Functions of the Viral Chitinase (CHIA) in the Processing

Functions of the viral chitinase (CHIA) in the processing, subcellular trafficking and cellular retention of proV-CATH from Autographa californica multiple nucleopolyhedrovirus

Jeffrey James Hodgson

A Thesis presented to The University of Guelph

In partial fulfilment of requirements for the degree of Doctor of Philosophy in Molecular and Cellular Biology

Guelph, Ontario, Canada

ABSTRACT

FUNCTIONS OF THE VIRAL CHITINASE (CHIA) IN THE PROCESSING, SUBCELLULAR TRAFFICKING AND CELLULAR RETENTION OF PROV- CATH FROM AUTOGRAPHA CALIFORNICA MULTIPLE NUCLEOPOLYHEDROVIRUS

Advisor: Jeffrey James Hodgson Dr. Peter J. Krell University of Guelph co-advisor: Dr. Basil M. Arif

The baculovirus chitinase (CHIA) and cathepsin protease (V-CATH) enzymes cause terminal host insect liquefaction, thereby enhancing dissemination of progeny virions in nature. Regulated and delayed cellular release of these host tissue-degrading enzymes ensures liquefaction starts only after optimal viral replication has occurred. Baculoviral CHIA remains intracellular due to its C-terminal KDEL endoplasmic reticulum (ER) retention motif. However, the intracellular processing and trafficking of the baculovirus v-cath expressed cathepsin (V-CATH) is poorly understood and a mechanism for cellular retention of the inactive V-CATH progenitor (proV-CATH) has not been determined. The cathepsins of Autographa californica multiple nucleoplyhedrovirus (AcMNPV) and most other group I alphabaculoviruses have well-conserved chymotrypsin cleavage (Y11) and myristoylation sites (G12) suggestive of proteolytic cleavage to generate proV-CATH, and subsequent acylation which could promote membrane anchoring in order to foster cellular retention of the protein. Proteolytic

N-terminal processing of baculoviral procathepsin was determined by fusing HA epitope-coding tags to the 5’ and/or 3’ ends of v-cath, indicating that the gene is expressed as a pre-proenzyme. However no evidence for myristoylation of proV-

CATH was found, suggesting that another mechanism is responsible for retaining proV-CATH in cells.

Prior evidence suggested that CHIA is a proV-CATH folding chaperone and that lack of chiA expression causes proV-CATH to become insoluble and unable to mature into V-CATH enzyme. A putative CHIA chaperone activity for assisting in proV-CATH folding implies that proV-CATH and CHIA interact in the

ER of infected cells. Fluorescence microscopy demonstrated co-localization of

CHIA-GFP and proV-CATH-RFP fusion proteins in the ER. An mRFP-based bimolecular fluorescence complementation (BiFC) assay helped to determine not only that AcMNPV proV-CATH interacts directly with the full-length viral CHIA, but also that it independently binds to the N-terminal chitin-binding domain (CBD) and C-terminal active site domain (ASD) of CHIA, in the ER during virus replication. Moreover, reciprocal Ni/HIS pull-downs of HIS-tagged proteins confirmed the proV-CATH interactions with CHIA, or with the CBD and ASD biochemically. The reciprocal co-purification of proV-CATH with all three polypeptides (CHIA, CBD, ASD) suggests proV-CATH specifically interacts with each of them, and corroborates the BiFC data. Furthermore, CHIA KDEL deletion allowed for premature secretion of not only CHIA but also of proV-CATH, suggesting that the CHIA/proV-CATH interaction in the ER aids cellular retention of proV-CATH. In contrast to prior reports, it was also determined that CHIA is

iii

dispensable for correct folding of proV-CATH since proV-CATH produced by a chiA-deficient virus was soluble, prematurely secreted from cells and could mature into V-CATH enzyme. Taken together, these data indicate that the viral chitinase plays a major role in ensuring that proV-CATH is neither prematurely secreted nor activated to V-CATH enzyme.

Acknowledgements

I thank Monique van Oers (Wageningen University) for kindly supplying the chiA/v-cath deletion bacmid (AcΔCCBAC), to Jeffrey Slack for providing the anti-V-CATH serum and to Joachim F. Uhrig (Max Planck Institute for Plant

Breeding Research) for his contribution of the split mRFP constructs pBatTL- smRFPN and pBatTL-smRFPC. Thanks are also given to Éva Nagy for editorial suggestions (Chapter 2) and to David Leishman for technical support. The support of grants to PJK from the Natural Sciences and Engineering Research

Council of Canada (STPGP 365213 and RGPIN 8395) is gratefully acknowledged.

Table of contents

ABSTRACT ...... ii Table of contents ...... vi List of Tables ...... ix List of figures ...... x List of abbreviations ...... xii Virus Abbreviations ...... xiii Chapter 1: Introduction and review of the literature ...... 1 1.1 Baculoviruses ...... 1 1.2 Baculovirus infection and pathogenesis ...... 2 1.3 Baculovirus temporal regulation of gene expression ...... 7 Immediate early and early transcription ...... 9 Late and very late transcription ...... 10 1.4 Chitinases and cathepsin proteases ...... 11 Chitin and chitinases ...... 11 Cathepsin proteases ...... 16 1.5 Baculovirus chiA and v-cath genomic organization and expression ...... 18 AcMNPV chiA expression ...... 22 AcMNPV v-cath expression ...... 25 1.6 CHIA and V-CATH co-dependence in host liquefaction ...... 29 1.7 Rationale, hypotheses and experimental design ...... 32 Chapter 2: Autographa californica multiple nucleopolyhedrovirus and Choristoneura fumiferana multiple nucleopolyhedrovirus v-cath genes are expressed as pre-proenzymes ...... 34 Abstract ...... 34 2.1 Introduction ...... 35 2.2 Materials and Methods ...... 40 Cells and virus ...... 40 V-cath constructs ...... 40 Molecular cloning ...... 41 V-CATH–DsRED/mGFP5 co-localization ...... 45 Western blot analysis ...... 46 2.3 Results and Discussion ...... 46

Analysis of the N-linked glycosylation state of AcMNPV and CfMNPV proV- CATH ...... 46 Proteolytic co-translational removal of the N-terminal signal peptides ...... 48 Subcellular localization of proV-CATH-DsRED ...... 50 Chapter 3: Interaction of Autographa californica multiple nucleopolyhedrovirus proV-CATH with CHIA as a mechanism for proV-CATH cellular retention ...... 53 3.1 Introduction ...... 55 3.2 Materials and Methods ...... 59 Cell and virus ...... 59 Cloning methodology for generating viral constructs ...... 60 Manipulation of viral genomes and generation of engineered viruses ...... 69 Northern blot analysis ...... 71 Western blot analyses ...... 73 Co-localization of CHIA and proV-CATH in virus-infected cells ...... 73 GFP ER-translocation assay ...... 75 mRFP-based bimolecular fluorescence complementation assay...... 76 Ni-agarose affinity co-purification of CHIA and proV-CATH ...... 76 Temporal analysis of CHIA and proV-CATH co-retention/co-secretion ...... 78 3.3 Results ...... 80 Bacmid chiA and v-cath temporal expression profiles ...... 80 Co-localization of CHIA and proV-CATH in virus-infected cells ...... 81 ER-localization of GFP fused to 12 or 22 N-terminal v-cath amino acids .... 84 mRFP-based bimolecular fluorescence complementation ...... 86 Ni-affinity co-purification of CHIA and proV-CATH ...... 89 Effects of CHIA KDEL deletion on CHIA and proV-CATH co-subcellular trafficking ...... 91 3.4 Discussion ...... 95 Chapter 4: ProV-CATH associates with both the CHIA chitin-binding domain and the active site domain, but proV-CATH folding and maturation into active V- CATH enzyme is independent of either CHIA domain ...... 102 4.1 Introduction ...... 104 4.2 Materials and Methods ...... 106 Cell and virus ...... 106 Cloning methodology for generating viral constructs ...... 107 mRFP-based bimolecular fluorescence complementation (BiFC) assay ... 118 Ni-agarose affinity co-purification of CHIA and proV-CATH ...... 119 vii

Sample preparation for immunoblotting ...... 121 Western blot analyses ...... 121 Induction of proV-CATH maturation into V-CATH ...... 122 4.3 Results ...... 123 ProV-CATH co-distributes differentially with CHIA, CBD or ASD and in infected cell culture ...... 123 Co-localization of proV-CATH-RFP with either GFP-CH, GFP-CBD or GFP- ASD in infected cells ...... 126 Ni-affinity co-purification of proV-CATH with the CBD or ASD proteins ..... 130 mRFP-based bimolecular fluorescence complementation ...... 133 Analysis of CA expression by chiA-deficient bacmid viruses ...... 138 Maturation of proV-CATH into V-CATH that is produced by a chiA-deficient virus ...... 142 Association with CH, CBD, ASD or trCHIA differentially co-distribute CA during infection ...... 143 4.4 Discussion ...... 149 Chapter 5: General discussion of the thesis ...... 160 Subcellular trafficking of proV-CATH ...... 162 Mechanism for regulating cellular/ER retention of proV-CATH ...... 164 CHIA domain interactions with proV-CATH ...... 167 Examining the nature and the potential cause of proV-CATH insolubility ...... 171 A fail-safe mechanism to avoid proV-CATH secretion in the absence of CHIA ...... 175 Future research objectives and perspectives ...... 179 References ...... 184

viii

List of Tables

Table 1.1: Distribution of chiA and v-cath genes amongst the baculoviruses…20

Table 2.1: List of DNA oligos (PCR primers) used for Chapter 2……………….42

Table 3.1: PCR template and primer sets used for generating constructs used in Chapter 3…………………………………………………………………65

Table 3.2: Virus constructs generated for chapter 3…………………….……….70

Table 4.1: Primer and template combinations used to produce PCR amplicons that were used to generate constructs used in Chapter 4...... 111

Table 4.2: Summary of the viral constructs (and their novel features) used for this chapter…………………………………………………………………..115

List of figures

Figure 1.1: Structures of baculovirus budded virions (BV) and occlusion-derived virions (ODV)……………………………………………………………..3

Figure 1.2: Schematic of the chiA and v-cath ORF organization in baculoviruses…………………………………………………………….19

Figure 1.3: Domain structure of baculovirus chitinases……………………………23

Figure 1.4: AcMNPV chiA/v-cath genomic organization and intergenic promoter sequences………………………………………………………………..27

Figure 2.1: Protein sequences of predicted N-termini and model for processing of baculoviral v-cath expressed proteins…………………………………37

Figure 2.2: Viral construct schematics. …………………………………..…………39

Figure 2.3: Processing and localization of cathepsin………………………………47

Figure 3.1: Cloning used to generate the virus constructs in Chapter 3…………61

Figure 3.2: Temporal patterns of chiA and v-cath expression by the CH/CA bacmid-derived virus…………………………………………………….72

Figure 3.3: Co-localization of CHIA and proV-CATH in the ER of virus-infected Hi5 cells...... 82

Figure 3.4: Fluorescence patterns of v-cath-GFP fusion proteins………………..85

Figure 3.5: Bimolecular fluorescence complementation (BiFC) assay…………..88

Figure 3.6: Reciprocal Ni-affinity co-purification of 6xHIS-tagged CHIA and proV- CATH…………………………………………………………………...…90

Figure 3.7: Effects of CHIA KDEL deletion on CHIA and proV-CATH co- subcellular trafficking……………………………………………………93

Figure 4.1: Schematics of molecular cloning steps used for generating the various constructs used in Chapter 4...... 108

Figure 4.2: Distribution of proV-CATH, CHIA, CBD and ASD in infected cell culture...... 125

Figure 4.3: Co-localization of proV-CATH-RFP (CA-RFP) with GFP-CH, GFP- CBD or GFP-ASD in virus infected cells...... 128

Figure 4.4: Reciprocal Ni-affinity co-purification of 6xHIS-tagged proV-CATH with CBD or ASD…………………………………………………………….131

Figure 4.5: Bimolecular fluorescence complementation (BiFC) assay…………134

Figure 4.6: ProV-CATH distribution with and without CHIA co-expression and/or N-glycosylation...... 139

Figure 4.7: Schematics of chiA-deficient viruses...... 144

Figure 4.8: Distribution of proV-CATH in cell culture when co-expressed with CHIA, CBD, ASD or trCHIA...... 146

Figure 5.1: Predicted model for proV-CATH processing, interaction with CHIA and retention in the endoplasmic reticulum (ER)...... 180

List of abbreviations

BV budded virus cDNA complementary DNA chiA/CHIA chitinase dsDNA double-stranded DNA E early (gene) E64 trans-epoxysuccinyl-L-leucylamido-(4- guanidino) butane (cysteine protease inhibitor) egfp/EGFP enhanced green fluorescent protein egt/EGT ecdysteroid UDP-glucosyltransferase ER endoplasmic reticulum FBS fetal bovine serum F protein fusion protein GI gastro-intestinal gp64/GP64 glycoprotein 64 GV granulovirus HA haemagglutinin hr homologous region IE immediate early (gene) INR initiator motif kb kilobases kDa kilodaltons L late (gene) LB Luria Bertanni lef-7 late expression factor 7 mmp matrix metalloprotease MOI multiplicity of infection mRNA messenger RNA NPV nucleopolyhedrovirus OB occlusion body ODV occlusion-derived virus ORF open reading frame p10 viral protein 10 kDa PAGE polyacrylamide gel electrophoresis PBS phosphate buffered saline pfu plaque-forming units PM peritrophic membrane polh polyhedrin proV-CATH progenitor of viral cathepsin SDS sodium dodecyl sulfate TCID tissue culture infectious dose v-cath/V-CATH viral cathepsin vef viral enhancing factor VL very late (gene) WT wild type

xii

Virus Abbreviations

Group I Alphabaculoviruses (nucleopolyhedroviruses of lepidoptera)

AnpeNPV Anternaea pernyi nucleopolyhedrovirus AcMNPV Autographa californica multiple nucleopolyhedrovirus AgMNPV Anticarsia gemmatalis multiple nucleopolyhedrovirus BmNPV Bombyx mori nucleopolyhedrovirus BomaNPV Bombyx mandarina nucleopolyhedrovirus CfDEFNPV Choristoneura fumiferana defective nucleopolyhedrovirus CfMNPV Choristoneura fumiferana multiple nucleopolyhedrovirus EppoNPV Epiphyas postvittana nucleopolyhedrovirus HycuNPV Hyphantria cunea nucleopolyhedrovirus MaviMNPV Maruca vitrata multiple nucleopolyhedrovirus OpMNPV Orgyia pseudotsugata multiple nucleopolyhedrovirus PenuNPV Perina nuda nucleopolyhedrovirus PlxyMNPV Plutella xylostella multiple nucleopolyhedrovirus RaouNPV Rachiplusia ou nucleopolyhedrovirus

Group II Alphabaculoviruses (nucleopolyhedroviruses of lepidoptera)

AdhoNPV Adoxophyes honmai nucleopolyhedrovirus AgipMNPV Agrotis ipsilon multiple nucleopolyhedrovirus ChchNPV Chrysodeixis chalcites nucleopolyhedrovirus ClbiNPV Clanis bilineata nucleopolyhedrosis EcobNPV Ecotropis oblique nucleopolyhedrovirus EupsNPV Euproctis pseudoconspersa nucleopolyhedrovirus HearNPV Helicoverpa armigera nucleopolyhedrovirus HzSNPV Helicoverpa zea single nucleopolyhedrovirus LdMNPV Lymantria dispar multiple nucleopolyhedrovirus LeseNPV Leucania separata nucleopolyhedrovirus LyxyNPV Lymantria xylina nucleopolyhedrovirus MacoNPV a Mamestra configurata nucleopolyhedrovirus a MacoNPV b Mamestra configurata nucleopolyhedrovirus b OrerNPV Orgyia ericae nucleopolyhedrovirus OrleNPV Orgyia leucostigma nucleopolyhedrovirus SeMNPV Spodoptera exigua multiple nucleopolyhedrovirus SpltNPV Spodoptera littura nucleopolyhedrovirus SfMNPV Spodoptera frugiperda multiple nucleopolyhedrovirus TrniSNPV Trichoplusia ni single nucleopolyhedrovirus

Betabaculoviruses (granuloviruses of lepidoptera)

AdorGV Adoxophyes orana granulovirus AgseGV Agrotis segetum granulovirus ClanGV Clostera anachoreta granulovirus

xiii

CpGV Cydia pomonella granulovirus CrleGV Cryptophlebia leucotreta granulovirus HbGV Harrasina brillians granulovirus PhopGV Pthorimaea operculella granulovirus PiraGV Pieris rapae granulovirus PlxyGV Plutella xylostella granulovirus PsunGV Pseudaletia unipuncta granulovirus XecnGV Xestia c-nigrum granulovirus

Deltabaculoviruses (nucleopolyhedrovirus of diptera)

CuniNPV Culex nigripalpus nucleopolyhedrovirus

Gammabaculoviruses (nucleopolyhedroviruses of hymenoptera)

NeleNPV Neodiprion lecontei nucleopolyhedrovirus NeseNPV Neodiprion sertifer nucleopolyhedrovirus

xiv

Chapter 1: Introduction and review of the literature

1.1 Baculoviruses

The family Baculoviridae is comprised of four genera: Alphabaculovirus and Betabaculovirus which infect lepidopteran larvae, Deltabaculovirus that is infectious to dipteran larvae and Gammabaculovirus that infect hymenopteran larvae (Fauquet & International Committee on Taxonomy of Viruses., 2005). All genera possess large (80 to 180 kilobase pairs) circular double-stranded DNA genomes that encode up to 181 distinct open reading frames (ORFs) on either strand. Genomes of members of each genus are similarly packaged into nucleocapsids that are over 200 µm long and 30 µm in diameter (Rohrmann &

National Center for Biotechnology Information., 2008). Baculoviruses are infectious to arthropods only, and most baculoviruses characterized thus far are alphabaculoviruses (ie. nucleopolyhedroviruses, NPVs) or betabaculoviruses (i.e. granuloviruses, GVs) that infect larvae of lepidopteran insects. Most baculoviruses have a narrow host range, able to infect only one species and its closest relatives. The type baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) is an exception, infective to several more distantly related hosts. Many homologues of AcMNPV ORFs are found in all other lepidopteran baculovirus genomes, but there is often a lack of strict conservation of genome organization among viruses, and similarly temporally- regulated ORFs generally are not grouped contiguously in the genome (Friesen.,

1997).

1.2 Baculovirus infection and pathogenesis

Lepidopteran baculoviruses are unique in having primary and secondary infection phases due to the production of two distinct virion phenotypes, occluded and budded virions. Infected cells produce both morphological forms of the virus.

Occluded virus (produced in the terminal stages of replication only) constitutes progeny virus responsible for initiating an infection and therefore facilitates horizontal, insect to insect transmission. Budded virions (see Figure 1.1a) are produced only in the early stages of replication, and spread the infection systemically to other cell and tissue types after the infection is initiation by an occluded virus. A nucleocapsid similar to that of BV, that contains the same double-stranded DNA (dsDNA) genome, is found in the occlusion derived virion

(ODV). There are different lipid and protein constituents of the BV and ODV envelopes, reflecting both the subcellular origin of each virion, and the cell populations susceptible to each. The ODV are embedded in occlusion bodies

(OBs), a proteinacious matrix composed largely of a single viral polypeptide: polyhedrin in alphabaculoviruses or NPVs and granulin in betabaculoviruses or

GVs (Funk et al., 1997; Slack & Arif., 2007). NPV OBs contain numerous enveloped virions, and thus are relatively larger (2000 nm) than GV granules or the OBs of hymenopteran or dipteran NPVs (200 x 500 nm), which typically contain only a single ODV. NPV ODVs may contain either a single nucleocapsid

(SNPV) or multiple nucleocapsids (MNPV) (see Figure 1.1b). The ODV within

OBs are an environmentally stable form of extracellular virus, the form encountered by susceptible hosts in the environment. The OB matrix confers

a) Structure of budded virions

b) Structures of occlusion bodies and occlusion-derived virions

Figure 1.1: Structures of baculovirus budded virions (BV) and occlusion-derived virions (ODV). a) The BV of all baculovirus species are similar, except that group I alphabaculoviruses have GP67 as their envelope fusion protein (EFP) instead of the F-protein found in the group II alphabaculoviruses and betabaculoviruses. b) Structures of occlusion bodies (OBs), showing differences between ODV of multiple or single nucleocapsid (MNPV or SNPV, respectively) alphabaculoviruses (nucleopolyhedroviruses, NPVs) and betabaculoviruses (granuloviruses, GVs). The OBs of the deltabaculovirus (CuniNPV) and gammabaculoviruses (NeleNPV and NeseNPV) are similar to that of the GVs. cs = cross-section. Images taken from Slack and Arif (2007).

some protection to ODVs from environmental desiccation and irradiation, remaining infectious to the following season’s larvae. Ingested OBs dissolve in the alkaline midguts of lepidopteran insects, releasing infectious ODV (Federici.,

1997). Released ODV must traverse a chitinous sheath (peritrophic membrane,

PM) that protects the midgut epithelia before ODV can contact the brush border epithelial cells lining the insects’ midgut. Some baculoviruses code for an enhancin or viral enhancing factor (vef), which is a metalloprotease that has been postulated to partially digest the PM, thus aiding ODV penetration through to the gastric epithelia (Derksen & Granados., 1988; Lepore et al., 1996). The ODV infect only the midgut epithelial cells, and entry of ODV nucleocapsids occurs by the direct fusion of viral and cellular membranes (Blissard., 1996). Nucleocapsids travel to the host nucleus via actin cables, where they uncoat and release the circular viral genome. Immediately thereafter, viral ORFs with immediate early promoters are transcribed by the host RNA polymerase II complex (Fuchs et al.,

1983). By six to eight hours post-infection (hours p.i.) early virus genes encoding viral DNA replication enzymes have been expressed to facilitate DNA replication, commencing the late () phase of viral gene expression (Rice & Miller., 1986). By this time the host nucleus is significantly modified to support ensuing virus replication. Viral cytopathic effects include extensive cellular and nuclear swelling, rearrangement of actin filaments and the formation of a “virogenic stroma” where nucleocapsids are assembled inside the nucleus (Carson et al.,

1991b).

Replication in approximately the first 24 hours post-infection produces only

BV, whose envelopes are gained from budding through the host cell plasma membrane. When BVs are released through the basolateral membrane of the primary-infected midgut epithelial cells, they can then spread throughout the insect body via the tracheal (respiratory) system (Engelhard et al., 1994).

Baculoviruses which produce systemic infections in their lepidopteran insect hosts express virally encoded fibroblast growth factor (vFGF) that associates with the BV envelope. The BV associated vFGF induces chemotaxis that causes tracheal cell motility through the basal lamina to the site of the BV-associated vFGF, perhaps providing a conduit for BV systemic infection. In addition, vFGF stimulation of host FGF receptors in turn signals for host cells to secrete matrix metalloproteases (MMPs) that degrade the basal lamina to provide a route for motile (tracheal) cells that are susceptible to infection (Means & Passarelli.,

2010). This aids in a more rapid establishment of systemic infection by BV of the numerous cell types found in tracheal, fat body and ovarian or other tissues.

Although no cellular receptor(s) for BV have been identified, nucleocapsid entry occurs by adsorptive endocytosis and requires the BV envelope-specific “fusion protein” (GP64 of Group I NPVs, F protein of Group II NPVs and the GVs)

(Monsma & Blissard., 1995; Wang et al., 1997; Lung et al., 2002; Pearson &

Rohrmann., 2002). Group II NPVs and GVs lack identifiable gp64 homologues, but Group I NPVs encode gp64 plus homologues of the F protein (ie. Se8 in

SeMNPV, Ld130 in LdMNPV).

ODV production occurs late in the replication cycle, between 24 and 72 hours p.i., acquiring envelopes from the host cell nuclear membrane and through

de novo phospholipid synthesis. Very late genes such as polyhedrin are expressed at extremely high levels after 24 hours of replication, and the

POLYHEDRIN protein constitutes the bulk of OBs and is required for OB formation. In a characteristic baculovirus infection of lepidopteran larvae the host insect dies within 5 to 10 days post-infection, at which time it is engorged with progeny OBs. The occluded progeny viruses are released from the cadaver once it is liquefied by the concerted activity of two late-expressed viral-encoded enzymes, the chiA-encoded chitinase that degrades chitin and the v-cath- encoded cathepsin, a cysteine protease (Hawtin et al., 1997). The activities of these viral enzymes are essential only to the liquefaction process, and not to replication or virulence of wild-type (WT) AcMNPV (Hawtin et al., 1997; Slack et al., 1995). Analogous properties and functions are predicted for all baculovirus chiA and v-cath homologues and have also been demonstrated for the BmNPV

(Ohkawa et al., 1994) and CpGV (Kang et al., 1998) v-cath homologues. The delta- and gammabaculoviruses infect only the gut tissues of dipteran (mosquito) and hymenopteran (sawfly) host larvae, respectively, and do not cause systemic infections. Since these viruses do not need to liquefy their host insect in order to disseminate their progeny OBs, they do not encode homologues of chiA or v-cath since. Rather, they cause viral-induced diarrhea which is sufficient to distribute progeny OBs effectively to other susceptible larvae due to their gregarious lifestyle (Herniou et al., 2004; Hodgson et al., 2011).

The characteristic liquefaction or “melting” of the host cadaver is a hallmark of baculovirus infections of Lepidoptera except AgMNPV, which lacks

homologues of chiA and v-cath (Slack & Shapiro., 2004). Structural and organizational differences in the cuticle do exist between different insect species and developmental forms, but there is a general pattern of an infected insect’s progression towards liquefaction. While still alive, the insect cuticle whitens.

Shortly after host death there is rapid darkening (melanisation) of the cuticle before complete liquefaction of both internal organs and the exoskeleton. Larval whitening is likely attributed to degradation by both the viral chitinase and protease, of cuticular tissues. The darkening is likely attributed to protein melanization caused by host phenoloxidases activated from proenzymatic forms by proteolysis (Slack et al., 1995). Due to the abundance of intracellular CHIA and V-CATH accumulated by the end of replication, with extensive cell death the concomitant activation of V-CATH and release of chitinase occurs and the host carcass liquefies from within (Hawtin et al., 1997). The integument, weakened by enzymatic digestion and desiccation, becomes brittle and the liquefied tissues laden with progeny OBs ooze out. The liberated OB progeny can now be dispersed in the environment and ingested by another susceptible insect that will then afford virus transmission to another subsequent cohort of insects.

1.3 Baculovirus temporal regulation of gene expression

Temporal gene expression is characterized by four transcriptional phases, immediate early (IE or ), early (E or ), late (L or ) and very late (VL or )

(Blissard & Rohrmann., 1990; Friesen & Miller., 1985). Genes are regarded as early or late depending on whether transcription occurs before (early) or after

(late) the onset of viral DNA replication. Early genes are designated as IE or E 7

with respect to how soon following infection they are expressed. Likewise, late genes are designated as L or VL relative to when they are expressed after DNA replication initiation, but also by the presence or absence of a conserved promoter sequence that designates a very late ORF. Early genes encode transcription factors, RNA and DNA polymerases and/or associated factors, which prepare cells for viral DNA replication and late gene expression. Many early genes are not expressed in the late expression phase, but the mode of early gene down-regulation has not been elucidated. Initiation of viral DNA replication is required for the onset of late gene expression. Many late genes encode virus structural proteins, which are required for the assembly, along with newly synthesized genomic DNA, of progeny virions. RNA transcription initiates from conserved promoter sequence motifs specific to either the early or the late transcription phase. Some ORFs are transcribed in both phases and thus the upstream regulatory sequences of these ORFs contain both early and late promoter motifs (Dickson & Friesen., 1991). The sequence motifs specific for each transcription phase are well conserved and can often be used to classify

ORFs as early or late based on their promoter sequences (Friesen., 1997).

Baculoviruses transcribe large polyadenylated RNAs, especially in the late phase of viral transcription (Friesen & Miller., 1985). Such RNAs are structurally polycistronic but likely are functionally monocistronic since an internal ribosome entry site (IRES) like translation initiation mechanism is not known to exist in baculoviruses.

Immediate early and early transcription

Transcription from immediate early (before 2hr p.i.) or early promoters is accomplished by host cell RNA polymerase II and associated factors and can begin within minutes of the nucleocapsid uncoating in the host nucleus (Friesen.,

1997). Purified viral DNA genomes are infectious and nuclear extracts of uninfected host cells can be used for transcription from early viral promoters

(Burand et al., 1980). Core early promoter motifs often contain the characteristic eukaryotic TATA element, located 25 or more bp upstream of the RNA initiation site (Blissard., 1996). It has been demonstrated by mutation and deletion of baculovirus early promoters that the host TATA-binding protein (TBP) initiates assembly of the RNA polymerase II complex at baculovirus TATA elements

(Blissard et al., 1992; Pullen & Friesen., 1995). Another early baculovirus promoter consensus sequence, the arthropod-like initiator-containing (INR)

“CA(G/T)T” motif, may also be found directly upstream of or overlapping the RNA initiation site (Blissard & Rohrmann., 1989). The baculovirus CA(G/T)T INR resembles a consensus sequence described in Drosophila, which binds the transcription factor IID, and its complexes (Arnosti., 2003; Blissard., 1996).

Initiation of RNA transcription usually occurs within the consensus CA(G/T)T sequence which may be present at several sites upstream of a particular ORF.

The efficiency of RNA initiation from early baculovirus promoters is dependent on the presence and conserved sequence of the CA(G/T)T element (Carson et al.,

1991a; Kogan et al., 1995). Proximal or distal cis-acting homologous repeat (hr) regions provide transcriptional enhancer functions for early genes prior to viral

DNA replication when only a few viral DNA templates exist in cells. There are other sequence motifs, (T/A)GATA(A/G) and CACGTG, commonly found in early promoters that also influence early gene expression (Blissard., 1996). Host factors have been found to bind these latter sequences and can influence transcription (Kogan & Blissard., 1994).

Late and very late transcription

Both late and very late promoters contain the consensus “TAAG” sequence motif that does not resemble host RNA polymerase II-responsive elements. A viral- induced RNA polymerase comprised of at least nine proteins of host and/or viral origin is insensitive to the RNA polymerase II inhibitor α-amanitin and does not transcribe from host RNA polymerase II-responsive motifs (TATA, INR) (Beniya et al., 1996). Efficiency of RNA transcription initiation in the late expression phase depends on the context of an 18 bp region containing the TAAG motif

(Morris & Miller., 1994). The TAAG motif itself is insufficient for the increased amount of expression required of the very late ORFs p10 or polh (Lu & Miller.,

1997). A “burst element” which overlaps the translational initiation codon (ATG) of very late ORFs is essential for the greatly increased transcription from such promoters. Expression of some ORFs such as ie-1, gp64 and me53 is accomplished in both the early and late transcriptional phases, and is reflected by the presence of both early and late consensus promoter sequences upstream of these ORFs (de Jong et al., 2009; Friesen., 1997; Knebel-Morsdorf et al.,

1996).

1.4 Chitinases and cathepsin proteases

Chitin and chitinases

Chitin, [(1-4)-linked 2-acetamido-2-deoxy-beta-D-glucan or polymers of N- acetylglucosamine (GlcNAc)] is an abundant polysaccharide in nature restricted to arthropods, nematodes, yeasts and some other fungi (Jollès & Muzzarelli.,

1999). There are two common crystalline forms of this insoluble polymer (α, β) characterized by the non-covalent arrangement of chitin polymers into fibres, but only α-chitin composed of antiparallell chitin polymers is found in insects (Kramer

& Muthukrishnan., 1997). Chitin and covalently attached polypeptides are the primary components of the insect exoskeleton and the PM lining the midgut

(Brandt et al., 1978; Kramer et al., 1985). Different species and developmental forms of arthropods have distinct arrangements and ratios of polypeptides and chitin fibres and other components giving structures with varied physical properties. Chitinous structures are “hardened” by schlerotization, which is the formation of covalent adducts between chitin and associated proteins through oxidized diphenolic compounds. Mineral deposits in chitinous structures constitute rigid crustacean and mollusk exoskeletons and chitin-carotenoid conjugates give characteristic exoskeletal colours to individual arthropod species and their developmental forms (Jollès & Muzzarelli., 1999).

The chitinous insect PM provides a physical barrier to enteric epithelium, protecting it from pathogenic bacterial or viral invasions (Brandt et al., 1978;

Kramer & Muthukrishnan., 1997). Exoskeletons similarly protect against pathogenic organisms and environmental factors and additionally act as support

for musculature. Larval exoskeletons are degraded and replaced at each molting, and the PM may be continually degraded and renewed throughout development.

Degradation of chitinous structures at specific times during insect development requires stringent hormonally regulated expression of host chitinolytic and proteolytic enzymes and their secretion into the molting fluid that encounters the exoskeleton. Chitinolytic enzymes present at incorrect times or amounts during development could degrade the PM and exoskeleton causing loss of muscular support, and allowing invasion of pathogens and desiccation (Kramer et al.,

1985).

Chitinases (EC 3.2.1.14) are chitin-degrading enzymes belonging to glycohydrolase families 18 and 19 (Jollès & Muzzarelli., 1999; Koga et al., 1999).

Family 18 and 19 chitinases differ in tertiary structure, active site motifs, substrate specificity, number and location of chitin-binding domains, hydrolytic mechanisms and anomeric configuration of catalytic products. Family 18 chitinases are found in diverse organisms such as bacteria, yeast, fungi, arthropods and mammals, and are expressed by baculoviruses whereas family

19 chitinases are found predominantly in plants. Chitinases from different organisms, particularly those that do not synthesize chitin, seem to have either a defensive or pathogenic role (Jollès & Muzzarelli., 1999). Chitinase defensive roles are predicted in plants and mammals, whereas entomopathogenic fungi, bacteria or nematode chitinases likely digest insect structures to access vital tissues.

A bacterial chitinase, Serratia marcescens chitinase A (PDB 1CTN)

(Perrakis et al., 1994) is representative of family 18 chitinases with a TIM-like α/β barrel core containing the catalytic residues. AcMNPV (NC 001623) chiA- encoded chitinase (family 18) has 57% amino acid sequence identity and 60.5% similarity to S. marcescens chitinase A but is smaller, lacking the N-terminal domain and a 23 amino acid prokaryotic secretory peptide (Hawtin et al., 1995).

The AcMNPV chitinase has a 17 amino acid N-terminal sequence resembling a eukaryotic signal peptide, and has a C-terminal KDEL motif signaling its retention in the ER so that throughout infection in cell culture, chitinase activity remains intracellular with the N-terminal eukaryotic signal sequence apparently cleaved

(Thomas et al., 1998). The N-terminal cleavage is consistent with the difference in the predicted chiA-encoded MW (60.9 kDa) of AcMNPV chitinase based on its nucleotide sequence compared to that isolated from infected cells (58 kDa)

(Hawtin et al., 1995). Since AcMNPV chitinase is not secreted from cells, presumably the later transcription of v-cath relative to chiA enables accumulation of N-terminally cleaved chitinase in the ER, which is released only upon cellular degradation that is due in part to the cathepsin cysteine protease (see section

1.5 for further discussion of the baculovirus CHIA and V-CATH interdependence), and then enabling degradation of chitin-protein structures together (Hawtin et al., 1997).

Phylogenetic comparison of the S. marcescens and AcMNPV chiA sequences suggests they are related, and since both are enteric lepidopteran pathogens, genetic transfer of S. marcescens chiA to AcMNPV has been proposed (Hawtin et al., 1995). Recent reports (Daimon et al., 2003; Daimon et

al., 2005; Daimon et al., 2006) have identified and characterized a host insect

(Bombyx mori) homologue of the baculoviral chitinase, which raises the question of whether baculovirus chitinase genes were originally derived from bacterial or host insect genomes. The predicted amino acid sequence of the Bombyx mori chitinase (BmChi-h; a family 18 chitinase) is 63% identical to AcMNPV chiA and

73% identical to that of Serratia marcescens. Despite the striking homology among S. marcescens, BmChi-h (insect) and AcMNPV chitinases, they have quite different enzymatic properties (Daimon et al., 2006; Hawtin et al., 1997). S. marcescens and the BmChi-h chitinase A have a narrow pH range (5-9) affording chitinolytic activity, and most activity is lost above pH 6.5. The AcMNPV chitinase has a much broader pH optimum (4-11.5), and has about 50% of its activity at pH

10 compared to pH 7, and has near maximal activity at pH 9. A high pH tolerance of AcMNPV chitinase would enable endo-chitinolysis of the PM in highly alkaline midguts of lepidopteran insects. Insects, fungi, and bacteria often encode several chitinases having distinct substrate profiles, endo- vs. exo-hydrolytic activity and catalytic products (Jollès & Muzzarelli., 1999; Koga et al., 1999; Kramer &

Muthukrishnan., 1997). Alternatively, a single chitinase may be expressed and proteolytically cleaved at amino acid PEST sequence motifs to generate cleavage products having diverse chitinolytic activities (Kramer & Koga., 1986).

Insects control the activities of their hormonally regulated molting chitinase and proteases through PEST-mediated enzymatic turnover to alter enzymatic activities or completely abolish chitinase activity to limit chitin degradation during molting (Kramer & Muthukrishnan., 1997).

Considering the different properties of the bacterial and insect (or baculovirus) chitinases (Daimon et al., 2006; Hawtin et al., 1995), they may all have a common ancestral origin, but they have each evolved in ways such that they can fulfill their necessary biological roles. For instance, the bacterial and insect CHIAs do not maintain much activity above neutral pH whereas the baculoviral enzymes do. Also, they have different subcellular targeting signals.

The bacterial protein lacks the typical eukarytic N-terminal secretory peptide sequence present in both the insect and baculoviral homologues, and the bacterial and insect CHIAs lack the C-terminal endoplasmic retention motif

(KDEL or HDEL) that is present on most baculoviral CHIAs. Expectedly, baculovirus chiA genes are much more related to one another than they are to the bacterial and insect homologues. For example, a BLAST alignment of C. fumiferana nucleopolyhedrovirus (CfMNPV) and AcMNPV chitinases revealed

80% identity and 87% similarity in amino acid sequence, with 75% identity in nucleotide sequence). The CfMNPV chitinase (de Jong et al., 2005; Hodgson et al., 2009) has an extra amino acid (residue 14) but also contains a C-terminal

KDEL motif and a similar 17 amino acid N-terminus as AcMNPV chitinase (59% identity and 82% similarity in amino acid sequence). As expected, C. fumiferana insect and CfMNPV (or AcMNPV) chitinases are much less homologous having

23% identity and 41% similarity in amino acid sequence. They belong to different classes of chitinases (C. fumiferana is family 19, baculovirus is family 18).

Cathepsin proteases

Cathepsin proteases are eukaryotic enzymes that are typically involved in proteolysis within endosomal vesicles. The name cathepsin is derived from the

Greek word “kathepsein” (to digest) (Saftig., 2005). Cathepsins are initially produced as inactive progenitors or proenzymes, which require proteolytic removal of an approximately 100 amino acid prodomain. The prodomain resides in the cleft containing the active site. Thus the proenzyme form is devoid of enzymatic activity because the prodomain acts as an enzyme inhibitor blocking entry of enzymatic substrate into the active site region (Stoka et al., 2005).

Cathepsin is a general term for lysosomal proteases that may contain either an aspartate or cysteine residue in the active site which acts as the nucleophile that initiates the cleavage of peptide bonds in the protein substrates (Turk et al.,

2003). Although initially regarded strictly as broad range proteases involved in the endosomal pathway, some cathepsins (eg. cathepsins B and L) are secreted from tumour cells enabling degradation of extracellular matrix to provide a conduit for cancerous metastases (Turk et al., 2002). Numerous other human pathologies are linked to either the dysregulated expression or inactivity of cathepsins, such as Pycnodysostosis, an autosomal recessive disease that causes bone abnormalities as a result of a mutant cathepsin K which is involved in osteoclast remodeling of bones (Stoka et al., 2005). Cathepsin S is important to immunity since it has a role in MHC II antigen processing and presentation of antigen presenting cells derived from bone marrow (Honey & Rudensky., 2003).

However, the majority of characterized cathepsins are cysteine cathepsins which

are trafficked to endosomes or lysosomes via one or more different protein sorting mechanisms in the trans Golgi network (Saftig., 2005).

Lysosomes are electron dense membranous organelles found in all animal cells except red blood cells. They typically serve as the digestive compartment of cells, constituting either autolysosomes or phagolysosomes, and thus their structure and enzymatic repertoire vary greatly depending on the particular cell type and its physiological state and environment (Lullmann-Rauche., 2005). Cells with non-functional or absent lysosomal hydrolases accumulate the undigested substrates of such enzymes in their lysosomes and cause medically identifiable conditions termed lysosomal storage diseases. Lysosomes are identified both immunohistochemically and cytochemically. Immunohistochemical identification of a lysosome requires its positive immunostaining for, e.g. proton pumps needed for lysosome acidification, and negative immunostaining for the mannose-6- phosphate receptor (MPR) responsible for the delivery of newly synthesized pro- hydrolases to lysosomes and related organelles. Cytochemically lysosomes are characterized for their highly acidic nature and the low pH optima of the contained hydrolases. Endosomes and related vesicles of the endocytic pathway share these cytochemical characteristics, but lysosomes are distinct from these in that they do not contain the MPR, an integral membrane protein found protruding from the lumenal face of endosomal membranes and in clathrin-rich regions of cellular membranes (Saftig., 2005). However, in the case of baculoviral cathepsins (V-CATH enzyme), which likely originated from the host insect, the proenzyme form (proV-CATH) accumulates in the endoplasmic

reticulum of infected cells (Hodgson et al., 2009; Hodgson et al., 2011; Hom &

Volkman., 2000). An unknown factor inside the cell triggers the proteolytic removal of the proV-CATH prodomain inhibitor peptide and virus-induced cell lysis ensues, resulting in the release of active V-CATH into the extracellular space (Hom et al., 2002) to enable host liquefaction in concert with the viral chitinase.

1.5 Baculovirus chiA and v-cath genomic organization and expression

Chitinase and cathepsin homologues are conserved in a majority of the lepidopteran baculoviruses, the Group I and II NPVs and the GVs. The chiA and v-cath ORFs are antiparallel to each other, as they are in Group I NPVs, in 16 of the 19 baculoviruses that harbour both genes. Most group II NPVs and GVs encode chiA and v-cath but the strict Group I NPV-like chiA/v-cath organization is less conserved among these viruses (see Figure 1.2 for schematics and Table

1.1 for chiA and v-cath genomic positions). Of the 16 baculoviruses that encode chiA and v-cath in an antiparallel manner, all but five Group II NPVs (LdMNPV,

MacoNPVA, MacoNPVB, SeMNPV and SpltMNPV) possess the strictly conserved Group I NPV-like small (41 – 122 bp) intergenic chiA/v-cath promoter region. The intergenic chiA/v-cath region of these latter viruses range from 1118 bp in (SeMNPV) to 9042 bp in MacoNPVa. SeMNPV encodes both chiA and v- cath in an orientation opposite that of AcMNPV. In HearNPV and HzSNPV or

XecnGV the chiA and v-cath ORFs are not antiparallel. In these viruses they are organized in a leftward orientation and 9 kb apart in HearNPV and HzSNPV and

Table 1.1: Distribution of chiA and v-cath genes amongst the baculoviruses. The genomic positions and the relative orientations of chiA to v-cath are indicated. Genomic location (orientation) Genbank Intergenic Virus a chiA cath accession # space (bp)

AnpeNPV (-) 95801..97459 (+) 97501..98475 41 AcMNPV (-) 105282..106937 (+) 106983..107954 NC 001623 45 AgMNPV YP 803518 BomaNPV (-) 96279..97934 (+) 97983..98954 YP 002884348 BmNPV (-) 97049..98707 (+) 98756..99727 NC 001962 48 CfMNPV (-) 100081..101739 (+) 101783..102757 NC 004778 43 CfDEFNPV (-) 100771..102429 (+) 102471..103445 NC 005137 41 EppoNPV (-) 90744..92402 (+) 92443..93414 NC 003083 40

HycuNPV (+) 31721..33382 (-) 30705..31679 YP 473218 42 alphabaculoviruses MaviMNPV (-) 83522..85177 (+) 85222..86196 YP 950825 45 OpMNPV (-) 101833..103485 (+) 103527..104501 NC 001875 41 b group I PenuNPV AF289055 PlxyMNPV (-) 105810..107465 (+) 107513..108484 YP 758590 48 RaouMNPV (-) 103143..104798 (+) 104844..105815 NC 003323 45 AdhoNPV (+) 44596..45609 AP006270 AgipMNPV (+) 27524..29266 (-) 22234..23328 YP 002268057 4196 ChchNPV (+) 61580..63298 (-) 60431..61465 YP 249669 115 ClbiNPV (-) 56916..58622 (+) 58919..59896 YP 717597 297 EcobNPV (-) 48434..50170 (+) 50337..51236 YP 874243 167 EupsNPV (-) 49886..51580 (+) 54880..55884 YP 002854665 3300 HearNPV (-) 35617..37371 (-) 46063..47160 NC 003094 8693 c HzSNPV (-) 35419..37146 (-) 46313..47416 NC 003349 9167 c LeseNPV (+) 65288..66367 (+) 43673..44686 YP 758354 20602 c LdMNPV (-) 64801..66477 (+) 72684..73754 NC 001973 6206 alphabaculoviruses LyxyMNPV (-) 61482..63200 (+) 68233..69240 YP 003517806 5033 MacoNPV a (-) 20061..21749 (+) 30792..31805 NC003 529 9042 MacoNPV b (-) 18666..20354 (+) 28710..29735 NC 004117 8355 group II groupII OrleNPV (+) 26996..28693 (-) 22774..23760 YP 001650934 3236 SeMNPV (+) 21122..22840 (-) 18990..20003 AF169823.1 1118 SpfrMNPV (+) 19981..21675 (-) 17759..18778 YP 001036314 1203 SpltMNPV (-) 40767..42461 (+) 49566..50579 NC 003102 7104 TrniSNPV (+) 55359..57098 (-) 54210..55244 YP 308951 115 AdorGV b NC 005038 AgseGV (+) 29758..31515 (-) 28729..29712 NC 005839 45 ClanGV (+) 5236..7002 (-) 7897..8895 895 CpGV (-) 6028..7812 (+) 7935..8936 NC 002816 122 CrleGV b NC 005068 PhopGV b NC 004062 PiraGV (-) 5711..7471 (+) 7546..8565 YP 003429334 75

PlxyGV b NC 002593 betabaculoviruses PsunGV (+) 98925..100032 (-) 61441..62457 YP 003422447 36468 XecnGV (+) 95968..97752 (+) 47561..48601 NC 002331 47367 c CuniNPV NC 003084 NeleNPV NC 005906 NeseNPV NC 005905 a See the list of virus abbreviations for full virus names. b The chiA and v-cath genomic location & sequence information not available. c The chiA and v-cath genes are encoded in the same orientations.

Group I NPVs 40 – 48 bp (except AgMNPV) chiA v-cath CpGV 122 bp

SeMNPV 1118 bp ( v - cath chiA AgseGV 45 bp

LdMNPV 6.2 kb

MacoNPV (A & B) chiA 9.0 & 8.3 kb v-cath SpltMNPV 7.1 kb

HearNPV 9 kb chiA v-cath HzNPV 9 kb

XecnGV v-cath 50 kb chiA

AdhoNPV v-cath

Figure 1.2: Schematics of the chiA and v-cath ORF organization in baculoviruses. The depicted order (top to bottom) signifies the relatedness in chiA/v-cath ORF organization to that of the conserved Group I NPVs; (top = most related, bottom = least related). Genomic positions of these ORFs in each virus are given in Table 1.1.

are in a rightward orientation with 50 kb separating them in XecnGV. AdhoNPV, a Group I alphabaculovirus, encodes only chiA.

AcMNPV is the archtype baculovirus, and therefore the function and expression of its chiA and v-cath homologues are the best characterized of all the baculoviruses, though similar reports of these homologues in CpGV (Daimon et al., 2007b; Kang et al., 1998), BmNPV (Daimon et al., 2007a; Katsuma et al.,

2009; Ohkawa et al., 1994), CfMNPV (Hill et al., 1995) and HzSNPV (Wang et al., 2005) have been published. The HzSNPV chiA ORF is in the same orientation as v-cath and like AcMNPV has a putative late baculovirus promoter sequence (TAAG) and two TATA sequences just upstream (-29 bp; TAAG, -21 and –33 bp; TATA) from its translation initiation codon (ATG) (Wang et al., 2005).

However HzSNPV chiA RNA isolated at 72 hours p.i. is initiated –246 bp upstream from the ATG. Analogous transcriptional phases promote a similar progression of infection and pathogenesis by all baculoviruses in their discrete hosts. Each virus may however have different and distinct expression patterns for either essential (e.g. DNA polymerase) or non-essential but nonetheless conserved (e.g. egt, chiA, v-cath) genes. For instance the HzSNPV chiA RNA and protein is first detected at 16 hours p.i. and 20 hours p.i., respectively (Wang et al., 2005). That AcMNPV is the virus being used in this study, and that its chiA and v-cath expression profiles are well characterized beckons for an elaboration of this virus’ chiA and v-cath expression and function.

AcMNPV chiA expression

The 1653 bp AcMNPV chiA gene (ORF126) is encoded on the minus genomic strand at positions 105,282 – 106,935 (Ayres et al., 1994). Based on comparisons to homologous sequences the baculoviral chiA gene may have been acquired by horizontal transfer from a bacterial inhabitant of lepidopteran digestive tracts (Hawtin et al., 1995). The deduced viral protein sequence most resembles (60.5 % identity) that of the Serratia marcescens chitinase A, although they harbour divergent amino-terminal signal peptides. Despite such high homology, the AcMNPV chitinase was considered to have an activity profile unparalleled to its bacterial counterpart, possessing high levels of both exo- and endochitinolytic activity and retaining activity at a broad pH range from 3 to 12

(Hawtin et al., 1997). The CHIA amino acid sequences are well conserved (54 –

91% identity) amongst all characterized baculovirus chitinases (Wang et al.,

2005). The Epiphyas postvittana nucleopolyhedrovirus (EppoNPV) chitinase, which is 78% identical (87% similar) to AcMNPV chitinase (see Figure 1.2 for structure), is documented as being an exochitinase lacking any endochitinolytic activity (Young et al., 2005). Whereas Hawtin et al. (1997) used short water soluble fluorigenic enzymatic substrates to characterize the AcMNPV CHIA activity profile, Young et al. (2005) determined that short chitin oligomers (2-4 chitin units) cannot be used to define chitinolytic profiles accurately because they auto-fluoresce in alkaline buffer without being hydrolyzed, which causes an over- estimation of activity levels.

The AcMNPV chiA mRNA transcriptional initiation site has been mapped

to a consensus late baculovirus promoter (TAAG) located 14 nucleotides upstream of the translational start codon (ATG) (Hawtin et al., 1997; Hodgson et al., 2007). Chitinase protein is detected in the cell lysate at 8-9 hours p.i. and 12 hours p.i. by enzymatic assay and immunoblot, respectively (Hawtin et al., 1997;

Hodgson et al., 2007; Thomas et al., 1998). Active enzyme is subsequently expressed through the terminal stages of virus replication. Nascent CHIA (551 amino acids) has a 17 residue amino-terminal secretory signal peptide (Hawtin et al., 1995; Thomas et al., 1998), and a carboxy-terminal KDEL endoplasmic reticulum (ER) retention motif (Thomas et al., 1998). The amino-terminal signal peptide is cleaved upon entry into the secretory pathway. Processed enzyme is returned to the ER via a retrograde Golgi vesicular transport system directed by its carboxy-terminal KDEL sequence. The intracellular CHIA transport and localization was demonstrated by immunogold and immunofluorescence microscopy(Thomas et al., 1998) and by the mutation or deletion of the KDEL- coding nucleotides (Saville et al., 2002).

Figure 1.2: Domain structure of baculovirus chitinases. a) Ribbon diagram depicting the folds comprising the N-terminal chitin-binding domain (CBD) and

C-terminal active site domain (ASD). b) Diagram of surface hydrophobicity for the baculovirus chitinase. Both diagrams were adapted from Young et al. (2005) that modeled EppoNPV CHIA against CHIA of S. marcescens. The EppoNPV CHIA is 78% identical (87% similar) to AcMNPV CHIA. PKD domain is a polycystic kidney disease domain. TIM refers to triosphosphate isomerase.

Active enzyme, which accumulates in the ER throughout replication, is presumably released from the cell only upon its death and subsequent lysis, and may be influenced by the release and activation of V-CATH (Hom et al., 2002).

There is evidence that CHIA, in a cellular calnexin/calreticulin-like manner

(Ellgaard & Helenius., 2003), acts as a chaperone for promoting proper folding of proV-CATH, through binding via its N-terminal chitin-binding domain to an N- linked (Asn65) oligosaccharide of proV-CATH (Daimon et al., 2007a; Hom &

Volkman., 2000; Katsuma et al., 2009). If CHIA is not expressed or if protein glycosylation is inhibited with tunicamycin, non-functional proV-CATH aggregates in the ER of infected cells and internal organs of infected insects do not liquefy

(Hom et al., 2002).

AcMNPV v-cath expression

The 966 bp AcMNPV v-cath gene (ORF127) is encoded on the plus genomic strand at positions 106983 –107954 and encodes a deduced pre- proprotease of 322 amino acids (Hodgson et al., 2009). A ~1.5 kb v-cath-specific

RNA is transcribed from 9 hr p.i. in Sf21 cells (Hodgson et al., 2007). A consensus late baculovirus promoter (TAAG) is found 25 - 29 nucleotides upstream of the translational start codon, and is the RNA transcriptional start site

(Hill et al., 1995). The AcMNPV and CfMNPV (Hill et al., 1995), BmNPV (Ohkawa et al., 1994) and CpGV (Kang et al., 1998) v-cath (or cysteine protease, CP) have similar promoter regions and the v-cath RNA initiation sites have been mapped to the corresponding and similarly located upstream TAAG motifs of all

of these viruses. Rapid amplification of cDNA end (RACE) mapping determined that the major v-cath RNA is terminated at nucleotide 108127, 173 bases beyond the v-cath ORF (Hodgson et al., 2007). There is a considerable lag between the time post-infection (9 hrs p.i.) that v-cath RNA is detected (Hodgson et al., 2007) compared to the time when proV-CATH is detectable (Hom et al., 2002; Slack et al., 1995). In AcMNPV, CfMNPV (Hill et al., 1995) and most other baculoviruses that encode a v-cath gene, a short minicistron (ATGTAA) exists between the v- cath promoter (TAAG) and translational start codon (ATG) (Figure 1.3). Hill et al.

(1995) suggested that this minicistron sequence could reduce the efficiency of v- cath expression as has been shown for a similar minicistron upstream of other baculovirus genes (Blissard & Rohrmann., 1989; Weyer & Possee., 1988). Based on temporal v-cath Northern blot data indicating that v-cath is transcribed from 9 hr p.i. (Hodgson et al., 2007), this minicistron in AcMNPV may modulate the efficiency of translating v-cath RNA to protein (Morris & Geballe., 2000). In addition, quantitative reverse-transcriptase PCR (qRT-PCR) experiments comparing kinetics of chiA versus v-cath RNA transcription demonstrated there is an excess of chiA to v-cath RNA (4-6 fold more) detectable at 24 hr p.i. (Mike

Norris, personal communications). Therefore, reduced transcription of v-cath relative to chiA as well as the putatively reduced translation of pre-proV-CATH from v-cath RNA could perhaps both ensure that sufficient CHIA protein accumulates in the ER before proV-CATH is translated, where CHIA is postulated to help nascent proV-CATH fold

start/stop v-cath chiA CAT TTTAATTTATCTTAATTTTAAGTTGTAATTATTTTATGTAAAAAA ATG v-cath ’ GTA AAATTAAATAGAATTAAAATTCAACATTAATAAAATACATTTTTT TAC chiA Figure 1.3: AcMNPV chiA/v-cath genomic organization and intergenic promoter sequences. The chiA and v-cath ORFs are contiguous and arranged head-to-head such that v-cath is encoded on the top (+) strand and chiA is encoded on the bottom (-) strand. The mRNA transcription sites, from the first “A” of the baculovirus late promoter TAAG motif, upstream of each ORF are indicated by arrows. The boxed sequence labeled start/stop refers to the out of frame ATG upstream of the v-cath ORF that is conserved amongst most baculoviruses that encode v-cath.

correctly (Daimon et al., 2007a; Hom & Volkman., 2000) or may merely help retain proV-CATH in the ER until virus-induced cell lysis occurs (Hodgson et al.,

2009; Hodgson et al., 2011).

AcMNPV cathepsin accumulates in cells as an inactive proenzyme (proV-

CATH), first detectable between 18 and 22 hours p.i. by activity assays and immunoblot (Hodgson et al., 2011; Slack et al., 1995). Eighteen N-terminal amino acids (Gotoh et al., 2010a) of the nascent polypeptide (pre-proV-CATH) are removed proteolytically upon its co-translational import into the endoplamic reticulum (ER). ProV-CATH is N-glycosylated and accumulates in the ER throughout the remainder of replication (Hodgson et al., 2009; Hodgson et al.,

2011; Hom et al., 2002; Slack et al., 1995). Although the natural, in vivo trigger for proteolytic proV-CATH maturation to V-CATH enzyme is unknown proV-

CATH autocatalysis into V-CATH can be induced by SDS or acidic (pH = 4) buffer (Hom & Volkman., 1998; Hom & Volkman., 2000). Presumably as is known for propapain, proteolysis at Pro113 of proV-CATH produces the active V-CATH protease. From these data it seems apparent that the proV-CATH is released and activated only upon