REPRODUCTIONRESEARCH

Differential activation of kiss receptors by Kiss1 and Kiss2 peptides in the sea bass

Alicia Felip*, Felipe Espigares*, Silvia Zanuy and Ana Go´mez Consejo Superior de Investigaciones Cientı´ficas (CSIC), Instituto de Acuicultura de Torre de la Sal (IATS), Ribera de Cabanes s/n Torre la Sal, 12595 Castello´n, Spain Correspondence should be addressed to A Felip; Email: [email protected]

*(A Felip and F Espigares contributed equally to this work)

Abstract

Two forms of kiss gene (kiss1 and kiss2) have been described in the teleost sea bass. This study assesses the cloning and characterization of two Kiss receptor genes, namely kissr2 and kissr3 (known as gpr54-1b and gpr54-2b, respectively), and their signal transduction pathways in response to Kiss1 and Kiss2 peptides. Phylogenetic and synteny analyses indicate that these paralogs originated by duplication of an ancestral gene before teleost specific duplication. The kissr2 and kissr3 mRNAs encode proteins of 368 and 378 amino acids, respectively, and share 53.1% similarity in amino acid sequences. In silico analysis of the putative promoter regions of the sea bass Kiss receptor genes revealed conserved flanking regulatory sequences among teleosts. Both kissr2 and kissr3 are predominantly expressed in brain and gonads of sea bass, medaka and zebrafish. In the testis, the expression levels of sea bass kisspeptins and Kiss receptors point to a significant variation during the reproductive cycle. In vitro functional analyses revealed that sea bass Kiss receptor signals are transduced both via the protein kinase C and protein kinase A pathway. Synthetic sea bass Kiss1–15 and Kiss2–12 peptides activated Kiss receptors with different potencies, indicating a differential ligand selectivity. Our data suggest that Kissr2 and Kissr3 have a preference for Kiss1 and Kiss2 peptides, respectively, thus providing the basis for future studies aimed at establishing their physiologic roles in sea bass. Reproduction (2015) 150 227–243

Introduction comparative genomics in several groups occupying relevant phylogenetic positions have led to the identifi- Soon after the Kiss/Gpr54 system had been demonstrated cation of four kissr and three kiss genes in the coelacanth to play a role in the control of reproduction in mammals (Sarcopterygian), while in teleosts at least one kiss and (Funes et al. 2003, de Roux et al. 2003, Seminara et al. kissr is known to be present in all the species investigated 2003, Pinilla et al. 2012), further investigation was to date. Nevertheless, a second gene for kisspeptin and initiated in several vertebrate species, leading to the identification of multiple kiss and gpr54 paralogous its receptor has been observed in the genomes of other genes in early osteichthyans (Biran et al. 2008, Felip et al. fish species (Biran et al. 2008, Lee et al. 2009, Akazome 2009, Lee et al. 2009, Akazome et al. 2010, Oakley et al. et al. 2010, Oakley et al. 2010, Um et al. 2010, Zohar 2010, Um et al. 2010, Zohar et al. 2010, Kim et al. 2012, et al. 2010, Kim et al. 2012, Pasquier et al. 2012a,b, Pasquier et al. 2012a,b, 2014a,b, Tena-Sempere et al. Tena-Sempere et al. 2012). So far, the occurrence of 2012). To date, a single ligand (Kiss) and receptor (Gpr54 three kissr and two kiss paralogous genes has been or Kissr) have been demonstrated to exist in placental reported in an early group of teleosts, the Elopomorphs mammals (human, opossum) and reptiles, while mam- (European eel, Anguilla anguilla)(Pasquier et al. malian monotrems (platypus) possess two forms of Kiss 2012a,b). In the spotted gar, Lepisosteus oculatus and Kissr genes. Contrasting situations are found in other (Actinopterygian, Ginglymode), four kissr and two kiss tetrapodes, such as amphibians, which have three kiss have been identified, while four kiss but no kissr have and kissr genes, whereas the kisspeptin system is absent been characterized in the elephant shark, Callorhinchus in birds, although a recent investigation into the milii (Chondrichtyan) (Pasquier et al. 2012a,b). Con- kisspeptin system in avian lineages provides molecular cerning cyclostomes, two kiss and one kissr genes have evidence of the presence of a kiss2-like gene that been identified in the sea lamprey (Petromyzon marinus) degenerated and lost its function (Pasquier et al. (Felip et al. 2009, Pasquier et al. 2012a,b). Furthermore, 2014b). All in all, advances in genome sequencing and two forms of kiss receptor-like genes have been

q 2015 Society for Reproduction and Fertility DOI: 10.1530/REP-15-0204 ISSN 1470–1626 (paper) 1741–7899 (online) Online version via www.reproduction-online.org Downloaded from Bioscientifica.com at 09/29/2021 01:27:29PM via free access 228 A Felip, F Espigares and others predicted in Ambulacrarians, such as the sea urchin, kiss1- and kiss2-expressing cells and their receptors in Strongylocentrotus purpuratus (Echinodermata) and the brain of male and female sea bass undergoing their acorn worm, Saccoglossus kowalevskii (Hemichordata) first sexual maturation has revealed that no sexual (Biran et al. 2008, Lee et al. 2009, Pasquier et al. 2012a). differences in the localization of the kisspeptin systems This situation demonstrates a complex functional exist in this species (Escobar et al. 2013a,b). Of note in and evolutionary scenario for this regulatory system in this study was that the expression of kissr3 presented an both vertebrates and invertebrates, which merits overlap with Kiss2 fibers in the central telencephalon investigation. and the lateral recess of the hypothalamus (Escobar et al. Accumulating evidence has provided insight into the 2013b). Despite these new findings, the specifically involvement of the kisspeptin system in the regulation of reproductive function of the duplicated Kiss system in neuronal systems other than those involved in vertebrate the sea bass still remains to be fully characterized. Here, reproduction, such as those related to complex behaviors, we report on the complete cDNA identification and including sexual motivation and arousal states (Parhar characterization of the two distinct Kiss receptors, et al. 2004, Kanda et al. 2008, Tena-Sempere 2010a, namely kissr2 and kissr3, and in silico analysis of their Servili et al. 2011, Shimizu et al. 2012, Zhao & Wayne putative regulatory regions. We analyze the tissue 2012, Zmora et al. 2012, Escobar et al. 2013a,b). distribution of both Kiss receptors in sea bass, medaka Expression levels of kiss and kissr in the brain and, to a and zebrafish. In addition, the expression of kissr genes lesser extent, in the gonad have been analyzed in several in brain, pituitary and gonads in adult and juvenile fish non-mammalian species, including amphibians during the reproductive period is explored. The (Chianese et al. 2013) and fish (Mohamed et al. 2007, expression study of kiss and kissr genes was extended Nocillado et al. 2007, Biran et al. 2008, Filby et al. 2008, to the different stages of gonad maturation in adult male van Aerle et al. 2008, Kitahashi et al. 2009, Mechaly et al. sea bass as recent findings have given evidence for a 2009, 2010, Migaud et al. 2012, Alvarado et al. 2013, differential involvement of the two kisspeptin systems in Ohga et al. 2013), suggesting a putative role for controlling gametogenesis in this species (Migaud et al. kisspeptins in controlling reproduction. Moreover, in vivo 2012, Alvarado et al. 2013). Furthermore, melatonin studies in some teleosts have found that the systemic administration has been shown to elicit changes in the administration of kisspeptin forms induces detectable expression of kisspeptin/gnrh system genes in the brain biological responses at brain and pituitary levels, with that appear to mirror disturbances in spermatogenesis potencies depending on the species (Filby et al. 2008, (Alvarado et al. 2015). In addition, searching for the Felip et al. 2009, Kitahashi et al. 2009, Li et al. 2009, Shi preferred activation of each sea bass Kiss receptor, a cell et al. 2010, Espigares et al. 2015). Furthermore, in vitro culture assay was used to delineate ligand-receptor functional analyses have delineated ligand-receptor interactions and signaling. Finally, we also studied the interactions in four fish species containing a duplicated chromosomal location of the sea bass Kiss receptors and Kiss system, namely zebrafish Danio rerio (Biran et al. placed them in an evolutionary scenario. 2008, Lee et al. 2009), goldfish Carassius auratus (Li et al. 2009), medaka Oryzias latipes (Kanda et al. 2013) and chub mackerel Scomber japonicus (Ohga et al. 2013), Materials and methods and in the orange-spotted grouper Epinephelus coioides Fish and sampling with a single Kiss/Kissr pair (Shi et al. 2010). As is the case in mammals (Pinilla et al. (2012) for review), the Male and female sea bass and medaka (Carbio strain) were activation of PKC-MAPKs is involved in the signaling obtained from stocks at IATS, whereas zebrafish were obtained pathways used by the fish Kiss receptors, but different from a local pet shop. Brain and gonads were collected levels of activation have been observed, depending on the monthly (January–April) from prepubertal and adult sea bass Z ligand/receptor combination (Tena-Sempere et al. 2012). (n 1–4 for each sex and developmental stage). In adition, The European sea bass (Dicentrarchus labrax L.) different somatic tissues were collected from the samples in provides an ideal model for studying aspects of fish January for expression analyses using an RT-PCR approach. The quantitative gonadal expression level of kiss and kissr genes reproduction, since important scientific achievements was analyzed by RT-qPCR in testis cDNA samples from animals have been developed for this species. It is an economi- in their first year of sexual maturation (nZ5 fish/month) during cally important farmed fish that still exhibits reproduc- a complete reproductive cycle (Rocha et al. 2009) where tion-related problems, such as the appearance of early testicular stages of development were determined by histo- puberty, and the mechanisms underlying this process logical analysis (Begtashi et al. 2004). Finally, different tissues merit further investigation (Carrillo et al. 2009). Previous of adult medaka and zebrafish (nZ4–5 for each sex) were studies in this species have found that the sea bass has collected. All fish were anesthetized with an overdose of two distinct kiss genes, kiss1 and kiss2 (Felip et al. 2009), 2-phenoxyethanol (Merck Schuchardt OHG, Hohenbrunn, whose mRNA levels in the brain change significantly in Germany) and killed by decapitation. All samples were frozen relation to the reproductive status of the animals (Migaud on dry ice and stored at K80 8C until use. All animal et al. 2012, Alvarado et al. 2013). The distribution of experiments were conducted in accordance with the

Reproduction (2015) 150 227–243 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/29/2021 01:27:29PM via free access Characterization of sea bass kiss receptors 229 guidelines for animal experimentation established by European used to amplify the full-length on sea bass brain cDNA using legislation (ETS No. 123, 01/01/91). The protocols used in this a proofreading DNA polymerase (Pfu DNA polymerase; study for animal experimentation were approved by the Stratagene). An aliquot of the amplified fragments was directly Welfare Committee of the IATS, under the supervision of the used for sequencing and the remaining part was used for ligation Ministry of Rural and Marine Environment. into the pGEM-T Easy Vector (Promega). One clone for each gene whose sequence corresponded to the consensus of the sequenced PCR product was selected as sea bass kissr2 and Molecular cloning of two kiss receptor genes in sea bass kissr3 cDNAs. The sequence of the human and tilapia kisspeptin receptors was used to query the medaka and zebrafish genome databases by Sequence analyses TBLASTN searches. Two different sequences corresponding to kiss receptor-like genes were identified in each species. To All amino acid sequences of different vertebrate species used amplify fragments of the sea bass receptors, degenerate PCR for alignments and phylogenetic analysis were extracted from primers were designed based on conserved amino acids from Ensembl (Ensembl Genome Browser, http://www.ensembl.org) the fish genes. PCR amplifications were carried out from four sea and NCBI (http://blast.ncbi.nlm.nih.gov). Amino acid bass genomic DNA libraries constructed with the Universal sequences were aligned using ClustalX (1.83) (Thompson et al. GenomeWalker Kit (Clontech Laboratories, Inc., Mountain 1997), and phylogenetic analysis was performed with the View, CA, USA). We will adopt the term kissr for kiss receptor Neighbor-Joining method using the Molecular Evolutionary genes in the sea bass (i.e., kissr2 and kissr3), also known as gpr54 Genetics Analysis Software (MEGA 4.1) (Kumar et al. 2008) and according to the nomenclature referred to in Tena-Sempere et al. full-length amino acid sequences. The synteny analysis was (2012) (i.e., gpr54-1b and gpr54-2b, respectively). Primary PCR performed using the Ensembl Genome Browser and PhyloView amplifications for kissr2 were performed by using a primer (AP1) of Genomicus v67.01 web site (Muffato et al. 2010). In addition complementary to the adaptor sequence provided with the kit to the searches of vertebrate Kiss receptors, we used the Ensembl and degenerate kissr2 PCR primers (first PCR sense, kissr2–1: Genome Browser and NCBI to retrieve the kisspeptin receptor- 50-CCASYNSHNTTGRYNRMNGCT-30; antisense, kissr2–4: like genes from the genomes of other chordates including 50-GTAHWNATTGGTGACCGTCTTCAT-30). Secondary and urochordates (tunicates) and cephalochordates (amphioxus or nested PCRs were performed by using a primer (AP2) lancelets) and invertebrates including echinodermates (sea complementary to the adaptor sequence provided with the urchin) and hemichordates (saccoglossus). In the case of sea kit and degenerate and nested kissr2 PCR primers (second bass, the AnnotationDraftV1 assembly from the sea bass PCR sense, kissr2–3: 50-TTGRYNGACGCNTGGCTGGTCCC- genome database (Kuhl & Reinhardt, unpublished) was used. CHYN-30; antisense kissr2–2: 50- ACCGTCTTCATYTGYTGRT- The seven transmembrane (TM) helical segments, phos- GYTTNGT-30). Similarly, primary PCR amplifications for kissr3 phorylation sites (NetPhosk 1.0 Server; GPS 2.1), potential were performed using AP1 primer and degenerate kissr3 PCR N-glycosylation sites (NetNGlyC 1.0 Server) and palmitoyla- primers (first PCR sense, kissr3–1: 50-CAYCCNTTCYTSACN- tion cysteine sites (CSS-Palm 2.0) in the C-terminus of the Kiss GAYGCMTGG-30; antisense, kissr3–4: 50-TRTARAARTTNGT- receptors were identified using prediction servers such as the NGCNGTNCTCATYTG-30). Secondary PCR amplifications for Center for Biological Sequence Analysis (http://www.cbs.dtu. kissr3 were performed using AP2 primer and degenerate kissr4 dk/services/) and HMMTOP Server of the Hungarian Academy PCR primers (second PCR sense, kissr3–3: 50-GTSCCNYTNT- of Sciences (http://www.enzim.hu/hmmtop). Two motifs, TYTTCTSNCTATHATG-30; antisense kissr3–2: 50-CGTCCTCA- E/DRY/W and NpxxY, known to be conserved in these TYTGYCTRTGYTTNGADAT-30). The primary PCR conditions rhodopsin family G-protein coupled receptors (Gloriam et al. were as follows: denaturation at 94 8C for 30 s, followed by 2005), were also identified in the kiss receptors of sea bass. seven cycles at 94 8C for 20 s and 76 8C for 3 min and 32 cycles In silico analysis of the putative promoter sequences of the sea at 94 8C for 20 s and 68 8C for 3 min, and 68 8C for 7 min after bass Kiss receptor genes was conducted to identify conserved the final cycle. For the secondary PCR, the primary PCR product regulatory elements in teleosts using bioinformatic tools was diluted 1/50 and PCR conditions were as follows: 94 8C for (CHAOS/DIALIGN at http://dialign.gobics.de/chaos-dialign-sub- 30 s, followed by seven cycles at 94 8C for 20 s and 76 8C for mission; Brudno et al.(2004); Alggen Promo v3 at http://alggen. 3 min and 32 cycles at 94 8C for 20 s and 708C for 3 min, and a lsi.upc.es/cgi-bin/promo_v3/promo/promoinit.cgi?dirDBZ final step of 70 8C for 7 min. PCR products were cloned into the TF_8.3; Messeguer et al. (2002) and Farre´ et al. (2003); and pGEM-T Easy Vector (Promega) and further sequenced. The full- Genomatix Software-MatInspector; Cartharius et al. (2005)). length cDNAs of kissr2 and kissr3 were obtained from a sea bass brain cDNA library constructed in the UNI ZAP-XR vector. RNA isolation, RT and cDNA synthesis: expression Initially, PCR reactions using gene-specific primers in com- analyses bination with primers annealing in the UNI Zap-XR vector were performed to obtain the cDNA ends. Then, specific primers Total RNA was extracted from frozen tissues with TRI- corresponding to the 50 and 30 ends of kissr2 (sense kissr2–16 REAGENT (Sigma) according to the manufacture’s instructions. 50-TCACTGACACTGGACTAAACCT-30;antisensekissr2–30 RT was performed on 2 mg of total RNA in the presence of 50-TCCAACGTCTTTATTTCTTTGTATA-30)andkissr3 (sense 100 ng of random hexamers and using SuperScript II Reverse kissr3–7 50-GATGTTGTGGCGGTTTTTCATC-30; antisense Transcriptase (Invitrogen). For expression analysis, two sets of kissr3–9 50-GACAACCACTTAATGCCATAGG-30) cDNAs were gene-specific primers located in two different exons were www.reproduction-online.org Reproduction (2015) 150 227–243

Downloaded from Bioscientifica.com at 09/29/2021 01:27:29PM via free access 230 A Felip, F Espigares and others

Table 1 Gene-specific primersa used for RT-PCR analysis. PCR programb

Touchdown cycles Gene Species 5’–3’ sequence Fragment size (bp) (8C–8C) Fixed cycles (8C) kissr2 Sea bass F: GTCACCAAGCACCAGCAGATGAAG 306 68–58 58 R: GACACAGAGATGGCCAGAGCCAT 20 20 Medaka F: ATCACGAAGCATCAGCAGATGAAG 296 68–58 58 R: GACACAGAGACGGCCAGAGCC 20 20 Zebrafish F: GTCATTAAAAACCAGCAGATGAAGAC 296 68–58 58 R: GTGGTGCACACAGACAGAGCCA 20 20 kissr3 Sea bass F: GCAACTCTCTGGTTATTTATGTAATTT 320 64–54 54 R: GCAGATGCTGACAATCATGGC 20 20 Medaka F: GCAACTCTCTGGTTATCTATGTGAT 320 68–58 58 R: GCAGATACTGACAATCATGGCTAC 20 20 Zebrafish F: GAAACTCACTGGTGATTTATGTCATC 319 68–58 58 R: GCATATGCTAACAATCATAGCAACAC 20 20 aAll primers were designed between exon regions to exclude false positive bands in case of potential genomic DNA contamination. The elongation factor-1 alpha (ef1a) gene was used in the three fish species as reference gene (Felip et al. 2009). Primer direction: forward (F) and reverse (R). bTemperature (upper side) and number of cycles (at the bottom) in each touchdown PCR is indicated. designed for sea bass, medaka and zebrafish kissr2 and kissr3 respectively. The pRL-TK plasmid (Promega), which constitu- genes (Table 1). As previously described (Felip et al. 2009), tively expresses a Renilla reniformis luciferase gene, was used RT-PCR analyses were performed using a touchdown PCR to control transfection efficiency. Chinese Hamster Ovary approach with the elongation factor-1alpha (ef1a) gene tested (CHO) cells were maintained in DMEM supplemented with in the three fish species as reference gene using specific 5% fetal bovine serum, 100 U/ml penicillin and 100 mg/ml primers. streptomycin at 37 8C under 5% CO2 until confluence. Six For testis samples from animals in their first year of sexual hours before transfection, the cells were seeded in 24-well maturation, total RNA was isolated from w100 mg of frozen tissue-culture plates. The pSRE-Luc or pCRE-Luc reporter gonads using the FastRNA Pro Green Kit (Qbiogene, Inc., plasmids (1 mg), pcDNA-kissr2, pcDNA-kissr3 (160 ng) or Irvine, CA, USA) and homogenized on a FastPrep Instrument human and mouse Kiss receptors (160 ng) and pRL-TK (Qbiogene, Inc.). One microgram of DNase-treated RNA was (320 ng) were co-transfected into the cells using Lipofectamine used for cDNA synthesis with the Superscript III reverse reagent (Invitrogen) according to the manufacturer’s instruc- transcriptase (Invitrogen Corp.,), according to the manufac- tions. Two days after transfection, cells were replated in turer’s instructions and using random hexamers as primers. 96-well, flat, white-walled plates (Corning) and then stimulated K K Gene expression was quantified by qPCR of the cDNA on a with various concentrations (from 10 5 to 10 7 M) of sea bass Realplex2 Mastercycler (Eppendorf AG, Hamburg, Germany) Kiss1–10, Kiss2–10, Kiss1–15 and Kiss2–12 in OPTI-MEM using 96 well optical plates. For each 25 ml of PCR reaction, medium (Invitrogen) for 6 h. In the case of transfections optimized amounts of the corresponding primers and probes of containing pSRE-Luc, cells were serum-starved for 2 h before kiss and kissr genes (Alvarado et al. 2013) were mixed with 1 ml stimulation. Two independent transfection experiments were of cDNA in 1! Abgene’s Absolute QPCR Mix (ABgene, performed, each conducted in duplicate. A parallel control Epsom, UK). The expression of the ribosomal protein L13a transfection experiment was performed with pcDNA3, pCRE- (rpl13a) gene was used as reference for testis samples (Mitter Luc or pSRE-Luc and the internal control pRL-TK. et al. 2009) using 1! Power SYBR Green PCR Master mix The kisspeptin peptides used in this study were synthesized (Applied Biosystems) and cDNA samples were diluted 1:50. by GenScript USA, Inc. (Piscataway, NJ, USA) and were as Male annual cycle data were normalized by dividing the input follows: Kiss1–10 (NH2-YNLNSFGLRY-CONH2), Kiss2–10 amount of the target gene by the amount of rpl13a RNA. (NH2-FNFNPFGLRF-CONH2), Kiss1–15 ({pGLU}DVSSYN- Tenfold series dilutions of the plasmid containing the LNSFGLRY-CONH2) and Kiss1–12 (NH2-SKFNFNPFGLRF- corresponding gene were included as standard curves. CONH2). Their sequences are based on the amino acid sequences deduced for sea bass kisspeptins. All peptides are amidated in C-terminal, and Kiss1–15 contains an N-terminal Expression plasmids, cell culture and transfections pyroglutamylation. The complete coding sequences of sea bass kissr2 and kissr3 cDNAs were cloned into the pcDNA3 expression vector Luciferase assays (Invitrogen) under the control of the cytomegalovirus (CMV) promoter to generate the pcDNA-kissr2 and pcDNA-kissr3 Firefly and Renilla luciferase activities were determined using plasmids. Expression plasmids for human and mouse kisspeptin the Dual-Glo Luciferase Assay System (Promega) on an ULTRA receptors were a generous gift from Robert Miller. pSRE-Luc Evolution Multi-Detection Microplate Reader (Tecan) and were and pCRE-Luc plasmids (BD Clontech, Palo Alto, CA, USA) expressed as relative light units. Final luciferase activity was contain the firefly luciferase gene under the control of represented as the ratio of firefly to Renilla luciferase activity, promoters with Serum Response Elements (SRE) or CRE, the latter acting as control for transfection efficiency.

Reproduction (2015) 150 227–243 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/29/2021 01:27:29PM via free access Characterization of sea bass kiss receptors 231

Data representation and statistical analysis 107 bp, a 30UTR of 222 bp and an open-reading frame (ORF) of 1104 bp that encodes a protein of 368 amino Gene expression levels in the testis during a complete reproductive cycle and receptor transactivation data are acids (Fig. 1). The kissr3 cDNA is 2365 bp long (Supplementary Figure 1B) and contains an ORF of represented as the meanGS.E.M. All statistical analyses were 1134 bp encoding a protein of 378 amino acids with 50 carried out using a one-way ANOVA followed by a Tukey test. 0 Before the analysis, values were log-transformed to meet and 3 UTRs of 636 and 595 bp in length, respectively normality and homoscedasticity requirements. Different letters (Fig. 1). The two sea bass kisspeptin receptors share in the figures represent significant differences between gonadal 53.1% amino acid sequence identity with each other, stages or the activation of Kiss receptors by the ligands. All with 6.5% identity in the extracellular region, 60.7% analyses were conducted using SigmaStat version 3.5 (SYSTAT identity in the TM regions and 6.3% in the C-terminus. Software, Inc., Richmond, CA, USA). Differences were considered to be significant when P!0.05. Kiss receptors have conserved structural elements Kiss receptors are members of the rhodopsin-like or Class Results A family of G-protein coupled receptors, which contain conserved structural elements. The two sea bass receptor Sea bass genome contains two kiss receptors proteins show conserved residues and motifs similar to After using degenerate PCR primers and a genome other vertebrate kisspeptin receptors. Both sea bass walking approach, two PCR fragments were obtained. Kissr2 and Kissr3 are membrane proteins with an A PCR fragment of 140 bp corresponded to genomic extracellular N-terminus, a cytoplasmic C-terminus and sequence 50upstream from exon 1 of the sea bass 7TM helices with three extracellular loops (EL) and three kissr2 gene, whereas a PCR fragment of 200 bp intracellular loops (IL) between the TM helices (Fig. 1). corresponded to genomic sequence 30downstream Several residues that are considered to be involved in from exon 1 of the kissr3 gene, respectively. Different ligand binding or formation of binding pockets are rounds of genome walking in both genes revealed that conserved in these receptors (Lee et al. 1999, Gloriam kissr2 contains six exons, whereas kissr3 contains five et al. 2005, Oh et al. 2006, Millar & Newton 2010), exons. The full-length cDNA sequences of both genes including the conserved asparagine (Asn, N) at position were obtained from sea bass brain cDNA by using N51 for Kissr2 and N65 for Kissr3 in TMI, the conserved specific primers (GenBank accesion number: kissr2 or aspartate (Asp, D) at position D79 for Kissr2 and D92 for gpr54-1b, JN202446 and kissr3 or gpr54-2b, JN202447). Kissr3 in TMII and some conserved prolines (Pro, P) in The kissr2 cDNA has a length of 1433 bp (Supple- TM IV–VII (P167, P211, P271, P326 for Kissr2 and P180, mentary Figure 1A, see section on supplementary data P224, P284, P323 for Kissr3). Cysteines (Cys, C) involved given at the end of this article) and consists of a 50UTR of in a conserved N-terminal disulphide bond are located

Figure 1 Predicted amino acid sequences for sea bass Kissr2 (or Gpr54-1b) and Kissr3 (or Gpr54-2b). Arrowheads mark the position of exon–intron junctions (black down triangle for kissr2 and grey down triangle for kissr3) in the corresponding amino acid sequences. The nucleotide sequences (Supplementary Figure 1A and B, see section on supplementary data given at the end of this article) have been submitted to the GenBank and are available under accession numbers JN202446 and JN202447 for sea bass gpr54-1b and gpr54-2b, respectively. The numbers on the right indicate the position of amino acid residues with respect to the initial methionine. The predicted seven transmembrane helices (TMH) are indicated above the aligned sequences. Putative phosphorylation sites are indicated by the symbol (C), the N-glycosilation by (*) and the motifs DRC and NPxxY by (#). www.reproduction-online.org Reproduction (2015) 150 227–243

Downloaded from Bioscientifica.com at 09/29/2021 01:27:29PM via free access 232 A Felip, F Espigares and others in EL1 and EL2 for Kissr2 (C106 and C186) and for Kissr3 (9 NTT, 17 NGS, 22 NFS). Conserved microdomains (C119 and C199). Almost all GPCRs are regulated by involved in receptor activation are also present in the phosphorylation, which is the key to determining the two sea bass Kiss receptors, with the DrxY motif within signalling properties of this receptor family. The TMIII, and NPxxY in TMVII. No palmitoylated cysteines multi-site phosphorylation of GPCRs reflects the action in the C-terminus were predicted. of a number of protein kinase families and includes the presence of several serine (Ser), threonine (Thr) and 0 tyrosine (Tyr) residues that were predicted to be Sequence analysis of the 5 -flanking regions of the sea bass kiss receptor genes phosphorylated. Thus, in the case of the Kissr2 four Ser, three Thr and two Tyr are potentially phosphorylated, The sequences of the 50-flanking regions of the sea bass while nine Ser, three Thr and five Try were predicted in Kiss receptor genes were extracted from the Annotation- the Kissr3. Interestingly, the results predicted for Kissr2 DraftV1 assembly from the sea bass genome database showed that phosphorylation in Ser192 (EL2) and Ser230 (Kuhl & Reinhardt, unpublished). 2.5 kb of 50-upstream (IL3) might be mediated by the protein kinase C (PKC), sequence from sea bass kissr2 and kissr3 putative while Thr146 (IL2) might be mediated by PKC and PKA. promoter regions along with 2.5 kb of sequence upstream On the other hand, phosphorylation in Ser24 of the ATG start codon from available genome sequences (N-terminus), Ser205 (EL2) and Ser336, Ser352 and of Kiss receptors in other teleosts were analyzed to Ser353 in the C-terminus might be mediated by PKC, ascertain potential conserved regulatory elements. Two while Ser262 (IL3) and Ser353 (C-terminus) might be conserved regions of 14 (Fig. 2A) and 15 bp (Fig. 2B) in mediated by both PKC and PKA in the Kissr3. size were identified in the 50-upstream region of sea bass Phosphorylation was also predicted on Thr159 via the kissr2 at position K1050 and K19 with respect to the PKA in the Kissr3. Further analysis predicted potential translation start codon. These conserved sequences were N-glycosylation sites for Kissr2 (17 NES) and Kissr3 also found in the promoter regions of the kissr2 receptor

Figure 2 Putative conserved transcription factor binding sites on the promoter regions of kissr2 (A and B) and kissr3 (C and D) genes in the sea bass compared with other available genome sequences of teleosts. The numbers represent distance in bp from the putative translation initiation site. Regulatory element name abbreviations: GR-a, glucocorticoid receptor alpha responsive element; C/EBP, nuclear factor-interleukin 6; PR, progesterone receptor or nuclear receptor subfamily 3, group C, member 3; WT1, transcription factor Wilms tumor 1; LCR-F1, bZIP transcription factor; TFIIB, general transcription factor IIB; GA-BF, GA-box binding factor; Pax-6, paired box 6; STE12, homeodomain transcription factor Ste12; XBP-1, X-box binding protein 1; HOXA5, homeobox protein Hox-A5; POU1F1a, POU class 1 homeobox 1; YY1, transcription factor Yin Yang 1; RFX1, regulatory factor X, 1 and CREM.

Reproduction (2015) 150 227–243 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/29/2021 01:27:29PM via free access Characterization of sea bass kiss receptors 233 genes of zebrafish (K2517) and medaka (K210), sequences that were used as queries. All three blast hits respectively. Of particular note was the conserved were hypothetical proteins that presented the typical 7TM location that these sequences had for GR-a, C/EBP, PR, of the GPCR family and shared conserved residues and WT1, LCR-F1, TFIIB, GA-BF, Pax-6 and STE12 binding motifs with other vertebrate Kiss receptors. In tunicates sites (Fig. 2A and B). Similarly, the sea bass kissr3 (Ciona, Urochordate), the genomic searches failed to promoter region was analyzed for conserved regions, identify or predicet Kiss receptor-like sequences. including stickleback and tilapia. Two conserved regions Several vertebrate representatives were used to per- of 17 bp (Fig. 2C) and 32 bp (Fig. 2D) identified in the form synteny analysis, the results of which revealed that sea bass genome (K1129 and K687 with respect to the the neighboring gene clusters surrounding the four kissr translation start codon) were also present in the promoter loci were highly conserved across vertebrate species and region of the kissr3 receptor gene of stickleback (K1415 each presenting paralogs (Fig. 4). Furthermore, when K K K and 927) and tilapia ( 1725 and 830). These multiple forms were identified in the same species, these sequences showed a marked degree of conservation as genes were located in different chromosomes. The sea regards the location of potential binding sites for C/EBP, bass kissr2 and kissr3 genes were located at the XBP-1, WT1, GR-a, YY1, CREM and RFX1. HOXA5 and chromosomes (i.e., linkage group, LG) LG20 and POU1F1a showed overlapping binding sites in the LG10, respectively. sequence of all three teleost species (Fig. 2C).

Kiss receptors show similar distribution in tissues of Phylogeny and synteny analyses of kiss receptors juveniles and adults A phylogenetic tree highlighting piscine Kiss receptors The tissue expression patterns of each kissr mRNAs were was constructed based on the available protein analyzed by RT-PCR in sea bass, medaka and zebrafish, sequences from the genome databases (Fig. 3). The results using gene-specific primers (Table1). A comparison of the showed that vertebrate Kiss receptors separated into four expression of kissr2 and kissr3 in different tissues of groups, which were supported by significant bootstrap juvenile and adult male and female sea bass showed that values (87, 64, 91 and 92%, respectively). Thus, it was predominantly observed in the brain, pituitary and according to the separation of the phylogenetic branches gonadal tissues (testis and ovary) (Fig. 5A). In adults, both encompassing the Kiss receptor forms, they were named genes were also highly expressed in the brain and gonads, kissr1, kissr2, kissr3 and kissr4, where kissr1 was used to with only faint levels of expression in pituitary. The name the group including the mammalian receptors, presence of both mRNAs was also detected in a number of as these were the first to be described. Present data somatic tissues, the eye showing high expression levels of demonstrate that the presence of these multiples forms kissr3 in the juvenile males of sea bass (Fig. 5, upper right could be the result of the two genome duplication events panel). In medaka, kissr2 and kissr3 were highly that constitued the segregation of the sequence of kissr1 expressed in brain, while gonadal tissues showed weaker from those of kissr2, suggesting that both emerged from a expression levels (Fig. 6, upper panel). In addition, kissr3 common ancestor and, in turn, these two closest forms could be sister groups after the 2R. On the other hand, we but not kissr2 was expressed in most tissues at low levels, observed that the sequence of kissr3 segregated with although with a notable expression in the eye of both those of kissr4, which was supported by significant sexes. In zebrafish, kissr2 and kissr3 were clearly detected bootstrap values (65 and 96%, respectively). Of note is in the brain of males and females and testis, but not in the fact that the sequence of one Kiss receptor in the sea ovary (Fig. 6, low panel). The presence of both genes was lamprey (P. marinus) could not be related to one of the also observed in a wide range of somatic tissues of males four vertebrate Kiss receptors. In the case of the sea bass and females, being particularly evident in the intestine, Kiss receptors, the two kissr sequences segregated into gill, eye and skin of both sexes. two different groups, namely kissr2 and kissr3 (Fig. 3). Searches in the available genome databeses of Ambula- Temporal mRNA expression of kiss receptors crarians pointed to the existence of Kiss receptor-like genes in the sea urchin and the acorn worm. Using NCBI Given the expression levels in the brain, pituitary and Blast to search for the presence of Kiss receptor-like gonadal tissues at the beginning of the reproductive sequences in other invertebrate species such as season (January; Fig. 5A) and the involvement of these Branchiostoma floridae (amphioxus or lancelets; organs in reproduction, sample collection from juvenile Cephalochordate), we identified three sequences and adult fish was extended from February to April (Accession numbers: XP_002611682, XP_002591960 (Fig. 5B), the sampling period thus coinciding with the and XP_002608825) that produced significant alignments whole reproductive season of sea bass. The results with medaka (Assembly MEDAKA1; Ch 9: 4484 331– showed that the expression of kissr2 and kissr3 in the 4490 709 and Ch 17: 29 839 926–29 854 747) and brain was independent of the developmental stage or sex zebrafish (EU047918, EU047917) Kissr amino acid during the reproductive season (Fig. 5B, middle panel). www.reproduction-online.org Reproduction (2015) 150 227–243

Downloaded from Bioscientifica.com at 09/29/2021 01:27:29PM via free access 234 A Felip, F Espigares and others

91 lizard r4 coelacanth r4 Kissr4 97 spotted gar r4 Vertebrata 85 atlantic croaker r3 cobia r3 sea bass r3 100 striped bass r3 58 grey mullet r3 orange-spotted grouper r3 tilapia r3

96 55 bluefin tuna r3 sole r3 atlantic halibut r3 55 takifugu r3 Kissr3 74 96 tetraodon r3 99 medaka r3 stickleback r3 98 cod r3

94 zebrafish r3 100 goldfish r3 european eel r3 92 100 anguilla japonica r3 69 spotted gar r3 83 coelacanth r3 97 bullfrog r3 100 xenopus r3 100 medaka r2 CHORDATA 98 sea bass r2 zebrafish r2 Kissr2 100 goldfish r2 64 european eel r2 xenopus r2 spotted gar r2 100 coelacanth r2 65 99 european eel r1 spotted gar r1 93 platypus r1 87 87 coelacanth r1 Kissr1 xenopus r1 97 59 opossum r1 93 human r1 82 pig r1 100 mouse r1 100 rat r1 lamprey lancelet XP 002611682.1 Cephalochordata lancelet XP 002591960.1 97 lancelet XP 002608825.1 acorn worm NP 001161573.1 50 acorn worm NP 001161574.1 AMBULACRARIANS 99 sea urchin XP 793873.1 50 sea urchin XP 796286.1

Figure 3 Unrooted phylogenetic tree of kisspeptin receptor sequences. The phylogenetic tree was generated with MEGA version 4.1 using the Neighbor-Joining bootstrap consensus tree (nZ1000 bootstrap replicates). The number shown at each branch indicates the bootstrap value (%). Phylogenetic analysis was performed using the following sequences, which were retrieved from both the GenBank and the Ensembl Genome Browser database: human (Homo sapiens) (NM_032551), mouse (Mus musculus) (NM_053244), rat (Rattus norvegicus) (NM_023992), pig (Sus scrofa) (NM_0011044624), opossum (Monodelphis domestica) (XM_001374715), platypus (Ornithorhynchus anatinus) (XP_001507133.1) (XP_001515272.1 a second predicted form, is an incomplete sequence and was not included in this analysis), western clawed frog (Silurana tropicalis) (EU853678 for kissr1, EU853679 for kissr2 and EU853680 for kissr3), bullfrog (Rana catesbeiana) (EU681171), lizard (Anolis carolinensis) (assembly AnoCar 1.0; scaffold_10 at location 6 382 138–6 392 509), goldfish (C. auratus) (FJ465140 for kissr2 and FJ465139 for kissr3), zebrafish (D. rerio) (EU047918 for kissr2 and EU047917 for kissr3), sea bass (D. labrax) (JN202446 for kissr2 and JN202447 for kissr3; this study), medaka (O. latipes) (assembly HdrR; ENSORLG00000001694 for kissr2 and ENSORLG00000017731 for kissr3), stickleback (Gasterosteus aculeatus) (assembly BROAD S1 group III), tetraodon (Tetraodon nigroviridis) (assembly TETRAODON 8.0; Chromosome 15_random), takifugu (Takifugu rubripes) (assembly FUGU 4.0; scaffold_80 at location 1 035 934–1 046 929), Atlantic halibut (Hippoglossus hipoglossus) (GQ330487), sole (S. sole) (EU136710), bluefin tuna (T. maccoyii) (GQ150542), tilapia (Oreochromis niloticus) (AB162143), orange-spotted grouper (E. coioides) (GQ258778), atlantic croaker (Micropogonias undulates) (DQ347412), cobia (Racycentron canadum) (DQ790001), grey mullet (Mugil cephalus) (DQ683737), european eel (A. anguilla) (HE802271.1 for kissr1, HE802272.1 for kissr2 and CBV36798.1 for kissr3), striped sea bass (Morone saxatilis) (GU351869), coelacanth (Latimeria chalumnae) (assembly LatCha1 at location scaffold00306 1 560.566–1 570.542 for kissr1, scaffold05360 16 000–47 400 and scaffold05042 42 298–42 626 for kissr2, scaffold06474 1 150–4 554 and scaffold07374 4 451–9 519 for kissr4 and scaffold14105 176–3308 and scaffold00201 18 834.000–19 277.000 for kissr3), spotted gar (L. oculatus) (assembly LepOcu1 at location LG19 3 928.147–4 091.428 for kissr1, LG2 5 620.093–5 628.136 for kissr2, LG6 13 721.309–13 725.765 for kissr4 and LG10 2 546 056–2 553.452 for kissr3), sea urchin (S. purpuratus) (XP_793873.1 and XP_796286.1), acorn worm (S. kowalevskii) (NP_001161573.1 and NP_001161574.1) and lancelet (B. floridae) (XP_002611682.1, XP_002591960.1 and XP_002608825.1).

Reproduction (2015) 150 227–243 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/29/2021 01:27:29PM via free access Characterization of sea bass kiss receptors 235

A B Kissr1 Arid3a Wdr18 Grin3b Abca7 Polr2e Gpx4 Stk11 Atp5d Prtn3 Elane Med16 Lppr3 Palm C19orf21 Midn Cfd Ptbp1 Agtpbp1 Naa35 Mccc2 Psat1 Kissr2 Isca1 Zcchc6 Hs (Ch19) Mcidas Ol (Ch9) Mm (Ch10) Dr (Ch5) Rn (Ch7) Dl (LG20) Md (Ch3) St (S_GL172758)

Oa (Ultra Cg_266) Lo (Ch2)

St (S_GL172925)

C

D Ipp Kissr3 Eef1d Atp6v08 Trim47 Gpbp1l1 Tmem69 C8orf55 Gata6 Odf2l Ipo13 Rabl5 Mcoln3 Ol (Ch17) Tecr Trappc5 Kissr4 Stxbp2 Camsap3 Xab2 Ephx3 Notch3 Dr (Ch2) Retn Ac (Ch2) Fr (S_80)

Tn (Ch15) Lo (Ch6)

Ga (GIII)

Dl (LG10)

St (S_GL172640)

Figure 4 Conserved synteny and genomic organization of the kiss receptors in vertebrates, kissr1 (A), kissr2 (B), kissr3 (C) and kissr4 (D). Genomic organization of the four Kiss receptor loci was obtained from Ensembl Genome Browser. The schematic representations are not to scale. Numbers in brackets in each representation indicate on which chromosome (Ch), linkage group (LG), scaffold (S), group (G) or contig (Cg) the cluster is found. The gene searches were done at Ensembl against the genome assemblies of human (Hs) (H. sapiens) (assembly GRCh37), mouse (Mm) (M. musculus) (assembly NCBI m37), rat (Rn) (R. norvegicus) (assembly RGSC 3.4), opossum (Md) (M. domestica) (assembly MonDom 5), platypus (Oa) (O. anatinus) (assembly Ornithorhynchus_anatinus-5.0), lizard (Ac) (A. carolinensis) (assembly AnoCar1.0), spotted gar (Lo) (L. oculatus) (LepOcu1), Xenopus (St) (S. tropicalis) (assembly JGI 4.1), medaka (Ol) (O. latipes) (assembly HdrH), zebrafish (Dr) (D. rerio) (assembly Zv8), takifugu (Fr) (T. rubripes) (assemby FUGU 4.0), Tetraodon (Tn) (T. nigroviridis) (assembly TETRAODON 8.0), stickleback (Ga) (G. aculeatus) (assembly BROAD S1) and sea bass (Dl) (D. labrax) (AnnotationDraftV1, unpublished) (illustrated here by a box). Gene name abbreviations: Palm, paralemmin; C19orf21, uncharacterized protein C19orf21; Ptbp1, polypyrimidine tract-binding protein 1; Prtn3, proteinase 3; Elane, elastase; Med 16, mediator of RNA polymerase II transcription subunit 16; Wdr18, WD repeat protein 18; Psat1, phosphoserine aminotransferase 1 isoform; Retn, resistin; Zcchc6, zinc finger, CCHC domain containing 6; Camsap3, Calmodulin-regulated spectrin-associated protein 3; Gpbp1l1, GC-rich promoter binding protein 1-like 1; Ipp, intracisternal A particle-promoted polypeptide; Tmem69, transmembrane protein 69; Ipo13, importin 13; Gata6,GATA binding protein 6; Rabl5, Rab member Ras oncogen family-like 5; Odf2l, Outer dense fiber of sperm tails 2-like; Mcoln3, Mucolipin-3; Atp6vob, ATPase, HC transporting, lysosomal 21 kDa, V0 subunit b; Eef1d, eukaryotic translation elongation factor 1 delta; Trim47, tripartite motif-containing 47; C8orf55, chromosome 8 ORF 55; Trappc5, trafficking protein particle complex 5; Tecr, trans-2,3-enoyl-CoA reductase; Stxbp2, syntaxin-Binding Protein 2; Xab2, XPA binding protein 2; Notch3, notch (Drosophila) homolog 3; Ephx3, epoxide hydrolase 3; Lppr3, lipid phosphate phosphatase- related protein type 3; Cfd, complement factor D (adipsin); Arid3a, AT rich interactive domain 3A;, Grin3b, glutamate receptor, ionotropic, N-methyl-D-aspartate 3B; Abca7, ATP-binding cassette, sub-family A (ABC1), member 7; Polr2e, polymerase (RNA) II (DNA directed) polypeptide E, 25 kDa; Gpx4, glutathione peroxidase 4; Stk11, serine/threonine kinase 11; Atp5d, ATP synthase, HC transporting, mitochondrial F1 complex, delta subunit; Midn, midnolin; Isca1, iron-sulfur cluster assembly 1; Mcidas, multiciliate differentiation and DNA synthesis associated cell cycle protein; Mccc2, methylcrotonoyl-CoA carboxylase 2 (beta); Naa35, N(alpha)-acetyltransferase 35, NatC auxiliary subunit; Agtpbp1, ATP/GTP binding protein 1.

Overall, the levels of expression of kissr3 were higher kissr3 in the testis or ovary was moderate and it was than those of kissr2 in adult and juvenile fish from both independent of developmental stage or sex during the sexes, with kissr2 mRNAs from brain showing weaker reproductive season (Fig. 5B upper panel). In this vein, expression levels in adults (Fig. 5B middle left panel) than moderate expression levels of kissr2 were observed in the juvenile fish for the same period of time (Fig. 5B middle pituitary, whereas faint expression levels of kissr3 were right panel). In addition, the expression of kissr2 and detected for the same period of time regardless of sex. www.reproduction-online.org Reproduction (2015) 150 227–243

Downloaded from Bioscientifica.com at 09/29/2021 01:27:29PM via free access 236 A Felip, F Espigares and others

Adults Juveniles A Males – – C Spleen Kidney Liver Intestine Gill Testis Brain Pituitary Heart Eye Skin Muscle C Spleen Kidney Liver Intestine Gill Testis Brain Pituitary Heart Eye Skin Muscle kissr2 kissr3 ef1α

Females

kissr2 kissr3 ef1α – – C C Gill Gill Eye Eye Skin Skin Liver Liver Brain Brain Heart Heart Ovary Ovary Kidney Kidney Spleen Spleen Muscle Muscle Pituitary Pituitary Intestine Intestine Figure 5 RT-PCR analysis of sea bass kissr2 and kissr3 genes. (A) Expression in adult and juvenile B Adults Juveniles fish tissues from male and female sea bass in – – Z JFMA JF MA J FMAC J FMAC January (n 3–5 pooled tissues) (B) Expression in kissr2 gonads (testis and ovary), brain and pituitary in kissr3 adult and juvenile fish during the reproductive ef1α Testis OvaryTestis Ovary period (J January; F, February; M, March; A, April). Total RNA extracted from 2 (in M and A) or 3 (in F) kissr2 kissr3 pooled tissues in each month was reverse- ef1α transcribed and amplified by PCR except for Brain Brain Brain Brain gonad, brain and pituitary from one fish in J that JF*M A C– JF*M*AC– was used individually for RT-PCR. The sea bass kissr2 ef1a was used as an internal control to verify the kissr3 K ef1α correctness of the RT reaction. C : negative Pituitary Pituitary Pituitary Pituitary control for PCR which was performed using sterile Males Females Males Females water as template.

Testicular expression of kiss/kissr genes in sea bass luciferase gene placed under two different promoters, during an annual reproductive cycle including SRE sequences as a reporter of PKC activation The expression of kiss1 was low compared with that of the and CRE sequences as a reporter for the PKA pathway. In other genes analyzed, and remained constant during male mock (pcDNA3)-transfected cells, sea bass Kiss1–10 and spermatogenesis. Levels decreased during the full spermia- sea bass Kiss2–10 were not able to induce SRE- or CRE- tion stage (stage V) and fell significantly during the post- driven luciferase activity (data not shown), indicating spawning stage (Fig. 7A). The expression of kiss2 was that CHO cells do not naturally express endogenous Kiss higher than that of kiss1 in all the stages of testicular receptors. The use of the SRE reporter system revealed maturation. As regards the male yearly reproductive cycle, that sea bass Kiss1–15 was most able to activate Kissr2 maximum values of kiss2 were observed in February (data with a ten-time increase of luciferase activity over the not shown), coinciding with mid- and late recrudescence non-activated control, while Kiss1–10 elicited and (stages IV and V) and then significantly decreased during increase of 4.84, in comparison to Kiss2–10 and the post-spawning stage (Fig. 7B). The expression of kissr2 Kiss2–12, which exhibited only 1.6- and 3.3-fold showed a significant increase at the end of spermato- increase, respectively (Fig. 8A). Using the CRE reporter genesis/beginning of spermiation (stage IV) and then system, sea bass Kiss1–10 elicited an increase of decreased during full spermiation (stage V) to levels that luciferase acrivity of 9.4 compared with Kiss2–10, were not statistically different from the previous stage. which showed no significant effect at all in CHO cells During the post-spawning stage kissr2 levels remained low transfected with Kissr2. It is interesting to note that (Fig. 7C). The expression pattern of kissr3 gene showed that Kiss1–15 exhibited the highest potency in activating levels remained low throughout spermatogenesis (stages Kissr2 (24.7-fold increase in luciferase over control), I–IV) (Fig. 7D). The levels of kissr3 increased significantly whereas Kiss2–12 elicited only an increase of 2.49 times in stage V before falling during stage VI. over control (Fig. 8B). On the other hand, cells transfected with kissr3 displayed the highest response to Kiss2–12, triggering similar activation via both SRE- and Ligand selectivity of sea bass Kiss receptors CRE-reporter constructs, with 3.3- and 3.9-fold increase In order to delineate sea bass ligand-receptor compared to basal levels, respectively (Fig. 8C and D). interactions, we analyzed the transactivation of the In addition, we tested whether sea bass decapeptide or

Reproduction (2015) 150 227–243 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/29/2021 01:27:29PM via free access Characterization of sea bass kiss receptors 237

Medaka

Males Females – – Spleen Kidney Liver Intestine Gill Testis Brain Heart Eye Skin Muscle C Spleen Fat Kidney Liver Intestine Gill Ovary Brain Heart Eye Skin Muscle C kissr2

kissr3 mdef1α

Zebrafish Figure 6 RT-PCR analysis of medaka and zebrafish kissr2 and kissr3 expression in tissues from male and female adult fish. Total RNA extracted from – –

Spleen Fat Liver Intestine Gill Testis Brain Heart Eye Skin Muscle C Spleen Fat Intestine Gill Ovary Brain Heart Eye Skin Muscle C three to six pooled tissues was reverse-transcribed and amplified by PCR. The medaka and zebrafish kissr2 ef1a were used as an internal control to verify the kissr3 correctness of the RT reaction. C-: negative control for PCR which were performed with sterile water α zfef1 as template. longer kisspeptins differentially activated the human and the highest potency (6.9 times over control) among the rat Kiss1 receptors using the SRE-reporter system, a peptides examined, with Kiss1–10 and Kiss2–12 exhibit- pathway commonly described for mammalian Kiss1 ing significantly low potency (2.8 and 2.5 times over receptor. We found that for human GPR54 (or KISSR1), control, respectively) (Fig. 8F). The sea bass Kiss2–10 was the peptides derived from sea bass Kiss1 efficently not able to activate the mouse Kiss1 receptor. activated the receptor (6.7 times over control for Kiss1–15 and 7.1 times over control for Kiss1–10), but Kiss2 dodecapeptide exhibited similar high potency Discussion (7.8 times over control) to Kiss1 peptides at a high peptide The present study reports the isolation and character- K concentration (10 5 M). The sea bass Kiss2–10 showed ization of two Kiss receptor genes (kissr2 and kissr3 in very low potency (4.3 times over control) (Fig. 8E). In the our nomenclature; Supplementary Material Table S1, see case of mouse Kiss1 receptor, sea bass Kiss1–15 showed section on supplementary data given at the end of this

A 5×10–4 B 1×10–2

4×10–4 c 8×10–3 b b b b ) ) bc bc 3×10–4 6×10–3 rpl13a rpl13a bc mRNA levels mRNA levels b b kiss2 kiss1 2×10–4 4×10–3 (norm. to (norm. (norm. to (norm. Relative Relative Relative Relative 1×10–4 2×10–3 a Figure 7 Relative patterns of (A) kiss1, a

0 0 (B) kiss2, (C) kissr2 and (D) kissr3 I II III IV V VI I II III IV V VI expression in testis of male sea bass sampled during their first sexual matu- C 2.5×10–2 D 3.0×10–3 ration. Values are represented by stages of –3 b –2 2.5×10 gonadal development as determined by 2.0×10 b

–3 histology. Stage I or ) ) 2.0×10 1.5×10–2 immature (nZ19), stage II or early rpl13a rpl13a mRNA levels mRNA levels 1.5×10–3 recrudescence (nZ6), stage III or mid kissr2 –2 kissr3 1.0×10 ab recrudescence (nZ3), stage IV or late (norm. to (norm. (norm. to (norm. 1.0×10–3 recrudescence (nZ6), stage V or full Relative Relative ab Relative –3 ab ab 5.0×10 –4 a Z a 5.0×10 spermiation (n 10) and stage VI or a a a a post-spawning (nZ3). Statistically 0 0 I II III IV V VI I II III IV V VI significant differences are indicated with Testicular stages Testicular stages different letters above the bars. www.reproduction-online.org Reproduction (2015) 150 227–243

Downloaded from Bioscientifica.com at 09/29/2021 01:27:29PM via free access 238 A Felip, F Espigares and others

20 30 20 ACEKissr2 SRE Kissr3 SRE hKISSR1 SRE

Kiss1–15 Kiss2–12 25 15 Kiss1–10 b 15 d Kiss2–10 b 20 b b 10 10 b 15 a c a a a a 5 a a 5 b 10 a Luciferase activity (ratio) Luciferase a a a a 5 0 0 –7 –6 –5 –7 –6 –5 –7 –6 –5

25BDKissr2 CRE 10 Kissr3 CRE20 F mKISSR1 SRE

20 c 8 b d 15 15 6 10 10 b c b b 4 a 5 a a b 5 a Luciferase activity (ratio) Luciferase a a a a a 2 0 0 –7 –6 –5 –7 –6 –5 –7 –6 –5 Peptide concentration (log M) Peptide concentration (log M) Peptide concentration (log M)

Figure 8 Differential ligand selectivity of sea bass Kiss receptors. SRE- (A, C, E, F) and CRE-driven (B and D) luciferase activities in CHO cells transfected with sea bass kissr2 (sb-kissr2) (A and B) or sea bass kissr3 (sb-kissr3) (C and D) and stimulated with Kiss1–10, Kiss1–15, Kiss2–10 or Kiss2–12. SRE-driven luciferase activities in CHO cells transfected with human KISSR1 (hKISSR1) (E) or mouse Kissr1 (mKISSR1) (F) and stimulated with Kiss1–10, Kiss1–15, Kiss2–10 or Kiss2–12. Results are mean valuesGS.E.M. from two independent experiments, each conducted in duplicate, and are expressed as the ratio of firefly luciferase activity to Renilla luciferase activity. The dashed line corresponds to basal levels of luciferase activity, in the absence of any stimulating peptide. Lowercase letters show significant differences with respect to the basal levels for each sample point (peptide concentration). article) in sea bass, where they are expressed in somatic progesterone receptor (PR) elements, suggesting that and gonadal tissue and show different potencies and the kiss receptors genes are regulated by steroids, as ligand selectivity to synthetic Kiss1 and Kiss2 peptides. described in the yellowtail kingfish and zebrafish Sequence analyses of kissr genes show that these (Nocillado et al. (2013) and this study). Sea bass Kiss receptors are highly conserved in evolution, as demon- receptors may also be regulated by tumor-related genes strated by the amino acid sequence identities (21–66%) such as transcription factor Wilms tumor 1 (WT1) and among the different forms of Kiss receptors across transcription factor Yin Yang 1 (YY1) (Roth et al. 2007, vertebrate species (Tena-Sempere et al. 2012). Most Nocillado et al. 2013), and it is also possible that vertebrate kissr genes consist of five coding exons, photoperiod acts on the kissr genes at the level of although sea bass and medaka kissr2 have six exons. expression as they contain C/EBP elements. In zebrafish, Interestingly, an additional intron has been observed these elements correspond to the light-responsive D-box between TMVI and TMVII in sea bass and medaka but regulatory motif (Weger et al. 2011). These observations not in other species whose gene sequences are currently provide preliminary data that could offer new insights available. Nevertheless, sea bass Kiss receptors possess into kissr transcriptional regulation and function. conserved structural elements of the rhodopsin-like To date, multiple kissr genes have been described in GPCR family, which have been shown to be necessary vertebrate species. Recent findings pointed to the for correct receptor folding, activation, signaling and presence of four kissr genes in osteichthyan species internalization of GPCRs (Lee et al. 1999, Gloriam et al. and three forms in an early group of teleosts, thus 2005, Oh et al. 2006, Millar & Newton 2010). The demonstrating the existence of a triplicate Kiss system in additional characterization of the kissr promoter fish (Pasquier et al. 2014a,b). Conversely, available data sequences of sea bass revealed that they contain putative are scarce in invertebrates (Biran et al. 2008, Pasquier conserved transcription factor binding sites similar to et al. 2012a,b, 2014a,b, Tena-Sempere et al. 2012). In those observed in other teleosts (Mechaly et al. 2010, addition to the characterization and/or prediction of Kiss Nocillado et al. 2013) and mammals (Roth et al. 2007). receptor sequences in the sea urchin (Biran et al. 2008, Of note, bioinformatic analysis of sea bass genes pointed Pasquier et al. 2012a) and the acorn worm (Pasquier to the presence of glucocorticoid receptor (GR) and et al. (2012a) and this study), we identify some

Reproduction (2015) 150 227–243 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/29/2021 01:27:29PM via free access Characterization of sea bass kiss receptors 239 significant blast hits of kissr in the Branchiostoma chondrichthyans (Pasquier et al. 2012b), while only one genome (amphioxus or lancelets). This supports the kissr has been identified in the sea lamprey, although it hypothesis that at least one ancestral Kiss receptor might does not specifically correlate to any of the four have existed before the emergence of vertebrates osteichthyan kissrs (Pasquier et al. (2012a) and this (Pasquier et al. 2014a), as Branchiostoma (Cephalochor- study). However, it is known that the lamprey genome data) reflects a primitive prevertebrate condition contains two kiss genes corresponding to the two rounds (Holland et al. 2008). On the other hand, the existence of whole genome duplication (Felip et al. 2009). In our of more than one kissr gene in amphioxus, prior to the study, we observed that the branch encompassing the whole genome duplication (WGD) events of vertebrates kissr1 form separated from the kissr2 form, deducing that (Dehal & Boore, 2005), is not strange, since it is known both emerged from a common ancestor. These findings that Branchiostoma genome cannot itself be taken as the are further supported by Pasquier et al. (2014b),who ancestral chordate genome, as it exhibited specialized indicated that kissr1 and kissr3 (kissr2 in our nomen- features after its divergence from the rest of the chordate clature) could be sister groups after the 2R. In addition, lineage (Holland et al. 2008, Louis et al. 2012). The the data presented in this study show that the branch current status and proposed evolutionary history of kissr encompassing the kissr3 form separated from the kissr4 genes among vertebrates points to the separation of Kiss form, thus concluding that kissr3 and kissr4 could be receptors into four main clades (Pasquier et al. 2014a,b) also sister groups. The Kissr form present in most teleost and this study). The sea bass Kiss receptors cluster into species and the amphibians, coelacanth and spotted gar two different clades with the kissr2 being related to the has been tentatively referred to as kissr3 in our forms found in a few teleosts such as medaka nomenclature after considering the distinct terminolo- (Beloniformes), zebrafish and goldfish (Cypriniformes), gies used to name Kiss receptors across species (see the Elopomorph European eel, the Actinopterygian Supplemental Material Table S1 for comparison, see spotted gar and two Sarcopterygians (Xenopus and section on supplementary data given at the end of this coelacanth) (Pasquier et al. 2012a). Thus, the sea bass article). Further characterization of Kiss receptor pepti- kissr3 form is the ortholog of those forms found in most of dic sequences in an increasing number of lineages will previously described teleosts, including Mugiliforms, be crucial to providing new evolutionary insights into Pleuronectiforms, Tetraodontiforms, Gasterosteiforms this receptor family in Deuterostomes. and Perciforms. This clade also encompasses the The tissue expression of kissr genes, and those of their Elopomorphes European eel, the Actinopterygians cognate ligands kiss1 and kiss2, in the brain and the spotted gar and three sarcopterygian species (Xenopus, gonads of sea bass, medaka and zebrafish is fully bullfrog and coelacanth) (Pasquier et al. 2012a). Synteny compatible with their putative roles in fish reproduction analysis shows that the four kissr neighboring genomic (Felip et al. (2009) and this study). In this respect, the regions are highly conserved, and when multiple genes mRNA expression profiles of kissr and kiss genes in the are identified in the same species, they are located in brain of sea bass suggested that these two kisspeptin different chromosomes (Lee et al. (2009),Umet al. systems might be involved in segregated functions of (2009), Akazome et al. (2010), Kim et al. (2012), neuroendocrine signaling that control early or late events Pasquier et al. (2012a,b) and this study). Our phyloge- of gametogenesis in this species (Migaud et al. 2012, netic and synteny analyses agree with those data Alvarado et al.2013). Moreover, the expression profiles of suggesting that this gene family might have arisen from two kisspeptin genes and their receptors in the gonads of a single ancestral gene – and genomic region – through adult male sea bass support the role of kisspeptins in the the two successive WGDs (1R and 2R) early in vertebrate regulation of late stages of spermatogenesis in this species, evolution, resulting in these four kissr paralogons. It as reported in other teleosts. In the Senegalese sole (Solea seems that the ocurrence of a third WGD event (3R) in senegalensis), the kiss2/kissr3 system is expressed in all the teleost fish lineage (w350 million years ago) had no germ cell types at different stages during spermatogenesis impact on the number of kissr paralogs in current (Marı´n-Juez et al.2013), while in sea bass the expression teleosts, as the potential existence of up to eight kiss of kiss1 and kiss2 did not change across the progression of receptor genes has not been reported in any species gonadal growth, kissr2 and kissr3 reaching a maximum at analyzed (Pasquier et al. 2014a,b). So far, the common the initiation and completion of the spermiation period. ancestral kissr gene diversified through gene duplication, For the first time in a multiple group-synchronous spawner with subsequent gene losses, to display a large variability teleost, the sea bass, the present study describes the of Kiss receptors (and ligands) depending on the species expression profiles of all four kisspeptin system genes (Akazome et al. 2010, Um et al. 2010, Kim et al. 2012, during the first gonadal recrudescence in males. Interest- Pasquier et al. 2012a,b, 2014a,b). In this context, the ingly, the elevated expression of Kiss receptors in impact of these events in Gnathostomos (chondrich- spermiation could be due to the group-synchronous thyans) and Agnathos (cyclostomes) is still uncertain. nature of gonadal development in this species, in which Currently, only some partial Kiss receptor these expression levels would need to be maintained in sequences have been identified but not published in some clutches of developing gametes. On the other hand, www.reproduction-online.org Reproduction (2015) 150 227–243

Downloaded from Bioscientifica.com at 09/29/2021 01:27:29PM via free access 240 A Felip, F Espigares and others in vitro functional luciferase assays conducted in this study a potency similar to that of Kiss1 peptides. In the case of demonstrate that sea bass Kissr2 and Kissr3 signals can be mouse Kissr1, sea bass Kiss1–15 showed the highest transduced via both PKA and PKC pathways. These potency while Kiss1–10 and Kiss2–12 exhibited a similar findings are consistent with data from zebrafish (Biran potency. Therefore, the ability of the sea bass Kiss2- et al. 2008), medaka (Kanda et al. 2013) and chub derived peptides for the activation of human KISSR1 might mackerel (Ohga et al. 2013). In contrast, and as observed support the initial evidence that provides the existence of a in mammals (Kotani et al.2001, Muir et al. 2001), no PKA kiss2-like gene in the genome database of primates activation has been described in orange spotted grouper including humans (Osugi et al. 2013). (Shi et al. 2010) and bullfrog (Moon et al. 2009). Thus, the All in all, the neuroanatomical distribution of kiss- sea bass Kiss1–15 exhibited the highest potency when and kissr-expressing neurons in sea bass (Escobar et al. activating the PKA pathway through Kissr2, as the CRE- 2013a,b) and zebrafish (Servili et al. 2011) agree with driven luciferase activity was higher than that driven by the higher potency of Kiss2 for activating Kissr3 rather the SRE promoter. Kissr3 was maximally activated by than Kissr2. While kissr2 mRNAs exhibit a modest Kiss2–12. These findings indicate that long Kiss peptides expression in limited regions of the brain, kissr3 mRNAs are more potent activators of Kiss receptors than the present a very large distribution and a high level of corresponding Kiss10 peptides in sea bass as has also been expression in the fore-, mid- and hindbrain (Servili et al. described in zebrafish (Lee et al. 2009), medaka (Kanda 2011, Escobar et al. 2013b). As in the zebrafish, sea et al.2013) and chub mackerel (Ohga et al. 2013). Our bass positive Kiss2 immunoreactive cells are observed results indicate that Kiss1 exhibits a preference for Kissr2, in the central telencephalon and the region surrounding while Kiss2 exhibits a preference for Kissr3, although this the lateral recess of the hypothalamus that exhibits receptor is also activated by the Kiss1 ligand. These kissr3-expressing neurons (Escobar et al. 2013b). There- findings are in close agreement with previous data in fore, it has been suggested that Kiss2 may be the zebrafish, where it was demonstrated that synthetic Kiss1 physiological ligand of Kissr3 in these brain regions and Kiss2 peptides activate Kiss receptors with different (Escobar et al. 2013b). This is in line with the observed potencies, the Kissr2 form exhibiting higher sensitivity enhancement of the expression of the kiss2/kissr3 toward Kiss1-derived peptides than Kiss2-derived system compared with kiss1 and kissr2 genes in the peptides (Lee et al.2009). In the southern bluefin tuna brain during different gonadal stages of adult male and (Thunnus maccoyii) and in yellowtail kingfish (Seriola female sea bass (Alvarado et al. 2013). In addition, the lalandi), Kissr3 showed a higher response to Kiss2–10 than fact that many teleosts lack kissr2 but possess kissr3 to Kiss1–10, with stronger transduction via the PKC than suggests that the kiss2/kissr3 system may be the most PKA pathway (Nocillado et al. 2012). Conversely, in robust one during the teleost evolutionary process, thus goldfish, according to Li et al. (2009), Kiss1–10 enhances operating as the Kiss/Gpr54 system does in mammals. the PKC pathway through Kissr3 activation, while Kiss2– Nevertheless, it must be taken into account that 10 exhibits higher preference for Kissr2 and the ability to zebrafish mutant lines of the ligands or receptor genes activate both PKC and PKA pathways. It is interesting to has demonstrated that the reproductive capability is not note that the concentration of ligands used for receptor impaired in male and female knockouts, indicating that activation in sea bass was higher than in medaka, the kiss/kissr systems are not absolutely essential for zebrafish and yellowtail kingfish, while the concentration reproduction in certain nonmammalian vertebrates of ligands for receptor activation in yellowtail kingfish and (Tang et al. 2015). In this line, these results show that southern bluefin tuna showed to be higher than those used among vertebrates, fish have an exceptional range of in medaka, zebrafish and chub mackerel. This can be reproductive strategies, and thus several scenarios might presumably due to different experimental conditions of be favored in evolution. Further investigation into the transfection assays such as expressionvectors, origin of the comparative physiology of kisspeptins and their cells, plasmid concentrations and/or transfection reagents receptors will be necessary to understand the function- as well as the luciferase reporter assays tested. Taken ality of these paralog genes. together, these data point to the existence of different levels of activation for the Kiss/Kissr systems in teleosts. When two Kiss receptors coexist in a fish species, both Supplementary data receptors may be activated by the two Kiss ligands with This is linked to the online version of the paper at http://dx.doi. different potencies, indicating differential ligand selec- org/10.1530/REP-15-0204. tivity (Biran et al. (2008), Lee et al. (2009), Li et al. (2009), Kanda et al. (2013) and Ohga et al. (2013) and this study) and influencing physiological actions (Felip et al. 2009, Kitahashi et al.2009, Li et al. 2009). Of note, our results Declaration of interest show that the sea bass Kiss1-derived peptides exhibit high The authors declare that there is no conflict of interest that potency to activate the human KISSR1. Furthermore, our could be perceived as prejudicing the impartiality of the findings have demonstrated that Kiss2 dodecapeptide has research reported.

Reproduction (2015) 150 227–243 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/29/2021 01:27:29PM via free access Characterization of sea bass kiss receptors 241

Funding Escobar S, Felip A, Gueguen MM, Zanuy S, Carrillo M, Kah O & Servili A 2013a Expression of kisspeptins in the brain and pituitary of the European This work was supported by GV (GV06/268) to A Go´mez and sea bass (Dicentrarchus labrax). Journal of Comparative Neurology 521 grant number FP7222719 (LIFECYCLE) from EU, Programa 933–948. (doi:10.1002/cne.23211) PROMETEO (Prometeo/2010/003; PrometeoII/2014/051) and Escobar S, Servili A, Espigares F, Gueguen MM, Brocal I, Felip A, Go´mez A, Carrillo M, Zanuy S & Kah O 2013b Expression of kisspeptins and kiss Accio´n Complementaria GV (ACOMP2010) to S Zanuy. A Felip receptors suggests a large range of functions for kisspeptin systems in the was supported by a Ramo´n y Cajal contract and F Espigares was brain of the European sea bass. PLoS ONE 8 e70177. (doi:10.1371/ supported by a JAE Predoctoral fellowship from Consejo journal.pone.0070177) Superior de Investigaciones Cientı´ficas (CSIC, Spain). Espigares F, Carrillo M, Go´mez A & Zanuy S 2015 The forebrain–midbrain acts as functional endocrine signaling pathway of Kiss2/Gnrh1 system controlling the gonadotroph activity in the teleost fish european sea bass (Dicentrarchus labrax). Biology of Reproduction 92 70. (doi:10.1095/ Acknowledgements biolreprod.114.125138) Farre´ D, Roset R, Huerta M, Adsuara JE, Rosello´ LL, Alba` MM & We thank C Marı´n and Dr A Rocha for their assistance in Messeguer X 2003 Identification of patterns in biological sequences at rearing and sampling the fish and bioinformatic analyses, the ALGGEN server: PROMO and MALGEN. Nucleic Acids Research 31 respectively. We are indebted to Dr R Reinhardt for access to 3651–3653. unpublished sea bass genome sequence data. We are grateful Felip A, Zanuy S, Pineda R, Pinilla L, Carrillo M, Tena-Sempere M & Go´mez A 2009 Evidences for two distinct KiSS genes in non-placental to Dr R Miller from MRC Human Reproductive Science Unit vertebrales that codes kisspeptins with different gonadotropin-releasing (Edinburgh) and Dr M Tena-Sempere from University of activities in fish and mammals. Molecular and Cellular Endocrinology Cordoba (Spain) for the kind provision of human and mouse 312 61–71. (doi:10.1016/j.mce.2008.11.017) Kissr plasmids. Filby AL, van Aerle R, Duitman J & Tyler CR 2008 The kisspeptin/ gonadotropin-releasing hormone pathway and molecular signaling of puberty in fish. Biology of Reproduction 78 278–289. (doi:10.1095/ biolreprod.107.063420) Funes S, Hendrick JA, Vassileva G, Markowitz L, Abbondanzo S, References Golovko A, Yang S, Monsma FJ & Gustafson EL 2003 The KiSS-1 receptor GPR54 is essential for the development of the murine van Aerle R, Kille P, Lange A & Tyler CR 2008 Evidence for the existence of reproductive system. Biochemical and Biophysical Research a functional Kiss1/Kiss1 receptor pathway in fish. Peptides 29 57–64. Communications 312 1357–1363. (doi:10.1016/j.bbrc.2003.11.066) (doi:10.1016/j.peptides.2007.10.018) Gloriam DEI, Schio¨th HB & Fredriksson R 2005 Nine new human Akazome Y, Kanda S, Okubo K & Oka Y 2010 Functional and evolutionary Rhodopsin family G-protein coupled receptors: identification, sequence insights into vertebrate kisspeptin systems from studies of fishbrain. charactarisation and evolutionary relationship. Biochimica et Biophysica Journal of Fish Biology 76 161–182. (doi:10.1111/j.1095-8649.2009. Acta 1722 235–246. (doi:10.1016/j.bbagen.2004.12.001) 02496.x) Holland LZ, Albalat R, Azumi K, Benito-Gutie´rrez E, Blow MJ, Bronner- Alvarado MV, Carrillo M & Felip A 2013 Expression of kisspeptins and their Frase M, Brunet F, Butts T, Candiani S, Dishaw LJ et al. 2008 The receptors, gnrh-1/gnrhr-II-1a and gonadotrpin genes in the brain of adult amphioxus genome illuminates vertebrate origins and cephalochordate male and female European sea bass during different gonadal stages. biology. Genome Research 18 1100–1111. (doi:10.1101/gr.073676.107) General and Comparative Endocrinology 187 104–116. (doi:10.1016/j. ygcen.2013.03.030) Kanda S, Akazome Y, Matsunaga T, Yamamoto N, Yamada S, Tsukamura H, Alvarado MV, Carrillo M & Felip A 2015 Melatonin-induced changes in Maeda K & Oka Y 2008 Identification of KiSS-1 product kisspeptin and kiss/gnrh gene expression patterns in the brain of male sea bass during steroid-sensitive sexually-dimorphickisspeptin neurons in medaka (Oryzias spermatogenesis. Comparative Biochemistry and Physiology. Part A, latipes). Endocrinology 149 2467–2476. (doi:10.1210/en.2007-1503) Molecular & Integrative Physiology 185 69–79. (doi:10.1016/j.cbpa. Kanda S, Akazome Y, Mitani Y, Okubo K & Oka Y 2013 Neuroanatomical 2015.03.010) evidence that kisspetin directly regulates isotocin and vasotocin neurons. Begtashi I, Rodrı´guez L, Mole´s G, Zanuy S & Carrillo M 2004 Long-term PLoS ONE 8 e62776. (doi:10.1371/journal.pone.0062776) exposure to continuous light inhibits precocity in juvenile male European Kim DK, Cho EB, Moon MJ, Park S, Hwang JI, Do Rego JL, Vaudry H & sea bass (Dicentrarchus labrax, L.). I. Morphological aspects. Aqua- Seong JY 2012 Molecular coevolution of neuropeptides gonadotropin- culture 241 539–559. (doi:10.1016/j.aquaculture.2004.07.011) releasing hormone and kisspeptin with their cognate G protein-coupled Biran J, Ben-Dor S & Levavi-Sivan B 2008 Molecular identification and receptors. Frontiers in Neuroscience 6 3. (doi:10.3389/fnins.2012. functional characterization of the kisspeptin/kisspeptin receptor system 00003) in lower vertebrates. Biology of Reproduction 79 776–786. (doi:10.1095/ Kotani M, Detheux M, Vandenbogaerde A, Communi D, biolreprod.107.066266) Vanderwinden JM, Le PE, Brezillon S, Tyldesley R, Suarez-Huerta N & Brudno M, Steinkamp R & Morgenstern B 2004 The CHAOS/DIALIGN Vandeput F 2001 The metastasis suppressor gene KiSS-1 encodes WWW server for multiple alignment of genomic sequences. Nucleic kisspeptins, the natural ligands of the orphan G protein-coupled Acids Research 32 41–44. (doi:10.1093/nar/gkh361) receptor GPR54. Journal of Biological Chemistry 276 34631–34636. Carrillo M, Zanuy S, Felip A, Bayarri MJ, Mole´sG&Go´mez A 2009 (doi:10.1074/jbc.M104847200) Hormonal and environmental control of puberty in perciform fish: the Kitahashi T, Ogawa S & Parhar IS 2009 Cloning and expression of kiss2 in case of sea bass. Annals of the New York Academy of Sciences 1163 the zebrafish and medaka. Endocrinology 150 821–831. (doi:10.1210/ 49–59. (doi:10.1111/j.1749-6632.2008.03645.x) en.2008-0940) Cartharius K, Frech K, Grote K, Klocke B, Haltmeier M, Klingenhoff A, Kumar S, Nei M, Dudley J & Tamura K 2008 MEGA: a biologist-centric Frisch M, Bayerlein M & Werner T 2005 MatInspector and beyond: software for evolutionary analysis of DNA and protein sequences. promoter analysis based on transcription factor binding sites. Bioinfor- Briefings in Bioinformatics 9 299–306. (doi:10.1093/bib/bbn017) 0 matics 21 2933–2942. (doi:10.1093/bioinformatics/bti473) Lee DK, Nguyen T, O Neill GP, Cheng R, Liu Y, Howard AD, Coulombe N, Chianese R, Ciaramella V, Fasano S, Pierantoni R & Meccariello R 2013 Tan CP, Tang-Nguyen AT, George SR et al. 1999 Discovery of a receptor Kisspeptin receptor, GPR54, as a candidate for the regulation of testiuclar related to the galanin receptors. FEBS Letters 466 103–107. (doi:10.1016/ activity in the frog Rana esculenta. Biology of Reproduction 88 73. S0014-5793(99)00009-5) (doi:10.1095/biolreprod.112.103515) Lee YR, Tsunekawa K, Moon MJ, Um HN, Hwang JI, Osugi T, Otaki N, Dehal P & Boore JL 2005 Two rounds of whole genome duplication in the Sunakawa Y, Kim K, Vaudry H et al. 2009 Molecular evolution of ancestral vertebrate. PLoS Biology 3 e314. (doi:10.1371/journal.pbio. multiple forms of kisspeptins and GPR54 receptors in vertebrates. 0030314) Neuroendocrinology 150 2837–2846. (doi:10.1210/en.2008-1679) www.reproduction-online.org Reproduction (2015) 150 227–243

Downloaded from Bioscientifica.com at 09/29/2021 01:27:29PM via free access 242 A Felip, F Espigares and others

Li S, Zhang Y, Liu Y, Huang X, Huang W, Lu D, Zhu P, Shi Y, Cheng CHK, Oh YDa, Kim K, Kwon HB & Seong JY 2006 Cellular and molecular biology Liu X et al. 2009 Structural and functional multiplicity of the of orphan G protein-coupled receptors. International Review of Cytology kisspeptin/GPR54 system in goldfish (Carassius auratus). Journal of 252 163–218. (doi:10.1016/S0074-7696(06)52003-0) Endocrinology 201 407–418. (doi:10.1677/JOE-09-0016) Ohga H, Fujinaga Y, Selvaraj S, Kitano H, Nyuji M, Yamaguchi A & Louis A, Crollius HR & Robinson-Rechavi M 2012 How much does the Matsuyama M 2013 Identification, characterization, and expression amphioxus genome represent the ancestor of chordates? Briefings in profiles of two subtypes of kisspetin receptors in a scombroid fish (chub Functional Genomics 11 89–95. (doi:10.1093/bfgp/els003) mackerel). General and Comparative Endocrinology 193 130–140. Marı´n-Juez R, Vin˜as J, Mechaly AS, Planas JV & Piferrer F 2013 Stage- (doi:10.1016/j.ygcen.2013.07.016) specific gene expression during spermatogenesis in the Senegalese sole Osugi T, Ohtaki N, Sunakawa Y, Son YL, Ohkubo M, Iigo M, Amano M & (Solea senegalensis), a fish with semi-cystic type of spermatogenesis, as Tsutsu K 2013 Molecular evolution of Kiss2 genes and peptides in assessed by laser capture microdissection and absolute quantitative PCR. vertebrates. Endocrinology 154 4270–4280. (doi:10.1210/en.2012-2267) General and Comparative Endocrinology 188 242–250. (doi:10.1016/ Parhar IS, Ogawa S & Sakuma Y 2004 Laser-captured single digoxigenin- j.ygcen.2013.04.015) labeled neurons of gonadotropin-releasing hormone types reveal a novel Mechaly AS, Vin˜as J & Piferrer F 2009 Identification of two isoforms of the G protein-coupled receptor (Gpr54) during maturation in cichlid fish. kisspeptin-1 receptor (Kiss1r) generated by alternative splicing in a Endocrinology 145 3613–3618. (doi:10.1210/en.2004-0395) modern teleost, the Senegalese sole (Solea senegalensis). Biology of Pasquier J, Lafont AG, Jeng SR, Morini M, Dirks R, van den Thillart G, Reproduction 80 60–69. (doi:10.1095/biolreprod.108.072173) Tomkiewicz J, Tostivint H, Chang CF & Rousseau K 2012a Multiple Mechaly AS, Vin˜as J, Murphy C, Reith M & Piferrer F 2010 Gene kisspeptin receptors in early osteichthyans provide new insights into the structure and regulation of the Kiss-1 receptor-2 (Kiss1r-2) in the Atlantic evolution of this receptor family. PLoS ONE 11 e48931. (doi:10.1371/ halibut: insights into the evolution and regulation of Kiss1r genes. journal.pone.0048931) Molecular and Cellular Endocrinology 317 78–89. (doi:10.1016/j.mce. Pasquier J, Lafont AG, Tostivint H, Vaudry H, Rousseau K & Dufour S 2012b 2009.11.005) Comparative evolutionary histories of kisspeptins and kisspeptin Messeguer X, Escudero R, Farre´ D, Nun˜ez O, Martı´nez J & Alba` MM 2002 receptors in vertebrates reveal both parallel and divergent features. PROMO: detection of known transcription regulatory elements using Frontiers in Endocrinology 3 173. (doi:10.3389/fendo.2012.00173) species-tailored searches. Bioinformatics 18 333–334. (doi:10.1093/ Pasquier J, Kamech N, Lafont AG, Vaudry H, Rousseau K & Dufour S 2014a bioinformatics/18.2.333) Kisspeptin/kisspetin receptors. Journal of Molecular Endocrinology 52 Migaud H, Ismail R, Cowan M & Davie A 2012 Kisspetin and seasonal 101–117. (doi:10.1530/JME-13-0224) control of reproduction in male European sea bass (Dicentrarchus Pasquier J, Lafont AG, Rousseau K, Que´rat B, Chemineau P & Dufour S labrax). General and Comparative Endocrinology 179 384–399. 2014b Looking for the bird kiss: evolutionary scenario in sauropsids. BMC (doi:10.1016/j.ygcen.2012.07.033) Evolutionary Biology 14 30. (doi:10.1186/1471-2148-14-30) Millar RP & Newton CL 2010 The year in G protein-coupled receptor research. Pinilla L, Aguilar E, Dieguez C, Millar RP & Tena-Sempere M 2012 Kisspeptins Molecular Endocrinology 24 261–274. (doi:10.1210/me.2009-0473) and reproduction: physiological roles and regulatory mechanisms. Mitter K, Kotoulas G, Magoulas A, Mulero V, Sepulcre P, Figueras A, Physiological Reviews 92 1235–1316. (doi:10.1152/physrev.00037.2010) Novoa B & Sarropoulou E 2009 Evaluation of candidate reference genes Rocha A, Zanuy S, Carrillo M & Go´mez A 2009 Seasonal changes in for QPCR during ontogenesis and of immune-relevant tissues of gonadal expression of gonadotropin receptors, steroidogenic acute European seabass (Dicentrarchus labrax). Comparative Biochemistry regulatory protein and steroidogenic enzymes in the European sea and Physiology. Part B, Biochemistry & Molecular Biology 153 340–347. bass. General and Comparative Endocrinology 162 265–275. (doi:10.1016/j.cbpb.2009.04.009) (doi:10.1016/j.ygcen.2009.03.023) Mohamed JS, Benninghoff AD, Holt GJ & Khan IA 2007 Developmental Roth CL, Mastronardi C, Lomniczi A, Wright H, Cabrera R, Mungenast AE, expression of the G protein-coupled receptor 54 and three GnRH Heger S, Jung H, Dubay C & Ojeda SR 2007 Expression of a tumor-related mRNAs in the teleost fish cobia. Journal of Molecular Endocrinology 38 gene network increases in the mammalian hypothalamus at the time offemale 235–244. (doi:10.1677/jme.1.02182) puberty. Endocrinology 148 5147–5161. (doi:10.1210/en.2007-0634) Moon JS, Lee YR, Oh DY, Hwang JI, Lee JY, Kim JI, Vaudry H, Kwon HB & de Roux N, Genin E, Carel JC, Matsuda F, Chaussain JL & Milgrom E 2003 Seong JY 2009 Molecular cloning of the bullfrog kisspeptin receptor Hypogonadotropic hypogonadism due to loss of function of the GPR54 with high sensitivity to Xenopus kisspeptin. Peptides 30 171–179. KiSS1-derived peptide receptor GPR54. PNAS 100 10972–10976. (doi:10.1016/j.peptides.2008.04.015) (doi:10.1073/pnas.1834399100) Muffato M, Louis A, Poisnel CE & Roest Crollius H 2010 Genomicus: a Seminara SB, Messager S, Chatzidaki EE, Thresher RR, Acierno JS, database and a browser to study gene synteny in modern in modern and Shagoury JK, Bo-Abbas Y, Kuohung W, Schwinof KM, Hendrick AG ancestral genomes. Bioinformatics 26 1119–1121. (doi:10.1093/bioin- et al. 2003 The GPR54 gene as a regulator of puberty. New England formatics/btq079) Journal of Medicine 349 1614–1627. (doi:10.1056/NEJMoa035322) Muir AI, Chamberlain L, Elshourbagy NA, Michalovich D, Moore DJ, Servili A, Le Page Y, Leprince J, Caraty A, Escobar S, Parhar IS, Seong JY, Calamari A, Szekeres PG, Sarau HM, Chambers JK & Murdock P 2001 Vaudry H & Kah O 2011 Organization of two independent kisspeptin AXOR12, a novel human G protein-coupled receptor, activated by the systems derived from evolutionary-ancient kiss kiss genes in the brain of peptide KiSS-1. Journal of Biological Chemistry 276 28969–28975. zebrafish. Endocrinology 152 1527–1540. (doi:10.1210/en.2010-0948) (doi:10.1074/jbc.M102743200) Shi Y, Zhang Y, Li S, Liu Q, Lu D, Liu M, Meng Z, Cheng CHK, Liu X & Lin H Nocillado JN, Levavi-Sivan B, Carrick F & Elizur A 2007 Temporal 2010 Molecular identification of the Kiss2/Kiss1ra system and its expression of G-protein-coupled receptor 54 (GPR54), gonadotropin- potential function during 17 a-methyltestosterone-induced sex reversal releasing hormones (GnRH), and dopamine receptor D2 (drd2) in in the orange-spotted grouper, Epinephelus coioides. Biology of pubertal female grey mullet, Mugil cephalus. General and Comparative Reproduction 83 63–74. (doi:10.1095/biolreprod.109.080044) Endocrinology 150 278–287. (doi:10.1016/j.ygcen.2006.09.008) Shimizu Y, Tomikawa J, Hirano K, Nanikawa Y, Akazome Y, Kanda S, Nocillado JN, Biran J, Lee YY, Levavi-Sivan B, Mechaly AS, Zohar Y & Kazeto Y, Okuzawa K, Uenoyama Y, Ohkura S et al. 2012 Central Elizur A 2012 The Kiss2 receptor (Kiss2r) gene in Southern Bluefin distribution of kiss2 neurons and peri-pubertal changes in their tuna. Thunnus maccoyii and in yelowtail kingfish, Seriola lalandi – expression in the brain of male and female red seabream Pagrus major. Functional analysis and isolation of transcript variants. Molecular General and Comparative Endocrinology 175 432–442. (doi:10.1016/ and Cellular Endocrinology 362 211–220. (doi:10.1016/j.mce.2012. j.ygcen.2011.11.038) 06.024) Tang H, Liu Y, Luo D, Ogawa S, Yin Y, Li S, Zhang Y, Hu W, Parhar IS, Lin H Nocillado JN, Mechaly AS & Elizur A 2013 In silico analysis of the et al. 2015 The kiss/kissr systems are dispensable for zebrafish regulatory region of the yellowtail kingfish and zebrafish Kiss and Kiss reproduction: evidence from gene knockout studies. Endocrinology receptor genes. Fish Physiology and Biochemistry 39 59–63. (doi:10. 156 589–599. (doi:10.1210/en.2014-1204) 1007/s10695-012-9642-0) Tena-Sempere M 2010a Kisspeptin signaling in the brain: recent Oakley AE, Clifton DK & Steiner RA 2010 Kisspeptin signaling in the brain. developments and future challenges. Molecular and Cellular Endo- Endocrine Reviews 30 713–743. (doi:10.1210/er.2009-0005) crinology 314 164–169. (doi:10.1016/j.mce.2009.05.004)

Reproduction (2015) 150 227–243 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/29/2021 01:27:29PM via free access Characterization of sea bass kiss receptors 243

Tena-Sempere M 2010b Roles of kisspeptins in the control of hypothalamic– Zhao Y & Wayne NL 2012 Effects of kisspeptin1 on electrical activity of an gonadotropic function: focus on sexual differentiation and puberty onset. extrahypothalamic population of gonadotropin-releasing hormone neurons In: Pediatric Neuroendocrinology, vol 17 52–62. Eds Loche S, Cappa M, in medaka (Oryzias latipes). PLoS ONE 7 e37909. (doi:10.1371/journal. Ghizzoni L, Maghnie M & Savage MO. Endocr Dev Basel, Karger. pone.0037909) Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F & Higgins DG 1997 Zmora N, Stubblefield J, Zulperi Z, Biran J, Levavi-Sivan B, Mun˜oz-Cueto JA The CLUSTAL X windows interface: flexible strategies for multiple & Zohar Y 2012 Differential and gonad stage-dependent roles of sequence alignment aided by quality analysis tools. Nucleic Acids kisspeptin1 and kisspeptin2 in reproduction in the modern teleosts, Research 25 4876–4882. (doi:10.1093/nar/25.24.4876) Morone species. Biology of Reproduction 86 177. (doi:10.1095/ Tena-Sempere M, Felip A, Go´mez A, Zanuy S & Carrillo M 2012 biolreprod.111.097667) Comparative insights of the kisspeptin/kisspeptin receptor system: Zohar Y, Mun˜oz-Cueto JA, Elizur A & Kah O 2010 Neuroendocrinology of lessons from non-mammalian vertebrates. General and Comparative reproduction in teleost fish. General and Comparative Endocrinology Endocrinology 175 234–243. (doi:10.1016/j.ygcen.2011.11.015) 165 438–455. (doi:10.1016/j.ygcen.2009.04.017) Um HN, Han JM, Hwang JIK, Hong SI, Vaudry H & Seong JY 2010 Molecular coevolution of kisspeptins and their receptors from fish to mammals. Annals of the New York Academy of Sciences 1200 67–74. (doi:10.1111/j.1749-6632.2010.05508.x) Received 30 April 2015 Weger BD, Sahinbas M, Otto GW, Mracek P, Armant O, Dolle D, Lahiri K, First decision 27 May 2015 Vallone D, Ettwiller L, Geisler R et al. 2011 The light responsive transcriptome of the zebrafish: function and regulation. PLoS ONE 6 Revised manuscript received 1 June 2015 e17080. (doi:10.1371/journal.pone.0017080) Accepted 5 June 2015

www.reproduction-online.org Reproduction (2015) 150 227–243

Downloaded from Bioscientifica.com at 09/29/2021 01:27:29PM via free access