A Dissertation
entitled
Characterization of the CXCR4-LASP1-eIF4F Axis in Triple-Negative Breast Cancer
by
Cory M Howard
Submitted to the Graduate Faculty as partial fulfillment of the requirements for the
Doctor of Philosophy Degree in
Biomedical Sciences
______Dayanidhi Raman, B.V.Sc., Ph.D., Committee Chair
______Amit Tiwari, Ph.D., Committee Member
______Ritu Chakravarti, Ph.D., Committee Member
______Nagalakshmi Nadiminty, Ph.D., Committee Member
______Saori Furuta, Ph.D., Committee Member
______Shi-He Liu, M.D., Committee Member
______Amanda C. Bryant-Friedrich, Ph.D., Dean College of Graduate Studies
The University of Toledo
August 2020
© 2020 Cory M. Howard
This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of
Characterization of the CXCR4-LASP1-eIF4F Axis in Triple-Negative Breast Cancer
by
Cory M. Howard
Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy Degree in Biomedical Sciences
The University of Toledo August 2020
Triple-negative breast cancer (TNBC) remains clinically challenging as effective
targeted therapies are still lacking. In addition, patient mortality mainly results from the
metastasized lesions. Therefore, there is an unmet need to develop novel therapies against
metastatic TNBC (mTNBC). CXCR4 has been identified to be one of the major
chemokine receptors involved in breast cancer metastasis. Previously, our lab had
identified LIM and SH3 Protein 1 (LASP1) to be a key mediator in CXCR4-driven
invasion. To further investigate the role of LASP1 in this process, a proteomic screen was
employed and identified a novel protein-protein interaction between LASP1 and
components of eukaryotic initiation 4F complex (eIF4F). We hypothesized that activation
of the CXCR4-LASP1-eIF4F axis may contribute to the preferential translation of
oncogenic mRNAs leading to an altered pro-oncogenic proteome that facilitates breast
cancer progression and metastasis. To test this hypothesis, we first confirmed that the
gene expression of CXCR4, LASP1, and eIF4A are upregulated in invasive breast cancer.
Moreover, we demonstrate that LASP1 specifically associated with eIF4A, a mRNA
helicase, in a CXCL12-dependent manner via a proximity ligation assay. We validated this finding through many approaches including co-immunoprecipitation and GST-
iii pulldown assays. Furthermore, we showed an association with eIF4B, an ancillary protein
that enhances the helicase activity of eIF4A. Activation of CXCR4 signaling by its
ligand, CXCL12, increased the translation of oncoproteins downstream of eIF4A.
Interestingly, genetic silencing of LASP1 interrupted the ability of eIF4A to translate oncogenic mRNAs into oncoproteins implicating a role for LASP1 in mediating the signaling from CXCR4. This impaired ability of eIF4A was confirmed by a previously established luciferase reporter assay which harbors a 5'-leader dependent on the helicase activity of eIF4A. Finally, depletion of LASP1 sensitizes 231S cells to the pharmacological inhibition of eIF4A by Rocaglamide A as evident through reduced expression of BIRC5, ROCK1, Cyclin D1, and Mdm2 which are downstream effectors of eIF4A and serves as an endogenous measure of the level of its activity. Importantly, the viability of 231 cells is compromised with the concomitant depletion of LASP1 and the pharmacological inhibition of eIF4A. Overall, our work identified that the CXCR4-
LASP1 axis is a novel mediator in oncogenic protein translation through activation of the helicase activity of eIF4A.
Next, we attempted to identify novel small molecule inhibitors against the helicase activity of eIF4A which is part of the CXCR4-LASP1-eIF4F axis. To accomplish this goal, a (CGG)4-tdTomato-luciferase reporter system was established to
determine the helicase activity of eIF4A in three distinct TNBC cell lines. The Prestwick
Chemical Library, consisting of mostly FDA-approved and off-patent drugs, was then
screened. This led to identification of cardiac glycosides as potential inhibitors of eIF4A-
mediated translation. We hypothesize that cardiac glycosides inhibit the expression of
eIF4A through decreases in c-Myc. The combination of rocaglamide A and a standard
iv cardiac glycoside such as digoxin exhibited synergistic anti-cancer activity against TNBC cells in vitro. Thus, digoxin and other related cardiac glycosides could be potentially harnessed to target the helicase activity of eIF4A in order to disrupt the CXCR4-LASP1- eIF4F axis in mTNBC.
v
Table of Contents
Abstract ...... iii
Table of Contents ...... vi
List of Tables ...... xiii
List of Figures ...... xiv
1 Breast Cancer Research and Treatment ...... 1
1.1 Epidemiology ...... 1
1.2 Subclassification of Breast Cancer and its Clinical Importance ...... 3
1.3 Triple-Negative Breast Cancer and Treatment ...... 4
1.4 Subtypes of Triple-Negative Breast Cancer ...... 6
1.5 The Phosphatidylinositol 3-kinase (PI3K) Pathway and Breast Cancer ...... 8
1.6 Future Perspectives on the Research and Treatment of Triple-Negative
Breast Cancer ...... 10
2 CXCR4 and Cancer...... 12
2.1 Chemokine Receptors in Cancer Biology ...... 12
2.1.1 Chemokine Receptors: An Overview ...... 12
2.1.2 Chemokine Receptors and Cancer Biology ...... 14
2.2 CXCL12–CXCR4 and Breast Cancer ...... 15
2.2.1 Cellular Signaling ...... 16
2.2.2 Tumor Microenvironment ...... 17
vi 2.2.3 Cancer Stemness ...... 20
2.2.4 Atypical Chemokine Receptor 3 (CXCR7) ...... 21
3 LIM and SH3 Protein 1 ...... 23
3.1 Introduction ...... 23
3.1.1 LASP1 Phosphorylation...... 25
3.1.2 Physiological Functions ...... 26
3.2 LASP1 and Cancer ...... 27
3.2.1 LASP1 and the Metastatic Cascade ...... 28
3.2.2 Uncovering a Unique Role for LASP1 in Chemotaxis ...... 29
3.2.3 LASP1 and the PI3K-Akt-mTOR Pathway ...... 29
3.2.4 LASP1 and Epigenetics ...... 30
3.2.5 Regulation of LASP1 Expression Levels ...... 31
4 A Key Role for the eIF4F Complex in Cancer ...... 35
4.1 Introduction ...... 35
4.1.1 mRNA Structure and Function ...... 37
4.2 The 5’Leader Sequence...... 37
4.2.1 5′ Terminal Oligopyrimidine (5’TOP) Motifs ...... 37
4.2.2 (NGG)4 Motifs: G-quadruplexes vs. Classical Secondary
Structures ...... 38
4.2.2.1 G-quadruplexes ...... 39
4.2.2.2 Translation Initiator of Short 5’UTR (TISU)...... 40
4.2.3 Translation Initiator of Short 5’UTR (TISU) ...... 42
4.3 eIF4F and Cancer ...... 42
vii 4.3.1 eIF4E ...... 42
4.3.2 eIF4A ...... 45
4.3.3 eIF4G ...... 49
4.3.4 eIF4B...... 51
4.3.5 eIF4H ...... 53
4.4 Regulation of the eIF4F Complex...... 54
4.4.1 4E-BP1 ...... 54
4.4.2 PDCD4 ...... 57
4.5 eIF4F Inhibitors ...... 58
4.5.1 4Ei-1 ...... 59
4.5.2 4E-GI-1/4E1RCat ...... 59
4.5.3 Hydrocarbon-stapled-4E-BP1 Peptide ...... 60
4.5.4 Pateamine A/DMDA PatA ...... 61
4.5.5 Hippuristanol...... 62
4.5.6 Rocaglates ...... 65
4.5.6.1 Rocaglamide A...... 65
4.5.6.2 Silvestrol ...... 66
4.5.6.3 FL3 ...... 67
4.5.6.4 CR-31-B/SDS-1-021-(-) ...... 67
4.5.6.5 Amidino-Rocaglates ...... 68
4.5.6.6 Aglaiastatins and Aglaroxins ...... 68
4.5.6.7 EC143.29 and EC143.69...... 69
4.5.6.8 eFT226/Additional Rocaglate Derivatives ...... 69
viii 4.5.7 Briciclib (ON 013105)/RNA-based Strategies ...... 69
4.6 Conclusions ...... 70
5 The CXCR4-LASP1-eIF4F Axis Promotes Translation of Oncogenic Proteins in
Triple-Negative Breast Cancer Cells ...... 72
5.1 Introduction ...... 72
5.2 Materials and Methods ...... 75
5.2.1 Bioinformatics Analysis...... 76
5.2.2 Cell Culture ...... 76
5.2.3 Generation of LASP1 Knockdown and Knockout Cell Lines ...... 77
5.2.4 Co-immunoprecipitation Assay ...... 77
5.2.5 m7-GTP Pull-Down Assay ...... 78
5.2.6 GST-LASP1 Pull-Down of eIF4A and eIF4B ...... 79
5.2.7 Direct Binding of LASP1 to eIF4A and eIF4B ...... 79
5.2.8 Proximity Ligation Assay (PLA) ...... 80
5.2.9 Western Blotting ...... 81
5.2.10 Real-Time PCR ...... 82
5.2.11 GQ 5′UTR Luciferase Assay ...... 83
5.2.12 Pharmacological Inhibition of eIF4A in 231S LASP1 NS and KD
Cells ...... 84
5.2.13 Statistical Analysis and Graph Preparation...... 85
5.3 Results… ...... 85
5.3.1 Breast Cancer Patient Samples Contain Elevated Levels of CXCR4,
LASP1, eIF4A, eIF4B, and the Downstream Targets of eIF4A ....85
ix 5.3.2 LASP1 Associates With eIF4A Endogenously in a CXCL12-
Dependent Manner in situ ...... 87
5.3.3 LASP1 Co-immunoprecipitates with eIF4A and eIF4B
Endogenously in a CXCL12-Dependent Manner ...... 87
5.3.4 Endogenous LASP1 Associates with the eIF4F Complex in a
CXCL12-Dependent Manner ...... 88
5.3.5 LASP1 Directly Binds to Both eIF4A and eIF4B ...... 91
5.3.6 Activation of CXCR4 Promotes Phosphorylation of PDCD4,
eIF4B, and 4E-BP1 ...... 91
5.3.7 Activation of the CXCR4-LASP1 Axis Enhances Selective
Expression of Genes Downstream of eIF4A ...... 92
5.3.8 Stable Knock Down of LASP1 Sensitizes TNBC Cells to eIF4A
Inhibition ...... 96
5.4 Discussion ...... 99
6 Identification of Cardiac Glycosides as Novel Inhibitors of eIF4A-mediated
Translation in Triple-Negative Breast Cancer Cells ...... 104
6.1 Introduction ...... 104
6.2 Materials and Methods ...... 107
6.2.1 Cell Culture ...... 107
6.2.2 Plasmids ...... 107
6.2.3 Compounds ...... 108
6.2.4 Luciferase Assays ...... 108
6.2.5 Generation of (CGG)4 Reporter Cell Lines ...... 108
x 6.2.6 (CGG)4-Luc2-tdTomato and Total Protein Readings ...... 109
6.2.7 Prestwick Chemical Library Screen ...... 109
6.2.8 Western Blotting ...... 110
6.2.9 Promoter Binding Analysis ...... 111
6.2.10 iLINCS GSEA ...... 111
6.2.11 Rescue Experiments ...... 111
6.2.12 Cell Viability ...... 112
6.2.13 Synergy Analysis ...... 112
6.2.14 Live-cell Cleaved Caspase 3 Staining...... 112
6.2.15 Graph Preparation, Determination of IC50 values, and Statistical
Analysis...... 112
6.3 Results…… ...... 113
6.3.1 Establishment of the (CGG)4 Luc2-TdTomato Reporter System 113
6.3.2 Prestwick Chemical Library Screen ...... 114
6.3.3 Cardiac Glycosides Inhibit eIF4A-mediated Translation in Triple-
Negative Breast Cancer Cells ...... 114
6.3.4 Cardiac Glycosides Modulate eIF4A Expression Levels through c-
Myc ...... 117
6.3.5 The Combination of Cardiac Glycosides and Rocaglates are
Synergistic in Inhibiting TNBC cells in vitro...... 122
6.4 Discussion ...... 125
7 Summary and Future Directions ...... 129
7.1 Summary and Implications of Work ...... 129
xi 7.2 Future Directions on the CXCR4-LASP1-eIF4F Axis ...... 130
7.2.1 Elucidation of the Mechanism by which LASP1 contributes to
eIF4F ...... 130
7.2.2 Identification of the CXCR4- and LASP1-Specific Proteome .....130
7.2.3 Examination of the LASP1-eIF4F Interaction at the Leading Edge
of Cells ...... 131
7.2.4 Other implications of the LASP1-eIF4A Interaction ...... 132
7.2.5 Development of a LASP1 Inhibitor ...... 132
7.3 Future Directions on the Identification of Digoxin as a Novel Inhibitor of
eIF4A-mediated Translation ...... 133
7.3.1 Examination of the Mechanism by which Digoxin Inhibits
c-Myc ...... 133
7.3.2 Development of Favorable Anti-Cancer Digoxin Derivatives .....133
7.3.3 Investigation of the eIF4A Transcriptional Network ...... 134
7.3.4 Examination of the Rocaglamide A-Digoxin Combination ...... 134
7.3.5 Digoxin: A Potential LASP1-, eIF4A inhibitor, or both? ...... 135
References ...... 136
xii
List of Tables
3.1 Regulation of LASP1 by microRNAs...... 32
4.1 Comparison of eIF4F Inhibitors...... 61
6.1 Digoxin Gene Set Enrichment Analysis ...... 121
6.2 Bufalin Gene Set Enrichment Analysis ...... 123
6.3 c-Myc Promoter Binding Analysis ...... 124
xiii
List of Figures
1 – 1 Subclassifications of Breast Cancer and Treatments ...... 2
1 – 2 Triple-Negative Breast Cancer Metastasis...... 6
1 – 3 The PI3K-Akt-mTOR Pathway ...... 9
2 – 1 CXCR4 Mediates the Metastatic Cascade in Breast Cancer Cells ...... 16
2 – 2 Understanding the CXCR4 Signaling Network ...... 21
2 – 3 Elucidating CXCR4’s role in the tumor microenvironment ...... 22
3 – 1 Structural Overview of LIM and SH3 Protein 1 ...... 26
3 – 2 LASP1 Physiological Functions ...... 27
3 – 3 LASP1 and Cancer ...... 31
4 – 1 eIF4F and Cancer ...... 36
4 – 2 mRNA Structure and the 5’ Leader Region ...... 41
4 – 3 eIF4F Signaling Cascade ...... 56
4 – 4 Comparison of eIF4F Inhibitors...... 64
5 – 1 The CXCR4-LASP1-eIF4A/B Axis is Upregulated in Breast Carcinoma
Patients ...... 86
5 – 2 The LASP1-eIF4A Interaction Increases with CXCL12 Stimulation in situ ...... 89
5 – 3 LASP1 Interacts with the eIF4F Complex in a CXCL12-dependent Manner...... 90
5 – 4 LASP1 Directly Interacts with both eIF4A and eIF4B ...... 94
5 – 5 Activation of CXCR4 Promotes Phosphorylation of eIF4B, 4E-BP1,
xiv and PDCD4 ...... 95
5 – 6 Activation of the CXCR4-LASP1 Axis Enhances Selective Expression of eIF4A-
dependent Genes ...... 97
5 – 7 Stable Knockdown of LASP1 Sensitizes TNBC Cells to Inhibition by
Rocaglamide A...... 98
5 – 8 Proposed Model of the CXCR4-LASP1-eIF4F Axis ...... 103
6 – 1 Characterization of the (CGG)4 Luc2-tdTomato Reporter System ...... 116
6 – 2 Prestwick Chemical Library Screen...... 117
6 – 3 Cardiac Glycosides Inhibit eIF4A-dependent Translation in TNBC Cells ...... 119
6 – 4 Cardiac Glycosides Modulate eIF4A Expression Levels through c-Myc ...... 120
6 – 5 Rocaglates in Combination with Cardiac Glycosides are Synergistic in Inhibiting
TNBC cells in vitro ...... 124
6 – 6 Proposed Combinatorial Targeting of eIF4A in TNBC cells ...... 128
xv Chapter 1
Breast Cancer Research and Treatment
For the past 50 years, significant progress has been made in the diagnosis and
treatment of female breast cancer [1]. Therapies have advanced from partial or total
mastectomies to a combination of chemotherapy, radiotherapy, and surgical resection of lesions. Attempts to define gene expression patterns of tumors have substantially changed the field. Endocrine therapies in ER-positive patients along with trastuzumab in HER2-
patients have greatly improved the 5-year survival rate for the majority of patients.
However, triple-negative breast cancer (TNBC) remains the most aggressive and
challenging subtype of breast cancer. Much progress is still needed to improve the
clinical outcome for those diagnosed with metastatic and basal-like breast cancer. In this
chapter, we provide an overview of the field of breast cancer research and treatment.
1.1 Epidemiology
Female breast cancer is the second most common form of cancer in the United
States. In 2019, there were approximately 3.8 million women diagnosed with this disease.
The relative survival for localized breast cancer remains high at 90% over the course of 5 years. However, this drops to a staggering 27% once the cancer has metastasized. Pre-
1 menopausal African American women are disproportionally affected. Their death rate
remains the highest among all other race and ethnicity groups. Overall, there is a 13%
risk rate to develop breast cancer over a female’s lifetime [2,3].
Figure 1-1 Subclassifications of Breast Cancer and Treatments. Based on the gene expression profile of the tumor, breast cancer is commonly divided into 4 main subtypes. These include luminal A, luminal B, HER2-enriched, and basal-like. Tumors are primarily grouped by the expression status of estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 (HER2). Patients whose cancer is enriched for estrogen or progesterone receptor may benefit from the use of hormonal pathway- targeted therapies such as selective estrogen receptor modulators/SERMs (tamoxifen), selective estrogen receptor downregulators/SERDS (fulvestrant), or aromatase inhibitors (letrozole). Tumors that are enriched for HER2 benefit from anti-HER2 monoclonal antibody (mAb)-based therapies like trastuzumab. Lastly, tumors which are not enriched for any receptor, or are very aggressive in nature, require the use of standard neoadjuvant chemotherapies (NACT). Taxanes, platinum drugs, and anthracyclines have been shown to be very effective in the use against breast cancer but are also highly toxic. Talazoparib [poly ADP-ribose polymerase (PARP) inhibitor)] or pembrolizumab (mAb against programmed death receptor-1 in CD8+ T cells) have been approved under certain tumor profiles but with limited success.
2 1.2 Subclassification of Breast Cancer and its Clinical
Importance
Systemic management of the primary breast tumor based on the gene expression
profile in the tumors has greatly improved clinical outcome [4]. Based on the gene
expression profile, breast carcinomas are divided into four major categories. These
include human epidermal growth factor receptor 2 (HER2) enriched, luminal A [estrogen
receptor (ER) +, progesterone receptor (PR) +, HER2-, Ki-67 low], luminal B [ER+, PR+/-,
HER2+/-, Ki-67 high], and basal-like (ER/PR/HER2-, Ki-67 high) [5]. Reliable gene
expression profiles are routinely obtained from fine-needle aspirates which facilitate
treatment options [6]. An overview of the clinical subclassifications of breast cancer and
treatment options is provided (Fig. 1-1).
Trastuzumab and endocrine therapies have greatly improved patient outcome in luminal A and B cancers. Tumors which upregulate ER expression benefit from hormonal axis-directed therapies such as fulvestrant or tamoxifen (SERDS and SERMS), and letrozole (aromatase inhibitors) [7]. Trastuzumab is a HER2-directed monoclonal antibody that has greatly improved the disease-free and overall survival for patients with
HER2-enriched tumors [8]. Other successful therapies have also been developed against
HER2. For example, pertuzumab is a HER2 dimerization inhibitor which can be used in combination with trastuzumab [9]. Trastuzumab emtansine (T-DM1) is an antibody-drug conjugate of trastuzumab and the cytotoxic agent emtansine. Recently, T-DM1 was approved for the adjuvant treatment of patients with HER2-positive early breast cancer
(EBC) who have residual invasive disease after neoadjuvant taxane and trastuzumab-
3 based treatments [10]. Unfortunately, ~20% of breast tumors are classified as triple- negative or basal like and do not benefit from hormone- or HER2-directed therapies as they lack detectable expression of any targets for these therapies.
1.3 Triple-Negative Breast Cancer and Treatment
In the clinical setting, triple-negative breast cancer (TNBC) remains the most challenging to treat as the pathological complete response (pCR) is low. In a cohort of over 1600 breast cancer patients, those with TNBC had an increased likelihood of distant recurrence and death [11]. Another study found recurrence and death rates are higher for
TNBC patients in the first 3 years of treatment [12]. TNBCs are more likely to metastasize to the lungs, brain, and bones [13]. Common sites for metastasis in TNBC patients are indicated (Fig. 1-2).
NACT is commonly used in the systematic management of TNBC patients.
Triple-negative tumors tend to respond better to anthracycline-based chemotherapies
(doxorubicin) as compared to CMF (cyclophosphamide, methotrexate, fluorouracil) regimens [14]. The addition of taxanes (docetaxel or paclitaxel) to anthracycline treatments also improves the disease-free survival in ER- tumors [15]. Other potential therapies are continually being developed and are discussed elsewhere [16]. Such examples include combinations of atezolizumab (PD-L1 mAb) with nab-paclitaxel, trilaciclib (CDK4/6 inhibitor) with gemcitabine (an antimetabolite) plus carboplatin, and bevacizumab [vascular endothelial growth factor (VEGF) mAb] with nab-paclitaxel plus doxorubicin and cyclophosphamide [17-19]. Overall, the enhanced propensity for
4 metastasis and lack of approved targeted therapies contributes to the poor clinical outcome for patients diagnosed with TNBC.
One interesting phenomenon for TNBC patients is referred to as the “TNBC paradox.” Tumors are initially more sensitive to anthracycline based NACT as compared to ER+ tumors, but with the high rate of recurrence or relapse, more aggressive tumors
and metastatic deposits are eventually observed. This paradoxical response leads to a
grave prognosis [12,20]. Recent retrospective studies have further investigated and
confirmed this finding. In a span of cases collected over a 21-year period, the overall rate
of distant recurrence for breast cancer in general has decreased over time. However,
TNBC patients have an increased risk for relapse of metastatic TNBC (mTNBC) [21]. In
addition, the TNBC paradox could be potentially explained by stratifying the
proliferation rate of triple-negative breast tumors. When grouping TNBCs by Ki-67
expression, tumors with a high expression of Ki-67 initially responded well to
chemotherapy as indicated by the pCR rate. However, this cohort still had a poor relative
survival and overall survival as compared to other TNBC groups [22]. In all, these
finding would support a model where TNBCs, especially those who are actively
proliferating, respond extremely well to anthracycline- and taxane-based chemotherapies.
However, a small population of cancer cells remain and have a high propensity to
metastasize to distant sites. Due to the fact that mTNBCs are extremely difficult to treat,
these patients would unfortunately have a poor prognosis.
5 Figure 1-2 Triple-Negative Breast Cancer Metastasis. TNBC is most likely to metastasize to the lungs, brain, liver, and bones. These estimates have been derived from various retrospective investigations tracking the pattern of metastasis [16]. In all, TNBC is more likely to metastasize to visceral organs as compared to other subtypes of breast cancer.
1.4 Subtypes of Triple-Negative Breast Cancer
TNBC represents around 20% of all breast cancers and lacks detectable expression of ER, PR, and HER2. This subclassification is poorly defined at the molecular level. To further define basal like-tumors, a large-scale study at Vanderbilt
University analyzed 21 breast cancer gene expression datasets consisting of over 587 triple-negative tumors. In their attempts, the group identified six distinct molecular categories of triple-negative tumors. These include two basal-like (BL1 + BL2), an immunomodulatory (IM), a mesenchymal (M), a mesenchymal stem–like (MSL), and a
luminal androgen receptor subtype (LAR) [23].
6 The BL1 and BL2 subtypes constitute the majority of TNBCs and express genes
associated with cell cycle and DNA repair proteins. BL2 differs from BL1 by displaying
unique gene ontologies associated with growth factor signaling. In the IM type, tumor
cells upregulate pathways associated with immune cell and cytokine signaling. M and
MSL subtypes are associated with genes that regulate cell motility (epithelial-
mesenchymal transition) and cell differentiation. However, the MSL subtype includes
unique growth factor signaling gene ontologies. MSL cancers also have low expression
of proliferation and claudin transcripts. Lastly, the LAR subtype is characterized by its 9-
fold increase in the expression of androgen receptor (AR). Importantly, the group
demonstrated that differing TNBC subtypes have differential sensitivity to therapeutic
agents. For example, basal-like cell lines were shown to be sensitive to platinum-based
chemotherapeutics. Viability of LAR cell lines decreases with the AR antagonist,
bicalutamide [23]. Interestingly, the majority of cell lines used in this dissertation classify
under the MSL subtype and display sensitivity to phosphatidylinositol 3-kinase (PI3K)
pathway inhibitors (discussed below). The same research group later refined their initial
classification of TNBC subtypes. Using histopathological quantification and laser-capture microdissection, this list was later reduced to 4 subtypes of TNBC: BL1, BL2, M, and
LAR. Differences between IM, M, and MSL subtypes were found to occur due to contributions of tumor-associated stromal cells [24]. In all, the classification of TNBC subtypes may one day impact the standard-of-care approach for TNBC patients. For example, the antiandrogen enzalutamide is under clinical investigation for TNBCs which express androgen receptor (NCT02689427).
7 1.5 The Phosphatidylinositol 3-kinase (PI3K) Pathway and
Breast Cancer
The phosphatidylinositol 3-kinase (PI3K)-protein kinase B (Akt)-mammalian target of rapamycin (mTOR) signaling pathway is an active area of study in breast cancer biology. An overview of the molecular signaling pathway is provided (Fig. 1-3).
Aberrations in this pathway occur frequently in breast cancer and is reviewed elsewhere
[25]. For example, phosphatase and tensin homolog (PTEN), a negative regulator of the
PI3K-Akt-mTOR pathway, is mutated or lost in 35% of basal-like tumors [26]. To date, there are two compounds which have successfully been approved to target PI3k-Akt- mTOR signaling in the clinical setting. Everolimus (a mTOR inhibitor) is approved in combination with an aromatase inhibitor to improve the progression-free survival in patients with hormone-receptor positive advanced breast cancer [27]. Clinical trials are currently under the way to investigate the use of everolimus in TNBC (NCT02531932,
NCT02456857, etc.…) Recently, the Akt inhibitor, alpelisib, received approval for the use in patients with phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha (PIK3CA) -mutated, HR-positive, HER2-negative advanced breast cancer [28].
Alpelisib in combination with nab-paclitaxel is currently under clinical investigation for anthracycline resistant TNBCs with a PI3K or PTEN mutation (NCT04216472).
There are currently several active clinical trials to investigate new PI3K-Akt- mTOR pathway inhibitors. Capivasertib, an Akt inhibitor, improves the progression free survival (PFS) and overall survival (OS) in combination with paclitaxel as a first-line therapy for TNBC patients [29]. This promising phase II result warrants further
8 investigation in the phase III setting. Gedatolisib (PF-05212384) is a dual PI3K and
mTOR inhibitor which has been tested in phase I trials [30]. This compound is currently
being investigated in combination with a poly ADP ribose polymerase (PARP) inhibitor
for advanced TNBC (NCT03911973). We fully anticipate other PI3K-Akt-mTOR inhibitors will find their way into the TNBC drug development pipeline. For example, ipatasertib is a pan-Akt inhibitor. This compound is being investigated in combination with paclitaxel for patients with locally advanced or mTNBC (NCT03337724).
Figure 1-3 The PI3K-Akt-mTOR Pathway. Activation of the PI3K-Akt-mTOR pathway is frequently amplified among breast cancers. This occurs due to constitutively activating mutations in the catalytic subunit of PI3K, phosphatase and tensin homolog (PTEN) loss, activation of growth factor receptors, and so forth. Due to this important signaling node in breast cancer biology, several small molecule inhibitors have been approved against this pathway or are still under investigation for clinical use.
9 1.6 Future Perspectives on the Research and Treatment of
Triple-Negative Breast Cancer
Patients with hormone positive breast tumors have greatly benefited from several
other approaches in recent years. One example of this is the development of compounds
that inhibit the cyclin-dependent kinases 4 and 6 (CDK4 and CDK6). In HR-positive,
HER2-negative advanced breast cancer, PFS was significantly longer for those receiving ribociclib as a first-line treatment [31]. A clinical trial starting in August 2020 will be
testing ribociclib in combination with a HDAC inhibitor (belinostat) in patients with
mTNBC (NCT04315233). In addition, cancer immunotherapy has greatly improved the
field. There has been much interest in targeting the protein programmed death-ligand 1
(PD-L1), a membrane-bound ligand which suppresses the immune response from CD8+-
T-cells. Atezolizumab (PD-L1 mAb) in combination with nab-paclitaxel increases the
PFS of patients with mTNBC [17]. Pembrolizumab (PD-1 mAb) has recently been approved in combination with chemotherapy for the treatment of PD-L1+ TNBC tumors.
Lastly, a high proportion of triple-negative/basal like tumors have mutations in the breast cancer type susceptibility proteins (BRCAs) [16]. These proteins are involved in the double-stranded DNA repair pathway. Patients with tumors who have a mutated BRCA
status benefit from the use of PARP inhibitors. Targeting of the BRCA/PARP interaction
results in a synthetic lethality and therefore should be exploited. Talazoparib is approved
for the treatment of HER2- advanced breast cancer with a germline BRCA mutation. One
phase II clinical trial is estimated to be completed by August 2021 and tests the efficacy
of talazoparib in triple-negative and HER2-tumors as a single-agent (NCT02401347). In
10 all, the arsenal of chemotherapies available to the clinician for the TNBC patient will only continue to grow. This of course will be driven by fundamental basic-science research-driven questions in cancer biology.
11 Chapter 2
CXCR4 and Cancer
C-X-C chemokine receptor type 4 (CXCR4) is a G protein-coupled receptor
(GPCR) implicated in a wide variety of solid and hematological malignancies. It is important to note that CXCR4 is studied in many aspects of human medicine. CXCR4 plays prominent roles in embryogenesis, immunology, wound healing, and virology.
Warts, Hypogammaglobulinemia, Immunodeficiency, and Myelokathexis (WHIM) syndrome is a genetic disease which is caused from a mutation in the CXCR4 gene. In this chapter however, we will focus on CXCR4 and its connection to breast cancer. In order to fully appreciate this multifaceted protein, a brief overview of the field of chemokine receptors and cancer will be reviewed. Following this introduction, the vital role played by CXCR4 in primary tumor progression and eventual metastasis will be explored.
2.1 Chemokine Receptors in Cancer Biology
2.1.1 Chemokine Receptors: An Overview
Chemokine receptors are a diverse group of G protein-coupled receptors that usually associate with Gαiβγ. Currently, there are 20 known chemokine receptors and 50
12 chemotactic cytokines or chemokines, the ligands which bind to and activate the
chemokine receptors. In general, chemokines are responsible for making cells migrate in a precise spatiotemporal context. Cells migrate directionally toward a chemotactic gradient in the biological process called chemotaxis. For a cell to accomplish this goal, it requires a complex signaling network to sense the gradient and rearrange the cytoskeletal network which results in cellular polarization. This process happens in three distinct steps: chemosensing, polarization, and locomotion [32]. In addition, some chemokine receptors act as molecular sponges or “scavengers” to control environmental chemokine levels and shape the chemokine gradient . An example of this is atypical chemokine receptor 3 (ACKR3 or CXCR7). Based on the positioning of the cysteine residues in the chemokines, there are several subclassifications of chemokine receptors. These include
CXC, CC, CX3C, or C chemokine receptors [33]. CXC chemokines can be further divided into ELR+ or ELR- based on a Glu–Leu–Arg motif preceding the first cysteine in
the chemokine.
Chemokine receptors play vital roles in normal physiology. More specifically,
they are necessary for proper immune cell homeostasis and function of the nervous
system. In the immune system, activation of chemokine signaling induces leukocyte to
arrest, cluster via integrin expression, and extravasate from the blood stream toward the
chemokine gradient in the local tissues. Once present in the tissue, they are able to fight
any infection or immunogen that may be present. The role of chemokine receptors in the
immune system also extends the biological process of wound healing. Mice lacking
CXCR2 or CX3CR1 are unable to recruit neutrophils or macrophages into the wound, respectively [34,35]. A similar mechanism is also found in the nervous system. CXCR2
13 plays an important role in the function of oligodendrocytes and the developing spinal cord [36]. The role of chemokine receptors in both immune and nervous system function has been reviewed elsewhere [37,38].
2.1.2 Chemokine Receptors and Cancer Biology
The diverse role of chemokine receptors is a critical, yet growing field of study in cancer biology. This includes investigations on both tumor cells and its surrounding niche called the tumor microenvironment (TME). Activation of chemokine receptors on tumor cells from the primary site often leads to cancer cell dissemination via the blood and lymph nodes and results in metastasis. In addition, tumor cells often recruit other stromal cells to the TME via chemokines. This process has been documented for recruitment of tumor-associated macrophages (TAMs), tumor-associated neutrophils (TANs), cancer- associated fibroblasts (CAFs), myeloid-derived tumor suppressor cells (MDSCs), and endothelial cells (locally and from endothelial progenitor cells from the bone marrow)
[32]. For example, levels of CCL5 and CCL2 is associated with enhanced recruitment of
TAM levels within the TME. Tumor infiltration of TAMs is associated with a poor patient prognosis [39]. Moreover, one of the most well studied chemokines in the field of tumor angiogenesis (discussed later) is IL-8 or CXCL8. Tumor cells secrete CXCL8 which stimulates endothelial cells via CXCR2 to produce vascular endothelial growth factor (VEGF). In return, VEGF promotes more CXCL8 production in a positive feedback loop. TANs also produce VEGF in response to CXCL8 [40]. CXCL8 is just one example of the autocrine and paracrine chemokine signaling loops that exist between tumor and stromal cells. An extensive list has been previously reviewed on various chemokines and their pro-tumorigenic effects on tumor and stromal cells [41].
14 2.2 CXCL12–CXCR4 and Breast Cancer
Upon further investigation of the role of chemokine receptors in breast cancer
biology, both the CXCL12/CXCR4 and CCL21/CCR7 signaling axes were found to be
associated with the metastatic cascade. More specifically, CXCR4 is upregulated in
tumors cells and cannot be detected in normal mammary epithelium. The increase of
CXCR4 leads to the preferential metastasis of circulating tumor cells to organs which
secrete high levels of CXCL12 [42-44]. Such organs include the lungs, bone, and brain
(Fig. 2-1). One potential mechanism could be due to the role of CXCR4 in preventing anoikis in breast cancer cells. Anoikis is a form of programmed cell death that occurs when cells detach from the extracellular matrix and is one major obstacle of the metastatic cascade [45]. Furthermore, activation of CXCR4 has been shown to promote epithelial to mesenchymal transition (EMT). This process occurs when cancer cells lose cell-to-cell adhesion and become migratory/invasive. Deletion of the carboxy-terminal domain of CXCR4 prevents β arrestin-mediated desensitization of CXCR4. MCF-7 breast cancer cells which harbor this mutant form of CXCR4 downregulate epithelial markers such as E-cadherin and Zonula occludens-1 (ZO-1) and upregulate ZEB1 (an
EMT transcription factor) demonstrating that they are indeed mesenchymal [46,47].
Subsequent studies have validated the importance of CXCR4 in patient samples.
Increased levels of CXCR4 are associated with the incidence of metastasis to the lymph node from invasive ductal carcinomas (IDC) [48,49]. In a cohort of 53 patients with locally advanced breast cancer, expression of CXCR4 predicted a poor clinical outcome
[50]. Interestingly, CXCR4 was also detected in the early stages of breast cancer, or ductal carcinoma in situ (DCIS) [51].
15 In addition to the metastatic breast cancer cascade, CXCR4 may also promote the
formation of the primary tumor. By using RNAi and the CXCR4 antagonist, AMD3100,
inhibition of CXCR4 significantly delayed the growth of syngeneic triple-negative 4T1
mouse allograft tumors [52]. In addition to TNBC, CXCR4 mediates tumor progression
in hormone+ and HER2 subtypes. For example, CXCR4 has been shown to mediate
estrogen independence and HER2-mediated metastasis [53-55]. Several aspects of
CXCR4 biology will be reviewed in subsequent sections.
Figure 2-1 CXCR4 mediates the metastatic cascade in breast cancer cells. Organs that secrete high levels of CXCL12 are often the sites of metastasis Such organs include the lungs, bone, and brain. Stimulation of CXCR4 on tumor cells at the primary sites initiates a wide range of phenotypic changes. Epithelial to mesenchymal transition is promoted along with directional migration toward the chemokine gradient.
2.2.1 Cellular Signaling
Due to the importance of CXCR4 in breast cancer biology, several studies have
attempted to elucidate its molecular signaling network. Initial attempts to characterize the
phosphoproteome of CXCR4-stimulated cells have identified several key downstream
16 effectors (Fig. 2-2). This includes increases in the phosphorylation status of focal
adhesion complex components including focal adhesion kinase (FAK, Y397 and Y577),
related adhesion focal tyrosine kinase (RAFTK/Pyk2, Y402 and Y579/580), adapter
molecule crk-like protein (CRKL), and paxillin. Regulation of focal adhesion complexes
modulates adherence to extracellular matrices which is needed for directional cell
migration or chemotaxis. Additionally, PI3K/Akt signaling was shown to be an important
mediator of CXCL12-induced chemotaxis [56]. Tyrosine kinase signaling is regulated
through Src homology region 2 (SH2)-containing protein tyrosine phosphatase 2 (Shp2)
and the E3 ubiquitin-protein ligase, Cbl [57]. Moreover, the association of G protein αβγ
heterotrimers with CXCR4 is required to activate a wide variety of signaling pathways to
promote invasion. Such signaling pathways include PI3K, mitogen-activated protein
kinase (MAPK), JNK (c-Jun-NH2-kinase), p38 MAPK, and GSK-3α/β [58]. In reference
to the role of CXCR4 in directional migration, actin polymerization and cytoskeletal
rearrangement occurs through Gαi-dependent association of Engulfment and cell motility
protein 1 (ELMO1) with Dedicator of cytokinesis (DOCK180) to activate Ras-related C3
botulinum toxin substrate 1 and 2 (RAC1/2) [59].
2.2.2 Tumor Microenvironment
There is growing appreciation for the role of tumor-stroma interactions within the
TME. Activation of CXCR4 has been identified to play a significant role for several cell types (Fig. 2-3). For example, fibroblasts are often converted to myofibroblasts within the TME. In a xenograft model of breast cancer, injection of cancer cells promoted the transformation of mammary fibroblasts to carcinoma-associated fibroblasts (CAFs), or tumor-associated myofibroblasts. These CAFs were found to secrete high levels of
17 CXCL12. Based on these findings, autocrine and paracrine CXCR4 signaling loops are
thought to sustain both CAF and tumor cells [60]. Upregulation of CXCR4 in CAFs is
also confirmed in patient samples [61].
Another class of cells within the TME includes those from the immune system.
As mentioned previously, CXCR4 is plays important roles in the immune response and
wound healing process. However, mechanisms of immune evasion are often found within
the tumor so that the disease is able to progress. Once class of cells is referred to as
tumor-associated macrophages (TAMs), or macrophages that exhibit a M2 or “anti-
inflammatory” phenotype. TAMs which had a high expression of CXCR4 were found to
accumulate around the tumor perivascular and promote relapse following treatment with
chemotherapy. Cytostatics also up-regulated the levels of CXCL12 within the TME
suggesting that TAM recruitment was indeed CXCR4-dependent (in addition to recruitment through CCR2 and CCR7) [62].
An additional type of lymphocytes found in the TME is T-cells. Depending on context, T-cells can however suppress the immune response or stimulate it. Regulatory T cells (Tregs) suppress the detection of cancer cells by the immune system and are
associated with cancer progression. When staining ten basal-like and eleven luminal
breast tumors matched for grade, infiltration of Tregs correlated with CXCL12-positivity and a poor patient prognosis. Upregulation of CXCR4 in Tregs was also observed in basal-
like cancers and hypoxia [63]. While the infiltration of Tregs is associated with tumor
growth, cytotoxic T-cells recognize tumor antigens and impede or antagonize the cancer
progression. Using the FDA-approved CXCR4 antagonist plerixafor (AMD3100),
inhibition of CXCR4 increased the population of CD8+ cytotoxic T-cells within TME. In
18 several orthotopic murine models of breast cancer, the combination of AMD3100 and
immune checkpoint therapies (α-CTLA-4 or α-PD-1) reduced the metastatic burden in the lungs and improved OS [64]. In all, these results suggest that inhibition of CXCR4 promotes immune recognition and activation within the breast tumor.
Angiogenesis is another important process for cancer progression. Tumors lacking a vasculature are unable to grow due to the physical limitations of diffusion by nutrients and removal of metabolic waste. The process by which tumor cells initiate angiogenesis in the TME is often referred to as the “angiogenic switch.” A well characterized growth factor in this process is VEGF. Stimulation of CXCR4 increases expression levels of
VEGF through phosphorylation of AKT [65]. Interestingly, VEGF appears to be in a positive feedback loop with CXCR4. CXCL12-driven chemotaxis was significantly reduced in MDA-MB-231 cells when expression levels of VEGF were decreased with an anti-sense oligonucleotide. Moreover, the reduction of CXCR4 protein levels could be rescued with recombinant VEGF. It is hypothesized that this mechanism occurs through
Neuropilin-1 (a receptor for VEGF), but only preliminary studies were performed to test this hypothesis [66].
Tumor areas that do not receive a blood supply often lack oxygen or become hypoxic in nature. In response to a lack of available oxygen, tumor cells upregulate hypoxia-inducible factor 1α (HIF-1α). Cancer cells within these hypoxic regions become highly migratory and metastatic in nature due to an upregulation of CXCR4 [67].
Moreover, hypoxia-induced adhesion of tumor cells to endothelial cells occurs in a HIF-
1α and CXCR4-dependent manner [68]. In all, these results suggest that CXCR4 is indeed a direct transcriptional target of HIF-1α. Moreover, the CXCL12-CXCR4
19 signaling axis is important mediator for hypoxia-induced breast cancer metastasis.
Recently, osteoprogenitor cells located in hypoxic niches in the bone marrow were shown to secrete high levels of CXCL12. This in turn stimulated CXCR4 on breast cancer cells, along with osteoclasts, and together they orchestrate induction of metastatic bone lesions
[69]. Hypoxia can therefore “prime” the tissue microenvironment for successful metastatic colonization by tumor cells.
2.2.3 Cancer Stemness
Breast cancer stem-like cells are a subset of tumor cells that are characterized by being intrinsically drug-resistant, capable of self-renewal, and often lead to therapy failure. Cancer stemness is a plastic state depending on cellular context [70]. One technique that is employed to measure the cancer stemness is the mammosphere formation efficiency assay. CXCR4 was first implicated in breast cancer stemness after observing that murine mammospheres in suspension culture were positive for the expression of CXCR4 [71]. A subset of breast cancer stem-like cells characterized by a high expression of CD44 and low expression of CD24 were also found to subsequently express high levels of CXCR4 after isolation from the heterogenous parental tumor cell population [72]. Interestingly, breast cancer stem-like cells can possess different phenotypes depending on the context within the tumor. Cancer stem-like cells located in the interior of the tumor form a reservoir and are mainly proliferative in nature and express high levels of aldehyde dehydrogenase (ALDH) enzymes. However, when located on the periphery, the cancer stem-like cells display a migratory phenotype and are less proliferative. The periphery stem-like cells are highly metastatic in nature and upregulate levels of CXCR4 [73]. Lastly, CXCR4 promotes the expression of the ARP-
20 binding cassette (ABC) drug transporter G2 (ABCG2) via the JNK/c-Jun pathway which could be one mechanism of drug resistance to NACT [74].
Figure 2-2 Depiction of the CXCR4 signaling network. CXCR4 activates a wide range of pathways including phosphoinositide 3-kinase (PI3K)/protein kinase B (Atk), mitogen-activated protein kinase (MAPK), focal adhesion kinase (FAK), glycogen synthase kinase 3 beta (GSK-3β), and c-Jun N- terminal kinase (JNK) signaling.
2.2.4 Atypical Chemokine Receptor 3 (CXCR7)
Another chemokine receptor called atypical chemokine receptor 3 (ACKR3) or
CXCR7 also binds to CXCL12, the same ligand that binds and activates CXCR4.
However, ACKR3 functions as an orphan receptor controlling the CXCL12 gradient through its high affinity binding. CXCL12 is internalized and recycled back to the cell surface of tumor cells displaying ACKR3 on their cell membrane. ACKR3 does not activate any heterotrimeric G-proteins but activates the β-arrestin-ERK pathway [75]. For this reason, this receptor is called as a decoy receptor. Recent investigations have found that buffering and shaping of the CXCL12 gradient by ACKR3 is needed for optimal
21 directional migration [76]. CXCR4 and ACKR3 work together to shape the CXCL12
gradient in embryogenesis to direct embryonic cells to different locations that will later
form distinct regions. This process is recapitulated by tumor cells which shape the local
CXCL12 gradient for the differing steps of metastasis. Early studies on this receptor in xenograft models of breast cancer using RNAi suggested that ACKR3 is needed for both primary tumor growth and lung metastasis [77]. Subsequent mechanistic studies suggested that this could be due to decreased levels of CXCL12 within the primary TME.
Regulation of CXCL12 promoted the growth and metastasis of CXCR4+ cells within the
tumor [78]. In all, these results would suggest that there is a “optimal” window of
CXCL12 expression levels within the TME for breast cancer progression and metastasis.
Figure 2-3 Elucidation of the role of CXCR4 in the tumor microenvironment. Expression of CXCR4 on tumor cells promotes primary tumor progression and eventual metastasis. However, different stromal cells are also recruited to the tumor microenvironment. Autocrine and paracrine CXCL12/CXCR4 signaling loops have been documented for carcinoma-associated fibroblasts (CAFs), tumor-associated macrophages (TAMs), regulatory T-cells (Tregs), and endothelial cells.
22 Chapter 3
LIM and SH3 Protein 1
Since the discovery of LIM and SH3 protein 1 (LASP1) over 25 years ago, this
simple actin binding protein has evolved into a complex regulator of cancer biology [79].
In this chapter, we provide an overview of current LASP1 literature. We will first discuss
known physiological functions of LASP1 followed by its important role in cancer
biology. Most prominently, LASP1 is a key contributor to cancer cell migration and
invasion. Recent literature has identified newly appreciated roles for LASP1 including contributions to epigenetics and the PI3K-Akt-mTOR signaling pathway. Due to the importance of LASP1 in the steps of the metastatic process, several attempts have been worked to understand the regulation of this protein. Examples include elucidation of its phosphorylation status and modulation of expression levels by microRNAs. In all, the prominent contributions of LASP1 to metastatic breast cancer will only continue to grow.
These findings may one day prompt the development of a LASP1-specific inhibitor for
use in the clinical setting.
3.1 Introduction
LIM and SH3 protein 1 (LASP1) is 261 amino acids in length and contains a
Lin/Isl/Mec (LIM) domain (amino acids 5-57), two nebulin-like repeats (NR) domains
23 (amino acids 62–92, 98–128), a linker region (amino acids 129–2020), and a Src
Homology 3 domain (amino acids 203-261) [80]. A structural overview of this protein is
provided (Fig. 3-1). Initial studies on LASP1 revealed its ability to bind to filamentous
(F)-actin in the extensions of cell membranes [81,82]. LASP1-actin interactions occur at focal adhesion complexes, lamellipodia, and filopodia. Based on these findings, it is hypothesized that LASP1 regulates actin-based, cytoskeletal activities. This could be through the ability of LASP1 ability to stabilize actin bundles [83].
Directional cell migration and adhesion is largely controlled by the actin cytoskeleton. As such, cells which have reduced levels of LASP1 are unable undergo migration [84]. Upon integrin stimulation with extracellular matrix proteins, or plasma membrane receptors by growth factors, LASP localizes to focal adhesion complexes in migrating cells. The precise mechanism by which LASP1 regulates cell migration is still being explored, but this most likely occurs through several protein-protein interactions.
LASP1 associates with key actin and focal adhesion regulator proteins such as LIM-
containing lipoma-preferred partner (LPP), vimentin, palladin, kelch-related protein 1
(Krp1), talin, and zyxin [85-92]. While focal adhesions attach cells to the extracellular
matrix to generate the force necessary for directional migration, podosomes function to
attach and degrade the surrounding extracellular matrix. LASP1 is also recruited to and
regulates these dynamic, actin-rich structures [93].
In addition to cellular migration and podosome function, LASP1 has been shown
to regulate vesicular trafficking, a process required for cytoskeleton rearrangement.
Epithelial cells which produce large amounts of secretory proteins upregulate levels of
LASP1 [94]. For example, LASP1 is detected in parietal cells of the gastric mucosa
24 which are responsible for the production of hydrochloric acid (HCl). This finding was
confirmed in vivo as LASP1 knockout mice produce large amounts of HCl in response to histamine stimulation [95]. Mechanistically, LASP1 most likely regulates vesicular trafficking through its interaction with dynamin, a GTPase responsible for the scission of newly formed vesicles [96,97]. An overview of intracellular functions of LASP1 is
provided (Fig. 3-2).
3.1.1 LASP1 Phosphorylation
Cells treated with forskolin, an activator of protein kinase A (PKA), results in the
detection of a higher molecular weight form of LASP1 [98]. Further investigations on
this finding revealed that PKA phosphorylates mouse LASP1 directly on Ser 99 and Ser
146 [82]. Importantly, serine phosphorylation decreases the affinity of LASP1 for F-actin
which is important for the regulation of cell migration [99]. p-S146-LASP1 also
translocates to nucleus of cells by interacting with the tight junction protein, ZO-2 [100].
In addition to PKA-dependent phosphorylation, c-Abl kinase and Src kinase are able to
phosphorylate LASP1 at tyrosine 171. Increases in p-Y171 levels alters the cellular
localization of LASP1 [84,101,102]. It is important to note that the phosphorylation
status of LASP1 may be context dependent. For example, p-S146-LASP1 levels are
upregulated in breast cancer while p-Y171-LASP1 levels are primarily present in chronic
myeloid leukemia [103].
25 Figure 3-1 Schematic structure of LIM and SH3 Protein 1. LASP1 contains a LIM domain at the N-terminus, two nebulin-like repeats (NR) domains, a linker region, and an SRC Homology 3 domain at the C-terminus. In addition, there are two key phosphorylation sites (S146 and Y171) which are important for LASP1 functionality.
3.1.2 Physiological Functions
Several studies have clarified the role of LASP1 in differing physiological functions. As mentioned previously, LASP1 regulates actin-based vesicular trafficking needed by secretory cells that produce enzymes and vary ion gradients. In the context of the nervous system, LASP1 is present in synapses and dendritic spines [104].
Knockdown of LASP1 impairs spine development and synapse formation [105]. This may explain why polymorphisms in the LASP1 promoter are associated with schizophrenia pathologies [106]. LASP1 is also present in chondrocytes of spinal vertebrae [107]. Recently, LASP1 has been suggested to play a role in the function of the kidney. Podocytes in the Bowman's capsule localize LASP1 to the slit membrane, suggesting a role for LASP1 in the filtration of the blood [108]. Lastly, LASP1 may appear to play a role in reproduction and pregnancy. LASP1 is localized to apical membrane of rat uterine epithelial cells [109]. This could be due to a newly identified
26 association with talin1. Increases in talin1 levels inhibited the nuclear transportation of
LASP1 in endometrial cells and increased cell adhesion [89].
Figure 3-2 Physiological functions of LASP1. LASP1 contributes to normal physiology primarily through its ability to bind F-actin. The LASP1-actin interaction regulates cell migration and vesicular trafficking in cell biology. These two biological processes can be extended to multiple body systems. 3.2 LASP1 and Cancer
There is considerable interest in the role of LASP1 in cancer biology. Several
studies have confirmed the overexpression of LASP1 in numerous cancer types.
Increased levels of LASP1 are detected in brain, colorectal, esophageal, oral, liver,
kidney, stomach, lung, gallbladder, bile duct, thyroid, and prostate cancer tissues [110-
122]. Importantly, nuclear localization of LASP1 correlates with increased stages of
breast tumors and a poor overall survival [123,124]. LASP1 is also a mixed-lineage
27 leukemia (MLL) fusion partner suggesting a role in acute leukemia as well [125].
Moreover, LASP1 levels are upregulated in castration- resistant prostate cancer [126]. In
the following sections, we specifically focus on the contributions of LASP1 to the
metastatic cascade, the PI3K-Akt-mTOR signaling pathway, and regulation of cancer
epigenetics. Finally, we will examine the regulation of LASP1 levels within tumors.
Several transcription factors and microRNAs have been identified to control its
expression.
3.2.1 LASP1 and the Metastatic Cascade
Cancer metastasis is a complex biological process. For cancers to colonize and
grow at distant sites, cells at the primary tumor must first adopt a mesenchymal or
migratory phenotype. Epithelial to mesenchymal transition (EMT) is a process by which
epithelial cells lose their adhesive and proliferative capabilities and acquire mesenchymal features. Tumor cells first migrate to the lymphatics and eventually find their way into the blood stream. The conditions of the circulatory system are unfavorable, and many
cells do not survive. It is also important to note that extensive remodeling of the
extracellular matrix is required for this process. This is accomplished by using a host of
enzymes such as the matrix metalloproteinases (MMPs), a family of zinc-dependent endopeptidases.
LASP1 has been implicated in several steps of the metastatic cascade (Fig. 3-3).
Knockdown of LASP1 decreases invasion and migration in multiple cancer types [127-
129]. Several molecular mechanisms have been proposed to explain these findings.
Ovarian cancer cells with reduced levels of LASP1 have reduced zyxin localization to
28 focal adhesion contacts [123]. LASP1 also induces EMT-like phenotypes [130]. In colorectal cancer, this may occur through an interaction with the calcium binding protein
S100A11, which induces an aggressive phenotype both in vivo and in vitro [131].
Invadopodia are structures in cancer cells which are closely related to podosomes.
Knockdown of LASP1 significantly impaired invadopodia function in TNBC cells by reducing the expression of MMP1, MMP3, and MMP9 [132].
3.2.2 Uncovering a Unique Role for LASP1 in Chemotaxis
As reviewed in chapter two of this dissertation, chemokine receptors are a family
of proteins which contributes to the progression and metastasis of multiple cancer types.
In pursuits to understand CXCR2-mediated chemotaxis , LASP1 was found to associate,
and co-localize with CXCR2 at the leading edge of migrating cells [133]. This interaction
was found to occur directly through the LIM domain of LASP1 and the LKIL motif on
the CXCR2 C-terminal tail. Direct binding of LASP1 also occurs with CXCR1, CXCR3,
and phospho-CXCR4. Phosphorylation of LASP1 at S146, but not Y171 is required for
direct binding to CXCR4 [103,133]. Significantly, knockdown of LASP1 impairs
CXCR2-induced chemotaxis. Stable knockdown of LASP1 was later shown to
significantly impair CXCR4-mediated invasion of TNBC cells [134].
3.2.3 LASP1 and the PI3K-Akt-mTOR Pathway
As discussed previously, the PI3K-Akt-mTOR pathway is frequently dysregulated in breast cancer. Regulation of this pathway by LASP1 is currently being investigated with several mechanisms being proposed. Decreases in LASP1 levels are associated with reduced levels of pS473-AKT [135-137]. One group has proposed that this could be
29 occurring with the 14-3-3, a diverse group of scaffolding proteins that regulate the cell
circuitry/AKT phosphorylation [138]. Proteomic investigations on LASP1 revealed an
unknown association with 14-3-3σ. In colorectal cancer, loss of 14-3-3σ is associated
with increased levels of pAKT and cancer progression. Mechanistically, LASP1 reduced
the expression levels of 14-3-3σ [139]. This could be occurring through LASP1’s
interaction with COP9 signalosome complex subunit 5 (COPS5), a regulator of the
ubiquitin conjugation pathway [140]. In another study, LASP1 was shown to interact
with PTEN, a negative regulator of the PI3K-AKT-mTOR pathway. LASP1 decreased expression levels of PTEN in nasopharyngeal carcinoma cells [141]. Due to the fact that
PTEN is frequently mutated in breast cancers, this may not be occurring in TNBC cells.
However, pS146-LASP1 was shown to associate with AKT in MDA-MB-231 cells [103].
This interaction could be occurring directly through the SH3 domain of the LASP1 with
the C-terminus of AKT1, suggesting a direct effect by LASP1. Heat shock protein family
A member 1A (HSPA1A) may also enhance the interaction between LASP1 and p-AKT
[142].
3.2.4 LASP1 and Epigenetics
Emerging evidence has suggested that nuclear LASP1 may regulate the epigenetic machinery of cancer cells. Knockdown of LASP1 alters the gene expression profile of several EMT markers and MMPs as discussed elsewhere. Furthermore, the association between LASP1 and epigenetic regulators such as ubiquitin-like with PHD and ring finger domains 1 (UHRF1), Snail1, and the histone methyltransferase G9a has been detected in the nucleus [134]. These findings are currently being explored by our lab, opening a new area of research for LASP1.
30 3.2.5 Regulation of LASP1 Expression Levels
LASP1 is upregulated in several cancers through a variety of mechanisms. The
LASP1 promoter is controlled by several transcription factors which are frequency dysregulated such as Activator protein 1 (AP-1), Hypoxia-inducible factor 1-alpha (HIF-
1α), and SOX9 [143-145]. Interestingly, CXCR4 is also a HIF-1α target gene suggesting a hypoxia-induced cancer cell migration mechanism in tumors. p53 is also reported to suppress LASP1 levels and this protein is frequently mutated [146]. Finally, numerous microRNAs have been reported to regulate levels of LASP1. A summary of the current literature is provided (Table 3.1). Interestingly, several long non-coding RNAs have also been identified to modulate LASP1 expression levels in cancer including SNHG16 and
LASP1-AS, although this area will need to be further explored [147,148].
Figure 3-3 LASP1 and Cancer. LASP1 has been shown to regulate the actin cytoskeleton, contribute to vesicular trafficking, influence the PI3K-Akt- mTOR signaling pathway, and also control the localization of the epigenetic machinery in the nucleus. Through these processes, LASP1 facilities and enhances the metastatic process, especially found in breast cancer.
31 Table 3.1 Regulation of LASP1 by microRNAs microRNA Model Significance Reference miR-1 Esophageal squamous Reduced levels of miR-1 [149] cell are associated with [150] carcinoma/colorectal increased levels of [151] carcinoma/bladder LASP1. miR-1 mimetics cancer suppress cell growth, migration, and invasion in vitro. miR-7 Breast carcinoma Reduced levels of miR-7 [152] are associated with increases in LASP1 expression. The miR-7- LASP1 axis may influence nodal- positivity and tumor size. miR-21 Uveal melanoma Upregulation of miR-21 [153] in cancer cells promotes the expression of LASP1. miR-21 increases proliferation, migration, and invasion in vitro. miR-29 Non-small cell lung Downregulation of miR- [154] cancer/melanoma/gastric 29a promotes LASP1 [155] cancer expression. [156] Overexpression of miR- 29a decreases proliferation, migration, and invasion in vitro. miR-133 Renal mesangial Expression of LASP1 is [157] cells/breast carcinoma/ negatively regulated by [158] colorectal carcinoma/ miR-133a in multiple [159] hepatocellular cancer types. Loss of [160] carcinoma/bladder miR-133a is associated [161] cancer with increases in [151] proliferation, migration, and invasion in vitro. miR-143 Esophageal cancer miR-143 downregulation [162] increases LASP1 expression. Elevated levels of LASP1 are associated with a decreased patient survival.
32 microRNA Model Significance Reference miR-145 Colorectal cancer miR-145 is downregulated in [163] cancer cells. Overexpression of miR-145 suppresses LASP1, migration and invasion in vitro. miR-203 Prostate cancer/ Loss of mir-203 expression in [164] nasopharyngeal tumors increases LASP1 [165] carcinoma/ levels to promote [166] esophageal squamous proliferation, migration, and [167] cell carcinoma/ invasion in vitro. [168] laryngeal The lncRNA PVT1 can also [169] carcinoma/prostate regulate expression of LASP1 [170] carcinoma/breast by controlling miR-203 levels. [171] carcinoma/ non-small [172] cell lung cancer/ head and neck squamous cell carcinoma miR-206 Medulloblastoma Low expression of miR-206 [173] upregulates LASP1 mRNA levels. Overexpression of LASP1 can abrogate reductions in migration and invasion by miR-206 in vitro. miR-218 Gastric miR-218 mimics reduce [174] cancer/pancreatic proliferation, migration, and [175] cancer/prostate invasion. Concurrent [176] cancer/bladder knockdown of LASP1 can [151] cancer/ further enhance the phenotypic effects. LASP1 expression is modulated by miR-218 through binding to its 3'UTR. miR-324 Papillary thyroid Levels of miR-324 are [177] cancer regulated by the lncRNA MIAT. As a result, LASP1 expression is upregulated and increases invasion in vitro. miR-326 Hepatocellular miR-326 is downregulated in [178] carcinoma cancer cells to promote the expression of LASP1. Knockdown of LASP1 produces a similar phenotype as overexpression of miR-326 in vitro.
33 microRNA Model Significance Reference miR-342 Oral squamous cell Downregulation of miR-342 [179] carcinoma in OSCC cells reduces cell proliferation. Overexpression of LASP1 can attenuate the effects by miR-342 in vitro. miR-377 Glioma Overexpression of miR-377- [180] 3p reduced the expression of LASP1. Concurrently, glioma cell proliferation and migration decreases in vitro. miR-423 Nasopharyngeal The lncRNA AFAP1-AS1 [181] carcinoma downregulates miR-423 to promote expression of LASP1. miR-1294 Esophageal miR-1294 levels are reduced [182] carcinoma by the circular RNA hsa_circ_0004370. As a result, expression levels of LASP1 are upregulated.
34 Chapter 4
A Key Role for the eIF4F Complex in Cancer
4.1 Introduction
The central dogma of eukaryotic molecular biology states that the encoded
genetic information in double stranded DNA is transferred to a class of RNA molecules
termed as messenger RNA (mRNA). The flow of genetic information or gene expression
culminates in protein synthesis according to a non-overlapping set of degenerate codons from the mRNA templates. Protein synthesis or ‘translation’ is an intricate and highly coordinated process involving a multitude of eukaryotic initiation factors (eIFs). The initiation of protein synthesis is regulated by a set of eIFs termed as eIF4F complex. eIF4F governs the recruitment of 43S pre-initiation complexes (PICs) to mRNA templates. The core trimeric eIF4Fcomplex consists of eIF4E that directly binds to 7- methylguanosine (m7G) cap at the 5’-end of mRNA template, eIF4G that provides the scaffolding function, and eIF4A that functions as an mRNA helicase [183]. Both the recruitment and function of eIF4F at the m7G cap is an active area of study. eIF4E is most
likely the first protein to bind to the mRNA. eIF4G then anchors eIF4E at the m7G cap
through its RNA-binding domain [184]. The precise step at which eIF4A is recruited is still unclear.
35 Documented evidence demonstrates a critical role played by eIF4F in cancer
biology through its activation via the phosphatidylinositol-3 kinase (PI3K) /Akt /
mammalian target of rapamycin (mTOR) pathway. Constitutively active mutations of
PI3K (PI3KCA) are often observed in about 50% of breast carcinoma. This will lead to
hyperactivation of the PI3K /Akt /mTOR pathway and aberrant activation of the eIF4F
complex. The dysregulated activity of the eIF4F complex facilitates several hallmarks of
cancer through translation of an altered subset of oncoproteins that impact primary tumor
progression and metastasis. For example, targeting of both eIF4E and eIF4A decreases
primary breast tumor growth and onset of associated pulmonary metastasis [185]. The multifaceted role eIF4F complex that is currently known in cancer biology is depicted
(Figure 4-1).
Figure 4-1 eIF4F and Cancer. eIF4F plays a multifaceted role in cancer biology. This is largely due to the oncogenic proteins which rely on eIF4F for their efficient production. A. Overview of eIF4F and its role in different aspects of cancer biology.
36 4.1.1 mRNA Structure and Function
Cellular mRNAs contain a 5’ cap (m7GpppN, where N is any nucleotide), a leader region, a start codon, and a 3’ trailer region. The vast majority of cellular mRNAs are polyadenylated which provides stability. Approximately, 50% of mRNAs harbor small upstream open reading frames (uORFs). The efficiency of initiation at start codons of
ORFs is dictated by the presence of a flanking motif, known as the Kozak consensus sequence. An overview of the mRNA structure and various 5’ leader motifs are discussed below (Figure 4-2).
4.2 The 5’ Leader Sequence
From the total pool of cellular mRNAs, a subset of them is highly dependent on eIF4F-mediated translation. Others have a lower dependency on eIF4F and so their translational output is minimally affected by alterations in the total levels of eIF4F. This phenomenon is largely due to structural diversity and complexity in the 5’ leader region
[186]. In this section, we discuss common motifs within the 5’ leader region including 5’ terminal oligopyrimidine (5’TOP) repeats, (NGG)4 motifs, and translation initiator of short 5’UTR (TISU) sequences among the eIF4F-dependent mRNAs.
4.2.1 5′ Terminal Oligopyrimidine (5’TOP) Motifs
The 5’ terminal oligopyrimidine motif (5’TOP) regulates the translational efficiency of a subset of mRNAs in vertebrates [187]. Mutation of the bases following the
5’cap of ribosomal protein L32 (RpL32) mRNA affected the ability by which ribosomes could be recruited [188]. Additionally, treatment of cells with a growth-arresting, anti-
37 inflammatory agent (dexamethasone), decreased the polysome profile of RpL32.
However, when the 5’ leader region was swapped with corresponding elements of β-actin
gene, the polysome profile was not altered highlighting the specificity [188]. There has
been considerable interest in regulation of the translational machinery by the mTOR
signaling pathway. Rapamycin, an mTOR inhibitor, was later demonstrated to selectively
suppress the translation of mRNAs harboring a 5’TOP motif at the 5’ leader region [189].
The structural features of this motif are defined by an invariable cytosine nucleotide
adjacent to the m7G cap, followed by an uninterrupted stretch of 4-14 pyrimidines
(cytosine or uracil). The human transcriptome analysis revealed that only 19% of mRNAs
begin with a cytosine. This suggests that only a fraction of mRNAs are directly regulated
by the mTOR signaling cascade through the 5’TOP motif [190].
The precise molecular mechanism of this translational control apparently occurs
through La-related protein 1 (LARP1). LARP1 directly binds to mRNAs containing a
5’TOP motif. The crystal structure of the DM15 domain of LARP1 revealed that it
directly bound to the m7G cap as well as the downstream pyrimidines [191]. When bound
to the mRNA, LARP1 inhibits the m7G cap-eIF4E interaction. However, when mTOR
becomes active, LARP1 gets phosphorylated and dissociates from 5’ leader regions
[192]. This will allow the eIF4F complex to bind to 5’TOP-contaning mRNAs and
facilitate translation. Specificity for pyrimidine tracks of 5’TOP containing mRNAs
occurs through an unusual static pocket in the C-terminal end of LARP1 that recognizes the +1 cytosine nucleotide [193].
4.2.2 (NGG)4 Motifs: G-quadruplexes vs. Classical Secondary
Structures
38 4.2.2.1 G-quadruplexes
The concept of formation of G-quadruplexes was first explored by experiments in the early 1960s. Using guanylic acid (guanosine monophosphate), it was discovered that guanine has the ability to form tetrameric structures by self-association. This structure was termed a G-quartet [194]. More specifically, a G-quartet is defined as four guanines folded in a square planar arrangement via Hoogsten pairing. A G-quadruplex is then formed from multiple G-quartets stacking upon each other [195]. A G-quadruplex present in the 5’ leader of the NRAS mRNA was found to inhibit its translation [196].
Ribosome profiling experiments employing T-cell acute lymphoblastic leukemia cells revealed that transcripts containing (NGG)4 motifs are highly dependent on the activity of eIF4A. Due to this sequence motif, it is predicted that mRNAs containing G-
quadruplexes in their 5’ leaders are dependent on the helicase activity of eIF4A to
unwind the G-quadruplexes and facilitate their efficient translation [197]. This notion is
also supported by another study using MCF7 breast cancer cells. The eIF4A knockdown
study indicated that the mRNAs of downregulated proteins harbored a (CGG)-repeat motif at their 5’ leader suggesting the formation of a G-quadruplex that physically blocks ribosome scanning [198]. The role of eIF4A in targeted unwinding of G-quadruplexes at the 5’ leader region of mRNAs was demonstrated through pharmacological inhibition of eIF4A helicase activity that resulted in a decrease in the level of anti-apoptotic protein B- cell lymphoma 2 (Bcl-2) in a dose-dependent manner [199]. By employing an RNA oligonucleotide duplex that mimics the 5’ leader region of Bcl-2, the duplex was shown to fold into a thermodynamically stable RNA G-quadruplex using circular dichroism and
39 UV melting studies [200]. The presence of RNA G-quadruplexes in situ in cells is not yet
demonstrated.
4.2.2.2 Classical Secondary Structures
The presence of (NGG)4 motifs at the 5’ leader region of mRNAs is thought to promote G-quadruplex formation. However, the recent evidence suggests that the presence of this motif increases the reliance on the helicase activity eIF4A simply due to the formation of classical secondary structures more than folded G-quadruplexes. This was ascertained by employing a combination of reverse transcription stalling assays and
7-deazaguanine incorporation experiments which indicated that (NGG)4 repeats form stem-loops or stable hairpin secondary structures than G-quartets [201].
A subset of cell cycle and survival-promoting mRNAs with long 5′ leader sequences were also found to be dependent on mTOR signaling pathway [202]. A long 5’ leader has increased the probability to form secondary structures through classical
Watson-Crick base paring. Thus, these mRNAs would rely on the helicase activity of eIF4A for their efficient unwinding of the secondary structures and eventual translation.
This notion is further supported by ribosome profiling experiments in MDA-MD-231 triple-negative breast cancer (TNBC) cells following the treatment with another pharmacological inhibitor of eIF4A, silvestrol. The eIF4A-dependent mRNAs were
40 found to have 5′ long leader sequences with a high potential to form classical secondary structures and a low overall GC content [203].
Figure 4-2 mRNA Structure and the 5’ Leader Region. Each mRNA contains an m7G cap and 5’ leader region. The major open reading frame is denoted with an AUG start codon. eIF4F regulation is largely due to structural diversity in the 5’ leader region. A. Graphical overview of architectural features. B. An example of a 5’ leader which is regulated by mTOR with a 5’TOP motif. C. Cartoon representation of a TISU motif in the 5’ leader. Linear scanning of the 40S ribosomal subunit does not occur due to proximity of this motif to the cap. D. Presence of the (NGG)4 generates stable secondary structure in the 5’ leader. Cartoon representation of two possible scenarios. The exact structure that forms is yet to be determined. This could be either a G- quadruplexes (Hoogsten pairing) or classic secondary structure (Watson- Crick base pairing).
41 4.2.3 Translation Initiator of Short 5’UTR (TISU)
A subset of protein-coding mRNAs (4.5%) harbor unusually short (around 12 nucleotide) 5’ leader sequences [204]. Analysis of the frequency of the nucleotides
positions surrounding the start codon of the ORF identified the translation initiator of
short 5’UTR (TISU) element [205]. The 5’ leader with a typical TISU consensus motif
consists of : 5’-(C/G)AA(C/G)ATGGCGGC-3’. Due to the short nature of the 5’ leader
sequence, it is thought that such mRNAs do not require linear scanning of the 40S
ribosomal subunit during translational initiation. Modulation of eIF1 (required for the
scanning-competent 43S PIC) was found to have no effect on mRNAs harboring a TISU in the 5’ leader. However, the presence of the m7G cap was still required for recruitment
of the 43S pre-initiation complex. Inhibition of eIF4A had minimal effects on the
translational efficiency of TISU-dependent mRNAs. Therefore, this unique subset of mRNAs requires eIF4E, but not eIF4A [206].
4.3 eIF4F and Cancer
4.3.1 eIF4E
One of the most studied eukaryotic translation initiation factors facilitating the
translation of a subset of oncogenic mRNAs is eIF4E. Overexpression of eIF4E protein
has been observed in breast carcinomas [207,208]. Elevated levels of eIF4E correlated
with increased angiogenesis, invasiveness of tumor cells, and a poor prognosis [209].
eIF4E has been documented to be a poor prognostic factor for the most aggressive
subtypes of breast cancer including human epidermal growth factor receptor 2 positivity
42 (HER2+), luminal B (hormone receptor positive with or without HER2 positivity),
therapy-naïve and anthracycline-resistant triple-negative cancers [198,209-211].
Although less studied than female breast cancer, expression of eIF4E was also shown to
be associated with a poor overall survival (OS) in male breast cancer [212]. The clinical
impact of eIF4E also extends to several other cancer types. Elevated expression levels of
eIF4E associated with a poor clinical outcome in bladder cancer, head and neck
carcinomas, and tumors affecting the larynx [213-216].
Several other groups have investigated the clinical impact of eIF4E-binding proteins (4E-BPs), a repressor of eIF4E. 4E-BP proteins are considered to be tumor suppressors. High levels of phosphorylated 4E-BP1 not only correlated with a poor patient prognosis, but also the grade of breast tumors [217,218]. Loss of one allele of 4E-
BP1 is observed in almost 40% of head and neck carcinomas [219]. Employing the ratio of eIF4E to 4E-BPs may provide a better prognostic index or factor than the levels of eIF4E alone [220]. For example, the eIF4E/4E-BP ratio predicts sensitivity of cancer cells to mTOR inhibitors in vivo [221].
The precise molecular mechanism by which eIF4E contributes to malignant transformation remain unknown, but several studies pointed to an oncogenic role for eIF4E. For example, stem cells of lactogenic acinar mammary epithelium engineered to ectopically express eIF4E were found to induce the formation of premalignant and malignant lesions. Mechanistically, lesions were found to contain oncogenic proteins upregulated in response to the ectopic expression of eIF4E, allowing the evasion of key
DNA damage checkpoints and acquisition of additional mutations [222]. Consistent with these findings, eIF4E knockdown cells are resistant to cellular transformation by
43 oncogenes Ras and Myc [223]. Using genome-wide translational profiling, 722 genes were identified to contribute to an eIF4E-dependent oncogenic translation program, a subset of which are involved in detoxifying and regulating ROS levels that are critical for survival [223].
In addition to contributing to malignant transformation, eIF4E has been associated with the metastatic breast cancer cascade. eIF4E is a well-established driver of epithelial- to-mesenchymal transition (EMT). Cap analogs such as 7-benzyl guanosine monophosphate (7Bn-GMP) were found to be a potent antagonist of eIF4E in preventing its binding to the cap structure at the 5’end of the mRNA. As 7Bn-GMP is not cell permeable, a tryptamine phosphoramidate prodrug of 7Bn-GMP, 4Ei-1, was synthesized which upon entering the cell gets metabolized to 7Bn-GMP [224]. Inhibition of eIF4E by
4Ei-1 reduced the cancer cell migration, invasion, and known EMT-markers such as
Snail1 [225]. Hypoxic conditions within the tumor also promote eIF4E-dependent translation. The promoter for eIF4E contains the binding sites for the transcription factor
HIF-1α. As a result, hypoxia induces cap-dependent translation [226].
Finally, the oncogenic proteome resulting from enhanced expression of eIF4E has been correlated with drug resistance in breast cancer. For example, eIF4E levels predicted the responsiveness to PI3K/mTOR inhibitors [227]. Resistance to dactolisib, a dual PI3K and mTOR inhibitor, in human mammary epithelial cells was associated with overexpression of both eIF4E and c-MYC, as determined by genome-wide copy number analyses [228].
44 Mitogen-activated protein kinase (MAPK) interacting protein kinases 1 and 2
(MNK1/2) phosphorylate eIF4E at residue S209. Hyperactive pS209-eIF4E promotes
tamoxifen resistance and lack of estrogen dependence in ER+ breast cancers [229].
Several standard neoadjuvant chemotherapeutic (NACT) drugs such as doxorubicin and
5-flurouracil (5-FU), induce an increase in pS209-eIF4E levels [230]. Targeting the
MNK1/2-eIF4E axis has advanced to the clinical trial phase with the MNK1/2 inhibitor,
eFT508 (Effector Therapeutics/NCT03690141). Silencing of eIF4E also altered the
response of MDA-MB-231 cells to NACT drugs such as anthracyclines, platinum drugs
and taxanes [231,232]. Levels of phosphorylated eIF4E have also been associated with
poor prognosis in pancreatic, non-small cell lung, and nasopharyngeal carcinomas [233-
236].
New roles for pS209-eIF4E levels in cancer biology are emerging. Recently, the
role of pS209-eIF4E has been implicated in shaping the tumor microenvironment (TME).
Metastatic tumor cells are impaired in their ability to colonize distant sites if the local
TME is unfavorable. Significantly, tumor cells with a phospho-null mutation at S209
(S209A) of eIF4E are resistant to the development of lung metastasis in a murine
mammary carcinoma model. This was due to a reduced expression of anti-apoptotic
proteins in prometastatic neutrophils (N2 type) needed for survival of the colonizing
tumor cells perhaps in a paracrine manner [237]. Additionally, the reduction in the levels
of pS209-eIF4E by eFT508 treatment led to downregulation of PD-L1 levels. This
resulted in a decrease in the incidence of metastasis in a murine model of liver tumor
presumably due to reduced immune evasion [238].
4.3.2 eIF4A
45 The intrinsic mRNA helicase activity of eIF4A is low and is modulated through interactions with several auxiliary factors. These proteins, along with mRNA, regulate the open and closed conformations of eIF4A during unwinding of the mRNA duplex [239-
241]. Importantly, these interactions control the 5’ to 3’ processivity of the enzyme
[242,243]. When the accessory protein eIF4B directly binds to eIF4A, there is a robust enhancement of its helicase activity [244]. Another auxiliary protein, eIF4H, can similarly enhance the activity of eIF4A but the binding of eIF4B and eIF4H to eIF4A is mutually exclusive [244-246]. Furthermore, the scaffolding protein, eIF4G, of the eIF4F complex can also stimulate the activity of eIF4A [247]. eIF4E can also enhance the activity of eIF4A. Interestingly, the eIF4E-binding site on eIF4G functions as an autoinhibitory domain. Once the eIF4E interacts with eIF4G the autoinhibition is relieved and that enables eIF4G to stimulate eIF4A helicase activity [248]. In addition to its helicase activity, eIF4A also aids in the recruitment of the PIC by reducing the affinity of eIF3j on the 40S subunit [249]. Several reviews discussing mRNA recruitment to the ribosome can be found elsewhere [250,251].
Numerous studies have established the mRNA helicase eIF4A as an important oncogene of various cancers. A subset of oncogenic mRNAs that contribute to the cancer cell proteome is highly dependent on eIF4A. The unwinding of the classical secondary structures at their 5’ leader regions allows ribosome scanning and initiation of translation
[202]. Silencing of eIF4A by genetic or pharmacological approaches in breast cancer cells restricts cellular growth and proliferation [198,199]. Due to the important nature of eIF4A, several studies have attempted to define the eIF4A-specific proteome. One
46 example of this was the proteomic characterization of silvestrol-treated MDA-MB-231
TNBC cells [203].
Many oncogenic mRNAs are increasingly reliant on the activity of eIF4A1 for their translation [197,252]. An elevated expression of eIF4A1 [253] is observed in BC
and found to be an independent predictor of poor outcome in ER-negative BC [198].
Enzymatically active eIF4A1 immensely contributes to tumor progression and metastasis
[197,254]. Downstream effectors of eIF4A1 (translated oncoproteins through the mRNA
helicase activity of eIF4A1) include: BIRC5 or survivin [255,256], Myeloid cell
leukemia 1 (MCL1) [257], c-MYC, cyclin D1 [258], cyclin D3, Human double minute 2
(HDM2) [259], Rho kinase 1 (ROCK1) [260,261], Mucin-1C (MUC-1C) [262-264],
ADP ribosylation factor 6 (ARF6) and ornithine decarboxylase (ODC). Collectively, these proteins are vital for tumor cell survival, proliferation, metastasis, and chemoresistance [198,202,203,265-268]. Interestingly, the transcription factor c-MYC and the anti-apoptotic protein MCL1 are frequently co-amplified in drug-resistant TNBC after neoadjuvant chemotherapy [257]. Survivin plays a key role as a functional checkpoint for both mitosis and apoptosis in cancer cells. Cyclin D1 is a pivotal protein in cell cycle along with cyclin-dependent kinases (CDK4/6). Although nuclear cyclin D1 is known for its role in cell proliferation [269], the cytoplasmic cyclin D1 has a novel, non-canonical role in cell migration [270,271]. Cyclin D1 activates CDK4/6 which is a current target in treating TNBC with the FDA-approved inhibitor Palbociclib [272].
ARF6 is one of the key proteins required for cell adhesion, migration, invasion, immune evasion through PD-L1 recycling and drug resistance of cancer cells [273-275]. In addition to PD-L1 recycling, another group demonstrated that eIF4A/eIF4F plays a role
47 in PD-L1 expression through regulation of translation of signal-transducer and activator of transcription 1 (STAT1) mRNA [276]. The PD-L1 promoter harbors binding sites for
STAT1 and hence is subject to transcriptional regulation. ROCK1 promotes cell polarization and directional migration (chemotaxis) [277,278]
Aside from modulation of immune checkpoints and aiding immune evasion, recent studies have begun to explore the role of eIF4A in cancer metabolism. Pancreatic cancer cells rely heavily on eIF4A due their dependencies on redox balance, oxidative phosphorylation, and glycolysis [279]. Lastly, eIF4A can impact cellular signaling. Lgr4, a regulator of the Wnt signaling pathway, was shown to harbor a G-quadruplex in its 5’ leader [280].
Myc is another example of a well-characterized mRNA whose translation is highly dependent on eIF4F activity. Many cancer types show elevated levels of Myc.
Myc regulates pleiotropic cellular functions and its function has been extensively reviewed [eg, [281]]. The eIF4F complex and Myc are part of a positive feedback loop where Myc promotes transcription of all three eIF4F subunits and in turn the eIF4F complex stimulates translation of c-Myc [282]. Targeting tumors which depend on Myc with eIF4A inhibitors appears to be a useful strategy for several cancer types [283-285].
A noteworthy function of eIF4A in cancer biology is its contribution to chemoresistance. Multiple studies have demonstrated a role for eIF4A in drug resistance.
First, targeting eIF4A is an attractive strategy towards melanomas that are resistant to both anti-BRAF and anti-MEK therapies [286,287]. Recently, one group has demonstrated that BRAFV600E mutant melanoma cells are resistant to the inhibition of
48 BRAF/MEK via a rewired translatome [288]. These BRAF/MEKi persister or “drug- tolerant” cells adapt their proteome in response to drug treatment. As a result, epigenetic regulators and mTOR signaling components were upregulated. Immunotherapies such as pembrolizumab have also been used to treat melanoma patients with mixed clinical efficacies. This could be explained by the contribution of the eIF4F complex in upregulating the expression of PD-L1 in a STAT1-dependent manner [276].
Several studies demonstrated that eIF4A inhibitors are effective in combination with standard-of-care chemotherapies. Inhibition of eIF4A was also shown to be an effective strategy against docetaxel- and cabazitaxel-resistant prostate cancer cells [289].
Recently, we found that eIF4A may play a causative role in paclitaxel resistance in triple- negative breast cancer. This could due to a newly identified role in cancer stemness and contributions to the expression of the ATP-binding cassette (ABC) family of drug transporters [290]. In addition to cytostatics, targeted therapies may also benefit from combinations with compounds that target eIF4A. Importantly in breast cancer, the combination of the CDK4/6 inhibitor Palbociclib and CR-1-31-B (a eIF4A inhibitor) was reported to be synergistic [291]. The same may also be true for targeted therapies against epidermal growth factor receptor (EGFR) and human epidermal growth factor receptor 2
(HER2) [292]. The combination of a eIF4A inhibitor and Bcl-2 antagonist (ABT-199) may also prove to be beneficial as demonstrated in several cancer types [285,293,294]. In all, the list will only continue to grow for combination therapies (both cytotoxic and targeted) that may show synergy with eIF4A inhibitors.
4.3.3 eIF4G
49 Of the three core subunits of the eIF4F complex, eIF4G has been rarely studied as
a single node contributing to cancer. However, several studies have elucidated a specific
role of eIF4G in breast cancer biology. The most notable study demonstrated a role for
eIF4G in the DNA damage response as it promoted the translation of damage repair
proteins following exposure to ionization radiation [295].. Such proteins include DNA
damage protein 45a (GADD45a) and ataxia telangiectasia mutated gene 1 (ATM).
Interestingly, reduced expression of eIF4G sensitized MCF10A cells to DNA damage by
ionizing radiation, but this phenotype was not observed when eIF4E levels were reduced
[295].
The unique role for eIF4G in the DNA damage response may be due to its
alternative role in translating mRNAs with internal ribosome entry sites (IRESes).
Consistent with these findings, it was found that overexpression of eIF4GI promotes
IRES-dependent translation of p120 mRNA in inflammatory breast cancer (IBC), the
most aggressive form of primary breast cancer. The overexpression of eIF4G1 may
explain why p120 promotes cell surface retention of E-cadherin in IBC- forming aggressive tumor emboli [296]. The overexpression of eIF4G1 in IBC may also promote a hypoxic oncoproteome, regardless of oxygen conditions within the tumor. Knockdown of eIF4G1 decreases IRES-dependent expression levels of vascular endothelial growth factor (VEGF), an important mediator in the hypoxic response [297]. Extracts isolated from the medicinal mushroom Ganoderma lucidum have been shown to decrease eIF4G1 levels in IBC and may be one approach to target this aggressive form of breast cancer
[298].
50 The influence of eIF4G1 in the hypoxic response has been explored in several
studies. One group found that phosphorylation of eIF4G1 on serine 1232 promotes
expression of HIF-1α. This phosphorylation event disrupts the association of eIF4G1 with eIF4E and could potentially contribute to a hypoxia-specific oncoproteome [299].
The hypoxic switch of canonical eIF4F-dependent translation to eIF4G-IRES hypoxic translation could also be triggered by overexpression of 4E-BP1. Overexpression of 4E-
BP1 and eIF4G1 may coordinate cap-independent translation of hypoxia associated mRNAs [300].
The eIF4GI homolog, DAP5, lacks an eIF4E binding site but interacts with eIF3d to facilitate translation initiation of ~20% of mRNAs [301]. Previously, DAP5 also interacts with eIF2β and eIF4A to promote IRES-driven translation [302]. The
DAP5:eIF2β complex was found to degrade HIF-1α levels by stimulating the translation of prolyl hydroxylase-domain protein 2 (PHD2) [303]. The roles of eIF4G and DAP5 in cellular homeostasis and points of regulation will need to be further explored to clarify their role in cancer biology.
4.3.4 eIF4B
High levels of eIF4B can predict the clinical outcome of patients diagnosed with
invasive lobular breast carcinoma [304]. Despite the clinical importance of eIF4B, very
few studies have further explored the role of eIF4B. One group has suggested that eIF4B
regulates translation via interactions with core binding factor subunit beta (CBFB) and
heterogeneous nuclear ribonucleoprotein K (hnRNPK). However, this complex is
suggested to be tumor suppressive in nature and may implicate eIF4B as a possible tumor
51 suppressor protein under certain cellular conditions [305]. The classical function of
eIF4B is to promote the helicase activity of eIF4A. As a result, eIF4B would cooperate
with eIF4F to drive the oncogenic proteome. The oncogenic nature of eIF4B has been
shown in several studies. For example, eIF4B mediates EGFR and mTOR inhibitor
synergy in TNBC cells [306]. In HeLa cells, reducing eIF4B has decreases levels of
proteins which function in both cell proliferation (c-Myc) and survival [X-Linked
Inhibitor Of Apoptosis (XIAP)/B-cell lymphoma 2 (Bcl-2)] [307].
Several studies have explored the impact of eIF4B phosphorylation. The most important phosphorylation site could arguably be Serine 422. Ser 422 phosphorylation is determined by the p70 and p90 ribosomal protein S6 kinases (RSKs). Furthermore, p-
S422-eIF4B increases the interaction of eIF4B with eIF3 and plays an important role in eIF4F-dependent functions [308,309]. The signaling pathway which primarily phosphorylates eIF4B may be specific for different cancer types. For example, in SNU-
407 colon cancer cells, stimulation of muscarinic acetylcholine receptors leads to
phosphorylation of eIF4B via the MAPK pathway but not through mTOR [310]. It was
also found that AKT can also phosphorylate eIF4B at S422 directly. Investigation of
AKT substrates also led to the discovery of a different eIF4B phosphorylation site at
S406 [311]. Moreover, p-S406 levels were also found to increase upon activation of
maternal and embryonic leucine zipper kinase (MELK). MELK is a member of the
AMPK/Snf1family of kinases and is a potential target in triple-negative breast cancer
[312]. Levels of p-S406-eIF4B were found to peak during the mitotic phase of the cell
cycle and induce the synthesis of Mcl-1 (myeloid leukemia cell differentiation protein).
Mcl-1 is a major component of the anti-apoptotic response and the MELK-eIF4B
52 signaling axis may be one mechanism allowing tumor cells to survive during mitosis
[313].
In addition to breast cancer, the role of eIF4B has been explored in several other
cancer types. First, MAPK signaling was found to increase both Laminin γ2 and c-Myc
levels in a p-S422-eIF4B-dependent manner in squamous cell carcinoma [314]. In diffuse
large B-cell lymphoma (DLBCL), fatty acid synthase was found to phosphorylate
ubiquitin carboxyl-terminal hydrolase 11 (USP11) which in turn inhibited proteasome-
mediated degradation of eIF4B, stabilizing its levels [315]. Targeting eIF4B with siRNAs
decreased levels of death-associated protein 6 (DAXX), B-cell lymphoma 2 (Bcl-2), and
DNA repair protein complementing XP-G cells (ERCC5) [316]. All three of these
proteins have been associated with poor survival and lymphomagenesis. eIF4B is thought
to also play an important role in Abl-mediated cellular transformation. The downstream
proto-oncogene serine/threonine-protein (Pim-1 and Pim-2) kinases phosphorylate eIF4B
at S422. Reducing p-S422-eIF4B levels in Abl-transformed cells sensitizes them to
apoptotic triggers [317,318]. Phosphorylation of eIF4B by Pim-2 may also impact the
apoptotic machinery in prostate cancer [319]. Finally, eIF4B was included in a gene
signature associated with resistance to cisplatin and fluorouracil in gastric cancer patients
[320]. In all, the role of eIF4B in modulating the response to chemotherapy and in
apoptosis will need to be further explored.
4.3.5 eIF4H
Eukaryotic initiation factor 4H (eIF4H) was first identified as a co-purifying protein in preparations of eIF4B and the eIF4F complex. To elucidate the function of
53 eIF4H, the rates of globin synthesis were measured in cell-free translation systems reconstituted from purified rabbit reticulocyte initiation factors. eIF4H was able to stimulate globin synthesis when sub-saturating amounts of eIF4B were used in these assays [321]. Similar to eIF4B, eIF4H is able to directly bind to eIF4A and stimulate its helicase activity [244]. However, because both of these proteins share a common binding site on eIF4A, their interactions are mutually exclusive [245]. It is unclear at this point if elevated levels of eIF4B versus eIF4H show equivalent oncogenic effects and/or if this is context dependent. Rather, the oncogenic role of each protein may be dependent on the context of different cancers. eIF4H is under the control of the transcription factor NF-κB
which is often deregulated in cancer. [322]. The current literature has supported that
eIF4H is an oncogene as well [323,324]. Elevated levels of eIF4H are associated with a poor chemotherapy response in A549 lung adenocarcinoma cells [325].
4.4 Regulation of the eIF4F Complex
The eIF4F complex is involved in the rate-limiting step of translational initiation.
As such, there are several mechanisms of regulation controlling the formation and
activity of the complex. Phosphorylation of eIF4B and eIF4E are two such events
discussed beforehand. In this section, we discuss 4E-BP1 and PDCD4, two additional
factors which regulate the eIF4F complex. A review of the signaling network associated
with this section is provided elsewhere [326]. The significance of each will however be
explored in cancer biology. An overview of the eIF4F signaling network is provided
(Figure 4-3).
4.4.1 4E-BP1
54 Eukaryotic initiation factor 4E-binding protein 1 (4E-BP1) is one of the hallmark proteins which negatively regulates the eIF4F complex. The canonical function of 4E-
BP1 is to sequester eIF4E from participating in eIF4F complex formation. When 4E-BP1 is phosphorylated, eIF4E is released and can interact with eIF4G. Several phosphorylation events are required to dissociate 4E-BP1 from eIF4E. More specifically, phosphorylation at Thr 37 and Thr 46 occurs first. Both of these phosphorylation events are rapamycin insensitive. Following phosphorylation at these two sites, Thr 70 and Ser
65 are then phosphorylated. Unlike Thr 37 and Thr 46, both are responsive to nutrient stimulation [327]. The precise role of 4E-BP1 in cancer biology has yet to be determined.
Direct phosphorylation of 4E-BP1 by mTORC1 requires the TOR signaling (TOS) motif which is located at the C-terminus of 4E-BP1 [328]. More specifically, the TOS motif is needed for 4E-BP1’s interaction with the raptor subunit of mTORC1 [329,330]. A four amino acid stretch (RAIP motif) in the N-terminus of 4E-BP1 also regulates the phosphorylation of 4E-BP1/2 by mTORC1. Subsequent studies have uncovered that the
RAIP motif may play a role in the binding to raptor as well [331,332]. The roles of 4E-
BP1 in tumor biology is extensively reviewed elsewhere [333].
Recent evidence has supported the notion that 4E-BP1 has both anti-tumor and pro-tumorigenic functions. In luminal breast cancer, 4E-BP1 was shown to promote cellular proliferation [334]. Interestingly, 4E-BP1 expression may be needed to suppress translation and induce a tolerance to hypoxic conditions within the tumor. Prostate cancers which lack 4E-BP1 show increased cell death within hypoxic regions of the tumor [335]. In contrast, 4E-BP1 is often lost in head and neck squamous cell carcinomas
(HNSCC). The expression and phosphorylation status of 4E-BP1 can predict the
55 sensitivity to mTOR inhibitors. Genetic targeting of 4E-BP1/2 reduced the
responsiveness to INK128 in a xenograft model of HNSCC [219]. Consistent with these
findings, loss of 4E-BP1 in pancreatic cancer promotes DNA repair and confers
resistance to mTOR inhibitors [336]. The transcription factor Snail1 was also found to
repress the transcription of 4E-BP1 [337]. 4E-BP1 could thereby play a role in EMT and metastasis of tumor cells. Lastly, 4E-BP1 was recently shown to induce TGF-β1 stimulated collagen synthesis [338]. This opens up the possibility that 4E-BP1 may play a role in the regulation of the extracellular matrix and tumor microenvironment.
Figure 4-3 eIF4F Signaling Cascade. The eIF4F complex is largely influenced by the MAPK and mTOR signaling cascade. Graphical overview of the eIF4F signaling network and its influence on oncogenic protein translation.
56 4.4.2 PDCD4
Similar to direct inhibition of eIF4E by 4E-BP1, programmed cell death protein 4
(PDCD4) directly binds to eIF4A and inhibits its activity [339]. One molecule of PDCD4 can sequester two molecules of eIF4A. More specifically, phosphorylation on PDCD4 at
Ser 67 by various signaling pathways releases eIF4A and targets PDCD4 for ubiquitin- mediated degradation [340]. It is of no surprise then that PDCD4 is considered a tumor suppressor protein and downregulated in several cancer types including breast cancer.
The downregulation occurs through several mechanisms.
The most notable microRNA which regulates PDCD4 is miR-21. This microRNA
binds to a target site in the 3’UTR of PDCD4 to inhibit its expression [341]. The breast
cancer stem cell marker CD44 was later shown to reduce PDCD4 levels by upregulating
miR-21 in a Nanog-dependent manner [342]. Both HER2 and STAT3 drive transcription
of miR-21 to downregulate PDCD4 and promote breast cancer metastasis [343]. The
miR-21-PDCD4 axis may also hold importance in castration-resistant prostate cancer.
Androgen signaling was shown to induce miR-21 and inhibit the expression of PDCD4
[344]. One additional microRNA which regulates PDCD4 is miR-23a/b. PDCD4 was
found to be a direct target of mi-23a/b in gastric cancer [345]. In addition to microRNAs,
long noncoding (lnc) RNAs are thought to regulate the expression and activity of
PDCD4. In a triple-negative breast cancer 3D culture model, loss of PDCD4-AS1
lncRNA was associated with decreased PDCD4 function [346].
Much interest has focused on the MAPK and PI3K/Akt signaling and its
relationship to PDCD4. In BCR-ABL-transformed leukemias, BCR-ABL was shown to
57 activate the mTOR/p70S6K signaling cascade and inhibit the expression of PDCD4. As a
result, BCR-ABL may drive resistance to anti-leukemic therapies in a PDCD4-dependent
manner [347]. Downregulation of p70S6K also induced the expression of PDCD4 in breast
cancer [348]. STAT1 was shown to decrease expression levels of PDCD4 in colorectal
cancer via increased PI3K signaling [349]. Interestingly, negative regulation of PDCD4
via the mTOR pathway could also occur at the transcriptional level in addition to
phosphorylation-dependent degradation [350]. The p90RSK family of kinases have also been shown to be important for deregulating PDCD4 activity. This has been shown to be especially important for triple-negative breast cancer [351]. Moreover, PDCD4 is an
important consideration for the response to anti-estrogen therapies for ER+ breast cancer
patients [352]. Resistance to aromatase inhibitors was found to occur with activation of
HER2/MAPK-dependent phosphorylation of PDCD4 [353]. Induction of PDCD4
expression may also explain the anti-tumor effects seen in ER+ breast tumor cells by retinoic acid receptor agonists [354].
The list of additional factors which regulate PDCD4 is expanding. For example,
S-phase kinase-associated protein 2 (SKP2) was recently shown to phosphorylate PDCD4
and promote its ubiquitin-dependent degradation [355]. The precise mechanism of
ubiquitin-dependent degradation will also need to be elucidated. One group has identified
an interaction between PDCD4 and Denticleless protein homolog (DTL), an accessory
protein of the ubiquitin E3 ligase CUL4A [356]. Lastly, research is needed to define the
role of PDCD4 in hypoxia, the arginine methylation status of the protein, and a potential
role in modulating translation elongation [357-359].
4.5 eIF4F Inhibitors
58 Due to the broad impact of eIF4F on cancer biology, there has been much interest
in developing inhibitors which specifically target the oncogenic translational program. In
this section, we summarize available inhibitors against eIF4F components. The anti-
cancer properties of each compound will be discussed. An overview of these inhibitors is
provided (Figure 4-4 and Table 4.1).
4.5.1 4Ei-1
The binding of eIF4E to the m7G cap is the rate-limiting step of translational initiation and is a prominent target for drug discovery. Due to the structural similarity of the m7G cap, cap analogs has been extensively explored as competitive antagonists of the
eIF4E:cap interaction. However, these cannot be used in cells due to their inability to
cross the cell membrane. In an attempt to identify guanosine ribonucleoside analogs that
could function in cells, a transport-competent prodrug was developed from 7-benzyl
guanosine monophosphate (7Bn-GMP), termed 4Ei-1. 4Ei-1 also leads to a reduction of eIF4E levels in a proteasome-dependent manner [224]. In combination with sub- nanomolar amounts of gemcitabine, 4Ei-1 significantly reduces the colony formation ability of both breast and lung cancer cell lines [224]. Moreover, 4Ei-1 reduces proliferation of mesothelioma cells treated with pemetrexed [360]. This compound also inhibits the EMT program. 4Ei-1 attenuates TGF-β1-induced EMT in lung epithelial cells as indicated by reductions in α-smooth muscle actin and a reduction in Snail1 nuclear localization [225].
4.5.2 4E-GI-1/4E1RCat
59 Two attempts have identified compounds that can disrupt the interaction between eIF4E and eIF4G. In one high-throughput screen, 16,000 compounds were tested and eventually yielded the identification of 4EGI-1 [361]. 4EGI-1 acts allosterically by binding to a site on eIF4E which is distinct from the eIF4G binding region [362]. In addition, the binding of eIF4E to unphosphorylated 4E-BP1 is stabilized [363]. Based off of these findings, the anticancer properties of this compound have been explored in several studies. 4EGI-1 enhances the sensitivity to gemcitabine and induces apoptosis in non-small cell lung cancer [364]. Disruption of the eIF4E-eIF4G interaction with 4EGI-1 constitutes a promising therapeutic strategy for the induction of apoptosis in several cancer types including acute myeloid leukemia, T-cell leukemia, multiple myeloma, mesothelioma, nasopharyngeal, breast, and melanoma malignancies [365-371]. 4EGI-1 also selectively targets breast cancer stem cells through reductions in the levels of stem cell markers including Nanog, Oct4, and CXCR4 [372]. 4E-GI-1 may inadvertently activate mTORC2 and could benefit in combination with AKT inhibition [373]. The combination of 4E-GI-1 is also synergistic with the Bcl2 inhibitor, ABT-737 in chronic lymphocytic leukemia through the enhanced induction of apoptosis [374]. Lastly, 4E-GI-
1 increases IRES-dependent translation of p53 and may prove beneficial in the treatment of wild-type tumors [375]. In a separate screen, 217,341 compounds were scored for their ability to inhibit eIF4E:eIF4G interactions based on a FRET-based reporter system and this led to the identification of 4E1RCat and 4E2RCat. 4E1RCat was shown to synergize with doxorubicin in treating a lymphoma mouse model [376].
4.5.3 Hydrocarbon-stapled-4E-BP1 Peptide
60 Stapled peptides are a novel therapeutic modality used to inhibit protein-protein
interactions. These hydrocarbon-stapled α-helical peptides have a greater specificity than small molecules, but still retain an acceptable bioavailability [377]. Recently, stapled peptides have been developed which inhibit eIF4E:eIF4G interactions. The stapled peptide HCS-4E-BP1was shown to be effective in inhibiting the eIF4E-eIF4G
interaction. Nanomolar amounts of HCS-4E-BP1 reduce the viability of breast cancer cells in in vitro systems [378,379].
Table 4.1 Comparison of eIF4F Inhibitors
Inhibitor Target Mechanism of Action 4Ei-1 eIF4E Cap Analog. Blocks eIF4E:cap interaction. 4E-Gi-1/4ERCat eIF4E, eIF4G Inhibition of eIF4E-eIF4G interaction HCS-4E-BP1 eIF4E Inhibition of eIF4E-eIF4G interaction Pateamine A eIF4A Inhibition of the helicase activity within eIF4F Hippuristanol eIF4A Inhibition of eIF4A-RNA binding Rocaglates eIF4A Clamping of eIF4A to RNA Antisense oligonucleotides eIF4E Reduction in eIF4E mRNA levels RNA Aptamer m7GTP, eIF4E, eIF4A, Target binding eIF4G
4.5.4 Pateamine A/DMDA PatA
An additional small molecule inhibitor of eIF4A is Pateamine A (Pat A).
Surprisingly, Pat A stimulates the ATPase activity of eIF4A in an RNA-dependent
manner. Early studies reported that no effect was seen on the helicase activity of the
enzyme. [380]. However, Pat A was reported to inhibit the eIF4A/eIF4G association
61 thereby disrupting eIF4A-mediated translation through modulation of the protein-protein
interactions [381]. Recent investigations of the mechanism of action by Pateamine A
have further clarified these previous findings. Using expanded recombinant approaches,
decreases in the eIF4A-eIF4G association was found to be both eIF4E and m7G cap
dependent. These results suggest that the helicase activity of eIF4A is actually inhibited
within the “active” eIF4F complex [382].
Pateamine A derivatives have also been synthesized. These include des-methyl, des-amino pateamine A (DMDA Pat A). Similar to pateamine A, DMDA Pat A reduces
cellular viability across a wide range of cancer cell lines. In addition, DMDA Pat A
reduced the viability of sarcoma cells which overexpress P-glycoprotein. Based off of these observations, DMDA Pat A is suggested to not be a substrate for P-glycoprotein
[381,383,384]. DMDA Pat A was also shown to be effective in initiating the apoptotic cascade in chronic lymphocytic leukemia (CLL) cells [294]. This occurred in a Mcl-1-
dependent mechanism. However, when CLL cells were cultured in autologous patient
plasma (instead of fetal bovine serum), DMDA Pat A lost its anti-cancer activity by 30- fold. Unlike DMDA Pat A, patient plasma had minimal effects on Pat A. The binding of
DMDA Pat A to human plasma is a major concern for future drug development. To address this problem, three new analogs have been developed. These compounds exhibit decreased binding to human serum while retaining their promising anti-cancer activity
[294].
4.5.5 Hippuristanol
62 Hippuristanol is a polyoxygenated steroid and was originally isolated from a
marine coral. This is a unique eIF4A inhibitor due to the fact that this compound keeps
eIF4A from interacting with RNA, but not ATP [385]. More specifically, hippuristanol
locks eIF4A in a closed conformation thereby blocking its activity [386]. The
hippuristanol-binding site was further defined on eIF4A. More specifically, hippuristanol
binds to motifs V and amino acids adjacent and downstream of motif VI in the C-
terminal domain of eIF4A. These findings support the selectivity of hippuristanol towards
eIF4A [387]. Hippuristanol has been shown across multiple studies (adult T-cell
leukemia, primary effusion lymphoma, and multiple myeloma) to reduce Mcl-1 levels and initiate the apoptotic cascade in chemotherapy resistant, hematological cancers [388-
391]. The combination of dexamethasone and hippuristanol is synergistic in multiple myeloma [390]. Similar to 4E-GI-1, hippuristanol is synergistic with ABT-737 in lymphoma and leukemias [391].
63
Figure 4-4 Comparison of eIF4F Inhibitors. A. Graphical overview of various eIF4F inhibitors. B. Chemical structures of several well-characterized compounds including highlighted differences of three rocaglates.
64 4.5.6 Rocaglates
4.5.6.1 Rocaglamide A
Rocaglates are a class of cyclopenta[b]benzofuran compounds originally isolated from plants of the Aglaia genus. One of the most well characterized rocaglates is
Rocaglamide A (RocA), discovered in 1982 [392]. Subsequent mutagenesis studies
(along with in silico modeling experiments) suggested that rocaglamides work to inhibit eIF4A by stabilizing its interaction with RNA [393]. This finding was later supported with experiments examining the selectivity of eIF4A for mRNAs upon treatment with
RocA. More specifically, RocA clamps eIF4A onto polypurine sequences in an ATP- independent manner [394]. To further support the specificity of this mechanism, the crystal structure of the eIF4A1/AMP-PNP/Roc A/polypurine RNA complex has been determined. The crystal structure also explained the resistance mechanism by which plants from the Aglaia genus are able to continue protein synthesis while synthesizing
RocA. This is due to a key mutation (Phe163) in Aglaia eIF4A which disrupts the RocA binding pocket [395]. The mutant form eIF4A (F163L) is unresponsive to RocA and confers resistance in vitro and in vivo [349]. Although RocA also affects MAPK signaling, inhibition of translation occurs through an eIF4E phosphorylation-independent mechanism [349].
The mechanism of action of rocaglates has been further expanded in recently. In a screen of over 200 synthetic rocaglates, it was found that the majority of compounds induce the binding onto polypurine RNA. However, outliers of polypurine RNA binding were observed that still inhibited cap-dependent translation. These results suggest that
65 inhibition of translation via polypurine clamping is not a universal feature of all
rocaglates. In addition, rocaglates were shown to trap the eIF4F complex at the m7G cap.
eIF4A can be found in both free and complex incorporated forms. Not only does the
sequestered eIF4F at m7G cap inhibit translation of the mRNA that it occupies, but it also
exerts a trans-effect and impacts translation of mRNAs whose expression is normally not
rocaglate-responsive [396].
4.5.6.2 Silvestrol
Silvestrol (and episilvestrol) are natural products isolated from Aglaia silvestris
[397]. Using a cap-dependent luciferase screening method, silvestrol was identified to be
a potent inhibitor of translational initiation and eIF4A [398]. Subsequent studies indicated
that silvestrol is effective against breast and B-cell malignancies [199,399]. Similarly, silvestrol inhibited MDA-MB-231 xenograft tumor growth in vivo [199]. This could be due to silvestrol’s ability to impede epigenetic reprogramming and subsequent breast tumorigenesis. Silvestrol treatment reduces expression of both Ezh2 and Suz12 in
HER2+ breast cancer cells. The HER2/c-Src axis was recently shown to drive epigenetic reprogramming by influencing the expression of components of the PRC2 epigenetic complex [400].
Inhibition of eIF4A by silvestrol has also been shown to improve the cytotoxic effects of several traditional chemotherapies. The combination of silvestrol and doxorubicin resulted in more apoptotic lymphoma cells and produced a longer tumor-free
survival in a MYC-driven lymphoma model [398]. The same is true with dexamethasone
and silvestrol towards multiple myeloma cells [390]. Finally, silvestrol shows synergy
66 with standard-of-care treatments (daunorubicin, etoposide, and cytarabine) in acute
myelogenous leukemia [401].
However, silvestrol is a substrate for the multidrug transporter P-glycoprotein (P-
gp) [402]. This finding was supported by another study where silvestrol-resistant 697-R
leukemia cells were found to overexpress P-gp. Interestingly, the IC50 of RocA was
similar between naïve and resistant cells. When comparing the pharmacokinetics between
these two compounds, serum concentration levels for silvestrol were significantly lower
vs. that of RocA when the drug was administered orally. This finding could have serious
implications for future human clinical trials. In a comparative toxicity study in beagles,
RocA did not cause extensive lung damage which was seen with silvestrol. Overall, these
results suggest that RocA may be a more favorable compound for in vivo use [403,404].
4.5.6.3 FL3
FL3 is a rocaglate derivative with anti-cancer activity [405]. A screen of a small library of flavagline derivates also verified that FL3 was able to inhibit eIF4F-dependent translation. This was assessed through a luciferase-based reporter assay. In addition, this compound was shown to be synergize with vemurafenib (BRAF inhibitor) in resistant
Mel624 melanoma cells [286].
4.5.6.4 CR-31-B/ SDS-1-021-(−)
CR-1-31-B and SDS-1-021-(−) (aka CMLD010509) are two additional rocaglate derivatives reported in the literature. Both have been validated as eIF4A inhibitors with a greater potency compared to silvestrol and RocA [349,406]. These compounds have been tested in numerous studies. For example, SDS-1-021-(−) sensitized renal carcinoma cells
67 to TNF-related apoptosis-inducing ligand (TRAIL)-mediated apoptosis [407]. In a screen
of 40 rocaglate derivatives, SDS-1-021-(−) was found to be the most potent compound to inhibit multiple myeloma cells. Moreover, SDS-1-021-(−) was tested on double-hit
(DHL) and double expression lymphoma (DEL) patient-derived xenografts. A dose of 0.2 mg/kg per day (for 10 days) reduced tumor growth in both models [285]. Lastly, CR-1-
31-B decreased expression levels of MUC1-C in MCF-10A cells. MUC1-C dimerizes with EGFR to activate PI3K signaling in breast cancer cells [268]
4.5.6.5 Amidino-Rocaglates
In a screen of over 200 rocaglates, amidino-rocaglate derivatives have recently been identified as promising candidates for eIF4A inhibition. Using an assay that measures polypurine RNA binding to eIF4A, the amidino-rocaglates CMLD012072 and
CMLD012073 were found to induce binding more so than SDS-1-021-(−).
CMLD012073 was also 3-fold more potent at inhibiting cap-dependent translation than
CR-1-31-B. A hydroxamate group was added to the amidino-rocaglate derivatives to yield CMLD012612. This compound has an IC50 of 2 nM in NIH/3T3 cells and may be
the most potent eIF4A inhibitor to date [408].
4.5.6.6 Aglaiastatins and Aglaroxins
Aglaiastatins and aglaroxins are cyclopenta[b]benzofuran metabolites that contain
a pyrimidone group linked to the core. The activity of several aglaiastatin analogs were
tested and compared against RocA and CR-1-31-B. These pursuits led to the identification of oxo-aglaiastatin (CMLD011580), which has a similar inhibitory activity
68 to translation as CR-1-31-B. CMLD011580 also synergizes with doxorubicin, dexamethasone, and ABT-199 in various settings to kill tumor cells [293].
4.5.6.7 EC143.29 and EC143.69
Two rocaglates, EC143.29 and EC143.69, were recently developed by the
Laboratoires Pierre Fabre. These compounds were shown to be more effective than RocA at inhibiting growth of pancreatic cancer cells. Importantly, both EC143.29 and
EC143.69 reduced tumor growth in a syngeneic, desmoplastic pancreatic tumor mouse model [336].
4.5.6.8 eFT226/Additional Rocaglate Derivatives
Effector Therapeutics, Inc. is currently developing a novel eIF4A inhibitor, eFT226. This compound promotes the formation of a stable complex between eIF4A and polypurine motifs in mRNAs (as suggested by the mechanism of RocA) [409]. In addition, eFT226 was shown to be effective against B-cell malignancies at concentrations below 15 nM in vitro [410]. This compound is currently under clinical investigation in advanced solid tumors (NCT04092673). Finally, didesmethylrocaglamide (DDR), another rocaglate, showed anti-tumor effects in a Malignant peripheral nerve sheath tumor (MPNST) mouse model [403].
4.5.7 Briciclib (ON 013105)/RNA-based Strategies
Several companies have attempted to develop novel eIF4F inhibitors for their use as chemotherapeutics. Briciclib (ON 013105) (Onconova Therapeutics, Inc.) is a potential eIF4E inhibitor and is currently in a phase 1 dose-escalation study
69 (NCT02168725). This compound was found to reduce expression levels of cyclin D1, c-
Myc, Mcl-1, and Bcl-xL in mantle cell lymphoma cells. Direct binding to eIF4E was
shown by nuclear magnetic resonance spectroscopy [411]. However, no further
mechanistic studies were provided to validate briciclib as an eIF4E inhibitor.
eIF4E has also been the target of several clinical trials. Ionis Pharmaceuticals, Inc.
have developed an eIF4E antisense oligonucleotide to reduce eIF4E proteins levels. ISIS
EIF4E Rx was first tested in combination with carboplatin and paclitaxel in non-small
cell lung cancer along with docetaxel and prednisone in castrate-resistant prostate cancer
(NCT01234038, NCT01234025). Following the results of these studies, a second
antisense oligonucleotide (ASO) was developed (ISIS 183750). In combination with
irinotecan, seven of 15 (47%) patients achieved a stable disease. However, no objective
clinical responses was observed in patients with irinotecan-refractory colorectal cancer
(NCT01675128) [412]. Lastly, in collaboration with Eli Lilly and Company, LY2275796
(an eIF4E ASO) was tested in patients with advanced cancer. Only seven patients (21%) achieved a stable disease (NCT00903708) [413].
Finally, RNA aptamers have been developed against the m7G cap, eIF4E, eIF4A,
and eIF4G. The functional use of these inhibitors have not been explored in vitro or in
vivo cancer models [414-416]. RNA aptamer against eIF4A have been shown to bind and
inhibit the ATPase activity of the enzyme [415]
4.6 Conclusions
Selective targeting of the cancer proteome has gained much interest in recent
years. It is now been demonstrated that the oncoproteome is continually changing,
70 responding to various stimuli and environmental stressors. One of the most prominent
regulators of translational initiation is eIF4F. eIF4F is involved in the rate-limiting step of protein translation and regulates synthesis of key oncogenes. eIF4F has been extensively associated with several aspects of cancer biology. These include proliferation, invasion, drug resistance, and survival via inhibition of caspase-mediated apoptosis. Newly identified roles of eIF4F are now emerging which include regulation of stemness, modulation of immunotherapy, and cancer metabolism. A wide variety of inhibitors have already been identified. Combining eIF4F inhibitors with a reduced dosage of cytotoxic or targeted chemotherapies may greatly improve their effectiveness. In all, high-impact studies elucidating the role of eIF4F in cancer biology will only continue to grow along with additional eIF4F inhibitors.
71
Chapter 5
The CXCR4-LASP1-eIF4F Axis Promotes Translation of Oncogenic Proteins in Triple-Negative Breast Cancer Cells
Citation: Howard CM, Bearss N, Subramaniyan B, Tilley A, Sridharan S, Villa N, Fraser
CS and Raman D (2019) The CXCR4-LASP1-eIF4F Axis Promotes Translation of
Oncogenic Proteins in Triple-Negative Breast Cancer Cells. Front. Oncol. 9:284. doi:
10.3389/fonc.2019.00284.
Copyright Notice: Under the Frontiers Terms and Conditions, authors retain the copyright
to their work. Furthermore, all Frontiers articles are Open Access and distributed under
the terms of the Creative Commons Attribution License (CC-BY 3.0), which permits the use, distribution and reproduction of material from published articles, provided the original authors and source are credited, and subject to any copyright notices concerning any third-party content. More information about CC-BY can be found here: http://creativecommons.org/licenses/by/4.0/
5.1 Introduction
Breast cancer is the second leading cause of death due to cancer in women. One
out of eight women (13%) will develop breast cancer in her lifetime [417]. Mortality in breast cancer patients is mainly due to metastasis to the lungs, bone, and the brain. More
72 specifically, triple-negative breast cancer (TNBC) is a devastating subtype with a low survival rate. Heterogeneity and plasticity observed in TNBC [418,419] often results in
chemoresistance, tumor relapse, and poor patient outcome. Therefore, it is imperative to
find novel (and effective) targets for patients diagnosed with TNBC.
One potential approach to target TNBC cells has been through the inhibition of
various chemokine receptors. Overall, this group of proteins play an essential role in the
tumor microenvironment to facilitate breast cancer progression and metastasis [42,420-
425]. More specifically, the CXCL12-CXCR4 signaling pathway has been associated
with TNBC invasiveness and chemotactic homing [42,43,53,421,426-428]. Previously, we reported that the C-terminal tail of CXCR4 directly binds to LIM and SH3 protein 1
(LASP1) [133] and knock down of LASP1 ablated CXCR4-driven invasion [134].
LASP1 is an adaptor protein that has been shown to mediate cell migration, proliferation, and survival in several breast cancer cell lines [133,134,429-431]. Additionally, LASP1 dissociates from the CXCR4 C-terminal tail upon CXCL12 stimulation [133]. We therefore hypothesized that stimulation with CXCL12 could promote LASP1 to modulate the signaling network of CXCR4 via transient protein-protein interactions. Subsequently, we performed a proteomic screen for novel LASP1 interacting proteins. Eukaryotic initiation factors 4A and 4B (eIF4A and eIF4B) were identified to be interacting proteins.
Both eIF4A and eIF4B are essential components of the eukaryotic initiation factor 4F complex (eIF4F).
The eIF4F complex consists of three core subunits: eIF4E, the cap binding subunit; eIF4A, an RNA helicase, and eIF4G1, a large scaffolding protein. Ultimately, selection of an mRNA by the eIF4F complex prepares it for successful recruitment of the
73 43S pre-initiation complex, and eventual ribosome assembly
[183,203,248,249,265,267,432,433]. More specifically, eIF4A catalyzes the ATP-
dependent unwinding of RNA duplexes and requires the direct binding of its co-factor,
eIF4B, along with eIF4G1, for its optimal activity [239,242,434-437]. The eIF4F
complex has been previously identified to be essential for the initiation and maintenance
of a malignant phenotype in human mammary epithelial cells [438]. Suppression of
eIF4F can also affect the maintenance, progression, and metastasis of breast cancer in in
vivo models [185,439,440]. Elevated protein expression levels of eIF4A [253] and eIF4B
have been observed in breast cancer patients [198]. Moreover, eIF4A, eIF4B, and eIF4E
were all found to be independent predictors of poor outcome in ER-negative breast
cancer [198].
The current notion within the field is that the eIF4F complex has been identified
to be a critical node of cancer biology due to many oncogenic mRNAs containing
secondary structures within their 5’untranslated regions (5’UTRs) [441]. Thus, cancer
cells preferentially rely on eIF4A to unwind these structured 5’-UTRs or stem-loop
structures (SLS). Without eIF4F complex formation and activity, the secondary structure
of the 5’UTR would stall ribosome scanning and detection of the methionine start codon
(AUG) [197,252]. As a result, many oncogenic proteins would remain at steady-state
levels and this would hinder malignancy. Several of these SLS-containing oncogenic
mRNAs include: BIRC5 (Survivin), Cyclin D1 (CCND1), Ornithine Decarboxylase
(ODC), Murine Double Minute 2 (Mdm2), Rho A kinase1 (ROCK1), Mucin-1C (MUC-
1C), Sin1, and ADP Ribosylation Factor 6 (ARF6) [202,203,265-268]. In this paper, we pursued BIRC5, CCND1, ROCK1, and Mdm2 as eIF4A-dependent target genes.
74 Additionally, we were also interested in the influence of CXCR4 on the eIF4F
complex through G-protein coupled receptor signaling. CXCR4 has been previously
shown to activate both ribosomal S6 kinases: p90 ribosomal S6 kinase (p90rsk – via the
ERK pathway) [442] and p70-S6 kinase (p70rsk - via the mTORC1 pathway) [443]. These
two major kinases have been established to feed into cap-dependent mRNA translation through modulation of regulatory proteins including 4E-BP1 [307,444]. In its phosphorylated form, 4E-BP1 releases eIF4E to promote eIF4F complex formation. In addition, eIF4B is specifically phosphorylated on Ser422 by p90rsk and p70rsk kinases.
This phosphorylated form of eIF4B is reported to increase the rate of translation
[308,309]. Finally, active p70rsk and p90rsk also induces the phosphorylation and
degradation of the tumor suppressor, programmed cell death protein 4 (PDCD4), an
endogenous inhibitor of eIF4A [351]. Despite strong primary evidence on several
signaling pathways feeding into the eIF4F complex, limited literature exists on the
phosphorylation status of these proteins following activation of CXCR4.
In this study, we confirm our initial findings from the proteomic screen and
demonstrate that LASP1 can interact with both eIF4A and eIF4B. Importantly, the
LASP1-eIF4A and LASP1-eIF4B interaction is shown to be CXCL12-dependent. In
addition, the ability of CXCR4 to impact the phosphorylation of eIF4F regulatory
proteins is provided. Taken together, we hypothesize that activation of CXCR4 can
promote eIF4F complex formation and activity through LASP1 and cell signaling. As a
result, the translation of oncogenic proteins is promoted thereby mediating an invasive
and metastatic phenotype commonly associated with CXCR4.
5.2 Materials and Methods
75 5.2.1 Bioinformatics Analysis
To determine the significance of the CXCR4-LASP1-eIF4A/B axis in patient tissues, gene expression data was obtained and analyzed using Oncomine™ [445-447].
Settings in the program were limited to a “cancer vs. normal analysis” and “breast cancer.” Data from two representative datasets are shown. Datasets include: Radvanyi
Breast (PNAS, 08/02/2005) and TCGA Breast (The Cancer Genome Atlas, 09/02/2011).
Box and whisker plots of the log2 median centered ratio for each cancer subtype were generated in the ‘R’ statistical package and the generated graphics were modified in
Inkscape.
5.2.2 Cell Culture
231S cells: MDA-MB-231 human breast cancer cells (MDA-MB-231: ATCC®
HTB-26™, Manassas, VA) were previously sorted for high cell surface expression of
CXCR4 (denoted as 231S cells) and are described elsewhere [134]. 293-HA-CXCR4
cells: Human embryonic kidney 293 cells (HEK-293: ATCC® CRL-1573™, Manassas,
VA) stably expressing human CXCR4 are also described previously [134]. MCF7 series:
MCF7 breast cancer cells (MCF7: ATCC® HTB-22™, Manassas, VA) expressing empty
vector, wild-type CXCR4 (wild-type), or CXCR4 with a truncated C-terminal domain
(ΔCTD) were characterized previously [423]. Cells were maintained in Dulbecco’s
modified eagle medium (DMEM) supplemented with 4 mM L-glutamine, +4500 mg/L
glucose, sodium pyruvate (GE Healthcare Life Sciences, Pittsburgh, PA, Cat. No.
SH30243.01), 10% heat-inactivated fetal bovine serum (FBS) (Denville Scientific,
Swedesboro, NJ, Cat. No. FB5001-H), and Penicillin (100 I.U.) / Streptomycin (100
µg/ml) (Corning, Corning, NY, Cat. No. 30-002-CI).
76 5.2.3 Generation of LASP1 Knockdown and Knockout Cell Lines
LASP1 was stably knocked down (KD) in 231S cells using shRNA constructs
(V2LHS_64685 and V2LHS_64686, Open Biosystems, Huntsville, AL) [134]. A non-
silencing (NS) shRNA served as the wild type control (denoted as 231S LASP1 NS and
KD). In order to obtain a genetic knockout (KO) of LASP1, LASP1 CRISPR/Cas9
knockout plasmids were purchased (Santa Cruz, Dallas, TX, Cat. No. sc-404630). Cells
were transfected using UltraCruz reagent (Santa Cruz, Dallas, TX, Cat. No. sc-395739)
according to the manufacturer’s instructions. The supernatant was removed 24 h later and
replaced with complete media. Cells were further cultured for 72 hours post-transfection.
Subsequently, LASP1-KO cells were sorted for GFP and single KO cells were isolated by limiting dilution. KO of LASP1 was confirmed by Western blotting. Non-targeting
CRISPR/Cas9 plasmids served as the control (Santa Cruz, Dallas, TX, Cat. No. sc-
418922). These plasmids encode the Cas9 nuclease and non-specific 20 nucleotide guide
RNAs (denoted CRISPR control and LASP1 KO).
5.2.4 Co-immunoprecipitation Assay
231S cells were serum-starved for 1 hour and stimulated with 10-20 nM CXCL12
(PeproTech, Rocky Hill, NJ, Cat. No. 300-28A) over different time points. Total cell
lysates were prepared by lysing the cells in co-immunoprecipitation buffer (Co-IP buffer)
(50 mM Tris pH 8.0, 100 mM NaCl, 0.1% IGEPAL CA-630, 0.1% Deoxycholate and 5 mM EDTA) supplemented with protease inhibitor cocktail (Sigma-Aldrich, St. Louis,
MO, Cat. No. P8340-5ML), phosphatase inhibitor cocktail 2 (Sigma-Aldrich, St. Louis,
MO, Cat. No. P5726), and phosphatase inhibitor cocktail 3 (Sigma-Aldrich, St. Louis,
MO, Cat. No. P0044) for 10 min at 4°C. Total protein in the clarified lysate was
77 quantified using a Bradford protein assay (Bio-Rad, Hercules, CA, Cat. No. 5000006). 1
mg of total protein lysate was employed in all immunoprecipitation reactions. eIF4B was
immunoprecipitated by using 2 µg of eIF4B antibody (Cell Signaling Technology,
Danvers, MA, Cat. No. 13088). Mouse (G3A1) mAb IgG1 Isotype Control (Cell
Signaling Technology, Danvers, MA, Cat. No. 5415) served as the mock control. Next,
eIF4A was immunoprecipitated using 2 µg of eIF4A1 antibody (Cohesion Biosciences,
London, Purley, Cat. No. CQA1180). His-Tag (D3L10) XP® Rabbit mAb (Cell Signaling
Technology, Danvers, MA, Cat. No. 12698) was employed for the mock condition.
Finally, in the reciprocal Co-IP, LASP1 was immunoprecipitated by using 2 µg LASP1
antibody (Biolegend, San Diego, CA, Cat. No. 909301). As in the eIF4B Co-IP, mouse
(G3A1) IgG1 Isotype mAb was employed as the mock control. Prior to
immunoprecipitation, lysates were pre-cleared with 20 µL of PureProteome™ Protein G
Magnetic Beads (Millipore, Billerica, MA, Cat No. LSKMAGG10) for 2 h at 4ºC.
Immunoprecipitation reactions were then allowed to proceed with 20 µL of protein G magnetic beads and the appropriate amount of antibody for 2 h at 4ºC. Beads were washed with Co-IP buffer. To avoid heavy chain contamination (55 kDa) in the eIF4A
Co-IP, antibodies were cross-linked using BS3 (according to Millipore
recommendations). Proteins of interest were analyzed by sodium dodecyl sulfate-
polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting.
5.2.5 m7-GTP pull-down Assay
231S cells were serum starved for 1 h and cells were stimulated (and prepared) as
described in the co-immunoprecipitation section. 100 nM AMD3465 (CXCR4 antagonist,
Sigma-Aldrich, St. Louis, MO, Cat. No. SML1433-5MG) was incubated 30 minutes prior
78 to stimulation. 1 mg of total protein lysate in 1 mL of Co-IP buffer was incubated with 25
µL of m7-GTP agarose beads overnight at 4ºC (Jena Biosciences, Jena, Germany, Cat.
No. AC-155S). Following incubation, beads were washed with Co-IP buffer. Protein was
eluted and analyzed by SDS-PAGE and Western blotting.
5.2.6 GST-LASP1 Pull-down of eIF4A and eIF4B
The open reading frame of the human LASP1 gene (Open Biosystems, Huntsville,
AL) was engineered with BamHI and XhoI cloning sites using the following gene specific primers: 5’-CTAGCTGGATCCATGAACC CCAACTGCGCC-3’ (forward), and
5’-CTAGCTCTCGAGTCAGATGGCCTCCACGTA-3’ (reverse). Following amplification by polymerase chain reaction (PCR), LASP1 was inserted into the GST bacterial expression vector pGEX-6P-1 (GE Healthcare Life Sciences, Pittsburgh, PA,
Cat. No. 28954648). The verity of the DNA construct was confirmed by sequencing
(Eurofins Genomics, Louisville, KY). Both the GST-LASP1 and empty pGEX-6P-1 vector (GST control) were transformed into E. coli BL21 strain for the production of
GST and GST-LASP1 proteins using standard protocols described elsewhere [431]. For the pull-down assays, 1.5 nmoles of the GST control protein (40.5 µg) and GST-LASP1
(85.1 µg) bound to glutathione agarose beads (Thermo Scientific, Rockford, IL, Cat No.
16100) were equilibrated in Co-IP buffer and incubated with 1 mg of total protein lysates from 231S cells in 1 mL of Co-IP buffer for 2 h at 4˚C. After washing the beads with
Co-IP buffer, the bound proteins were eluted and analyzed by SDS-PAGE and Western blotting.
5.2.7 Direct Binding of LASP1 to eIF4A and eIF4B
79 Recombinant eIF4A and eIF4B were purified to homogeneity according to
previously published protocols [248,249]. In one set of direct binding experiments, 1.5
nmoles of GST-LASP1 and GST-control beads in 1 mL of Co-IP buffer were incubated with purified recombinant eIF4A and eIF4B overnight at 4ºC. Beads were then washed with Co-IP buffer and bound protein was eluted by SDS-PAGE and Western blotting. To confirm that the binding is able to occur in a 1:1 molar ratio (and also in solution), GST-
LASP1 and GST were eluted from the beads using glutathione elution buffer (10 mM L- glutathione, 50 mM Tris pH 8.0). Eluted protein was quantified using a Bradford protein assay. Equimolar amounts of proteins were incubated in a final volume of 1 mL of Co-IP buffer overnight at 4ºC. Complexes were then re-captured with 10 µL glutathione agarose beads for 1 h at 4ºC. Finally, beads were washed with Co-IP buffer and bound proteins were eluted and analyzed by SDS-PAGE and Western blotting. Purity of the recombinant proteins was confirmed by SDS-PAGE and staining with Imperial™ Protein Stain
(Thermo Scientific, Rockford, IL, Cat No. 24615) (5 ng detection limit).
5.2.8 Proximity Ligation Assay (PLA)
The Duolink In Situ Orange Fluorescent kit (Sigma/Aldrich, St. Louis, MO, Cat.
No. DUO92102-1KT) was employed to detect the endogenous interaction between
LASP1 and eIF4A in situ in 231S cells. The PLA was performed according to manufacturer’s instructions using a rabbit eIF4A1 antibody (Cohesion Biosciences,
London, Purley, Cat. No. CQA1180) and a mouse LASP1 antibody (Biolegend, San
Diego, CA, Cat. No. 909301) [134]. The single Ab control condition represents the PLA reaction with only the LASP1 antibody. In addition, cells were stained with phalloidin
(Life Technologies, Carlsbad, CA, Cat. No. A12379) and nuclei with DRAQ5 (Thermo
80 Scientific, Rockford, IL, Cat No. 62251). Cells were stimulated and inhibited as
described elsewhere in the paper. Moreover, cells were fixed, stained, and permeabilized
with standard methods [134]. The images were acquired by two-photon confocal
microscopy and processed with Leica Application Suite X software (Leica, Wetzlar,
Germany). Quantification of the interaction dots was preformed using ImageJ.
5.2.9 Western Blotting
Cell lysates were prepared and quantified as described elsewhere. Western blots
were incubated with the following 1ºAbs: Cyclin D1 (Cell Signaling Technology,
Danvers, MA, Cat. No. 2922), eIF4A C32B4 (Cell Signaling Technology, Danvers, MA,
Cat. No. 2013), eIF4B 1F5 (Cell Signaling Technology, Danvers, MA, Cat. No. 13088),
p-eIF4B S422 (Thermo Scientific, Rockford, IL, Cat No. PA5-38362), eIF4E C46H6
(Cell Signaling Technology, Danvers, MA, Cat. No. 2067), eIF4G C45A4 (Cell
Signaling Technology, Danvers, MA, Cat. No. 2469), GST 26H1 (Cell Signaling
Technology, Danvers, MA, Cat. No. 2624), LASP1 8C6 (Biolegend, San Diego, CA, Cat.
No. 909301), MDM2 SMP14 (Santa Cruz Biotechnology, Dallas, TX, Cat. No. sc-965),
PDCD4 D29C6 (Cell Signaling Technology, Danvers, MA, Cat. No. 9535), p-PDCD4
S67 (Sigma-Aldrich, St. Louis, MO, Cat. No. P0072), ROCK1 C8F7 (Cell Signaling
Technology, Danvers, MA, Cat. No. 4035), Survivin 71G4B7 (Cell Signaling
Technology, Danvers, MA, Cat. No. 2808), 4E-BP1 53H11 (Cell Signaling Technology,
Danvers, MA, Cat. No. 9644), p-4E-BP1 Thr70 (Cell Signaling Technology, Danvers,
MA, Cat. No. 9455), and β-tubulin D66 (Sigma/Aldrich, St. Louis, MO, Cat. No. T0198).
Following primary incubation, Western blots were incubated with Goat anti-Mouse IgG
(H+L) Superclonal™ Secondary Ab conjugated to HRP (Thermo Scientific, Rockford,
81 IL, Cat No. A28177) or Goat anti-Rabbit IgG (H+L) Superclonal™ Secondary Ab conjugated to HRP (Thermo Scientific, Rockford, IL, Cat No. A27036). Finally, blots were developed with Amersham™ ECL™ Prime Western Blotting Detection Reagent
(GE Healthcare Life Sciences, Pittsburgh, PA, Cat. No. RPN2232) and HyBlot ES™
Autoradiography Film (Denville Scientific, Swedesboro, NJ, Cat. No. E3212).
Densitometry of the Western blots was performed using ImageJ. Calculation of fold change is given in the figure legend for each experiment.
5.2.10 Real-Time PCR
Total RNA was extracted from 231 S LASP1 NS and 231S LASP1 KD cells
using an RNeasy® Mini Kit according to the manufacturer’s instructions (Qiagen,
Germantown, MD, Cat. No. 74104). Following RNA isolation, cDNA was synthesized
using a SuperScript™ III First-Strand Synthesis Kit (Invitrogen, Carlsbad, CA, Cat. No.
18080-400). 2000 ng of input RNA and random hexamer primers were used according to the manufacturer’s instructions. Finally, real-time PCR was performed using 2X
PowerUp™ SYBR™ Green Master Mix (Applied Biosystems, Foster City, CA, Cat. No.
A25741), 2 µL of cDNA, and 2 µL of the following forward and reverse primers (300 nM): ROCK1: 5'-AACATGCTGCTGGATAAATCTGG-3' and 5'-
TGTATCACATCGTACCATGCCT-3' MDM2: 5’-CCTTCGTGAGAATTGGCTTC-3’
and 5’-CAACACATG ACTCTCTGGAATCA-3’ CCND1: 5′-
ATGTTCGTGGCCTCTAAGATG A-3′ and 5′-CAGGTTCCACTTGAGCTTGTTC-3′
BIRC5: 5'-AAGAACTGGCCCTTCTTGGA-3' and 5′-CAACCGGACGAATGCTTTT-3'
β-tubulin: 5’-TTGGCCAGATCTTTAGACCAGACAAC-3’ and 5’-
CCGTACCACATCCAGGACAGAATC-3’. Real time data was analyzed using the ΔΔCt
82 method with β-tubulin primers as the control. The values from 231S LASP1 NS cells
were then set to 1.
5.2.11 GQ 5’UTR Luciferase Assay
The GQ 5'UTR luciferase assay is a previously published method to assess the
endogenous activity of eIF4A in cells [197]. Four tandem repeats of the (CGG)4 12-mer motif (GQ 5'UTR) or a random sequence matched for length and GC content (Random
GQ 5'UTR) were cloned into the 5′UTR of firefly pGL4.10 luc2 (Promega, Madison, WI,
Cat. No. E6651) containing the CMV promoter. To create these constructs, CMV was first cloned into pGL4.10 luc2 by employing KpnI and XhoI restriction sites. The CMV promoter was amplified from pcDNA3.0 (Invitrogen, Carlsbad, CA, Cat. No. V79020) using the following primers: 5’-TTTGTAGGTACCGATGTACGGGCCAGATATAC-3’ and 5’-TTTGTACTCGAGGTATTAATTTCGATA AGC-3’. After successful insertion and verification of the CMV promoter, both 5’UTR sequences (GQ and Random GQ) were cloned before the luciferase open reading frame via added BglII and HindIII sites.
This was accomplished with the following annealed oligonucleotides obtained commercially (Eurofins Genomics, Louisville, KY): GQ 5’UTR: 5’-
GATCTCTAGGTTGAAAGTACTTTGACGGCGGCGGCGGTCAATCTTACGGCGG
CGGCGGACATAGATACGGCGGCGGCGGTAGAAACTACGGCGGCGGCGGATT
AGAATAGTAAAA-3’ and 5’-
AGCTTTTTACTATTCTAATCCGCCGCCGCCGTAGTTTCTACCGCCGCCGCCGT
ATCTATGTCCGCCGCCGCCGTAAGATTGACCGCCGCCGCCGTCAAAGTACTTT
CAACCTAGA-3’ Random GQ 5’UTR: 5’-
GATCTCTAGGGCGCACGTACTTCGACAACGTCAGCGTTCAGCGTTCCAACGT
83 CAGCGTACAGCGATCCAACGTCAGCGTTCTGCGCTACAACGTCAGCGTATCC
GCGTAGCACAA-3’ and 5’-
AGCTTTGTGCTACGCGGATACGCTGACGTTGTAGCGCAGAACGCTGACGTTG
GATCGCTGTACGCTGACGTTGGAACGCTGAACGCTGACGTTGTCGAAGTACG
TGCGCCCTAGA-3’. 40 ng of each firefly luciferase construct was transfected along
with 40 ng of pGL4.74 hRluc (Promega, Madison, WI, Cat. No. E6921). Following
transfection, cells were incubated in serum free media overnight. Cells were lysed,
protein lysates were then collected the next day. Firefly and renilla luciferase activity
were assessed by employing the Dual-Luciferase® Reporter Assay System (Promega,
Madison, WI, Cat. No. E1910). Data reflects firefly luciferase activity normalized to
renilla readings with the CMV-pGL4.10 luc2 set to 1 for each cell type.
5.2.12 Pharmacological Inhibition of eIF4A in 231S LASP1 NS and KD
Cells
231S LASP1 NS / KD cells were plated into 96-well dishes (3,000 cells / well)
and incubated with various amounts of Rocaglamide A (Sigma/Aldrich, St. Louis, MO,
Cat. No. SML0656) in low serum media (LSM-DMEM/0.5% FBS). Images were
acquired via an IncuCyte® S3 Live-Cell Analysis System (Essen BioScience, Ann Arbor,
Michigan). Two images per well were acquired every 2 h. Data was processed on the
IncuCyte S3 software (Essen BioScience, Ann Arbor, Michigan). Only cells with an area greater than 150 µm2 were analyzed to avoid cellular debris. Data is reflective of the
percent confluence of each image at 36 h RocA incubation. Percent inhibition was
calculated in reference to the DMSO control. The readings from 231S LASP1 NS cells
were set to 1. In the cell viability experiments, 231S LASP1 NS/KD cells were seeded at
84 6,000 cells/well and allowed to attach and spread overnight. The following day, complete
media was replaced with LSM and RocA. Cell viability was then determined 36 h later
using a cell counting kit-8 (Sigma/Aldrich, St. Louis, MO, Cat. No 96992) according to
the manufacturer’s instructions. Data is reflective of the absorbance at 450 nm (A450).
The DMSO controls were set to 100%.
5.2.13 Statistical Analysis and Graph Preparation
Data analysis was performed using the R statistical program (version 3.5.1).
Statistical significance between groups was determined by unpaired Student’s t-tests with
a ‘p’ value set to <0.05. Graphs were first generated in R and then modified in Inkscape
(version 0.92.3).
5.3 Results
5.3.1 Breast Cancer Patient Samples Contain Elevated Levels of
CXCR4, LASP1, eIF4A, eIF4B, and the Downstream Targets of eIF4A
In order to evaluate the gene expression profile of CXCR4, LASP1, eIF4A and
eIF4B in breast cancer patients, we analyzed breast cancer data sets using ‘Oncomine’.
This online resource is a cancer microarray database and an integrated data-mining
platform [445-447]. Differential expression analyses were performed on ‘The Cancer
Genome Atlas’ (TCGA) and Radvanyi data sets. In each analysis, the gene expression
profile of normal breast tissue was compared with invasive lobular carcinoma (ILC) and
invasive ductal carcinoma (IDC) samples. We observed a significant elevation of gene
expression for CXCR4, LASP1, eIF4A, and eIF4B. In addition, the genes downstream of
eIF4A (BIRC5, CCND1, ROCK1 and MDM2) were also observed to have elevated
expression levels (p<0.05) (Fig. 1A-D). Overall, this points to the clinical significance of
85 our axis of study. Elevated mRNA levels of these genes established the premise that these
proteins may play a vital role in oncoprotein translation to promote metastatic breast
cancer. However, we recognize that future studies will need to confirm these findings at
the protein level.
Figure 5-1 The CXCR4-LASP1-eIF4A/B axis is upregulated in breast carcinoma patients. Gene expression data was obtained and analyzed using Oncomine.com. Two representative datasets were selected. Box and whisker plots of the log2 median centered ratio (fold change) are shown for each. A. Radvanyi Breast Invasive Ductal Carcinoma (n=31 for CXCR4, LASP1, eIF4A, and CCND1. n=28 for BIRC5 and ROCK1. n=27 for MDM2.) vs. Breast Tissue (n=9 for CXCR4, LASP1, eIF4A, and CCND1. n=2 for BIRC5. n=5 for MDM2 and ROCK1). B. Radvanyi Breast Invasive Lobular Carcinoma (n=7 for CXCR4, LASP1, eIF4A, and CCND1. n=2 for BIRC5. n=6 for MDM2 and ROCK1) vs. Breast Tissue (n=9 for CXCR4, LASP1, eIF4A, and CCND1. n=2 for BIRC5. n=5 for MDM2 and ROCK1). C. TCGA Breast Invasive Ductal Carcinoma (n=389) vs. Breast Tissue (n=61). D. TCGA Breast Invasive Lobular Carcinoma (n=36) vs. Breast Tissue (n=61). * indicates p < .05 as evaluated by student’s t-tests.
86 5.3.2 LASP1 Associates with eIF4A Endogenously in a CXCL12- dependent Manner in situ
To initially confirm the LASP1-eIF4A interaction, we examined whether LASP1
would associate with eIF4A endogenously in 231S cells in situ. Following stimulation or
inhibition of CXCR4, the endogenous interaction between LASP1 and eIF4A was probed
by a proximity ligation assay (PLA). The single antibody control displayed almost no
interaction dots (0.09±0.6 dots - from 39 cells). In the unstimulated state (-CXCL12), a
basal interaction was detected between LASP1 and eIF4A (11.6±6.5 dots - from 46 cells).
With CXCL12 incubation for 5 min, there was a 3-fold stimulation of the interaction between LASP1 and eIF4A (118±58.3 dots – from 29 cells). The CXCL12-stimulated interaction between LASP1 and eIF4A can be abrogated to the basal level by the CXCR4 antagonist, AMD3465 (13.3±10.2 dots – from 15 cells) (Fig. 2).
5.3.3 LASP1 Co-immunoprecipitates with eIF4A and eIF4B
Endogenously in a CXCL12-dependent Manner
In order to further evaluate the association between LASP1, eIF4A1, and eIF4B,
we performed co-immunoprecipitation assays with and without CXCL12 stimulation in
231S cells. In each of these co-immunoprecipitation experiments, both eIF4A and eIF4B
associated with LASP1 endogenously in a CXCL12-dependent manner with peak
interaction at 5 min (Fig. 3A+3B). To further validate the interaction, we also
immunoprecipitated LASP1 and probed for the presence of eIF4A and eIF4B in the
reciprocal Co-IP. There was a slight basal association of endogenous LASP1 and eIF4A1
which increased to 19.1 fold upon stimulation of CXCR4 for 5 min. Similarly, there was
87 a 7.5-fold increase in association of LASP1 with eIF4B upon activation of CXCR4 (Fig.
3C).
5.3.4 Endogenous LASP1 Associates with the eIF4F Complex in a
CXCL12-dependent Manner
We next asked if LASP1 could be incorporated into the eIF4F complex upon
stimulation of CXCR4. To address this question, we employed the previously established
m7GTP-pulldown assay. Activation of CXCR4 in 231S cells resulted in an increased
association of endogenous LASP1 with eIF4E. This association peaked at 5 (2.2-fold)
minutes before returning a to basal level at 20 min. Importantly, the CXCL12-dependent
recruitment of LASP1 at 5 min can be abrogated by pre-treatment of the cells with
AMD3465 (Fig. 3D). Furthermore, the eIF4G-eIF4E interaction has been commonly accepted to give an indication of eIF4F complex formation [286]. As such, we explored the influence of CXCR4 on the eIF4G-eIF4E interaction. eIF4G was incorporated in a
CXCL12-dependent manner with a peak recruitment at 5 min (4.4-fold) and slowly declined to 2.2-fold at 20 min, well above the baseline level. This peak recruitment at 5 min of CXCL12 treatment can also be reduced by AMD3465 (Figure 3E).
88
Figure 5-2 The LASP1-eIF4A interaction increases with CXCL12 stimulation in situ. A. The Proximity Ligation Assay (PLA) was used to visual the in situ interaction between LASP1 and eIF4A in 231S cells. Cells were stimulated with 20 nM CXCL12 for 5 minutes. 100 nM AMD3465 was added 30 minutes prior to stimulation. The single antibody control employs the PLA reaction using only the LASP1 antibody. A. Representative images of the PLA experiment. Quantification indicates the average number of interactions/cell across multiple independent fields. (Single Ab Control: n=39, -CXCL12: n=46, +CXCL12: n=29, +CXCL12/AMD3465: n=15); Red-LASP1-eIF4A interaction, Green-phalloidin (actin), and Blue-DRAQ5 (nucleus); Scale bar – 10 µm.
89
Figure 5-3 LASP1 interacts with the eIF4F complex in a CXCL12-dependent manner. A. Co-immunoprecipitation assay of eIF4A and LASP1 in 231S cells following stimulation with 20 nM CXCL12 (n=2). B. Co- immunoprecipitation assay of eIF4B and LASP1 in 231S cells following stimulation with 10 nM CXCL12 (n=3). C. Co-immunoprecipitation assay of LASP1 and eIF4A/B following stimulation with 20 nM CXCL12 in 231S cells (n=2). Fold change was calculated based off the densitometry ratio of co-immunoprecipitated/immunoprecipitated protein signal with 0 min. set to 1. D and E. m7GTP pulldown assay in 231S cells following stimulation with 20 nM CXCL12 and 100 nM AMD3465 examining the interaction between: D.) LASP1-eIF4E (n=3) and E.) eIF4G-eIF4E (n=3). Fold change was calculated based off the densitometry ratio of co-precipitate (LASP1 or eIF4G)/precipitate (eIF4E) protein signal with 0 min. set to 1.
90 5.3.5 LASP1 Directly Binds to Both eIF4A and eIF4B
To further prove the interaction of LASP1 with eIF4A and eIF4B, we employed a
GST-pulldown approach. In the eIF4A pulldown, we also added exogenous ATP (2 mM)
and MgCl2 (3 mM) since eIF4A is an ATP-dependent enzyme. LASP1 associated robustly with eIF4A regardless of any exogenous addition of ATP and MgCl2 (Fig. 4A &
B). In addition, LASP1 robustly associated with eIF4B as well (Fig. 4C). This
experimental system was also used to test if LASP1 could directly bind to both eIF4A
and eIF4B. Previous interaction experiments were unable to distinguish a direct
interaction between these proteins. LASP1 directly bound to purified, recombinant eIF4A
(Fig. 4D) and eIF4B (Fig. 4E) in a dose-dependent manner. Finally, to further confirm the validity of the direct binding experiments, we mixed equimolar amounts of purified GST-
LASP1 with eIF4A or eIF4B in a solution and captured the complex with glutathione
beads. As expected, LASP1 directly bound to both eIF4A and eIF4B (Fig. 3F). The purity
of the proteins employed in these experiments is shown (Fig. 4G).
5.3.6 Activation of CXCR4 Promotes Phosphorylation of PDCD4, eIF4B, and 4E-BP1
Aside from the influence of LASP1 on eIF4A and eIF4B, we next addressed
whether activation of CXCR4 would feed into the activation of eIF4F complex through
cell signaling. Interestingly, activation of CXCR4 led to phosphorylation of eIF4B on
S422 by 5 min before declining (Fig. 5A). The increase at 10 min in p-eIF4B levels can
be abrogated with AMD3465. Next, we addressed if CXCR4 could promote the
phosphorylation of PDCD4. With CXCR4 activation, the phosphorylation increased to
3.3-fold at 5 min and peaked at 10 min (3.9-fold). The increase at 5 min in pS67-PDCD4
91 level can be abrogated by pretreatment of cells with AMD3465 (Fig. 5B). We then
examined phosphorylation of 4E-BP1, which releases eIF4E and allows its incorporation
into the eIF4F complex. Upon activation of CXCR4, pT70-4E-BP1 levels increased by 5
min and this effect could be abrogated with AMD3465 (Fig. 5C). Finally, to further prove
these findings, we utilized a MCF7-CXCR4 cell series which contains increasing basal
activity of CXCR4 [423]. As expected, MCF7-CXCR4 wild-type and ΔCTD cells had
demonstrated increase in levels of p-4E-BP1, p-PDCD4 and p-eIF4B over that of the vector control (Fig. 5D).
5.3.7 Activation of the CXCR4-LASP1 Axis Enhances Selective
Expression of Genes Downstream of eIF4A.
To determine the functional consequence of CXCR4 and LASP1 on the eIF4F
complex, we examined eIF4A-dependent oncogenes commonly associated with cancer.
Activation of CXCR4 and the selective expression of cyclin D1 (CCND1), Mdm2,
BIRC5, and Rho kinase 1 (ROCK1) in 231S LASP1 NS and KD cells were tested.
Stimulation of CXCR4 in control-silenced (LASP1 NS) 231S cells resulted considerable
increase in protein levels of CCND1, BIRC5 and Mdm2 and a profound increase in
ROCK1 (Fig. 6A). On the contrary, when LASP1 is silenced, CXCR4 signaling could not
sustain the expression of these proteins downstream of eIF4A1 at comparable control
levels.
We then examined the steady state levels of oncogenic proteins that are dependent
on the activity of eIF4A in the 231S LASP1 KD cells and serum-starved. Evidently, there
was a marked reduction of protein levels of CCND1 (60% reduced); BIRC5 (50%
reduced); Mdm2 (80% reduced) and ROCK1 (80% reduced) compared to LASP1-NS
92 cells (Fig. 6B). There was no significant reduction in the mRNA levels of these genes as
assessed by qPCR to suggest that this difference is occurring at the translational level
(Fig. 6C). Next, we utilized the MCF7 series to further validate the translational findings
of the 231S LASP1 NS/KD cells. As expected, the levels of BIRC5, ROCK1, Mdm2, and
including LASP1 itself were increased when CXCR4 was constitutively active (Fig. 6D).
To investigate the role of LASP1 in modulating the activity of eIF4A, we
employed a synthetic 5’-GQ-UTR luciferase reporter assay from a documented and
validated method [197]. This assay allowed us to evaluate the functional activity of
eIF4A. Corresponding to the activity of eIF4A, the luciferase activity will either increase
or decrease. When LASP1 was stably knocked down, there was a 60% reduction in
reporter luciferase activity (less unwinding of 5’-GQ-UTR) in 231S cells (Figure 6E).
This highlights a crucial role of LASP1 in modulating the activity of eIF4A/4B in the
eIF4F complex in TNBC cells. To test the effects of LASP1 in other cell types, we
generated a KO cell line in 293-HA-CXCR4 cells. In the 293-HA-CXCR4 LASP1 KO cells, there was a 20% decrease in eIF4A activity (Fig. 6E and F). Taken together, data obtained from the 231S and 293-HA-CXCR4 cells suggests that LASP1 does play a role
in modulating the activity of eIF4A. However, the cancer cells are highly reliant on the
functional consequence of this interaction.
93 Figure 5-4 LASP1 directly interacts with both eIF4A and eIF4B. A-C. 1 mg of 231S lysate was incubated with 1.5 nmoles of GST or GST-LASP1. A. Presence of eIF4A was detected by Western blotting (n=3). B. 2 mM ATP and 3mM MgCl2 were exogenously added to the 231S lysate. Presence of eIF4A was then detected by Western blotting (n=3). C. Presence of eIF4B was detected by Western blotting (n=3). D-E. Purified eIF4A or eIF4B was incubated with 1.5 nmoles GST or GST-LASP1. Amounts of purified proteins are indicated in parenthesis. D. Presence of eIF4B was detected by Western blotting (n=3). E. Presence of eIF4A was detected for by Western blotting (n=3). Ponceau S stains of each blot are shown below to confirm loading of GST or GST-LASP1 following the elution from glutathione agarose beads. F. Purified eIF4A and eIF4B were mixed with purified GST or GST-LASP1 in an equimolar ratio and in solution. Proteins complexes were then captured with glutathione beads and detected for by Western blotting (n=1). G. Imperial Protein Stain of purified eIF4A, eIF4B, GST, and GST-LASP1 (n=1).
94
Figure 5-5 Activation of CXCR4 promotes phosphorylation of eIF4B, 4E-BP1, and PDCD4. 231S cells were stimulated with 10-20 nM CXL12 for the indicated period. Phosphorylation status of A. p-eIF4B S422 B. p-PDCD4 S67 C. p- 4E-BP1 Thr70 was determined by Western blotting (n=3). Fold change indicates the densitometry ratio of (phospho-protein/total protein)/β-tubulin signal with 0 min. set to 1. D. Status of p-eIF4B, p-PDCD4 S67, and p-4E- BP1 Thr70 in MCF7 vector, wild-type CXCR4, and CXCR4 ΔCTD cells (n=3). Fold change indicates the densitometry ratio of (phospho- protein/total protein)/β-tubulin signal with MCF7 vector cells set to 1. E. Proposed model of CXCR4 signaling and its effects on the eIF4F complex.
95 5.3.8 Stable Knock Down of LASP1 Sensitizes TNBC Cells to eIF4A1
Inhibition
Inhibition of eIF4A has been investigated for its potential as a chemotherapeutic
target [267,440,448,449]. As such, we examined if the LASP1 deficiency would sensitize
231S TNBC cells to pharmacological inhibition of eIF4A by Rocaglamide A (RocA).
Silvestrol, a flavagline family member of Rocaglamide A, was found to have an IC50
value of 60 nM in MDA-MB-231 cells [199]. We therefore subjected 231S LASP1 NS and KD cells to RocA treatment ranging from 30-100 nM (Fig. 7A). Stable knock down of LASP1 sensitized the 231S cells to RocA treatment especially at the lowest treatment dose of 30 nM (Fig. 7B). Cellular viability also significantly decreased in the LASP1 KD cells with RocA drug treatment (Fig. 7C). We verified if RocA inhibited eIF4A, by blotting for levels of BIRC5 protein in LASP1 NS and KD cells. LASP1 NS cells had a dose-dependent decrease in BIRC5 levels. In the LASP1 KD cells, a 70% loss of BIRC5 occurred with LASP1 knock down alone and further decreased with RocA treatment
(Figure 7D).
96 Figure 5-6 Activation of the CXCR4-LASP1 Axis enhances selective expression of eIF4A-dependent genes. A. 231S LASP1 NS and KD cells were stimulated with 10-20 nM CXL12. Expression levels of eIF4A-dependent genes were then determined by Western blotting (n=3). Fold change indicates the densitometry ratio of protein signal/β-tubulin with 0 min. set to 1. B. Stable knockdown of LASP1 leads to a reduced expression of eIF4A-dependent genes (n=3). Fold change indicates the densitometry ratio of protein signal/β-tubulin with 231S LASP1 NS cells set to 1. C. Knockdown of LASP1 does not significantly affect ROCK1, BIRC5, and CCND1 mRNA levels (n=3). Data was analyzed using the ΔΔCt method with β-tubulin primers as the control. Fold change was calculated with the 231S LASP1 NS cells set to 1. D. Endogenous expression levels of CCND1, BIRC5, and ROCK1 in MCF7 Vector, Wild-type CXCR4, and CXCR4 ΔCTD cells (n=3). Fold change indicates the densitometry ratio of protein signal/β- tubulin with MCF7 vector cells set to 1. E. 231S LASP1 KD cells have a reduced capacity to translate genes harboring a complex 5’UTR as indicated by the GQ 5’UTR luciferase assay (n=3). F. GQ 5’UTR luciferase assay in 293-HA-CXCR4 CRISPR Control and LASP1 KO cells (n=3). Fold change indicates the luminescent ratio of luciferase/renilla (transfection control) with CMV set to 1. G. Western blot analysis of LASP1 protein levels in 293- HA-CXCR4 CRISPR Control and LASP1 KO cells (n=3). * indicates p < .05 as evaluated by unpaired student’s t-tests.
97 Figure 5-7 Stable knockdown of LASP1 sensitizes TNBC cells to inhibition by Rocaglamide A. A. Representative images of 231S LASP1 NS and KD cells incubated with various concentrations of Rocaglamide A at 0 hour and 36- hour time points. B. Percent inhibition of 231S LASP1 NS and KD cells following 36-hour RocA drug treatment (n=3). Percent inhibition was calculated in reference to the fold difference of percent confluence between Rocaglamide A treated cells and the DMSO control for each cell type at 36 hours. C. Percent viability in 231S LASP1 NS and KD cells following Rocaglamide A drug treatment. Data is reflective of absorbance at 450 nm with the DMSO condition set to 100% for each cell type. D. Western blotting of BIRC5 in LASP1 NS/KD cells following 24 hours of Rocaglamide A incubation (n=3). Fold change indicates the densitometry ratio of BIRC5 signal/β-tubulin with the 231S LASP1 NS DMSO condition set to 1. * indicates p < .05 as evaluated by student’s t tests.
98 5.4 Discussion
This is the first report that the CXCR4-LASP1 pathway regulates eIF4A1-
mediated translation of oncogenic proteins with long and structured 5’-UTRs. The
findings in this study are important as a dysregulation in translational control can rewire
the proteome through selective translation of oncogenic mRNAs. The resultant
oncoproteins are critical for breast cancer cell survival, tumor progression, local invasion
and metastasis [450-455]. Protein synthesis is a tightly regulated process. To date, translational initiation has been identified as the rate limiting step. This step of translational regulation is primarily controlled by the eukaryotic initiation 4F complex
(eIF4F). In this study, we suggest that CXCR4 can feed into this complex thereby having a significant impact on synthesis of oncogenic proteins needed for breast cancer survival
and invasion. To date, there is one additional report suggesting that CXCR4 can influence
the protein translational machinery, occurring through an interaction with eIF2B [456].
However, the functional consequence of this interaction was not explored in significant
detail.
In our initial proteomic screen, eIF4A and eIF4B were identified to interact with
LASP1. To confirm this finding, we have provided several pieces of experimental
evidence further characterizing this interaction. In the co-immunoprecipitation where
eIF4B was immunoprecipitated and blotted for LASP1, three distinctive bands were
produced. The one below the LASP1 band (37 kDa) is presumably LASP2 as clone 8C6
anti-LASP1 antibody is known to react with LASP2. However, we hypothesize that the
band above 37 kDa is a doubly-phosphorylated form of LASP1 (pY171 and pS146)
[99,101]. The human LASP1 that is singly phosphorylated is not reported to shift above
99 37 kDa thus far. Future studies will need to elucidate the phosphorylation status of
LASP1 and the functional consequences interacting with eIF4A and eIF4B. Furthermore,
LASP1 associated with eIF4A robustly regardless of the presence or absence of
exogenous ATP and Mg2+ in the GST-pulldown assay. This may mean that the binding site for LASP1 on the surface of eIF4A is always accessible in spite of conformational changes induced by ATP and Mg2+.
Aside from the LASP1 interaction, activation of the CXCR4 pathway led to the formation of the eIF4F complex as evident through several phosphorylation events. First,
4E-BP1 was phosphorylated in a CXCL12-dependent manner similar to the time frame reported in renal cell carcinoma and would release eIF4E [457]. Second, phosphorylation of eIF4B at S422 was similarly observed to increase with CXCL12 stimulation and would affect the rate of translation. Third, an increase in the phosphorylation of PDCD4 following CXCL12 treatment would release eIF4A to incorporate into the eIF4F complex. In all, these three phosphorylation events, in addition to phosphorylation of eIF4E (data not shown), may contribute to active and selective synthesis of oncogenic proteins.
To establish the possibility that LASP1 gets actively recruited into the eIF4F complex upon stimulation with CXCL12, we employed the m7-GTP pulldown assay.
However, the m7-GTP pulldown assay only tells you that components are bound to a
complex that “contains” eIF4F. Based off of our findings of the m7-GTP experiment and direct binding studies, we hypothesize LASP1 gets actively recruited into the eIF4F complex in a CXCL12-dependent manner. This raises the possibility that LASP1 may assist eIF4A and eIF4B in the unwinding of SLS at the 5’-UTR of oncogenic mRNAs.
100 The other key finding of this experiment is the interaction between eIF4G and eIF4E
increased in a CXCL12-dependent manner. eIF4G has two binding sites for eIF4A, one
of which is necessary for translation and the other plays a modulatory role [458]. This
brings out the key role played by CXCR4 in enabling the recruitment of eIF4G and
LASP1 to enable the synthesis of oncogenic proteins involved in tumor progression and
metastasis. It is also interesting to note that LASP1 directly binds to the C-termini of
other chemokine receptors including CXCR1, CXCR2, and CXCR3. LASP1 can
augmented CXCR2-mediated cell migration (Raman et al., 2010). Therefore, it is
possible that additional chemokine receptors could feed into the eIF4F complex via
interactions with LASP1.
If CXCR4 activation led to recruitment of LASP1 and eIF4G into the eIF4F
complex and influenced the activity of eIF4A, it would promote the translation of
oncogenic mRNAs downstream of eIF4A. As expected, many oncogenic mRNAs with
SLS situated at their 5’-UTRs including survivin or BIRC5, cyclin D1, Mdm2 and
ROCK1 were translated in response to CXCL12 stimulation. These proteins have
appreciable roles in breast cancer biology. BIRC5 is involved in cell survival through
inhibition of caspase-mediated apoptosis [459]. Cyclin D1 is a pivotal protein in the cell cycle. Although nuclear cyclin D1 is known for its role in cell proliferation [269], the
cytoplasmic cyclin D1 has a novel, non-canonical role in cell migration [270,271,460].
Cyclin D1 activates CDK4/6 which is a current target in the clinic for chemoresistant
cases of breast cancer [461]. Next, ROCK1 promotes cell polarization, and persistent
directional migration (chemotaxis) [277,278]. Additionally, perturbation of the CXCL12-
CXCR4 axis promotes breast cancer cell migration by regulating tumor cell adhesion
101 events through provision of an optimal level of ROCK activity for effective cell
migration [462,463]. Finally, Mdm2 has been shown to promote invasive ductal breast
carcinoma (IDC) and metastasis and is thought to have additional roles beyond p53 [464].
Taking these proteins into account, CXCR4 could therefore have significant (and
multifaceted) effects on breast cancer cells through modulation of this translational
mechanism.
In summary, we have explored a mechanistic relationship between the CXCR4-
LASP1 axis and the regulation of oncoprotein synthesis through specific components of
the eIF4F complex. As a result of characterizing this novel protein axis, we hope to
provide significant insights in the development of novel small molecule or cell-permeant biopeptide inhibitors. More specifically, inhibiting the interaction between LASP1 and eIF4A may be one approach to sensitize triple-negative breast cancer cells to other inhibitors [432]. It is reported that targeting the eIF4F complex may overcome plasticity
and heterogeneity issues associated residual disease and chemoresistance [439,448,449].
This work may facilitate novel modalities of therapy against TNBC breast cancer
progression and metastasis [394,432,465].
102
Figure 5-8 Proposed Model of the CXCR4-LASP1-eIF4F Axis. A. An illustration of CXCR4 and its relation to the eIF4F complex upon stimulation with CXCL12. This relationship is occurring through two distinctive mechanisms. First, LASP1 dissociates from CXCR4 and directly interacts with eIF4A and eIF4B. Second, phosphorylation of PDCD4, 4E-BP1, and eIF4B is promoted through G protein-coupled receptor signaling. As a result, both complex formation increases along with the function of eIF4A. Consequently, the translation of oncogenic proteins is promoted.
103 Chapter 6
Identification of Cardiac Glycosides as Novel Inhibitors of eIF4A-mediated Translation in Triple-Negative Breast Cancer Cells.
Citation: Howard CM, Estrata M, Tiwari A, and Raman D (2020). Identification of
Cardiac Glycosides as Novel Inhibitors of eIF4A-mediated Translation in Triple-
Negative Breast Cancer Cells. Cancers (Basel). Under Review.
Copyright Notice: Submitted for possible open access publication under the terms and conditions of the Creative Commons Attribution (CC BY) license
(http://creativecommons.org/licenses/by/4.0/).
6.1 Introduction
The eukaryotic initiation factor (eIF) 4F complex regulates the rate-limiting step of translational initiation. This complex consists of the cap binding protein eIF4E, the large scaffolding protein eIF4G, and the DEAD-box RNA helicase eIF4A1. eIF4F assists in the recruitment of the 43S preinitiation complex (PIC) to the messenger RNA [251].
The necessity for the eIF4F complex is largely dependent on the structural diversity of the 5’-leader region [186]. Sequences that contain a high degree of secondary structures or stem-loops require the ATP-dependent helicase activity of eIF4A1 to unwind any folding which allows for the successful recruitment of the PIC to the mRNA.
104 There has been considerable interest in the eIF4F complex and its vital connection
to cancer biology. Several signaling pathways are frequently dysregulated in cancer and
these feed into the mTOR complex which ultimately promote the assembly of the eIF4F
complex through a series of phosphorylation reactions [440]. Moreover, eIF4F cancer
dependency is largely due to several oncogenic mRNAs containing complex secondary
structures in their 5’-leader region. Examples of eIF4F-dependent mRNAs include
baculoviral IAP repeat containing 5 (BIRC5) or survivin, cyclin D3 (CCND3), c-MYC, and BCL-2 [466].
The role of eIF4F complex in primary breast tumor progression and metastasis has been studied. Knockdown of eIF4E reduced the migration and invasion in vitro.
Moreover, the loss of eIF4E reduced the primary tumor growth and the onset of pulmonary metastasis [185]. Importantly, eIF4A1 and eIF4E were found to be independent predictors of poor outcome in ER-negative breast cancer [198]. Recently, we
indicated a role for eIF4A1 in facilitating paclitaxel resistance in triple-negative breast cancer (TNBC) cell lines [290].
As the eIF4F complex immensely supports the cancer proteome to enable primary tumor progression and metastasis, there have been several pursuits to identify inhibitors that disrupt its activity. Some examples include 4E-GI-1 which prevents the protein- protein interaction between eIF4E and eIF4G [361]. In addition, there are several small molecule inhibitors (SMIs) which disrupt the activity of the eIF4A1. This includes pateamine A and hippuristanol [380,385]. Among the SMIs of eIF4A1 to date, the best characterized set of inhibitors are the rocaglates. Rocaglates clamp eIF4A1 onto RNA polypurine sequences in an ATP-independent manner. This prevents the participation of
105 eIF4A1 in the eIF4F complex which disrupts 43S PIC recruitment and the translation of
the oncogenic mRNAs [394,395]. These anti-eIF4A1 inhibitors demonstrated remarkable efficacy in the treatment of TNBC. For example, silvestrol significantly inhibited the growth of MDA-MB-231 orthotopic xenograft tumors [199]. New amidino-rocaglate derivatives have recently been developed with an IC50 value as low as 0.97 nM in MDA-
MB-231 cells [408,467]. One rocaglate derivative, eFT226 (Zotatifin) has just entered a
phase 1 clinical trial in patients with advanced solid tumors (NCT04092673). Despite the
clear and potent anti-cancer activity of eIF4F inhibitors, none are FDA-approved
currently.
Drug repositioning or repurposing is the process by which novel uses are found
for pre-existing drugs. This approach has several distinct advantages over the
conventional drug development pipeline. For example, the biosafety and pharmacokinetic
and pharmacodynamic profiles of any FDA-approved drug are already known which is beneficial in the clinical trial process. One successful example of repositioning compounds as an anti-cancer agent is the use of thalidomide in the treatment of multiple myeloma [468]. Several studies have suggested that commonly used medications such as
β-blockers, ACE inhibitors, or statins may actually reduce breast cancer mortality [469].
In this study, we developed a modified eIF4A1-reporter system to screen the
Prestwick chemical library consisting of mostly FDA-approved drugs. To our knowledge, this is the first attempt to repurpose compounds as potential inhibitors of eIF4A-mediated translation. Such compounds could potentially show potent anti-cancer activity while making a quick clinical impact. In our drug screening, we identified that cardiac glycosides have the ability to inhibit eIF4A1 through a c-MYC-dependent mechanism.
106 6.2 Materials and Methods
6.2.1 Cell Culture
MDA-MB-231 breast cancer cells were previously sorted for high cell surface
expression of CXCR4 (denoted as 231-S) [134]. Human embryonic kidney 293 cells
stably expressing human CXCR4 (denoted 293-HA-CXCR4) are also previously
described [134]. MDA-MD-Bone-un cells are a bone metastatic variant of MDA-MB-231 cells [470]. Finally, 293-Parental, SUM-159PT, BT-20, and BT-549 cells were used in this study. Cells were maintained in high glucose Dulbecco's modified eagle medium
(DMEM) (GE Healthcare Life Sciences, Pittsburgh, PA, Cat. No. SH30243.01), 10% heat-inactivated fetal bovine serum (Denville Scientific, Swedesboro, NJ, Cat. No.
FB5001-H), and 1% Penicillin/Streptomycin solution (Corning, Corning, NY, Cat. No.
30-002-CI).
6.2.2 Plasmids
Construction of the plasmids used in the (CGG)4 luciferase assay were described
previously [471]. To create an eIF4A reporter gene, the (CGG)4 motif was inserted
upstream of the Luciferase-dtTomato fusion protein. pCDH-2A-Luc2-dtTomato was a gift from Dr. Shi-He Liu (University of Toledo). Previously, Luc2-dtTomato was inserted into the backbone of pCDH-EF1α-MCS-T2A-Puro (Systems Biosciences Cat. No.
CD527A-1). The (CGG)4 motif was amplified from the CMV GQ 5’UTR luciferase
plasmid by using the following primers: 5’-
CTAGCTTCTAGACTAGGTTGAAAGTAC-3’ and 5’-
AGCTAGGAATTCTTTACTATTCTAATCCG-3’. The (CGG)4 motif was then
incorporated into the pCDH plasmid using added XbaI (5’end) and EcoRI (3’end)
107 restriction sites. The open reading frame of eIF4A1 was a gift from Dr. Nahum
Sonenberg (Mcgill University). To create an overexpression vector, eIF4A1 was
amplified using the following primers: 5’ – CTAGCTGGATCCACC
ATGTCTGCGAGTCAGGATTC– 3’ and 5’ – CTAGCTGCGGCCGC
TCAAATGAGGTCAGCAAC– 3’. eIF4A1 was inserted into pcDNA3.0 ((Invitrogen,
Carlsbad, CA, Cat. No. V79020) using added BAMHI (5’end) and NotI (3’end) sites.
pcDNA3.0-c-Myc was a gift from Dr. Nagalakshmi Nadiminty (University of Toledo).
6.2.3 Compounds
All compounds were purchased from MedChemExpress (Monmouth Junction,
NJ). This includes rocaglamide A (Cat. HY-19356), silvestrol (Cat. HY-13251), mitoxantrone (HY-13502), paclitaxel (HY-B0015), digoxin (HY-B1049), and bufalin
(HY-N0877).
6.2.4 Luciferase Assays
50 ng of each (CMV, random (CGG)4, or (CGG)4) pGL4.10 luciferase (Promega,
Madison, WI, Cat. No. E6651) was transfected along with 50 ng of pGL4.74 hRluc
(Promega, Madison, WI, Cat. No. E6921) using FuGENE 6 (Promega, Madison, WI, Cat.
No. E2691) in 293 cells using the manufacturer’s instructions. Firefly and renilla
luciferase activity were taken 48 hours later by using the Dual-Luciferase® Reporter
Assay System (Promega, Madison, WI, Cat. No. E1910) and a SpectraMax iD5 plate reader.
6.2.5 Generation of (CGG)4 Reporter Cell Lines
The (CGG)4-Luc2-tdTomato fusion protein was stably inserted into the genome of
MDA-MB-231-S, MDA-MB-Bone-un, SUM-159PT, and 293-HA-CXCR4 by lentiviral
108 transduction. Virus was first packaged into 293-FT cells. T75 flasks were transfected
with 4 μg of psPAX2, 2 μg pMD2.G, and 7 μg of pCDH-2A-(CGG)4-Luc2-dtTomato using Fugene 6 (Promega, Madison, WI, Cat. E2691) according to the manufacturer’s instructions. Lentivirus was collected at the 48- and 72-hour time points. Viral sample
was concentrated using Amicon® Ultra-15 Centrifugal 10 kDa Filter Units (Millipore
Sigma, St. Louis, MO, Cat. UFC901024). Lentivirus was added to cells overnight along with polybrene (8 μg/mL) (Millipore Sigma, St. Louis, MO, Cat. H9268). The next day media was removed, and cells were continually selected in 2 μg/mL of puromycin
(Millipore Sigma, St. Louis, MO, Cat. P8833).
6.2.6 (CGG)4-Luc2-tdTomato and Total Protein Readings
Reporter cells were seeded into black/clear bottom 96-well plates and allowed to attach overnight (Corning, Oneonta, New York, Cat. 3603). Full-serum media and drug was then added the next day. Cells were incubated for 48 hours at 37°C/5% CO2. Each
well was then washed one time with 1X PBS and additional PBS was added for each
reading. Fluorescent measurements were taken on a SpectraMax iD5 plate reader
(Molecular Devices, San Jose, CA). 541excitation/581emission well-scan readings were taken with 9 data points in each well (pattern: fill/density: 3/point spacing: 1.90). For plates with total protein readings, PBS was replaced with 1X PBS/0.1% IGEPAL CA-630
(Millipore Sigma, St. Louis, MO, Cat. 56741) and nutated for 20 minutes. Protein
Bradford reagent (Bio-Rad, Hercules, CA, Cat. 5000006) was added to each well. A595 readings were taken on the SpectraMax iD5 plate reader with standard endpoint settings.
6.2.7 Prestwick Chemical Library Screen
109 The Prestwick Chemical Library was a gift from Dr. Kevin Pan (University of
Toledo). Compounds were tested at a final concentration of 5 μM for 48 hours before
(CGG)4 RFU readings were obtained. The z-score was calculated for each compound.
More specifically, the equation is as follows: [(CGG)4 RFU Compound X- (CGG4) RFU average of each 96 well plate]/ (CGG)4 RFU standard deviation of the 96 well plate.
6.2.8 Western Blotting
Cell lysates were prepared by lysing the cells in the following buffer: 50 mM Tris
pH 8.0, 100 mM NaCl, 0.1% IGEPAL CA-630, 0.1% Deoxycholate, 5 mM EDTA, protease inhibitor cocktail (Sigma-Aldrich, St. Louis, MO, Cat. No. P8340-5ML), phosphatase inhibitor cocktail 2 (Sigma-Aldrich, St. Louis, MO, Cat. No. P5726), and phosphatase inhibitor cocktail 3 (Sigma-Aldrich, St. Louis, MO, Cat. No. P0044).
Lysates were nutated for 10 min at 4°C and centrifuged for 10 min at 10,000 RPM.
Supernatants were quantified using protein bradford reagent and loaded onto an SDS-
PAGE gel. Following transfer onto nitrocellulose, membranes were incubated with the
following primary antibodies: eIF4A1 (Cell Signaling Technology, Danvers, MA, Cat.
2490), eIF4E (Cell Signaling Technology, Danvers, MA, Cat. 2067), eIF4G (Cell
Signaling Technology, Danvers, MA, Cat. 2469), BIRC5 (Cell Signaling Technology,
Danvers, MA, Cat. 2808), CCND3 (Cell Signaling Technology, Danvers, MA, Cat.
2936), c-Myc (Proteintech, Rosemont, IL, Cat. 10828-1-AP), β-actin (Cell Signaling
Technology, Danvers, MA, Cat. 8457), and β-tubulin D66 (Millipore Sigma, St. Louis,
MO, Cat. No. T0198). Following primary antibody incubation, goat anti-Mouse IgG (H +
L) Superclonal™ Secondary Ab conjugated to HRP (Thermo Scientific, Rockford, IL,
Cat No. A28177) or Goat anti-Rabbit IgG (H+L) Superclonal™ Secondary Ab
110 conjugated to HRP (Thermo Scientific, Rockford, IL, Cat No. A27036) was used. Blots
were developed with Amersham™ ECL™ Prime Western Blotting Detection Reagent
(GE Healthcare Life Sciences, Pittsburgh, PA, Cat. No. RPN2232) and a G-Box Chemi
system (Syngene USA, Frederick, MD).
6.2.9 Promoter Binding Analysis
The promoter sequence (-499 to +100) for eIF4A (ENSG00000161960), eIF4E
(ENSG00000151247), and eIF4G (ENSG00000114867) was obtained from the
Eukaryotic Promoter Database ( https://epd.epfl.ch//index.php). Putative transcription factor binding sites were predicted by PROMO (http://alggen.lsi.upc.es/cgi- bin/promo_v3/promo/promoinit.cgi?dirDB=TF_8.3). Transcription factors were predicted within a dissimilarity margin less or equal than 15%. Only human factors and sites were considered for analysis.
6.2.10 iLINCS GSEA
The Integrative Library of Integrated Network-Based Cellular Signatures
(iLINCS) was used to obtain transcriptomic data of digoxin and bufalin treated MCF7 cells (http://www.ilincs.org/ilincs/). More specifically, LINCSCP_33452 (digoxin) and
LINCSCP_33779 (bufalin) signatures were chosen for further analysis. MCF7 cells were treated with 10 μM of each compound for 6 hours. Gene Set Enrichment Analyses were performed by Enrichr. The “TF Perturbations Followed by Expression” gene-set library was selected for each compound.
6.2.11 Rescue Experiments
200 ng/well of pcDNA3-eIF4A1 or pcDNA3-c-Myc was transfected into 293-
HA-CXCR4 (CGG)4 Luc2-tdTomato cells using Fugene 6 according to the
111 manufacturer’s instructions. Following transfection, each indicated amount of bufalin
added to each well. Cells were incubated for 48 hours before taking (CGG)4 RFU and
total protein (A595) readings.
6.2.12 Cell Viability
Cellular Viability was determined by using either Cell Titer-Glo (Promega,
Madison, WI, Cat. No. G7570) or Cell Titer-Blue (Promega, Madison, WI, Cat. No.
G8080) according to the manufacturer’s instructions. 3,000 cells were plated in each well and allowed to attached overnight. The next day, DMEM was replaced with drug- containing media and readings were taken 48 hours later.
6.2.13 Synergy Analysis
The combination index of each drug combination was calculated by using the
Chou-Talalay method of drug synergy and CompuSyn software (www.combosyn.com)
[472]. Data was obtained from CompuSyn and graphed in Prism.
6.2.14 Live-cell Cleaved Caspase 3 Staining
Cleaved caspase 3/7 was stained in live cells by using the IncuCyte caspase 3/7
green reagent for Apoptosis (Essen BioScience, Ann Arbor, MI, Cat. 4440) according to
the manufacturer’s instructions. Images were captured in the IncuCyte system.
6.2.15 Graph Preparation, Determination of IC50 values, and Statistical
Analysis
All graphs, IC50 values, and statistical analysis was performed by using Prism 8
(GraphPad Software, San Diego, CA).
112 6.3 Results
6.3.1 Establishment of the (CGG)4 Luc2-TdTomato Reporter System
The (CGG)4 motif in the 5’leader sequence of mRNAs has been recognized to confer eIF4A dependency [197]. Early studies characterizing the structural characteristics
of the (CGG)4 motif have hypothesized the formation of a G-quadruplex. However, the actual existence of G-quadruplexes within the cell remain controversial. Recent literature has suggested that this motif rather confers eIF4A dependency through the formation of classical secondary structures [201,473]. Irrespective of the precise secondary structure,
we first confirmed eIF4A’s dependency of the (CGG)4 motif using a previously established luciferase assay [197]. 293 cells were transfected with with CMV-luciferase,
CMV-random (CGG)4 luciferase (matched for G/C content), or CMV-(CGG)4 luciferase
in the presence of silvestrol. There was a significant reduction in the relative luciferase
activity for the construct harboring the (CGG)4 motif in the 5’leader sequence (Fig. 1A).
Based off of these findings, we created an eIF4A reporter gene which harbored a (CGG)4
motif immediately upstream of the open reading frame of the luciferase-tdTomato fusion
protein (Fig. 1B). Following stable selection with puromycin in multiple cell lines,
successful incorporation and expression of the fusion protein was confirmed by live-cell
fluorescent microscopy (Fig. 1C). To confirm dependency of the reporter protein on
eIF4A, the concentration-dependent response of two known eIF4A inhibitors,
rocaglamide A and silvestrol, was tested. Rocaglamide A and silvestrol potently reduced
Luc2-tdTomato expression levels in a concentration-dependent manner (Figs. 1D and
1E). To further confirm the specificity of our system, we tested the response following
the addition of two cytostaticss commonly used for triple-negative breast cancer patients,
113 mitoxantrone and paclitaxel. Both compounds only reduced Luc2-tdTomato expression
by 20% in the same dose range (Figs. And 1F). In all, our results suggest that the
establishment of a reporter system which does indeed confer eIF4A dependency.
6.3.2 Prestwick Chemical Library Screen
To reposition a compound which inhibits eIF4A-mediated translation, we
screened the Prestwick chemical library. This library contains mostly FDA-approved
drugs with known bioavailability and toxicity profiles. To further confirm accuracy of
each hit, we also decided to screen the library in all three triple-negative breast cancer
reporter cell lines. Z-scores of each compound were calculated for each (Fig. 2A). When
comparing the results between each cell line, cardiac glycosides significantly inhibited
Luc2-tdTomato expression in our eIF4A reporter system. The individual Z-scores of each
compound are listed (Fig. 2B). Based off of these findings, we further pursued the cardiac
glycosides digoxin and bufalin in our studies. Digoxin is commonly used in the clinic for
heart failure patients. Moreover, bufalin has been shown to inhibit the growth of tumors
in a xenograft model of breast cancer [474]
6.3.3 Cardiac glycosides inhibit eIF4A-mediated translation in triple-
negative breast cancer cells
We further refined the results of our Prestwick screen by investigating the
concentration-dependent reduction of (CGG)4 Luc2-tdTomato expression in the three
triple-negative breast cancer cell lines (Fig 3A.) All three cell lines showed favorable
(CGG)4 RFU IC50 values ranging from 40-90 nM (Fig 3B). Previous studies with digoxin have suggest that this compound can significantly inhibit global protein synthesis as intracellular potassium is required for translational elongation [475]. Based off of the
114 results of this study, we re-examined our findings from the (CGG)4 reporter assay. To address the toxicity concerns associated with digoxin, we repeated the experiment with
231-S cells but also normalized the fluorescent readings to total protein values of each well. Despite total protein normalization, both rocaglamide A and digoxin showed similar
(CGG)4 RFU IC50 values (Fig. 3C). Next, we looked at the relative luciferase activity of
CMV-luciferase in 293 cells as a generic indicator of total protein synthesis.
Concentrations exceeding 50 nM of digoxin did reduce CMV-luciferase levels beyond
20% (Fig. 3D). These results would support the previous reports that digoxin does indeed affect global protein synthesis at high concentrations. However, based off of our (CGG)4
IC50 values, we believe that a therapeutic window does exist to target eIF4A without significant reductions in global protein synthesis. To support this claim, we treated SUM-
159PT cells with 30-50 nM digoxin and observed two eIF4A target genes (ROCK1 and
BIRC5) decrease after 48 hours of drug treatment (Fig 3E). Finally, to investigate a potential mechanism by which cardiac glycosides inhibit eIF4A-mediated translation, we examined the expression levels of all three eIF4F components. Rocaglamide A is known to inhibit eIF4A by inducing non-specific binding to polypurine RNA [394]. We therefore did not expect any reductions in eIF4A levels upon rocaglamide A treatment.
Interestingly, both digoxin and bufalin significantly reduced protein levels of eIF4A.
Expression levels of eIF4G, but not eIF4E, was also reduced by digoxin or bufalin (Fig.
3F).
115
Figure 6-1 Characterization of the (CGG)4 Luc2-tdTomato Reporter System. A. (CGG)4 luciferase assay in 293 cells following treatment with 30 nM silvestrol (n = 3). Relative luciferase activity indicates the luminescent ratio of luciferase/renilla with untreated cells set to 100%. B. Cartoon representation of the (CGG)4 Luc2-tdTomato reporter plasmid. C. Live- cell fluorescent images of MDA-MB-231-S, MDA-MB-Bone-un, SUM- 159PT, and 293-HA-CXCR4 cells after introduction of the (CGG)4 Luc2- tdTomato fusion protein (n=1). D. (CGG)4 Luc2-tdTomato readings in MDA-MD-231-S, MDA-MB-Bone-un, and SUM-159PT cells following treatment with 0-200 nM rocaglamide A (n = 3). E. (CGG)4 Luc2- tdTomato readings in MDA-MD-231-S, MDA-MB-Bone-un, and SUM- 159PT cells following treatment with 0-150 nM silvestrol (n = 3). F. (CGG)4 Luc2-tdTomato readings in MDA-MD-231-S, MDA-MB-Bone- un, and SUM-159PT cells following treatment with 0-150 nM mitoxantrone (n = 3). G. (CGG)4 Luc2-tdTomato readings in MDA-MD- 231-S and MDA-MB-Bone-un cells following treatment with 0-150 nM paclitaxel (n = 3).
116 Figure 6-2 Prestwick Chemical Library Screen. A. Z-scores for each compound from the Prestwick Chemical Library were calculated for their ability to reduce expression levels of (CGG)4 Luc2-tdTomato in MDA-MB-231-S, MDA- MB-Bone-un, and SUM-159PT cells (n=1). B. Individual Z-scores of lanatoside C, digoxin, digoxigenin, and digitoxigenin from each cell line. 6.3.4 Cardiac Glycosides Modulate eIF4A Expression Levels through c-
Myc
We next wanted to further elucidate the mechanism by which cardiac glycosides
were decreasing the protein levels of eIF4A. The Library of Integrated Network-Based
Cellular Signatures (LINCS) is a NIH sponsored program which catalogues proteomic
and transcriptomic perturbation-response signatures across several cancer types.
Integrated LINCS (iLINCS) is biologist friendly extension of this program which allows
for the easy identification and analysis of these signatures. When examining biological
117 processes affected by digoxin or bufalin in MCF7 cells, transcription was largely
impacted (data not shown). Both digoxin or bufalin treated MCF7 gene set enrichment
analyses suggested that c-Myc was largely affected (Table 1 and 2). To confirm this
finding, we treated BT20 treated with only 30 nM of digoxin or bufalin. Western blots
show a time-dependent decrease in the levels of c-Myc (Fig. 4A).
The c-Myc-eIF4F axis has been established to be an important mediator of
tumorigenesis [476,477]. Moreover, the eIF4F complex and c-Myc are in a positive
feedback loop with one another. Expression levels of c-Myc are regulated by the presence of a secondary structure in the 5’leader sequence. Components of the eIF4F complex are then in turn transcribed by c-Myc [282]. Based off of this literature and our own findings, we hypothesized that cardiac glycosides could inhibit eIF4A-mediated translation through modulations in c-Myc. To test this hypothesis, we first looked at the number of
Myc binding sites in the promoters of eIF4A, eIF4E, and eIF4G. All three promoters contained putative Myc binding sites with eIF4A only containing one (Table 3). Next, we confirmed decreases in c-Myc and eIF4A levels in SUM-159PT cells upon treatment with digoxin. CCND3, ROCK1, and BIRC5 levels also decreased in a time-dependent fashion suggesting that eIF4A was indeed affected. Moreover, the levels of eIF4G, but not eIF4E also decreased (Fig. 4B). Next, we tested a c-Myc/Max dimerization inhibitor that has shown anti-cancer activity in breast cancer xenografts [478]. Kj Pyr 9 did show a concentration-dependent reduction in 293-HA-CXCR4 cells, although the (CGG)4 RFU
IC50 value (9.7 μM) was quite high (Fig 4C). This could be attributed to c-Myc’s
“undruggable” nature, a problem that the field has faced for decades [479]. Lastly, to
support the specificity of our proposed hypothesis, we overexpressed eIF4A or c-Myc in
118 293-HA-CXCR4 cells following the treatment with bufalin. Overexpression of either
eIF4A or c-Myc reduced the concentration-dependent reduction of (CGG)4 Luc2-
tdTomato with bufalin treatment (Fig. 4D).
Figure 6-3 Cardiac glycosides inhibit eIF4A-dependent translation in TNBC cells. A. (CGG)4 Luc2-tdTomato readings in MDA-MD-231-S, MDA-MB-Bone-un, and SUM-159PT cells following treatment with 0-187.5 nM digoxin (12.5 nM increments). B. Calculated (CGG)4 IC50 values for each cell line. C. (CGG)4 Luc2-tdTomato/total protein readings (A595) in MDA-MD-231-S cells following treatment with either 0-150 nM digoxin or rocaglamide A. D. CMV-Luciferase/RTK Renilla expression readings in 293 cells following treatment with 0-100 nM digoxin. E. Western blots following treatment with 0-50 nM digoxin for 48 hours in SUM-159PT cells. F. Western blots following treatment with 50 nM of each indicated drug for 72 hours in SUM- 159PT cells.
119
Figure 6-4 Cardiac glycosides modulate eIF4A expression levels through c-Myc. A. Western blot of BT20 cells following treatment with 30 nM of digoxin or bufalin for the indicated times. B. Western blot of SUM-159PT cells following treatment with 50 nM digoxin for the indicated times. C. (CGG)4 Luc2-tdTomato/total protein readings (A595) in 293-HA-CXCR4 cells following treatment with 0-20 μM KJ Pyr 9. D. (CGG)4 Luc2- tdTomato/total protein readings (A595) in 293-HA-CXCR4 cells following the transfection of pcDNA3-eIF4A1 or pcDNA3-c-Myc and 0-75 nM bufalin.
120 Table 6.1 Digoxin Gene Set Enrichment Analysis
Term Overla P- Adjuste Old Old Odds Combi p value d P- Adjuste Ratio ned P-value valu d Score e P-value MYC OE 11/159 4.36E 8.54E-07 0 0 13.836477 298.2241 MCF7 -10 99 HUMAN GSE101738 RNASEQ DOWN SREBF2 KD 12/294 2.70E 2.64E-05 0 0 8.1632653 142.2611 HUMAN -08 06 GSE50588 CREEDSID GENE 2823 UP STAT3 KD 12/309 4.67E 3.05E-05 0 0 7.7669902 131.1075 HUMAN -08 91 GSE42979 CREEDSID GENE 2148 DOWN HEY2 KO 9/205 8.91E 3.49E-04 0 0 8.7804878 122.3245 MOUSE -07 05 GSE6526 CREEDSID GENE 1511 UP HEY2 KO 9/205 8.91E 2.91E-04 0 0 8.7804878 122.3245 MOUSE -07 05 GSE6526 CREEDSID GENE 1512 DOWN STAT3 10/246 4.33E 2.12E-04 0 0 8.1300813 119.1174 DEFICIENC -07 01 Y MOUSE GSE6846 CREEDSID GENE 85 DOWN
121 6.3.5 The Combination of Cardiac Glycosides and Rocaglates are Synergistic in Inhibiting TNBC cells in vitro.
Retrospective studies examining digoxin use in breast cancer patients has showed
no survival advantage. However, the authors note that there is also not an increase in
mortality suggesting that this drug is safe to use in breast cancer patients [480]. Based off
of these findings, digoxin could be a good candidate for a combinatorial therapy in this
population groupp. Due to the observation that digoxin could reduce total levels of
eIF4A, we hypothesized that this drug could be synergistic with a known eIF4A inhibitor
such as rocaglamide A. Cell viability experiments in SUM-159PT cells showed a
synergistic effect with the combination of rocaglamide A and digoxin (Fig. 5A).
Moreover, to confirm that this phenomenon was not cell-type or digoxin specific, we also tested the combination of rocaglamide A and bufalin in BT-549 cells (Fig. 5B). The eIF4F complex regulates the mRNA translation of several anti-apoptotic proteins and rescues cells from caspase-mediated apoptosis [481]. We therefore stained for cleaved caspase 3 in live SUM-159PT cells. The combination of rocaglamide A and digoxin resulted in more caspase 3/7 cleavage over that of rocaglamide A alone (Fig 5C). In all, our results suggest that targeting the c-Myc-eIF4A axis may be a beneficial and synergistic combination for triple-negative breast cancer patients (Fig. 6).
122 Table 6.2 Bufalin Gene Set Enrichment Analysis
Term Overla P- Adjusted Old Old Odds Combined p value P-value P- Adjust Ratio Score valu ed e P- value MYC OE 8/159 1.34 8.74E-04 0 0 10.06289 136.08401 MCF7 E-06 31 92 HUMAN GSE101738 RNASEQ DOWN ZNF143 10/233 2.63 5.15E-04 0 0 8.583690 130.05524 SIRNA E-07 99 3 MCF7 HUMAN GSE76453 RNASEQ DOWN STAT3 10/246 4.33 4.24E-04 0 0 8.130081 119.11737 DEFICIENC E-07 3 12 Y MOUSE GSE6846 CREEDSID GENE 85 DOWN FOXO1 KD 8/195 6.12 0.0017110 0 0 8.205128 98.497708 MOUSE E-06 65 21 09 GSE6623 CREEDSID GENE 505 DOWN SREBF2 KD 10/294 2.18 8.54E-04 0 0 6.802721 88.677733 HUMAN E-06 09 34 GSE50588 CREEDSID GENE 2823 UP PAX5 KD 10/295 2.25 7.34E-04 0 0 6.779661 88.171191 HUMAN E-06 02 7 GSE50588 CREEDSID GENE 2810 DOWN
123 Table 6.3 c-Myc Promoter Binding Analysis
Gene Factor Start End Dissimila String Random Random Name Position Position rity Expectati Expectati on on Equally Query eIF4A c-Myc [T001 40] 204 209 0.000000 CAC 0.14648 0.19526 GTG eIF4E 266 271 0.000000 CAC 0.14648 0.16595 GTG 419 424 0.000000 CAC 0.14648 0.16595 GTG eIF4G 355 360 0.000000 CAC 0.14648 0.18917 GTG 432 437 0.000000 CAC 0.14648 0.18917 GTG
Figure 6-5 Rocaglates in combination with cardiac glycosides are synergistic in inhibiting TNBC cells in vitro. A. Cell viability readings using Cell Titer GLO in SUM-159PT cells following the treatment of rocaglamide A, digoxin, or the combination of both (0-150 nM). B. Cell viability readings using Cell Titer Blue in BT-549 cells following the treatment of rocaglamide A, bufalin, or the combination of both (0-70 nM). C. Cleaved caspase 3 staining in SUM-159PT cells following treatment with rocaglamide A, digoxin, or the combination of both (50 nM) after 24 hours.
124 6.4 Discussion
In this study, we identified several cardiac glycosides such as lanatoside C,
digoxin, digoxigenin, and digitoxigenin to reduce the activity of eIF4A1. We continued
the study with digoxin as its anti-cancer properties are under current clinical investigation
(NCT03928210). We also employed bufalin to indicate that our findings were not
digoxin specific. In our study, we found that digoxin and other cardiac glycosides are
capable of reducing the total protein levels of eIF4A1. This was reflected in the loss of
viability of several TNBC cell lines. Furthermore, the cells die through apoptosis as there
was an induction of cleaved caspase-3 upon digoxin treatment. When digoxin was
combined with RocA, the level of induction of cleaved caspase-3 was further enhanced.
Interestingly, digoxin has also been suggested to affect other biological processes
such as anoikis and cellular signaling. In a screen of over 2,000 off-patent drugs and
natural products, digoxin was identified to induce cell death in anoikis-resistant
suspension cultures of prostate adenocarcinoma cells [482]. Digoxin also appears to
affect prominent oncogenic signaling nodes such as the cytosolic tyrosine kinase Src
[483,484]. Recently, there has been renewed interest in digoxin for its ability to target
senescent tumor cells. Cardiac glycosides were also identified to induce senolytic activity
in cancer cells. The combination of a senogenic (doxorubicin) and senolytic (digoxin)
compounds showed remarkable synergy in inhibiting a patient-derived xenograft model
of breast cancer [485]. Digoxin monotherapy was demonstrated to reduce the lymphatic
dissemination in a xenograft model of breast cancer [486].
Here, we demonstrate that there was an observed decrease in the protein levels of eIF4A1 following digoxin treatment. This could be due to the observed decrease in the
125 levels of the transcription factor c-MYC. MYC is known to transcriptionally regulate the protein level of eIF4A1 [282]. In support of our observations, an innovative high- throughput screen of various compounds identified cardiac glycosides as potent inhibitors of c-MYC expression. This was determined with a CRISPR-Cas9 engineered multiple myeloma cell line which had one allele of c-MYC tagged with GFP [487]. Importantly, cardiac glycosides were shown to inhibit the expression of c-MYC at the transcriptional level. Moreover, the ability of bufalin (a derivative of digoxin) to reduce c-MYC levels was demonstrated in xenograft models of pancreatic cancer [488]. Interestingly, silencing of c-MYC in pancreatic cancer cells promoted the anti-cancer effects of bufalin.
There is a long-standing interest in the role of c-MYC and regulation of translational initiation [489]. For breast epithelium, c-MYC is required in the translational regulation of lactation and alveologenesis [490]. However, cancers are highly dependent on the activity of c-MYC to sustain mRNA translation [491]. More specifically, the eIF4F complex and c-MYC cooperate to promote tumorigenesis. Earlier studies found that c-MYC and eIF4E cooperate and facilitate immortalization of rat primary fibroblasts [492]. In cooperation with eIF4F, which helps to translate a variety of anti-apoptotic proteins, tumorigenesis is greatly accelerated [477]. Targeting of eIF4F in
MYC-driven models of cancer greatly reduces tumor initiation [283]. Preventing the release of eIF4E by reducing phosphorylation levels of 4E-BP1 with mTOR inhibitors has also been another approach [493]. The c-MYC-eIF4E axis has also been extended to cancer immunotherapy. Reductions in p-eIF4E level with a MNK1/2 inhibitor reduced the expression of PD-L1 in a MYC/KRAS model of cancer [238]. Recently, c-MYC has
126 also been shown to control 4E-BP1 levels [494]. This could be one translational control
mechanism to reduce MYC-induced cellular stress.
Based on our data and the findings in the literature, we believe that a therapeutic
window does exist to target eIF4A1 with these compounds. This comes from a growing
evidence that in addition to inhibiting the Na+/K+-ATPase, cardiac glycosides also
significantly impact transcriptional regulation of proteins. Bufalin was shown to directly
bind and promote the proteasome-mediated degradation of the steroid receptor coactivator (SRC) family of transcription factors [474]. Interestingly, SRC-1 was demonstrated to interact with Ets2 to increase c-MYC mRNA levels [495]. We showed that digoxin or bufalin treatment resulted in significant reductions of the expression levels of both eIF4A1 and c-MYC. Consistently, of the three eIF4F components, eIF4A1 was the most sensitive to a reduction by these compounds. This could be due to the fact that eIF4A only contains one c-MYC binding site in its promoter whereas eIF4E and eIF4G contain two.
Despite numerous studies suggesting that digoxin and other cardiac glycosides are beneficial for the treatment of cancer, epidemiological studies have yielded inconsistent results. This could be due to the narrow therapeutic window of these compounds. In other words, efficacious concentrations cannot be obtained in the tumor without considerable toxicity in the patient. Due to the structural similarity to estrogen, several studies have suggested that digoxin may actually increase the risk for estrogen receptor positive breast cancer [496,497]. Based on these findings, we hypothesized that digoxin may be a good candidate at lower doses in combinatorial therapies for TNBC patients. The combination of rocaglamide A and digoxin or bufalin was shown to be synergistic in inhibiting the
127 viability of TNBC cells. Inhibiting expression levels of eIF4A1 would thereby require
decreased doses of rocaglamide A. Disruption of the c-MYC-eIF4F positive feedback loop could explain the synergistic effect. These findings could have future implications for Zotatifin (eFT226), a rocaglate currently in phase 1 clinical trials (NCT04092673).
Figure 6-6 Proposed Combinatorial Targeting of eIF4A in TNBC cells. Inhibition of eIF4A, both directly and through modulation of upstream regulators (c-Myc), may prove synergistic as an anti- cancer therapy for triple- negative breast cancer patients.
128 Chapter 7
Summary and Future Directions
7.1 Summary and Implications of Work
In this dissertation, we identify a novel axis of study in triple-negative breast cancer cells. Despite the extensive literature on CXCR4 and eIF4F, our group was the first to identify a direct connection between the two. We present compelling evidence of an interaction between LASP1 and eIF4A/eIF4B. This association was also shown to occur in a CXCL12-dependent manner. Based on our in vitro functional studies, we hypothesize that the CXCR4-LASP1-eIF4F axis may contribute to the metastatic breast cancer cascade. Next, to identify a potential inhibitor for this axis of study, we developed an eIF4A reporter system which could easily screen small molecules. More specifically, the Prestwick Chemical Library was screened to reposition compounds against eIF4A.
Our pursuits led to the identification of digoxin and other cardiac glycosides.
Mechanistically, inhibition of eIF4A may be occurring through digoxin’s potent ability to repress levels of c-Myc. Interestingly, we observed a synergistic response between digoxin and rocaglamide A in inhibiting the viability of multiple TNBC cell lines. This finding could have future clinical implications as digoxin is routinely taken by breast cancer patients who have heart failure.
129
7.2 Future Directions on the CXCR4-LASP1-eIF4F Axis
7.2.1 Elucidation of the Mechanism by which LASP1 contributes to eIF4F
In our studies, we present compelling evidence that LASP1 contributes to the function of eIF4F in triple-negative breast cancer cells. The precise mechanism of how this is occurring is yet to be determined. We present data that LASP1 can directly bind to both eIF4A and eIF4B. It is therefore possible that LASP1 can directly stimulate the helicase activity of eIF4A. To test this hypothesis, assays that measure the helicase activity of eIF4A can be conducted with or without the presence of purified LASP1.
However, the conformational cycles of eIF4A are controlled by a multitude of factors.
Therefore, experiments that precisely monitor the kinetics of eIF4F-dependent mRNA translation in real time are needed to give a better understanding of LASP1’s role. Our collaborators have spent much time and effort developing such experimental systems
[498]. Alternatively, LASP1 may contribute to eIF4F’s function by facilitating protein- protein interactions. For example, LASP1 may traffic eIF4B and eIF4A to the assembling eIF4F complex. To elucidate such possibilities, the binding site between LASP1, eIF4A, and eIF4B will need to be further defined. Once the binding site has been narrowed down to a 1-5 amino acid stretch on each protein, mutagenesis and functional studies can carried out in cells where LASP1 is genetically ablated. For example, does the expression of a mutant LASP1 affect the interaction between eIF4A and eIF4B?
7.2.2 Identification of the CXCR4- and LASP1-Specific Proteome
130 One of the greatest challenges of our field is to successfully identify the “eIF4F-
specific oncoproteome” in each experimental model. In our studies, we examined eIF4F
target genes based on previous reports in the literature. However, it is quite possible that
both CXCR4 and LASP1 support their own specific proteome with some possible
overlap. Several assays have been developed to monitor nascent protein synthesis [499].
Understanding mRNA-specific translation requires the use of mass spectrometry. In
pulsed stable isotope labeling by amino acid in cell culture (pSILAC), amino acids
containing heavy isotopes are used to identify newly synthesized proteins [500]. In
addition, other techniques have also been developed such as puromycin-associated
nascent chain proteomics (PUNCH-P) or bio-orthogonal non-canonical amino acid
tagging (BONCAT) [501,502]. Such techniques would allow for the identification of
nascent proteins which CXCR4 and LASP1 contribute to. Due to the fact that LASP1
directly binds to eIF4A and eIF4B, this protein may contribute to its own proteome
independent of CXCR4. Therefore, it would be very interesting to send both control and
LASP1-silenced cells stimulated with CXCL12 for analysis in mass spectrometer-based
experiments.
7.2.3 Examination of the LASP1-eIF4F Interaction at the Leading Edge
of Cells
As discussed in the introduction section of the dissertation, LASP1 is often
localized to focal adhesion complexes and lamellipodia of migrating cells. This raises the possibility that LASP1 could recruit the eIF4F complex to the leading edge of migrating cells. Protrusions of the cell membrane are highly dynamic requiring a high rate of
131 protein turnover. Further investigation of the spatiotemporal implications of the LASP1- eIF4A and LASP1-eIF4B interaction will need to be conducted.
7.2.4 Other implications of the LASP1-eIF4A Interaction
There is growing appreciation for the role of eIF4A in cell biology. For example, the ATP-dependent RNA unwinding activity of eIF4A was recently identified to be an important component of the stress granule response [503]. Therefore, the LASP1-eIF4A interaction could have roles independent of its role in mRNA translation. eIF4B has also been reported to have functions independent of eIF4A [435]. The LASP1-eIF4B interaction may also have its own unique implications.
7.2.5 Development of a LASP1 Inhibitor
Currently, no small molecule inhibitors or therapies have been identified to target
LASP1 and it seems to be “undruggable” at this point. Therefore, it is difficult to assess the efficacy of a LASP1-directed therapy in the treatment of metastatic breast cancer.
This is most likely due to the fact that LASP1 lacks any enzymatic activity and pursuits to develop such compounds would be very difficult. However, it is possible to identify compounds that inhibit protein-protein interactions such as those targeting oncogenic transcription factors [504]. Future studies will need to identify compounds that specifically inhibit the LASP1-eIF4A and LASP1-eIF4B interactions. Alternatively,
LASP1 can be inhibited at the transcriptional level. This approach has been taken with other proteins that are considered “undruggable.” Also, dimerization of LASP1 has been proposed and if this holds good, a synthetic dimerization inhibitor would work similar to
132 survivin inhibitors. In all, targeting LASP1 in cancer will be an exciting area of study once an inhibitor has been identified.
7.3 Future Directions on the Identification of Digoxin as a
Novel Inhibitor of eIF4A-mediated Translation
7.3.1 Examination of the Mechanism by which Digoxin Inhibits c-Myc
In our study, we did not address the mechanism by which digoxin inhibits the expression of c-Myc. Other studies have hypothesized that decreases in c-Myc levels by digoxin are dependent on the activity of the Na+/K+ ATPase. However, there is also growing evidence that digoxin can dysregulate the transcriptomic profile of cancer cells.
One group has demonstrated that bufalin can directly bind to and promote the proteasomal-mediated degradation of SRC-3 [474]. In all, our findings support further investigation on the effects of digoxin, bufalin, and other cardiac glycosides independent on the activity of the Na+/K+ ATPase.
7.3.2 Development of Favorable Anti-Cancer Digoxin Derivatives
Pre-clinical investigations have identified the antineoplastic properties of digoxin.
Despite these findings, very few clinical studies have supported the use of digoxin as chemotherapeutic. This is mostly likely due to the narrow therapeutic window of cardiac glycosides and difficulty to achieve effective concentrations within the tumor microenvironment. To address these concerns, digoxin can be combined with other therapies as we demonstrated with rocaglamide A. Alternatively, derivatives of digoxin or bufalin can be developed which may show improved pharmacokinetic and
133 pharmacodynamic properties over that of the parent molecule. Lastly, alternative delivery
systems could also be developed such as the formulation of digoxin or bufalin
nanoparticles. In all, these pursuits may improve the anti-cancer efficacy of cardiac
glycosides.
7.3.3 Investigation of the eIF4A Transcriptional Network
Few studies have explored the regulation of eIF4A at the transcriptomic level.
Rather, many investigators in the field have focused on eIF4A regulation and function at
the protein level. However, we presented data that eIF4A mRNA levels are also
upregulated in breast cancers. Additional studies will need to further investigate the
transcription factors which control expression of eIF4A in cancer. The eIF4A promoter
only contained only 1 binding site for c-Myc suggesting that other transcription factors may be involved. Moreover, targeting the eIF4F complex at the transcriptional level may be one additional approach for an anti-cancer therapy.
7.3.4 Examination of the Rocaglamide A-Digoxin Combination
Combination chemotherapy has been recognized as an auspicious approach in the
next generation of cancer treatment. More specifically, drug regimens which enhance cell
death through multiple mechanisms or those which target specific vulnerabilities of
tumor cells have proved promising [505]. However, drug-drug interactions are a serious
concern when compounds are given concurrently. Anti-cancer agents often have narrow therapeutic windows and considerable toxicities. Therefore, small variations from drug- drug interactions can have significant adverse effects for the patient [506]. For example, one studied estimated that 78% of cancer patients had a risk of potential drug-drug
134 interactions based on medications that they were currently prescribed [507].
Consequently, understanding the pharmacokinetic and pharmacodynamic profile of each
drug combination is of the utmost importance. In our pursuits, we did not explore the
pharmacology of the rocaglamide A-digoxin drug combination. Future studies will need to explore these drug profiles in combination in vivo.
7.3.5 Digoxin: A Potential LASP1-, eIF4A inhibitor, or both?
One interesting observation from our lab is that digoxin is capable of reducing
expression levels of LASP1 in TNBC cells (data not shown). This is hypothesized to be
occurring through digoxin’s ability to reduce HIF-1α [508]. This data supports a
serendipitous finding between our two works which indicate that digoxin can decrease
both LASP1 and eIF4A levels within TNBC cells. Although digoxin may not be able to
be used clinically as a single anti-cancer agent, combinatorial targeting of LASP1 and
eIF4A at the transcriptional level may be another promising approach. Several other
potent HIF-1α inhibitors have already been developed. For example, BAY 87-2243
inhibits the hypoxia induced expression of HIF-1α in non-small cell lung cancer cells
with a calculated IC50 value of ~0.7 nM [509]. This could be combined with rocaglamide
A as a potentially potent TNBC therapy. In all, the combination of a c-Myc inhibitor, eIF4A inhibitor, or HIF-1α inhibitor may prove to be synergistic in inhibiting TNBC metastasis. This in part could be in part explained by a direct connection with LASP1!
135 References
1. Hortobagyi, G.N. Breast Cancer: 45 Years of Research and Progress. J Clin Oncol
2020, 10.1200/JCO.20.00199, JCO2000199, doi:10.1200/JCO.20.00199.
2. National Cancer Institute, S.R.P. SEER*Stat Database: Incidence - SEER 9 Regs
Research Data, Nov 2018 Sub (1975-2016) Adjustment> - Linked To County Attributes - Total U.S., 1969-2017 Counties. released April 2019, based on the November 2018 submission. ed. 3. DeSantis, C.E.; Ma, J.; Gaudet, M.M.; Newman, L.A.; Miller, K.D.; Goding Sauer, A.; Jemal, A.; Siegel, R.L. Breast cancer statistics, 2019. CA Cancer J Clin 2019, 69, 438-451, doi:10.3322/caac.21583. 4. van 't Veer, L.J.; Dai, H.; van de Vijver, M.J.; He, Y.D.; Hart, A.A.; Mao, M.; Peterse, H.L.; van der Kooy, K.; Marton, M.J.; Witteveen, A.T., et al. Gene expression profiling predicts clinical outcome of breast cancer. Nature 2002, 415, 530-536, doi:10.1038/415530a. 5. Sorlie, T.; Perou, C.M.; Tibshirani, R.; Aas, T.; Geisler, S.; Johnsen, H.; Hastie, T.; Eisen, M.B.; van de Rijn, M.; Jeffrey, S.S., et al. Gene expression patterns of 136 breast carcinomas distinguish tumor subclasses with clinical implications. Proc Natl Acad Sci U S A 2001, 98, 10869-10874, doi:10.1073/pnas.191367098. 6. Pusztai, L.; Ayers, M.; Stec, J.; Clark, E.; Hess, K.; Stivers, D.; Damokosh, A.; Sneige, N.; Buchholz, T.A.; Esteva, F.J., et al. Gene expression profiles obtained from fine-needle aspirations of breast cancer reliably identify routine prognostic markers and reveal large-scale molecular differences between estrogen-negative and estrogen-positive tumors. Clin Cancer Res 2003, 9, 2406-2415. 7. Early Breast Cancer Trialists' Collaborative, G. Aromatase inhibitors versus tamoxifen in early breast cancer: patient-level meta-analysis of the randomised trials. Lancet 2015, 386, 1341-1352, doi:10.1016/S0140-6736(15)61074-1. 8. Pegram, M.D.; Lipton, A.; Hayes, D.F.; Weber, B.L.; Baselga, J.M.; Tripathy, D.; Baly, D.; Baughman, S.A.; Twaddell, T.; Glaspy, J.A., et al. Phase II study of receptor-enhanced chemosensitivity using recombinant humanized anti- p185HER2/neu monoclonal antibody plus cisplatin in patients with HER2/neu- overexpressing metastatic breast cancer refractory to chemotherapy treatment. J Clin Oncol 1998, 16, 2659-2671, doi:10.1200/JCO.1998.16.8.2659. 9. Agus, D.B.; Gordon, M.S.; Taylor, C.; Natale, R.B.; Karlan, B.; Mendelson, D.S.; Press, M.F.; Allison, D.E.; Sliwkowski, M.X.; Lieberman, G., et al. Phase I clinical study of pertuzumab, a novel HER dimerization inhibitor, in patients with 137 advanced cancer. J Clin Oncol 2005, 23, 2534-2543, doi:10.1200/JCO.2005.03.184. 10. von Minckwitz, G.; Huang, C.S.; Mano, M.S.; Loibl, S.; Mamounas, E.P.; Untch, M.; Wolmark, N.; Rastogi, P.; Schneeweiss, A.; Redondo, A., et al. Trastuzumab Emtansine for Residual Invasive HER2-Positive Breast Cancer. N Engl J Med 2019, 380, 617-628, doi:10.1056/NEJMoa1814017. 11. Dent, R.; Trudeau, M.; Pritchard, K.I.; Hanna, W.M.; Kahn, H.K.; Sawka, C.A.; Lickley, L.A.; Rawlinson, E.; Sun, P.; Narod, S.A. Triple-negative breast cancer: clinical features and patterns of recurrence. Clin Cancer Res 2007, 13, 4429-4434, doi:10.1158/1078-0432.CCR-06-3045. 12. Liedtke, C.; Mazouni, C.; Hess, K.R.; Andre, F.; Tordai, A.; Mejia, J.A.; Symmans, W.F.; Gonzalez-Angulo, A.M.; Hennessy, B.; Green, M., et al. Response to neoadjuvant therapy and long-term survival in patients with triple- negative breast cancer. J Clin Oncol 2008, 26, 1275-1281, doi:10.1200/JCO.2007.14.4147. 13. Dent, R.; Hanna, W.M.; Trudeau, M.; Rawlinson, E.; Sun, P.; Narod, S.A. Pattern of metastatic spread in triple-negative breast cancer. Breast Cancer Res Treat 2009, 115, 423-428, doi:10.1007/s10549-008-0086-2. 138 14. Di Leo, A.; Desmedt, C.; Bartlett, J.M.; Piette, F.; Ejlertsen, B.; Pritchard, K.I.; Larsimont, D.; Poole, C.; Isola, J.; Earl, H., et al. HER2 and TOP2A as predictive markers for anthracycline-containing chemotherapy regimens as adjuvant treatment of breast cancer: a meta-analysis of individual patient data. Lancet Oncol 2011, 12, 1134-1142, doi:10.1016/S1470-2045(11)70231-5. 15. Ellis, P.; Barrett-Lee, P.; Johnson, L.; Cameron, D.; Wardley, A.; O'Reilly, S.; Verrill, M.; Smith, I.; Yarnold, J.; Coleman, R., et al. Sequential docetaxel as adjuvant chemotherapy for early breast cancer (TACT): an open-label, phase III, randomised controlled trial. Lancet 2009, 373, 1681-1692, doi:10.1016/S0140- 6736(09)60740-6. 16. Foulkes, W.D.; Smith, I.E.; Reis-Filho, J.S. Triple-negative breast cancer. N Engl J Med 2010, 363, 1938-1948, doi:10.1056/NEJMra1001389. 17. Schmid, P.; Adams, S.; Rugo, H.S.; Schneeweiss, A.; Barrios, C.H.; Iwata, H.; Dieras, V.; Hegg, R.; Im, S.A.; Shaw Wright, G., et al. Atezolizumab and Nab- Paclitaxel in Advanced Triple-Negative Breast Cancer. N Engl J Med 2018, 379, 2108-2121, doi:10.1056/NEJMoa1809615. 18. Tan, A.R.; Wright, G.S.; Thummala, A.R.; Danso, M.A.; Popovic, L.; Pluard, T.J.; Han, H.S.; Vojnovic, Z.; Vasev, N.; Ma, L., et al. Trilaciclib plus chemotherapy versus chemotherapy alone in patients with metastatic triple- 139 negative breast cancer: a multicentre, randomised, open-label, phase 2 trial. Lancet Oncol 2019, 20, 1587-1601, doi:10.1016/S1470-2045(19)30616-3. 19. Nahleh, Z.A.; Barlow, W.E.; Hayes, D.F.; Schott, A.F.; Gralow, J.R.; Sikov, W.M.; Perez, E.A.; Chennuru, S.; Mirshahidi, H.R.; Corso, S.W., et al. SWOG S0800 (NCI CDR0000636131): addition of bevacizumab to neoadjuvant nab- paclitaxel with dose-dense doxorubicin and cyclophosphamide improves pathologic complete response (pCR) rates in inflammatory or locally advanced breast cancer. Breast Cancer Res Treat 2016, 158, 485-495, doi:10.1007/s10549- 016-3889-6. 20. Carey, L.A.; Dees, E.C.; Sawyer, L.; Gatti, L.; Moore, D.T.; Collichio, F.; Ollila, D.W.; Sartor, C.I.; Graham, M.L.; Perou, C.M. The triple negative paradox: primary tumor chemosensitivity of breast cancer subtypes. Clin Cancer Res 2007, 13, 2329-2334, doi:10.1158/1078-0432.CCR-06-1109. 21. Malmgren, J.; Hurlbert, M.; Atwood, M.; Kaplan, H.G. Examination of a paradox: recurrent metastatic breast cancer incidence decline without improved distant disease survival: 1990-2011. Breast Cancer Res Treat 2019, 174, 505-514, doi:10.1007/s10549-018-05090-y. 22. Keam, B.; Im, S.A.; Lee, K.H.; Han, S.W.; Oh, D.Y.; Kim, J.H.; Lee, S.H.; Han, W.; Kim, D.W.; Kim, T.Y., et al. Ki-67 can be used for further classification of 140 triple negative breast cancer into two subtypes with different response and prognosis. Breast Cancer Res 2011, 13, R22, doi:10.1186/bcr2834. 23. Lehmann, B.D.; Bauer, J.A.; Chen, X.; Sanders, M.E.; Chakravarthy, A.B.; Shyr, Y.; Pietenpol, J.A. Identification of human triple-negative breast cancer subtypes and preclinical models for selection of targeted therapies. J Clin Invest 2011, 121, 2750-2767, doi:10.1172/JCI45014. 24. Lehmann, B.D.; Jovanovic, B.; Chen, X.; Estrada, M.V.; Johnson, K.N.; Shyr, Y.; Moses, H.L.; Sanders, M.E.; Pietenpol, J.A. Refinement of Triple-Negative Breast Cancer Molecular Subtypes: Implications for Neoadjuvant Chemotherapy Selection. PLoS One 2016, 11, e0157368, doi:10.1371/journal.pone.0157368. 25. Costa, R.L.B.; Han, H.S.; Gradishar, W.J. Targeting the PI3K/AKT/mTOR pathway in triple-negative breast cancer: a review. Breast Cancer Res Treat 2018, 169, 397-406, doi:10.1007/s10549-018-4697-y. 26. Cancer Genome Atlas, N. Comprehensive molecular portraits of human breast tumours. Nature 2012, 490, 61-70, doi:10.1038/nature11412. 27. Baselga, J.; Campone, M.; Piccart, M.; Burris, H.A., 3rd; Rugo, H.S.; Sahmoud, T.; Noguchi, S.; Gnant, M.; Pritchard, K.I.; Lebrun, F., et al. Everolimus in postmenopausal hormone-receptor-positive advanced breast cancer. N Engl J Med 2012, 366, 520-529, doi:10.1056/NEJMoa1109653. 141 28. Andre, F.; Ciruelos, E.; Rubovszky, G.; Campone, M.; Loibl, S.; Rugo, H.S.; Iwata, H.; Conte, P.; Mayer, I.A.; Kaufman, B., et al. Alpelisib for PIK3CA- Mutated, Hormone Receptor-Positive Advanced Breast Cancer. N Engl J Med 2019, 380, 1929-1940, doi:10.1056/NEJMoa1813904. 29. Schmid, P.; Abraham, J.; Chan, S.; Wheatley, D.; Brunt, A.M.; Nemsadze, G.; Baird, R.D.; Park, Y.H.; Hall, P.S.; Perren, T., et al. Capivasertib Plus Paclitaxel Versus Placebo Plus Paclitaxel As First-Line Therapy for Metastatic Triple- Negative Breast Cancer: The PAKT Trial. J Clin Oncol 2020, 38, 423-433, doi:10.1200/JCO.19.00368. 30. Shapiro, G.I.; Bell-McGuinn, K.M.; Molina, J.R.; Bendell, J.; Spicer, J.; Kwak, E.L.; Pandya, S.S.; Millham, R.; Borzillo, G.; Pierce, K.J., et al. First-in-Human Study of PF-05212384 (PKI-587), a Small-Molecule, Intravenous, Dual Inhibitor of PI3K and mTOR in Patients with Advanced Cancer. Clin Cancer Res 2015, 21, 1888-1895, doi:10.1158/1078-0432.CCR-14-1306. 31. Hortobagyi, G.N.; Stemmer, S.M.; Burris, H.A.; Yap, Y.S.; Sonke, G.S.; Paluch- Shimon, S.; Campone, M.; Blackwell, K.L.; Andre, F.; Winer, E.P., et al. Ribociclib as First-Line Therapy for HR-Positive, Advanced Breast Cancer. N Engl J Med 2016, 375, 1738-1748, doi:10.1056/NEJMoa1609709. 32. Roussos, E.T.; Condeelis, J.S.; Patsialou, A. Chemotaxis in cancer. Nat Rev Cancer 2011, 11, 573-587, doi:10.1038/nrc3078. 142 33. Zlotnik, A.; Yoshie, O. Chemokines: a new classification system and their role in immunity. Immunity 2000, 12, 121-127, doi:10.1016/s1074-7613(00)80165-x. 34. Ishida, Y.; Gao, J.L.; Murphy, P.M. Chemokine receptor CX3CR1 mediates skin wound healing by promoting macrophage and fibroblast accumulation and function. J Immunol 2008, 180, 569-579, doi:10.4049/jimmunol.180.1.569. 35. Nanney, L.B.; Mueller, S.G.; Bueno, R.; Peiper, S.C.; Richmond, A. Distributions of melanoma growth stimulatory activity of growth-regulated gene and the interleukin-8 receptor B in human wound repair. Am J Pathol 1995, 147, 1248- 1260. 36. Tsai, H.H.; Frost, E.; To, V.; Robinson, S.; Ffrench-Constant, C.; Geertman, R.; Ransohoff, R.M.; Miller, R.H. The chemokine receptor CXCR2 controls positioning of oligodendrocyte precursors in developing spinal cord by arresting their migration. Cell 2002, 110, 373-383, doi:10.1016/s0092-8674(02)00838-3. 37. Ransohoff, R.M. Chemokines and chemokine receptors: standing at the crossroads of immunobiology and neurobiology. Immunity 2009, 31, 711-721, doi:10.1016/j.immuni.2009.09.010. 38. Raman, D.; Sobolik-Delmaire, T.; Richmond, A. Chemokines in health and disease. Exp Cell Res 2011, 317, 575-589, doi:10.1016/j.yexcr.2011.01.005. 143 39. Balkwill, F. Cancer and the chemokine network. Nat Rev Cancer 2004, 4, 540- 550, doi:10.1038/nrc1388. 40. Dorsam, R.T.; Gutkind, J.S. G-protein-coupled receptors and cancer. Nat Rev Cancer 2007, 7, 79-94, doi:10.1038/nrc2069. 41. Raman, D.; Baugher, P.J.; Thu, Y.M.; Richmond, A. Role of chemokines in tumor growth. Cancer Lett 2007, 256, 137-165, doi:10.1016/j.canlet.2007.05.013. 42. Muller, A.; Homey, B.; Soto, H.; Ge, N.; Catron, D.; Buchanan, M.E.; McClanahan, T.; Murphy, E.; Yuan, W.; Wagner, S.N., et al. Involvement of chemokine receptors in breast cancer metastasis. Nature 2001, 410, 50-56, doi:10.1038/35065016. 43. Liang, Z.; Yoon, Y.; Votaw, J.; Goodman, M.M.; Williams, L.; Shim, H. Silencing of CXCR4 blocks breast cancer metastasis. Cancer Res 2005, 65, 967- 971. 44. Ling, X.; Spaeth, E.; Chen, Y.; Shi, Y.; Zhang, W.; Schober, W.; Hail, N., Jr.; Konopleva, M.; Andreeff, M. The CXCR4 antagonist AMD3465 regulates oncogenic signaling and invasiveness in vitro and prevents breast cancer growth and metastasis in vivo. PLoS One 2013, 8, e58426, doi:10.1371/journal.pone.0058426. 144 45. Kochetkova, M.; Kumar, S.; McColl, S.R. Chemokine receptors CXCR4 and CCR7 promote metastasis by preventing anoikis in cancer cells. Cell Death Differ 2009, 16, 664-673, doi:10.1038/cdd.2008.190. 46. Ueda, Y.; Neel, N.F.; Schutyser, E.; Raman, D.; Richmond, A. Deletion of the COOH-terminal domain of CXC chemokine receptor 4 leads to the down- regulation of cell-to-cell contact, enhanced motility and proliferation in breast carcinoma cells. Cancer Res 2006, 66, 5665-5675, doi:10.1158/0008-5472.CAN- 05-3579. 47. Sobolik, T.; Su, Y.J.; Wells, S.; Ayers, G.D.; Cook, R.S.; Richmond, A. CXCR4 drives the metastatic phenotype in breast cancer through induction of CXCR2 and activation of MEK and PI3K pathways. Mol Biol Cell 2014, 25, 566-582, doi:10.1091/mbc.E13-07-0360. 48. Kato, M.; Kitayama, J.; Kazama, S.; Nagawa, H. Expression pattern of CXC chemokine receptor-4 is correlated with lymph node metastasis in human invasive ductal carcinoma. Breast Cancer Res 2003, 5, R144-150, doi:10.1186/bcr627. 49. Cabioglu, N.; Yazici, M.S.; Arun, B.; Broglio, K.R.; Hortobagyi, G.N.; Price, J.E.; Sahin, A. CCR7 and CXCR4 as novel biomarkers predicting axillary lymph node metastasis in T1 breast cancer. Clin Cancer Res 2005, 11, 5686-5693, doi:10.1158/1078-0432.CCR-05-0014. 145 50. Holm, N.T.; Abreo, F.; Johnson, L.W.; Li, B.D.; Chu, Q.D. Elevated chemokine receptor CXCR4 expression in primary tumors following neoadjuvant chemotherapy predicts poor outcomes for patients with locally advanced breast cancer (LABC). Breast Cancer Res Treat 2009, 113, 293-299, doi:10.1007/s10549-008-9921-8. 51. Schmid, B.C.; Rudas, M.; Rezniczek, G.A.; Leodolter, S.; Zeillinger, R. CXCR4 is expressed in ductal carcinoma in situ of the breast and in atypical ductal hyperplasia. Breast Cancer Res Treat 2004, 84, 247-250, doi:10.1023/B:BREA.0000019962.18922.87. 52. Smith, M.C.; Luker, K.E.; Garbow, J.R.; Prior, J.L.; Jackson, E.; Piwnica-Worms, D.; Luker, G.D. CXCR4 regulates growth of both primary and metastatic breast cancer. Cancer Res 2004, 64, 8604-8612, doi:10.1158/0008-5472.CAN-04-1844. 53. Li, Y.M.; Pan, Y.; Wei, Y.; Cheng, X.; Zhou, B.P.; Tan, M.; Zhou, X.; Xia, W.; Hortobagyi, G.N.; Yu, D., et al. Upregulation of CXCR4 is essential for HER2- mediated tumor metastasis. Cancer Cell 2004, 6, 459-469, doi:10.1016/j.ccr.2004.09.027. 54. Sauve, K.; Lepage, J.; Sanchez, M.; Heveker, N.; Tremblay, A. Positive feedback activation of estrogen receptors by the CXCL12-CXCR4 pathway. Cancer Res 2009, 69, 5793-5800, doi:10.1158/0008-5472.CAN-08-4924. 146 55. Rhodes, L.V.; Short, S.P.; Neel, N.F.; Salvo, V.A.; Zhu, Y.; Elliott, S.; Wei, Y.; Yu, D.; Sun, M.; Muir, S.E., et al. Cytokine receptor CXCR4 mediates estrogen- independent tumorigenesis, metastasis, and resistance to endocrine therapy in human breast cancer. Cancer Res 2011, 71, 603-613, doi:10.1158/0008- 5472.CAN-10-3185. 56. Lee, B.C.; Lee, T.H.; Avraham, S.; Avraham, H.K. Involvement of the chemokine receptor CXCR4 and its ligand stromal cell-derived factor 1alpha in breast cancer cell migration through human brain microvascular endothelial cells. Mol Cancer Res 2004, 2, 327-338. 57. Fernandis, A.Z.; Prasad, A.; Band, H.; Klosel, R.; Ganju, R.K. Regulation of CXCR4-mediated chemotaxis and chemoinvasion of breast cancer cells. Oncogene 2004, 23, 157-167, doi:10.1038/sj.onc.1206910. 58. Holland, J.D.; Kochetkova, M.; Akekawatchai, C.; Dottore, M.; Lopez, A.; McColl, S.R. Differential functional activation of chemokine receptor CXCR4 is mediated by G proteins in breast cancer cells. Cancer Res 2006, 66, 4117-4124, doi:10.1158/0008-5472.CAN-05-1631. 59. Li, H.; Yang, L.; Fu, H.; Yan, J.; Wang, Y.; Guo, H.; Hao, X.; Xu, X.; Jin, T.; Zhang, N. Association between Galphai2 and ELMO1/Dock180 connects chemokine signalling with Rac activation and metastasis. Nat Commun 2013, 4, 1706, doi:10.1038/ncomms2680. 147 60. Kojima, Y.; Acar, A.; Eaton, E.N.; Mellody, K.T.; Scheel, C.; Ben-Porath, I.; Onder, T.T.; Wang, Z.C.; Richardson, A.L.; Weinberg, R.A., et al. Autocrine TGF-beta and stromal cell-derived factor-1 (SDF-1) signaling drives the evolution of tumor-promoting mammary stromal myofibroblasts. Proc Natl Acad Sci U S A 2010, 107, 20009-20014, doi:10.1073/pnas.1013805107. 61. Eck, S.M.; Cote, A.L.; Winkelman, W.D.; Brinckerhoff, C.E. CXCR4 and matrix metalloproteinase-1 are elevated in breast carcinoma-associated fibroblasts and in normal mammary fibroblasts exposed to factors secreted by breast cancer cells. Mol Cancer Res 2009, 7, 1033-1044, doi:10.1158/1541-7786.MCR-09-0015. 62. Hughes, R.; Qian, B.Z.; Rowan, C.; Muthana, M.; Keklikoglou, I.; Olson, O.C.; Tazzyman, S.; Danson, S.; Addison, C.; Clemons, M., et al. Perivascular M2 Macrophages Stimulate Tumor Relapse after Chemotherapy. Cancer Res 2015, 75, 3479-3491, doi:10.1158/0008-5472.CAN-14-3587. 63. Yan, M.; Jene, N.; Byrne, D.; Millar, E.K.; O'Toole, S.A.; McNeil, C.M.; Bates, G.J.; Harris, A.L.; Banham, A.H.; Sutherland, R.L., et al. Recruitment of regulatory T cells is correlated with hypoxia-induced CXCR4 expression, and is associated with poor prognosis in basal-like breast cancers. Breast Cancer Res 2011, 13, R47, doi:10.1186/bcr2869. 64. Chen, I.X.; Chauhan, V.P.; Posada, J.; Ng, M.R.; Wu, M.W.; Adstamongkonkul, P.; Huang, P.; Lindeman, N.; Langer, R.; Jain, R.K. Blocking CXCR4 alleviates 148 desmoplasia, increases T-lymphocyte infiltration, and improves immunotherapy in metastatic breast cancer. Proc Natl Acad Sci U S A 2019, 116, 4558-4566, doi:10.1073/pnas.1815515116. 65. Liang, Z.; Brooks, J.; Willard, M.; Liang, K.; Yoon, Y.; Kang, S.; Shim, H. CXCR4/CXCL12 axis promotes VEGF-mediated tumor angiogenesis through Akt signaling pathway. Biochem Biophys Res Commun 2007, 359, 716-722, doi:10.1016/j.bbrc.2007.05.182. 66. Bachelder, R.E.; Wendt, M.A.; Mercurio, A.M. Vascular endothelial growth factor promotes breast carcinoma invasion in an autocrine manner by regulating the chemokine receptor CXCR4. Cancer Res 2002, 62, 7203-7206. 67. Cronin, P.A.; Wang, J.H.; Redmond, H.P. Hypoxia increases the metastatic ability of breast cancer cells via upregulation of CXCR4. BMC Cancer 2010, 10, 225, doi:10.1186/1471-2407-10-225. 68. Jin, F.; Brockmeier, U.; Otterbach, F.; Metzen, E. New insight into the SDF- 1/CXCR4 axis in a breast carcinoma model: hypoxia-induced endothelial SDF-1 and tumor cell CXCR4 are required for tumor cell intravasation. Mol Cancer Res 2012, 10, 1021-1031, doi:10.1158/1541-7786.MCR-11-0498. 69. Devignes, C.S.; Aslan, Y.; Brenot, A.; Devillers, A.; Schepers, K.; Fabre, S.; Chou, J.; Casbon, A.J.; Werb, Z.; Provot, S. HIF signaling in osteoblast-lineage 149 cells promotes systemic breast cancer growth and metastasis in mice. Proc Natl Acad Sci U S A 2018, 115, E992-E1001, doi:10.1073/pnas.1718009115. 70. Sridharan, S.; Howard, C.M.; Tilley, A.M.C.; Subramaniyan, B.; Tiwari, A.K.; Ruch, R.J.; Raman, D. Novel and Alternative Targets Against Breast Cancer Stemness to Combat Chemoresistance. Front Oncol 2019, 9, 1003, doi:10.3389/fonc.2019.01003. 71. Krohn, A.; Song, Y.H.; Muehlberg, F.; Droll, L.; Beckmann, C.; Alt, E. CXCR4 receptor positive spheroid forming cells are responsible for tumor invasion in vitro. Cancer Lett 2009, 280, 65-71, doi:10.1016/j.canlet.2009.02.005. 72. Yi, T.; Zhai, B.; Yu, Y.; Kiyotsugu, Y.; Raschle, T.; Etzkorn, M.; Seo, H.C.; Nagiec, M.; Luna, R.E.; Reinherz, E.L., et al. Quantitative phosphoproteomic analysis reveals system-wide signaling pathways downstream of SDF-1/CXCR4 in breast cancer stem cells. Proc Natl Acad Sci U S A 2014, 111, E2182-2190, doi:10.1073/pnas.1404943111. 73. Mukherjee, S.; Manna, A.; Bhattacharjee, P.; Mazumdar, M.; Saha, S.; Chakraborty, S.; Guha, D.; Adhikary, A.; Jana, D.; Gorain, M., et al. Non- migratory tumorigenic intrinsic cancer stem cells ensure breast cancer metastasis by generation of CXCR4(+) migrating cancer stem cells. Oncogene 2016, 35, 4937-4948, doi:10.1038/onc.2016.26. 150 74. He, C.; Zhang, H.; Wang, B.; He, J.; Ge, G. SDF-1/CXCR4 axis promotes the growth and sphere formation of hypoxic breast cancer SP cells by c-Jun/ABCG2 pathway. Biochem Biophys Res Commun 2018, 505, 593-599, doi:10.1016/j.bbrc.2018.09.130. 75. Balabanian, K.; Lagane, B.; Infantino, S.; Chow, K.Y.; Harriague, J.; Moepps, B.; Arenzana-Seisdedos, F.; Thelen, M.; Bachelerie, F. The chemokine SDF- 1/CXCL12 binds to and signals through the orphan receptor RDC1 in T lymphocytes. J Biol Chem 2005, 280, 35760-35766, doi:10.1074/jbc.M508234200. 76. Lau, S.; Feitzinger, A.; Venkiteswaran, G.; Wang, J.; Lewellis, S.W.; Koplinski, C.A.; Peterson, F.C.; Volkman, B.F.; Meier-Schellersheim, M.; Knaut, H. A negative-feedback loop maintains optimal chemokine concentrations for directional cell migration. Nat Cell Biol 2020, 22, 266-273, doi:10.1038/s41556- 020-0465-4. 77. Miao, Z.; Luker, K.E.; Summers, B.C.; Berahovich, R.; Bhojani, M.S.; Rehemtulla, A.; Kleer, C.G.; Essner, J.J.; Nasevicius, A.; Luker, G.D., et al. CXCR7 (RDC1) promotes breast and lung tumor growth in vivo and is expressed on tumor-associated vasculature. Proc Natl Acad Sci U S A 2007, 104, 15735- 15740, doi:10.1073/pnas.0610444104. 151 78. Luker, K.E.; Lewin, S.A.; Mihalko, L.A.; Schmidt, B.T.; Winkler, J.S.; Coggins, N.L.; Thomas, D.G.; Luker, G.D. Scavenging of CXCL12 by CXCR7 promotes tumor growth and metastasis of CXCR4-positive breast cancer cells. Oncogene 2012, 31, 4750-4758, doi:10.1038/onc.2011.633. 79. Tomasetto, C.; Moog-Lutz, C.; Regnier, C.H.; Schreiber, V.; Basset, P.; Rio, M.C. Lasp-1 (MLN 50) defines a new LIM protein subfamily characterized by the association of LIM and SH3 domains. FEBS Lett 1995, 373, 245-249, doi:10.1016/0014-5793(95)01040-l. 80. Butt, E.; Raman, D. New Frontiers for the Cytoskeletal Protein LASP1. Front Oncol 2018, 8, 391, doi:10.3389/fonc.2018.00391. 81. Schreiber, V.; Moog-Lutz, C.; Regnier, C.H.; Chenard, M.P.; Boeuf, H.; Vonesch, J.L.; Tomasetto, C.; Rio, M.C. Lasp-1, a novel type of actin-binding protein accumulating in cell membrane extensions. Mol Med 1998, 4, 675-687. 82. Chew, C.S.; Chen, X.; Parente, J.A., Jr.; Tarrer, S.; Okamoto, C.; Qin, H.Y. Lasp- 1 binds to non-muscle F-actin in vitro and is localized within multiple sites of dynamic actin assembly in vivo. J Cell Sci 2002, 115, 4787-4799, doi:10.1242/jcs.00174. 152 83. Nakagawa, H.; Terasaki, A.G.; Suzuki, H.; Ohashi, K.; Miyamoto, S. Short-term retention of actin filament binding proteins on lamellipodial actin bundles. FEBS Lett 2006, 580, 3223-3228, doi:10.1016/j.febslet.2006.04.082. 84. Lin, Y.H.; Park, Z.Y.; Lin, D.; Brahmbhatt, A.A.; Rio, M.C.; Yates, J.R., 3rd; Klemke, R.L. Regulation of cell migration and survival by focal adhesion targeting of Lasp-1. J Cell Biol 2004, 165, 421-432, doi:10.1083/jcb.200311045. 85. Keicher, C.; Gambaryan, S.; Schulze, E.; Marcus, K.; Meyer, H.E.; Butt, E. Phosphorylation of mouse LASP-1 on threonine 156 by cAMP- and cGMP- dependent protein kinase. Biochem Biophys Res Commun 2004, 324, 308-316, doi:10.1016/j.bbrc.2004.08.235. 86. Salvi, A.; Bongarzone, I.; Ferrari, L.; Abeni, E.; Arici, B.; De Bortoli, M.; Scuri, S.; Bonini, D.; Grossi, I.; Benetti, A., et al. Molecular characterization of LASP-1 expression reveals vimentin as its new partner in human hepatocellular carcinoma cells. Int J Oncol 2015, 46, 1901-1912, doi:10.3892/ijo.2015.2923. 87. Li, B.; Zhuang, L.; Trueb, B. Zyxin interacts with the SH3 domains of the cytoskeletal proteins LIM-nebulette and Lasp-1. J Biol Chem 2004, 279, 20401- 20410, doi:10.1074/jbc.M310304200. 88. Spence, H.J.; McGarry, L.; Chew, C.S.; Carragher, N.O.; Scott-Carragher, L.A.; Yuan, Z.; Croft, D.R.; Olson, M.F.; Frame, M.; Ozanne, B.W. AP-1 differentially 153 expressed proteins Krp1 and fibronectin cooperatively enhance Rho-ROCK- independent mesenchymal invasion by altering the function, localization, and activity of nondifferentially expressed proteins. Mol Cell Biol 2006, 26, 1480- 1495, doi:10.1128/MCB.26.4.1480-1495.2006. 89. Li, J.; Lin, J.; Yang, Y.; Chen, S.; Huang, P.; Jiang, R.; Tan, Y.; Huang, Y.; Mo, L.; Qin, A. Talin1 regulates the endometrial epithelial cell adhesive capacity by interacting with LASP1 and Vitronectin. Reprod Biol 2020, 10.1016/j.repbio.2020.02.006, doi:10.1016/j.repbio.2020.02.006. 90. Rachlin, A.S.; Otey, C.A. Identification of palladin isoforms and characterization of an isoform-specific interaction between Lasp-1 and palladin. J Cell Sci 2006, 119, 995-1004, doi:10.1242/jcs.02825. 91. Gray, C.H.; McGarry, L.C.; Spence, H.J.; Riboldi-Tunnicliffe, A.; Ozanne, B.W. Novel beta-propeller of the BTB-Kelch protein Krp1 provides a binding site for Lasp-1 that is necessary for pseudopodial extension. J Biol Chem 2009, 284, 30498-30507, doi:10.1074/jbc.M109.023259. 92. Grunewald, T.G.; Kammerer, U.; Schulze, E.; Schindler, D.; Honig, A.; Zimmer, M.; Butt, E. Silencing of LASP-1 influences zyxin localization, inhibits proliferation and reduces migration in breast cancer cells. Exp Cell Res 2006, 312, 974-982, doi:10.1016/j.yexcr.2005.12.016. 154 93. Stolting, M.; Wiesner, C.; van Vliet, V.; Butt, E.; Pavenstadt, H.; Linder, S.; Kremerskothen, J. Lasp-1 regulates podosome function. PLoS One 2012, 7, e35340, doi:10.1371/journal.pone.0035340. 94. Chew, C.S.; Parente, J.A., Jr.; Chen, X.; Chaponnier, C.; Cameron, R.S. The LIM and SH3 domain-containing protein, lasp-1, may link the cAMP signaling pathway with dynamic membrane restructuring activities in ion transporting epithelia. J Cell Sci 2000, 113 ( Pt 11), 2035-2045. 95. Chew, C.S.; Chen, X.; Bollag, R.J.; Isales, C.; Ding, K.H.; Zhang, H. Targeted disruption of the Lasp-1 gene is linked to increases in histamine-stimulated gastric HCl secretion. Am J Physiol Gastrointest Liver Physiol 2008, 295, G37-G44, doi:10.1152/ajpgi.90247.2008. 96. Vaman, V.S.A.; Poppe, H.; Houben, R.; Grunewald, T.G.; Goebeler, M.; Butt, E. LASP1, a Newly Identified Melanocytic Protein with a Possible Role in Melanin Release, but Not in Melanoma Progression. PLoS One 2015, 10, e0129219, doi:10.1371/journal.pone.0129219. 97. Okamoto, C.T.; Li, R.; Zhang, Z.; Jeng, Y.Y.; Chew, C.S. Regulation of protein and vesicle trafficking at the apical membrane of epithelial cells. J Control Release 2002, 78, 35-41, doi:10.1016/s0168-3659(01)00479-5. 155 98. Chew, C.S.; Parente, J.A., Jr.; Zhou, C.; Baranco, E.; Chen, X. Lasp-1 is a regulated phosphoprotein within the cAMP signaling pathway in the gastric parietal cell. Am J Physiol 1998, 275, C56-67, doi:10.1152/ajpcell.1998.275.1.C56. 99. Butt, E.; Gambaryan, S.; Gottfert, N.; Galler, A.; Marcus, K.; Meyer, H.E. Actin binding of human LIM and SH3 protein is regulated by cGMP- and cAMP- dependent protein kinase phosphorylation on serine 146. J Biol Chem 2003, 278, 15601-15607, doi:10.1074/jbc.M209009200. 100. Mihlan, S.; Reiss, C.; Thalheimer, P.; Herterich, S.; Gaetzner, S.; Kremerskothen, J.; Pavenstadt, H.J.; Lewandrowski, U.; Sickmann, A.; Butt, E. Nuclear import of LASP-1 is regulated by phosphorylation and dynamic protein-protein interactions. Oncogene 2013, 32, 2107-2113, doi:10.1038/onc.2012.216. 101. Traenka, J.; Hauck, C.R.; Lewandrowski, U.; Sickmann, A.; Gambaryan, S.; Thalheimer, P.; Butt, E. Integrin-dependent translocation of LASP-1 to the cytoskeleton of activated platelets correlates with LASP-1 phosphorylation at tyrosine 171 by Src-kinase. Thromb Haemost 2009, 102, 520-528, doi:10.1160/TH09-03-0143. 102. Frietsch, J.J.; Kastner, C.; Grunewald, T.G.; Schweigel, H.; Nollau, P.; Ziermann, J.; Clement, J.H.; La Rosee, P.; Hochhaus, A.; Butt, E. LASP1 is a novel BCR- ABL substrate and a phosphorylation-dependent binding partner of CRKL in 156 chronic myeloid leukemia. Oncotarget 2014, 5, 5257-5271, doi:10.18632/oncotarget.2072. 103. Butt, E.; Stempfle, K.; Lister, L.; Wolf, F.; Kraft, M.; Herrmann, A.B.; Viciano, C.P.; Weber, C.; Hochhaus, A.; Ernst, T., et al. Phosphorylation-Dependent Differences in CXCR4-LASP1-AKT1 Interaction between Breast Cancer and Chronic Myeloid Leukemia. Cells 2020, 9, doi:10.3390/cells9020444. 104. Phillips, G.R.; Anderson, T.R.; Florens, L.; Gudas, C.; Magda, G.; Yates, J.R., 3rd; Colman, D.R. Actin-binding proteins in a postsynaptic preparation: Lasp-1 is a component of central nervous system synapses and dendritic spines. J Neurosci Res 2004, 78, 38-48, doi:10.1002/jnr.20224. 105. Myers, K.R.; Yu, K.; Kremerskothen, J.; Butt, E.; Zheng, J.Q. The Nebulin Family LIM and SH3 Proteins Regulate Postsynaptic Development and Function. J Neurosci 2020, 40, 526-541, doi:10.1523/JNEUROSCI.0334-19.2019. 106. Lin, C.H.; Yang, S.; Huang, Y.J.; Lane, H.Y. Polymorphism in the LASP1 gene promoter region alters cognitive functions of patients with schizophrenia. Sci Rep 2019, 9, 18840, doi:10.1038/s41598-019-55414-1. 107. Hermann-Kleiter, N.; Ghaffari-Tabrizi, N.; Blumer, M.J.; Schwarzer, C.; Mazur, M.A.; Artner, I. Lasp1 misexpression influences chondrocyte differentiation in 157 the vertebral column. Int J Dev Biol 2009, 53, 983-991, doi:10.1387/ijdb.072435nh. 108. Lepa, C.; Moller-Kerutt, A.; Stolting, M.; Picciotto, C.; Eddy, M.L.; Butt, E.; Kerjaschki, D.; Korb-Pap, A.; Vollenbroker, B.; Weide, T., et al. LIM and SH3 protein 1 (LASP-1): A novel link between the slit membrane and actin cytoskeleton dynamics in podocytes. FASEB J 2020, 34, 5453-5464, doi:10.1096/fj.201901443R. 109. Nicholson, L.; Lindsay, L.; Murphy, C.R. Change in distribution of cytoskeleton- associated proteins, lasp-1 and palladin, during uterine receptivity in the rat endometrium. Reprod Fertil Dev 2018, 30, 1482-1490, doi:10.1071/RD17530. 110. Traenka, C.; Remke, M.; Korshunov, A.; Bender, S.; Hielscher, T.; Northcott, P.A.; Witt, H.; Ryzhova, M.; Felsberg, J.; Benner, A., et al. Role of LIM and SH3 protein 1 (LASP1) in the metastatic dissemination of medulloblastoma. Cancer Res 2010, 70, 8003-8014, doi:10.1158/0008-5472.CAN-10-0592. 111. Zhao, L.; Wang, H.; Liu, C.; Liu, Y.; Wang, X.; Wang, S.; Sun, X.; Li, J.; Deng, Y.; Jiang, Y., et al. Promotion of colorectal cancer growth and metastasis by the LIM and SH3 domain protein 1. Gut 2010, 59, 1226-1235, doi:10.1136/gut.2009.202739. 158 112. Ardelt, P.; Grunemay, N.; Strehl, A.; Jilg, C.; Miernik, A.; Kneitz, B.; Butt, E. LASP-1, a novel urinary marker for detection of bladder cancer. Urol Oncol 2013, 31, 1591-1598, doi:10.1016/j.urolonc.2012.02.002. 113. He, B.; Yin, B.; Wang, B.; Chen, C.; Xia, Z.; Tang, J.; Yuan, Y.; Feng, X.; Yin, N. Overexpression of LASP1 is associated with proliferation, migration and invasion in esophageal squamous cell carcinoma. Oncol Rep 2013, 29, 1115- 1123, doi:10.3892/or.2012.2199. 114. Shimizu, F.; Shiiba, M.; Ogawara, K.; Kimura, R.; Minakawa, Y.; Baba, T.; Yokota, S.; Nakashima, D.; Higo, M.; Kasamatsu, A., et al. Overexpression of LIM and SH3 Protein 1 leading to accelerated G2/M phase transition contributes to enhanced tumourigenesis in oral cancer. PLoS One 2013, 8, e83187, doi:10.1371/journal.pone.0083187. 115. Wang, H.; Li, W.; Jin, X.; Cui, S.; Zhao, L. LIM and SH3 protein 1, a promoter of cell proliferation and migration, is a novel independent prognostic indicator in hepatocellular carcinoma. Eur J Cancer 2013, 49, 974-983, doi:10.1016/j.ejca.2012.09.032. 116. Yang, F.; Zhou, X.; Du, S.; Zhao, Y.; Ren, W.; Deng, Q.; Wang, F.; Yuan, J. LIM and SH3 domain protein 1 (LASP-1) overexpression was associated with aggressive phenotype and poor prognosis in clear cell renal cell cancer. PLoS One 2014, 9, e100557, doi:10.1371/journal.pone.0100557. 159 117. Zheng, J.; Yu, S.; Qiao, Y.; Zhang, H.; Liang, S.; Wang, H.; Liu, Y.; Zhou, F.; Jiang, J.; Lu, S. LASP-1 promotes tumor proliferation and metastasis and is an independent unfavorable prognostic factor in gastric cancer. J Cancer Res Clin Oncol 2014, 140, 1891-1899, doi:10.1007/s00432-014-1759-3. 118. Fahrmann, J.F.; Grapov, D.; Phinney, B.S.; Stroble, C.; DeFelice, B.C.; Rom, W.; Gandara, D.R.; Zhang, Y.; Fiehn, O.; Pass, H., et al. Proteomic profiling of lung adenocarcinoma indicates heightened DNA repair, antioxidant mechanisms and identifies LASP1 as a potential negative predictor of survival. Clin Proteomics 2016, 13, 31, doi:10.1186/s12014-016-9132-y. 119. Li, Z.; Chen, Y.; Wang, X.; Zhang, H.; Zhang, Y.; Gao, Y.; Weng, M.; Wang, L.; Liang, H.; Li, M., et al. LASP-1 induces proliferation, metastasis and cell cycle arrest at the G2/M phase in gallbladder cancer by down-regulating S100P via the PI3K/AKT pathway. Cancer Lett 2016, 372, 239-250, doi:10.1016/j.canlet.2016.01.008. 120. Zhang, H.; Li, Z.; Chu, B.; Zhang, F.; Zhang, Y.; Ke, F.; Chen, Y.; Xu, Y.; Liu, S.; Zhao, S., et al. Upregulated LASP-1 correlates with a malignant phenotype and its potential therapeutic role in human cholangiocarcinoma. Tumour Biol 2016, 37, 8305-8315, doi:10.1007/s13277-015-4704-4. 160 121. Gao, W.; Han, J. Silencing of LIM and SH3 Protein 1 (LASP-1) Inhibits Thyroid Cancer Cell Proliferation and Invasion. Oncol Res 2017, 25, 879-886, doi:10.3727/096504016X14785415155643. 122. Sun, W.; Guo, L.; Shao, G.; Liu, X.; Guan, Y.; Su, L.; Zhao, S. Suppression of LASP-1 attenuates the carcinogenesis of prostatic cancer cell lines: Key role of the NF-kappaB pathway. Oncol Rep 2017, 37, 341-347, doi:10.3892/or.2016.5223. 123. Grunewald, T.G.; Kammerer, U.; Kapp, M.; Eck, M.; Dietl, J.; Butt, E.; Honig, A. Nuclear localization and cytosolic overexpression of LASP-1 correlates with tumor size and nodal-positivity of human breast carcinoma. BMC Cancer 2007, 7, 198, doi:10.1186/1471-2407-7-198. 124. Frietsch, J.J.; Grunewald, T.G.; Jasper, S.; Kammerer, U.; Herterich, S.; Kapp, M.; Honig, A.; Butt, E. Nuclear localisation of LASP-1 correlates with poor long- term survival in female breast cancer. Br J Cancer 2010, 102, 1645-1653, doi:10.1038/sj.bjc.6605685. 125. Strehl, S.; Borkhardt, A.; Slany, R.; Fuchs, U.E.; Konig, M.; Haas, O.A. The human LASP1 gene is fused to MLL in an acute myeloid leukemia with t(11;17)(q23;q21). Oncogene 2003, 22, 157-160, doi:10.1038/sj.onc.1206042. 161 126. Dejima, T.; Imada, K.; Takeuchi, A.; Shiota, M.; Leong, J.; Tombe, T.; Tam, K.; Fazli, L.; Naito, S.; Gleave, M.E., et al. Suppression of LIM and SH3 Domain Protein 1 (LASP1) Negatively Regulated by Androgen Receptor Delays Castration Resistant Prostate Cancer Progression. Prostate 2017, 77, 309-320, doi:10.1002/pros.23269. 127. Lin, X.; Liu, X.; Fang, Y.; Weng, X. LIM and SH3 protein 1 promotes tumor proliferation and metastasis in lung carcinoma. Oncol Lett 2016, 12, 4756-4760, doi:10.3892/ol.2016.5225. 128. Sato, M.; Yoneyama, M.S.; Hatakeyama, S.; Funyu, T.; Suzuki, T.; Ohyama, C.; Tsuboi, S. The role of LIM and SH3 protein-1 in bladder cancer metastasis. Oncol Lett 2017, 14, 4829-4834, doi:10.3892/ol.2017.6802. 129. Zhao, H.; Liu, B.; Li, J. LIM and SH3 protein 1 knockdown suppresses proliferation and metastasis of colorectal carcinoma cells via inhibition of the mitogen-activated protein kinase signaling pathway. Oncol Lett 2018, 15, 6839- 6844, doi:10.3892/ol.2018.8222. 130. Wang, H.; Shi, J.; Luo, Y.; Liao, Q.; Niu, Y.; Zhang, F.; Shao, Z.; Ding, Y.; Zhao, L. LIM and SH3 protein 1 induces TGFbeta-mediated epithelial-mesenchymal transition in human colorectal cancer by regulating S100A4 expression. Clin Cancer Res 2014, 20, 5835-5847, doi:10.1158/1078-0432.CCR-14-0485. 162 131. Niu, Y.; Shao, Z.; Wang, H.; Yang, J.; Zhang, F.; Luo, Y.; Xu, L.; Ding, Y.; Zhao, L. LASP1-S100A11 axis promotes colorectal cancer aggressiveness by modulating TGFbeta/Smad signaling. Sci Rep 2016, 6, 26112, doi:10.1038/srep26112. 132. Endres, M.; Kneitz, S.; Orth, M.F.; Perera, R.K.; Zernecke, A.; Butt, E. Regulation of matrix metalloproteinases (MMPs) expression and secretion in MDA-MB-231 breast cancer cells by LIM and SH3 protein 1 (LASP1). Oncotarget 2016, 7, 64244-64259, doi:10.18632/oncotarget.11720. 133. Raman, D.; Sai, J.; Neel, N.F.; Chew, C.S.; Richmond, A. LIM and SH3 protein-1 modulates CXCR2-mediated cell migration. PLoS One 2010, 5, e10050, doi:10.1371/journal.pone.0010050. 134. Duvall-Noelle, N.; Karwandyar, A.; Richmond, A.; Raman, D. LASP-1: a nuclear hub for the UHRF1-DNMT1-G9a-Snail1 complex. Oncogene 2016, 35, 1122- 1133, doi:10.1038/onc.2015.166. 135. Zhang, X.; Liu, Y.; Fan, C.; Wang, L.; Li, A.; Zhou, H.; Cai, L.; Miao, Y.; Li, Q.; Qiu, X., et al. Lasp1 promotes malignant phenotype of non-small-cell lung cancer via inducing phosphorylation of FAK-AKT pathway. Oncotarget 2017, 8, 75102- 75113, doi:10.18632/oncotarget.20527. 163 136. Zhong, C.; Chen, Y.; Tao, B.; Peng, L.; Peng, T.; Yang, X.; Xia, X.; Chen, L. LIM and SH3 protein 1 regulates cell growth and chemosensitivity of human glioblastoma via the PI3K/AKT pathway. BMC Cancer 2018, 18, 722, doi:10.1186/s12885-018-4649-2. 137. Zhong, C.; Li, X.; Tao, B.; Peng, L.; Peng, T.; Yang, X.; Xia, X.; Chen, L. LIM and SH3 protein 1 induces glioma growth and invasion through PI3K/AKT signaling and epithelial-mesenchymal transition. Biomed Pharmacother 2019, 116, 109013, doi:10.1016/j.biopha.2019.109013. 138. Gomez-Suarez, M.; Gutierrez-Martinez, I.Z.; Hernandez-Trejo, J.A.; Hernandez- Ruiz, M.; Suarez-Perez, D.; Candelario, A.; Kamekura, R.; Medina-Contreras, O.; Schnoor, M.; Ortiz-Navarrete, V., et al. 14-3-3 Proteins regulate Akt Thr308 phosphorylation in intestinal epithelial cells. Cell Death Differ 2016, 23, 1060- 1072, doi:10.1038/cdd.2015.163. 139. Shao, Z.; Cai, Y.; Xu, L.; Yao, X.; Shi, J.; Zhang, F.; Luo, Y.; Zheng, K.; Liu, J.; Deng, F., et al. Loss of the 14-3-3sigma is essential for LASP1-mediated colorectal cancer progression via activating PI3K/AKT signaling pathway. Sci Rep 2016, 6, 25631, doi:10.1038/srep25631. 140. Zhou, R.; Shao, Z.; Liu, J.; Zhan, W.; Gao, Q.; Pan, Z.; Wu, L.; Xu, L.; Ding, Y.; Zhao, L. COPS5 and LASP1 synergistically interact to downregulate 14-3-3sigma 164 expression and promote colorectal cancer progression via activating PI3K/AKT pathway. Int J Cancer 2018, 142, 1853-1864, doi:10.1002/ijc.31206. 141. Gao, Q.; Tang, L.; Wu, L.; Li, K.; Wang, H.; Li, W.; Wu, J.; Li, M.; Wang, S.; Zhao, L. LASP1 promotes nasopharyngeal carcinoma progression through negatively regulation of the tumor suppressor PTEN. Cell Death Dis 2018, 9, 393, doi:10.1038/s41419-018-0443-y. 142. Chen, Q.; Wu, K.; Qin, X.; Yu, Y.; Wang, X.; Wei, K. LASP1 promotes proliferation, metastasis, invasion in head and neck squamous cell carcinoma and through direct interaction with HSPA1A. J Cell Mol Med 2020, 24, 1626-1639, doi:10.1111/jcmm.14854. 143. You, H.; Kong, F.; Zhou, K.; Wei, X.; Hu, L.; Hu, W.; Luo, W.; Kou, Y.; Liu, X.; Chen, X., et al. HBX protein promotes LASP-1 expression through activation of c-Jun in human hepatoma cells. J Cell Physiol 2018, 233, 7279-7291, doi:10.1002/jcp.26560. 144. Zhao, T.; Ren, H.; Li, J.; Chen, J.; Zhang, H.; Xin, W.; Sun, Y.; Sun, L.; Yang, Y.; Sun, J., et al. LASP1 is a HIF1alpha target gene critical for metastasis of pancreatic cancer. Cancer Res 2015, 75, 111-119, doi:10.1158/0008-5472.CAN- 14-2040. 165 145. Shi, J.; Guo, J.; Li, X. Role of LASP-1, a novel SOX9 transcriptional target, in the progression of lung cancer. Int J Oncol 2018, 52, 179-188, doi:10.3892/ijo.2017.4201. 146. Li, W.; Li, H.; Zhang, L.; Hu, M.; Li, F.; Deng, J.; An, M.; Wu, S.; Ma, R.; Lu, J., et al. Long non-coding RNA LINC00672 contributes to p53 protein-mediated gene suppression and promotes endometrial cancer chemosensitivity. J Biol Chem 2017, 292, 5801-5813, doi:10.1074/jbc.M116.758508. 147. Yang, L.; Zhang, L.; Lu, L.; Wang, Y. Long Noncoding RNA SNHG16 Sponges miR-182-5p And miR-128-3p To Promote Retinoblastoma Cell Migration And Invasion By Targeting LASP1. Onco Targets Ther 2019, 12, 8653-8662, doi:10.2147/OTT.S212352. 148. Yin, L.; Chen, Y.; Zhou, Y.; Deng, G.; Han, Y.; Guo, C.; Li, Y.; Zeng, S.; Shen, H. Increased long noncoding RNA LASP1-AS is critical for hepatocellular carcinoma tumorigenesis via upregulating LASP1. J Cell Physiol 2019, 234, 13493-13509, doi:10.1002/jcp.28028. 149. Du, Y.Y.; Zhao, L.M.; Chen, L.; Sang, M.X.; Li, J.; Ma, M.; Liu, J.F. The tumor- suppressive function of miR-1 by targeting LASP1 and TAGLN2 in esophageal squamous cell carcinoma. J Gastroenterol Hepatol 2016, 31, 384-393, doi:10.1111/jgh.13180. 166 150. Xu, L.; Zhang, Y.; Wang, H.; Zhang, G.; Ding, Y.; Zhao, L. Tumor suppressor miR-1 restrains epithelial-mesenchymal transition and metastasis of colorectal carcinoma via the MAPK and PI3K/AKT pathway. J Transl Med 2014, 12, 244, doi:10.1186/s12967-014-0244-8. 151. Chiyomaru, T.; Enokida, H.; Kawakami, K.; Tatarano, S.; Uchida, Y.; Kawahara, K.; Nishiyama, K.; Seki, N.; Nakagawa, M. Functional role of LASP1 in cell viability and its regulation by microRNAs in bladder cancer. Urol Oncol 2012, 30, 434-443, doi:10.1016/j.urolonc.2010.05.008. 152. Moazzeni, H.; Najafi, A.; Khani, M. Identification of direct target genes of miR-7, miR-9, miR-96, and miR-182 in the human breast cancer cell lines MCF-7 and MDA-MB-231. Mol Cell Probes 2017, 34, 45-52, doi:10.1016/j.mcp.2017.05.005. 153. Wang, Y.C.; Yang, X.; Wei, W.B.; Xu, X.L. Role of microRNA-21 in uveal melanoma cell invasion and metastasis by regulating p53 and its downstream protein. Int J Ophthalmol 2018, 11, 1258-1268, doi:10.18240/ijo.2018.08.03. 154. Hu, Z.; Cui, Y.; Zhou, Y.; Zhou, K.; Qiao, X.; Li, C.; Wang, S. MicroRNA-29a plays a suppressive role in non-small cell lung cancer cells via targeting LASP1. Onco Targets Ther 2016, 9, 6999-7009, doi:10.2147/OTT.S116509. 167 155. Andrews, M.C.; Cursons, J.; Hurley, D.G.; Anaka, M.; Cebon, J.S.; Behren, A.; Crampin, E.J. Systems analysis identifies miR-29b regulation of invasiveness in melanoma. Mol Cancer 2016, 15, 72, doi:10.1186/s12943-016-0554-y. 156. Li, H.; Liu, G.; Pan, K.; Miao, X.; Xie, Y. Methylation-induced downregulation and tumor suppressive role of microRNA-29b in gastric cancer through targeting LASP1. Oncotarget 2017, 8, 95880-95895, doi:10.18632/oncotarget.21431. 157. Huang, Z.; Pang, G.; Huang, Y.G.; Li, C. miR-133 inhibits proliferation and promotes apoptosis by targeting LASP1 in lupus nephritis. Exp Mol Pathol 2020, 114, 104384, doi:10.1016/j.yexmp.2020.104384. 158. Sui, Y.; Zhang, X.; Yang, H.; Wei, W.; Wang, M. MicroRNA-133a acts as a tumour suppressor in breast cancer through targeting LASP1. Oncol Rep 2018, 39, 473-482, doi:10.3892/or.2017.6114. 159. Wang, H.; An, H.; Wang, B.; Liao, Q.; Li, W.; Jin, X.; Cui, S.; Zhang, Y.; Ding, Y.; Zhao, L. miR-133a represses tumour growth and metastasis in colorectal cancer by targeting LIM and SH3 protein 1 and inhibiting the MAPK pathway. Eur J Cancer 2013, 49, 3924-3935, doi:10.1016/j.ejca.2013.07.149. 160. Li, H.; Xiang, Z.; Liu, Y.; Xu, B.; Tang, J. MicroRNA-133b Inhibits Proliferation, Cellular Migration, and Invasion via Targeting LASP1 in Hepatocarcinoma Cells. Oncol Res 2017, 25, 1269-1282, doi:10.3727/096504017X14850151453092. 168 161. Wan, T.M.; Lam, C.S.; Ng, L.; Chow, A.K.; Wong, S.K.; Li, H.S.; Man, J.H.; Lo, O.S.; Foo, D.; Cheung, A., et al. The clinicopathological significance of miR- 133a in colorectal cancer. Dis Markers 2014, 2014, 919283, doi:10.1155/2014/919283. 162. Liu, H.; Zheng, M.; Zhao, Y.; Zhang, S. miR-143 inhibits migration and invasion through regulating LASP1 in human esophageal cancer. Int J Clin Exp Pathol 2019, 12, 466-476. 163. Wang, W.; Ji, G.; Xiao, X.; Chen, X.; Qin, W.W.; Yang, F.; Li, Y.F.; Fan, L.N.; Xi, W.J.; Huo, Y., et al. Epigenetically regulated miR-145 suppresses colon cancer invasion and metastasis by targeting LASP1. Oncotarget 2016, 7, 68674- 68687, doi:10.18632/oncotarget.11919. 164. Hailer, A.; Grunewald, T.G.; Orth, M.; Reiss, C.; Kneitz, B.; Spahn, M.; Butt, E. Loss of tumor suppressor mir-203 mediates overexpression of LIM and SH3 Protein 1 (LASP1) in high-risk prostate cancer thereby increasing cell proliferation and migration. Oncotarget 2014, 5, 4144-4153, doi:10.18632/oncotarget.1928. 165. Jiang, N.; Jiang, X.; Chen, Z.; Song, X.; Wu, L.; Zong, D.; Song, D.; Yin, L.; Wang, D.; Chen, C., et al. MiR-203a-3p suppresses cell proliferation and metastasis through inhibiting LASP1 in nasopharyngeal carcinoma. J Exp Clin Cancer Res 2017, 36, 138, doi:10.1186/s13046-017-0604-3. 169 166. Takeshita, N.; Mori, M.; Kano, M.; Hoshino, I.; Akutsu, Y.; Hanari, N.; Yoneyama, Y.; Ikeda, N.; Isozaki, Y.; Maruyama, T., et al. miR-203 inhibits the migration and invasion of esophageal squamous cell carcinoma by regulating LASP1. Int J Oncol 2012, 41, 1653-1661, doi:10.3892/ijo.2012.1614. 167. Tan, J.; Jing, Y.Y.; Han, L.; Zheng, H.W.; Shen, J.X.; Zhang, L.H.; Yu, L.S. MicroRNA-203 inhibits invasion and induces apoptosis of laryngeal cancer cells via targeting LASP1. Eur Rev Med Pharmacol Sci 2018, 22, 6350-6357, doi:10.26355/eurrev_201810_16046. 168. Viticchie, G.; Lena, A.M.; Latina, A.; Formosa, A.; Gregersen, L.H.; Lund, A.H.; Bernardini, S.; Mauriello, A.; Miano, R.; Spagnoli, L.G., et al. MiR-203 controls proliferation, migration and invasive potential of prostate cancer cell lines. Cell Cycle 2011, 10, 1121-1131, doi:10.4161/cc.10.7.15180. 169. Wang, C.; Zheng, X.; Shen, C.; Shi, Y. MicroRNA-203 suppresses cell proliferation and migration by targeting BIRC5 and LASP1 in human triple- negative breast cancer cells. J Exp Clin Cancer Res 2012, 31, 58, doi:10.1186/1756-9966-31-58. 170. Zheng, J.; Wang, F.; Lu, S.; Wang, X. LASP-1, regulated by miR-203, promotes tumor proliferation and aggressiveness in human non-small cell lung cancer. Exp Mol Pathol 2016, 100, 116-124, doi:10.1016/j.yexmp.2015.11.031. 170 171. Li, P.D.; Hu, J.L.; Ma, C.; Ma, H.; Yao, J.; Chen, L.L.; Chen, J.; Cheng, T.T.; Yang, K.Y.; Wu, G., et al. Upregulation of the long non-coding RNA PVT1 promotes esophageal squamous cell carcinoma progression by acting as a molecular sponge of miR-203 and LASP1. Oncotarget 2017, 8, 34164-34176, doi:10.18632/oncotarget.15878. 172. Benaich, N.; Woodhouse, S.; Goldie, S.J.; Mishra, A.; Quist, S.R.; Watt, F.M. Rewiring of an epithelial differentiation factor, miR-203, to inhibit human squamous cell carcinoma metastasis. Cell Rep 2014, 9, 104-117, doi:10.1016/j.celrep.2014.08.062. 173. Pan, X.; Wang, Z.; Wan, B.; Zheng, Z. MicroRNA-206 inhibits the viability and migration of medulloblastoma cells by targeting LIM and SH3 protein 1. Exp Ther Med 2017, 14, 3894-3900, doi:10.3892/etm.2017.5016. 174. Wang, L.L.; Wang, L.; Wang, X.Y.; Shang, D.; Yin, S.J.; Sun, L.L.; Ji, H.B. MicroRNA-218 inhibits the proliferation, migration, and invasion and promotes apoptosis of gastric cancer cells by targeting LASP1. Tumour Biol 2016, 37, 15241-15252, doi:10.1007/s13277-016-5388-0. 175. Wang, A.; Dai, H.; Gong, Y.; Zhang, C.; Shu, J.; Luo, Y.; Jiang, Y.; Liu, W.; Bie, P. ANLN-induced EZH2 upregulation promotes pancreatic cancer progression by mediating miR-218-5p/LASP1 signaling axis. J Exp Clin Cancer Res 2019, 38, 347, doi:10.1186/s13046-019-1340-7. 171 176. Nishikawa, R.; Goto, Y.; Sakamoto, S.; Chiyomaru, T.; Enokida, H.; Kojima, S.; Kinoshita, T.; Yamamoto, N.; Nakagawa, M.; Naya, Y., et al. Tumor-suppressive microRNA-218 inhibits cancer cell migration and invasion via targeting of LASP1 in prostate cancer. Cancer Sci 2014, 105, 802-811, doi:10.1111/cas.12441. 177. Liu, W.; Wang, Z.; Wang, C.; Ai, Z. Long non-coding RNA MIAT promotes papillary thyroid cancer progression through upregulating LASP1. Cancer Cell Int 2019, 19, 194, doi:10.1186/s12935-019-0913-z. 178. Hu, S.; Ran, Y.; Chen, W.; Zhang, Y.; Xu, Y. MicroRNA-326 inhibits cell proliferation and invasion, activating apoptosis in hepatocellular carcinoma by directly targeting LIM and SH3 protein 1. Oncol Rep 2017, 38, 1569-1578, doi:10.3892/or.2017.5810. 179. Song, X.; Jin, Y.; Yan, M.; Zhang, Y.; Chen, B. MicroRNA-342-3p functions as a tumor suppressor by targeting LIM and SH3 protein 1 in oral squamous cell carcinoma. Oncol Lett 2019, 17, 688-696, doi:10.3892/ol.2018.9637. 180. Liu, Y.; Gao, Y.; Li, D.; He, L.; Iw, L.; Hao, B.; Chen, X.; Cao, Y. LASP1 promotes glioma cell proliferation and migration and is negatively regulated by miR-377-3p. Biomed Pharmacother 2018, 108, 845-851, doi:10.1016/j.biopha.2018.09.068. 172 181. Lian, Y.; Xiong, F.; Yang, L.; Bo, H.; Gong, Z.; Wang, Y.; Wei, F.; Tang, Y.; Li, X.; Liao, Q., et al. Long noncoding RNA AFAP1-AS1 acts as a competing endogenous RNA of miR-423-5p to facilitate nasopharyngeal carcinoma metastasis through regulating the Rho/Rac pathway. J Exp Clin Cancer Res 2018, 37, 253, doi:10.1186/s13046-018-0918-9. 182. Zhang, Z.; Lin, W.; Gao, L.; Chen, K.; Yang, C.; Zhuang, L.; Peng, S.; Kang, M.; Lin, J. Hsa_circ_0004370 promotes esophageal cancer progression through miR- 1294/LASP1 pathway. Biosci Rep 2019, 39, doi:10.1042/BSR20182377. 183. Merrick, W.C. eIF4F: a retrospective. The Journal of biological chemistry 2015, 290, 24091-24099, doi:10.1074/jbc.R115.675280. 184. Yanagiya, A.; Svitkin, Y.V.; Shibata, S.; Mikami, S.; Imataka, H.; Sonenberg, N. Requirement of RNA binding of mammalian eukaryotic translation initiation factor 4GI (eIF4GI) for efficient interaction of eIF4E with the mRNA cap. Mol Cell Biol 2009, 29, 1661-1669, doi:10.1128/MCB.01187-08. 185. Nasr, Z.; Robert, F.; Porco, J.A., Jr.; Muller, W.J.; Pelletier, J. eIF4F suppression in breast cancer affects maintenance and progression. Oncogene 2013, 32, 861- 871, doi:10.1038/onc.2012.105. 186. Svitkin, Y.V.; Pause, A.; Haghighat, A.; Pyronnet, S.; Witherell, G.; Belsham, G.J.; Sonenberg, N. The requirement for eukaryotic initiation factor 4A (elF4A) 173 in translation is in direct proportion to the degree of mRNA 5' secondary structure. RNA 2001, 7, 382-394, doi:10.1017/s135583820100108x. 187. Avni, D.; Shama, S.; Loreni, F.; Meyuhas, O. Vertebrate mRNAs with a 5'- terminal pyrimidine tract are candidates for translational repression in quiescent cells: characterization of the translational cis-regulatory element. Mol Cell Biol 1994, 14, 3822-3833, doi:10.1128/mcb.14.6.3822. 188. Levy, S.; Avni, D.; Hariharan, N.; Perry, R.P.; Meyuhas, O. Oligopyrimidine tract at the 5' end of mammalian ribosomal protein mRNAs is required for their translational control. Proc Natl Acad Sci U S A 1991, 88, 3319-3323, doi:10.1073/pnas.88.8.3319. 189. Jefferies, H.B.; Reinhard, C.; Kozma, S.C.; Thomas, G. Rapamycin selectively represses translation of the "polypyrimidine tract" mRNA family. Proc Natl Acad Sci U S A 1994, 91, 4441-4445, doi:10.1073/pnas.91.10.4441. 190. Meyuhas, O.; Kahan, T. The race to decipher the top secrets of TOP mRNAs. Biochim Biophys Acta 2015, 1849, 801-811, doi:10.1016/j.bbagrm.2014.08.015. 191. Lahr, R.M.; Fonseca, B.D.; Ciotti, G.E.; Al-Ashtal, H.A.; Jia, J.J.; Niklaus, M.R.; Blagden, S.P.; Alain, T.; Berman, A.J. La-related protein 1 (LARP1) binds the mRNA cap, blocking eIF4F assembly on TOP mRNAs. Elife 2017, 6, doi:10.7554/eLife.24146. 174 192. Hong, S.; Freeberg, M.A.; Han, T.; Kamath, A.; Yao, Y.; Fukuda, T.; Suzuki, T.; Kim, J.K.; Inoki, K. LARP1 functions as a molecular switch for mTORC1- mediated translation of an essential class of mRNAs. Elife 2017, 6, doi:10.7554/eLife.25237. 193. Cassidy, K.C.; Lahr, R.M.; Kaminsky, J.C.; Mack, S.; Fonseca, B.D.; Das, S.R.; Berman, A.J.; Durrant, J.D. Capturing the Mechanism Underlying TOP mRNA Binding to LARP1. Structure 2019, 27, 1771-1781 e1775, doi:10.1016/j.str.2019.10.006. 194. Gellert, M.; Lipsett, M.N.; Davies, D.R. Helix formation by guanylic acid. Proc Natl Acad Sci U S A 1962, 48, 2013-2018, doi:10.1073/pnas.48.12.2013. 195. Song, J.; Perreault, J.P.; Topisirovic, I.; Richard, S. RNA G-quadruplexes and their potential regulatory roles in translation. Translation (Austin) 2016, 4, e1244031, doi:10.1080/21690731.2016.1244031. 196. Kumari, S.; Bugaut, A.; Huppert, J.L.; Balasubramanian, S. An RNA G- quadruplex in the 5' UTR of the NRAS proto-oncogene modulates translation. Nat Chem Biol 2007, 3, 218-221, doi:10.1038/nchembio864. 197. Wolfe, A.L.; Singh, K.; Zhong, Y.; Drewe, P.; Rajasekhar, V.K.; Sanghvi, V.R.; Mavrakis, K.J.; Jiang, M.; Roderick, J.E.; Van der Meulen, J., et al. RNA G- 175 quadruplexes cause eIF4A-dependent oncogene translation in cancer. Nature 2014, 513, 65-70, doi:10.1038/nature13485. 198. Modelska, A.; Turro, E.; Russell, R.; Beaton, J.; Sbarrato, T.; Spriggs, K.; Miller, J.; Graf, S.; Provenzano, E.; Blows, F., et al. The malignant phenotype in breast cancer is driven by eIF4A1-mediated changes in the translational landscape. Cell Death Dis 2015, 6, e1603, doi:10.1038/cddis.2014.542. 199. Cencic, R.; Carrier, M.; Galicia-Vazquez, G.; Bordeleau, M.E.; Sukarieh, R.; Bourdeau, A.; Brem, B.; Teodoro, J.G.; Greger, H.; Tremblay, M.L., et al. Antitumor activity and mechanism of action of the cyclopenta[b]benzofuran, silvestrol. PLoS One 2009, 4, e5223, doi:10.1371/journal.pone.0005223. 200. Shahid, R.; Bugaut, A.; Balasubramanian, S. The BCL-2 5' untranslated region contains an RNA G-quadruplex-forming motif that modulates protein expression. Biochemistry 2010, 49, 8300-8306, doi:10.1021/bi100957h. 201. Waldron, J.A.; Raza, F.; Le Quesne, J. eIF4A alleviates the translational repression mediated by classical secondary structures more than by G- quadruplexes. Nucleic Acids Res. 2018, 46, 3075-3087, doi:10.1093/nar/gky108. 202. Gandin, V.; Masvidal, L.; Hulea, L.; Gravel, S.P.; Cargnello, M.; McLaughlan, S.; Cai, Y.; Balanathan, P.; Morita, M.; Rajakumar, A., et al. nanoCAGE reveals 5' UTR features that define specific modes of translation of functionally related 176 MTOR-sensitive mRNAs. Genome Res. 2016, 26, 636-648, doi:10.1101/gr.197566.115. 203. Rubio, C.A.; Weisburd, B.; Holderfield, M.; Arias, C.; Fang, E.; DeRisi, J.L.; Fanidi, A. Transcriptome-wide characterization of the eIF4A signature highlights plasticity in translation regulation. Genome Biol. 2014, 15, 476, doi:10.1186/s13059-014-0476-1. 204. Dikstein, R. Transcription and translation in a package deal: the TISU paradigm. Gene 2012, 491, 1-4, doi:10.1016/j.gene.2011.09.013. 205. Elfakess, R.; Dikstein, R. A translation initiation element specific to mRNAs with very short 5'UTR that also regulates transcription. PLoS One 2008, 3, e3094, doi:10.1371/journal.pone.0003094. 206. Elfakess, R.; Sinvani, H.; Haimov, O.; Svitkin, Y.; Sonenberg, N.; Dikstein, R. Unique translation initiation of mRNAs-containing TISU element. Nucleic Acids Res. 2011, 39, 7598-7609, doi:10.1093/nar/gkr484. 207. Kerekatte, V.; Smiley, K.; Hu, B.; Smith, A.; Gelder, F.; De Benedetti, A. The proto-oncogene/translation factor eIF4E: a survey of its expression in breast carcinomas. Int J Cancer 1995, 64, 27-31, doi:10.1002/ijc.2910640107. 177 208. Li, B.D.; Liu, L.; Dawson, M.; De Benedetti, A. Overexpression of eukaryotic initiation factor 4E (eIF4E) in breast carcinoma. Cancer 1997, 79, 2385-2390. 209. Zhou, S.; Wang, G.P.; Liu, C.; Zhou, M. Eukaryotic initiation factor 4E (eIF4E) and angiogenesis: prognostic markers for breast cancer. BMC Cancer 2006, 6, 231, doi:10.1186/1471-2407-6-231. 210. Heikkinen, T.; Korpela, T.; Fagerholm, R.; Khan, S.; Aittomaki, K.; Heikkila, P.; Blomqvist, C.; Carpen, O.; Nevanlinna, H. Eukaryotic translation initiation factor 4E (eIF4E) expression is associated with breast cancer tumor phenotype and predicts survival after anthracycline chemotherapy treatment. Breast Cancer Res Treat 2013, 141, 79-88, doi:10.1007/s10549-013-2671-2. 211. Pettersson, F.; Yau, C.; Dobocan, M.C.; Culjkovic-Kraljacic, B.; Retrouvey, H.; Puckett, R.; Flores, L.M.; Krop, I.E.; Rousseau, C.; Cocolakis, E., et al. Ribavirin treatment effects on breast cancers overexpressing eIF4E, a biomarker with prognostic specificity for luminal B-type breast cancer. Clin Cancer Res 2011, 17, 2874-2884, doi:10.1158/1078-0432.CCR-10-2334. 212. Humphries, M.P.; Sundara Rajan, S.; Droop, A.; Suleman, C.A.B.; Carbone, C.; Nilsson, C.; Honarpisheh, H.; Cserni, G.; Dent, J.; Fulford, L., et al. A Case- Matched Gender Comparison Transcriptomic Screen Identifies eIF4E and eIF5 as Potential Prognostic Markers in Male Breast Cancer. Clin Cancer Res 2017, 23, 2575-2583, doi:10.1158/1078-0432.CCR-16-1952. 178 213. Crew, J.P.; Fuggle, S.; Bicknell, R.; Cranston, D.W.; de Benedetti, A.; Harris, A.L. Eukaryotic initiation factor-4E in superficial and muscle invasive bladder cancer and its correlation with vascular endothelial growth factor expression and tumour progression. Br J Cancer 2000, 82, 161-166, doi:10.1054/bjoc.1999.0894. 214. Huang, C.I.; Wang, C.C.; Tai, T.S.; Hwang, T.Z.; Yang, C.C.; Hsu, C.M.; Su, Y.C. eIF4E and 4EBP1 are prognostic markers of head and neck squamous cell carcinoma recurrence after definitive surgery and adjuvant radiotherapy. PLoS One 2019, 14, e0225537, doi:10.1371/journal.pone.0225537. 215. Nathan, C.O.; Liu, L.; Li, B.D.; Abreo, F.W.; Nandy, I.; De Benedetti, A. Detection of the proto-oncogene eIF4E in surgical margins may predict recurrence in head and neck cancer. Oncogene 1997, 15, 579-584, doi:10.1038/sj.onc.1201216. 216. Nathan, C.O.; Sanders, K.; Abreo, F.W.; Nassar, R.; Glass, J. Correlation of p53 and the proto-oncogene eIF4E in larynx cancers: prognostic implications. Cancer Res 2000, 60, 3599-3604. 217. Rojo, F.; Najera, L.; Lirola, J.; Jimenez, J.; Guzman, M.; Sabadell, M.D.; Baselga, J.; Ramon y Cajal, S. 4E-binding protein 1, a cell signaling hallmark in breast cancer that correlates with pathologic grade and prognosis. Clin Cancer Res 2007, 13, 81-89, doi:10.1158/1078-0432.CCR-06-1560. 179 218. Meric-Bernstam, F.; Chen, H.; Akcakanat, A.; Do, K.A.; Lluch, A.; Hennessy, B.T.; Hortobagyi, G.N.; Mills, G.B.; Gonzalez-Angulo, A. Aberrations in translational regulation are associated with poor prognosis in hormone receptor- positive breast cancer. Breast Cancer Res 2012, 14, R138, doi:10.1186/bcr3343. 219. Wang, Z.; Feng, X.; Molinolo, A.A.; Martin, D.; Vitale-Cross, L.; Nohata, N.; Ando, M.; Wahba, A.; Amornphimoltham, P.; Wu, X., et al. 4E-BP1 Is a Tumor Suppressor Protein Reactivated by mTOR Inhibition in Head and Neck Cancer. Cancer Res 2019, 79, 1438-1450, doi:10.1158/0008-5472.CAN-18-1220. 220. Coleman, L.J.; Peter, M.B.; Teall, T.J.; Brannan, R.A.; Hanby, A.M.; Honarpisheh, H.; Shaaban, A.M.; Smith, L.; Speirs, V.; Verghese, E.T., et al. Combined analysis of eIF4E and 4E-binding protein expression predicts breast cancer survival and estimates eIF4E activity. Br J Cancer 2009, 100, 1393-1399, doi:10.1038/sj.bjc.6605044. 221. Alain, T.; Morita, M.; Fonseca, B.D.; Yanagiya, A.; Siddiqui, N.; Bhat, M.; Zammit, D.; Marcus, V.; Metrakos, P.; Voyer, L.A., et al. eIF4E/4E-BP ratio predicts the efficacy of mTOR targeted therapies. Cancer Res 2012, 72, 6468- 6476, doi:10.1158/0008-5472.CAN-12-2395. 222. Avdulov, S.; Herrera, J.; Smith, K.; Peterson, M.; Gomez-Garcia, J.R.; Beadnell, T.C.; Schwertfeger, K.L.; Benyumov, A.O.; Manivel, J.C.; Li, S., et al. eIF4E threshold levels differ in governing normal and neoplastic expansion of mammary 180 stem and luminal progenitor cells. Cancer Res 2015, 75, 687-697, doi:10.1158/0008-5472.CAN-14-2571. 223. Truitt, M.L.; Conn, C.S.; Shi, Z.; Pang, X.; Tokuyasu, T.; Coady, A.M.; Seo, Y.; Barna, M.; Ruggero, D. Differential Requirements for eIF4E Dose in Normal Development and Cancer. Cell 2015, 162, 59-71, doi:10.1016/j.cell.2015.05.049. 224. Li, S.; Jia, Y.; Jacobson, B.; McCauley, J.; Kratzke, R.; Bitterman, P.B.; Wagner, C.R. Treatment of breast and lung cancer cells with a N-7 benzyl guanosine monophosphate tryptamine phosphoramidate pronucleotide (4Ei-1) results in chemosensitization to gemcitabine and induced eIF4E proteasomal degradation. Mol Pharm 2013, 10, 523-531, doi:10.1021/mp300699d. 225. Smith, K.A.; Zhou, B.; Avdulov, S.; Benyumov, A.; Peterson, M.; Liu, Y.; Okon, A.; Hergert, P.; Braziunas, J.; Wagner, C.R., et al. Transforming Growth Factor- beta1 Induced Epithelial Mesenchymal Transition is blocked by a chemical antagonist of translation factor eIF4E. Sci Rep 2015, 5, 18233, doi:10.1038/srep18233. 226. Yi, T.; Papadopoulos, E.; Hagner, P.R.; Wagner, G. Hypoxia-inducible factor- 1alpha (HIF-1alpha) promotes cap-dependent translation of selective mRNAs through up-regulating initiation factor eIF4E1 in breast cancer cells under hypoxia conditions. J Biol Chem 2013, 288, 18732-18742, doi:10.1074/jbc.M113.471466. 181 227. Satheesha, S.; Cookson, V.J.; Coleman, L.J.; Ingram, N.; Madhok, B.; Hanby, A.M.; Suleman, C.A.; Sabine, V.S.; Macaskill, E.J.; Bartlett, J.M., et al. Response to mTOR inhibition: activity of eIF4E predicts sensitivity in cell lines and acquired changes in eIF4E regulation in breast cancer. Mol Cancer 2011, 10, 19, doi:10.1186/1476-4598-10-19. 228. Ilic, N.; Utermark, T.; Widlund, H.R.; Roberts, T.M. PI3K-targeted therapy can be evaded by gene amplification along the MYC-eukaryotic translation initiation factor 4E (eIF4E) axis. Proc Natl Acad Sci U S A 2011, 108, E699-708, doi:10.1073/pnas.1108237108. 229. Geter, P.A.; Ernlund, A.W.; Bakogianni, S.; Alard, A.; Arju, R.; Giashuddin, S.; Gadi, A.; Bromberg, J.; Schneider, R.J. Hyperactive mTOR and MNK1 phosphorylation of eIF4E confer tamoxifen resistance and estrogen independence through selective mRNA translation reprogramming. Genes Dev 2017, 31, 2235- 2249, doi:10.1101/gad.305631.117. 230. Li, Z.; Sun, Y.; Qu, M.; Wan, H.; Cai, F.; Zhang, P. Inhibiting the MNK-eIF4E- beta-catenin axis increases the responsiveness of aggressive breast cancer cells to chemotherapy. Oncotarget 2017, 8, 2906-2915, doi:10.18632/oncotarget.13772. 231. Zhou, F.F.; Yan, M.; Guo, G.F.; Wang, F.; Qiu, H.J.; Zheng, F.M.; Zhang, Y.; Liu, Q.; Zhu, X.F.; Xia, L.P. Knockdown of eIF4E suppresses cell growth and migration, enhances chemosensitivity and correlates with increase in Bax/Bcl-2 182 ratio in triple-negative breast cancer cells. Med Oncol 2011, 28, 1302-1307, doi:10.1007/s12032-010-9630-0. 232. Dong, K.; Wang, R.; Wang, X.; Lin, F.; Shen, J.J.; Gao, P.; Zhang, H.Z. Tumor- specific RNAi targeting eIF4E suppresses tumor growth, induces apoptosis and enhances cisplatin cytotoxicity in human breast carcinoma cells. Breast Cancer Res. Treat. 2009, 113, 443-456, doi:10.1007/s10549-008-9956-x. 233. Yoshizawa, A.; Fukuoka, J.; Shimizu, S.; Shilo, K.; Franks, T.J.; Hewitt, S.M.; Fujii, T.; Cordon-Cardo, C.; Jen, J.; Travis, W.D. Overexpression of phospho- eIF4E is associated with survival through AKT pathway in non-small cell lung cancer. Clin Cancer Res 2010, 16, 240-248, doi:10.1158/1078-0432.CCR-09- 0986. 234. Adesso, L.; Calabretta, S.; Barbagallo, F.; Capurso, G.; Pilozzi, E.; Geremia, R.; Delle Fave, G.; Sette, C. Gemcitabine triggers a pro-survival response in pancreatic cancer cells through activation of the MNK2/eIF4E pathway. Oncogene 2013, 32, 2848-2857, doi:10.1038/onc.2012.306. 235. Lu, J.; Zang, H.; Zheng, H.; Zhan, Y.; Yang, Y.; Zhang, Y.; Liu, S.; Feng, J.; Wen, Q.; Long, M., et al. Overexpression of p-Akt, p-mTOR and p-eIF4E proteins associates with metastasis and unfavorable prognosis in non-small cell lung cancer. PLoS One 2020, 15, e0227768, doi:10.1371/journal.pone.0227768. 183 236. Zheng, J.; Li, J.; Xu, L.; Xie, G.; Wen, Q.; Luo, J.; Li, D.; Huang, D.; Fan, S. Phosphorylated Mnk1 and eIF4E are associated with lymph node metastasis and poor prognosis of nasopharyngeal carcinoma. PLoS One 2014, 9, e89220, doi:10.1371/journal.pone.0089220. 237. Robichaud, N.; Hsu, B.E.; Istomine, R.; Alvarez, F.; Blagih, J.; Ma, E.H.; Morales, S.V.; Dai, D.L.; Li, G.; Souleimanova, M., et al. Translational control in the tumor microenvironment promotes lung metastasis: Phosphorylation of eIF4E in neutrophils. Proc. Natl. Acad. Sci. U. S. A. 2018, 115, E2202-E2209, doi:10.1073/pnas.1717439115. 238. Xu, Y.; Poggio, M.; Jin, H.Y.; Shi, Z.; Forester, C.M.; Wang, Y.; Stumpf, C.R.; Xue, L.; Devericks, E.; So, L., et al. Translation control of the immune checkpoint in cancer and its therapeutic targeting. Nat. Med. 2019, 25, 301-311, doi:10.1038/s41591-018-0321-2. 239. Harms, U.; Andreou, A.Z.; Gubaev, A.; Klostermeier, D. eIF4B, eIF4G and RNA regulate eIF4A activity in translation initiation by modulating the eIF4A conformational cycle. Nucleic Acids Res 2014, 42, 7911-7922, doi:10.1093/nar/gku440. 240. Andreou, A.Z.; Harms, U.; Klostermeier, D. Single-stranded regions modulate conformational dynamics and ATPase activity of eIF4A to optimize 5'-UTR unwinding. Nucleic Acids Res. 2019, 47, 5260-5275, doi:10.1093/nar/gkz254. 184 241. Hilbert, M.; Kebbel, F.; Gubaev, A.; Klostermeier, D. eIF4G stimulates the activity of the DEAD box protein eIF4A by a conformational guidance mechanism. Nucleic Acids Res. 2011, 39, 2260-2270, doi:10.1093/nar/gkq1127. 242. Garcia-Garcia, C.; Frieda, K.L.; Feoktistova, K.; Fraser, C.S.; Block, S.M. RNA BIOCHEMISTRY. Factor-dependent processivity in human eIF4A DEAD-box helicase. Science 2015, 348, 1486-1488, doi:10.1126/science.aaa5089. 243. Rozen, F.; Edery, I.; Meerovitch, K.; Dever, T.E.; Merrick, W.C.; Sonenberg, N. Bidirectional RNA helicase activity of eucaryotic translation initiation factors 4A and 4F. Mol Cell Biol 1990, 10, 1134-1144, doi:10.1128/mcb.10.3.1134. 244. Rogers, G.W., Jr.; Richter, N.J.; Lima, W.F.; Merrick, W.C. Modulation of the helicase activity of eIF4A by eIF4B, eIF4H, and eIF4F. J. Biol. Chem. 2001, 276, 30914-30922, doi:10.1074/jbc.M100157200. 245. Rozovsky, N.; Butterworth, A.C.; Moore, M.J. Interactions between eIF4AI and its accessory factors eIF4B and eIF4H. RNA 2008, 14, 2136-2148, doi:10.1261/rna.1049608. 246. Sun, Y.; Atas, E.; Lindqvist, L.; Sonenberg, N.; Pelletier, J.; Meller, A. The eukaryotic initiation factor eIF4H facilitates loop-binding, repetitive RNA unwinding by the eIF4A DEAD-box helicase. Nucleic Acids Res 2012, 40, 6199- 6207, doi:10.1093/nar/gks278. 185 247. Ozes, A.R.; Feoktistova, K.; Avanzino, B.C.; Fraser, C.S. Duplex unwinding and ATPase activities of the DEAD-box helicase eIF4A are coupled by eIF4G and eIF4B. J. Mol. Biol. 2011, 412, 674-687, doi:10.1016/j.jmb.2011.08.004. 248. Feoktistova, K.; Tuvshintogs, E.; Do, A.; Fraser, C.S. Human eIF4E promotes mRNA restructuring by stimulating eIF4A helicase activity. Proc Natl Acad Sci U S A 2013, 110, 13339-13344, doi:10.1073/pnas.1303781110. 249. Sokabe, M.; Fraser, C.S. A helicase-independent activity of eIF4A in promoting mRNA recruitment to the human ribosome. Proc Natl Acad Sci U S A 2017, 114, 6304-6309, doi:10.1073/pnas.1620426114. 250. Mishra, R.K.; Datey, A.; Hussain, T. mRNA Recruiting eIF4 Factors Involved in Protein Synthesis and Its Regulation. Biochemistry 2019, 10.1021/acs.biochem.9b00788, doi:10.1021/acs.biochem.9b00788. 251. Pelletier, J.; Sonenberg, N. The Organizing Principles of Eukaryotic Ribosome Recruitment. Annu. Rev. Biochem. 2019, 88, 307-335, doi:10.1146/annurev- biochem-013118-111042. 252. Kumar, P.; Hellen, C.U.; Pestova, T.V. Toward the mechanism of eIF4F-mediated ribosomal attachment to mammalian capped mRNAs. Genes Dev. 2016, 30, 1573- 1588, doi:10.1101/gad.282418.116. 186 253. Lu, W.T.; Wilczynska, A.; Smith, E.; Bushell, M. The diverse roles of the eIF4A family: you are the company you keep. Biochemical Society transactions 2014, 42, 166-172, doi:10.1042/BST20130161. 254. Parsyan, A.; Svitkin, Y.; Shahbazian, D.; Gkogkas, C.; Lasko, P.; Merrick, W.C.; Sonenberg, N. mRNA helicases: the tacticians of translational control. Nat. Rev. Mol. Cell Biol. 2011, 12, 235-245, doi:10.1038/nrm3083. 255. Yu, C.J.; Ou, J.H.; Wang, M.L.; Jialielihan, N.; Liu, Y.H. Elevated survivin mediated multidrug resistance and reduced apoptosis in breast cancer stem cells. J. BUON 2015, 20, 1287-1294. 256. Siddharth, S.; Das, S.; Nayak, A.; Kundu, C.N. SURVIVIN as a marker for quiescent-breast cancer stem cells-An intermediate, adherent, pre-requisite phase of breast cancer metastasis. Clin. Exp. Metastasis 2016, 33, 661-675, doi:10.1007/s10585-016-9809-7. 257. Lee, K.M.; Giltnane, J.M.; Balko, J.M.; Schwarz, L.J.; Guerrero-Zotano, A.L.; Hutchinson, K.E.; Nixon, M.J.; Estrada, M.V.; Sanchez, V.; Sanders, M.E., et al. MYC and MCL1 Cooperatively Promote Chemotherapy-Resistant Breast Cancer Stem Cells via Regulation of Mitochondrial Oxidative Phosphorylation. Cell metabolism 2017, 26, 633-647 e637, doi:10.1016/j.cmet.2017.09.009. 187 258. Sun, H.; Ding, C.; Zhang, H.; Gao, J. Let7 miRNAs sensitize breast cancer stem cells to radiationinduced repression through inhibition of the cyclin D1/Akt1/Wnt1 signaling pathway. Mol Med Rep 2016, 14, 3285-3292, doi:10.3892/mmr.2016.5656. 259. Tin, A.S.; Park, A.H.; Sundar, S.N.; Firestone, G.L. Essential role of the cancer stem/progenitor cell marker nucleostemin for indole-3-carbinol anti-proliferative responsiveness in human breast cancer cells. BMC Biol. 2014, 12, 72, doi:10.1186/s12915-014-0072-6. 260. Srinivasan, S.; Ashok, V.; Mohanty, S.; Das, A.; Das, S.; Kumar, S.; Sen, S.; Purwar, R. Blockade of Rho-associated protein kinase (ROCK) inhibits the contractility and invasion potential of cancer stem like cells. Oncotarget 2017, 8, 21418-21428, doi:10.18632/oncotarget.15248. 261. Becker, M.S.; Muller, P.M.; Bajorat, J.; Schroeder, A.; Giaisi, M.; Amin, E.; Ahmadian, M.R.; Rocks, O.; Kohler, R.; Krammer, P.H., et al. The anticancer phytochemical rocaglamide inhibits Rho GTPase activity and cancer cell migration. Oncotarget 2016, 7, 51908-51921, doi:10.18632/oncotarget.10188. 262. Maeda, T.; Hiraki, M.; Jin, C.; Rajabi, H.; Tagde, A.; Alam, M.; Bouillez, A.; Hu, X.; Suzuki, Y.; Miyo, M., et al. MUC1-C Induces PD-L1 and Immune Evasion in Triple-Negative Breast Cancer. Cancer Res. 2018, 78, 205-215, doi:10.1158/0008-5472.CAN-17-1636. 188 263. Alam, M.; Rajabi, H.; Ahmad, R.; Jin, C.; Kufe, D. Targeting the MUC1-C oncoprotein inhibits self-renewal capacity of breast cancer cells. Oncotarget 2014, 5, 2622-2634, doi:10.18632/oncotarget.1848. 264. Ahmad, R.; Alam, M.; Hasegawa, M.; Uchida, Y.; Al-Obaid, O.; Kharbanda, S.; Kufe, D. Targeting MUC1-C inhibits the AKT-S6K1-elF4A pathway regulating TIGAR translation in colorectal cancer. Mol. Cancer 2017, 16, 33, doi:10.1186/s12943-017-0608-9. 265. Malka-Mahieu, H.; Newman, M.; Desaubry, L.; Robert, C.; Vagner, S. Molecular Pathways: The eIF4F Translation Initiation Complex-New Opportunities for Cancer Treatment. Clin. Cancer Res. 2017, 23, 21-25, doi:10.1158/1078- 0432.CCR-14-2362. 266. Leppek, K.; Das, R.; Barna, M. Functional 5' UTR mRNA structures in eukaryotic translation regulation and how to find them. Nature reviews. Molecular cell biology 2017, 10.1038/nrm.2017.103, doi:10.1038/nrm.2017.103. 267. Steinberger, J.; Chu, J.; Maiga, R.I.; Sleiman, K.; Pelletier, J. Developing anti- neoplastic biotherapeutics against eIF4F. Cellular and molecular life sciences : CMLS 2017, 74, 1681-1692, doi:10.1007/s00018-016-2430-8. 189 268. Jin, C.; Rajabi, H.; Rodrigo, C.M.; Porco, J.A., Jr.; Kufe, D. Targeting the eIF4A RNA helicase blocks translation of the MUC1-C oncoprotein. Oncogene 2013, 32, 2179-2188, doi:10.1038/onc.2012.236. 269. Lee, R.J.; Albanese, C.; Fu, M.; D'Amico, M.; Lin, B.; Watanabe, G.; Haines, G.K., 3rd; Siegel, P.M.; Hung, M.C.; Yarden, Y., et al. Cyclin D1 is required for transformation by activated Neu and is induced through an E2F-dependent signaling pathway. Mol. Cell. Biol. 2000, 20, 672-683. 270. Li, Z.; Jiao, X.; Wang, C.; Ju, X.; Lu, Y.; Yuan, L.; Lisanti, M.P.; Katiyar, S.; Pestell, R.G. Cyclin D1 induction of cellular migration requires p27(KIP1). Cancer research 2006, 66, 9986-9994, doi:10.1158/0008-5472.CAN-06-1596. 271. Li, Z.; Wang, C.; Jiao, X.; Lu, Y.; Fu, M.; Quong, A.A.; Dye, C.; Yang, J.; Dai, M.; Ju, X., et al. Cyclin D1 regulates cellular migration through the inhibition of thrombospondin 1 and ROCK signaling. Mol. Cell. Biol. 2006, 26, 4240-4256, doi:10.1128/MCB.02124-05. 272. Di Sante, G.; Page, J.; Jiao, X.; Nawab, O.; Cristofanilli, M.; Skordalakes, E.; Pestell, R.G. Recent advances with cyclin-dependent kinase inhibitors: therapeutic agents for breast cancer and their role in immuno-oncology. Expert Rev. Anticancer Ther. 2019, 19, 569-587, doi:10.1080/14737140.2019.1615889. 190 273. Sabe, H. Requirement for Arf6 in cell adhesion, migration, and cancer cell invasion. J. Biochem. 2003, 134, 485-489. 274. Hashimoto, A.; Hashimoto, S.; Sugino, H.; Yoshikawa, A.; Onodera, Y.; Handa, H.; Oikawa, T.; Sabe, H. ZEB1 induces EPB41L5 in the cancer mesenchymal program that drives ARF6-based invasion, metastasis and drug resistance. Oncogenesis 2016, 5, e259, doi:10.1038/oncsis.2016.60. 275. Hashimoto, S.; Furukawa, S.; Hashimoto, A.; Tsutaho, A.; Fukao, A.; Sakamura, Y.; Parajuli, G.; Onodera, Y.; Otsuka, Y.; Handa, H., et al. ARF6 and AMAP1 are major targets of KRAS and TP53 mutations to promote invasion, PD-L1 dynamics, and immune evasion of pancreatic cancer. Proc. Natl. Acad. Sci. U. S. A. 2019, 116, 17450-17459, doi:10.1073/pnas.1901765116. 276. Cerezo, M.; Guemiri, R.; Druillennec, S.; Girault, I.; Malka-Mahieu, H.; Shen, S.; Allard, D.; Martineau, S.; Welsch, C.; Agoussi, S., et al. Translational control of tumor immune escape via the eIF4F-STAT1-PD-L1 axis in melanoma. Nat Med 2018, 24, 1877-1886, doi:10.1038/s41591-018-0217-1. 277. Petrie, R.J.; Doyle, A.D.; Yamada, K.M. Random versus directionally persistent cell migration. Nature reviews. Molecular cell biology 2009, 10, 538-549, doi:10.1038/nrm2729. 191 278. Lammermann, T.; Sixt, M. Mechanical modes of 'amoeboid' cell migration. Curr. Opin. Cell Biol. 2009, 21, 636-644, doi:10.1016/j.ceb.2009.05.003. 279. Chan, K.; Robert, F.; Oertlin, C.; Kapeller-Libermann, D.; Avizonis, D.; Gutierrez, J.; Handly-Santana, A.; Doubrovin, M.; Park, J.; Schoepfer, C., et al. eIF4A supports an oncogenic translation program in pancreatic ductal adenocarcinoma. Nat Commun 2019, 10, 5151, doi:10.1038/s41467-019-13086-5. 280. Nguyen, T.M.; Kabotyanski, E.B.; Dou, Y.; Reineke, L.C.; Zhang, P.; Zhang, X.H.; Malovannaya, A.; Jung, S.Y.; Mo, Q.; Roarty, K.P., et al. FGFR1-Activated Translation of WNT Pathway Components with Structured 5' UTRs Is Vulnerable to Inhibition of EIF4A-Dependent Translation Initiation. Cancer Res 2018, 78, 4229-4240, doi:10.1158/0008-5472.CAN-18-0631. 281. Meyer, N.; Penn, L.Z. Reflecting on 25 years with MYC. Nat Rev Cancer 2008, 8, 976-990, doi:10.1038/nrc2231. 282. Lin, C.J.; Cencic, R.; Mills, J.R.; Robert, F.; Pelletier, J. c-Myc and eIF4F are components of a feedforward loop that links transcription and translation. Cancer Res 2008, 68, 5326-5334, doi:10.1158/0008-5472.CAN-07-5876. 283. Lin, C.J.; Nasr, Z.; Premsrirut, P.K.; Porco, J.A., Jr.; Hippo, Y.; Lowe, S.W.; Pelletier, J. Targeting synthetic lethal interactions between Myc and the eIF4F 192 complex impedes tumorigenesis. Cell Rep 2012, 1, 325-333, doi:10.1016/j.celrep.2012.02.010. 284. Wiegering, A.; Uthe, F.W.; Jamieson, T.; Ruoss, Y.; Huttenrauch, M.; Kuspert, M.; Pfann, C.; Nixon, C.; Herold, S.; Walz, S., et al. Targeting Translation Initiation Bypasses Signaling Crosstalk Mechanisms That Maintain High MYC Levels in Colorectal Cancer. Cancer Discov 2015, 5, 768-781, doi:10.1158/2159- 8290.CD-14-1040. 285. Zhang, X.; Bi, C.; Lu, T.; Zhang, W.; Yue, T.; Wang, C.; Tian, T.; Zhang, X.; Huang, Y.; Lunning, M., et al. Targeting translation initiation by synthetic rocaglates for treating MYC-driven lymphomas. Leukemia 2019, 10.1038/s41375- 019-0503-z, doi:10.1038/s41375-019-0503-z. 286. Boussemart, L.; Malka-Mahieu, H.; Girault, I.; Allard, D.; Hemmingsson, O.; Tomasic, G.; Thomas, M.; Basmadjian, C.; Ribeiro, N.; Thuaud, F., et al. eIF4F is a nexus of resistance to anti-BRAF and anti-MEK cancer therapies. Nature 2014, 513, 105-109, doi:10.1038/nature13572. 287. Malka-Mahieu, H.; Girault, I.; Rubington, M.; Leriche, M.; Welsch, C.; Kamsu- Kom, N.; Zhao, Q.; Desaubry, L.; Vagner, S.; Robert, C. Synergistic effects of eIF4A and MEK inhibitors on proliferation of NRAS-mutant melanoma cell lines. Cell Cycle 2016, 15, 2405-2409, doi:10.1080/15384101.2016.1208862. 193 288. Shen, S.; Faouzi, S.; Bastide, A.; Martineau, S.; Malka-Mahieu, H.; Fu, Y.; Sun, X.; Mateus, C.; Routier, E.; Roy, S., et al. An epitranscriptomic mechanism underlies selective mRNA translation remodelling in melanoma persister cells. Nature communications 2019, 10, 5713, doi:10.1038/s41467-019-13360-6. 289. Garrido, M.F.; Martin, N.J.; Bertrand, M.; Gaudin, C.; Commo, F.; El Kalaany, N.; Al Nakouzi, N.; Fazli, L.; Del Nery, E.; Camonis, J., et al. Regulation of eIF4F Translation Initiation Complex by the Peptidyl Prolyl Isomerase FKBP7 in Taxane-resistant Prostate Cancer. Clin. Cancer Res. 2019, 25, 710-723, doi:10.1158/1078-0432.CCR-18-0704. 290. Sridharan, S.; Robeson, M.; Bastihalli-Tukaramrao, D.; Howard, C.M.; Subramaniyan, B.; Tilley, A.M.C.; Tiwari, A.K.; Raman, D. Targeting of the Eukaryotic Translation Initiation Factor 4A Against Breast Cancer Stemness. Front Oncol 2019, 9, 1311, doi:10.3389/fonc.2019.01311. 291. Kong, T.; Xue, Y.; Cencic, R.; Zhu, X.; Monast, A.; Fu, Z.; Pilon, V.; Sangwan, V.; Guiot, M.C.; Foulkes, W.D., et al. eIF4A Inhibitors Suppress Cell-Cycle Feedback Response and Acquired Resistance to CDK4/6 Inhibition in Cancer. Mol Cancer Ther 2019, 18, 2158-2170, doi:10.1158/1535-7163.MCT-19-0162. 292. Zindy, P.; Berge, Y.; Allal, B.; Filleron, T.; Pierredon, S.; Cammas, A.; Beck, S.; Mhamdi, L.; Fan, L.; Favre, G., et al. Formation of the eIF4F translation-initiation complex determines sensitivity to anticancer drugs targeting the EGFR and HER2 194 receptors. Cancer Res. 2011, 71, 4068-4073, doi:10.1158/0008-5472.CAN-11- 0420. 293. Itoua Maiga, R.; Cencic, R.; Chu, J.; Waller, D.D.; Brown, L.E.; Devine, W.G.; Zhang, W.; Sebag, M.; Porco, J.A., Jr.; Pelletier, J. Oxo-aglaiastatin-Mediated Inhibition of Translation Initiation. Sci Rep 2019, 9, 1265, doi:10.1038/s41598- 018-37666-5. 294. Chen, R.; Zhu, M.; Chaudhari, R.R.; Robles, O.; Chen, Y.; Skillern, W.; Qin, Q.; Wierda, W.G.; Zhang, S.; Hull, K.G., et al. Creating novel translation inhibitors to target pro-survival proteins in chronic lymphocytic leukemia. Leukemia 2019, 33, 1663-1674, doi:10.1038/s41375-018-0364-x. 295. Badura, M.; Braunstein, S.; Zavadil, J.; Schneider, R.J. DNA damage and eIF4G1 in breast cancer cells reprogram translation for survival and DNA repair mRNAs. Proc. Natl. Acad. Sci. U. S. A. 2012, 109, 18767-18772, doi:10.1073/pnas.1203853109. 296. Silvera, D.; Arju, R.; Darvishian, F.; Levine, P.H.; Zolfaghari, L.; Goldberg, J.; Hochman, T.; Formenti, S.C.; Schneider, R.J. Essential role for eIF4GI overexpression in the pathogenesis of inflammatory breast cancer. Nat. Cell Biol. 2009, 11, 903-908, doi:10.1038/ncb1900. 195 297. Silvera, D.; Schneider, R.J. Inflammatory breast cancer cells are constitutively adapted to hypoxia. Cell cycle 2009, 8, 3091-3096. 298. Suarez-Arroyo, I.J.; Rosario-Acevedo, R.; Aguilar-Perez, A.; Clemente, P.L.; Cubano, L.A.; Serrano, J.; Schneider, R.J.; Martinez-Montemayor, M.M. Anti- tumor effects of Ganoderma lucidum (reishi) in inflammatory breast cancer in in vivo and in vitro models. PLoS One 2013, 8, e57431, doi:10.1371/journal.pone.0057431. 299. Gluck, A.A.; Orlando, E.; Leiser, D.; Poliakova, M.; Nisa, L.; Quintin, A.; Gavini, J.; Stroka, D.M.; Berezowska, S.; Bubendorf, L., et al. Identification of a MET- eIF4G1 translational regulation axis that controls HIF-1alpha levels under hypoxia. Oncogene 2018, 37, 4181-4196, doi:10.1038/s41388-018-0256-6. 300. Braunstein, S.; Karpisheva, K.; Pola, C.; Goldberg, J.; Hochman, T.; Yee, H.; Cangiarella, J.; Arju, R.; Formenti, S.C.; Schneider, R.J. A hypoxia-controlled cap-dependent to cap-independent translation switch in breast cancer. Mol. Cell 2007, 28, 501-512, doi:10.1016/j.molcel.2007.10.019. 301. de la Parra, C.; Ernlund, A.; Alard, A.; Ruggles, K.; Ueberheide, B.; Schneider, R.J. A widespread alternate form of cap-dependent mRNA translation initiation. Nat Commun 2018, 9, 3068, doi:10.1038/s41467-018-05539-0. 196 302. Liberman, N.; Gandin, V.; Svitkin, Y.V.; David, M.; Virgili, G.; Jaramillo, M.; Holcik, M.; Nagar, B.; Kimchi, A.; Sonenberg, N. DAP5 associates with eIF2beta and eIF4AI to promote Internal Ribosome Entry Site driven translation. Nucleic Acids Res. 2015, 43, 3764-3775, doi:10.1093/nar/gkv205. 303. Bryant, J.D.; Brown, M.C.; Dobrikov, M.I.; Dobrikova, E.Y.; Gemberling, S.L.; Zhang, Q.; Gromeier, M. Regulation of Hypoxia-Inducible Factor 1alpha during Hypoxia by DAP5-Induced Translation of PHD2. Mol Cell Biol 2018, 38, doi:10.1128/MCB.00647-17. 304. Michaut, M.; Chin, S.F.; Majewski, I.; Severson, T.M.; Bismeijer, T.; de Koning, L.; Peeters, J.K.; Schouten, P.C.; Rueda, O.M.; Bosma, A.J., et al. Integration of genomic, transcriptomic and proteomic data identifies two biologically distinct subtypes of invasive lobular breast cancer. Sci. Rep. 2016, 6, 18517, doi:10.1038/srep18517. 305. Malik, N.; Yan, H.; Moshkovich, N.; Palangat, M.; Yang, H.; Sanchez, V.; Cai, Z.; Peat, T.J.; Jiang, S.; Liu, C., et al. The transcription factor CBFB suppresses breast cancer through orchestrating translation and transcription. Nat Commun 2019, 10, 2071, doi:10.1038/s41467-019-10102-6. 306. Madden, J.M.; Mueller, K.L.; Bollig-Fischer, A.; Stemmer, P.; Mattingly, R.R.; Boerner, J.L. Abrogating phosphorylation of eIF4B is required for EGFR and 197 mTOR inhibitor synergy in triple-negative breast cancer. Breast Cancer Res. Treat. 2014, 147, 283-293, doi:10.1007/s10549-014-3102-8. 307. Shahbazian, D.; Parsyan, A.; Petroulakis, E.; Topisirovic, I.; Martineau, Y.; Gibbs, B.F.; Svitkin, Y.; Sonenberg, N. Control of cell survival and proliferation by mammalian eukaryotic initiation factor 4B. Molecular and cellular biology 2010, 30, 1478-1485, doi:10.1128/MCB.01218-09. 308. Raught, B.; Peiretti, F.; Gingras, A.C.; Livingstone, M.; Shahbazian, D.; Mayeur, G.L.; Polakiewicz, R.D.; Sonenberg, N.; Hershey, J.W. Phosphorylation of eucaryotic translation initiation factor 4B Ser422 is modulated by S6 kinases. EMBO J 2004, 23, 1761-1769, doi:10.1038/sj.emboj.7600193. 309. Shahbazian, D.; Roux, P.P.; Mieulet, V.; Cohen, M.S.; Raught, B.; Taunton, J.; Hershey, J.W.; Blenis, J.; Pende, M.; Sonenberg, N. The mTOR/PI3K and MAPK pathways converge on eIF4B to control its phosphorylation and activity. The EMBO journal 2006, 25, 2781-2791, doi:10.1038/sj.emboj.7601166. 310. Liu, Z.; Cho, N.J. Muscarinic acetylcholine receptors mediate eIF4B phosphorylation in SNU-407 colon cancer cells. Biochem. Biophys. Res. Commun. 2016, 480, 450-454, doi:10.1016/j.bbrc.2016.10.069. 311. van Gorp, A.G.; van der Vos, K.E.; Brenkman, A.B.; Bremer, A.; van den Broek, N.; Zwartkruis, F.; Hershey, J.W.; Burgering, B.M.; Calkhoven, C.F.; Coffer, P.J. 198 AGC kinases regulate phosphorylation and activation of eukaryotic translation initiation factor 4B. Oncogene 2009, 28, 95-106, doi:10.1038/onc.2008.367. 312. Speers, C.; Zhao, S.G.; Kothari, V.; Santola, A.; Liu, M.; Wilder-Romans, K.; Evans, J.; Batra, N.; Bartelink, H.; Hayes, D.F., et al. Maternal Embryonic Leucine Zipper Kinase (MELK) as a Novel Mediator and Biomarker of Radioresistance in Human Breast Cancer. Clin Cancer Res 2016, 22, 5864-5875, doi:10.1158/1078-0432.CCR-15-2711. 313. Wang, Y.; Begley, M.; Li, Q.; Huang, H.T.; Lako, A.; Eck, M.J.; Gray, N.S.; Mitchison, T.J.; Cantley, L.C.; Zhao, J.J. Mitotic MELK-eIF4B signaling controls protein synthesis and tumor cell survival. Proc. Natl. Acad. Sci. U. S. A. 2016, 113, 9810-9815, doi:10.1073/pnas.1606862113. 314. Degen, M.; Barron, P.; Natarajan, E.; Widlund, H.R.; Rheinwald, J.G. RSK activation of translation factor eIF4B drives abnormal increases of laminin gamma2 and MYC protein during neoplastic progression to squamous cell carcinoma. PLoS One 2013, 8, e78979, doi:10.1371/journal.pone.0078979. 315. Kapadia, B.; Nanaji, N.M.; Bhalla, K.; Bhandary, B.; Lapidus, R.; Beheshti, A.; Evens, A.M.; Gartenhaus, R.B. Fatty Acid Synthase induced S6Kinase facilitates USP11-eIF4B complex formation for sustained oncogenic translation in DLBCL. Nat Commun 2018, 9, 829, doi:10.1038/s41467-018-03028-y. 199 316. Horvilleur, E.; Sbarrato, T.; Hill, K.; Spriggs, R.V.; Screen, M.; Goodrem, P.J.; Sawicka, K.; Chaplin, L.C.; Touriol, C.; Packham, G., et al. A role for eukaryotic initiation factor 4B overexpression in the pathogenesis of diffuse large B-cell lymphoma. Leukemia 2014, 28, 1092-1102, doi:10.1038/leu.2013.295. 317. Yang, J.; Wang, J.; Chen, K.; Guo, G.; Xi, R.; Rothman, P.B.; Whitten, D.; Zhang, L.; Huang, S.; Chen, J.L. eIF4B phosphorylation by pim kinases plays a critical role in cellular transformation by Abl oncogenes. Cancer Res. 2013, 73, 4898-4908, doi:10.1158/0008-5472.CAN-12-4277. 318. Chen, K.; Yang, J.; Li, J.; Wang, X.; Chen, Y.; Huang, S.; Chen, J.L. eIF4B is a convergent target and critical effector of oncogenic Pim and PI3K/Akt/mTOR signaling pathways in Abl transformants. Oncotarget 2016, 7, 10073-10089, doi:10.18632/oncotarget.7164. 319. Ren, K.; Gou, X.; Xiao, M.; Wang, M.; Liu, C.; Tang, Z.; He, W. The over- expression of Pim-2 promote the tumorigenesis of prostatic carcinoma through phosphorylating eIF4B. Prostate 2013, 73, 1462-1469, doi:10.1002/pros.22693. 320. Kim, H.K.; Choi, I.J.; Kim, C.G.; Kim, H.S.; Oshima, A.; Michalowski, A.; Green, J.E. A gene expression signature of acquired chemoresistance to cisplatin and fluorouracil combination chemotherapy in gastric cancer patients. PLoS One 2011, 6, e16694, doi:10.1371/journal.pone.0016694. 200 321. Richter-Cook, N.J.; Dever, T.E.; Hensold, J.O.; Merrick, W.C. Purification and characterization of a new eukaryotic protein translation factor. Eukaryotic initiation factor 4H. J. Biol. Chem. 1998, 273, 7579-7587. 322. Fiume, G.; Rossi, A.; de Laurentiis, A.; Falcone, C.; Pisano, A.; Vecchio, E.; Pontoriero, M.; Scala, I.; Scialdone, A.; Masci, F.F., et al. Eukaryotic Initiation Factor 4H Is under Transcriptional Control of p65/NF-kappaB. PLoS One 2013, 8, e66087, doi:10.1371/journal.pone.0066087. 323. Bai, Y.; Lu, C.; Zhang, G.; Hou, Y.; Guo, Y.; Zhou, H.; Ma, X.; Zhao, G. Overexpression of miR-519d in lung adenocarcinoma inhibits cell proliferation and invasion via the association of eIF4H. Tumour Biol 2017, 39, 1010428317694566, doi:10.1177/1010428317694566. 324. Wu, D.; Matsushita, K.; Matsubara, H.; Nomura, F.; Tomonaga, T. An alternative splicing isoform of eukaryotic initiation factor 4H promotes tumorigenesis in vivo and is a potential therapeutic target for human cancer. Int J Cancer 2011, 128, 1018-1030, doi:10.1002/ijc.25419. 325. Vaysse, C.; Philippe, C.; Martineau, Y.; Quelen, C.; Hieblot, C.; Renaud, C.; Nicaise, Y.; Desquesnes, A.; Pannese, M.; Filleron, T., et al. Key contribution of eIF4H-mediated translational control in tumor promotion. Oncotarget 2015, 6, 39924-39940, doi:10.18632/oncotarget.5442. 201 326. Roux, P.P.; Topisirovic, I. Signaling Pathways Involved in the Regulation of mRNA Translation. Mol Cell Biol 2018, 38, doi:10.1128/MCB.00070-18. 327. Gingras, A.C.; Raught, B.; Gygi, S.P.; Niedzwiecka, A.; Miron, M.; Burley, S.K.; Polakiewicz, R.D.; Wyslouch-Cieszynska, A.; Aebersold, R.; Sonenberg, N. Hierarchical phosphorylation of the translation inhibitor 4E-BP1. Genes Dev. 2001, 15, 2852-2864, doi:10.1101/gad.912401. 328. Schalm, S.S.; Blenis, J. Identification of a conserved motif required for mTOR signaling. Curr Biol 2002, 12, 632-639, doi:10.1016/s0960-9822(02)00762-5. 329. Beugnet, A.; Wang, X.; Proud, C.G. Target of rapamycin (TOR)-signaling and RAIP motifs play distinct roles in the mammalian TOR-dependent phosphorylation of initiation factor 4E-binding protein 1. J Biol Chem 2003, 278, 40717-40722, doi:10.1074/jbc.M308573200. 330. Nojima, H.; Tokunaga, C.; Eguchi, S.; Oshiro, N.; Hidayat, S.; Yoshino, K.; Hara, K.; Tanaka, N.; Avruch, J.; Yonezawa, K. The mammalian target of rapamycin (mTOR) partner, raptor, binds the mTOR substrates p70 S6 kinase and 4E-BP1 through their TOR signaling (TOS) motif. J Biol Chem 2003, 278, 15461-15464, doi:10.1074/jbc.C200665200. 331. Tee, A.R.; Proud, C.G. Caspase cleavage of initiation factor 4E-binding protein 1 yields a dominant inhibitor of cap-dependent translation and reveals a novel 202 regulatory motif. Mol Cell Biol 2002, 22, 1674-1683, doi:10.1128/mcb.22.6.1674- 1683.2002. 332. Lee, V.H.; Healy, T.; Fonseca, B.D.; Hayashi, A.; Proud, C.G. Analysis of the regulatory motifs in eukaryotic initiation factor 4E-binding protein 1. FEBS J 2008, 275, 2185-2199, doi:10.1111/j.1742-4658.2008.06372.x. 333. Musa, J.; Orth, M.F.; Dallmayer, M.; Baldauf, M.; Pardo, C.; Rotblat, B.; Kirchner, T.; Leprivier, G.; Grunewald, T.G. Eukaryotic initiation factor 4E- binding protein 1 (4E-BP1): a master regulator of mRNA translation involved in tumorigenesis. Oncogene 2016, 35, 4675-4688, doi:10.1038/onc.2015.515. 334. Rutkovsky, A.C.; Yeh, E.S.; Guest, S.T.; Findlay, V.J.; Muise-Helmericks, R.C.; Armeson, K.; Ethier, S.P. Eukaryotic initiation factor 4E-binding protein as an oncogene in breast cancer. BMC Cancer 2019, 19, 491, doi:10.1186/s12885-019- 5667-4. 335. Ding, M.; Van der Kwast, T.H.; Vellanki, R.N.; Foltz, W.D.; McKee, T.D.; Sonenberg, N.; Pandolfi, P.P.; Koritzinsky, M.; Wouters, B.G. The mTOR Targets 4E-BP1/2 Restrain Tumor Growth and Promote Hypoxia Tolerance in PTEN-driven Prostate Cancer. Mol. Cancer Res. 2018, 16, 682-695, doi:10.1158/1541-7786.MCR-17-0696. 203 336. Muller, D.; Shin, S.; Goullet de Rugy, T.; Samain, R.; Baer, R.; Strehaiano, M.; Masvidal-Sanz, L.; Guillermet-Guibert, J.; Jean, C.; Tsukumo, Y., et al. eIF4A inhibition circumvents uncontrolled DNA replication mediated by 4E-BP1 loss in pancreatic cancer. JCI Insight 2019, 4, doi:10.1172/jci.insight.121951. 337. Wang, J.; Ye, Q.; Cao, Y.; Guo, Y.; Huang, X.; Mi, W.; Liu, S.; Wang, C.; Yang, H.S.; Zhou, B.P., et al. Snail determines the therapeutic response to mTOR kinase inhibitors by transcriptional repression of 4E-BP1. Nat Commun 2017, 8, 2207, doi:10.1038/s41467-017-02243-3. 338. Woodcock, H.V.; Eley, J.D.; Guillotin, D.; Plate, M.; Nanthakumar, C.B.; Martufi, M.; Peace, S.; Joberty, G.; Poeckel, D.; Good, R.B., et al. The mTORC1/4E-BP1 axis represents a critical signaling node during fibrogenesis. Nat Commun 2019, 10, 6, doi:10.1038/s41467-018-07858-8. 339. Yang, H.S.; Jansen, A.P.; Komar, A.A.; Zheng, X.; Merrick, W.C.; Costes, S.; Lockett, S.J.; Sonenberg, N.; Colburn, N.H. The transformation suppressor Pdcd4 is a novel eukaryotic translation initiation factor 4A binding protein that inhibits translation. Mol Cell Biol 2003, 23, 26-37, doi:10.1128/mcb.23.1.26-37.2003. 340. Dorrello, N.V.; Peschiaroli, A.; Guardavaccaro, D.; Colburn, N.H.; Sherman, N.E.; Pagano, M. S6K1- and betaTRCP-mediated degradation of PDCD4 promotes protein translation and cell growth. Science 2006, 314, 467-471, doi:10.1126/science.1130276. 204 341. Lu, Z.; Liu, M.; Stribinskis, V.; Klinge, C.M.; Ramos, K.S.; Colburn, N.H.; Li, Y. MicroRNA-21 promotes cell transformation by targeting the programmed cell death 4 gene. Oncogene 2008, 27, 4373-4379, doi:10.1038/onc.2008.72. 342. Bourguignon, L.Y.; Spevak, C.C.; Wong, G.; Xia, W.; Gilad, E. Hyaluronan- CD44 interaction with protein kinase C(epsilon) promotes oncogenic signaling by the stem cell marker Nanog and the Production of microRNA-21, leading to down-regulation of the tumor suppressor protein PDCD4, anti-apoptosis, and chemotherapy resistance in breast tumor cells. J Biol Chem 2009, 284, 26533- 26546, doi:10.1074/jbc.M109.027466. 343. Venturutti, L.; Romero, L.V.; Urtreger, A.J.; Chervo, M.F.; Cordo Russo, R.I.; Mercogliano, M.F.; Inurrigarro, G.; Pereyra, M.G.; Proietti, C.J.; Izzo, F., et al. Stat3 regulates ErbB-2 expression and co-opts ErbB-2 nuclear function to induce miR-21 expression, PDCD4 downregulation and breast cancer metastasis. Oncogene 2016, 35, 2208-2222, doi:10.1038/onc.2015.281. 344. Zennami, K.; Choi, S.M.; Liao, R.; Li, Y.; Dinalankara, W.; Marchionni, L.; Rafiqi, F.H.; Kurozumi, A.; Hatano, K.; Lupold, S.E. PDCD4 Is an Androgen- Repressed Tumor Suppressor that Regulates Prostate Cancer Growth and Castration Resistance. Mol Cancer Res 2019, 17, 618-627, doi:10.1158/1541- 7786.MCR-18-0837. 205 345. Hu, X.; Wang, Y.; Liang, H.; Fan, Q.; Zhu, R.; Cui, J.; Zhang, W.; Zen, K.; Zhang, C.Y.; Hou, D., et al. miR-23a/b promote tumor growth and suppress apoptosis by targeting PDCD4 in gastric cancer. Cell Death Dis 2017, 8, e3059, doi:10.1038/cddis.2017.447. 346. Jadaliha, M.; Gholamalamdari, O.; Tang, W.; Zhang, Y.; Petracovici, A.; Hao, Q.; Tariq, A.; Kim, T.G.; Holton, S.E.; Singh, D.K., et al. A natural antisense lncRNA controls breast cancer progression by promoting tumor suppressor gene mRNA stability. PLoS Genet 2018, 14, e1007802, doi:10.1371/journal.pgen.1007802. 347. Carayol, N.; Katsoulidis, E.; Sassano, A.; Altman, J.K.; Druker, B.J.; Platanias, L.C. Suppression of programmed cell death 4 (PDCD4) protein expression by BCR-ABL-regulated engagement of the mTOR/p70 S6 kinase pathway. J. Biol. Chem. 2008, 283, 8601-8610, doi:10.1074/jbc.M707934200. 348. Akar, U.; Ozpolat, B.; Mehta, K.; Lopez-Berestein, G.; Zhang, D.; Ueno, N.T.; Hortobagyi, G.N.; Arun, B. Targeting p70S6K prevented lung metastasis in a breast cancer xenograft model. Mol Cancer Ther 2010, 9, 1180-1187, doi:10.1158/1535-7163.MCT-09-1025. 349. Chu, J.; Cencic, R.; Wang, W.; Porco, J.A., Jr.; Pelletier, J. Translation Inhibition by Rocaglates Is Independent of eIF4E Phosphorylation Status. Mol Cancer Ther 2016, 15, 136-141, doi:10.1158/1535-7163.MCT-15-0409. 206 350. Vikhreva, P.N.; Shepelev, M.V.; Korobko, I.V. mTOR-dependent transcriptional repression of Pdcd4 tumor suppressor in lung cancer cells. Biochim Biophys Acta 2014, 1839, 43-49, doi:10.1016/j.bbagrm.2013.12.001. 351. Cuesta, R.; Holz, M.K. RSK-mediated down-regulation of PDCD4 is required for proliferation, survival, and migration in a model of triple-negative breast cancer. Oncotarget 2016, 7, 27567-27583, doi:10.18632/oncotarget.8375. 352. Jansen, A.P.; Camalier, C.E.; Stark, C.; Colburn, N.H. Characterization of programmed cell death 4 in multiple human cancers reveals a novel enhancer of drug sensitivity. Mol. Cancer Ther. 2004, 3, 103-110. 353. Chen, Z.; Yuan, Y.C.; Wang, Y.; Liu, Z.; Chan, H.J.; Chen, S. Down-regulation of programmed cell death 4 (PDCD4) is associated with aromatase inhibitor resistance and a poor prognosis in estrogen receptor-positive breast cancer. Breast Cancer Res Treat 2015, 152, 29-39, doi:10.1007/s10549-015-3446-8. 354. Afonja, O.; Juste, D.; Das, S.; Matsuhashi, S.; Samuels, H.H. Induction of PDCD4 tumor suppressor gene expression by RAR agonists, antiestrogen and HER-2/neu antagonist in breast cancer cells. Evidence for a role in apoptosis. Oncogene 2004, 23, 8135-8145, doi:10.1038/sj.onc.1207983. 355. Li, C.; Du, L.; Ren, Y.; Liu, X.; Jiao, Q.; Cui, D.; Wen, M.; Wang, C.; Wei, G.; Wang, Y., et al. SKP2 promotes breast cancer tumorigenesis and radiation 207 tolerance through PDCD4 ubiquitination. J. Exp. Clin. Cancer Res. 2019, 38, 76, doi:10.1186/s13046-019-1069-3. 356. Cui, H.; Wang, Q.; Lei, Z.; Feng, M.; Zhao, Z.; Wang, Y.; Wei, G. DTL promotes cancer progression by PDCD4 ubiquitin-dependent degradation. J Exp Clin Cancer Res 2019, 38, 350, doi:10.1186/s13046-019-1358-x. 357. Biyanee, A.; Ohnheiser, J.; Singh, P.; Klempnauer, K.H. A novel mechanism for the control of translation of specific mRNAs by tumor suppressor protein Pdcd4: inhibition of translation elongation. Oncogene 2015, 34, 1384-1392, doi:10.1038/onc.2014.83. 358. Powers, M.A.; Fay, M.M.; Factor, R.E.; Welm, A.L.; Ullman, K.S. Protein arginine methyltransferase 5 accelerates tumor growth by arginine methylation of the tumor suppressor programmed cell death 4. Cancer Res 2011, 71, 5579-5587, doi:10.1158/0008-5472.CAN-11-0458. 359. Santhanam, A.N.; Baker, A.R.; Hegamyer, G.; Kirschmann, D.A.; Colburn, N.H. Pdcd4 repression of lysyl oxidase inhibits hypoxia-induced breast cancer cell invasion. Oncogene 2010, 29, 3921-3932, doi:10.1038/onc.2010.158. 360. Chen, E.Z.; Jacobson, B.A.; Patel, M.R.; Okon, A.M.; Li, S.; Xiong, K.; Vaidya, A.J.; Bitterman, P.B.; Wagner, C.R.; Kratzke, R.A. Small-molecule inhibition of 208 oncogenic eukaryotic protein translation in mesothelioma cells. Invest New Drugs 2014, 32, 598-603, doi:10.1007/s10637-014-0076-7. 361. Moerke, N.J.; Aktas, H.; Chen, H.; Cantel, S.; Reibarkh, M.Y.; Fahmy, A.; Gross, J.D.; Degterev, A.; Yuan, J.; Chorev, M., et al. Small-molecule inhibition of the interaction between the translation initiation factors eIF4E and eIF4G. Cell 2007, 128, 257-267, doi:10.1016/j.cell.2006.11.046. 362. Papadopoulos, E.; Jenni, S.; Kabha, E.; Takrouri, K.J.; Yi, T.; Salvi, N.; Luna, R.E.; Gavathiotis, E.; Mahalingam, P.; Arthanari, H., et al. Structure of the eukaryotic translation initiation factor eIF4E in complex with 4EGI-1 reveals an allosteric mechanism for dissociating eIF4G. Proc Natl Acad Sci U S A 2014, 111, E3187-3195, doi:10.1073/pnas.1410250111. 363. Sekiyama, N.; Arthanari, H.; Papadopoulos, E.; Rodriguez-Mias, R.A.; Wagner, G.; Leger-Abraham, M. Molecular mechanism of the dual activity of 4EGI-1: Dissociating eIF4G from eIF4E but stabilizing the binding of unphosphorylated 4E-BP1. Proc Natl Acad Sci U S A 2015, 112, E4036-4045, doi:10.1073/pnas.1512118112. 364. De, A.; Jacobson, B.A.; Peterson, M.S.; Stelzner, M.E.; Jay-Dixon, J.; Kratzke, M.G.; Patel, M.R.; Bitterman, P.B.; Kratzke, R.A. Inhibition of oncogenic cap- dependent translation by 4EGI-1 reduces growth, enhances chemosensitivity and 209 alters genome-wide translation in non-small cell lung cancer. Cancer Gene Ther 2019, 26, 157-165, doi:10.1038/s41417-018-0058-6. 365. Tamburini, J.; Green, A.S.; Bardet, V.; Chapuis, N.; Park, S.; Willems, L.; Uzunov, M.; Ifrah, N.; Dreyfus, F.; Lacombe, C., et al. Protein synthesis is resistant to rapamycin and constitutes a promising therapeutic target in acute myeloid leukemia. Blood 2009, 114, 1618-1627, doi:10.1182/blood-2008-10- 184515. 366. Chen, L.; Aktas, B.H.; Wang, Y.; He, X.; Sahoo, R.; Zhang, N.; Denoyelle, S.; Kabha, E.; Yang, H.; Freedman, R.Y., et al. Tumor suppression by small molecule inhibitors of translation initiation. Oncotarget 2012, 3, 869-881, doi:10.18632/oncotarget.598. 367. Schwarzer, A.; Holtmann, H.; Brugman, M.; Meyer, J.; Schauerte, C.; Zuber, J.; Steinemann, D.; Schlegelberger, B.; Li, Z.; Baum, C. Hyperactivation of mTORC1 and mTORC2 by multiple oncogenic events causes addiction to eIF4E- dependent mRNA translation in T-cell leukemia. Oncogene 2015, 34, 3593-3604, doi:10.1038/onc.2014.290. 368. Descamps, G.; Gomez-Bougie, P.; Tamburini, J.; Green, A.; Bouscary, D.; Maiga, S.; Moreau, P.; Le Gouill, S.; Pellat-Deceunynck, C.; Amiot, M. The cap- translation inhibitor 4EGI-1 induces apoptosis in multiple myeloma through Noxa induction. Br J Cancer 2012, 106, 1660-1667, doi:10.1038/bjc.2012.139. 210 369. Attar-Schneider, O.; Drucker, L.; Zismanov, V.; Tartakover-Matalon, S.; Lishner, M. Targeting eIF4GI translation initiation factor affords an attractive therapeutic strategy in multiple myeloma. Cell Signal 2014, 26, 1878-1887, doi:10.1016/j.cellsig.2014.05.005. 370. Wang, W.; Li, J.; Wen, Q.; Luo, J.; Chu, S.; Chen, L.; Qing, Z.; Xie, G.; Xu, L.; Alnemah, M.M., et al. 4EGI-1 induces apoptosis and enhances radiotherapy sensitivity in nasopharyngeal carcinoma cells via DR5 induction on 4E-BP1 dephosphorylation. Oncotarget 2016, 7, 21728-21741, doi:10.18632/oncotarget.7824. 371. De, A.; Jacobson, B.A.; Peterson, M.S.; Jay-Dixon, J.; Kratzke, M.G.; Sadiq, A.A.; Patel, M.R.; Kratzke, R.A. 4EGI-1 represses cap-dependent translation and regulates genome-wide translation in malignant pleural mesothelioma. Invest New Drugs 2018, 36, 217-229, doi:10.1007/s10637-017-0535-z. 372. Yi, T.; Kabha, E.; Papadopoulos, E.; Wagner, G. 4EGI-1 targets breast cancer stem cells by selective inhibition of translation that persists in CSC maintenance, proliferation and metastasis. Oncotarget 2014, 5, 6028-6037, doi:10.18632/oncotarget.2112. 373. Wang, H.; Huang, F.; Wang, J.; Wang, P.; Lv, W.; Hong, L.; Li, S.; Zhou, J. The synergistic inhibition of breast cancer proliferation by combined treatment with 211 4EGI-1 and MK2206. Cell Cycle 2015, 14, 232-242, doi:10.4161/15384101.2014.977096. 374. Willimott, S.; Beck, D.; Ahearne, M.J.; Adams, V.C.; Wagner, S.D. Cap- translation inhibitor, 4EGI-1, restores sensitivity to ABT-737 apoptosis through cap-dependent and -independent mechanisms in chronic lymphocytic leukemia. Clin Cancer Res 2013, 19, 3212-3223, doi:10.1158/1078-0432.CCR-12-2185. 375. Harris, B.R.E.; Wang, D.; Zhang, Y.; Ferrari, M.; Okon, A.; Cleary, M.P.; Wagner, C.R.; Yang, D.Q. Induction of the p53 Tumor Suppressor in Cancer Cells through Inhibition of Cap-Dependent Translation. Mol Cell Biol 2018, 38, doi:10.1128/MCB.00367-17. 376. Cencic, R.; Hall, D.R.; Robert, F.; Du, Y.; Min, J.; Li, L.; Qui, M.; Lewis, I.; Kurtkaya, S.; Dingledine, R., et al. Reversing chemoresistance by small molecule inhibition of the translation initiation complex eIF4F. Proc Natl Acad Sci U S A 2011, 108, 1046-1051, doi:10.1073/pnas.1011477108. 377. Ali, A.M.; Atmaj, J.; Van Oosterwijk, N.; Groves, M.R.; Domling, A. Stapled Peptides Inhibitors: A New Window for Target Drug Discovery. Comput Struct Biotechnol J 2019, 17, 263-281, doi:10.1016/j.csbj.2019.01.012. 378. Gallagher, E.E.; Song, J.M.; Menon, A.; Mishra, L.D.; Chmiel, A.F.; Garner, A.L. Consideration of Binding Kinetics in the Design of Stapled Peptide Mimics of the 212 Disordered Proteins Eukaryotic Translation Initiation Factor 4E-Binding Protein 1 and Eukaryotic Translation Initiation Factor 4G. J Med Chem 2019, 62, 4967- 4978, doi:10.1021/acs.jmedchem.9b00068. 379. Song, J.M.; Gallagher, E.E.; Menon, A.; Mishra, L.D.; Garner, A.L. The role of olefin geometry in the activity of hydrocarbon stapled peptides targeting eukaryotic translation initiation factor 4E (eIF4E). Org Biomol Chem 2019, 17, 6414-6419, doi:10.1039/c9ob01041f. 380. Bordeleau, M.E.; Matthews, J.; Wojnar, J.M.; Lindqvist, L.; Novac, O.; Jankowsky, E.; Sonenberg, N.; Northcote, P.; Teesdale-Spittle, P.; Pelletier, J. Stimulation of mammalian translation initiation factor eIF4A activity by a small molecule inhibitor of eukaryotic translation. Proc Natl Acad Sci U S A 2005, 102, 10460-10465, doi:10.1073/pnas.0504249102. 381. Low, W.K.; Dang, Y.; Schneider-Poetsch, T.; Shi, Z.; Choi, N.S.; Merrick, W.C.; Romo, D.; Liu, J.O. Inhibition of eukaryotic translation initiation by the marine natural product pateamine A. Mol Cell 2005, 20, 709-722, doi:10.1016/j.molcel.2005.10.008. 382. Kommaraju, S.S.; Aulicino, J.; Gobbooru, S.; Li, J.; Zhu, M.; Romo, D.; Low, W.K. Investigation of the mechanism of action of a potent pateamine A analog, des-methyl, des-amino pateamine A (DMDAPatA). Biochem Cell Biol 2020, 10.1139/bcb-2019-0307, doi:10.1139/bcb-2019-0307. 213 383. Kuznetsov, G.; Xu, Q.; Rudolph-Owen, L.; Tendyke, K.; Liu, J.; Towle, M.; Zhao, N.; Marsh, J.; Agoulnik, S.; Twine, N., et al. Potent in vitro and in vivo anticancer activities of des-methyl, des-amino pateamine A, a synthetic analogue of marine natural product pateamine A. Mol Cancer Ther 2009, 8, 1250-1260, doi:10.1158/1535-7163.MCT-08-1026. 384. Low, W.K.; Li, J.; Zhu, M.; Kommaraju, S.S.; Shah-Mittal, J.; Hull, K.; Liu, J.O.; Romo, D. Second-generation derivatives of the eukaryotic translation initiation inhibitor pateamine A targeting eIF4A as potential anticancer agents. Bioorg Med Chem 2014, 22, 116-125, doi:10.1016/j.bmc.2013.11.046. 385. Bordeleau, M.E.; Mori, A.; Oberer, M.; Lindqvist, L.; Chard, L.S.; Higa, T.; Belsham, G.J.; Wagner, G.; Tanaka, J.; Pelletier, J. Functional characterization of IRESes by an inhibitor of the RNA helicase eIF4A. Nat Chem Biol 2006, 2, 213- 220, doi:10.1038/nchembio776. 386. Sun, Y.; Atas, E.; Lindqvist, L.M.; Sonenberg, N.; Pelletier, J.; Meller, A. Single- molecule kinetics of the eukaryotic initiation factor 4AI upon RNA unwinding. Structure 2014, 22, 941-948, doi:10.1016/j.str.2014.04.014. 387. Lindqvist, L.; Oberer, M.; Reibarkh, M.; Cencic, R.; Bordeleau, M.E.; Vogt, E.; Marintchev, A.; Tanaka, J.; Fagotto, F.; Altmann, M., et al. Selective pharmacological targeting of a DEAD box RNA helicase. PLoS One 2008, 3, e1583, doi:10.1371/journal.pone.0001583. 214 388. Tsumuraya, T.; Ishikawa, C.; Machijima, Y.; Nakachi, S.; Senba, M.; Tanaka, J.; Mori, N. Effects of hippuristanol, an inhibitor of eIF4A, on adult T-cell leukemia. Biochem Pharmacol 2011, 81, 713-722, doi:10.1016/j.bcp.2010.12.025. 389. Ishikawa, C.; Tanaka, J.; Katano, H.; Senba, M.; Mori, N. Hippuristanol reduces the viability of primary effusion lymphoma cells both in vitro and in vivo. Mar Drugs 2013, 11, 3410-3424, doi:10.3390/md11093410. 390. Robert, F.; Roman, W.; Bramoulle, A.; Fellmann, C.; Roulston, A.; Shustik, C.; Porco, J.A., Jr.; Shore, G.C.; Sebag, M.; Pelletier, J. Translation initiation factor eIF4F modifies the dexamethasone response in multiple myeloma. Proc Natl Acad Sci U S A 2014, 111, 13421-13426, doi:10.1073/pnas.1402650111. 391. Cencic, R.; Robert, F.; Galicia-Vazquez, G.; Malina, A.; Ravindar, K.; Somaiah, R.; Pierre, P.; Tanaka, J.; Deslongchamps, P.; Pelletier, J. Modifying chemotherapy response by targeted inhibition of eukaryotic initiation factor 4A. Blood Cancer J 2013, 3, e128, doi:10.1038/bcj.2013.25. 392. King, M.L.; Chiang, C.C.; Ling, H.C.; Fujita, E.; Ochiai, M.; McPhail, A.T. X- Ray crystal structure of rocaglamide, a novel antileulemic 1H- cyclopenta[b]benzofuran from Aglaia elliptifolia. Journal of the Chemical Society, Chemical Communications 1982, 1150-1151 215 393. Sadlish, H.; Galicia-Vazquez, G.; Paris, C.G.; Aust, T.; Bhullar, B.; Chang, L.; Helliwell, S.B.; Hoepfner, D.; Knapp, B.; Riedl, R., et al. Evidence for a functionally relevant rocaglamide binding site on the eIF4A-RNA complex. ACS Chem Biol 2013, 8, 1519-1527, doi:10.1021/cb400158t. 394. Iwasaki, S.; Floor, S.N.; Ingolia, N.T. Rocaglates convert DEAD-box protein eIF4A into a sequence-selective translational repressor. Nature 2016, 534, 558- 561, doi:10.1038/nature17978. 395. Iwasaki, S.; Iwasaki, W.; Takahashi, M.; Sakamoto, A.; Watanabe, C.; Shichino, Y.; Floor, S.N.; Fujiwara, K.; Mito, M.; Dodo, K., et al. The Translation Inhibitor Rocaglamide Targets a Bimolecular Cavity between eIF4A and Polypurine RNA. Mol Cell 2019, 73, 738-748 e739, doi:10.1016/j.molcel.2018.11.026. 396. Chu, J.; Zhang, W.; Cencic, R.; O'Connor, P.B.F.; Robert, F.; Devine, W.G.; Selznick, A.; Henkel, T.; Merrick, W.C.; Brown, L.E., et al. Rocaglates Induce Gain-of-Function Alterations to eIF4A and eIF4F. Cell Rep 2020, 10.1016/j.celrep.2020.02.002, doi:10.1016/j.celrep.2020.02.002. 397. Hwang, B.Y.; Su, B.N.; Chai, H.; Mi, Q.; Kardono, L.B.; Afriastini, J.J.; Riswan, S.; Santarsiero, B.D.; Mesecar, A.D.; Wild, R., et al. Silvestrol and episilvestrol, potential anticancer rocaglate derivatives from Aglaia silvestris. J Org Chem 2004, 69, 3350-3358, doi:10.1021/jo040120f. 216 398. Bordeleau, M.E.; Robert, F.; Gerard, B.; Lindqvist, L.; Chen, S.M.; Wendel, H.G.; Brem, B.; Greger, H.; Lowe, S.W.; Porco, J.A., Jr., et al. Therapeutic suppression of translation initiation modulates chemosensitivity in a mouse lymphoma model. J Clin Invest 2008, 118, 2651-2660, doi:10.1172/JCI34753. 399. Lucas, D.M.; Edwards, R.B.; Lozanski, G.; West, D.A.; Shin, J.D.; Vargo, M.A.; Davis, M.E.; Rozewski, D.M.; Johnson, A.J.; Su, B.N., et al. The novel plant- derived agent silvestrol has B-cell selective activity in chronic lymphocytic leukemia and acute lymphoblastic leukemia in vitro and in vivo. Blood 2009, 113, 4656-4666, doi:10.1182/blood-2008-09-175430. 400. Smith, H.W.; Hirukawa, A.; Sanguin-Gendreau, V.; Nandi, I.; Dufour, C.R.; Zuo, D.; Tandoc, K.; Leibovitch, M.; Singh, S.; Rennhack, J.P., et al. An ErbB2/c-Src axis links bioenergetics with PRC2 translation to drive epigenetic reprogramming and mammary tumorigenesis. Nat Commun 2019, 10, 2901, doi:10.1038/s41467- 019-10681-4. 401. Cencic, R.; Carrier, M.; Trnkus, A.; Porco, J.A., Jr.; Minden, M.; Pelletier, J. Synergistic effect of inhibiting translation initiation in combination with cytotoxic agents in acute myelogenous leukemia cells. Leuk. Res. 2010, 34, 535-541, doi:10.1016/j.leukres.2009.07.043. 402. Gupta, S.V.; Sass, E.J.; Davis, M.E.; Edwards, R.B.; Lozanski, G.; Heerema, N.A.; Lehman, A.; Zhang, X.; Jarjoura, D.; Byrd, J.C., et al. Resistance to the 217 translation initiation inhibitor silvestrol is mediated by ABCB1/P-glycoprotein overexpression in acute lymphoblastic leukemia cells. AAPS J 2011, 13, 357-364, doi:10.1208/s12248-011-9276-7. 403. Chang, L.S.; Oblinger, J.L.; Burns, S.S.; Huang, J.; Anderson, L.W.; Hollingshead, M.G.; Shen, R.; Pan, L.; Agarwal, G.; Ren, Y., et al. Targeting protein translation by rocaglamide and didesmethylrocaglamide to treat MPNST and other sarcomas. Mol Cancer Ther 2019, 10.1158/1535-7163.MCT-19-0809, doi:10.1158/1535-7163.MCT-19-0809. 404. Saradhi, U.V.; Gupta, S.V.; Chiu, M.; Wang, J.; Ling, Y.; Liu, Z.; Newman, D.J.; Covey, J.M.; Kinghorn, A.D.; Marcucci, G., et al. Characterization of silvestrol pharmacokinetics in mice using liquid chromatography-tandem mass spectrometry. AAPS J 2011, 13, 347-356, doi:10.1208/s12248-011-9273-x. 405. Thuaud, F.; Bernard, Y.; Turkeri, G.; Dirr, R.; Aubert, G.; Cresteil, T.; Baguet, A.; Tomasetto, C.; Svitkin, Y.; Sonenberg, N., et al. Synthetic analogue of rocaglaol displays a potent and selective cytotoxicity in cancer cells: involvement of apoptosis inducing factor and caspase-12. J Med Chem 2009, 52, 5176-5187, doi:10.1021/jm900365v. 406. Rodrigo, C.M.; Cencic, R.; Roche, S.P.; Pelletier, J.; Porco, J.A. Synthesis of rocaglamide hydroxamates and related compounds as eukaryotic translation 218 inhibitors: synthetic and biological studies. J Med Chem 2012, 55, 558-562, doi:10.1021/jm201263k. 407. Nalli, A.D.; Brown, L.E.; Thomas, C.L.; Sayers, T.J.; Porco, J.A., Jr.; Henrich, C.J. Sensitization of renal carcinoma cells to TRAIL-induced apoptosis by rocaglamide and analogs. Sci Rep 2018, 8, 17519, doi:10.1038/s41598-018- 35908-0. 408. Zhang, W.; Chu, J.; Cyr, A.M.; Yueh, H.; Brown, L.E.; Wang, T.T.; Pelletier, J.; Porco, J.A., Jr. Intercepted Retro-Nazarov Reaction: Syntheses of Amidino- Rocaglate Derivatives and Their Biological Evaluation as eIF4A Inhibitors. J Am Chem Soc 2019, 141, 12891-12900, doi:10.1021/jacs.9b06446. 409. Ernst, J.T.; Thompson, P.A.; Nilewski, C.; Sprengeler, P.A.; Sperry, S.; Packard, G.; Michels, T.; Xiang, A.; Tran, C.; Wegerski, C.J., et al. Design of Development Candidate eFT226, a First in Class Inhibitor of Eukaryotic Initiation Factor 4A RNA Helicase. J Med Chem 2020, 63, 5879-5955, doi:10.1021/acs.jmedchem.0c00182. 410. Thompson, P.A.; Eam, B.; Young, N.P.; Fish, S.; Chen, J.; Barrera, M.; Howard, H.; Parra, A.; Molter, J.; Staunton, J., et al. Preclinical Evaluation of eFT226, a Novel, Potent and Selective eIF4A Inhibitor with Anti-Tumor Activity in B-Cell Malignancies. Blood 2017, 130 219 411. Prasad, A.; Shrivastava, A.; Papadopoulos, E.; Kuzontkoski, P.M.; Reddy, M.V.; Gillum, A.M.; Kumar, R.; Reddy, E.P.; Groopman, J.E. Combined administration of rituximab and on 013105 induces apoptosis in mantle cell lymphoma cells and reduces tumor burden in a mouse model of mantle cell lymphoma. Clin Cancer Res 2013, 19, 85-95, doi:10.1158/1078-0432.CCR-12-1425. 412. Duffy, A.G.; Makarova-Rusher, O.V.; Ulahannan, S.V.; Rahma, O.E.; Fioravanti, S.; Walker, M.; Abdullah, S.; Raffeld, M.; Anderson, V.; Abi-Jaoudeh, N., et al. Modulation of tumor eIF4E by antisense inhibition: A phase I/II translational clinical trial of ISIS 183750-an antisense oligonucleotide against eIF4E-in combination with irinotecan in solid tumors and irinotecan-refractory colorectal cancer. Int J Cancer 2016, 139, 1648-1657, doi:10.1002/ijc.30199. 413. Hong, D.S.; Kurzrock, R.; Oh, Y.; Wheler, J.; Naing, A.; Brail, L.; Callies, S.; Andre, V.; Kadam, S.K.; Nasir, A., et al. A phase 1 dose escalation, pharmacokinetic, and pharmacodynamic evaluation of eIF-4E antisense oligonucleotide LY2275796 in patients with advanced cancer. Clin Cancer Res 2011, 17, 6582-6591, doi:10.1158/1078-0432.CCR-11-0430. 414. Miyakawa, S.; Oguro, A.; Ohtsu, T.; Imataka, H.; Sonenberg, N.; Nakamura, Y. RNA aptamers to mammalian initiation factor 4G inhibit cap-dependent translation by blocking the formation of initiation factor complexes. RNA 2006, 12, 1825-1834, doi:10.1261/rna.2169406. 220 415. Oguro, A.; Ohtsu, T.; Svitkin, Y.V.; Sonenberg, N.; Nakamura, Y. RNA aptamers to initiation factor 4A helicase hinder cap-dependent translation by blocking ATP hydrolysis. RNA 2003, 9, 394-407. 416. Mochizuki, K.; Oguro, A.; Ohtsu, T.; Sonenberg, N.; Nakamura, Y. High affinity RNA for mammalian initiation factor 4E interferes with mRNA-cap binding and inhibits translation. RNA 2005, 11, 77-89, doi:10.1261/rna.7108205. 417. Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2019. CA Cancer J Clin 2019, 69, 7-34, doi:10.3322/caac.21551. 418. Valent, P.; Bonnet, D.; Wohrer, S.; Andreeff, M.; Copland, M.; Chomienne, C.; Eaves, C. Heterogeneity of neoplastic stem cells: theoretical, functional, and clinical implications. Cancer research 2013, 73, 1037-1045, doi:10.1158/0008- 5472.CAN-12-3678. 419. Brooks, M.D.; Burness, M.L.; Wicha, M.S. Therapeutic Implications of Cellular Heterogeneity and Plasticity in Breast Cancer. Cell stem cell 2015, 17, 260-271, doi:10.1016/j.stem.2015.08.014. 420. Goldberg-Bittman, L.; Neumark, E.; Sagi-Assif, O.; Azenshtein, E.; Meshel, T.; Witz, I.P.; Ben-Baruch, A. The expression of the chemokine receptor CXCR3 and its ligand, CXCL10, in human breast adenocarcinoma cell lines. Immunology letters 2004, 92, 171-178, doi:10.1016/j.imlet.2003.10.020. 221 421. Smith, M.C.; Luker, K.E.; Garbow, J.R.; Prior, J.L.; Jackson, E.; Piwnica-Worms, D.; Luker, G.D. CXCR4 regulates growth of both primary and metastatic breast cancer. Cancer Res. 2004, 64, 8604-8612, doi:10.1158/0008-5472.CAN-04-1844. 422. Luker, K.E.; Luker, G.D. Functions of CXCL12 and CXCR4 in breast cancer. Cancer letters 2006, 238, 30-41, doi:10.1016/j.canlet.2005.06.021. 423. Ueda, Y.; Neel, N.F.; Schutyser, E.; Raman, D.; Richmond, A. Deletion of the COOH-terminal domain of CXC chemokine receptor 4 leads to the down- regulation of cell-to-cell contact, enhanced motility and proliferation in breast carcinoma cells. Cancer Res. 2006, 66, 5665-5675, doi:10.1158/0008-5472.CAN- 05-3579. 424. Walser, T.C.; Rifat, S.; Ma, X.; Kundu, N.; Ward, C.; Goloubeva, O.; Johnson, M.G.; Medina, J.C.; Collins, T.L.; Fulton, A.M. Antagonism of CXCR3 inhibits lung metastasis in a murine model of metastatic breast cancer. Cancer Res. 2006, 66, 7701-7707, doi:10.1158/0008-5472.CAN-06-0709. 425. Fulton, A.M. The chemokine receptors CXCR4 and CXCR3 in cancer. Curr. Oncol. Rep. 2009, 11, 125-131. 426. Zlotnik, A.; Burkhardt, A.M.; Homey, B. Homeostatic chemokine receptors and organ-specific metastasis. Nature reviews. Immunology 2011, 11, 597-606, doi:10.1038/nri3049. 222 427. Zlotnik, A. Chemokines in neoplastic progression. Seminars in cancer biology 2004, 14, 181-185, doi:10.1016/j.semcancer.2003.10.004. 428. Liang, Z.; Wu, T.; Lou, H.; Yu, X.; Taichman, R.S.; Lau, S.K.; Nie, S.; Umbreit, J.; Shim, H. Inhibition of breast cancer metastasis by selective synthetic polypeptide against CXCR4. Cancer research 2004, 64, 4302-4308, doi:10.1158/0008-5472.CAN-03-3958. 429. Lin, Y.H.; Park, Z.Y.; Lin, D.; Brahmbhatt, A.A.; Rio, M.C.; Yates, J.R., 3rd; Klemke, R.L. Regulation of cell migration and survival by focal adhesion targeting of Lasp-1. The Journal of cell biology 2004, 165, 421-432. 430. Grunewald, T.G.; Kammerer, U.; Schulze, E.; Schindler, D.; Honig, A.; Zimmer, M.; Butt, E. Silencing of LASP-1 influences zyxin localization, inhibits proliferation and reduces migration in breast cancer cells. Experimental cell research 2006, 312, 974-982. 431. Raman, D.; Neel, N.F.; Sai, J.; Mernaugh, R.L.; Ham, A.J.; Richmond, A.J. Characterization of chemokine receptor CXCR2 interacting proteins using a proteomics approach to define the CXCR2 "chemosynapse". Methods in enzymology 2009, 460, 315-330, doi:10.1016/S0076-6879(09)05215-X. 223 432. Bhat, M.; Robichaud, N.; Hulea, L.; Sonenberg, N.; Pelletier, J.; Topisirovic, I. Targeting the translation machinery in cancer. Nature reviews. Drug discovery 2015, 14, 261-278, doi:10.1038/nrd4505. 433. Robichaud, N.; Sonenberg, N. Translational control and the cancer cell response to stress. Current opinion in cell biology 2017, 45, 102-109, doi:10.1016/j.ceb.2017.05.007. 434. Andreou, A.Z.; Harms, U.; Klostermeier, D. eIF4B stimulates eIF4A ATPase and unwinding activities by direct interaction through its 7-repeats region. RNA biology 2017, 14, 113-123, doi:10.1080/15476286.2016.1259782. 435. Sen, N.D.; Zhou, F.; Harris, M.S.; Ingolia, N.T.; Hinnebusch, A.G. eIF4B stimulates translation of long mRNAs with structured 5' UTRs and low closed- loop potential but weak dependence on eIF4G. Proc Natl Acad Sci U S A 2016, 113, 10464-10472, doi:10.1073/pnas.1612398113. 436. Andreou, A.Z.; Klostermeier, D. eIF4B and eIF4G jointly stimulate eIF4A ATPase and unwinding activities by modulation of the eIF4A conformational cycle. Journal of molecular biology 2014, 426, 51-61, doi:10.1016/j.jmb.2013.09.027. 437. Nielsen, K.H.; Behrens, M.A.; He, Y.; Oliveira, C.L.; Jensen, L.S.; Hoffmann, S.V.; Pedersen, J.S.; Andersen, G.R. Synergistic activation of eIF4A by eIF4B 224 and eIF4G. Nucleic acids research 2011, 39, 2678-2689, doi:10.1093/nar/gkq1206. 438. Avdulov, S.; Li, S.; Michalek, V.; Burrichter, D.; Peterson, M.; Perlman, D.M.; Manivel, J.C.; Sonenberg, N.; Yee, D.; Bitterman, P.B., et al. Activation of translation complex eIF4F is essential for the genesis and maintenance of the malignant phenotype in human mammary epithelial cells. Cancer cell 2004, 5, 553-563, doi:10.1016/j.ccr.2004.05.024. 439. Lee, T.; Pelletier, J. Eukaryotic initiation factor 4F: a vulnerability of tumor cells. Future medicinal chemistry 2012, 4, 19-31, doi:10.4155/fmc.11.150. 440. Pelletier, J.; Graff, J.; Ruggero, D.; Sonenberg, N. Targeting the eIF4F translation initiation complex: a critical nexus for cancer development. Cancer Res 2015, 75, 250-263, doi:10.1158/0008-5472.CAN-14-2789. 441. Truitt, M.L.; Ruggero, D. New frontiers in translational control of the cancer genome. Nat Rev Cancer 2016, 16, 288-304, doi:10.1038/nrc.2016.27. 442. Saini, V.; Staren, D.M.; Ziarek, J.J.; Nashaat, Z.N.; Campbell, E.M.; Volkman, B.F.; Marchese, A.; Majetschak, M. The CXC chemokine receptor 4 ligands ubiquitin and stromal cell-derived factor-1alpha function through distinct receptor interactions. The Journal of biological chemistry 2011, 286, 33466-33477, doi:10.1074/jbc.M111.233742. 225 443. Dillenburg-Pilla, P.; Patel, V.; Mikelis, C.M.; Zarate-Blades, C.R.; Doci, C.L.; Amornphimoltham, P.; Wang, Z.; Martin, D.; Leelahavanichkul, K.; Dorsam, R.T., et al. SDF-1/CXCL12 induces directional cell migration and spontaneous metastasis via a CXCR4/Galphai/mTORC1 axis. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2015, 29, 1056-1068, doi:10.1096/fj.14-260083. 444. Shahbazian, D.; Parsyan, A.; Petroulakis, E.; Hershey, J.; Sonenberg, N. eIF4B controls survival and proliferation and is regulated by proto-oncogenic signaling pathways. Cell cycle 2010, 9, 4106-4109. 445. Rhodes, D.R.; Kalyana-Sundaram, S.; Mahavisno, V.; Varambally, R.; Yu, J.; Briggs, B.B.; Barrette, T.R.; Anstet, M.J.; Kincead-Beal, C.; Kulkarni, P., et al. Oncomine 3.0: genes, pathways, and networks in a collection of 18,000 cancer gene expression profiles. Neoplasia 2007, 9, 166-180. 446. Rhodes, D.R.; Kalyana-Sundaram, S.; Tomlins, S.A.; Mahavisno, V.; Kasper, N.; Varambally, R.; Barrette, T.R.; Ghosh, D.; Varambally, S.; Chinnaiyan, A.M. Molecular concepts analysis links tumors, pathways, mechanisms, and drugs. Neoplasia 2007, 9, 443-454. 447. Rhodes, D.R.; Yu, J.; Shanker, K.; Deshpande, N.; Varambally, R.; Ghosh, D.; Barrette, T.; Pandey, A.; Chinnaiyan, A.M. ONCOMINE: a cancer microarray database and integrated data-mining platform. Neoplasia 2004, 6, 1-6. 226 448. Chu, J.; Cajal, S.R.Y.; Sonenberg, N.; Pelletier, J. Eukaryotic initiation factor 4F- sidestepping resistance mechanisms arising from expression heterogeneity. Current opinion in genetics & development 2018, 48, 89-96, doi:10.1016/j.gde.2017.11.002. 449. Chu, J.; Pelletier, J. Targeting the eIF4A RNA helicase as an anti-neoplastic approach. Biochimica et biophysica acta 2015, 1849, 781-791, doi:10.1016/j.bbagrm.2014.09.006. 450. Hanahan, D.; Weinberg, R.A. The hallmarks of cancer. Cell 2000, 100, 57-70. 451. Hanahan, D.; Weinberg, R.A. Hallmarks of cancer: the next generation. Cell 2011, 144, 646-674, doi:10.1016/j.cell.2011.02.013. 452. Silvera, D.; Formenti, S.C.; Schneider, R.J. Translational control in cancer. Nat Rev Cancer 2010, 10, 254-266, doi:10.1038/nrc2824. 453. de la Parra, C.; Walters, B.A.; Geter, P.; Schneider, R.J. Translation initiation factors and their relevance in cancer. Current opinion in genetics & development 2017, 48, 82-88, doi:10.1016/j.gde.2017.11.001. 454. Vaklavas, C.; Blume, S.W.; Grizzle, W.E. Translational Dysregulation in Cancer: Molecular Insights and Potential Clinical Applications in Biomarker Development. Frontiers in oncology 2017, 7, 158, doi:10.3389/fonc.2017.00158. 227 455. Raza, F.; Waldron, J.A.; Quesne, J.L. Translational dysregulation in cancer: eIF4A isoforms and sequence determinants of eIF4A dependence. Biochemical Society transactions 2015, 43, 1227-1233, doi:10.1042/BST20150163. 456. Palmesino, E.; Apuzzo, T.; Thelen, S.; Mueller, B.; Langen, H.; Thelen, M. Association of eukaryotic translation initiation factor eIF2B with fully solubilized CXCR4. J Leukoc Biol 2016, 99, 971-978, doi:10.1189/jlb.2MA0915-415R. 457. Ierano, C.; Santagata, S.; Napolitano, M.; Guardia, F.; Grimaldi, A.; Antignani, E.; Botti, G.; Consales, C.; Riccio, A.; Nanayakkara, M., et al. CXCR4 and CXCR7 transduce through mTOR in human renal cancer cells. Cell death & disease 2014, 5, e1310, doi:10.1038/cddis.2014.269. 458. Morino, S.; Imataka, H.; Svitkin, Y.V.; Pestova, T.V.; Sonenberg, N. Eukaryotic translation initiation factor 4E (eIF4E) binding site and the middle one-third of eIF4GI constitute the core domain for cap-dependent translation, and the C- terminal one-third functions as a modulatory region. Molecular and cellular biology 2000, 20, 468-477. 459. Okada, H.; Mak, T.W. Pathways of apoptotic and non-apoptotic death in tumour cells. Nat Rev Cancer 2004, 4, 592-603, doi:10.1038/nrc1412. 460. Li, Z.; Wang, C.; Prendergast, G.C.; Pestell, R.G. Cyclin D1 functions in cell migration. Cell cycle 2006, 5, 2440-2442, doi:10.4161/cc.5.21.3428. 228 461. Lamb, R.; Lehn, S.; Rogerson, L.; Clarke, R.B.; Landberg, G. Cell cycle regulators cyclin D1 and CDK4/6 have estrogen receptor-dependent divergent functions in breast cancer migration and stem cell-like activity. Cell cycle 2013, 12, 2384-2394, doi:10.4161/cc.25403. 462. Tan, W.; Martin, D.; Gutkind, J.S. The Galpha13-Rho signaling axis is required for SDF-1-induced migration through CXCR4. The Journal of biological chemistry 2006, 281, 39542-39549, doi:10.1074/jbc.M609062200. 463. Struckhoff, A.P.; Rana, M.K.; Kher, S.S.; Burow, M.E.; Hagan, J.L.; Del Valle, L.; Worthylake, R.A. PDZ-RhoGEF is essential for CXCR4-driven breast tumor cell motility through spatial regulation of RhoA. Journal of cell science 2013, 126, 4514-4526, doi:10.1242/jcs.132381. 464. Slabakova, E.; Kharaishvili, G.; Smejova, M.; Pernicova, Z.; Suchankova, T.; Remsik, J.; Lerch, S.; Strakova, N.; Bouchal, J.; Kral, M., et al. Opposite regulation of MDM2 and MDMX expression in acquisition of mesenchymal phenotype in benign and cancer cells. Oncotarget 2015, 6, 36156-36171, doi:10.18632/oncotarget.5392. 465. Chu, J.; Cajal, S.R.Y.; Sonenberg, N.; Pelletier, J. Eukaryotic initiation factor 4F- sidestepping resistance mechanisms arising from expression heterogeneity. Current opinion in genetics & development 2017, 48, 89-96, doi:10.1016/j.gde.2017.11.002. 229 466. Graff, J.R.; Konicek, B.W.; Vincent, T.M.; Lynch, R.L.; Monteith, D.; Weir, S.N.; Schwier, P.; Capen, A.; Goode, R.L.; Dowless, M.S., et al. Therapeutic suppression of translation initiation factor eIF4E expression reduces tumor growth without toxicity. J Clin Invest 2007, 117, 2638-2648, doi:10.1172/JCI32044. 467. Chu, J.; Zhang, W.; Cencic, R.; Devine, W.G.; Beglov, D.; Henkel, T.; Brown, L.E.; Vajda, S.; Porco, J.A., Jr.; Pelletier, J. Amidino-Rocaglates: A Potent Class of eIF4A Inhibitors. Cell Chem Biol 2019, 26, 1586-1593 e1583, doi:10.1016/j.chembiol.2019.08.008. 468. Ashburn, T.T.; Thor, K.B. Drug repositioning: identifying and developing new uses for existing drugs. Nat Rev Drug Discov 2004, 3, 673-683, doi:10.1038/nrd1468. 469. Holmes, M.D.; Chen, W.Y. Hiding in plain view: the potential for commonly used drugs to reduce breast cancer mortality. Breast Cancer Res 2012, 14, 216, doi:10.1186/bcr3336. 470. Johnson, R.W.; Nguyen, M.P.; Padalecki, S.S.; Grubbs, B.G.; Merkel, A.R.; Oyajobi, B.O.; Matrisian, L.M.; Mundy, G.R.; Sterling, J.A. TGF-beta promotion of Gli2-induced expression of parathyroid hormone-related protein, an important osteolytic factor in bone metastasis, is independent of canonical Hedgehog signaling. Cancer Res 2011, 71, 822-831, doi:10.1158/0008-5472.CAN-10-2993. 230 471. Howard, C.M.; Bearss, N.; Subramaniyan, B.; Tilley, A.; Sridharan, S.; Villa, N.; Fraser, C.S.; Raman, D. The CXCR4-LASP1-eIF4F Axis Promotes Translation of Oncogenic Proteins in Triple-Negative Breast Cancer Cells. Front Oncol 2019, 9, 284, doi:10.3389/fonc.2019.00284. 472. Chou, T.C. Drug combination studies and their synergy quantification using the Chou-Talalay method. Cancer Res 2010, 70, 440-446, doi:10.1158/0008- 5472.CAN-09-1947. 473. Waldron, J.A.; Tack, D.C.; Ritchey, L.E.; Gillen, S.L.; Wilczynska, A.; Turro, E.; Bevilacqua, P.C.; Assmann, S.M.; Bushell, M.; Le Quesne, J. mRNA structural elements immediately upstream of the start codon dictate dependence upon eIF4A helicase activity. Genome Biol 2019, 20, 300, doi:10.1186/s13059-019-1901-2. 474. Wang, Y.; Lonard, D.M.; Yu, Y.; Chow, D.C.; Palzkill, T.G.; Wang, J.; Qi, R.; Matzuk, A.J.; Song, X.; Madoux, F., et al. Bufalin is a potent small-molecule inhibitor of the steroid receptor coactivators SRC-3 and SRC-1. Cancer Res 2014, 74, 1506-1517, doi:10.1158/0008-5472.CAN-13-2939. 475. Perne, A.; Muellner, M.K.; Steinrueck, M.; Craig-Mueller, N.; Mayerhofer, J.; Schwarzinger, I.; Sloane, M.; Uras, I.Z.; Hoermann, G.; Nijman, S.M., et al. Cardiac glycosides induce cell death in human cells by inhibiting general protein synthesis. PLoS One 2009, 4, e8292, doi:10.1371/journal.pone.0008292. 231 476. Polunovsky, V.A.; Rosenwald, I.B.; Tan, A.T.; White, J.; Chiang, L.; Sonenberg, N.; Bitterman, P.B. Translational control of programmed cell death: eukaryotic translation initiation factor 4E blocks apoptosis in growth-factor-restricted fibroblasts with physiologically expressed or deregulated Myc. Mol Cell Biol 1996, 16, 6573-6581, doi:10.1128/mcb.16.11.6573. 477. Ruggero, D.; Montanaro, L.; Ma, L.; Xu, W.; Londei, P.; Cordon-Cardo, C.; Pandolfi, P.P. The translation factor eIF-4E promotes tumor formation and cooperates with c-Myc in lymphomagenesis. Nat Med 2004, 10, 484-486, doi:10.1038/nm1042. 478. Hart, J.R.; Garner, A.L.; Yu, J.; Ito, Y.; Sun, M.; Ueno, L.; Rhee, J.K.; Baksh, M.M.; Stefan, E.; Hartl, M., et al. Inhibitor of MYC identified in a Krohnke pyridine library. Proc Natl Acad Sci U S A 2014, 111, 12556-12561, doi:10.1073/pnas.1319488111. 479. Chen, H.; Liu, H.; Qing, G. Targeting oncogenic Myc as a strategy for cancer treatment. Signal Transduct Target Ther 2018, 3, 5, doi:10.1038/s41392-018- 0008-7. 480. Karasneh, R.A.; Murray, L.J.; Mc Menamin, U.C.; Hughes, C.M.; Cardwell, C.R. Digoxin use after diagnosis of breast cancer and survival: a population-based cohort study. Breast Cancer Res Treat 2015, 151, 661-669, doi:10.1007/s10549- 015-3417-0. 232 481. Tan, A.; Bitterman, P.; Sonenberg, N.; Peterson, M.; Polunovsky, V. Inhibition of Myc-dependent apoptosis by eukaryotic translation initiation factor 4E requires cyclin D1. Oncogene 2000, 19, 1437-1447, doi:10.1038/sj.onc.1203446. 482. Simpson, C.D.; Mawji, I.A.; Anyiwe, K.; Williams, M.A.; Wang, X.; Venugopal, A.L.; Gronda, M.; Hurren, R.; Cheng, S.; Serra, S., et al. Inhibition of the sodium potassium adenosine triphosphatase pump sensitizes cancer cells to anoikis and prevents distant tumor formation. Cancer Res 2009, 69, 2739-2747, doi:10.1158/0008-5472.CAN-08-2530. 483. Lin, S.Y.; Chang, H.H.; Lai, Y.H.; Lin, C.H.; Chen, M.H.; Chang, G.C.; Tsai, M.F.; Chen, J.J. Digoxin Suppresses Tumor Malignancy through Inhibiting Multiple Src-Related Signaling Pathways in Non-Small Cell Lung Cancer. PLoS One 2015, 10, e0123305, doi:10.1371/journal.pone.0123305. 484. Wang, Z.; Zheng, M.; Li, Z.; Li, R.; Jia, L.; Xiong, X.; Southall, N.; Wang, S.; Xia, M.; Austin, C.P., et al. Cardiac glycosides inhibit p53 synthesis by a mechanism relieved by Src or MAPK inhibition. Cancer Res 2009, 69, 6556- 6564, doi:10.1158/0008-5472.CAN-09-0891. 485. Triana-Martinez, F.; Picallos-Rabina, P.; Da Silva-Alvarez, S.; Pietrocola, F.; Llanos, S.; Rodilla, V.; Soprano, E.; Pedrosa, P.; Ferreiros, A.; Barradas, M., et al. Identification and characterization of Cardiac Glycosides as senolytic compounds. Nat Commun 2019, 10, 4731, doi:10.1038/s41467-019-12888-x. 233 486. Schito, L.; Rey, S.; Tafani, M.; Zhang, H.; Wong, C.C.; Russo, A.; Russo, M.A.; Semenza, G.L. Hypoxia-inducible factor 1-dependent expression of platelet- derived growth factor B promotes lymphatic metastasis of hypoxic breast cancer cells. Proc Natl Acad Sci U S A 2012, 109, E2707-2716, doi:10.1073/pnas.1214019109. 487. Steinberger, J.; Robert, F.; Halle, M.; Williams, D.E.; Cencic, R.; Sawhney, N.; Pelletier, D.; Williams, P.; Igarashi, Y.; Porco, J.A., Jr., et al. Tracing MYC Expression for Small Molecule Discovery. Cell Chem Biol 2019, 26, 699-710 e696, doi:10.1016/j.chembiol.2019.02.007. 488. Liu, X.; Zhou, Y.; Peng, J.; Xie, B.; Shou, Q.; Wang, J. Silencing c-Myc Enhances the Antitumor Activity of Bufalin by Suppressing the HIF-1alpha/SDF- 1/CXCR4 Pathway in Pancreatic Cancer Cells. Front Pharmacol 2020, 11, 495, doi:10.3389/fphar.2020.00495. 489. Schmidt, E.V. The role of c-myc in regulation of translation initiation. Oncogene 2004, 23, 3217-3221, doi:10.1038/sj.onc.1207548. 490. Stoelzle, T.; Schwarb, P.; Trumpp, A.; Hynes, N.E. c-Myc affects mRNA translation, cell proliferation and progenitor cell function in the mammary gland. BMC Biol 2009, 7, 63, doi:10.1186/1741-7007-7-63. 234 491. Ruggero, D. The role of Myc-induced protein synthesis in cancer. Cancer Res 2009, 69, 8839-8843, doi:10.1158/0008-5472.CAN-09-1970. 492. Lazaris-Karatzas, A.; Sonenberg, N. The mRNA 5' cap-binding protein, eIF-4E, cooperates with v-myc or E1A in the transformation of primary rodent fibroblasts. Mol Cell Biol 1992, 12, 1234-1238, doi:10.1128/mcb.12.3.1234. 493. Pourdehnad, M.; Truitt, M.L.; Siddiqi, I.N.; Ducker, G.S.; Shokat, K.M.; Ruggero, D. Myc and mTOR converge on a common node in protein synthesis control that confers synthetic lethality in Myc-driven cancers. Proc Natl Acad Sci U S A 2013, 110, 11988-11993, doi:10.1073/pnas.1310230110. 494. Tameire, F.; Verginadis, II; Leli, N.M.; Polte, C.; Conn, C.S.; Ojha, R.; Salas Salinas, C.; Chinga, F.; Monroy, A.M.; Fu, W., et al. ATF4 couples MYC- dependent translational activity to bioenergetic demands during tumour progression. Nat Cell Biol 2019, 21, 889-899, doi:10.1038/s41556-019-0347-9. 495. McBryan, J.; Theissen, S.M.; Byrne, C.; Hughes, E.; Cocchiglia, S.; Sande, S.; O'Hara, J.; Tibbitts, P.; Hill, A.D.; Young, L.S. Metastatic progression with resistance to aromatase inhibitors is driven by the steroid receptor coactivator SRC-1. Cancer Res 2012, 72, 548-559, doi:10.1158/0008-5472.CAN-11-2073. 496. Osman, M.H.; Farrag, E.; Selim, M.; Osman, M.S.; Hasanine, A.; Selim, A. Cardiac glycosides use and the risk and mortality of cancer; systematic review 235 and meta-analysis of observational studies. PLoS One 2017, 12, e0178611, doi:10.1371/journal.pone.0178611. 497. Biggar, R.J.; Wohlfahrt, J.; Oudin, A.; Hjuler, T.; Melbye, M. Digoxin use and the risk of breast cancer in women. J Clin Oncol 2011, 29, 2165-2170, doi:10.1200/JCO.2010.32.8146. 498. Sokabe, M.; Fraser, C.S. Toward a Kinetic Understanding of Eukaryotic Translation. Cold Spring Harb Perspect Biol 2019, 11, doi:10.1101/cshperspect.a032706. 499. Iwasaki, S.; Ingolia, N.T. The Growing Toolbox for Protein Synthesis Studies. Trends Biochem Sci 2017, 42, 612-624, doi:10.1016/j.tibs.2017.05.004. 500. Schwanhausser, B.; Busse, D.; Li, N.; Dittmar, G.; Schuchhardt, J.; Wolf, J.; Chen, W.; Selbach, M. Global quantification of mammalian gene expression control. Nature 2011, 473, 337-342, doi:10.1038/nature10098. 501. Aviner, R.; Geiger, T.; Elroy-Stein, O. Novel proteomic approach (PUNCH-P) reveals cell cycle-specific fluctuations in mRNA translation. Genes Dev 2013, 27, 1834-1844, doi:10.1101/gad.219105.113. 502. Dieterich, D.C.; Link, A.J.; Graumann, J.; Tirrell, D.A.; Schuman, E.M. Selective identification of newly synthesized proteins in mammalian cells using 236 bioorthogonal noncanonical amino acid tagging (BONCAT). Proc Natl Acad Sci U S A 2006, 103, 9482-9487, doi:10.1073/pnas.0601637103. 503. Tauber, D.; Tauber, G.; Khong, A.; Van Treeck, B.; Pelletier, J.; Parker, R. Modulation of RNA Condensation by the DEAD-Box Protein eIF4A. Cell 2020, 180, 411-426 e416, doi:10.1016/j.cell.2019.12.031. 504. Bushweller, J.H. Targeting transcription factors in cancer - from undruggable to reality. Nat Rev Cancer 2019, 19, 611-624, doi:10.1038/s41568-019-0196-7. 505. Al-Lazikani, B.; Banerji, U.; Workman, P. Combinatorial drug therapy for cancer in the post-genomic era. Nat Biotechnol 2012, 30, 679-692, doi:10.1038/nbt.2284. 506. Scripture, C.D.; Figg, W.D. Drug interactions in cancer therapy. Nat Rev Cancer 2006, 6, 546-558, doi:10.1038/nrc1887. 507. Ismail, M.; Khan, S.; Khan, F.; Noor, S.; Sajid, H.; Yar, S.; Rasheed, I. Prevalence and significance of potential drug-drug interactions among cancer patients receiving chemotherapy. BMC Cancer 2020, 20, 335, doi:10.1186/s12885-020-06855-9. 508. Zhang, H.; Qian, D.Z.; Tan, Y.S.; Lee, K.; Gao, P.; Ren, Y.R.; Rey, S.; Hammers, H.; Chang, D.; Pili, R., et al. Digoxin and other cardiac glycosides inhibit HIF- 237 1alpha synthesis and block tumor growth. Proc Natl Acad Sci U S A 2008, 105, 19579-19586, doi:10.1073/pnas.0809763105. 509. Ellinghaus, P.; Heisler, I.; Unterschemmann, K.; Haerter, M.; Beck, H.; Greschat, S.; Ehrmann, A.; Summer, H.; Flamme, I.; Oehme, F., et al. BAY 87-2243, a highly potent and selective inhibitor of hypoxia-induced gene activation has antitumor activities by inhibition of mitochondrial complex I. Cancer Med 2013, 2, 611-624, doi:10.1002/cam4.112. 238