9 Disorders of Fructose Metabolism
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Prevalence of Fructose Malabsorption in Patients with Irritable Bowel Syndrome After Excluding Small Intestinal Bacterial Overgrowth
J Neurogastroenterol Motil, Vol. 24 No. 2 April, 2018 pISSN: 2093-0879 eISSN: 2093-0887 https://doi.org/10.5056/jnm17044 JNM Journal of Neurogastroenterology and Motility Original Article Prevalence of Fructose Malabsorption in Patients With Irritable Bowel Syndrome After Excluding Small Intestinal Bacterial Overgrowth Kee Wook Jung,1 Myeognsook Seo,1 Young Hwan Cho,1 Young-Ok Park,2 So-Yoon Yoon,2 Jungbok Lee,3 Dong-Hoon Yang,1 In Ja Yoon,1 So Young Seo,1 Hyo Jeong Lee,1 Sang Hyoung Park,1 Kyung Jo Kim,1 Byong Duk Ye,1 Jeong-Sik Byeon,1 Hwoon-Yong Jung,1 Suk-Kyun Yang,1 Jin-Ho Kim,1 and Seung-Jae Myung1* Departments of 1Gastroenterology, 2Clinical Nutrition, and 3Clinical Epidemiology and Biostatistics, Asan Medical Center, University of Ulsan College of Medicine, Seoul, Korea Background/Aims Fructose malabsorption (FM) mimics symptoms of irritable bowel syndrome (IBS), and its prevalence has increased. Diagnosing FM in IBS is challenging because of its overlap with small intestinal bacterial overgrowth (SIBO). We assessed the prevalence of FM by comparing patients with IBS with asymptomatic control individuals after excluding SIBO using the glucose hydrogen breath test (HBT). Methods Patients diagnosed with IBS and asymptomatic control individuals were enrolled prospectively. Dietary habits were assessed with the Food Frequency Questionnaire. After excluding SIBO, participants underwent HBTs with both 15 g and 25 g of fructose. Results Thirty-five patients with IBS and 35 age- and sex-matched asymptomatic control individuals were enrolled. The 15-g fructose HBT yielded positive results in 7 of the 35 (20.0%) patients with IBS and in 2 of 35 (5.7%) controls (P = 0.070). -
Indications for a Central Role of Hexokinase Activity in Natural Variation of Heat Acclimation in Arabidopsis Thaliana
Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 14 June 2020 doi:10.20944/preprints202006.0169.v1 Article Indications for a central role of hexokinase activity in natural variation of heat acclimation in Arabidopsis thaliana Vasil Atanasov §, Lisa Fürtauer § and Thomas Nägele * LMU Munich, Plant Evolutionary Cell Biology, Großhaderner Str. 2-4, 82152 Planegg, Germany § Authors contributed equally * Correspondence: [email protected] Abstract: Diurnal and seasonal changes of abiotic environmental factors shape plant performance and distribution. Changes of growth temperature and light intensity may vary significantly on a diurnal, but also on a weekly or seasonal scale. Hence, acclimation to a changing temperature and light regime is essential for plant survival and propagation. In the present study, we analyzed photosynthetic CO2 assimilation and metabolic regulation of the central carbohydrate metabolism in two natural accessions of Arabidopsis thaliana originating from Russia and south Italy during exposure to heat and a combination of heat and high light. Our findings indicate that it is hardly possible to predict photosynthetic capacities to fix CO2 under combined stress from single stress experiments. Further, capacities of hexose phosphorylation were found to be significantly lower in the Italian than in the Russian accession which could explain an inverted sucrose-to-hexose ratio. Together with the finding of significantly stronger accumulation of anthocyanins under heat/high light these observations indicate a central role of hexokinase activity in stabilization of photosynthetic capacities within a changing environment. Keywords: photosynthesis; carbohydrate metabolism; hexokinase; heat acclimation; environmental changes; natural variation; high light; combined stress. 1. Introduction Changes of growth temperature and light intensity broadly affect plant molecular, physiological and developmental processes. -
Limiting Fructose, Fructans Intake May Ease IBS
36 Digestive Disorders FAMILY P RACTICE N EWS • July 1, 2008 Limiting Fructose, Fructans Intake May Ease IBS BY MARY ANN MOON “marked and sustained global improve- of irritable bowel syndrome (IBS) in patients prove symptoms. In the current study, the Contributing Writer ment in gastrointestinal symptoms,” re- who also have fructose malabsorption. researchers focused on osmotic load with- searchers noted. A subsequent study of The results also demonstrate that re- in the lumen and fermentative gas content. atients with irritable bowel syn- the patients revealed that symptom relief stricting intake of these substances may Poorly absorbed short-chain carbohy- drome and fructose malabsorption was not specific to restricted intake of lead to durable symptomatic improve- drates, including fructose and lactose, are Pappeared to benefit from a diet that fructose, but was achieved by limiting the ment, wrote Ms. Shepherd, a dietician at highly fermentable. They exert a strong restricted intake of fructose and fructans, intake of poorly absorbed short-chain Australia’s Monash University, Clayton, osmotic effect in people who have malab- Susan J. Shepherd and her colleagues re- carbohydrates. Victoria, and her colleagues. sorption of these two sugars—about 40% ported in an article appearing in the July These findings “represent the first high- They theorized that, because many ab- of the population in the case of fructose, 2008 issue of Clinical Gastroenterology level evidence” that poorly absorbed short- dominal symptoms may originate from and between 15% to 100% of the popula- and Hepatology. chain carbohydrates—fructose and fruc- bowel distension, addressing factors that tion for lactose. In the 25-patient study, the diet led to tans—are dietary triggers for the symptoms contribute to the distension would im- To minimize or eliminate intake of poor- ly absorbed short-chain carbohydrates, the investigators created a diet that omitted Brief Summary—see package insert for full prescribing information. -
Labeled in Thecourse of Glycolysis, Since Phosphoglycerate Kinase
THE STATE OF MAGNESIUM IN CELLS AS ESTIMATED FROM THE ADENYLATE KINASE EQUILIBRIUM* BY TRWIN A. RoSE THE INSTITUTE FOR CANCER RESEARCH, PHILADELPHIA Communicated by Thomas F. Anderson, August 30, 1968 Magnesium functions in many enzymatic reactions as a cofactor and in com- plex with nucleotides acting as substrates. Numerous examples of a possible regulatory role of Mg can be cited from studies with isolated enzymes,'- and it is known that Mg affects the structural integrity of macromolecules such as trans- fer RNA" and functional elements such as ribosomes.'0 The major problem in translating this information on isolated preparations to the functioning cell is the difficulty in determining the distribution of Mg and the nucleotides among the free and complexed forms that function in the region of the cell for which this information is desired. Nanningall based an attempt to calculate the free Mg2+ and Ca2+ ion concentrations of frog muscle on the total content of these metals and of the principal known ligands (adenosine 5'-triphosphate (ATP), creatine-P, and myosin) and the dissociation constants of the complexes. However, this method suffers from the necessity of evaluating the contribution of all ligands as well as from the assumption that all the known ligands are contributing their full complexing capacity. During studies concerned with the control of glycolysis in red cells and the control of the phosphoglycerate kinase step in particular, it became important to determine the fractions of the cell's ATP and adenosine 5'-diphosphate (ADP) that were present as Mg complexes. Just as the problem of determining the distribution of protonated and dissociated forms of an acid can be solved from a knowledge of pH and pKa of the acid, so it would be possible to determine the liganded and free forms of all rapidly established Mg complexes from a knowledge of Mg2+ ion concentration and the appropriate dissociation constants. -
Molecular Analysis of the Aldolase B Gene in Patients with Hereditary
1of8 J Med Genet: first published as 10.1136/jmg.39.9.e56 on 1 September 2002. Downloaded from ONLINE MUTATION REPORT Molecular analysis of the aldolase B gene in patients with hereditary fructose intolerance from Spain J C Sánchez-Gutiérrez, T Benlloch, M A Leal, B Samper, I García-Ripoll, J E Felíu ............................................................................................................................. J Med Genet 2002;39:e56 (http://www.jmedgenet.com/cgi/content/full/39/9/e56) ereditary fructose intolerance (HFI) is an autosomal resident in the following regions: Madrid (11 families), Anda- recessive metabolic disorder caused by aldolase (fructo- lusia (4), Galicia (3), Estremadura (1), Valencia (1), and Hsediphosphate aldolase, EC 4.1.2.13) B deficiency.1 The Spanish possessions in North Africa (1). HFI diagnosis was B isoform of aldolase is critical for the metabolism of based on enzymatic studies (deficient aldolase B activity in exogenous fructose by the liver, kidney, and intestine, since it hepatic biopsies from 16 patients) or clinical symptoms (six can use fructose-1-phosphate as substrate at physiological patients). Another six subjects were suspected to suffer from concentrations, unlike aldolases A and C. Affected subjects HFI on the basis of dietary intolerance with episodes sugges- suffer abdominal pain, vomiting, and hypoglycaemia after the tive of hypoglycaemia and occurrence of the disease in their ingestion of fructose, sucrose, or sorbitol. Continued ingestion first degree relatives. of noxious sugars causes hepatic and renal injury, which eventually leads to liver cirrhosis and sometimes death, Reagents particularly in small infants.1 Treatment consists of strict Thermostable DNA polymerase, deoxynucleotides, and gen- elimination of fructose, sucrose, and sorbitol from the diet eral PCR products were from Biotools (Madrid, Spain). -
Open Full Page
Research Article Glutathione Transferase P Plays a Critical Role in the Development of Lung Carcinogenesis following Exposure to Tobacco-Related Carcinogens and Urethane Kenneth J. Ritchie,1 Colin J. Henderson,1 Xiu Jun Wang,1 Olga Vassieva,1 Dianne Carrie,1 Peter B. Farmer,2 Margaret Gaskell,2 Kevin Park,3 and C. Roland Wolf1 1Cancer Research UK Molecular Pharmacology Unit, Biomedical Research Centre, Ninewells Hospital and Medical School, Dundee, United Kingdom; 2Cancer Biomarkers and Prevention Group, Biocentre, University of Leicester, Leicester, United Kingdom;and 3Department of Pharmacology and Therapeutics, University of Liverpool, Liverpool, United Kingdom Abstract family of dimeric enzymes (EC 2.5.1.18;GST a, A, k, u, j, ~, n, and N) Human cancer is controlled by a complex interaction between identified on the basis of their amino acid sequence and substrate genetic and environmental factors. Such environmental specificity (4). GSTs are regarded as being important detoxification factors are well defined for smoking-induced lung cancer; enzymes due to their capacity to catalyze the addition of reduced however, the roles of specific genes have still to be elucidated. glutathione (GSH) to reactive electrophiles produced by cyto- Glutathione transferase P (GSTP) catalyzes the detoxification chrome P450 metabolism. As a consequence, there has been a of electrophilic diol epoxides produced by the metabolism of significant interest in elucidating the relationship between GSTP polycyclic aromatic hydrocarbons such as benzo[a]pyrene function and resistance to cancer chemotherapeutic agents and the development of cancer (5–7). In a genetic approach to study GST (BaP), a common constituent of tobacco smoke. Activity- altering polymorphisms in Gstp have therefore been speculated functions, we have generated mice nulled at the Gstp gene locus to be potential risk modifiers in lung cancer development. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Isolation and Characterization of a Mutant Liver Aldolase in Adult Hereditary Fructose Intolerance
Isolation and characterization of a mutant liver aldolase in adult hereditary fructose intolerance. Identification of the enzyme variant by radioassay in tissue biopsy specimens Timothy M. Cox, … , Michael Camilleri, Arthur H. Burghes J Clin Invest. 1983;72(1):201-213. https://doi.org/10.1172/JCI110958. Hereditary fructose intolerance (HFI) is a metabolic disorder caused by enzymic deficiency of aldolase B, a genetically distinct cytosolic isoenzyme expressed exclusively in liver, kidney, and intestine. The molecular basis of this enzyme defect has been investigated in three affected individuals from a nonconsanguineous kindred, in whom fructose-l- phosphate aldolase activities in liver or intestinal biopsy samples were reduced to 2-6% of mean control values. To identify a putative enzyme mutant in tissue extracts, aldolase B was purified from human liver by affinity chromatography and monospecific antibodies were prepared from antiserum raised in sheep. Immunodiffusion gels showed a single precipitin line common to pure enzyme and extracts of normal liver and intestine, but no reaction with extracts of brain, muscle, or HFI liver. However, weak positive staining for aldolase in hepatocyte and enterocyte cytosol was demonstrated by indirect immunofluorescence of HFI tissues. This was abolished by pretreatment with pure enzyme protein. Accordingly, a specific radioimmunoassay (detection limit 7.5 ng) was established to quantify immunoreactive aldolase B in human biopsy specimens. Extracts of tissue from affected patients gave 10-25% immunoreactive enzyme in control samples; immunoreactive aldolase in intestinal extracts from four heterozygotes was reduced (to 55%) when compared with seven samples from normal control subjects (P < 0.05). In extracts of HFI tissues, there was a sevenfold reduction in apparent absolute specific […] Find the latest version: https://jci.me/110958/pdf Isolation and Characterization of a Mutant Liver Aldolase in Adult Hereditary Fructose Intolerance IDENTIFICATION OF THE ENZYME VARIANT BY RADIOASSAY IN TISSUE BIOPSY SPECIMENS TIMOTHY M. -
Fructose in Medicine Jussi K. HUTTUNEN
Postgrad Med J: first published as 10.1136/pgmj.47.552.654 on 1 October 1971. Downloaded from Poitgraduate Medical Journal (October 1971) 47, 654-659. CURRENT SURVEY Fructose in medicine A review with particular reference to diabetes mellitus Jussi K. HUTTUNEN M.D. Third Department of Medicine, University of Helsinki, Finland Summary and in experimental animals. Earlier suggestions con- A review is given of the metabolism of fructose in the cerned with the atherogenic properties of fructose mammalian organism, and its significance in medicine. have recently been challenged. The apparent increase Emphasis is laid upon the absorption and assimilation in the incidence of coronary disease among sucrose of fructose through pathways not identical with those users seems to be a statistical artefact, caused by the of glucose. The metabolism of fructose is largely increased ingestion of coffee and soft drinks by insulin-independent, although the ultimate fate of cigarette smokers. fructose carbons is determined by the presence or the absence of insulin. Introduction Clinical and experimental work has suggested that The metabolism of fructose has engaged the atten- fructose may exert beneficial effects as a component tion of clinicians since 1874, when Kulz suggestedProtected by copyright. of the diet for patients with mild and well-balanced that diabetic patients can assimilate fructose better diabetes. Fructose is absorbed slowly from the gut, than glucose. These observations have been con- and does not induce drastic changes in blood sugar firmed in a number of experimental and clinical levels. Secondly, fructose is metabolized by insulin- studies (Minkowski, 1893; Naunyn, 1906; Joslin, independent pathways in the liver, intestinal wall, 1923), it being further shown that in some patients kidney and adipose tissue. -
Fructose and Mannose in Inborn Errors of Metabolism and Cancer
H OH metabolites OH Review Fructose and Mannose in Inborn Errors of Metabolism and Cancer Elizabeth L. Lieu †, Neil Kelekar †, Pratibha Bhalla † and Jiyeon Kim * Department of Biochemistry and Molecular Genetics, University of Illinois, Chicago, IL 60607, USA; [email protected] (E.L.L.); [email protected] (N.K.); [email protected] (P.B.) * Correspondence: [email protected] † These authors contributed equally to this work. Abstract: History suggests that tasteful properties of sugar have been domesticated as far back as 8000 BCE. With origins in New Guinea, the cultivation of sugar quickly spread over centuries of conquest and trade. The product, which quickly integrated into common foods and onto kitchen tables, is sucrose, which is made up of glucose and fructose dimers. While sugar is commonly associated with flavor, there is a myriad of biochemical properties that explain how sugars as biological molecules function in physiological contexts. Substantial research and reviews have been done on the role of glucose in disease. This review aims to describe the role of its isomers, fructose and mannose, in the context of inborn errors of metabolism and other metabolic diseases, such as cancer. While structurally similar, fructose and mannose give rise to very differing biochemical properties and understanding these differences will guide the development of more effective therapies for metabolic disease. We will discuss pathophysiology linked to perturbations in fructose and mannose metabolism, diagnostic tools, and treatment options of the diseases. Keywords: fructose and mannose; inborn errors of metabolism; cancer Citation: Lieu, E.L.; Kelekar, N.; Bhalla, P.; Kim, J. Fructose and Mannose in Inborn Errors of Metabolism and Cancer. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Chrebp-Knockout Mice Show Sucrose Intolerance and Fructose Malabsorption
nutrients Article ChREBP-Knockout Mice Show Sucrose Intolerance and Fructose Malabsorption Takehiro Kato 1, Katsumi Iizuka 1,2,* ID , Ken Takao 1, Yukio Horikawa 1, Tadahiro Kitamura 3 and Jun Takeda 1 1 Department of Diabetes and Endocrinology, Graduate School of Medicine, Gifu University, Gifu 501-1194, Japan; [email protected] (T.K.); [email protected] (K.T.); [email protected] (Y.H.); [email protected] (J.T.) 2 Gifu University Hospital Center for Nutritional Support and Infection Control, Gifu 501-1194, Japan 3 Metabolic Signal Research Center, Institute for Molecular and Cellular Regulation, Gunma University, Gunma 371-8512, Japan; [email protected] * Correspondence: [email protected]; Tel.: +81-58-230-6564; Fax: +81-58-230-6376 Received: 31 January 2018; Accepted: 9 March 2018; Published: 10 March 2018 Abstract: We have previously reported that 60% sucrose diet-fed ChREBP knockout mice (KO) showed body weight loss resulting in lethality. We aimed to elucidate whether sucrose and fructose metabolism are impaired in KO. Wild-type mice (WT) and KO were fed a diet containing 30% sucrose with/without 0.08% miglitol, an α-glucosidase inhibitor, and these effects on phenotypes were tested. Furthermore, we compared metabolic changes of oral and peritoneal fructose injection. A thirty percent sucrose diet feeding did not affect phenotypes in KO. However, miglitol induced lethality in 30% sucrose-fed KO. Thirty percent sucrose plus miglitol diet-fed KO showed increased cecal contents, increased fecal lactate contents, increased growth of lactobacillales and Bifidobacterium and decreased growth of clostridium cluster XIVa.