-L. J Neurochem, 69, 1945-1953.

Cudkowicz, M. E., McKenna-Yasek D., Sapp P. E. et al. (1997) Epidemiology of mutations in superoxide dismutase in amyotrophic lateral sclerosis. Ann Neurol, 41, 210- 221.

Cui, C., Stambrook P. J. and Parysek L. M. (1995) Peripherin assembles into homopolymers in SW13 cells. J Cell Sci, 108 ( Pt 10), 3279-3284.

Curti, D., Malaspina A., Facchetti G., Camana C., Mazzini L., Tosca P., Zerbi F. and Ceroni M. (1996) Amyotrophic lateral sclerosis: oxidative energy metabolism and calcium homeostasis in peripheral blood lymphocytes. Neurology, 47, 1060-1064.

Cwik, V. A. (2005) ALS Clinical Motor . In: Amyotrophic Lateral Sclerosis, (H. Mitsumoto, S. Przedborski and P. Gordon eds.), pp. 395-417. Marcel Dekker Inc., London.

Dal Canto, M. C. and Gurney M. E. (1995) Neuropathological changes in two lines of mice carrying a transgene for mutant human Cu,Zn SOD, and in mice overexpressing wild type human SOD: a model of familial amyotrophic lateral sclerosis (FALS). Brain Res, 676, 25-40.

Dal Canto, M. C. and Gurney M. E. (1997) A low expressor line of transgenic mice carrying a mutant human Cu,Zn superoxide dismutase (SOD1) gene develops pathological changes that most closely resemble those in human amyotrophic lateral sclerosis. Acta Neuropathol, 93, 537-550.

Dalakas, M. C., Hatazawa J., Brooks R. A. and Di Chiro G. (1987) Lowered cerebral glucose utilization in amyotrophic lateral sclerosis. Ann Neurol, 22, 580-586.

Das, S., Ghosh R. and Maitra U. (2001) Eukaryotic translation initiation factor 5 functions as a GTPase-activating protein. J Biol Chem, 276, 6720-6726.

Davies, S. W., Turmaine M., Cozens B. A. et al. (1997) Formation of neuronal intranuclear inclusions underlies the neurological dysfunction in mice transgenic for the HD mutation. Cell, 90, 537-548.

De Vos, K., Severin F., Van Herreweghe F., Vancompernolle K., Goossens V., Hyman A. and Grooten J. (2000) Tumor necrosis factor induces hyperphosphorylation of kinesin light chain and inhibits kinesin-mediated transport of mitochondria. J Cell Biol, 149, 1207-1214. 160

De Vos, K. J., Chapman A. L., Tennant M. E. et al. (2007) Familial amyotrophic lateral sclerosis-linked SOD1 mutants perturb fast axonal transport to reduce axonal mitochondria content. Hum Mol Genet, 16, 2720-2728.

De Vos, K. J., Grierson A. J., Ackerley S. and Miller C. C. (2008) Role of axonal transport in neurodegenerative diseases. Annu Rev Neurosci, 31, 151-173.

Delisle, M. B. and Carpenter S. (1984) Neurofibrillary axonal swellings and amyotrophic lateral sclerosis. J Neurol Sci, 63, 241-250.

Deng, H. X., Hentati A., Tainer J. A. et al. (1993) Amyotrophic lateral sclerosis and structural defects in Cu,Zn superoxide dismutase. Science, 261, 1047-1051.

Desmarais, D., Filion M., Lapointe L. and Royal A. (1992) Cell-specific transcription of the peripherin gene in neuronal cell lines involves a cis-acting element surrounding the TATA box. EMBO J, 11, 2971-2980.

DiDonato, M., Craig L., Huff M. E. et al. (2003) ALS mutants of human superoxide dismutase form fibrous aggregates via framework destabilization. J Mol Biol, 332, 601- 615.

Djabali, K., Piron G., de Nechaud B. and Portier M. M. (1999) alphaB-crystallin interacts with cytoplasmic intermediate filament bundles during . Exp Cell Res, 253, 649- 662.

Djabali, K., Portier M. M., Gros F., Blobel G. and Georgatos S. D. (1991) Network antibodies identify nuclear lamin B as a physiological attachment site for peripherin intermediate filaments. Cell, 64, 109-121.

Djabali, K., Zissopoulou A., de Hoop M. J., Georgatos S. D. and Dotti C. G. (1993) Peripherin expression in hippocampal neurons induced by muscle soluble factor(s). J Cell Biol, 123, 1197-1206.

Drachman, D. B., Fishman P. S., Rothstein J. D., Motomura M., Lang B., Vincent A. and Mellits E. D. (1995) Amyotrophic lateral sclerosis. An autoimmune disease? Adv Neurol, 68, 59-65.

Drory, V. E., Goltsman E., Reznik J. G., Mosek A. and Korczyn A. D. (2001) The value of muscle exercise in patients with amyotrophic lateral sclerosis. J Neurol Sci, 191, 133- 137.

Duchen, L. W. (1976) Dystonia musculorum--an inherited disease of the nervous system in the mouse. Adv Neurol, 14, 353-65

Duchenne (De Boulogne) (1860) Paralysie musculaire progressive de la langue, du voile du palais et des levres; affection non encore decrite comme espece morbide distincte. Arch Gen Med, 16, 283-296. 161

Dupuis, L., Gonzalez de Aguilar J. L., Oudart H., de Tapia M., Barbeito L. and Loeffler J. P. (2004) Mitochondria in amyotrophic lateral sclerosis: a trigger and a target. Neurodegener Dis, 1, 245-254.

Durham, H. D., Roy J., Dong L. and Figlewicz D. A. (1997) Aggregation of mutant Cu/Zn superoxide dismutase proteins in a culture model of ALS. J Neuropathol Exp Neurol, 56, 523-530.

Dyson, H. J. and Wright P. E. (2005) Intrinsically unstructured proteins and their functions. Nat Rev Mol Cell Biol, 6, 197-208.

Eaker, E. Y. and Sallustio J. E. (1994) The distribution of novel intermediate filament proteins defines subpopulations of myenteric neurons in rat intestine. Gastroenterology, 107, 666-74.

Eisen, A., Schulzer M., MacNeil M., Pant B. and Mak E. (1993) Duration of amyotrophic lateral sclerosis is age dependent. Muscle Nerve, 16, 27-32.

Elchuri, S., Oberley T. D., Qi W., Eisenstein R. S., Jackson Roberts L., Van Remmen H., Epstein C. J. and Huang T. T. (2005) CuZnSOD deficiency leads to persistent and widespread oxidative damage and hepatocarcinogenesis later in life. Oncogene, 24, 367- 380.

Elder, G. A., Friedrich V. L., Jr., Bosco P., Kang C., Gourov A., Tu P. H., Lee V. M. and Lazzarini R. A. (1998a) Absence of the mid-sized neurofilament subunit decreases axonal calibers, levels of light neurofilament (NF-L), and neurofilament content. J Cell Biol, 141, 727-739.

Elder, G. A., Friedrich V. L., Jr., Kang C., Bosco P., Gourov A., Tu P. H., Zhang B., Lee V. M. and Lazzarini R. A. (1998b) Requirement of heavy neurofilament subunit in the development of axons with large calibers. J Cell Biol, 143, 195-205.

Elder, G. A., Friedrich V. L., Jr., Margita A. and Lazzarini R. A. (1999) Age-related atrophy of motor axons in mice deficient in the mid-sized neurofilament subunit. J Cell Biol, 146, 181-192.

Ellgaard, L. and Helenius A. (2003) Quality control in the endoplasmic reticulum. Nat Rev Mol Cell Biol, 4, 181-191.

Elliott, J. L. (2001) Cytokine upregulation in a murine model of familial amyotrophic lateral sclerosis. Brain Res Mol Brain Res, 95, 172-178.

Epstein, C. J., Avraham K. B., Lovett M., Smith S., Elroy-Stein O., Rotman G., Bry C. and Groner Y. (1987) Transgenic mice with increased Cu/Zn-superoxide dismutase activity: animal model of dosage effects in Down syndrome. Proc Natl Acad Sci U S A, 84, 8044-8048. 162

Escurat, M., Djabali K., Gumpel M., Gros F. and Portier M. M. (1990) Differential expression of two neuronal intermediate-filament proteins, peripherin and the low- molecular-mass neurofilament protein (NF-L), during the development of the rat. J Neurosci, 10, 764-784.

Estevez, A. G., Crow J. P., Sampson J. B., Reiter C., Zhuang Y., Richardson G. J., Tarpey M. M., Barbeito L. and Beckman J. S. (1999) Induction of nitric oxide-dependent apoptosis in motor neurons by zinc-deficient superoxide dismutase. Science, 286, 2498- 2500.

Fernaeus, S., Reis K., Bedecs K. and Land T. (2005) Increased susceptibility to oxidative stress in scrapie-infected neuroblastoma cells is associated with intracellular iron status. Neurosci Lett, 389, 133-136.

Ferrante, R. J., Browne S. E., Shinobu L. A., Bowling A. C., Baik M. J., MacGarvey U., Kowall N. W., Brown R. H., Jr. and Beal M. F. (1997) Evidence of increased oxidative damage in both sporadic and familial amyotrophic lateral sclerosis. J Neurochem, 69, 2064-2074.

Ferrari, N., Desmarais D. and Royal A. (1995) Transcriptional activation of the neuronal peripherin-encoding gene depends on a G + C-rich element that binds Sp1 in vitro and in vivo. Gene, 159, 159-165.

Fiala, J. C. (2007) Mechanisms of amyloid plaque pathogenesis. Acta Neuropathol, 114, 551-571.

Figlewicz, D. A., Krizus A., Martinoli M. G., Meininger V., Dib M., Rouleau G. A. and Julien J. P. (1994) Variants of the heavy neurofilament subunit are associated with the development of amyotrophic lateral sclerosis. Hum Mol Genet, 3, 1757-1761.

Fischer, L. R., Culver D. G., Tennant P., Davis A. A., Wang M., Castellano-Sanchez A., Khan J., Polak M. A. and Glass J. D. (2004) Amyotrophic lateral sclerosis is a distal axonopathy: evidence in mice and man. Exp Neurol, 185, 232-240.

Fitzmaurice, P. S., Shaw I. C., Kleiner H. E., Miller R. T., Monks T. J., Lau S. S., Mitchell J. D. and Lynch P. G. (1996) Evidence for DNA damage in amyotrophic lateral sclerosis. Muscle Nerve, 19, 797-798.

Flood, D. G., Reaume A. G., Gruner J. A., Hoffman E. K., Hirsch J. D., Lin Y. G., Dorfman K. S. and Scott R. W. (1999) Hindlimb motor neurons require Cu/Zn superoxide dismutase for maintenance of neuromuscular junctions. Am J Pathol, 155, 663-672.

Foley, J., Ley C. A. and Parysek L. M. (1994) The structure of the human peripherin gene (PRPH) and identification of potential regulatory elements. Genomics, 22, 456-461.

Forman, H. J. and Fridovich I. (1973) On the stability of bovine superoxide dismutase. The effects of metals. J Biol Chem, 248, 2645-2649. 163

Forno, L. S. (1996) Neuropathology of Parkinson's disease. J Neuropathol Exp Neurol, 55, 259-272.

Franke, T. F. (2008) PI3K/Akt: getting it right matters. Oncogene, 27, 6473-6488.

Fray, A. E., Ince P. G., Banner S. J., Milton I. D., Usher P. A., Cookson M. R. and Shaw P. J. (1998) The expression of the glial glutamate transporter protein EAAT2 in motor neuron disease: an immunohistochemical study. Eur J Neurosci, 10, 2481-2489.

Fuchs, E. (1996) The cytoskeleton and disease: genetic disorders of intermediate filaments. Annu Rev Genet, 30, 197-231.

Fuchs, E. and Cleveland D. W. (1998) A structural scaffolding of intermediate filaments in health and disease. Science, 279, 514-519.

Fuchs, E. and Weber K. (1994) Intermediate filaments: structure, dynamics, function, and disease. Annu Rev Biochem, 63, 345-382.

Furuichi, Y., Morgan M., Muthukrishnan S. and Shatkin A. J. (1975) Reovirus messenger RNA contains a methylated, blocked 5'-terminal structure: m-7G(5')ppp(5')G-MpCp. Proc Natl Acad Sci U S A, 72, 362-366.

Furukawa, Y. and O'Halloran T. V. (2006) Posttranslational modifications in Cu,Zn- superoxide dismutase and mutations associated with amyotrophic lateral sclerosis. Antioxid Redox Signal, 8, 847-867.

Gajdusek, D. C. (1994) Nucleation of amyloidogenesis in infectious and noninfectious amyloidoses of brain. Ann N Y Acad Sci, 724, 173-190.

Gajdusek, D. C. and Salazar A. M. (1982) Amyotrophic lateral sclerosis and parkinsonian syndromes in high incidence among the Auyu and Jakai people of West New Guinea. Neurology, 32, 107-126.

Gallagher, J. P. and Sanders M. (1987) Trauma and amyotrophic lateral sclerosis: a report of 78 patients. Acta Neurol Scand, 75, 145-150.

Gallagher, J. P. and Talbert O. R. (1991) Motor neuron syndrome after electric shock. Acta Neurol Scand, 83, 79-82.

Gallo, J. M., Jin P., Thornton C. A., Lin H., Robertson J., D'Souza I. and Schlaepfer W. W. (2005) The role of RNA and RNA processing in neurodegeneration. J Neurosci, 25, 10372-10375.

Ganns, D., Schrödl F., Neuhuber W. and Brehmer A. (2006) Investigation of general and cytoskeletal markers to estimate numbers and proportions of neurons in the human intestine. Histol Histopathol, 21, 41-51 164

Garcia-Blanco, M. A., Baraniak A. P. and Lasda E. L. (2004) Alternative splicing in disease and therapy. Nat Biotechnol, 22, 535-546.

Gelinas, S., Chapados C., Beauregard M., Gosselin I. and Martinoli M. G. (2000) Effect of oxidative stress on stability and structure of neurofilament proteins. Biochem Cell Biol, 78, 667-674.

Gellera, C., Castellotti B., Riggio M. C. et al. (2001) Superoxide dismutase gene mutations in Italian patients with familial and sporadic amyotrophic lateral sclerosis: identification of three novel missense mutations. Neuromuscul Disord, 11, 404-410.

Giasson, B. I. and Mushynski W. E. (1997) Developmentally regulated stabilization of neuronal intermediate filaments in rat cerebral cortex. Neurosci Lett, 229, 77-80.

Giess, R., Beck M., Goetz R., Nitsch R. M., Toyka K. V. and Sendtner M. (2000) Potential role of LIF as a modifier gene in the pathogenesis of amyotrophic lateral sclerosis. Neurology, 54, 1003-1005.

Glabe, C. G. and Kayed R. (2006) Common structure and toxic function of amyloid oligomers implies a common mechanism of pathogenesis. Neurology, 66, S74-78.

Goebel, H. H. (1997) Desmin-related myopathies. Curr Opin Neurol, 10, 426-429.

Goldman, R. D. (2001) Worms reveal essential functions for intermediate filaments. Proc Natl Acad Sci U S A, 98, 7659-7661.

Goldman, R. D., Grin B., Mendez M. G. and Kuczmarski E. R. (2008) Intermediate filaments: versatile building blocks of cell structure. Curr Opin Cell Biol, 20, 28-34.

Goldstein, A. Y., Wang X. and Schwarz T. L. (2008) Axonal transport and the delivery of pre-synaptic components. Curr Opin Neurobiol, 18, 495-503.

Goldstein, M. E., Weiss S. R., Lazzarini R. A., Shneidman P. S., Lees J. F. and Schlaepfer W. W. (1988) mRNA levels of all three neurofilament proteins decline following nerve transection. Brain Res, 427, 287-291.

Gong, Y. H., Parsadanian A. S., Andreeva A., Snider W. D. and Elliott J. L. (2000) Restricted expression of G86R Cu/Zn superoxide dismutase in astrocytes results in astrocytosis but does not cause motoneuron degeneration. J Neurosci, 20, 660-665.

Goodall, E. F., Greenway M. J., van Marion I., Carroll C. B., Hardiman O. and Morrison K. E. (2005) Association of the H63D polymorphism in the hemochromatosis gene with sporadic ALS. Neurology, 65, 934-937.

Gould, T. W., Buss R. R., Vinsant S., Prevette D., Sun W., Knudson C. M., Milligan C. E. and Oppenheim R. W. (2006) Complete dissociation of motor neuron death from motor dysfunction by Bax deletion in a mouse model of ALS. J Neurosci, 26, 8774-8786. 165

Gowing, G., Philips T., Van Wijmeersch B., Audet J. N., Dewil M., Van Den Bosch L., Billiau A. D., Robberecht W. and Julien J. P. (2008) Ablation of proliferating microglia does not affect motor neuron degeneration in amyotrophic lateral sclerosis caused by mutant superoxide dismutase. J Neurosci, 28, 10234-10244.

Granieri, E., Carreras M., Tola R., Paolino E., Tralli G., Eleopra R. and Serra G. (1988) Motor neuron disease in the province of Ferrara, Italy, in 1964-1982. Neurology, 38, 1604-1608.

Green, K. J., Virata M. L., Elgart G. W., Stanley J. R. and Parry D. A. (1992) Comparative structural analysis of , bullous pemphigoid antigen and : members of a new gene family involved in organization of intermediate filaments. Int J Biol Macromol, 14, 145-53.

Greenway, M. J., Andersen P. M., Russ C. et al. (2006) ANG mutations segregate with familial and 'sporadic' amyotrophic lateral sclerosis. Nat Genet, 38, 411-413.

Grignaschi, G. and Samanin R. (1992) Role of serotonin and catecholamines in brain in the feeding suppressant effect of fluoxetine. Neuropharmacology, 31, 445-449.

Gros-Louis, F., Gaspar C. and Rouleau G. A. (2006) Genetics of familial and sporadic amyotrophic lateral sclerosis. Biochim Biophys Acta, 1762, 956-972.

Gros-Louis, F., Lariviere R., Gowing G., Laurent S., Camu W., Bouchard J. P., Meininger V., Rouleau G. A. and Julien J. P. (2004) A frameshift deletion in peripherin gene associated with amyotrophic lateral sclerosis. J Biol Chem, 279, 45951-45956.

Grosskreutz, J., Peschel T., Unrath A., Dengler R., Ludolph A. C. and Kassubek J. (2008) Whole brain-based computerized neuroimaging in ALS and other motor neuron disorders. Amyotroph Lateral Scler, 9, 238-248.

Gubbay, S. S., Kahana E., Zilber N., Cooper G., Pintov S. and Leibowitz Y. (1985) Amyotrophic lateral sclerosis. A study of its presentation and prognosis. J Neurol, 232, 295-300.

Gurney, M. E. (1997) The use of transgenic mouse models of amyotrophic lateral sclerosis in preclinical drug studies. J Neurol Sci, 152 Suppl 1, S67-73.

Gurney, M. E., Pu H., Chiu A. Y. et al. (1994) Motor neuron degeneration in mice that express a human Cu,Zn superoxide dismutase mutation. Science, 264, 1772-1775.

Haass, C. and Selkoe D. J. (2007) Soluble protein oligomers in neurodegeneration: lessons from the Alzheimer's amyloid beta-peptide. Nat Rev Mol Cell Biol, 8, 101-112.

Hadano, S., Hand C. K., Osuga H. et al. (2001) A gene encoding a putative GTPase regulator is mutated in familial amyotrophic lateral sclerosis 2. Nat Genet, 29, 166-173. 166

Hadano, S., Kunita R., Otomo A., Suzuki-Utsunomiya K. and Ikeda J. E. (2007) Molecular and cellular function of ALS2/alsin: implication of membrane dynamics in neuronal development and degeneration. Neurochem Int, 51, 74-84.

Hafezparast, M., Klocke R., Ruhrberg C. et al. (2003) Mutations in dynein link motor neuron degeneration to defects in retrograde transport. Science, 300, 808-812.

Hall, E. D., Oostveen J. A. and Gurney M. E. (1998) Relationship of microglial and astrocytic activation to disease onset and progression in a transgenic model of familial ALS. Glia, 23, 249-256.

Halliwell, B. and Gutteridge J. M. C. (2007) Free radicals in biology and medicine. Oxford University Press, Oxford ; New York.

Harper, J. D. and Lansbury P. T., Jr. (1997) Models of amyloid seeding in Alzheimer's disease and scrapie: mechanistic truths and physiological consequences of the time- dependent solubility of amyloid proteins. Annu Rev Biochem, 66, 385-407.

Harper, J. D., Wong S. S., Lieber C. M. and Lansbury P. T., Jr. (1999) Assembly of A beta amyloid protofibrils: an in vitro model for a possible early event in Alzheimer's disease. Biochemistry, 38, 8972-8980.

Hayashi, S., Sakurai A., Amari M. and Okamoto K. (2001) Pathological study of the diffuse myelin pallor in the anterolateral columns of the spinal cord in amyotrophic lateral sclerosis. J Neurol Sci, 188, 3-7.

Hayward, C., Colville S., Swingler R. J. and Brock D. J. (1999) Molecular genetic analysis of the APEX nuclease gene in amyotrophic lateral sclerosis. Neurology, 52, 1899-1901.

Hayward, L. J., Rodriguez J. A., Kim J. W., Tiwari A., Goto J. J., Cabelli D. E., Valentine J. S. and Brown R. H., Jr. (2002) Decreased metallation and activity in subsets of mutant superoxide dismutases associated with familial amyotrophic lateral sclerosis. J Biol Chem, 277, 15923-15931.

He, B. P. and Strong M. J. (2000) Motor neuronal death in sporadic amyotrophic lateral sclerosis (ALS) is not apoptotic. A comparative study of ALS and chronic aluminium chloride neurotoxicity in New Zealand white rabbits. Neuropathol Appl Neurobiol, 26, 150-160.

He, B. P., Wen W. and Strong M. J. (2002) Activated microglia (BV-2) facilitation of TNF-alpha-mediated motor neuron death in vitro. J Neuroimmunol, 128, 31-38.

He, C. Z. and Hays A. P. (2004) Expression of peripherin in ubiquinated inclusions of amyotrophic lateral sclerosis. J Neurol Sci, 217, 47-54.

Helfand, B. T., Chang L. and Goldman R. D. (2004) Intermediate filaments are dynamic and motile elements of cellular architecture. J Cell Sci, 117, 133-141. 167

Helfand, B. T., Loomis P., Yoon M. and Goldman R. D. (2003a) Rapid transport of neural intermediate filament protein. J Cell Sci, 116, 2345-2359.

Helfand, B. T., Mendez M. G., Pugh J., Delsert C. and Goldman R. D. (2003b) A role for intermediate filaments in determining and maintaining the shape of nerve cells. Mol Biol Cell, 14, 5069-5081.

Henkel, J. S., Engelhardt J. I., Siklos L. et al. (2004) Presence of dendritic cells, MCP-1, and activated microglia/macrophages in amyotrophic lateral sclerosis spinal cord tissue. Ann Neurol, 55, 221-235.

Hensley, K., Floyd R. A., Gordon B., Mou S., Pye Q. N., Stewart C., West M. and Williamson K. (2002) Temporal patterns of cytokine and apoptosis-related gene expression in spinal cords of the G93A-SOD1 mouse model of amyotrophic lateral sclerosis. J Neurochem, 82, 365-374.

Hensley, K., Mhatre M., Mou S., Pye Q. N., Stewart C., West M. and Williamson K. S. (2006) On the relation of oxidative stress to neuroinflammation: lessons learned from the G93A-SOD1 mouse model of amyotrophic lateral sclerosis. Antioxid Redox Signal, 8, 2075-2087.

Hentati, A., Bejaoui K., Pericak-Vance M. A. et al. (1994) Linkage of recessive familial amyotrophic lateral sclerosis to chromosome 2q33-q35. Nat Genet, 7, 425-428.

Hentati, A., Ouahchi K., Pericak-Vance M. A. et al. (1998) Linkage of a commoner form of recessive amyotrophic lateral sclerosis to chromosome 15q15-q22 markers. Neurogenetics, 2, 55-60.

Herrmann, H., Bar H., Kreplak L., Strelkov S. V. and Aebi U. (2007) Intermediate filaments: from cell architecture to nanomechanics. Nat Rev Mol Cell Biol, 8, 562-573.

Hervias, I., Beal M. F. and Manfredi G. (2006) Mitochondrial dysfunction and amyotrophic lateral sclerosis. Muscle Nerve, 33, 598-608.

Higgins, C. M., Jung C. and Xu Z. (2003) ALS-associated mutant SOD1G93A causes mitochondrial vacuolation by expansion of the intermembrane space and by involvement of SOD1 aggregation and peroxisomes. BMC Neurosci, 4, 16.

Hirano, A. (1991) Cytopathology of amyotrophic lateral sclerosis. Adv Neurol, 56, 91- 101.

Hirano, A., Donnenfeld H., Sasaki S. and Nakano I. (1984) Fine structural observations of neurofilamentous changes in amyotrophic lateral sclerosis. J Neuropathol Exp Neurol, 43, 461-470.

Hirano, A., Kurland L. T., Krooth R. S. and Lessell S. (1961a) Parkinsonism-dementia complex, an endemic disease on the island of Guam. I. Clinical features. Brain, 84, 642- 661. 168

Hirano, A., Kurland L. T. and Sayre G. P. (1967) Familial amyotrophic lateral sclerosis. A subgroup characterized by posterior and spinocerebellar tract involvement and hyaline inclusions in the anterior horn cells. Arch Neurol, 16, 232-243.

Hirano, A., Malamud N. and Kurland L. T. (1961b) Parkinsonism-dementia complex, an endemic disease on the island of Guam. II. Pathological features. Brain, 84, 662-679.

Hirokawa, N. and Takemura R. (2005) Molecular motors and mechanisms of directional transport in neurons. Nat Rev Neurosci, 6, 201-214.

Hiruma, H., Katakura T., Takahashi S., Ichikawa T. and Kawakami T. (2003) Glutamate and amyloid beta-protein rapidly inhibit fast axonal transport in cultured rat hippocampal neurons by different mechanisms. J Neurosci, 23, 8967-8977.

Ho, C. L., Chien C. L., Brown K. and Liem R. K. (1998a) Ultrastructural studies of carboxyl-terminal truncation mutants of the neuronal intermediate filament protein peripherin. J Neurochem, 70, 1916-1924.

Ho, C. L., Chin S. S., Carnevale K. and Liem R. K. (1995) Translation initiation and assembly of peripherin in cultured cells. Eur J Cell Biol, 68, 103-112.

Ho, Y. S., Gargano M., Cao J., Bronson R. T., Heimler I. and Hutz R. J. (1998b) Reduced fertility in female mice lacking copper-zinc superoxide dismutase. J Biol Chem, 273, 7765-7769.

Hoffman, P. N., Cleveland D. W., Griffin J. W., Landes P. W., Cowan N. J. and Price D. L. (1987) Neurofilament gene expression: a major determinant of axonal caliber. Proc Natl Acad Sci U S A, 84, 3472-3476.

Horner, R. D., Kamins K. G., Feussner J. R. et al. (2003) Occurrence of amyotrophic lateral sclerosis among Gulf War veterans. Neurology, 61, 742-749.

Hossmann, K. A. (1994) Glutamate-mediated injury in focal cerebral ischemia: the excitotoxin hypothesis revised. Brain Pathol, 4, 23-36.

Hough, M. A., Grossmann J. G., Antonyuk S. V. et al. (2004) Dimer destabilization in superoxide dismutase may result in disease-causing properties: structures of motor neuron disease mutants. Proc Natl Acad Sci U S A, 101, 5976-5981.

Houseweart, M. K. and Cleveland D. W. (1999) Cytoskeletal linkers: new MAPs for old destinations. Curr Biol, 9, R864-866.

Huc, C., Escurat M., Djabali K., Derer M., Landon F., Gros F. and Portier M. M. (1989) Phosphorylation of peripherin, an intermediate filament protein, in mouse neuroblastoma NIE 115 cell line and in sympathetic neurons. Biochem Biophys Res Commun, 160, 772- 779. 169

Ihara, Y., Nobukuni K., Takata H. and Hayabara T. (2005) Oxidative stress and metal content in blood and cerebrospinal fluid of amyotrophic lateral sclerosis patients with and without a Cu, Zn-superoxide dismutase mutation. Neurol Res, 27, 105-108.

Ince, P. G., Tomkins J., Slade J. Y., Thatcher N. M. and Shaw P. J. (1998) Amyotrophic lateral sclerosis associated with genetic abnormalities in the gene encoding Cu/Zn superoxide dismutase: molecular pathology of five new cases, and comparison with previous reports and 73 sporadic cases of ALS. J Neuropathol Exp Neurol, 57, 895-904.

Iqbal, K., Liu F., Gong C. X., Alonso A. D. and Grundke-Iqbal I. (2009) Mechanisms of tau-induced neurodegeneration. Acta Neuropathol.

Izawa, I. and Inagaki M. (2006) Regulatory mechanisms and functions of intermediate filaments: a study using site- and phosphorylation state-specific antibodies. Cancer Sci, 97, 167-174.

Jaarsma, D., Haasdijk E. D., Grashorn J. A., Hawkins R., van Duijn W., Verspaget H. W., London J. and Holstege J. C. (2000) Human Cu/Zn superoxide dismutase (SOD1) overexpression in mice causes mitochondrial vacuolization, axonal degeneration, and premature motoneuron death and accelerates motoneuron disease in mice expressing a familial amyotrophic lateral sclerosis mutant SOD1. Neurobiol Dis, 7, 623-643.

Jaarsma, D., Rognoni F., van Duijn W., Verspaget H. W., Haasdijk E. D. and Holstege J. C. (2001) CuZn superoxide dismutase (SOD1) accumulates in vacuolated mitochondria in transgenic mice expressing amyotrophic lateral sclerosis-linked SOD1 mutations. Acta Neuropathol, 102, 293-305.

Jablecki, C. K., Berry C. and Leach J. (1989) Survival prediction in amyotrophic lateral sclerosis. Muscle Nerve, 12, 833-841.

Jackson, M., Al-Chalabi A., Enayat Z. E., Chioza B., Leigh P. N. and Morrison K. E. (1997) Copper/zinc superoxide dismutase 1 and sporadic amyotrophic lateral sclerosis: analysis of 155 cases and identification of a novel insertion mutation. Ann Neurol, 42, 803-807.

Jafari, H., Couratier P. and Camu W. (2001) Motor neuron disease after electric injury. J Neurol Neurosurg Psychiatry, 71, 265-267.

Johansson, A., Engler H., Blomquist G., Scott B., Wall A., Aquilonius S. M., Langstrom B. and Askmark H. (2007) Evidence for astrocytosis in ALS demonstrated by [11C](L)- deprenyl-D2 PET. J Neurol Sci, 255, 17-22.

Johnston, J. A., Dalton M. J., Gurney M. E. and Kopito R. R. (2000) Formation of high molecular weight complexes of mutant Cu, Zn-superoxide dismutase in a mouse model for familial amyotrophic lateral sclerosis. Proc Natl Acad Sci U S A, 97, 12571-12576. 170

Jones, C. T., Swingler R. J. and Brock D. J. (1994) Identification of a novel SOD1 mutation in an apparently sporadic amyotrophic lateral sclerosis patient and the detection of Ile113Thr in three others. Hum Mol Genet, 3, 649-650.

Jonsson, P. A., Graffmo K. S., Brannstrom T., Nilsson P., Andersen P. M. and Marklund S. L. (2006) Motor neuron disease in mice expressing the wild type-like D90A mutant superoxide dismutase-1. J Neuropathol Exp Neurol, 65, 1126-1136.

Julien, J. P. and Beaulieu J. M. (2000) Cytoskeletal abnormalities in amyotrophic lateral sclerosis: beneficial or detrimental effects? J Neurol Sci, 180, 7-14.

Julien, J. P. and Mushynski W. E. (1998) Neurofilaments in health and disease. Prog Nucleic Acid Res Mol Biol, 61, 1-23.

Jung, C., Higgins C. M. and Xu Z. (2002) Mitochondrial electron transport chain complex dysfunction in a transgenic mouse model for amyotrophic lateral sclerosis. J Neurochem, 83, 535-545.

Jung, C., Lee S., Ortiz D., Zhu Q., Julien J. P. and Shea T. B. (2005) The high and middle molecular weight neurofilament subunits regulate the association of neurofilaments with kinesin: inhibition by phosphorylation of the high molecular weight subunit. Brain Res Mol Brain Res, 141, 151-155.

Kabashi, E. and Durham H. D. (2006) Failure of protein quality control in amyotrophic lateral sclerosis. Biochim Biophys Acta, 1762, 1038-1050.

Kabashi, E., Valdmanis P. N., Dion P. et al. (2008) TARDBP mutations in individuals with sporadic and familial amyotrophic lateral sclerosis. Nat Genet, 40, 572-574.

Kamel, F., Umbach D. M., Munsat T. L., Shefner J. M. and Sandler D. P. (1999) Association of cigarette smoking with amyotrophic lateral sclerosis. Neuroepidemiology, 18, 194-202.

Kanitakis, J., Bourchany D., Faure M. and Claudy A. (1998) Expression of the intermediate filament peripherin in skin tumors. Eur J Dermatol, 8, 339-42

Karpov, V., Landon F., Djabali K., Gros F. and Portier M. M. (1992) Structure of the mouse gene encoding peripherin: a neuronal intermediate filament protein. Biol Cell, 76, 43-48.

Kato, S. (2008) Amyotrophic lateral sclerosis models and human neuropathology: similarities and differences. Acta Neuropathol, 115, 97-114.

Kato, S., Hayashi H. and Yagishita A. (1993) Involvement of the frontotemporal lobe and limbic system in amyotrophic lateral sclerosis: as assessed by serial computed tomography and magnetic resonance imaging. J Neurol Sci, 116, 52-58. 171

Kato, S., Horiuchi S., Liu J. et al. (2000) Advanced glycation endproduct-modified superoxide dismutase-1 (SOD1)-positive inclusions are common to familial amyotrophic lateral sclerosis patients with SOD1 gene mutations and transgenic mice expressing human SOD1 with a G85R mutation. Acta Neuropathol, 100, 490-505.

Kato, T., Katagiri T., Hirano A., Kawanami T. and Sasaki H. (1989) Lewy body-like hyaline inclusions in sporadic motor neuron disease are ubiquitinated. Acta Neuropathol, 77, 391-396.

Katzman, R., Terry R., DeTeresa R., Brown T., Davies P., Fuld P., Renbing X. and Peck A. (1988) Clinical, pathological, and neurochemical changes in dementia: a subgroup with preserved mental status and numerous neocortical plaques. Ann Neurol, 23, 138- 144.

Kawamata, T., Akiyama H., Yamada T. and McGeer P. L. (1992) Immunologic reactions in amyotrophic lateral sclerosis brain and spinal cord tissue. Am J Pathol, 140, 691-707.

Kawase, M., Murakami K., Fujimura M., Morita-Fujimura Y., Gasche Y., Kondo T., Scott R. W. and Chan P. H. (1999) Exacerbation of delayed cell injury after transient global ischemia in mutant mice with CuZn superoxide dismutase deficiency. Stroke, 30, 1962-1968.

Kent-Braun, J. A., Walker C. H., Weiner M. W. and Miller R. G. (1998) Functional significance of upper and lower motor neuron impairment in amyotrophic lateral sclerosis. Muscle Nerve, 21, 762-768.

Kieran, D., Sebastia J., Greenway M. J., King M. A., Connaughton D., Concannon C. G., Fenner B., Hardiman O. and Prehn J. H. (2008) Control of motoneuron survival by angiogenin. J Neurosci, 28, 14056-14061.

Kim, N. H., Jeong M. S., Choi S. Y. and Hoon Kang J. (2004) Oxidative modification of neurofilament-L by the Cu,Zn-superoxide dismutase and hydrogen peroxide system. Biochimie, 86, 553-559.

Kim, N. H. and Kang J. H. (2003) Oxidative modification of neurofilament-L by copper- catalyzed reaction. J Biochem Mol Biol, 36, 488-492.

Kim, S. and Coulombe P. A. (2007) Intermediate filament scaffolds fulfill mechanical, organizational, and signaling functions in the cytoplasm. Genes Dev, 21, 1581-1597.

Kim, S., Wong P. and Coulombe P. A. (2006) A keratin cytoskeletal protein regulates protein synthesis and epithelial cell growth. Nature, 441, 362-365.

Kindler, S., Wang H., Richter D. and Tiedge H. (2005) RNA transport and local control of translation. Annu Rev Cell Dev Biol, 21, 223-245. 172

Klement, I. A., Skinner P. J., Kaytor M. D., Yi H., Hersch S. M., Clark H. B., Zoghbi H. Y. and Orr H. T. (1998) Ataxin-1 nuclear localization and aggregation: role in polyglutamine-induced disease in SCA1 transgenic mice. Cell, 95, 41-53.

Ko, T. L., Chien C. L. and Lu K. S. (2005) The expression of alpha-internexin and peripherin in the developing mouse pineal gland. J Biomed Sci, 12, 777-789.

Kochanski, A. (2004) Mutations in the neurofilament light chain gene (NEFL)--a study of a possible pathogenous effect. Folia Neuropathol, 42, 187-190.

Kokubo, Y., Kuzuhara S. and Narita Y. (2000) Geographical distribution of amyotrophic lateral sclerosis with neurofibrillary tangles in the Kii Peninsula of Japan. J Neurol, 247, 850-852.

Kong, J. and Xu Z. (1998) Massive mitochondrial degeneration in motor neurons triggers the onset of amyotrophic lateral sclerosis in mice expressing a mutant SOD1. J Neurosci, 18, 3241-3250.

Konishi, H., Namikawa K., Shikata K., Kobatake Y., Tachibana T. and Kiyama H. (2007) Identification of peripherin as a Akt substrate in neurons. J Biol Chem, 282, 23491- 23499.

Kostic, V., Gurney M. E., Deng H. X., Siddique T., Epstein C. J. and Przedborski S. (1997) dopaminergic neuronal degeneration in a transgenic mouse model of familial amyotrophic lateral sclerosis. Ann Neurol, 41, 497-504.

Kouklis, P. D., Hatzfeld M., Brunkener M., Weber K. and Georgatos S. D. (1993) In vitro assembly properties of vimentin mutagenized at the beta-site tail motif. J Cell Sci, 106 ( Pt 3), 919-928.

Kozak, M. (1986) Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell, 44, 283-292.

Kozak, M. (2002a) Emerging links between initiation of translation and human diseases. Mamm Genome, 13, 401-410.

Kozak, M. (2002b) Pushing the limits of the scanning mechanism for initiation of translation. Gene, 299, 1-34.

Kreplak, L., Aebi U. and Herrmann H. (2004) Molecular mechanisms underlying the assembly of intermediate filaments. Exp Cell Res, 301, 77-83.

Kriz, J., Beaulieu J. M., Julien J. P. and Krnjevic K. (2005) Up-regulation of peripherin is associated with alterations in synaptic plasticity in CA1 and CA3 regions of hippocampus. Neurobiol Dis, 18, 409-420. 173

Kriz, J., Meier J., Julien J. P. and Padjen A. L. (2000) Altered ionic conductances in axons of transgenic mouse expressing the human neurofilament heavy gene: A mouse model of amyotrophic lateral sclerosis. Exp Neurol, 163, 414-421.

Kunita, R., Otomo A., Mizumura H., Suzuki K., Showguchi-Miyata J., Yanagisawa Y., Hadano S. and Ikeda J. E. (2004) Homo-oligomerization of ALS2 through its unique carboxyl-terminal regions is essential for the ALS2-associated Rab5 guanine nucleotide exchange activity and its regulatory function on endosome trafficking. J Biol Chem, 279, 38626-38635.

Kuriyama, K. and Taguchi J. (1984) Purification of gamma-aminobutyric acid (GABA) and benzodiazepine receptors from rat brain using benzodiazepine-affinity column chromatography. Adv Exp Med Biol, 175, 221-233.

Kurland, L. T. and Mulder D. W. (1954a) Epidemiologic investigations of amyotrophic lateral sclerosis. I. Preliminary report on geographic distribution and special reference to the Mariana Islands, including clinical and pathologic observations. Neurology, 4, 438- 448.

Kurland, L. T. and Mulder D. W. (1954b) Epidemiologic investigations of amyotrophic lateral sclerosis. I. Preliminary report on geographic distribution, with special reference to the Mariana Islands, including clinical and pathologic observations. Neurology, 4, 355- 378.

Kurland, L. T., Radhakrishnan K., Smith G. E., Armon C. and Nemetz P. N. (1992) Mechanical trauma as a risk factor in classic amyotrophic lateral sclerosis: lack of epidemiologic evidence. J Neurol Sci, 113, 133-143.

Kusumoto, Y., Lomakin A., Teplow D. B. and Benedek G. B. (1998) Temperature dependence of amyloid beta-protein fibrillization. Proc Natl Acad Sci U S A, 95, 12277- 12282.

Kwiatkowski, T. J., Jr., Bosco D. A., Leclerc A. L. et al. (2009) Mutations in the FUS/TLS gene on chromosome 16 cause familial amyotrophic lateral sclerosis. Science, 323, 1205-1208.

Lacomblez, L., Bensimon G., Leigh P. N., Guillet P. and Meininger V. (1996) Dose- ranging study of riluzole in amyotrophic lateral sclerosis. Amyotrophic Lateral Sclerosis/Riluzole Study Group II. Lancet, 347, 1425-1431.

Lagier-Tourenne, C. and Cleveland D. W. (2009) Rethinking ALS: the FUS about TDP- 43. Cell, 136, 1001-1004.

Lalancette-Hebert, M., Gowing G., Simard A., Weng Y. C. and Kriz J. (2007) Selective ablation of proliferating microglial cells exacerbates ischemic injury in the brain. J Neurosci, 27, 2596-2605. 174

Lambrechts, D., Storkebaum E., Morimoto M. et al. (2003) VEGF is a modifier of amyotrophic lateral sclerosis in mice and humans and protects motoneurons against ischemic death. Nat Genet, 34, 383-394.

LaMonte, B. H., Wallace K. E., Holloway B. A., Shelly S. S., Ascano J., Tokito M., Van Winkle T., Howland D. S. and Holzbaur E. L. (2002) Disruption of dynein/dynactin inhibits axonal transport in motor neurons causing late-onset progressive degeneration. Neuron, 34, 715-727.

Lampson, L. A., Kushner P. D. and Sobel R. A. (1990) Major histocompatibility complex antigen expression in the affected tissues in amyotrophic lateral sclerosis. Ann Neurol, 28, 365-372.

Lander, E. S., Linton L. M., Birren B. et al. (2001) Initial sequencing and analysis of the human genome. Nature, 409, 860-921.

Landon, F., Lemonnier M., Benarous R., Huc C., Fiszman M., Gros F. and Portier M. M. (1989) Multiple mRNAs encode peripherin, a neuronal intermediate filament protein. EMBO J, 8, 1719-1726.

Landon, F., Wolff A. and de Nechaud B. (2000) Mouse peripherin isoforms. Biol Cell, 92, 397-407.

Langmore, S. E., Kasarskis E. J., Manca M. L. and Olney R. K. (2006) Enteral tube feeding for amyotrophic lateral sclerosis/motor neuron disease. Cochrane Database Syst Rev, CD004030.

Lansbury, P. T. and Lashuel H. A. (2006) A century-old debate on protein aggregation and neurodegeneration enters the clinic. Nature, 443, 774-779.

Lariviere, R. C., Beaulieu J. M., Nguyen M. D. and Julien J. P. (2003) Peripherin is not a contributing factor to motor neuron disease in a mouse model of amyotrophic lateral sclerosis caused by mutant superoxide dismutase. Neurobiol Dis, 13, 158-166.

Lariviere, R. C. and Julien J. P. (2004) Functions of intermediate filaments in neuronal development and disease. J Neurobiol, 58, 131-148.

Lariviere, R. C., Nguyen M. D., Ribeiro-da-Silva A. and Julien J. P. (2002) Reduced number of unmyelinated sensory axons in peripherin null mice. J Neurochem, 81, 525- 532.

Lavedan, C., Buchholtz S., Nussbaum R. L., Albin R. L. and Polymeropoulos M. H. (2002) A mutation in the human neurofilament M gene in Parkinson's disease that suggests a role for the cytoskeleton in neuronal degeneration. Neurosci Lett, 322, 57-61.

Layfield, R., Lowe J. and Bedford L. (2005) The ubiquitin-proteasome system and neurodegenerative disorders. Essays Biochem, 41, 157-171. 175

Lecomte, M. J., Basseville M., Landon F., Karpov V. and Fauquet M. (1998) Transcriptional activation of the mouse peripherin gene by leukemia inhibitory factor: involvement of STAT proteins. J Neurochem, 70, 971-982.

Lee, M. K., Marszalek J. R. and Cleveland D. W. (1994) A mutant neurofilament subunit causes massive, selective motor neuron death: implications for the pathogenesis of human motor neuron disease. Neuron, 13, 975-988.

Lee, M. K., Xu Z., Wong P. C. and Cleveland D. W. (1993) Neurofilaments are obligate heteropolymers in vivo. J Cell Biol, 122, 1337-1350.

Lee, V. M., Elder G. A., Chen L. C., Liang Z., Snyder S. E., Friedrich V. L., Jr. and Lazzarini R. A. (1992) Expression of human mid-sized neurofilament subunit in transgenic mice. Brain Res Mol Brain Res, 15, 76-84.

Lee, V. M., Goedert M. and Trojanowski J. Q. (2001) Neurodegenerative . Annu Rev Neurosci, 24, 1121-59.

Leidhold, C. and Voos W. (2007) Chaperones and proteases--guardians of protein integrity in eukaryotic organelles. Ann N Y Acad Sci, 1113, 72-86.

Leigh, P. N., Anderton B. H., Dodson A., Gallo J. M., Swash M. and Power D. M. (1988) Ubiquitin deposits in anterior horn cells in motor neurone disease. Neurosci Lett, 93, 197- 203.

Leigh, P. N., Whitwell H., Garofalo O., Buller J., Swash M., Martin J. E., Gallo J. M., Weller R. O. and Anderton B. H. (1991) Ubiquitin-immunoreactive intraneuronal inclusions in amyotrophic lateral sclerosis. Morphology, distribution, and specificity. Brain, 114 ( Pt 2), 775-788.

Leonard, D. G., Gorham J. D., Cole P., Greene L. A. and Ziff E. B. (1988) A nerve growth factor-regulated messenger RNA encodes a new intermediate filament protein. J Cell Biol, 106, 181-193.

Leonard, D. G., Ziff E. B. and Greene L. A. (1987) Identification and characterization of mRNAs regulated by nerve growth factor in PC12 cells. Mol Cell Biol, 7, 3156-3167.

Leung, C. L., He C. Z., Kaufmann P., Chin S. S., Naini A., Liem R. K., Mitsumoto H. and Hays A. P. (2004) A pathogenic peripherin gene mutation in a patient with amyotrophic lateral sclerosis. Brain Pathol, 14, 290-296.

Leung, C. L., Sun D. and Liem R. K. (1999) The intermediate filament protein peripherin is the specific interaction partner of mouse BPAG1-n (dystonin) in neurons. J Cell Biol, 144, 435-446.

Levine, H., 3rd (1995) Soluble multimeric Alzheimer beta(1-40) pre-amyloid complexes in dilute solution. Neurobiol Aging, 16, 755-764. 176

Levine, R. L. (2002) Carbonyl modified proteins in cellular regulation, aging, and disease. Free Radic Biol Med, 32, 790-796.

Li, R., Messing A., Goldman J. E. and Brenner M. (2002) GFAP mutations in Alexander disease. Int J Dev Neurosci, 20, 259-268.

Li, T. M., Alberman E. and Swash M. (1988) Comparison of sporadic and familial disease amongst 580 cases of motor neuron disease. J Neurol Neurosurg Psychiatry, 51, 778-784.

Li, Y. J., Pericak-Vance M. A., Haines J. L. et al. (2004) Apolipoprotein E is associated with age at onset of amyotrophic lateral sclerosis. Neurogenetics, 5, 209-213.

Licatalosi, D. D. and Darnell R. B. (2006) Splicing regulation in neurologic disease. Neuron, 52, 93-101.

Lin, C. L., Bristol L. A., Jin L., Dykes-Hoberg M., Crawford T., Clawson L. and Rothstein J. D. (1998) Aberrant RNA processing in a neurodegenerative disease: the cause for absent EAAT2, a glutamate transporter, in amyotrophic lateral sclerosis. Neuron, 20, 589-602.

Lin, H. and Schlaepfer W. W. (2006) Role of neurofilament aggregation in motor neuron disease. Ann Neurol, 60, 399-406.

Lindberg, M. J., Bystrom R., Boknas N., Andersen P. M. and Oliveberg M. (2005) Systematically perturbed folding patterns of amyotrophic lateral sclerosis (ALS)- associated SOD1 mutants. Proc Natl Acad Sci U S A, 102, 9754-9759.

Lindegren, H., Ostlund P., Gyllberg H. and Bedecs K. (2003) Loss of lipopolysaccharide- induced nitric oxide production and inducible nitric oxide synthase expression in scrapie- infected N2a cells. J Neurosci Res, 71, 291-299.

Lino, M. M., Schneider C. and Caroni P. (2002) Accumulation of SOD1 mutants in postnatal motoneurons does not cause motoneuron pathology or motoneuron disease. J Neurosci, 22, 4825-4832.

Lipscombe, D. (2005) Neuronal proteins custom designed by alternative splicing. Curr Opin Neurobiol, 15, 358-363.

Liu, Q., Lee H. G., Honda K., Siedlak S. L., Harris P. L., Cash A.D., Zhu X., Avila J., Nunomura A., Takeda A., Smith M. A., and Perry G. (2005) Tau modifiers as therapeutic targets for Alzheimer's disease. Biochim Biophys Acta, 1739, 211-5.

Lobsiger, C. S., Boillee S., McAlonis-Downes M., Khan A. M., Feltri M. L., Yamanaka K. and Cleveland D. W. (2009) Schwann cells expressing dismutase active mutant SOD1 unexpectedly slow disease progression in ALS mice. Proc Natl Acad Sci U S A. 177

Logroscino, G., Traynor B. J., Hardiman O., Chio A., Couratier P., Mitchell J. D., Swingler R. J. and Beghi E. (2008) Descriptive epidemiology of amyotrophic lateral sclerosis: new evidence and unsolved issues. J Neurol Neurosurg Psychiatry, 79, 6-11.

Lomen-Hoerth, C. and Strong M. J. (2006) Frontotemporal dysfunction in amyotrophic lateral sclerosis. In: Amyotrophic lateral sclerosis, (H. Mitsumoto ed.), pp. 117-140. Tayloe & Francis Group, New York.

Lupski, J. R. (2000) Axonal Charcot-Marie-Tooth disease and the neurofilament light gene (NF-L). Am J Hum Genet, 67, 8-10.

Majoor-Krakauer, D., Ottman R., Johnson W. G. and Rowland L. P. (1994) Familial aggregation of amyotrophic lateral sclerosis, dementia, and Parkinson's disease: evidence of shared genetic susceptibility. Neurology, 44, 1872-1877.

Mandler, R. N., Anderson F. A., Jr., Miller R. G., Clawson L., Cudkowicz M. and Del Bene M. (2001) The ALS Patient Care Database: insights into end-of-life care in ALS. Amyotroph Lateral Scler Other Motor Neuron Disord, 2, 203-208.

Mann, D. M. and Esiri M. M. (1989) The pattern of acquisition of plaques and tangles in the brains of patients under 50 years of age with Down's syndrome. J Neurol Sci, 89, 169- 179.

Maracchioni, A., Totaro A., Angelini D. F., Di Penta A., Bernardi G., Carri M. T. and Achsel T. (2007) Mitochondrial damage modulates alternative splicing in neuronal cells: implications for neurodegeneration. J Neurochem, 100, 142-153.

Marquardt, G. and Lorenz R. (1999) Intrathecal baclofen for intractable spasticity in amyotrophic lateral sclerosis. J Neurol, 246, 619-620.

Maselli, R. A., Wollman R. L., Leung C., Distad B., Palombi S., Richman D. P., Salazar- Grueso E. F. and Roos R. P. (1993) Neuromuscular transmission in amyotrophic lateral sclerosis. Muscle Nerve, 16, 1193-1203.

Masui, Y., Mozai T. and Kakehi K. (1985) Functional and morphometric study of the liver in motor neuron disease. J Neurol, 232, 15-19.

Matsumoto, G., Stojanovic A., Holmberg C. I., Kim S. and Morimoto R. I. (2005) Structural properties and neuronal toxicity of amyotrophic lateral sclerosis-associated Cu/Zn superoxide dismutase 1 aggregates. J Cell Biol, 171, 75-85.

Matsusue, E., Sugihara S., Fujii S., Kinoshita T., Nakano T., Ohama E. and Ogawa T. (2007) Cerebral cortical and lesions in amyotrophic lateral sclerosis with dementia: correlation with MR and pathologic examinations. AJNR Am J Neuroradiol, 28, 1505-1510. 178

Mattiazzi, M., D'Aurelio M., Gajewski C. D., Martushova K., Kiaei M., Beal M. F. and Manfredi G. (2002) Mutated human SOD1 causes dysfunction of oxidative phosphorylation in mitochondria of transgenic mice. J Biol Chem, 277, 29626-29633.

McCluskey, L. (2007) Amyotrophic Lateral Sclerosis: ethical issues from diagnosis to end of life. NeuroRehabilitation, 22, 463-472.

McDermott, C. J. and Shaw P. J. (2008) Diagnosis and management of motor neurone disease. BMJ, 336, 658-662.

McLean, J. R., Sanelli T. R., Leystra-Lantz C., He B. P. and Strong M. J. (2005) Temporal profiles of neuronal degeneration, glial proliferation, and cell death in hNFL(+/+) and NFL(-/-) mice. Glia, 52, 59-69.

Meier, J., Couillard-Despres S., Jacomy H., Gravel C. and Julien J. P. (1999) Extra neurofilament NF-L subunits rescue motor neuron disease caused by overexpression of the human NF-H gene in mice. J Neuropathol Exp Neurol, 58, 1099-1110.

Mennini, T., Bigini P., Cagnotto A. et al. (2004) Glial activation and TNFR-I upregulation precedes motor dysfunction in the spinal cord of mnd mice. Cytokine, 25, 127-135.

Merigo, F., Mucignat-Caretta C. and Zancanaro C. (2005) Timing of neuronal intermediate filament proteins expression in the mouse vomeronasal organ during pre- and postnatal development. An immunohistochemical study. Chem Senses, 30, 707-717.

Meyer, T., Fromm A., Munch C. et al. (1999) The RNA of the glutamate transporter EAAT2 is variably spliced in amyotrophic lateral sclerosis and normal individuals. J Neurol Sci, 170, 45-50.

Mhatre, M., Floyd R. A. and Hensley K. (2004) Oxidative stress and neuroinflammation in Alzheimer's disease and amyotrophic lateral sclerosis: common links and potential therapeutic targets. J Alzheimers Dis, 6, 147-157.

Migheli, A., Pezzulo T., Attanasio A. and Schiffer D. (1993) Peripherin immunoreactive structures in amyotrophic lateral sclerosis. Lab Invest, 68, 185-191.

Millecamps, S., Robertson J., Lariviere R., Mallet J. and Julien J. P. (2006) Defective axonal transport of neurofilament proteins in neurons overexpressing peripherin. J Neurochem, 98, 926-938.

Miller, D. W., Cookson M. R. and Dickson D. W. (2004) Glial cell inclusions and the pathogenesis of neurodegenerative diseases. Neuron Glia Biol, 1, 13-21.

Miller, K. E. and Sheetz M. P. (2004) Axonal mitochondrial transport and potential are correlated. J Cell Sci, 117, 2791-2804. 179

Miller, R. G., Rosenberg J. A., Gelinas D. F. et al. (1999) Practice parameter: the care of the patient with amyotrophic lateral sclerosis (an evidence-based review): report of the Quality Standards Subcommittee of the American Academy of Neurology: ALS Practice Parameters Task Force. Neurology, 52, 1311-1323.

Millul, A., Beghi E., Logroscino G., Micheli A., Vitelli E. and Zardi A. (2005) Survival of patients with amyotrophic lateral sclerosis in a population-based registry. Neuroepidemiology, 25, 114-119.

Minc-Golomb, D., Knobler H. and Groner Y. (1991) Gene dosage of CuZnSOD and Down's syndrome: diminished prostaglandin synthesis in human trisomy 21, transfected cells and transgenic mice. EMBO J, 10, 2119-2124.

Missler, M. and Sudhof T. C. (1998) Neurexins: three genes and 1001 products. Trends Genet, 14, 20-26.

Mitchell, J. D., O'Brien M R. and Joshi M. (2006) Audit of outcomes in motor neuron disease (MND) patients treated with riluzole. Amyotroph Lateral Scler, 7, 67-71.

Mitsumoto, H. and Rabkin J. G. (2007) Palliative care for patients with amyotrophic lateral sclerosis: "prepare for the worst and hope for the best". JAMA, 298, 207-216.

Mizusawa, H., Nakamura H., Wakayama I., Yen S. H. and Hirano A. (1991) Skein-like inclusions in the anterior horn cells in motor neuron disease. J Neurol Sci, 105, 14-21.

Moechars, D., Dewachter I., Lorent K. et al. (1999) Early phenotypic changes in transgenic mice that overexpress different mutants of amyloid precursor protein in brain. J Biol Chem, 274, 6483-6492.

Moisse, K. and Strong M. J. (2006) Innate immunity in amyotrophic lateral sclerosis. Biochim Biophys Acta, 1762, 1083-1093.

Moncla, A., Landon F., Mattei M. G. and Portier M. M. (1992) Chromosomal localisation of the mouse and human peripherin genes. Genet Res, 59, 125-129.

Moreau, C., Devos D., Brunaud-Danel V., Defebvre L., Perez T., Destee A., Tonnel A. B., Lassalle P. and Just N. (2005) Elevated IL-6 and TNF-alpha levels in patients with ALS: inflammation or hypoxia? Neurology, 65, 1958-1960.

Morrison, B. M., Hof P. R. and Morrison J. H. (1998) Determinants of neuronal vulnerability in neurodegenerative diseases. Ann Neurol, 44, S32-44.

Moulard, B., Sefiani A., Laamri A., Malafosse A. and Camu W. (1996) Apolipoprotein E genotyping in sporadic amyotrophic lateral sclerosis: evidence for a major influence on the clinical presentation and prognosis. J Neurol Sci, 139 Suppl, 34-37.

Mourelatos, Z., Gonatas N. K., Stieber A., Gurney M. E. and Dal Canto M. C. (1996) The Golgi apparatus of spinal cord motor neurons in transgenic mice expressing mutant 180

Cu,Zn superoxide dismutase becomes fragmented in early, preclinical stages of the disease. Proc Natl Acad Sci U S A, 93, 5472-5477.

Mulder, D. W., Kurland L. T., Offord K. P. and Beard C. M. (1986) Familial adult motor neuron disease: amyotrophic lateral sclerosis. Neurology, 36, 511-517.

Muller, F. L., Song W., Liu Y. et al. (2006) Absence of CuZn superoxide dismutase leads to elevated oxidative stress and acceleration of age-dependent skeletal muscle atrophy. Free Radic Biol Med, 40, 1993-2004.

Munch, C., Ebstein M., Seefried U., Zhu B., Stamm S., Landwehrmeyer G. B., Ludolph A. C., Schwalenstocker B. and Meyer T. (2002) Alternative splicing of the 5'-sequences of the mouse EAAT2 glutamate transporter and expression in a transgenic model for amyotrophic lateral sclerosis. J Neurochem, 82, 594-603.

Munch, G., Gasic-Milenkovic J., Dukic-Stefanovic S., Kuhla B., Heinrich K., Riederer P., Huttunen H. J., Founds H. and Sajithlal G. (2003) Microglial activation induces cell death, inhibits neurite outgrowth and causes neurite retraction of differentiated neuroblastoma cells. Exp Brain Res, 150, 1-8.

Munoz, D. G., Greene C., Perl D. P. and Selkoe D. J. (1988) Accumulation of phosphorylated neurofilaments in anterior horn motoneurons of amyotrophic lateral sclerosis patients. J Neuropathol Exp Neurol, 47, 9-18.

Murakami, N. (1999) Parkinsonism-dementia complex on Guam - overview of clinical aspects. J Neurol, 246 Suppl 2, II16-18.

Murayama, S., Bouldin T. W. and Suzuki K. (1992) Immunocytochemical and ultrastructural studies of upper motor neurons in amyotrophic lateral sclerosis. Acta Neuropathol, 83, 518-524.

Murayama, S., Mori H., Ihara Y., Bouldin T. W., Suzuki K. and Tomonaga M. (1990) Immunocytochemical and ultrastructural studies of lower motor neurons in amyotrophic lateral sclerosis. Ann Neurol, 27, 137-148.

Muthukrishnan, S., Both G. W., Furuichi Y. and Shatkin A. J. (1975) 5'-Terminal 7- methylguanosine in eukaryotic mRNA is required for translation. Nature, 255, 33-37.

Nagai, M., Abe K., Okamoto K. and Itoyama Y. (1998) Identification of alternative splicing forms of GLT-1 mRNA in the spinal cord of amyotrophic lateral sclerosis patients. Neurosci Lett, 244, 165-168.

Nagai, M., Re D. B., Nagata T., Chalazonitis A., Jessell T. M., Wichterle H. and Przedborski S. (2007) Astrocytes expressing ALS-linked mutated SOD1 release factors selectively toxic to motor neurons. Nat Neurosci, 10, 615-622.

Nagy, D., Kato T. and Kushner P. D. (1994) Reactive astrocytes are widespread in the cortical gray matter of amyotrophic lateral sclerosis. J Neurosci Res, 38, 336-347. 181

Nakano, Y., Hirayama K. and Terao K. (1987) Hepatic ultrastructural changes and liver dysfunction in amyotrophic lateral sclerosis. Arch Neurol, 44, 103-106.

Neumann, M., Sampathu D. M., Kwong L. K. et al. (2006) Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science, 314, 130- 133.

Neusch, C., Bahr M. and Schneider-Gold C. (2007) Glia cells in amyotrophic lateral sclerosis: new clues to understanding an old disease? Muscle Nerve, 35, 712-724.

Nguyen, M. D., D'Aigle T., Gowing G., Julien J. P. and Rivest S. (2004) Exacerbation of motor neuron disease by chronic stimulation of innate immunity in a mouse model of amyotrophic lateral sclerosis. J Neurosci, 24, 1340-1349.

Nguyen, M. D., Lariviere R. C. and Julien J. P. (2001) Deregulation of Cdk5 in a mouse model of ALS: toxicity alleviated by perikaryal neurofilament inclusions. Neuron, 30, 135-147.

Niebroj-Dobosz, I., Dziewulska D. and Kwiecinski H. (2004) Oxidative damage to proteins in the spinal cord in amyotrophic lateral sclerosis (ALS). Folia Neuropathol, 42, 151-156.

Nielsen, A. L. and Jorgensen A. L. (2003) Structural and functional characterization of the zebrafish gene for glial fibrillary acidic protein, GFAP. Gene, 310, 123-132.

Nishimura, A. L., Mitne-Neto M., Silva H. C. et al. (2004) A mutation in the vesicle- trafficking protein VAPB causes late-onset spinal muscular atrophy and amyotrophic lateral sclerosis. Am J Hum Genet, 75, 822-831.

Nystrom, T. (2005) Role of oxidative carbonylation in protein quality control and senescence. EMBO J, 24, 1311-1317.

Oblinger, M. M., Szumlas R. A., Wong J. and Liuzzi F. J. (1989a) Changes in cytoskeletal gene expression affect the composition of regenerating axonal sprouts elaborated by dorsal root ganglion neurons in vivo. J Neurosci, 9, 2645-2653.

Oblinger, M. M., Wong J. and Parysek L. M. (1989b) Axotomy-induced changes in the expression of a type III neuronal intermediate filament gene. J Neurosci, 9, 3766-3775.

Oh, Y. K., Shin K. S., Yuan J. and Kang S. J. (2008) Superoxide dismutase 1 mutants related to amyotrophic lateral sclerosis induce endoplasmic stress in neuro2a cells. J Neurochem, 104, 993-1005.

Ohlemiller, K. K., McFadden S. L., Ding D. L. et al. (1999) Targeted deletion of the cytosolic Cu/Zn-superoxide dismutase gene (Sod1) increases susceptibility to noise- induced hearing loss. Audiol Neurootol, 4, 237-246. 182

Omary, M. B., Coulombe P. A. and McLean W. H. (2004) Intermediate filament proteins and their associated diseases. N Engl J Med, 351, 2087-2100.

Omary, M. B., Ku N. O., Tao G. Z., Toivola D. M. and Liao J. (2006) "Heads and tails" of intermediate filament phosphorylation: multiple sites and functional insights. Trends Biochem Sci, 31, 383-394.

Otomo, A., Hadano S., Okada T. et al. (2003) ALS2, a novel guanine nucleotide exchange factor for the small GTPase Rab5, is implicated in endosomal dynamics. Hum Mol Genet, 12, 1671-1687.

Ou, S. H., Wu F., Harrich D., Garcia-Martinez L. F. and Gaynor R. B. (1995) Cloning and characterization of a novel cellular protein, TDP-43, that binds to human immunodeficiency virus type 1 TAR DNA sequence motifs. J Virol, 69, 3584-3596.

Oyanagi, K., Makifuchi T., Ohtoh T., Chen K. M., Gajdusek D. C. and Chase T. N. (1997) Distinct pathological features of the gallyas- and tau-positive glia in the Parkinsonism-dementia complex and amyotrophic lateral sclerosis of Guam. J Neuropathol Exp Neurol, 56, 308-316.

Pan, X. D., Chen X. C., Zhu Y. G., Zhang J., Huang T. W., Chen L. M., Ye Q. Y. and Huang H. P. (2008) Neuroprotective role of tripchlorolide on inflammatory neurotoxicity induced by lipopolysaccharide-activated microglia. Biochem Pharmacol, 76, 362-372.

Paramio, J. M. and Jorcano J. L. (2002) Beyond structure: do intermediate filaments modulate cell signalling? Bioessays, 24, 836-844.

Parry, D. A. and Steinert P. M. (1999) Intermediate filaments: molecular architecture, assembly, dynamics and polymorphism. Q Rev Biophys, 32, 99-187.

Parysek, L. M. and Goldman R. D. (1987) Characterization of intermediate filaments in PC12 cells. J Neurosci, 7, 781-791.

Parysek, L. M. and Goldman R. D. (1988) Distribution of a novel 57 kDa intermediate filament (IF) protein in the nervous system. J Neurosci, 8, 555-563.

Parysek, L. M., McReynolds M. A., Goldman R. D. and Ley C. A. (1991) Some neural intermediate filaments contain both peripherin and the neurofilament proteins. J Neurosci Res, 30, 80-91.

Pasinelli, P., Belford M. E., Lennon N., Bacskai B. J., Hyman B. T., Trotti D. and Brown R. H., Jr. (2004) Amyotrophic lateral sclerosis-associated SOD1 mutant proteins bind and aggregate with Bcl-2 in spinal cord mitochondria. Neuron, 43, 19-30.

Paulin, D., Huet A., Khanamyrian L. and Xue Z. (2004) Desminopathies in muscle disease. J Pathol, 204, 418-427. 183

Pedersen, W. A., Becker L. E. and Yeger H. (1993) Expression and distribution of peripherin protein in human neuroblastoma cell lines. Int J Cancer, 53, 463-70.

Pehar, M., Vargas M. R., Cassina P., Barbeito A. G., Beckman J. S. and Barbeito L. (2005) Complexity of -motor neuron interactions in amyotrophic lateral sclerosis. Neurodegener Dis, 2, 139-146.

Peled-Kamar, M., Lotem J., Okon E., Sachs L. and Groner Y. (1995) Thymic abnormalities and enhanced apoptosis of thymocytes and bone marrow cells in transgenic mice overexpressing Cu/Zn-superoxide dismutase: implications for Down syndrome. EMBO J, 14, 4985-4993.

Perng, M. D., Wen S. F., Gibbon T., Middeldorp J., Sluijs J., Hol E. M. and Quinlan R. A. (2008) Glial fibrillary acidic protein filaments can tolerate the incorporation of assembly-compromised GFAP-delta, but with consequences for filament organization and alphaB-crystallin association. Mol Biol Cell, 19, 4521-4533.

Petrucelli, L. and Dawson T. M. (2004) Mechanism of neurodegenerative disease: role of the ubiquitin proteasome system. Ann Med, 36, 315-320.

Phukan, J., Pender N. P. and Hardiman O. (2007) Cognitive impairment in amyotrophic lateral sclerosis. Lancet Neurol, 6, 994-1003.

Piao, Y. S., Wakabayashi K., Kakita A., Yamada M., Hayashi S., Morita T., Ikuta F., Oyanagi K. and Takahashi H. (2003) Neuropathology with clinical correlations of sporadic amyotrophic lateral sclerosis: 102 autopsy cases examined between 1962 and 2000. Brain Pathol, 13, 10-22.

Plato, C. C., Garruto R. M., Galasko D., Craig U. K., Plato M., Gamst A., Torres J. M. and Wiederholt W. (2003) Amyotrophic lateral sclerosis and parkinsonism-dementia complex of Guam: changing incidence rates during the past 60 years. Am J Epidemiol, 157, 149-157.

Portier, M. M., de Nechaud B. and Gros F. (1983) Peripherin, a new member of the intermediate filament protein family. Dev Neurosci, 6, 335-344.

Prahlad, V., Yoon M., Moir R. D., Vale R. D. and Goldman R. D. (1998) Rapid movements of vimentin on microtubule tracks: kinesin-dependent assembly of intermediate filament networks. J Cell Biol, 143, 159-170.

Pramatarova, A., Laganiere J., Roussel J., Brisebois K. and Rouleau G. A. (2001) Neuron-specific expression of mutant superoxide dismutase 1 in transgenic mice does not lead to motor impairment. J Neurosci, 21, 3369-3374.

Prieto, V. G., McNutt N. S., Lugo J. and Reed J. A. (1997) Differential expression of the intermediate filament peripherin in cutaneous neural lesions and neurotized melanocytic nevi. Am J Surg Pathol, 21, 1450-4. 184

Ho, C. L. and Liem R. K. (1996) Intermediate filaments in the nervous system: implications in cancer. Cancer Metastasis Rev, 15, 483-97

Prasad, S., Soldatenkov V. A., Srinivasarao G. and Dritschilo A. (1999) Intermediate filament proteins during carcinogenesis and apoptosis. Int J Oncol, 14, 563-70.

Puertas, M. C., Carrillo J., Pastor X., Ampudia R. M, Planas R., Alba A., Bruno R., Pujol-Borrell R., Estanyol J. M., Vives-Pi M. and Verdaguer J. (2007) Peripherin is a relevant neuroendocrine autoantigen recognized by islet-infiltrating B lymphocytes. J Immunol, 178, 6533-9

Puls, I., Jonnakuty C., LaMonte B. H. et al. (2003) Mutant dynactin in motor neuron disease. Nat Genet, 33, 455-456.

Quinlan, R. A., Brenner M., Goldman J. E. and Messing A. (2007) GFAP and its role in Alexander disease. Exp Cell Res, 313, 2077-2087.

Raats, J. M., Pieper F. R., Vree Egberts W. T., Verrijp K. N., Ramaekers F. C. and Bloemendal H. (1990) Assembly of amino-terminally deleted desmin in vimentin-free cells. J Cell Biol, 111, 1971-1985.

Radunovic, A., Mitsumoto H. and Leigh P. N. (2007) Clinical care of patients with amyotrophic lateral sclerosis. Lancet Neurol, 6, 913-925.

Ragonese, P., Filippini G., Salemi G. et al. (2004) Accuracy of death certificates for amyotrophic lateral sclerosis varies significantly from north to south of Italy: implications for mortality studies. Neuroepidemiology, 23, 73-77.

Rakhit, R., Cunningham P., Furtos-Matei A., Dahan S., Qi X. F., Crow J. P., Cashman N. R., Kondejewski L. H. and Chakrabartty A. (2002) Oxidation-induced misfolding and aggregation of superoxide dismutase and its implications for amyotrophic lateral sclerosis. J Biol Chem, 277, 47551-47556.

Rando, T. A., Crowley R. S., Carlson E. J., Epstein C. J. and Mohapatra P. K. (1998) Overexpression of copper/zinc superoxide dismutase: a novel cause of murine muscular dystrophy. Ann Neurol, 44, 381-386.

Raoul, C., Estevez A. G., Nishimune H., Cleveland D. W., deLapeyriere O., Henderson C. E., Haase G. and Pettmann B. (2002) Motoneuron death triggered by a specific pathway downstream of Fas. potentiation by ALS-linked SOD1 mutations. Neuron, 35, 1067-1083.

Ratovitski, T., Corson L. B., Strain J., Wong P., Cleveland D. W., Culotta V. C. and Borchelt D. R. (1999) Variation in the biochemical/biophysical properties of mutant superoxide dismutase 1 enzymes and the rate of disease progression in familial amyotrophic lateral sclerosis kindreds. Hum Mol Genet, 8, 1451-1460. 185

Ravits, J. (2005) Sporadic amyotrophic lateral sclerosis: a hypothesis of persistent (non- lytic) enteroviral infection. Amyotroph Lateral Scler Other Motor Neuron Disord, 6, 77- 87.

Ray, S. S., Nowak R. J., Strokovich K., Brown R. H., Jr., Walz T. and Lansbury P. T., Jr. (2004) An intersubunit disulfide bond prevents in vitro aggregation of a superoxide dismutase-1 mutant linked to familial amytrophic lateral sclerosis. Biochemistry, 43, 4899-4905.

Reaume, A. G., Elliott J. L., Hoffman E. K. et al. (1996) Motor neurons in Cu/Zn superoxide dismutase-deficient mice develop normally but exhibit enhanced cell death after axonal injury. Nat Genet, 13, 43-47.

Reid, E., Kloos M., Ashley-Koch A. et al. (2002) A kinesin heavy chain (KIF5A) mutation in hereditary spastic paraplegia (SPG10). Am J Hum Genet, 71, 1189-1194.

Reynolds, A., Laurie C., Mosley R. L. and Gendelman H. E. (2007) Oxidative stress and the pathogenesis of neurodegenerative disorders. Int Rev Neurobiol, 82, 297-325.

Rhrich-Haddout, F., Klosen P., Portier M. M. and Horvat J. C. (1997) Expression of peripherin, NADPH-diaphorase and NOS in the adult rat neocortex. Neuroreport, 8, 3313-3316.

Robberecht, W. (2000) Oxidative stress in amyotrophic lateral sclerosis. J Neurol, 247 Suppl 1, I1-6.

Robertson, J., Beaulieu J. M., Doroudchi M. M., Durham H. D., Julien J. P. and Mushynski W. E. (2001) Apoptotic death of neurons exhibiting peripherin aggregates is mediated by the proinflammatory cytokine tumor necrosis factor-alpha. J Cell Biol, 155, 217-226.

Robertson, J., Doroudchi M. M., Nguyen M. D., Durham H. D., Strong M. J., Shaw G., Julien J. P. and Mushynski W. E. (2003) A neurotoxic peripherin splice variant in a mouse model of ALS. J Cell Biol, 160, 939-949.

Robertson, J., Kriz J., Nguyen M. D. and Julien J. P. (2002) Pathways to motor neuron degeneration in transgenic mouse models. Biochimie, 84, 1151-1160.

Robinson, K. M., Lacey S. C., Grugan P., Glosser G., Grossman M. and McCluskey L. F. (2006) Cognitive functioning in sporadic amyotrophic lateral sclerosis: a six month longitudinal study. J Neurol Neurosurg Psychiatry, 77, 668-670.

Rodriguez, J. A., Valentine J. S., Eggers D. K., Roe J. A., Tiwari A., Brown R. H., Jr. and Hayward L. J. (2002) Familial amyotrophic lateral sclerosis-associated mutations decrease the thermal stability of distinctly metallated species of human copper/zinc superoxide dismutase. J Biol Chem, 277, 15932-15937. 186

Rojo, A. I., Sagarra M. R. and Cuadrado A. (2008) GSK-3beta down-regulates the transcription factor Nrf2 after oxidant damage: relevance to exposure of neuronal cells to oxidative stress. J Neurochem, 105, 192-202.

Román, G. C. (1996) Neuroepidemiology of amyotrophic lateral sclerosis: clues to aetiology and pathogenesis. J Neurol Neurosurg Psychiatry, 61, 131-137.

Rosen, D. R., Siddique T., Patterson D. et al. (1993) Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature, 362, 59-62.

Rosenfeld, M. R. and Posner J. B. (1991) Paraneoplastic motor neuron disease. Adv Neurol, 56, 445-459.

Ross, C. A. and Pickart C. M. (2004) The ubiquitin-proteasome pathway in Parkinson's disease and other neurodegenerative diseases. Trends Cell Biol, 14, 703-711.

Ross, C. A. and Poirier M. A. (2004) Protein aggregation and neurodegenerative disease. Nat Med, 10 Suppl, S10-17.

Ross, M. A., Miller R. G., Berchert L. et al. (1998) Toward earlier diagnosis of amyotrophic lateral sclerosis: revised criteria. rhCNTF ALS Study Group. Neurology, 50, 768-772.

Rothstein, J. D. (1995) Excitotoxic mechanisms in the pathogenesis of amyotrophic lateral sclerosis. Adv Neurol, 68, 7-20; discussion 21-27.

Rothstein, J. D. (2009) Current hypotheses for the underlying biology of amyotrophic lateral sclerosis. Ann Neurol, 65 Suppl 1, S3-9.

Rothstein, J. D., Van Kammen M., Levey A. I., Martin L. J. and Kuncl R. W. (1995) Selective loss of glial glutamate transporter GLT-1 in amyotrophic lateral sclerosis. Ann Neurol, 38, 73-84.

Rowland, L. P. (1998) Diagnosis of amyotrophic lateral sclerosis. J Neurol Sci, 160 Suppl 1, S6-24.

Rowland, L. R. (2003) Clinical aspects of sporadic amyotrophic lateral sclerosis/motor neuron disease. In: Motor neuron disorders, (P. J. Shaw ed.), pp. 111-143. Butterworth Heinemann, Philadelphia.

Ruhrberg, C. and Watt F. M. (1997) The plakin family: versatile organizers of cytoskeletal architecture. Curr Opin Genet Dev, 7, 392-7.

Sanelli, T., Ge W., Leystra-Lantz C. and Strong M. J. (2007a) Calcium mediated excitotoxicity in neurofilament aggregate-bearing neurons in vitro is NMDA receptor dependant. J Neurol Sci, 256, 39-51. 187

Sanelli, T. and Strong M. J. (2007) Loss of nitric oxide-mediated down-regulation of NMDA receptors in neurofilament aggregate-bearing motor neurons in vitro: implications for motor neuron disease. Free Radic Biol Med, 42, 143-151.

Sanelli, T., Xiao S., Horne P., Bilbao J., Zinman L. and Robertson J. (2007b) Evidence that TDP-43 is not the major ubiquitinated target within the pathological inclusions of amyotrophic lateral sclerosis. J Neuropathol Exp Neurol, 66, 1147-1153.

Sarchielli, P., Pelliccioli G. P., Tarducci R., Chiarini P., Presciutti O., Gobbi G. and Gallai V. (2001) Magnetic resonance imaging and 1H-magnetic resonance spectroscopy in amyotrophic lateral sclerosis. Neuroradiology, 43, 189-197.

Sargsyan, S. A., Monk P. N. and Shaw P. J. (2005) Microglia as potential contributors to motor neuron injury in amyotrophic lateral sclerosis. Glia, 51, 241-253.

Sarria, A. J., Nordeen S. K. and Evans R. M. (1990) Regulated expression of vimentin cDNA in cells in the presence and absence of a preexisting vimentin filament network. J Cell Biol, 111, 553-565.

Sasaki, S. and Iwata M. (1996) Ultrastructural study of in the anterior horn neurons of patients with amyotrophic lateral sclerosis. Neurosci Lett, 204, 53-56.

Sasaki, S. and Iwata M. (1999) Ultrastructural change of synapses of Betz cells in patients with amyotrophic lateral sclerosis. Neurosci Lett, 268, 29-32.

Sasaki, S., Komori T. and Iwata M. (2000) Excitatory amino acid transporter 1 and 2 immunoreactivity in the spinal cord in amyotrophic lateral sclerosis. Acta Neuropathol, 100, 138-144.

Sasaki, S., Warita H., Murakami T., Shibata N., Komori T., Abe K., Kobayashi M. and Iwata M. (2005) Ultrastructural study of aggregates in the spinal cord of transgenic mice with a G93A mutant SOD1 gene. Acta Neuropathol, 109, 247-255.

Sato, S., Idogawa M., Honda K., Fujii G., Kawashima H., Takekuma K., Hoshika A., Hirohashi S. and Yamada T. (2005) Beta- interacts with the FUS proto-oncogene product and regulates pre-mRNA splicing. Gastroenterology, 129, 1225-36

Saxena, S. and Caroni P. (2007) Mechanisms of axon degeneration: from development to disease. Prog Neurobiol, 83, 174-191.

Scherzinger, E., Sittler A., Schweiger K., Heiser V., Lurz R., Hasenbank R., Bates G. P., Lehrach H. and Wanker E. E. (1999) Self-assembly of polyglutamine-containing huntingtin fragments into amyloid-like fibrils: implications for Huntington's disease pathology. Proc Natl Acad Sci U S A, 96, 4604-4609.

Schickler, M., Knobler H., Avraham K. B., Elroy-Stein O. and Groner Y. (1989) Diminished serotonin uptake in platelets of transgenic mice with increased Cu/Zn- superoxide dismutase activity. EMBO J, 8, 1385-1392. 188

Schiffer, D., Cordera S., Cavalla P. and Migheli A. (1996) Reactive of the spinal cord in amyotrophic lateral sclerosis. J Neurol Sci, 139 Suppl, 27-33.

Schwab, C., Steele J. C. and McGeer P. L. (1996) Neurofibrillary tangles of Guam parkinson-dementia are associated with reactive microglia and complement proteins. Brain Res, 707, 196-205.

Schweitzer, S. C., Klymkowsky M. W., Bellin R. M., Robson R. M., Capetanaki Y. and Evans R. M. (2001) Paranemin and the organization of desmin filament networks. J Cell Sci, 114, 1079-1089.

Schymick, J. C., Scholz S. W., Fung H. C. et al. (2007a) Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data. Lancet Neurol, 6, 322-328.

Schymick, J. C., Talbot K. and Traynor B. J. (2007b) Genetics of sporadic amyotrophic lateral sclerosis. Hum Mol Genet, 16 Spec No. 2, R233-242.

Shaked, I., Zimmerman G. and Soreq H. (2008) Stress-induced alternative splicing modulations in brain and periphery: acetylcholinesterase as a case study. Ann N Y Acad Sci, 1148, 269-281.

Shaw, B. F. and Valentine J. S. (2007) How do ALS-associated mutations in superoxide dismutase 1 promote aggregation of the protein? Trends Biochem Sci, 32, 78-85.

Shaw, P. J., Ince P. G., Falkous G. and Mantle D. (1995) Oxidative damage to protein in sporadic motor neuron disease spinal cord. Ann Neurol, 38, 691-695.

Shea, T. B., Jung C. and Pant H. C. (2003) Does neurofilament phosphorylation regulate axonal transport? Trends Neurosci, 26, 397-400.

Shea, T. B., Yabe J. T., Ortiz D., Pimenta A., Loomis P., Goldman R. D., Amin N. and Pant H. C. (2004) Cdk5 regulates axonal transport and phosphorylation of neurofilaments in cultured neurons. J Cell Sci, 117, 933-941.

Shefner, J. M., Reaume A. G., Flood D. G., Scott R. W., Kowall N. W., Ferrante R. J., Siwek D. F., Upton-Rice M. and Brown R. H., Jr. (1999) Mice lacking cytosolic copper/zinc superoxide dismutase display a distinctive motor axonopathy. Neurology, 53, 1239-1246.

Shibata, N., Asayama K., Hirano A. and Kobayashi M. (1996) Immunohistochemical study on superoxide dismutases in spinal cords from autopsied patients with amyotrophic lateral sclerosis. Dev Neurosci, 18, 492-498.

Shibata, N., Nagai R., Uchida K. et al. (2001) Morphological evidence for lipid peroxidation and protein glycoxidation in spinal cords from sporadic amyotrophic lateral sclerosis patients. Brain Res, 917, 97-104. 189

Shoesmith, C. L. and Strong M. J. (2006) Amyotrophic lateral sclerosis: update for family physicians. Can Fam Physician, 52, 1563-1569.

Sihag, R. K., Inagaki M., Yamaguchi T., Shea T. B. and Pant H. C. (2007) Role of phosphorylation on the structural dynamics and function of types III and IV intermediate filaments. Exp Cell Res, 313, 2098-2109.

Siklos, L., Engelhardt J., Harati Y., Smith R. G., Joo F. and Appel S. H. (1996) Ultrastructural evidence for altered calcium in terminals in amyotropic lateral sclerosis. Ann Neurol, 39, 203-216.

Simpson, C. L. and Al-Chalabi A. (2006) Amyotrophic lateral sclerosis as a complex genetic disease. Biochim Biophys Acta, 1762, 973-985.

Simpson, E. P., Yen A. A. and Appel S. H. (2003) Oxidative Stress: a common denominator in the pathogenesis of amyotrophic lateral sclerosis. Curr Opin Rheumatol, 15, 730-736.

Sjakste, N. and Sjakste T (2005) proteins and hereditary diseases. Genetika, 41, 293-8

Skalli, O., Chou Y. H. and Goldman R. D. (1992) Intermediate filaments: not so tough after all. Trends Cell Biol, 2, 308-312.

Slowik, A., Tomik B., Wolkow P. P. et al. (2006) Paraoxonase gene polymorphisms and sporadic ALS. Neurology, 67, 766-770.

Smith, M. C. (1960) Nerve fibre degeneration in the brain in amyotrophic lateral sclerosis. J Neurol Neurosurg Psychiatry, 23, 269-282.

Soellner, P., Quinlan R. A. and Franke W. W. (1985) Identification of a distinct soluble subunit of an intermediate filament protein: tetrameric vimentin from living cells. Proc Natl Acad Sci U S A, 82, 7929-7933.

Soto, C. (2003) Unfolding the role of protein misfolding in neurodegenerative diseases. Nat Rev Neurosci, 4, 49-60.

Soto, C., Estrada L. and Castilla J. (2006) Amyloids, prions and the inherent infectious nature of misfolded protein aggregates. Trends Biochem Sci, 31, 150-155.

Spillantini, M. G., Van Swieten J. C. and Goedert M. (2000) Tau gene mutations in frontotemporal dementia and parkinsonism linked to chromosome 17 (FTDP-17). Neurogenetics, 2, 193-205.

Sreedharan, J., Blair I. P., Tripathi V. B. et al. (2008) TDP-43 mutations in familial and sporadic amyotrophic lateral sclerosis. Science, 319, 1668-1672. 190

Standart, N. and Jackson R. J. (1994) Regulation of translation by specific protein/mRNA interactions. Biochimie, 76, 867-879.

Steinert, P. M., Chou Y. H., Prahlad V., Parry D. A., Marekov L. N., Wu K. C., Jang S. I. and Goldman R. D. (1999) A high molecular weight intermediate filament-associated protein in BHK-21 cells is nestin, a type VI intermediate filament protein. Limited co- assembly in vitro to form heteropolymers with type III vimentin and type IV alpha- internexin. J Biol Chem, 274, 9881-9890.

Steinert, P. M. and Roop D. R. (1988) Molecular and cellular biology of intermediate filaments. Annu Rev Biochem, 57, 593-625.

Sterneck, E., Kaplan D. R. and Johnson P. F. (1996) Interleukin-6 induces expression of peripherin and cooperates with signaling to promote neuronal differentiation in PC12 cells. J Neurochem, 67, 1365-1374.

Stieber, A., Gonatas J. O. and Gonatas N. K. (2000) Aggregates of mutant protein appear progressively in , in periaxonal processes of oligodendrocytes, and in neuronal and astrocytic perikarya of mice expressing the SOD1(G93A) mutation of familial amyotrophic lateral sclerosis. J Neurol Sci, 177, 114-123.

Streit, W. J., Miller K. R., Lopes K. O. and Njie E. (2008) Microglial degeneration in the aging brain--bad news for neurons? Front Biosci, 13, 3423-3438.

Streit, W. J., Walter S. A. and Pennell N. A. (1999) Reactive microgliosis. Prog Neurobiol, 57, 563-581.

Strelkov, S. V., Herrmann H., Geisler, N., Lustig, A., Ivaninskii S., Zimbelmann R., Burkhard, P. and Aebi U. (2001) Divide-and-conquer crystallographic approach towards an atomic structure of intermediate filaments. J Mol Biol, 306: 773-781

Strelkov, S. V., Herrmann H. and Aebi U. (2003) Molecular architecture of intermediate filaments. Bioessays, 25, 243-251.

Strelkov, S. V., Kreplak L., Herrmann H. and Aebi U. (2004) Intermediate filament protein structure determination. Methods Cell Biol, 78, 25-43.

Strong, M. J. (1999) Neurofilament metabolism in sporadic amyotrophic lateral sclerosis. J Neurol Sci, 169, 170-177.

Strong, M. J. (2003) The basic aspects of therapeutics in amyotrophic lateral sclerosis. Pharmacol Ther, 98, 379-414.

Strong, M. J., Gaytan-Garcia S. and Jakowec D. M. (1995) Reversibility of neurofilamentous inclusion formation following repeated sublethal intracisternal inoculums of AlCl3 in New Zealand white rabbits. Acta Neuropathol, 90, 57-67. 191

Strong, M. J., Grace G. M., Orange J. B. and Leeper H. A. (1996) Cognition, language, and speech in amyotrophic lateral sclerosis: a review. J Clin Exp Neuropsychol, 18, 291- 303.

Strong, M. J., Grace G. M., Orange J. B., Leeper H. A., Menon R. S. and Aere C. (1999) A prospective study of cognitive impairment in ALS. Neurology, 53, 1665-1670.

Strong, M. J., Leystra-Lantz C. and Ge W. W. (2004) Intermediate filament steady-state mRNA levels in amyotrophic lateral sclerosis. Biochem Biophys Res Commun, 316, 317- 322.

Strong, M. J., Sopper M. M., Crow J. P., Strong W. L. and Beckman J. S. (1998) Nitration of the low molecular weight neurofilament is equivalent in sporadic amyotrophic lateral sclerosis and control cervical spinal cord. Biochem Biophys Res Commun, 248, 157-164.

Subramanian, V. and Feng Y. (2007) A new role for angiogenin in neurite growth and pathfinding: implications for amyotrophic lateral sclerosis. Hum Mol Genet, 16, 1445- 1453.

Sutedja, N. A., Veldink J. H., Fischer K., Kromhout H., Wokke J. H., Huisman M. H., Heederik D. J. and Van den Berg L. H. (2007) Lifetime occupation, education, smoking, and risk of ALS. Neurology, 69, 1508-1514.

Szabolcs, M. J., Visser J., Shelanski M. L., O'Toole K. and Schullinger J. N. (1996) Peripherin: a novel marker for the immunohistochemical study of malformations of the enteric nervous system. Pediatr Pathol Lab Med, 16, 51-70

Takeuchi, H., Kobayashi Y., Ishigaki S., Doyu M. and Sobue G. (2002) Mitochondrial localization of mutant superoxide dismutase 1 triggers caspase-dependent cell death in a cellular model of familial amyotrophic lateral sclerosis. J Biol Chem, 277, 50966-50972.

Takuma, H., Kwak S., Yoshizawa T. and Kanazawa I. (1999) Reduction of GluR2 RNA editing, a molecular change that increases calcium influx through AMPA receptors, selective in the spinal ventral gray of patients with amyotrophic lateral sclerosis. Ann Neurol, 46, 806-815.

Tanaka, M., Kondo S., Hirai S., Sun X., Yamagishi T. and Okamoto K. (1993) Cerebral blood flow and oxygen metabolism in progressive dementia associated with amyotrophic lateral sclerosis. J Neurol Sci, 120, 22-28.

Taylor, J., Anderson N. L., Scandora A. E., Jr., Willard K. E. and Anderson N. G. (1982) Design and implementation of a prototype Human Protein Index. Clin Chem, 28, 861- 866.

Taylor, J. P., Sater R., French J., Baltuch G. and Crino P. B. (2001) Transcription of intermediate filament genes is enhanced in focal cortical dysplasia. Acta Neuropathol, 102, 141-148. 192

Tedeschi, G., Cappelletti G., Nonnis S., Taverna F., Negri A., Ronchi C. and Ronchi S. (2007) Tyrosine nitration is a novel post-translational modification occurring on the neural intermediate filament protein peripherin. Neurochem Res, 32, 433-441.

Teplow, D. B. (1998) Structural and kinetic features of amyloid beta-protein fibrillogenesis. Amyloid, 5, 121-142.

Terao, E., Janssens S., van den Bosch de Aguilar P., Portier M. and Klosen P. (2000) In vivo expression of the intermediate filament peripherin in rat motoneurons: modulation by inhibitory and stimulatory signals. Neuroscience, 101, 679-688.

Thompson, M. A., Lee E., Lawe D., Gizang-Ginsberg E. and Ziff E. B. (1992) Nerve growth factor-induced derepression of peripherin gene expression is associated with alterations in proteins binding to a negative regulatory element. Mol Cell Biol, 12, 2501- 2513.

Thompson, M. A. and Ziff E. B. (1989) Structure of the gene encoding peripherin, an NGF-regulated neuronal-specific type III intermediate filament protein. Neuron, 2, 1043- 1053.

Tiwari, A., Xu Z. and Hayward L. J. (2005) Aberrantly increased hydrophobicity shared by mutants of Cu,Zn-superoxide dismutase in familial amyotrophic lateral sclerosis. J Biol Chem, 280, 29771-29779.

Toivola, D. M., Tao G. Z., Habtezion A., Liao J. and Omary M. B. (2005) Cellular integrity plus: organelle-related and protein-targeting functions of intermediate filaments. Trends Cell Biol, 15, 608-617.

Tompkins, M. M., Basgall E. J., Zamrini E. and Hill W. D. (1997) Apoptotic-like changes in Lewy-body-associated disorders and normal aging in substantia nigral neurons. Am J Pathol, 150, 119-131.

Tortarolo, M., Veglianese P., Calvaresi N., Botturi A., Rossi C., Giorgini A., Migheli A. and Bendotti C. (2003) Persistent activation of p38 mitogen-activated protein kinase in a mouse model of familial amyotrophic lateral sclerosis correlates with disease progression. Mol Cell Neurosci, 23, 180-192.

Traynor, B. J., Alexander M., Corr B., Frost E. and Hardiman O. (2003) An outcome study of riluzole in amyotrophic lateral sclerosis--a population-based study in Ireland, 1996-2000. J Neurol, 250, 473-479.

Traynor, B. J., Codd M. B., Corr B., Forde C., Frost E. and Hardiman O. M. (2000) Clinical features of amyotrophic lateral sclerosis according to the El Escorial and Airlie House diagnostic criteria: A population-based study. Arch Neurol, 57, 1171-1176.

Troost, D., Van den Oord J. J. and Vianney de Jong J. M. (1990) Immunohistochemical characterization of the inflammatory infiltrate in amyotrophic lateral sclerosis. Neuropathol Appl Neurobiol, 16, 401-410. 193

Trotti, D., Rolfs A., Danbolt N. C., Brown R. H., Jr. and Hediger M. A. (1999) SOD1 mutants linked to amyotrophic lateral sclerosis selectively inactivate a glial glutamate transporter. Nat Neurosci, 2, 848.

Troy, C. M., Greene L. A. and Shelanski M. L. (1992) Neurite outgrowth in peripherin- depleted PC12 cells. J Cell Biol, 117, 1085-1092.

Troy, C. M., Muma N. A., Greene L. A., Price D. L. and Shelanski M. L. (1990) Regulation of peripherin and neurofilament expression in regenerating rat motor neurons. Brain Res, 529, 232-238.

Tu, P. H., Raju P., Robinson K. A., Gurney M. E., Trojanowski J. Q. and Lee V. M. (1996) Transgenic mice carrying a human mutant superoxide dismutase transgene develop neuronal cytoskeletal pathology resembling human amyotrophic lateral sclerosis lesions. Proc Natl Acad Sci U S A, 93, 3155-3160.

Turner, B. J. and Talbot K. (2008) Transgenics, toxicity and therapeutics in rodent models of mutant SOD1-mediated familial ALS. Prog Neurobiol, 85, 94-134.

Turner, M. R., Bakker M., Sham P., Shaw C. E., Leigh P. N. and Al-Chalabi A. (2002) Prognostic modelling of therapeutic interventions in amyotrophic lateral sclerosis. Amyotroph Lateral Scler Other Motor Neuron Disord, 3, 15-21.

Turner, M. R., Cagnin A., Turkheimer F. E., Miller C. C., Shaw C. E., Brooks D. J., Leigh P. N. and Banati R. B. (2004) Evidence of widespread cerebral microglial activation in amyotrophic lateral sclerosis: an [11C](R)-PK11195 positron emission tomography study. Neurobiol Dis, 15, 601-609.

Turner, M. R., Kiernan M. C., Leigh P. N. and Talbot K. (2009) Biomarkers in amyotrophic lateral sclerosis. Lancet Neurol, 8, 94-109.

Umahara, T., Hirano A., Kato S., Shibata N. and Yen S. H. (1994) Demonstration of neurofibrillary tangles and neuropil thread-like structures in spinal cord white matter in parkinsonism-dementia complex on Guam and in Guamanian amyotrophic lateral sclerosis. Acta Neuropathol, 88, 180-184.

Urushitani, M., Nakamizo T., Inoue R., Sawada H., Kihara T., Honda K., Akaike A. and Shimohama S. (2001) N-methyl-D-aspartate receptor-mediated mitochondrial Ca(2+) overload in acute excitotoxic motor neuron death: a mechanism distinct from chronic neurotoxicity after Ca(2+) influx. J Neurosci Res, 63, 377-387.

Uveges, T. E., Shan Y., Kramer B. E., Wight D. C. and Parysek L. M. (2002) Intron 1 is required for cell type-specific, but not injury-responsive, peripherin gene expression. J Neurosci, 22, 7959-7967.

Valdmanis, P. N. and Rouleau G. A. (2008) Genetics of familial amyotrophic lateral sclerosis. Neurology, 70, 144-152. 194

Valentine, J. S. and Hart P. J. (2003) Misfolded CuZnSOD and amyotrophic lateral sclerosis. Proc Natl Acad Sci U S A, 100, 3617-3622.

Valko, M., Leibfritz D., Moncol J., Cronin M. T., Mazur M. and Telser J. (2007) Free radicals and antioxidants in normal physiological functions and human disease. Int J Biochem Cell Biol, 39, 44-84.

Van Damme, P., Dewil M., Robberecht W. and Van Den Bosch L. (2005) Excitotoxicity and amyotrophic lateral sclerosis. Neurodegener Dis, 2, 147-159.

Van Den Bosch, L. and Robberecht W. (2008) Crosstalk between astrocytes and motor neurons: what is the message? Exp Neurol, 211, 1-6.

Van Den Bosch, L., Van Damme P., Bogaert E. and Robberecht W. (2006) The role of excitotoxicity in the pathogenesis of amyotrophic lateral sclerosis. Biochim Biophys Acta, 1762, 1068-1082.

Van Den Bosch, L., Vandenberghe W., Klaassen H., Van Houtte E. and Robberecht W. (2000) Ca(2+)-permeable AMPA receptors and selective vulnerability of motor neurons. J Neurol Sci, 180, 29-34.

Van der Valk, J. B. and Vijverberg H. P. (1990) Glutamate-induced inward current in a clonal neuroblastoma cell line. Eur J Pharmacol, 185, 99-102. van Es, M. A., Van Vught P. W., Blauw H. M. et al. (2007) ITPR2 as a susceptibility gene in sporadic amyotrophic lateral sclerosis: a genome-wide association study. Lancet Neurol, 6, 869-877. van Welsem, M. E., Hogenhuis J. A., Meininger V., Metsaars W. P., Hauw J. J. and Seilhean D. (2002) The relationship between Bunina bodies, skein-like inclusions and neuronal loss in amyotrophic lateral sclerosis. Acta Neuropathol, 103, 583-589.

Vance, C., Al-Chalabi A., Ruddy D. et al. (2006) Familial amyotrophic lateral sclerosis with frontotemporal dementia is linked to a locus on chromosome 9p13.2-21.3. Brain, 129, 868-876.

Vance, C., Rogelj B., Hortobagyi T. et al. (2009) Mutations in FUS, an RNA processing protein, cause familial amyotrophic lateral sclerosis type 6. Science, 323, 1208-1211.

Vargas, M. E. and Barres B. A. (2007) Why is Wallerian degeneration in the CNS so slow? Annu Rev Neurosci, 30, 153-179.

Veldink, J. H., Kalmijn S., Groeneveld G. J., Titulaer M. J., Wokke J. H. and van den Berg L. H. (2005) Physical activity and the association with sporadic ALS. Neurology, 64, 241-245.

Venter, J. C., Adams M. D., Myers E. W. et al. (2001) The sequence of the human genome. Science, 291, 1304-1351. 195

Verma, A. and Berger J. R. (2006) ALS syndrome in patients with HIV-1 infection. J Neurol Sci, 240, 59-64.

Vickers, J. C., Morrison J. H., Friedrich V. L., Jr., Elder G. A., Perl D. P., Katz R. N. and Lazzarini R. A. (1994) Age-associated and cell-type-specific neurofibrillary pathology in transgenic mice expressing the human midsized neurofilament subunit. J Neurosci, 14, 5603-5612.

von Lewinski, F. and Keller B. U. (2005) Ca2+, mitochondria and selective motoneuron vulnerability: implications for ALS. Trends Neurosci, 28, 494-500.

Wagner, O. I., Lifshitz J., Janmey P. A., Linden M., McIntosh T. K. and Leterrier J. F. (2003) Mechanisms of mitochondria-neurofilament interactions. J Neurosci, 23, 9046- 9058.

Wang, J., Xu G., Gonzales V., Coonfield M., Fromholt D., Copeland N. G., Jenkins N. A. and Borchelt D. R. (2002) Fibrillar inclusions and motor neuron degeneration in transgenic mice expressing superoxide dismutase 1 with a disrupted copper-binding site. Neurobiol Dis, 10, 128-138.

Wang, Q., Johnson J. L., Agar N. Y. and Agar J. N. (2008) Protein aggregation and protein instability govern familial amyotrophic lateral sclerosis patient survival. PLoS Biol, 6, e170.

Watanabe, M., Dykes-Hoberg M., Culotta V. C., Price D. L., Wong P. C. and Rothstein J. D. (2001) Histological evidence of protein aggregation in mutant SOD1 transgenic mice and in amyotrophic lateral sclerosis neural tissues. Neurobiol Dis, 8, 933-941.

Weinhold, K. J., Tartaglia J., Paoletti E., Graham B., Schwartz D., McElrath J., Roberts N. and Gorse G. (1992) Specific activation strategies for amplification of low CTL signals. AIDS Res Hum Retroviruses, 8, 1373.

Weir, M. L., Klip A. and Trimble W. S. (1998) Identification of a human homologue of the vesicle-associated membrane protein (VAMP)-associated protein of 33 kDa (VAP- 33): a broadly expressed protein that binds to VAMP. Biochem J, 333 ( Pt 2), 247-251.

Weisskopf, M. G., McCullough M. L., Calle E. E., Thun M. J., Cudkowicz M. and Ascherio A. (2004) Prospective study of cigarette smoking and amyotrophic lateral sclerosis. Am J Epidemiol, 160, 26-33.

Weng, Y. C. and Kriz J. (2007) Differential neuroprotective effects of a minocycline- based drug cocktail in transient and permanent focal cerebral ischemia. Exp Neurol, 204, 433-442.

Weydt, P., Yuen E. C., Ransom B. R. and Moller T. (2004) Increased cytotoxic potential of microglia from ALS-transgenic mice. Glia, 48, 179-182. 196

Wharton, S. and Ince P. G. (2003) Pathology of Motor Neuron Disorders. In: Motor Neuron Disorders, (P. J. Shaw and M. J. Strong eds.), pp. 17-49. Elsevier, Inc., Pennsylvania.

Wiche, G. (1998) Role of plectin in cytoskeleton organization and dynamics. J Cell Sci, 111, 2477-86.

Wiedau-Pazos, M., Goto J. J., Rabizadeh S., Gralla E. B., Roe J. A., Lee M. K., Valentine J. S. and Bredesen D. E. (1996) Altered reactivity of superoxide dismutase in familial amyotrophic lateral sclerosis. Science, 271, 515-518.

Wiedemann, F. R., Manfredi G., Mawrin C., Beal M. F. and Schon E. A. (2002) Mitochondrial DNA and respiratory chain function in spinal cords of ALS patients. J Neurochem, 80, 616-625.

Wiedemann, F. R., Winkler K., Kuznetsov A. V., Bartels C., Vielhaber S., Feistner H. and Kunz W. S. (1998) Impairment of mitochondrial function in skeletal muscle of patients with amyotrophic lateral sclerosis. J Neurol Sci, 156, 65-72.

Williams, A. J. and Paulson H. L. (2008) Polyglutamine neurodegeneration: protein misfolding revisited. Trends Neurosci, 31, 521-528.

Williams, B. L. and Lipkin W. I. (2006) Endoplasmic reticulum stress and neurodegeneration in rats neonatally infected with borna disease virus. J Virol, 80, 8613- 8626.

Williams, D. B., Floate D. A. and Leicester J. (1988) Familial motor neuron disease: differing penetrance in large pedigrees. J Neurol Sci, 86, 215-230.

Williamson, T. L. and Cleveland D. W. (1999) Slowing of axonal transport is a very early event in the toxicity of ALS-linked SOD1 mutants to motor neurons. Nat Neurosci, 2, 50- 56.

Wilson, C. M., Grace G. M., Munoz D. G., He B. P. and Strong M. J. (2001) Cognitive impairment in sporadic ALS: a pathologic continuum underlying a multisystem disorder. Neurology, 57, 651-657.

Winterholler, M. G., Heckmann J. G., Hecht M. and Erbguth F. J. (2002) Recurrent trismus and stridor in an ALS patient: successful treatment with botulinum toxin. Neurology, 58, 502-503.

Wokke, J. H. (2000) Confounding effects of mimicking disorders in the early diagnosis of amyotrophic lateral sclerosis. Amyotroph Lateral Scler Other Motor Neuron Disord, 1 Suppl 1, S61-63.

Wong, J. and Oblinger M. M. (1987) Changes in neurofilament gene expression occur after axotomy of dorsal root ganglion neurons: an in situ hybridization study. Metab Brain Dis, 2, 291-303. 197

Wong, J. and Oblinger M. M. (1990) Differential regulation of peripherin and neurofilament gene expression in regenerating rat DRG neurons. J Neurosci Res, 27, 332- 341.

Wong, N. K., He B. P. and Strong M. J. (2000) Characterization of neuronal intermediate filament protein expression in cervical spinal motor neurons in sporadic amyotrophic lateral sclerosis (ALS). J Neuropathol Exp Neurol, 59, 972-982.

Wong, P. C., Pardo C. A., Borchelt D. R., Lee M. K., Copeland N. G., Jenkins N. A., Sisodia S. S., Cleveland D. W. and Price D. L. (1995) An adverse property of a familial ALS-linked SOD1 mutation causes motor neuron disease characterized by vacuolar degeneration of mitochondria. Neuron, 14, 1105-1116.

Wood, J. D., Beaujeux T. P. and Shaw P. J. (2003) Protein aggregation in motor neurone disorders. Neuropathol Appl Neurobiol, 29, 529-545.

Woolley, S. C. and Jonathan S. K. (2008) Cognitive and behavioral impairment in amyotrophic lateral sclerosis. Phys Med Rehabil Clin N Am, 19, 607-617, xi.

Worms, P. M. (2001) The epidemiology of motor neuron diseases: a review of recent studies. J Neurol Sci, 191, 3-9.

Worrall, B. B., Rowland L. P., Chin S. S. and Mastrianni J. A. (2000) Amyotrophy in prion diseases. Arch Neurol, 57, 33-38.

Wyss-Coray, T. and Mucke L. (2002) Inflammation in neurodegenerative disease--a double-edged sword. Neuron, 35, 419-432.

Xiao, Q., Zhao W., Beers D. R., Yen A. A., Xie W., Henkel J. S. and Appel S. H. (2007) Mutant SOD1(G93A) microglia are more neurotoxic relative to wild-type microglia. J Neurochem, 102, 2008-2019.

Xiao, S., McLean J. and Robertson J. (2006) Neuronal intermediate filaments and ALS: a new look at an old question. Biochim Biophys Acta, 1762, 1001-1012.

Xiao, S., Tjostheim S., Sanelli T., McLean J. R., Horne P., Fan Y., Ravits J., Strong M. J. and Robertson J. (2008) An aggregate-inducing peripherin isoform generated through intron retention is upregulated in amyotrophic lateral sclerosis and associated with disease pathology. J Neurosci, 28, 1833-1840.

Xing, J., Yu Y. and Rando T. A. (2002) The modulation of cellular susceptibility to oxidative stress: protective and destructive actions of Cu,Zn-superoxide dismutase. Neurobiol Dis, 10, 234-246.

Xu, Z., Cork L. C., Griffin J. W. and Cleveland D. W. (1993) Increased expression of neurofilament subunit NF-L produces morphological alterations that resemble the pathology of human motor neuron disease. Cell, 73, 23-33. 198

Yamaguchi, H., Sugihara S., Ogawa A., Oshima N. and Ihara Y. (2001) Alzheimer beta amyloid deposition enhanced by apoE epsilon4 gene precedes neurofibrillary pathology in the frontal association cortex of nondemented senior subjects. J Neuropathol Exp Neurol, 60, 731-739.

Yamanaka, K., Boillee S., Roberts E. A., Garcia M. L., McAlonis-Downes M., Mikse O. R., Cleveland D. W. and Goldstein L. S. (2008a) Mutant SOD1 in cell types other than motor neurons and oligodendrocytes accelerates onset of disease in ALS mice. Proc Natl Acad Sci U S A, 105, 7594-7599.

Yamanaka, K., Chun S. J., Boillee S., Fujimori-Tonou N., Yamashita H., Gutmann D. H., Takahashi R., Misawa H. and Cleveland D. W. (2008b) Astrocytes as determinants of disease progression in inherited amyotrophic lateral sclerosis. Nat Neurosci, 11, 251-253.

Yen, A., Simpson E. P. and Appel S. H. (2006) Neuroinflammation in ALS. In: Amyotrophic Lateral Sclerosis, (H. Mitsumoto, S. Przedborski and P. Gordon eds.), pp. 487-503. Taylor and Francis, New York.

Yen, A. A., Simpson E. P., Henkel J. S., Beers D. R. and Appel S. H. (2004) HFE mutations are not strongly associated with sporadic ALS. Neurology, 62, 1611-1612.

Yeo, G., Holste D., Kreiman G. and Burge C. B. (2004) Variation in alternative splicing across human tissues. Genome Biol, 5, R74.

Yoshida, M. (2004) Amyotrophic lateral sclerosis with dementia: the clinicopathological spectrum. Neuropathology, 24, 87-102.

Yoshihara, T., Ishigaki S., Yamamoto M., Liang Y., Niwa J., Takeuchi H., Doyu M. and Sobue G. (2002) Differential expression of inflammation- and apoptosis-related genes in spinal cords of a mutant SOD1 transgenic mouse model of familial amyotrophic lateral sclerosis. J Neurochem, 80, 158-167.

Yoshihara, T., Ishii T., Iwata M. and Nomoto M. (1998) Ultrastructural and histochemical study of the motor end plates of the intrinsic laryngeal muscles in amyotrophic lateral sclerosis. Ultrastruct Pathol, 22, 121-126.

Zhang, B., Tu P., Abtahian F., Trojanowski J. Q. and Lee V. M. (1997) Neurofilaments and orthograde transport are reduced in ventral root axons of transgenic mice that express human SOD1 with a G93A mutation. J Cell Biol, 139, 1307-1315.

Zhu, Q., Couillard-Despres S. and Julien J. P. (1997) Delayed maturation of regenerating myelinated axons in mice lacking neurofilaments. Exp Neurol, 148, 299-316.

Zhu, Q., Lindenbaum M., Levavasseur F., Jacomy H. and Julien J. P. (1998) Disruption of the NF-H gene increases axonal microtubule content and velocity of neurofilament transport: relief of axonopathy resulting from the toxin beta,beta'-iminodipropionitrile. J Cell Biol, 143, 183-193. 199

Zinman, L., Liu H. N., Sato C. et al. (2009) A mechanism for low penetrance in an ALS family with a novel SOD1 deletion. Neurology, 72, 1153-1159.

Zoccolella, S., Beghi E., Palagano G. et al. (2007) Riluzole and amyotrophic lateral sclerosis survival: a population-based study in southern Italy. Eur J Neurol, 14, 262-268.

Zoccolella, S., Masi G., Mezzapesa D., Carnicella F., Iliceto G., Lamberti P. and Serlenga L. (2008) Motoneuron disease after electric injury: a case report. Neurol Sci, 29, 47-49.