DOCSLIB.ORG

A Molecular Signature of Gastric Metaplasia Arising in Response to Acute Parietal Cell Loss

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Molecular Signature of Gastric Metaplasia Arising in Response to Acute Parietal Cell Loss GASTROENTEROLOGY 2008;134:511–522 A Molecular Signature of Gastric Metaplasia Arising in Response to Acute Parietal Cell Loss KOJI NOZAKI,*,‡ MASAKO OGAWA,‡ JANICE A. WILLIAMS,* BONNIE J. LAFLEUR,* VIVIAN NG,§ RONNY I. DRAPKIN,§,ʈ JASON C. MILLS,¶ STEPHEN F. KONIECZNY,# SACHIYO NOMURA,‡ and JAMES R. GOLDENRING* *Nashville VA Medical Center and the Department of Surgery, Vanderbilt-Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, Tennessee; ‡Department of Gastrointestinal Surgery, University of Tokyo, Tokyo, Japan; §Harvard Medical School, Dana-Farber Cancer Institute; ʈDepartment of Pathology, Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts; ¶Department of Pathology and Immunology, Washington University School of Medicine, St. Louis, Missouri; and the #Department of Biological Sciences and the Purdue Cancer Center, Purdue University, West Lafayette, Indiana Background & Aims: Loss of gastric parietal cells is cosa or oxyntic atrophy. The loss of parietal cells leads to a critical precursor to gastric metaplasia and neoplasia. alterations in the cells in the gastric mucosa with the However, the origin of metaplasia remains obscure. emergence of metaplastic mucous cell lineages. The de- Acute parietal cell loss in gastrin-deficient mice treated velopment of oxyntic atrophy and gastric cancer in hu- with DMP-777 leads to the rapid emergence of spasmo- man beings is linked strongly through a sequence of lytic polypeptide/trefoil factor family 2 (TFF2)-express- lineage changes from normal to metaplastic to neoplas- ing metaplasia (SPEM) from the bases of fundic glands. tic.2 Although Helicobacter pylori infection is associated We now sought to characterize more definitively the with the induction of atrophic gastritis and histologic pathway for emergence of SPEM. Methods: Emerging progression to gastric cancer, the exact mechanisms for BASIC– SPEM lineages in gastrin-deficient mice treated with the development of gastric metaplasia remain obscure. In DMP-777 were examined for immunolocalization of addition to their important role in luminal HCl secre- ALIMENTARY TRACT TFF2, intrinsic factor, and Mist1, and morphologically tion, gastric parietal cells also secrete a number of critical with electron microscopy. Emerging SPEM was isolated paracrine and autocrine regulators including sonic with laser-capture microdissection and RNA was ana- hedgehog3 and the epidermal growth factor receptor li- lyzed using gene microarrays. Immunohistochemistry gands transforming growth factor ␣, amphiregulin, and in mouse and human samples was used to confirm heparin binding–epidermal growth factor.4 Thus, loss of up-regulated transcripts. Results: DMP-777–induced parietal cells may alter the intramucosal milieu, leading SPEM was immunoreactive for TFF2 and the differen- to the initiation of metaplasia. It now is clear that 2 types tiated chief cell markers, Mist1 and intrinsic factor, of mucous cell metaplasia develop in the atrophic human suggesting that SPEM derived from transdifferentiation stomach and represent putative preneoplastic lesions: of chief cells. Microarray analysis of microdissected goblet cell intestinal metaplasia and spasmolytic SPEM lineages induced by DMP-777 showed up-regu- polypeptide–expressing metaplasia (SPEM, also known lation of transcripts associated with G1/S cell-cycle as pseudopyloric metaplasia).5 transition including minichromosome maintenance de- In the normal gastric fundic mucosa, progenitor cells ficient proteins, as well as a number of secreted factors, located in the gland neck give rise to 4 types of epithelial including human epididymis 4 (HE4). HE4, which was cells including pepsinogen-secreting zymogenic chief cells, absent in the normal stomach, was expressed in SPEM acid-producing parietal cells, and 2 types of mucous cells: of human and mouse and in intestinal metaplasia and surface mucous cells and mucous neck cells.6 Surface gastric cancer in human beings. Conclusions: Al- mucous cells secrete trefoil factor family 1 (TFF1) and though traditionally metaplasia was thought to origi- mucin 5AC, whereas mucous neck cells secrete spasmo- nate from normal mucosal progenitor cells, these stud- lytic polypeptide/TFF2 and mucin 6. As mucous neck ies indicate that SPEM evolves through either cells migrate towards the bases of fundic glands they transdifferentiation of chief cells or activation of a basal redifferentiate into zymogenic chief cells, which secrete cryptic progenitor. In addition, induction of metaplasia both pepsinogen and intrinsic factor in rodents.6 The elicits the expression of secreted factors, such as HE4, relevant to gastric preneoplasia. Abbreviations used in this paper: HE4, human epididymis 4; MCM, minichromosome maintenance deficient; PCR, polymerase chain re- astric cancer remains the second leading cause of action; SPEM, spasmolytic polypeptide expressing metaplastic lin- cancer-related death worldwide.1 Although the dis- eage; TACC3, transforming acidic coiled-coil–containing protein 3; G TFF2, trefoil factor family 2. crete mechanisms of gastric carcinogenesis remain ob- © 2008 by the AGA Institute scure, one constant in the etiology of gastric cancer is the 0016-5085/08/$34.00 loss of acid-secreting parietal cells from the fundic mu- doi:10.1053/j.gastro.2007.11.058 512 NOZAKI ET AL GASTROENTEROLOGY Vol. 134, No. 2 prezymogenic cells display granules showing features in- days with oral gavage administration of DMP-777 (a gift termediate between those of neck cells and zymogenic of DuPont Pharmaceuticals), formulated in 0.5% meth- chief cells. Importantly, the transition between mucous ylcellulose (administered orally as a gavage once daily at neck cells and chief cells occurs without an intermediate 350 mg/kg/day). Untreated mice were used as controls. transiently amplifying cell and involves the induction of Mice were killed and their stomachs were excised and the transcription factor Mist1, a specific marker for ma- opened along the greater curvature and processed for ture chief cells.7 frozen sections for laser-capture microdissection. From Several mouse models have sought to examine influ- the untreated gastrin-deficient mice, chief cells were mi- ences that may lead to metaplasia. Chronic infection with crodissected from the bases of gastric glands. The emerg- Helicobacter felis leads to oxyntic atrophy and the emer- ing SPEM cells were microdissected from the bases of gence of SPEM, with the eventual development of dys- fundic glands of DMP-777–treated gastrin-deficient mice plasia.8,9 Oral administration of DMP-777, a cell-per- after 1 or 3 days of oral drug administration. Cell collec- meant inhibitor of neutrophil elastase, which also acts as tions (10,000 cells) and extractions of total RNA were a parietal cell–specific protonophore,10 leads to the emer- performed as previously described.12 gence of SPEM, but in the absence of a significant in- Total RNAs from microdissected cells were reverse flammatory response.11,12 Although SPEM develops in transcribed and amplified through 2 rounds of linear wild-type mice after 7–10 days of DMP-777–induced pa- amplification using a Nugen (San Carlos, CA) Ovation rietal cell loss, SPEM develops after only a single dose in kit to amplify and label 10–20 ng of RNA. The resulting ALIMENTARY TRACT gastrin-deficient mice.11 Importantly, emerging SPEM single-strand complementary DNA (cDNA) product was cells express both TFF2 and the mouse chief cell marker purified by binding to and elution from a Qiagen (Va- BASIC– intrinsic factor.11 Thus, although prevailing dogma has lencia, CA) Qiaquick column. The cDNA product then suggested that metaplasias arise from aberrant differen- was measured and 2.2 ␮g of the fragmented, labeled tiation of normal progenitor cells, these findings sug- product was hybridized to Affymetrix (Santa Clara, CA) gested that metaplastic SPEM cells were derived either Mouse 430 2.0 microarrays overnight, with staining and from a cryptic progenitor cell population at the bases of scanning performed the next day (Vanderbilt Microarray fundic glands or from transdifferentiation of chief cells Facility). Gene expression was analyzed among microdis- expressing intrinsic factor into mucous cells expressing sected cells from 4 untreated gastrin-deficient mice, 4 TFF2. mice treated with DMP-777 for 1 day, and 4 mice treated We now report that, in response to parietal cell loss, with DMP-777 for 3 days. The raw gene expression data SPEM arises at the bases of gastric glands distinct from (.cel files) were converted to expression values using the normal progenitor cells. Loss of parietal cells leads to the Affy function in R (http://www.bioconductor.org). the observation of metaplastic cells expressing TFF2 The expression levels between groups were compared first along with the mature chief cell markers, intrinsic factor using an overall permutation F-test for difference be- and Mist1. Microdissected emerging SPEM shows up- tween the groups (control, 1-day treatment, and 3 days of regulation of transcripts associated with G1/S cell-cycle treatment) using analysis of variance; if a statistically transition. In addition, transcripts for a group of secreted significant overall difference was seen then pair-wise dif- ligands were up-regulated prominently in SPEM. In par- ferences between control and 1 day of treatment and ticular, the whey acidic protein domain protein human control and 3 days of treatment were performed using epididymis 4 (HE4) was absent from the normal stom- permutation
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Mary Bartlett Bunge 40
    EDITORIAL ADVISORY COMMITTEE Marina Bentivoglio Larry F. Cahill Stanley Finger Duane E. Haines Louise H. Marshall Thomas A. Woolsey Larry R. Squire (Chairperson) The History of Neuroscience in Autobiography VOLUME 4 Edited by Larry R. Squire ELSEVIER ACADEMIC PRESS Amsterdam Boston Heidelberg London New York Oxford Paris San Diego San Francisco Singapore Sydney Tokyo This book is printed on acid-free paper. (~ Copyright 9 byThe Society for Neuroscience All Rights Reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any information storage and retrieval system, without permission in writing from the publisher. Permissions may be sought directly from Elsevier's Science & Technology Rights Department in Oxford, UK: phone: (+44) 1865 843830, fax: (+44) 1865 853333, e-mail: [email protected]. You may also complete your request on-line via the Elsevier homepage (http://elsevier.com), by selecting "Customer Support" and then "Obtaining Permissions." Academic Press An imprint of Elsevier 525 B Street, Suite 1900, San Diego, California 92101-4495, USA http ://www.academicpress.com Academic Press 84 Theobald's Road, London WC 1X 8RR, UK http://www.academicpress.com Library of Congress Catalog Card Number: 2003 111249 International Standard Book Number: 0-12-660246-8 PRINTED IN THE UNITED STATES OF AMERICA 04 05 06 07 08 9 8 7 6 5 4 3 2 1 Contents Per Andersen 2 Mary Bartlett Bunge 40 Jan Bures 74 Jean Pierre G. Changeux 116 William Maxwell (Max) Cowan 144 John E. Dowling 210 Oleh Hornykiewicz 240 Andrew F.
    [Show full text]
  • Parietal Cell Hyperplasia Induced by Long-Term Administration of Antacids to Rats
    Gut: first published as 10.1136/gut.19.9.798 on 1 September 1978. Downloaded from Gut, 1978, 19, 798-801 Parietal cell hyperplasia induced by long-term administration of antacids to rats G. MAZZACCA1, F. CASCIONE, G. BUDILLON, L. D'AGOSTINO, L. CIMINO, AND C. FEMIANO From the Division of Gastroenterology, 2nd School ofMedicine, University ofNaples, and the Department ofPathology, Institute for Tumoral Diseases, Naples, Italv SUMMARY Suspension of magnesium and aluminum hydroxide (30-60 mEq/24 h) or a comparable volume of water was orally administered by gastric intubation to two groups of 20 male wistar rats each over 60 days. The antacid treatment led to a significant increase in the height (0-464 + 0-02 mm v. 0-318 ± 0 06) and in the volume (472 ± 32 mm3 v. 328 ± 45) of the fundic mucosa ofthe stomach, in the average count of parietal cells per unit area of the mucosa (32-37 ± 1 8 v. 22-3 + 1 6), and in the total parietal cell population of the stomach (53-6 + 3.5 x 106 v. 43-2 + 3.7 x 106). Furthermore fasting serum gastrin concentration was significantly higher in the antacid treated rats (81.2 + 7.4 pg/ml) than in control animals (56-9 ± 6-9 pg/ml). It is known that a feedback mechanism governs the The animals of group B received each time and by relationship between antral gastrin release and the same procedure a comparable volume of water. intraluminal gastric pH (Walsh et al., 1975). During the night each animal was housed in a Furthermore, gastrin exerts a trophic influence on separate cage and the antacid suspension was the the gastric mucosa with increase in the parietal cell only drinking fluid available to the rats of group A.
    [Show full text]
  • The Two Faces of Thrombosis: Coagulation Cascade and Platelet Aggregation. Are Platelets the Main Therapeutic Target
    Thrombosis and Circulation Open Access Cimmino et al., J Thrombo Cir 2017, 3:1 Review Article Open Access The Two Faces of Thrombosis: Coagulation Cascade and Platelet Aggregation. Are Platelets the Main Therapeutic Target? Giovanni Cimmino*, Salvatore Fischetti and Paolo Golino Department of Cardio-Thoracic and Respiratory Sciences, Section of Cardiology, University of Campania “Luigi Vanvitelli”, Naples, Italy *Corresponding author: Giovanni Cimmino, MD, PhD, Department of Cardio-Thoracic and Respiratory Sciences, Section of Cardiology, University of Campania “Luigi Vanvitelli”, via Leonardo Bianchi, 180131 Naples, Italy. Tel: +39-081-7064175, Fax: +39-081-7064234; E-mail: [email protected] Received date: Dec 28, 2016, Accepted date: Jan 27, 2017, Published date: Jan 31, 2017 Copyright: © 2017 Giovanni C, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Abstract Acute thrombus formation is the pathophysiological substrate underlying several clinical conditions, such as acute coronary syndrome (ACS) and stroke. Activation of coagulation cascade is a key step of the thrombotic process: vessel injury results in exposure of the glycoprotein tissue factor (TF) to the flowing blood. Once exposed, TF binds factor VII/VIIa (FVII/FVIIa) and in presence of calcium ions, it forms a tertiary complex able to activate FX to FXa, FIX to FIXa, and FVIIa itself. The final step is thrombin formation at the site of vessel injury with subsequent platelet activation, fibrinogen to fibrin conversion and ultimately thrombus formation. Platelets are the key cells in primary hemostasis.
    [Show full text]
  • Cells Using Gene Expression Profiling and Insulin Gene Methylation
    RESEARCH ARTICLE Comparison of enteroendocrine cells and pancreatic β-cells using gene expression profiling and insulin gene methylation ☯ ☯ Gyeong Ryul Ryu , Esder Lee , Jong Jin Kim, Sung-Dae MoonID, Seung-Hyun Ko, Yu- Bae Ahn, Ki-Ho SongID* Division of Endocrinology & Metabolism, Department of Internal Medicine, College of Medicine, The Catholic University of Korea, Seoul, Korea ☯ These authors contributed equally to this work. a1111111111 * [email protected] a1111111111 a1111111111 a1111111111 a1111111111 Abstract Various subtypes of enteroendocrine cells (EECs) are present in the gut epithelium. EECs and pancreatic β-cells share similar pathways of differentiation during embryonic develop- ment and after birth. In this study, similarities between EECs and β-cells were evaluated in OPEN ACCESS detail. To obtain specific subtypes of EECs, cell sorting by flow cytometry was conducted Citation: Ryu GR, Lee E, Kim JJ, Moon S-D, Ko S- from STC-1 cells (a heterogenous EEC line), and each single cell was cultured and pas- H, Ahn Y-B, et al. (2018) Comparison of saged. Five EEC subtypes were established according to hormone expression, measured enteroendocrine cells and pancreatic β-cells using by quantitative RT-PCR and immunostaining: L, K, I, G and S cells expressing glucagon-like gene expression profiling and insulin gene methylation. PLoS ONE 13(10): e0206401. https:// peptide-1, glucose-dependent insulinotropic polypeptide, cholecystokinin, gastrin and doi.org/10.1371/journal.pone.0206401 secretin, respectively. Each EEC subtype was found to express not only the corresponding Editor: Wataru Nishimura, International University gut hormone but also other gut hormones. Global microarray gene expression profiles of Health and Welfare School of Medicine, JAPAN revealed a higher similarity between each EEC subtype and MIN6 cells (a β-cell line) than Received: March 29, 2018 between C2C12 cells (a myoblast cell line) and MIN6 cells, and all EEC subtypes were highly similar to each other.
    [Show full text]
  • Overview of Gastrointestinal Function
    Overview of Gastrointestinal Function George N. DeMartino, Ph.D. Department of Physiology University of Texas Southwestern Medical Center Dallas, TX 75390 The gastrointestinal system Functions of the gastrointestinal system • Digestion • Absorption • Secretion • Motility • Immune surveillance and tolerance GI-OP-13 Histology of the GI tract Blood or Lumenal Serosal Side or Mucosal Side Structure of a villus Villus Lamina propria Movement of substances across the epithelial layer Tight junctions X Lumen Blood Apical membrane Basolateral membrane X X transcellular X X paracellular GI-OP-19 Histology of the GI tract Blood or Lumenal Serosal Side or Mucosal Side Motility in the gastrointestinal system Propulsion net movement by peristalsis Mixing for digestion and absorption Separation sphincters Storage decreased pressure GI-OP-42 Intercellular signaling in the gastrointestinal system • Neural • Hormonal • Paracrine GI-OP-10 Neural control of the GI system • Extrinsic nervous system autonomic central nervous system • Intrinsic (enteric) nervous system entirely with the GI system GI-OP-14 The extrinsic nervous system The intrinsic nervous system forms complete functional circuits Sensory neurons Interneurons Motor neurons (excitatory and inhibitory) Parasympathetic nerves regulate functions of the intrinsic nervous system Y Reflex control of gastrointestinal functions Vago-vagal Afferent reflex Salivary Glands Composition of Saliva O Proteins α−amylase lactoferrin lipase RNase lysozyme et al mucus O Electrolyte solution water Na+ , K + - HCO3
    [Show full text]
  • Diagnostic Methods in Hematology II
    DiagnosticDiagnostic methodsmethods inin hematologyhematology IIII Jan Zivny Department of Pathophysiology 1. LF UK OutlineOutline Specialized hematology tests • Evaluation of anemia – Anemia basics • Anemia caused by excessive erythrocyte loss • Anemia caused by deficient erythropoiesis • Diagnostic methods used in leukemia/lymphoma ANEMIAANEMIA • WHO criteria: Hb < 125 g/L in adults • US criteria: –M: Hb < 135 g/L –F: Hb < 125 g/L •• AnemiaAnemia isis clinicalclinical signsign CausesCauses ofof anemiaanemia • Insufficient RBC production – deficient erythropoiesis • Excessive RBC loss – Hemolysis (shortened lifespan of erythrocytes) – Acute bleeding (chronic bleeding leads to iron depletion and results in iron loss and deficient erythropoiesis) AnemiaAnemia causedcaused byby deficientdeficient erythropoiesiserythropoiesis Causes of insufficient erythropoiesis? AnemiaAnemia causedcaused byby deficientdeficient erythropoiesiserythropoiesis • Iron metabolism related (microcytic) – Iron deficiency – Chronic diseases • Vitamin B12 or folate deficiency (macrocytic) • Insuficient EPO production and marrow failure (normocytic) – kidney failure – aplastic anemia – myelodysplasia – leukemia DiagnosticDiagnostic aproachesaproaches toto ironiron metabolismmetabolism relatedrelated anemiaanemia IronIron deficiencydeficiency ChronicChronic diseasesdiseases IronIron deficiencydeficiency • microcytic anemia and/or anisocytosis • ↓ blood reticulocytes • hypoproliferative BM • Blood loss in excess of 10 to 20 mL of blood per day (> 5-10 mg of iron) or
    [Show full text]
  • The Mucin 5AC Level in Medical Faculty Students with Computer Vision Syndrome (CVS)
    ORIGINAL ARTICLE Bali Medical Journal (Bali Med J) 2019, Volume 8, Number 2: 460-463 P-ISSN.2089-1180, E-ISSN.2302-2914 The mucin 5AC level in medical faculty students with ORIGINAL ARTICLE Computer Vision Syndrome (CVS) Published by DiscoverSys CrossMark Doi: http://dx.doi.org/10.15562/bmj.v8i2.1425 I Gusti Ayu Made Juliari,1* Ratna Sari Dewi,1 Ni Luh Made Novi Ratnasari,2 Ariesanti Tri Handayani1 Volume No.: 8 ABSTRACT Introduction: Prolonged computer use will lead to a group of level which less than 186.33 ng/mL categorized as low mucin, while symptoms such as dryness of eyes, tired, headache and others called more than 186.33 ng/mL categorized as normal mucin level. Data was Issue: 2 Computer Vision Syndrome (CVS). The decrease of Mucin 5 AC (MUC5AC) analyzed by crosstabulation table and chi-square test with significant level could be one of the signs of dry eye disease on persons with CVS. value p < 0.05. Objective: The purpose of this study is to describe the Mucin 5AC Result: Most of the students who diagnosed with CVS had lower level in medical faculty students of Udayana University, Bali, Indonesia mucin 5AC levels as much as 77,3% and 33,3% students with CVS had First page No.: 460 with CVS. normal mucin 5AC level. This study analyses found there is significant Method: It is an observational cross-sectional analytic study at association between level of mucin 5AC with CVS. The students with Medical Faculty Udayana University on October 2018. Thirty four low level of mucin 5AC had 6,8 higher risk tend to be CVS (OR=6,8; CI P-ISSN.2089-1180 subject selected by purposive sampling and examined with Schirmer 95%= 1,42-32,37; p=0,012).
    [Show full text]
  • Mucins: the Old, the New and the Promising Factors in Hepatobiliary Carcinogenesis
    International Journal of Molecular Sciences Review Mucins: the Old, the New and the Promising Factors in Hepatobiliary Carcinogenesis Aldona Kasprzak 1,* and Agnieszka Adamek 2 1 Department of Histology and Embryology, Poznan University of Medical Sciences, Swiecicki Street 6, 60-781 Pozna´n,Poland 2 Department of Infectious Diseases, Hepatology and Acquired Immunodeficiencies, University of Medical Sciences, Szwajcarska Street 3, 61-285 Pozna´n,Poland; [email protected] * Correspondence: [email protected]; Tel.: +48-61-8546441; Fax: +48-61-8546440 Received: 25 February 2019; Accepted: 10 March 2019; Published: 14 March 2019 Abstract: Mucins are large O-glycoproteins with high carbohydrate content and marked diversity in both the apoprotein and the oligosaccharide moieties. All three mucin types, trans-membrane (e.g., MUC1, MUC4, MUC16), secreted (gel-forming) (e.g., MUC2, MUC5AC, MUC6) and soluble (non-gel-forming) (e.g., MUC7, MUC8, MUC9, MUC20), are critical in maintaining cellular functions, particularly those of epithelial surfaces. Their aberrant expression and/or altered subcellular localization is a factor of tumour growth and apoptosis induced by oxidative stress and several anti-cancer agents. Abnormal expression of mucins was observed in human carcinomas that arise in various gastrointestinal organs. It was widely believed that hepatocellular carcinoma (HCC) does not produce mucins, whereas cholangiocarcinoma (CC) or combined HCC-CC may produce these glycoproteins. However, a growing number of reports shows that mucins can be produced by HCC cells that do not exhibit or are yet to undergo, morphological differentiation to biliary phenotypes. Evaluation of mucin expression levels in precursors and early lesions of CC, as well as other types of primary liver cancer (PLC), conducted in in vitro and in vivo models, allowed to discover the mechanisms of their action, as well as their participation in the most important signalling pathways of liver cystogenesis and carcinogenesis.
    [Show full text]
  • Intrinsic Factor
    ENZYMES INTRINSIC FACTOR EINECS Number 232-711-9 Alternative Names Vitamin B12-binding protein, Factor VII, Intrinsic Factor protein Assay Principle Intrinsic Factor binds specifically to Vitamin B12. The coating of a Vitamin B12-BSA (IF Content) conjugate to the ELISA plate allows for the extent of Intrinsic Factor binding to be investigated. A Mouse monoclonal Anti-Intrinsic Factor antibody is used to identify the concentration of Intrinsic Factor bound to the Vitamin B12. The Antibody bound to the Intrinsic Factor on the plate is identified by use of an Anti Mouse AP conjugate. PNPP substrate is used to develop signals, read at an absorbance of 405nm on a plate reader. What is pernicious anaemia? Key Benefits Intrinsic Factor is primarily used in the diagnosis of pernicious anaemia, a condition caused by a vitamin B12 deficiency. Prevalence in the general + SUPPLY SECURITY population varies from around 3% - 5%, and increases dramatically to Fully manufactured by BBI 5% - 20% among people older than 65 years. Solutions at our Crumlin site, ensuring control over manufacturing processes and supply chain + HIGH PURITY Intrinsic Factor has a purity of >95% ensuring optimal performance in your assay + PROVEN PERFORMANCE Porcine Intrinsic Factor works in a range of immunoassay formats The role of Intrinsic Factor in diagnosis + HIGH QUALITY Intrinsic Factor has a high affinity and specificity to vitamin B12, which Manufactured under a makes it ideal for use in immunoassays. Most commercial assays utilise Quality System compliant a competitive binding technique generating a chemiluminescent signal. with ISO 13485:2016 with Commercial assays can usually detect to a level of ~50 pg/ml vitamin B12.
    [Show full text]
  • Enteric Nervous System (ENS): 1) Myenteric (Auerbach) Plexus & 2
    Enteric Nervous System (ENS): 1) Myenteric (Auerbach) plexus & 2) Submucosal (Meissner’s) plexus à both triggered by sensory neurons with chemo- and mechanoreceptors in the mucosal epithelium; effector motors neurons of the myenteric plexus control contraction/motility of the GI tract, and effector motor neurons of the submucosal plexus control secretion of GI mucosa & organs. Although ENS neurons can function independently, they are subject to regulation by ANS. Autonomic Nervous System (ANS): 1) parasympathetic (rest & digest) – can innervate the GI tract and form connections with ENS neurons that promote motility and secretion, enhancing/speeding up the process of digestion 2) sympathetic (fight or flight) – can innervate the GI tract and inhibit motility & secretion by inhibiting neurons of the ENS Sections and dimensions of the GI tract (alimentary canal): Esophagus à ~ 10 inches Stomach à ~ 12 inches and holds ~ 1-2 L (full) up to ~ 3-4 L (distended) Duodenum à first 10 inches of the small intestine Jejunum à next 3 feet of small intestine (when smooth muscle tone is lost upon death, extends to 8 feet) Ileum à final 6 feet of small intestine (when smooth muscle tone is lost upon death, extends to 12 feet) Large intestine à 5 feet General Histology of the GI Tract: 4 layers – Mucosa, Submucosa, Muscularis Externa, and Serosa Mucosa à epithelium, lamina propria (areolar connective tissue), & muscularis mucosae Submucosa à areolar connective tissue Muscularis externa à skeletal muscle (in select parts of the tract); smooth muscle (at least 2 layers – inner layer of circular muscle and outer layer of longitudinal muscle; stomach has a third layer of oblique muscle under the circular layer) Serosa à superficial layer made of areolar connective tissue and simple squamous epithelium (a.k.a.
    [Show full text]
  • In Vitro Modelling of the Mucosa of the Oesophagus and Upper Digestive Tract
    21 Review Article Page 1 of 21 In vitro modelling of the mucosa of the oesophagus and upper digestive tract Kyle Stanforth1, Peter Chater1, Iain Brownlee2, Matthew Wilcox1, Chris Ward1, Jeffrey Pearson1 1NUBI, Newcastle University, Newcastle upon Tyne, UK; 2Applied Sciences (Department), Northumbria University, Newcastle upon Tyne, UK Contributions: (I) Conception and design: All Authors; (II) Administrative support: All Authors; (III) Provision of study materials or patients: All Authors; (IV) Collection and assembly of data: All Authors; (V) Data analysis and interpretation: All Authors; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. Correspondence to: Kyle Stanforth. NUBI, Medical School, Framlington Place, Newcastle University, NE2 4HH, Newcastle upon Tyne, UK. Email: [email protected]. Abstract: This review discusses the utility and limitations of model gut systems in accurately modelling the mucosa of the digestive tract from both an anatomical and functional perspective, with a particular focus on the oesophagus and the upper digestive tract, and what this means for effective in vitro modelling of oesophageal pathology. Disorders of the oesophagus include heartburn, dysphagia, eosinophilic oesophagitis, achalasia, oesophageal spasm and gastroesophageal reflux disease. 3D in vitro models of the oesophagus, such as organotypic 3D culture and spheroid culture, have been shown to be effective tools for investigating oesophageal pathology. However, these models are not integrated with modelling of the upper digestive tract—presenting an opportunity for future development. Reflux of upper gastrointestinal contents is a major contributor to oesophageal pathologies like gastroesophageal reflux disease and Barratt’s oesophagus, and in vitro models are essential for understanding their mechanisms and developing solutions.
    [Show full text]