A2) United States Patent (10) Patent No.: US 8,940,711 B2 Olsonet Al

US008940711B2 a2) United States Patent (10) Patent No.: US 8,940,711 B2 Olsonet al. (45) Date of Patent: Jan. 27, 2015

(54) MICRO-RNA FAMILY THAT MODULATES C1I2N 2310/321 (2013.01); C12N 2310/346 FIBROSIS AND USES THEREOF (2013.01); CI2N 2310/3515 (2013.01); C12N (71) Applicant: The Board of Regents, The University 2320/31 (2013.01); CI2N 2330/10 (2013.01) of Texas System, Austin, TX (US) USPC iececcsesseeseeesenensceesensessecsenesenscnseeee 514/444 (58) Field of Classification Search (72) Inventors: Erie N. Olson, Dallas, TX (US); Eva USPC iececcsesseeseeesenensceesensessecsenesenscnseeee 514/44A van Rooij, Utrecht (NL) See application file for complete search history. (56) References Cited (73) Assignee: The Board of Regents, The University of Texas System, Austin, TX (US) U.S. PATENT DOCUMENTS

Notice: Subject to any disclaimer, the term of this 7,232,806 B2 6/2007 Tuschletal. (*) 7,674,617 B2 3/2010 Kim etal. patent is extended or adjusted under 35 2005/0059005 Al 3/2005 Tuschletal. U.S.C. 154(b) by 1 day. 2005/0222399 Al 10/2005 Bentwich 2005/0261218 Al 11/2005 Esau etal. (21) Appl. No.: 13/840,242 2006/0019286 Al 1/2006 Horvitz et al. 2006/0105360 Al 5/2006 Croceet al. Filed: Mar.15, 2013 2006/0185027 Al 8/2006 Bartel etal. (22) 2006/0247193 Al 11/2006 Taira etal. 2007/0087335 Al 4/2007 Brahmacharietal. (65) Prior Publication Data 2007/0092882 Al 4/2007 Wangetal. US 2013/0261169 Al Oct. 3, 2013 2008/0050722 Al 2/2008 Kim etal. 2008/0176766 Al 7/2008 Brown etal. 2009/0053718 Al 2/2009 Naguibnevaet al. Related U.S. Application Data 2009/0092980 Al 4/2009 Arenz etal. 2009/0143326 Al 6/2009 Obadetal. (62) Division of application No. 12/671,445, filed as 2009/0281167 Al 11/2009 Shenetal. application No. PCT/US2008/071839 on Jul. 31, (Continued) 2008, now Pat. No. 8,440,636. FOREIGN PATENT DOCUMENTS (60) Provisional application No. 60/952,917, filed on Jul. 31, 2007, provisional application No. 60/980,303, EP 1440981 A2 7/2004 filed on Oct. 16, 2007, provisional application No. EP 1627925 Al 2/2006 61/047,014,filed on Apr. 22, 2008. (Continued) OTHER PUBLICATIONS (51) Int. Cl. CIQN 15/11 (2006.01) Cheng et al, “MicroRNAs Are Aberrantly Expressed in A6IK 31/713 (2006.01) Hypertrophic Heart,” Am. J. Pathol. 170(6):183 1-1840 (2007). AOIK 67/027 (2006.01) Kim, “International Search Report,” 4 pages, from International A6IK 38/22 (2006.01) Patent Appl. No. PCT/US2008/071839, Korean Intellectual Property CI2N 9/16 (2006.01) Office, Daejon, Republic of Korea (mailed Jan. 6, 2009). CI2N 15/113 (2010.01) Rooij et al., “A signature pattern of stress-responsive microRNAsthat can evoke cardiac hypertrophy and heart failure,” Proc. Natl. Acad. CI2N 15/85 (2006.01) Sci. USA 103(48):18255-18260 (2006). A6IK 31/7105 (2006.01) Tatsuguchiet al., “Expression of MicroRNAsis Dynamically Regu- A6IK 31/712 (2006.01) lated During Cardiomyocyte Hypertrophy,” J. Mol. Cell. Cardiol. A6IK 31/7125 (2006.01) 42(6):1137-1141 (2007). A61K 39/395 (2006.01) Lagos-Quintanaet al., “New microRNAsfrom mouse and. human,” RNA,vol. 9:175-179, 2003. A6IK 45/06 (2006.01) Lagos-Quintanaet al., “Identification of tissue-specific microRNAs A6IK 31/07 (2006.01) from mouse,” Curent Biology, vol. 12:735-739, 2002. AGIK 31/355 (2006.01) (Continued) A6IK 31/375 (2006.01) (52) US. Cl. Primary Examiner — J. E. Angell CPC oc. A61LK 31/713 (2013.01); AOLK 67/0276 (74) Attorney, Agent, or Firm — Cooley LLP (2013.01); A6LK 38/2242 (2013.01); C12N (57) ABSTRACT 9/16 (2013.01); CI2N 15/113 (2013.01); CI2N The present invention relates to the identification of a 15/8509 (2013.01); AGLK 31/7105 (2013.01); microRNAfamily, designated miR-29a-c, that is a key regu- A61LK 31/712 (2013.01); A6LK 31/7125 lator of fibrosis in cardiac tissue. The inventors show that (2013.01); A6LK 39/3955 (2013.01); A61K members of the miR-29 family are down-regulated in the 45/06 (2013.01); A61K 31/07 (2013.01); A6LK heart tissue in responseto stress, and are up-regulatedin heart 31/355 (2013.01); A6LK 31/375 (2013.01); tissue of mice that are resistant to both stress and fibrosis. AOLK 2207/30 (2013.01); AOLK 2217/052 Also provided are methods of modulating expression and (2013.01); AOLK 2217/075 (2013.01); AOILK activity of the miR-29 family of miRNAsas a treatment for 2217/15 (2013.01); AOLK 2217/206 (2013.01); fibrotic disease, including cardiac hypertrophy, skeletal AOLK 2227/105 (2013.01); AOLK 2267/0375 muscle fibrosis other fibrosis related diseases and collagen (2013.01); CI2N 2310/113 (2013.01); C12N loss-related disease. 2310/141 (2013.01); CI2N 2310/315 (2013.01); 22 Claims, 29 Drawing Sheets US 8,940,711 B2 Page 2

(56) References Cited WO WO2007/081720 A2 7/2007 = WO WO 2007/081740 A2 7/2007 U.S. PATENT DOCUMENTS WO WO 2007/109236 A2 9/2007 WO WO 2007/112754 A2 10/2007 2009/0286969 Al 11/2009 Esauetal. WO WO 2008/016924 A2 2/2008 2009/0291906 Al 11/2009 Esauetal. WO WO 2008/043521 A2 4/2008 2009/0291907 Al 11/2009 Esau et al. WO WO 2008/061537 A2 5/2008 2009/0293148 Al 11/2009 Renetal. WO WO 2008/116267 Al 10/2008 2009/0317369 Al 12/2009 Hosodaet al. WO WO 2008/147839 Al 12/2008 2009/0326049 Al 12/2009 Aristarkhovetal. WO WO 2009/012263 A2 1/2009 —_ 2010/0029003 Al 2/2010 Barteletal. WO WO 2009/026576 Al 2/2009 2010/0087512 Al 4/2010 Tuschlet al. WO WO 2009/043353 A2 4/2009 — 2010/0087513 Al 4/2010 Tuschlet al. WO WO 2009/058818 A2 5/2009 2010/0093837 Al 4/2010 Tuschlet al. WO WO 2009/062169 A2 5/2009 2010/0099748 Al 4/2010 Tuschlet al. WO WO 2009/111375 A2 9/2009 2010/0113561 Al 5/2010 Tuschlet al. WO WO 2009/114681 A2 9/2009 WO WO 2009/121031 Al 10/2009 WO WO 2009/149182 Al 12/2009 FOREIGN PATENT DOCUMENTS WO WO 2010/036939 A2 4/2010 WO WO 2010/048585 A2 4/2010 EP 1777301 A2 4/2007 EP 1959012 A2 8/2008 EP 2113567 Al 11/2009 OTHER PUBLICATIONS — JP 2006-5 19008 8/2006 Sempere et al., “Expression profiling of mammalian microRNAs vo Wobolovoaee AQ oooos uncoversa subset ofbrain-expressed microRNAswith possible roles Wo WO 2004/076622 A2 9/2004 in murine and human neuronal differentiation”’ Genome Biology, WO WO 2005/013901 A2 2/2005 vol. 5:R13, 2004. Wo WO 2005/017145 Al 2/2005 Mott et al., “miR-29 regulates Mcl-1 protein expression and. WO WO 2005/040419 Al 5/2005 apoptosis,” Oncogene,vol. 26: 6133-6140, 2007. WO WO2005/047505 A2 5/2005 He et al., “Overexpression of Micro Ribonucleic Acid 29, Highly WO WO 2005/056797 Al 6/2005 Up-Regulated in Diabetic Rats, Leads to Insulin Resistance in 3T3- WO WO 2005/118806 A2 12/2005 L1 Adipocytes,” Molecular Endocrinology, vol. 21: 2785-2794, — WO WO 2006/033020 A2 3/2006 2007 WO WO 2006/033928 A2 3/2006 , . . . . . wo WO 2006/081284 A2 8/2006 Zhaoet al., “Dysregulation of Cardiogenesis, Cardiac Conduction, Wo WO 2006/108473 Al 10/2006 and Cell Cycle in Mice Lacking miRNA-1-2,” Cell. vol. 129: 303- WO WO 2006/111512 Al 10/2006 317, 2007. WO WO 2006/128245 Al 12/2006 Van Rooij et al., “Dysregulation of microRNAsafter myocardial — WO WO 2006/133022 A2 12/2006 infarction reveals a role of miR-29 in cardiac fibrosis,” Proc. Natl. WO WO 2006/137941 A2 12/2006 Acad. Sci. USA,vol. 105: 13027-13032, 2008. — we we sooo ‘ seen Spindler, Supplementary European Search Report for European wo WO 2007/033023 A2 3/2007 Application No. 08797006.7, 10 pages, European Patent Office, The WO WO 2007/042899 A2 4/2007 Hague, mailed Aug. 17, 2011. WO WO 2007/067695 A2 6/2007 Pekarsky Y. et al., “Tell expression in chronic lymphocytic leukemia WO WO 2007/070483 A2 6/2007 is regulated by miR-29 and miR-181,’ Cancer Research, vol. WO WO 2007/081680 A2 7/2007 66:11590-11593, 2006. U.S. Patent Jan. 27, 2015 Sheet 1 of 29 US 8,940,711 B2

UOLOO WOLOO UOLOOTLOLLOOVVW

UWOLOOLIDLLOO

REAM

wee

LID

LINO

ERE

LLOOVWUTYOOUDO

LLOD

MEER

TION CWO

WUC

non eu;

O°D¥

Woo n

REREAD

i€

OAWAYY oynynh

villi

WON

WOO VIO

RONNOOVYYWWOSUpOVeLEAY

OWO

VD VO VO

REED

£ ov

WULYELOOWOLIOLUDLOOULUL

VV VV UUL

O29

“Sid

VIO

39 ¥

LOO LOW

3D DD

G4 OVO

5 Y¥

RENE

AnnnoSeWSDSS VewEoonnonh

LIEITELEE

£9°Se

LOOLYUOTOOUDULLODOOISOOLELOOVONONOOVOL LOLOVOLOOWLULLOODOOODDLLLIOOVALODDOVEL LOLOVS

KEEPER

LODUL

> .S ®

pnd DW)

PLR

_FeESUO

ULEAD

LODO ¥ n

EERE

OS os

doonmueis BOZ-HyW

ODDS

LOST

LLELOOVOLOODOVeL

FPELSRETERES

SINVW

LLIOO

(te

VOR

ton

son

EREE

TIOO

ous)

VOL

as)

«=SSNOH

«RUA

Boa

wea

(Ee

‘ON

‘ON ‘ON

GI CI

OHS)

OS)

OmS) O8S)

UCU U.S. Patent Jan. 27, 2015 Sheet 2 of 29 US 8,940,711 B2

£d —

HUuIUd

el:

anon

IMS UleUy

WZ 00T o oO o o © oO © o 8 Oo mM r+ 4 NN wv

AAPOPH s oO « “Sl uoIssaldxXs OHI SANEIAY

Ayyoequoy

yse2.]

UISOAIN

@JOUIOIILS

Eas

9/2

AyNOeUOD

Mois U.S. Patent Jan. 27, 2015 Sheet 3 of 29 US 8,940,711 B2

Aywpoenuog

TUT

MOIS

PNT

IMU

usipjosAyjodAH

ern

__vy

Ors

athe

WAV)

SSOS

Aqynoe1u09

sme

yse4

U.S. Patent Jan. 27, 2015 Sheet 4 of 29 US 8,940,711 B2

ONL

REK eR

SKM

MPLIEI up

Tee wn

ERNE ot

Buje

RTE

PML tt

Lacroe

et |

oF S

MAUrLEL

sel wy

elite ay

mol "7

sity

wed

Aas

PST

; _<

[tee

OHIN®

uoIssaidxe eAneiay U.S. Patent Jan. 27, 2015 Sheet 5 of 29 US 8,940,711 B2

9n B0c-Ylul

rey

jods

jeds

RTO

UOHeUIqWUIO.eY

polelpefl-31D

snoBojouwoy

UOISIOXy

“TEs

“Ord

Ax,

Are

Len

jeds

eds

SISHVY

ay pexol4

JOJDSA poyebie

odAPPIIM SISHY

Bunsbiel U.S. Patent Jan. 27, 2015 Sheet 6 of 29 US 8,940,711 B2

Ueto

ey ee)

pivey

Rene

jeyeuOeN Pee

“Did

mel

Rl.

See

Bl Aree U.S. Patent Jan. 27, 2015 Sheet 7 of 29 US 8,940,711 B2

colt

Re)

Bly

aps

PVOLSAG

GuNssoig

Eolas

Bulmoyjo-]

ory

ELL

a U.S. Patent Jan. 27, 2015 Sheet 8 of 29 US 8,940,711 B2

SRO)

oiuebsues}

Rtas

Huyeubls O™

g0z-ulw

RRs

uUNeuloyey

upmaulojes Beatle

esuodsey

ler

lame

ui cecil

tele U.S. Patent Jan. 27, 2015 Sheet 9 of 29 US 8,940,711 B2

$S91]S

- 0}

OHIN-J asuodsay

—

:By-u9

Lop

OJ -09 OS r- oe oz

‘08

OF Ul

2 § & @ 2

= 6

DHIN-G

OHIA- Mojs

Lillo

Om <———

SHIN-

- “OId |

9HIN-9 el

= }Se}

[AVL

— -08 09 ~ 02

Oct OOL Le

uoisseidxy aagejoy

el)

mites

Loe R U.S. Patent Jan. 27, 2015 Sheet 10 of 29 US 8,940,711 B2

PUCIRSISMSR

uoIsseldx3

TITAne

goz-yiu

“Sid

QHINd

CM!

A}-pyE

eonpul

(el

cry

(eh

eBay

Ve)

«= U.S. Patent Jan. 27, 2015 Sheet 11 of 29 US 8,940,711 B2

O»

Ceo

—

SHINY

eudje

LAA

uONeAIOR

sve

Beye

- - - 909

Nid

006

noe

OOSL 002 oosl

S}USAOId

eset

wisipiosAujodAy

> x

& © —”D

= >

puke

OL fanoenuon

P}Eq

“OTs

Roe

UOISS61de1

BIGUIODILS &

Le =

Rolie).

= Aumpenuog

SOASI|O1

BolT

Q1Ld

agc

Lee U.S. Patent Jan. 27, 2015 Sheet 12 of 29 US 8,940,711 B2

9Yyw-0

—_

RCo hak

tt Bele

"Oia

cCe

erie) U.S. Patent Jan. 27, 2015 Sheet 13 of 29 US 8,940,711 B2

PST rcaca

rene

Betis

80¢-HIUW

SSOUSAISUGUSOY

ReLa| os

———______j

ese Bom

Cert

a sous

“Sia

—iteeier..

SSO1]S eLye

Se }2}Of8AS

_— ojasny

nat

ee BUTT

pur

‘ re

°2°5S

Buyyeubis Ae

syeubis jeqswidojsasq

stiy

ane LET U.S. Patent Jan. 27, 2015 Sheet 14 of 29 US 8,940,711 B2

= ES 2 © o © 2

miR-214 miR-195 © miR-21 rr] a]

fo) A) ° rr ed is 43 o. rn FIG, s) oO view’= ro) re) ~

mereyh Syl

peyejnbal-umoqg US

ulneulgjed o1uebsuelL

syiw PIER

G-VWPt

peye(nBa-dpq

papueg

OM-YIINL-Tl “DIA 919eI0U show |

omg at

ulineulajeo

adAy Ned

av. avi PIM

ULINSUID;ed ry

Aq Aq Aq

(TR,

pajejnbey payejnBoy pejeinbey Vv

pue U.S. Patent Jan. 27, 2015 Sheet 16 of 29 US 8,940,711 B2

‘GbSb

PLZ

RUL-TIV Teak

SYNYo1siw

OSL

PEs)

B66)

poyejnBoiumog

(oda

S6b

Neale

VAT ua

SYNYOIIWW

Seh

962

M-LURMCOM-YLiV OPE

Yiu

LM. "SIA

pejejnBoidyr)

Miu

gqe¢c

SCM

UPS

“WUD

Pee

eee

LAK’

= U.S. Patent Jan. 27, 2015 Sheet 17 of 29 US 8,940,711 B2

AudosedAy

uolssaidxa

yep

oeipses

odA-prim

6Z-yIW

+Z0

-9°0 vo

r :

Bulinp

| |

poyejnboiumop

“Sia

yuy

‘SAM

6Z-yIwW U.S. Patent Jan. 27, 2015 Sheet 18 of 29 US 8,940,711 B2

uonejnBeiumop 0991 p

jO4 8t OO NE OE OE AT OAL OSE AL ON

adA}-plIM

Pccp-arw

G2cp-arw

BQET-aTwW

gLe-atu

COT-atu LOT-atw TSE-H

TOe-a 069-aTu

66h-atul SOg-aTu

SYNYIwW

“SA

00et

OY 0

palejnbsluMog

80Z-M!W 91

00S ‘Sls

SYNUY!W

dg-rLend

dg-sog-y

BOE GEE

POs

Oga- =

$ sot-wTw POT POI

Stlg-wd Ssl—aTw

cred Ge TOs agtew

sora EScaw LLe-uyu Sset-e

SES SLE

G9 539-WTw ASEM

SOS ose-u

Stet

Sad

payejnbaiumog Bp-33T

ape

Ted AL

fen35T

Ue-2eT

BL-3BT ag—a

Ld erat

Ta bw

-w

dg el

er UPR

wT ut

Tu Tut aS

Fur

tu pw Fur Tu

Fu Tat

TM but ear

Tur Tu Fa

Fut

Tw Tu eae

Te Fa yu

Fu ru

| jf

LAA

U.S. Patent Jan. 27, 2015 Sheet 19 of 29 US 8,940,711 B2

uoneinBeidn cL

plo

odA}-plIM

de de-pie- de—-e QLOl-w Tsle-arw

eT ¥

eS CT

BOTs

BST SPT

Seog~u Ppos—apu Sgqt—wtu Gté-ytu atea~w Ag Zec-utTw Tog—wtur GoL— O8o-utTu eet-wtTwa Ger-w

ty BL-3T Qp~w

6t— Q Ee-wru ofr

Fn EM THT pT

~2t

HU ru wa Fur

Fur

Tut Fu Fe

Fu Ew em tut ra

“SA

SYNulW

paleinbeidn

80Z-M!W

SYNUYIW

Old

ae o ag-kLe~ m

-KOS x aoe SEER

pazeinbaidy 2 4 hid

Eso ogee age BS POw~ OsSscu Bee— MPO Do wader| Doe Of cluboww rtStd Maron

GL,-9 ea- YL-3ST

2 C.-387 gga OMe Donn toh OO 0 ro ue Gi Osia ig O FEA OE rte

Zou S-

Boe

[at Teh

Tet Lu Er

Fu ~4 ; ea redid da Ctfret nm ‘ rit

UT a -ST — i TELLid ! d

Mt a ate

Wye dtu

dru nt PG ey,Me a oy feI

Fu EM Fu

Pa Tu pur tart Tae re Pu 57 TU Fa yu Tu ru te Tw tf oe“ft * ‘ rf EEEE E 4 E E

“LAA

U.S. Patent Jan. 27, 2015 Sheet 20 of 29 US 8,940,711 B2

FIG. 17 (cont.)

WT het KO miR-208

miR-29

U.S. Patent Jan. 27, 2015 Sheet 21 of 29 US 8,940,711 B2

(61

(8b

(ON

‘ON

DAS)

OAS)

NNONOVONVVVONNANVIOVOOVN

NNONSVONVVVONNNVOSVOOVN

—NNSOONVVVONOAVIDVOSVN

—NODONVVVONNNVIDVOSVN

Ti}

(eee

clea

Mele

St “Sig

emVi

6Z-yiul

Bude

eudye

Bude

amr

‘Aj

‘|x

‘a]

‘]]

‘A

Ajiwue}

‘|

Soueb

addy

ody adAy

adAj

ad}

edAy edAj

AbeTLEe

‘uabeljoo ‘uebeljoo

‘usbeljoo

‘uebeljoo

‘uebeyjoo

‘usbeljoo

‘uabejjoo

jobiey

uysele

Uiiqu U.S. Patent Jan. 27, 2015 Sheet 22 of 29 US 8,940,711 B2

PNT

EBLUL

suobe]joo

suoBeyjoo

laces

OM odA}-PIIM

80c-ulw

——

ved

———

“DT

Ce]!

Maly]

HIW

-temro

alee

meri

Ape

| U.S. Patent Jan. 27, 2015 Sheet 23 of 29 US 8,940,711 B2

FIG. 20A-B

A 3/ -UUGUGACUAAAGAAAGUUUACCACGAU~5' miR-29 (SEQ ID NO: 22) COL3A1 UGGUGCUA 8&mer

FBN1 UGGUGCUA 8mer uUGGUGCUU 7mer-1A UGGUGCUA 8mer

ELN1 UGGUGCUA 8mer uGGuGCcUC 7mer-1A AGGUGCUA 7mer-m8

COL1A2 AGGUGCUA 7mer-ms

COL1A1 UGGUGCUA Smer AGGUGCUA 7mer-més

BecoA1 col A2 col3A1

70 60 50 40 30 20 10 0 a Ee WT border remote WT border remote WT border remote zone zone zone

FBN1 ELN1 10 8 7 8 6 6 5 4 4 3 2 2 i 1 0 0

WT border remote WT border remote zone zone

U.S. Patent Jan. 27, 2015 Sheet 24 of 29 US 8,940,711 B2

FIG. 20C-D

miR-29b-1cee miR-29aFAG) col1A1 12 col1A2 col3A1 amma 6miR ———~a“ iimiR — miR | miR-29 206 miR-29 206 miR-29 206 FBN1 ELN1 _———a—aail@l |6—6miR ——aama—a@l 6COmiR miR-29 206 miR-29 206

U.S. Patent Jan. 27, 2015 Sheet 25 of 29 US 8,940,711 B2

1.2

1.04

0.8;

0.6;

0.4; 0.2-

TGFB: - + - + - + miR-29a miR-29b miR-29c

B WT het KO miR-208

<< ee ee miR-29

7 BNP . expression

4 3 2 1 0 WT het KO

FIG. 21A-B U.S. Patent Jan. 27, 2015 Sheet 26 of 29 US 8,940,711 B2

zyLuebeljoo = PPE ©o nm + » [O19qSSTOUD-SYSNSDSOSNOONYYYONANWONITOSESY TO293SSTOUD-—-SUSNSYUSDSNDONVIVONONWONOWYS 3 © NHN 3 3

3 o

Lg Y LOL -8 0 ol J YS e*Ua655 oo ao Ss eS cr] @2e °c *Q6¢c-HHU -Q6c-HIWHUe J “ RSE YoTewsiw 8 s d6z-uiuUe G62-uhw Ques Hovews) Yoyewisiw O-Vee V qi Ols 8 U.S. Patent Jan. 27, 2015 Sheet 27 of 29 US 8,940,711 B2

FIG. 22D-E

D Heart Kidney Liver Lung

miR-29b

mis anti mis anti mis anti mis anti match miR thatch miR match miR match mik

2.5 mm miR-29b 2.07 LI Mi antimiR-29b 1.5°

mn Col1A1 Col1A2 Col3A1 U.S. Patent Jan. 27, 2015 Sheet 28 of 29 US 8,940,711 B2

FIG. 22F-G

F A50 miR-29b 1.2 miR-29a 20 miR-29c

Cc 400- 18; 2 350+ 1.05 “_ 16; % 300; 0.8- iS. ~ 250+ 7 200- 0.6- a4 © 150; 0.4- 6: 2 100; 0.24 4: i, 5O . 21 . om dug Sug OnN- tug” 5ug On tug Sug 29b mimic 29b mimic 29b mimic

me G 1.2 COL3AT COL1A2 COL1A1

1.O+ ~ - - - > oer UC OC TC oO Oo CT

- tug 5ug - ‘ug 5ug jug 5ug 29b mimic 29b mimic 29b mimic U.S. Patent Jan. 27, 2015 Sheet 29 of 29 US 8,940,711 B2

FIG, 23 miR-29a

18 1.6} Tjmm i antimiA-29b | 1.4]

heart 1.2] to expression 0.8 0.6 | 0.4 | compared Relative 0.2 |

heart jung liver kidney spleen sk muscle intestine miR-29b

1.6 — {]mm 1.4 Mi antimif-29b 1.24 heart

to 0.8 | expression 0.6 | 0.4 | compared Relative 0.2 |

heart lung liver kidney spleen sk muscle intestine miR-29c

1.6 Limm 1.4,

1.2;

heart to

0.8 | expression 0.6 |

0.4 compared Relative 0.2

| heart hung liver kidney spleen sk muscle intestine US 8,940,711 B2 1 2 MICRO-RNA FAMILY THAT MODULATES inducesstiffness, diastolic dysfunction, and cardiomyocyte FIBROSIS AND USES THEREOF hypertrophy due to the increase in stress and can also lead to arrythmias. CROSS-REFERENCE TO RELATED Cardiac hypertrophyis an adaptive responseofthe heart to APPLICATIONS virtually all forms of cardiac disease, including those arising from hypertension, mechanical load, myocardial infarction, This application 1s a divisional ofU.S. application Ser. No. cardiac arrhythmias, endocrine disorders, and genetic muta- 12/671,445, filed Jan. 29, 2010, which is a national stage tions in cardiac contractile protein genes. While the hypertrophic responseis initially a compensatory mechanism that application of International Application No. PCT/US2008/ 10 augments cardiac output, sustained hypertrophy can lead to 071839, filed Jul. 31, 2008, which claims the benefit of U.S. dilated cardiomyopathy (DCM), heart failure, and sudden Provisional Application No. 60/952,917,filed Jul. 31, 2007; death. In the United States, approximately half a million US. Provisional Application No. 60/980,303, filed Oct. 16, individuals are diagnosed with heart failure each year, with a 2007, and U.S. Provisional Application No. 61/047,014,filed mortality rate approaching 50%. The causes andeffects of Apr. 22, 2008, all of which are herein incorporated byrefer- 15 cardiac hypertrophy have been extensively documented, but encein their entireties. the underlying molecular mechanisms have not been eluci- dated. Understanding these mechanismsis a major concern in STATEMENT OF GOVERNMENT SUPPORT the prevention and treatment of cardiac disease and will be crucialas a therapeutic modality in designing new drugsthat This invention was made with grant support undergrantno. 20 specifically target cardiac hypertrophy andcardiac heart fail- HL53351-06 from the NationalInstitutes of Health. The gov- ure. ernmenthas certain rights in the invention. Treatment with pharmacological agents representsthepri- mary mechanism for reducing or eliminating the manifesta- DESCRIPTION OF THE TEXT FILE SUBMITTED tions of heart failure. Diuretics constitute the first line of ELECTRONICALLY 25 treatment for mild-to-moderate heart failure. If diuretics are ineffective, vasodilatory agents, such as angiotensin convert- The contents of the text file submitted electronically here- ing enzyme (ACE) inhibitors(e.g., enalopril and lisinopril) or with are incorporated herein by reference in their entirety: A inotropic agent therapy (i.e., a drug that improves cardiac computer readable format copy ofthe Sequence Listing(file- output by increasing the force ofmyocardial muscle contrac- name: MIRG_005_04US_SeqList_ST25, date recorded: 30 tion) may be used. Unfortunately, many of these standard Mar. 15, 2013 file size 5 kilobytes). therapies have numerous adverse effects and are contraindi- cated in some patients. Thus, the currently used pharmaco- FIELD OF THE INVENTION logical agents have severe shortcomingsin particular patient populations. The availability ofnew,safe and effective agents The present invention relates generally to the fields of 35 would undoubtedly benefit patients who either cannot use the developmental biology and molecular biology. More particu- pharmacological modalities presently available, or who do larly, it concerns gene regulation and cellular physiology in not receive adequate relief from those modalities. fibroblasts by the miR-29 family. This miRNA family plays Cardiac myocytes are normally surroundedbya fine net- an important role in collagen deposition, particularly col- work of collagen fibers. In response to pathological stress, 40 cardiac fibroblasts and extracellular matrix proteins accumu- lagen deposition mediated by fibroblasts. late disproportionately and excessively. Myocardialfibrosis, a characteristic of all forms of pathological hypertrophy, BACKGROUND OF THE INVENTION leads to mechanicalstiffness, which contributes to contractile dysfunction (Abraham et al., 2002). Another hallmark of Heart disease and its manifestations, including coronary 45 pathological hypertrophy andheart failure is the re-activation artery disease, myocardial infarction, congestive heart failure of a set of fetal cardiac genes, including those encodingatrial and cardiac hypertrophy, clearly presents a major health risk natriuretic peptide (ANP), B-type natriuretic peptide (BNP) in the United States today. The cost to diagnose, treat and and fetal isoforms of contractile proteins, such as skeletal support patients suffering from these diseases is well into the a-actin and B-myosin heavy chain (MHC). These genes are billions of dollars. Two particularly severe manifestations of 50 typically repressed post-natally and replaced by the expres- heart disease are myocardial infarction and cardiac hypertro- sion of a set of adult cardiac genes (McKinsey and Olson, phy. With respect to myocardial infarction, typically an acute 2005). The consequencesof fetal gene expression on cardiac thrombocytic coronary occlusion occurs in a coronary artery function and remodeling (e.g., fibrosis) are not completely as a result of atherosclerosis and causes myocardial cell understood. However, the up-regulation of B-MHC, a slow death. Because cardiomyocytes, the heart muscle cells, are 55 ATPase, and down-regulation of a-MHC,a fast contracting terminally differentiated and generally incapableof cell divi- ATPase, in response to stress has been implicated in the sion, they are generally replaced by scar tissue when they die diminution of cardiac function (Bartel, 2004) and BNP is during the course of an acute myocardial infarction. Scar known to play a dominantrole in cardiacfibrosis. tissue is not contractile, fails to contribute to cardiac function, In addition to cardiac fibrosis, there are a numberofdisor- and often plays a detrimentalrole in heart function by expand- 60 ders or conditions that are associated with fibrosis of various ing during cardiac contraction, or by increasing the size and tissues. Congenital hepatic fibrosis, an autosomal recessive effective radius of the ventricle, for example, becoming disease, is a rare genetic disease that affects both the liver and hypertrophic. Althoughinitial collagen depositionis required kidneys. The disease is characterized by liver abnormalities, for infarct healing and to prevent cardiac rupture, the continu- such as hepatomegaly, portal hypertension, and fiber-like ous production of collagen by fibroblasts induces interstitial 65 connective tissue that spreads over and through the liver (he- fibrosis surrounding the myocytes in the infarct borderzone patic fibrosis). Pulmonary fibrosis, or scarring of the lung, and remote myocardium ofthe infracted heart. This fibrosis results from the gradual replacement of normallungair sacs US 8,940,711 B2 3 4 with fibrotic tissue. When the scar forms, the tissue becomes tion of the target sequence, forms the basis for many current thicker, causing an irreversible loss of the tissue’s ability to target prediction models. Although increasingly sophisti- transfer oxygen into the bloodstream. The mostcurrent think- cated computational approachesto predict miRNAsandtheir ing is that the fibrotic process in pulmonary tissue is a reaction targets are becoming available, target prediction remains a (predisposed by genetics) to microscopic injury to the lung. major challenge and requires experimental validation. While the exact cause remains unknown, associations have Ascribing the functions of miRNAsto the regulation of spe- been made with inhaled environmental and occupationalpol- cific mRNAtargets is further complicated by the ability of lutants, cigarette smoking, diseases such as scleroderma, individual miRNAsto base pair with hundreds of potential rheumatoid arthritis, lupus and sarcoidosis, certain medica- high and low affinity mRNA targets and by the targeting of tions and therapeutic radiation. 10 multiple miRNAs to individual mRNAs. Enhanced under- Scleroderma is a chronic disease characterized by exces- standing ofthe functions ofmiRNAswill undoubtedly reveal sive deposits of collagen in the skin or other organs. The regulatory networks that contribute to normal development, localized type of the disease, while disabling, tends not to be differentiation, inter- and intra-cellular communication,cell fatal. The systemic type or systemic sclerosis, which is the cycle, angiogenesis, apoptosis, and manyother cellular pro- generalized type of the disease, can be fatal as a result ofheart, cesses. Recently, the inventors reported a cardiac-specific kidney, lung or intestinal damage. Scleroderma affects the microRNA, miR-208, which is encoded by an intron of the skin, and in moreserious cases it can affect the blood vessels a-myosin heavy chain (MHC) gene, andis required for up- and internal organs. regulation of B-MHCexpression in responseto cardiac stress Skeletal muscle fibrosis is a phenomenon which frequently and for repression of fast skeletal muscle genes in the heart occurs in diseased or damaged muscle. It is characterized by (see co-pending application WO2008/016924, which is the excessive growth of fibrous tissue which usually results herein incorporated by reference in its entirety). The present from the body’s attempt to recover from injury. Fibrosis invention expands on the involvement of microRNAsin the impairs muscle function and causes weakness. The extent of heart as well as othertissues. loss ofmuscle function generally increases with the extent of fibrosis. Victims ofmuscular dystrophies, particularly Becker SUMMARY OF THE INVENTION muscular dystrophy (BMD)and the more severely penetrat- ing allelic manifestation, Duchenne muscular dystrophy The present invention is based on the discovery that the (DMD), frequently suffer from increasing skeletal muscle miR-29 family, which is down-regulated in the heart in fibrosis as the disease progresses. Other afflictions such as response to stress, regulates collagen deposition and the denervation atrophy are known to produce skeletal muscle developmentoffibroses, including cardiac fibrosis. Up-regu- fibrosis, as well as neuromuscular diseases, such as acute lation of miR-29a-c expression or function results in the polyneuritis, poliomyelitis, Werdig/Hoffman disease, amyo- decrease of expression ofcollagen andfibrin genes leading to trophiclateral sclerosis (Lou Gehrig’s Disease), and progres- reduced cardiac fibrosis. Accordingly, the present invention sive bulbar atrophy disease. provides a methodoftreating cardiacfibrosis, cardiac hyper- MicroRNAshave recently been implicated in a numberof 35 trophy, or heart failure in a subject in need thereofcomprising biological processes including regulation of developmental identifying a subject having cardiac fibrosis, cardiac hyper- timing, apoptosis, fat metabolism, and hematopoietic cell trophyor heart failure; and administering to said subject an differentiation among others. MicroRNAs (miRs) are small, agonist ofmiR-29a-c expression or function. In one embodi- non-protein coding RNAsof about18 to about 25 nucleotides ment, the agonist of miR-29a-c is a polynucleotide compris- in length thatare derived from individual miRNA genes, from 40 ing the mature sequence of miR-29a, miR-29b, miR-29c, or introns of protein coding genes, or from poly-cistronic tran- combinations thereof. The agonist of miR-29a-c may be scripts that often encode multiple, closely related miRNAs. administered by parenteral administration (e.g. intravenous See review of Carringtonet al. (2003). MiRsact as repressors or subcutaneous), oral, transdermal, sustained release, con- of target mRNAsby promoting their degradation, when their trolled release, delayed release, suppository, catheter or sub- sequences are perfectly complementary, or by inhibiting 45 lingual administration. In another embodiment, the method translation, when their sequences contain mismatches. further comprises administering to the subject a second miRNAsare transcribed by RNA polymeraseII (pol II) or therapy. The second therapy is selected from the group con- RNA polymeraseIII (pol IIT; see Qi et al. (2006) Cellular & sisting of a beta blocker, an ionotrope, a diuretic, ACE-I, AII Molecular Immunology Vol. 3:411-419) andarise from initial antagonist, BNP, a Ca**-blocker, an endothelin receptor transcripts, termed primary miRNA transcripts (pri-miR- 50 antagonist, and an HDAC inhibitor. NAs), that are generally several thousand bases long. Pri- The present invention also provides a methodofpreventing miRNAsare processed in the nucleus by the RNase Drosha pathologic hypertrophy or heart failure in a subject in need into about 70- to about 100-nucleotide hairpin-shaped pre- thereof comprising identifying a subjectat risk ofdeveloping cursors (pre-miRNAs). Following transport to the cytoplasm, pathologic cardiac hypertrophyorheart failure; and promot- the hairpin pre-miRNAis further processed by Dicer to pro- ing the expression or activity ofmiR-29a-cin cardiac cells of duce a double-stranded miRNA. The mature miRNAstrand is said subject. In one embodiment, the promoting expression or then incorporated into the RNA-induced silencing complex activity of miR-29a-c comprises delivering to the cardiac (RISC), where it associates with its target mRNAs by base- cells an agonist of miR-29a-c or an expression vector encod- pair complementarity. In the relatively rare cases in which a ing miR-29a-c. In another embodiment, the subject at risk miRNA base pairs perfectly with an mRNAtarget, it pro- exhibits one or more risk factors selected from the group motes mRNA degradation. More commonly, miRNAs form consisting of long standing uncontrolled hypertension, imperfect heteroduplexes with target mRNAs, affecting uncorrected valvular disease, chronic angina, recent myocar- either mRNAstability or inhibiting mRNAtranslation. dial infarction, congenital predisposition to heart disease, and The 5' portion of a miRNAspanning bases 2-8, termed the pathological hypertrophy. In another embodiment, the sub- ‘seed’ region, is especially important for target recognition ject at risk has been diagnosed as having a genetic predispo- (Krenz and Robbins, 2004; Kiriazis and Krania, 2000). The sition to cardiac hypertrophy.In still another embodiment,the sequence of the seed, together with phylogenetic conserva- subject at risk has a familial history of cardiac hypertrophy. US 8,940,711 B2 5 6 The present invention also encompassesa transgenic, non- tissue to a second treatment, such as a chemical peel, laser human mammal, the cells ofwhichfail to express a functional treatment, dermaplaning, or dermabrasion. In another miR-29a, miR29b, and/or miR29c. In another embodiment, embodiment, the tissue is in a subject that suffers from the invention provides a transgenic, non-human mammal, the Ehler’s-Danlos syndrome or Vitamin C deficiency. cells ofwhich comprise a miR-29a-c coding region under the control of a heterologous promoter active in the cells of said BRIEF DESCRIPTION OF THE DRAWINGS non-human mammal. The transgenic mammal may be a mouse. The invention maybe better understood by reference to one In one embodiment, the present invention provides a or more of these drawings in combination with the detailed methodoftreating myocardial infarction in a subject in need description of specific embodiments presented herein. thereof comprising promoting expressionor activity ofmiR- FIGS. 1A-B. miR-208 is encoded by the a-MHC gene and 29a-c in cardiac cells of said subject. In another embodiment, is expressed specifically in the heart. (FIG. 1A) miR-208 is the present invention provides a methodofpreventing cardiac encoded within an intron of the a-MHCgene.Asterisks indi- hypertrophy anddilated cardiomyopathy in a subject in need cate sequence conservation (SEQ ID NOS:1-5). (FIG. 1B) thereof comprising promoting expressionor activity ofmiR- Detection of miR-208 transcripts by Northern analysis of 29a-c in cardiac cells of said subject. In another embodiment, adult mousetissues. U6 mRNAservesas a loading control. the present invention provides a method of inhibiting progres- FIGS. 2A-B. Regulation of a- and B-MHC. (FIG. 2A) sion of cardiac hypertrophyin a subject in need thereof com- Regulation of class switch by thyroid hormone and TRE. prising promoting expression or activity of miR-29a-c in (FIG. 2B) Modelfor stress/hypothyroidism in fast-to-slow cardiac cells of said subject. 20 muscle fiber contactility switch. The present invention also contemplates a methodoftreat- FIG. 3. Detection of miR-208 in humanheart. Transcripts ing or preventing a tissue fibrosis in a subject comprising for a-MHC and miR-208 were detected by Northern blot of identifying a subject having orat risk of tissue fibrosis; and cardiac tissue from six normalindividuals andsix individuals increasing the expression and/or activity of miR-29a-c in with idiopathic cardiomyopathy. A close correlation exists skeletal muscle or fibroblast cells of the subject. The tissue betweenthe level ofexpression of a-MHCand pre-miR-208, fibrosis may be cardiacfibrosis, scleroderma, skeletal muscle whereas mature miR-208 expression is maintained after the fibrosis, hepatic fibrosis, kidney fibrosis, pulmonary fibrosis, latter has been down-regulated. or diabetic fibrosis. In some embodiments, increasing the FIGS. 4A-B. Generation of miR-208 mutant mice. (FIG. expression and/or activity of miR-29a-c comprises adminis- 4A) Strategy to generate miR-208 mutant mice by homolo- tering an agonist of miR-29a-c to the subject. An agonist of gous recombination. The pre-miRNA sequence (located miR-29a-c may be a polynucleotide comprising the sequence within intron 29 of the mouse a-MHC gene in most tran- of a mature miR-29a, miR-29b, and/or miR-29c sequence. scripts) was replaced with a neomycin resistance cassette The agonist of miR-29a-c mayalso be an expression vector flanked by loxP sites. The neomycin cassette was removedin encoding miR-29a, miR-29b, and/or miR-29c. In one the mouse germline by breeding heterozygous miceto trans- embodiment, the method further comprises administering a genic mice harboring the CAG-Cre transgene. (FIG. 4B) non-miR-29a-c anti-fibrotic therapy to the subject. Detection of miR-208 transcripts by Northern analysis of Thepresent invention also provides a methodfor identify- hearts from wild-type and miR-208 mutant mice. ing a modulator of miR-29a-c comprising contacting a cell FIG. 5. Western analysis of a-MHC and B-MHCprotein with a candidate compound; assessing miR-29a-c activity or levels in hearts of neonatal mice of the indicated genotypes. expression; and comparingthe activity or expression in step 40 Two mice of each genotype were analyzed. GAPDH was (b) with the activity or expression of miR-29a-c in the detected as a loading control. absence of the candidate compound, wherein a difference FIG. 6. MiR-208~’~ mice show reduced cardiac hypertro- between the measuredactivities or expression of miR-29a-c phyin responseto pressure overload. Histological sections of indicates that the candidate compoundis a modulator ofmiR- hearts of wild-type and miR-208-”- mice stained for Masson 29. The cell may be contacted with the candidate compound 45 trichrome. The absence of miR-208 diminishes hypertrophy in vitro or in vivo. Suitable candidate compounds include and fibrosis seen in wild-type mice subjected to thoracic proteins, peptides, polypeptides, polynucleotides, oligo- aortic banding (TAB) for 21 days. Scale bar equals 2 mm in nucleotides or small molecules. top panel and 20 um for bottom panel. The present invention also encompasses a pharmaceutical FIG. 7. MiR-208~~ mice show reduced cardiac hypertro- composition comprising an agonist or antagonist ofmiR-29a- phy in response to calcineurin activation. Histological sec- c. In some embodiments, the pharmaceutical composition tions of hearts of 6 week-old mice expressing a calcineurin may be formulated for injection or topical administration. transgene (CnA-Tg) and hearts of miR-208--; CnA-Tg The formulation for topical administration may be a gel, stained for Masson trichrome. Absence of miR-208 dimin- cream, lotion, or ointment. ishes hypertrophy and fibrosis seen in CnA-Tg mice. Scale The present invention provides a methodof inducing col- bar=2 mm for top panel, 20 um for bottom panel. lagen deposition in a tissue comprising contacting said tissue FIG. 8. Mir-208-’- mice fail to up-regulate B-MHC in with an antagonist of miR-29a-c. The antagonist may be an response to TAB and calcineurin activation. antagonist ofmiR-29a, miR-29b, or miR-29c. The antagonist FIG. 9. Western analysis of a and B-MHCprotein levels in may be an antagomir of miR-29a-c, an antisense oligonucle- adult wild-type and miR-208 transgenic animals. GAPDH otide that targets a mature miR-29a-c sequence, or an inhibi- wasdetected as a loading control. tory RNA molecule, such as a siRNA or shRNA, that com- FIG. 10. miR-208-" mice fail to up-regulate B-MHC in prises a sequenceidentical to a mature miR-29a-c sequence, response to hypothyroidism with PTU treatment. or a ribozyme or another inhibitory nucleic acid. In one FIG. 11. Schematic diagram of the role of miR-208 in the embodiment, the method further comprises contacting said control of B-MHCexpression. tissue with a second agent. The second agent maybe topical FIG. 12. Schematic diagram of the role of miR-208 in the vitamin A, topical vitamin C, or vitamin E. In another regulation of B-MHCand fast skeletal muscle gene expres- embodiment, the method further comprises subjecting said sion via Thrap1. US 8,940,711 B2 7 8 FIG. 13. Mechanismsofaction of microRNAsduring car- FIGS. 22A-G. miR-29a-c inhibition induces fibrosis in diac hypertrophy. vivo. (FIG. 22A) Chemical structure of anti-miR-29a-c and FIGS. 14A-C. miRNAexpression during cardiac hypertro- mismatch (mm) miR-29a-c. (FIG. 22B) Northern blot analy- phy and remodeling. (FIG. 14A) H&E stained sections of sis showing tissue specific knockdown after 3 days in representative hearts from mice following sham and TAB for 5 response to intravenous injection of 80 mg/kg of either anti- 21 days and from CnA Tg mice. Scale bar equals 2 mm.(FIG. miR-29a-c or mm miR-29a-c or a comparable volume of 14B) Venn diagrams showing numbers of microRNAsthat saline. (FIG. 22C) Real-time PCR analysis of liver extracts changed in expression in each type of heart are shown below. indicate a pronounced increase in collagen expression in (FIG. 14C) Northern blots of microRNAs that change in response to miR-29a-c knockdown, while this effect was expression during hypertrophy. U6 RNA wasdetected as a 10 absent after saline or mm injection. (FIG. 22D) Tissue col- loading control. lection, three weeks after intravenousinjection with 80 mg/kg FIG. 15. miR-29a-c expression is down-regulated in on two consecutive days of either anti-miR-29a-c or mm responseto cardiac stress. Hearts from wild-type mice (WT) and mice with hypertrophy and fibrosis induced by a cal- miR-29a-c oligonucleotide or a comparable volumeofsaline, indicates a severe knockdown ofmiR-29a-cin heart, liver and cineurin transgene (CnA) or TAB are shown ontheleft. The 15 relative level ofexpression ofmiR-29a-c in each type of heart kidney, while miR-29a-c levels in lungs appear unaffected. is shown ontheright. (FIG. 22E) Real-time PCR analysis of heart extracts indicate FIG. 16. Microarray analysis of hearts from miR-208 a increase in cardiac collagen expression in response to miR- knockout mice compared to wild-type. Microarray analysis 29a-c knockdown. (FIG. 22F) Real-time PCR analysis indi- was performed on mRNAisolated from wild-type and miR- 20 cating an increase in miR-29b expression in fibroblasts two 208-null hearts at 6 weeks of age. The most down-regulated days after miR-29b mimic treatment, while miR-29a levels miRNA,next to miR-208, is miR-499. were unchanged and miR-29clevels only slightly increased. FIG. 17. miR-29 family is dramatically up-regulated in (FIG. 22G) miR-29b overexpression in fibroblasts represses miR-208-null hearts. the expression of collagen genes as determined by real-time FIG. 18. miR-29 family targets mRNAs encoding col- 25 PCRanalysis. lagens and other components of the extracellular matrix FIG. 23. Expression ofmiR-29 family membersin various involvedin fibrosis. Based on their high sequence homology, tissues in response to miR-29b knockdown. Knockdown of the miR 29 family consists of 4 members; miR-29a, all miR-29 members in the different tissues indicates that miR29b-1 and -2 and miR-29c. The sequences of the mature miR-29b shows a 50% reduction in the heart in response to miRNAs are shown (SEQ ID NOS:18-20). The mature 30 anti-miR-29b, while miR-29a and -c only show marginal sequences of miR-29b-1 and miR-29b-2 are identical. changes. However, the knockdown of miR-29b in liver and Togetherthis family is directed against many components of kidney in responseto anti-miR-29b is almost complete, while the extracellular matrix involvedin fibrosis. miR-29a and-c also appear to be reduced in these tissues in FIG. 19. Model for the control of cardiac fibrosis by miR- response to anti-miR-29b. 208 and miR-29 family. In the normalheart, miR-208 inhibits 35 the expression of miR-29a-c. In the absence of miR-208, DETAILED DESCRIPTION OF ILLUSTRATIVE miR-29a-c expression is up-regulated, preventing the expres- EMBODIMENTS sion of extracellular matrix andfibrosis in responseto stress. The functions of miR-208, miR-499 and miR-29 are inter- Cardiac and skeletal muscles respondto a variety ofpatho- linked. Loss of miR-208 can be cardioprotective by prevent- 40 physiological stimuli such as workload, thyroid hormonesig- ing expression of miR-499 and up-regulating expression of naling and injury by modulating the expression of myosin miR-29a-c, with consequent blockade tofibrosis. isoforms, which regulate the efficiency of contraction. FIGS. 20A-D. miR-29a-c regulates the expressionofextra- Recently, the inventors reported a_ cardiac-specific cellular matrix proteins. (FIG. 20A) Potential binding sites microRNA, miR-208, which is encoded by an intron of the for miR-29a-c in 3' UTRregionsof key fibrotic genes. (FIG. 45 a-myosin heavy chain (MHC) gene, andis required for up- 20B) Real-time PCR analysis of predicted target genes in regulation of B-MHCexpression in responseto cardiac stress both the borderzone and remote myocardium 3 days after MI, and for repression of fast skeletal muscle genes in the heart showsa decrease in miR-29a-c to correlate to an increase in (see co-pending application WO2008/016924, which is collagens (COLIA1, COL1A2 and COL3A1) andfibrillin herein incorporated by referencein its entirety). (FBN1), while there was no significant change in elastin 50 Here, the inventors extend their earlier work and show that (ELN1). (FIG. 20C) Northern blot analysis on COScells miR-208 also down-regulates a family of related miRNAs, transfected with increasing amounts of the CMV expression miR-29a-c. Because miR-29a-c are expressed ubiquitously, plasmid encoding the miR-29b-1/miR-29a cluster, shows and are involved in regulation of collagen deposition, strate- efficient overexpression of miR-29a-b. The top band corre- gies to upregulate miR-29a-c expression have applications in sponds to the pre-miRNA,while the lower band corresponds 55 the prevention of a variety oftissue fibroses including cardiac to the mature miRNA. (FIG. 20D) Luciferase experiments fibrosis, as well as skeletal muscle,liver, pulmonary, diabetic using the endogenous UTR sequencesofthe predicted target and kidneyfibrosis. Regulation ofmiR-29a-c in cardiaccells, genes, showing miR-29a-cto repress expression of luciferase such as cardiac fibroblasts, can be used to treat or prevent in response to increasing amounts of miR-29a-c while this cardiac hypertrophy or heart failure in a subject. Thus, one decrease was absent when using an unrelated miR, miR-206. 60 aspectofthe invention is agonism ofmiR-29a-c expression or FIGS. 21A-B. miR-29a-c expression responsive to TGFB. activity, optionally in conjunction with inhibiting miR-208. (FIG. 21A) Real-time PCR analysis indicates that all three Agonism may involve introducing exogenous miR-29a-c into miR-29 family members are downregulated in fibroblasts in the heart or other tissues of interest, either directly using response to TGFB. (FIG. 21B) Northern analysis showing naked nucleic acid or a delivery vehicle such as a lipid/ miR-29a-c expression is upregulated in miR-208 mutant ani- 65 liposome/nanoparticle, or through gene expression, for mals which coincides with an increase in BNP expression as example by using adenoviral vectors or other means of determined by real-time PCR. ectopic expression to reduce fibrosis. Activation of the anti- US 8,940,711 B2 9 10 fibrotic function of miR-29a-c through pharmaceutical fibrillin 1 (FBN1), collagen type I, a1 and a2 (COLIAI, “small molecules” also is contemplated, as are screens to COL1A2) collagen type III, a1 (COL3A1), metallopepti- identify such compounds. dases, and integrins. In response to pathologicalstress, car- The increase in collagen that ensues following repression diac fibroblasts and extracellular matrix proteins accumulate ofmiR-29a-c expression, for example, following myocardial disproportionately and excessively. Myocardial fibrosis, a infarction (MI) and other forms of stress, may indicate characteristic of all forms of pathological hypertrophy, leads another role for miR-29a-c. One focus of the inventors’ work to mechanical stiffness, which contributes to contractile dys- is cardiac fibrosis, and an examination of a subset of key function (Berk et al., 2007). Since the miR-29 family is down- regulatory genes, namely collagen I, ITI, elastin andfibrillin, regulated during this remodeling process, this family is likely showeda striking increase in both collagens andfibrillin in to play an active role in the modulation of collagen deposi- response to miR-29a-c downregulation, while there was no tion, and thereby regulate cardiac fibrosis and cardiac con- increase in elastin. As such, therapeutically repressing miR- tractility, which secondarily can induce hypertrophy and 29a-c to increase collagen deposition presents a unique pathological remodeling. option for addressing conditions characterized by loss of As discussed previously, miR-208 appears to regulate collagen, such as in cosmetic applications and scarring. MicroRNA 29 (miR-29) is a family of microRNAsthat miR-29 expression as miR-29 is significantly up-regulated in consists of 4 known members, miR-29a, b1 and 2 (identical) the hearts of mice lacking both copies of miR-208 (see and c. While miR29b-1 and 29a stem from the sametranscript Example 1). Thus, modulation of miR-208 can affect the originating from chromosome 7 in humans and chromosome expression of miR-29 as well as the expression of miR-29 6 in mice, the miRNA cluster containing miR29b-2 and target genes. MiR-208 is an intronic miRNAthat is located miR29¢cis transcribed from chromosome 1 in both species. within an intron of the a-MHC gene. Theprecise intron The mature miRNA sequencesfor each of the human miR-29 family membersislisted below: location is dependent on the particular species and specific transcript. For example, in humans, miR-208 is encoded 25 within the 28” intron of the a-MHCgene,while in mice,it is (SEQ ID No: 18) hsa-miR-29a uagcaccaucugaaaucgguua encoded within the 29” intron. The pre-miRNA encoding sequences for miR-208 for human, mouse,rat, and canine are (SEQ ID NO: 19) hsa-miR-29b-1 and b-2 uagcaccauuugaaaucaguguu provided in SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, 30 SEQ ID NO:17, respectively. The mature miR-208 sequence (SEQ ID No: 20) hsa-miR-29c uagcaccauuugaaaucgguua is provided in SEQ ID NO:5. Like a-MHC, miR-208 is expressed solely in the heart. (FIG. 1).

Human pre-miR-208 (SEQ ID NO: 14) acgggcegage ttttggcecg ggttatacct gatgctcacg tataagacga gcaaaaagct tgttggtcag a

Mouse pre-miR-208 (SEQ ID NO: 15) acgggtgage ttttggcecg ggttatacct gactctcacg tataagacga gcaaaaagct tgttggtcag a

Rat pre-miR-208

(SEQ ID NO: 16) acgggtgage ttttggcecg ggttatacct gactctcacg tataagacga gcaaaaagct tgttggtcag a

Canine pre-miR-208

(SEQ ID NO: 17) acgcatgage ttttggctcg ggttatacct gatgctcacg tataagacga gcaaaaaget tgttggtcag a

These microRNAsform a family based on their sequence Using the PicTar algorithm for the identification ofmiRNA homology (Yuet al; 2006). Since there are only minordiffer- targets (Krek et al., 2005), the inventors identified thyroid ences between the family members, and the members have a 60 100% conserved seed region (which helps to define target hormonereceptor associated protein 1 (THRAP1) as a pre- determination), they are very likely to target the same mRNA dicted target for miR-208. THRAP1 3' UTR sequences from targets (FIG. 18), and lower gene expressionofthese specific human, chimp, mouse, rat, canine, chicken, fugu, and target genes. Target determination for the miR-29 family zebrafish are provided in SEQ ID NO:6, SEQ ID NO:7, SEQ revealed that the miR-29 family showsa high preference for 65 targeting genes involved in collagen formation as well as ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, other extracellular matrix proteins, such as elastin (ELN), SEQ ID NO:12, and SEQ ID NO:13, respectively. US 8,940,711 B2 11

Human THRAP1 3'UTR (SEQ ID NO: 6) uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aaaguugcag uaggguuge

Chimp THRAP1 3'UTR (SEQ ID NO: 7) uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aacguugcag uaggguuge

Mouse THRAP1 3'UTR (SEQ ID NO: 8) uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aacguugcag uaggguuge

Rat THRAP1 3'UTR (SEQ ID NO: 9) uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aacguugcag uaggguuge

Canine THRAP1 3'UTR (SEQ ID NO: 10) uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aacguugcag uaggguuge

Chicken THRAP1 3'UTR (SEQ ID NO: 11) uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aacguugcag uaggguuge

Fugu THRAP1 3'UTR (SEQ ID NO: 12) uuccugcuuu aagcaauugg uugaaaauau auguauguaa uggucuuaau uaaaaaaaca aacuaagaca aa

Zebrafish THRAP1 3'UTR (SEQ ID NO: 13) uuccugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuucauuac aaaaacgaac caucaaacg

The present invention provides a method oftreating car- purposes of this application, the terms “expression con- diac fibrosis, cardiac hypertrophy orheart failure in a subject struct,” “expression vector,’ and “vector,” are used inter- in need thereof comprising identifying a subject having car- changeably to demonstrate the application ofthe invention in diac fibrosis, cardiac hypertrophyor heart failure; and admin- a general, illustrative sense, and are not intended to limit the istering to the subject an agonist of miR-29 expression or invention. function. The miR-29 agonist may be an agonist ofmiR-29a, In one embodiment, an expression vector for expressing miR-29b and/or miR-29c. 35 miR-29a-c comprises a promoter “operably linked”to a poly- In one embodiment, agonists of miR-29a-c may be polynucleotide encoding miR-29a, miR-29b, miR-29c, or combi- nucleotides comprising the mature miR-29a-c sequence. In nations thereof. In another embodiment, the polynucleotide some embodiments, the polynucleotide comprises the may encode the miR-29b-1/miR-29a cluster. In another sequence of SEQ ID NO: 18, SEQ ID NO:19, or SEQID NO: embodiment, the polynucleotide may encode the miR-29b-2/ 20. In another embodiment, the agonist ofmiR-29a-c may be 40 miR-29c cluster. The phrase “operably linked” or “under a polynucleotide comprising the pri-miRNA or pre-miRNA transcriptional control” as used herein meansthat the pro- sequence for miR-29a, miR-29b, and/or miR-29c. The poly- moteris in the correct location andorientation in relation to a nucleotide comprising the mature miR-29a-c, pre-miR-29a- polynucleotide to control the initiation of transcription by c, or pri-miR-29a-c sequence may be single stranded or RNA polymerase and expression of the polynucleotide. The double stranded. The polynucleotides may contain one or 45 polynucleotide encoding miR-29a-c may encode the pri- more chemical modifications, such as locked nucleic acids, mary-microRNA-29a-c sequence (pri-miR-29a-c), the pre- peptide nucleic acids, sugar modifications, such as 2'-O-alkyl cursor-microRNA-29a-c sequence (pre-miR-229a-c) or the (e.g. 2'-O-methyl, 2'-O-methoxyethyl), 2'-fluoro, and 4'thio mature miR-29a-c sequence. In another embodiment, the modifications, and backbone modifications, such as one or expression vector comprises a polynucleotide operably more phosphorothioate, morpholino, or phosphonocarboxy- 50 linked to a promoter, wherein said polynucleotide comprises late linkages. In one embodiment, the polynucleotide com- the sequence of SEQ ID NO:18. In another embodiment, the prising a miR-29a-c sequenceis conjugated to cholesterol. In expression vector comprises a polynucleotide operably another embodiment, the agonist of miR-29a-c may be an linked to a promoter, wherein said polynucleotide comprises agent distinct from miR-29a-c that acts to increase, supple- the sequence of SEQ ID NO:19. In still another embodiment, ment, or replace the function of miR-29a-c. 55 the expression vector comprises a polynucleotide operably In another embodiment, the agonist of miR-29a-c may be linked to a promoter, wherein said polynucleotide comprises expressed in vivo from a vector. A “vector” is a composition the sequence of SEQ ID NO:20. The polynucleotide com- of matter which can be used to deliver a nucleic acid of prising the sequence of SEQ ID NO: 18, SEQ ID NO:19, or interest to the interior ofa cell. Numerous vectors are known SEQ ID NO:20 maybe about 18 to about 2000 nucleotides in in the art including,but notlimitedto,linear polynucleotides, length, about 70 to about 200 nucleotides in length, about 20 polynucleotides associated with ionic or amphiphilic com- to about 50 nucleotides in length, or about 18 to about 25 pounds, plasmids, and viruses. Thus, the term “vector” nucleotides in length. includes an autonomously replicating plasmid or a virus. Throughout this application, the term “expression con- Examples of viral vectors include, but are not limited to, struct” is meant to include any type of genetic construct adenoviral vectors, adeno-associated virus vectors, retroviral containing a nucleic acid coding for a gene product in which vectors, and the like. An expression construct can be repli- part or all of the nucleic acid encoding sequenceis capable of cated in a living cell, or it can be made synthetically. For being transcribed. Generally, the nucleic acid encoding a US 8,940,711 B2 13 14 gene productis undertranscriptional control of a promoter. A ers which are well-knownin the art to achieve expression of “promoter” refers to a DNA sequence recognized by the a polynucleotide of interest is contemplated as well, provided synthetic machinery of the cell, or introduced synthetic that the levels ofexpression aresufficient for a given purpose. machinery, required to initiate the specific transcription of a By employing a promoter with well-known properties, the gene. level and pattern of expression of the polynucleotideof interest following transfection or transformation can be opti- The term promoter will be used here to refer to a group of mized. Further, selection of a promoter that is regulated in transcriptional control modules that are clustered around the responseto specific physiologic signals can permit inducible initiation site for a RNA polymerase. Muchofthe thinking expression of the gene product. Tables 1 and 2 list several about how promoters are organized derives from analyses of regulatory elements that may be employed,in the context of several viral promoters, including those for the HSV thymi- 1° the present invention,to regulate the expressionofthe gene of dine kinase (tk) and SV40early transcription units. These interest. This list is not intended to be exhaustive of all the studies, augmented by more recent work, have shown that possible elements involved in the promotion of gene expres- promoters are composedofdiscrete functional modules, each sion but, merely, to be exemplary thereof. consisting of approximately 7-20 bp of DNA,and containing - Enhancers are genetic elements that increase transcription one or more recognition sites for transcriptional activator or from a promoter located at a distant position on the same repressorproteins. molecule of DNA. Enhancers are organized muchlike pro- At least one module in each promoterfunctionsto position moters. That is, they are composed of many individualele- the start site for RNA synthesis. The best known example of ments, each of which binds to one or more transcriptional this is the TATA box,but in some promoters lacking a TATA 30 proteins. box, suchas the promoter for the mammalian terminal deoxy- The basic distinction between enhancers and promotersis nucleotidyl transferase gene and the promoter for the SV40 operational. An enhancer region as a whole must be able to late genes, a discrete element overlying the start site itself stimulate transcription at a distance; this need notbe true ofa helps to fix the place of initiation. promoter region or its component elements. On the other Additional promoter elements regulate the frequency of 35 hand, a promoter must have one or more elements that direct transcriptional initiation. Typically, these are located in the initiation of RNA synthesis at a particular site and in a par- region 30-110 bp upstream of thestart site, although a number ticular orientation, whereas enhancerslack these specificities. of promoters have recently been shownto contain functional Promoters and enhancers are often overlapping and contigu- elements downstream of the start site as well. The spacing ous, often seeming to have a very similar modular organiza- between promoteres elements frequently is flexible,: so that 30 tion. ... promoterfunction is preserved when elements are inverted or Below is a list of viral promoters, cellular promoters/en- movedrelative to one another. In the tk promoter, the spacing hancers and inducible promoters/enhancers that could be between promoter elements can be increased to 50 bp apart used in combination with the nucleic acid encoding a gene of before activity begins to decline. Depending on the promoter, interest in an expression construct (Table 1 and Table 2). it appears that individual elements can function either co- 35 Additionally, any promoter/enhancer combination (as per the operatively or independently to activate transcription. Eukaryotic Promoter Data Base EPDB) could also be used to In other embodiments, the human cytomegalovirus (CMV) drive expression of the gene. Eukaryotic cells can support immediate early gene promoter, the SV40 early promoter, the cytoplasmictranscription from certain bacterial promoters if Rous sarcoma virus long terminal repeat, rat insulin pro- the appropriate bacterial polymerase is provided, either as moter, RNA pol III promoter, and glyceraldehyde-3-phos- 40 part of the delivery complex or as an additional genetic phate dehydrogenase promoter can be used to obtain high- expression construct. In a preferred embodiment, the poly- level expression of the polynucleotide of interest. The use of nucleotide encoding the miR-29a-c or miR-29a-c antagonist other viral or mammalian cellular or bacterial phage promot- is operably-linked to a fibroblast specific promoter. TABLE 1

Promoter and/or Enhancer

Promoter/Enhancer References

Immunoglobulin Heavy Chain Banerji et al., 1983; Gilles et al., 1983; Grossched| et al., 1985; Atchinsonet al., 1986, 1987; Imler et al., 1987; Weinbergeret al., 1984; Kiledjian etal., 1988; Porton et al.; 1990 Immunoglobulin Light Chain Queenet al., 1983; Picard et al., 1984 T-Cell Receptor Luriaet al., 1987; Winoto et al., 1989; Redondo et al.; 1990 HLA DQ aand/or DQ 6 Sullivan et al., 1987 §-Interferon Goodbournet al., 1986; Fujita et al., 1987; Goodbourn etal., 1988 Interleukin-2 Greeneet al., 1989 Interleukin-2 Receptor Greeneet al., 1989; Lin et al., 1990 MHCClass II 5 Kochet al., 1989 MHCClass II HLA-DRa Sherman etal., 1989 f-Actin Kawamotoet al., 1988; Ng etal.; 1989 Muscle Creatine Kinase (MCK) Jaynes et al., 1988; Horlick et al., 1989; Johnson et al., 1989 Prealbumin (Transthyretin) Costaet al., 1988 Elastase I Ornitz et al., 1987 Metallothionein (MTII) Karin et al., 1987; Culottaet al., 1989 Collagenase Pinkert et al., 1987; Angel et al., 1987a Albumin Pinkert et al., 1987; Troncheet al., 1989, 1990 US 8,940,711 B2 15 16 TABLE1-continued

Promoter and/or Enhancer

Promotetr/Enhancer References

a-Fetoprotein Godbout etal., 1988; Campereet al., 1989 t-Globin Bodineet al., 1987; Perez-Stableet al., 1990 6-Globin Trudel etal., 1987 c-fos Cohenet al., 1987 c-HA-ras Triesman, 1986; Deschampset al., 1985 Insulin Edlundet al., 1985 Neural Cell Adhesion Molecule Hirshet al., 1990 (NCAM) a,-Antitrypain Latimeret al., 1990 H2B (TH2B) Histone Hwanget al., 1990 Mouseand/or Type I Collagen Ripe et al., 1989 Glucose-Regulated Proteins Changet al., 1989 (GRP94 and GRP78) Rat Growth Hormone Larsenet al., 1986 Human Serum Amyloid A (SAA) Edbrookeetal., 1989 Troponin I (TN I) Yutzey et al., 1989 Platelet-Derived Growth Factor Pechet al., 1989 (PDGF) Duchenne Muscular Dystrophy Klamutet al., 1990 Sv40 Banerji et al., 1981; Moreauet al., 1981; Sleigh et al., 1985; Firak et al., 1986; Herr et al., 1986; Imbraet al., 1986; Kadeschet al., 1986; Wang et al., 1986; Ondeket al., 1987; Kuhletal., 1987; Schaffner et al., 1988 Polyoma Swartzendruberet al., 1975; Vasseuret al., 1980; Katinkaet al., 1980, 1981; Tyndell et al., 1981; Dandolo et al., 1983; de Villiers et al., 1984; Hen et al., 1986; Satake et al., 1988; Campbell and/or Villarreal, 1988 Retroviruses Kriegler et al., 1982, 1983; Levinson et al., 1982; Kriegler et al., 1983, 1984a, b, 1988; Boszeet al., 1986; Miksicek et al., 1986; Celanderet al., 1987; Thiesen et al., 1988; Celanderet al., 1988; Choi et al., 1988; Reisman et al., 1989 Papilloma Virus Campoet al., 1983; Lusky et al., 1983; Spandidos and/or Wilkie, 1983; Spalholz et al., 1985; Lusky et al., 1986; Cripe et al., 1987; Gloss et al., 1987; Hirochika et al., 1987; Stephenset al., 1987 Hepatitis B Virus Bulla et al., 1986; Jameelet al., 1986; Shauletal., 1987; Spandauet al., 1988; Vannice et al., 1988 Human Immunodeficiency Virus Muesinget al., 1987; Hauberet al., 1988; Jakobovits et al., 1988; Feng et al., 1988; Takebe et al., 1988; Rosen etal., 1988; Berkhoutet al., 1989; Laspia et al., 1989; Sharp etal., 1989; Braddocketal., 1989 Cytomegalovirus (CMV) Weberet al., 1984; Boshart et al., 1985; Foecking et al., 1986 Gibbon Ape Leukemia Virus Holbrooketal., 1987; Quinn et al., 1989

TABLE 2 TABLE 2-continued

Inducible Element: Inducible Element:

Element Inducer References 50 Element Inducer References

MT II Phorbol Ester (TFA) Palmiteret al., 1982; Murine MX Gene Interferon, Newcastle Hug et al., 1988 Heavy metals Haslinger et al., 1985; Disease Virus Searle et al., 1985; Stuart GRP78 Gene A23187 Resendezet al., 1988 et al., 1985; Imagawaet a-2-Macroglobulin IL-6 Kunzet al., 1989 al., 1987, Karin etal., 55 Vimentin Serum Rittling et al., 1989 1987; Angelet al., 1987b; MHCClass I Interferon Blanar et al., 1989 McNeallet al., 1989 Gene H-2«b MMTV Glucocorticoids Huang et al., 1981; Lee et HSP70 EIA, SV40 Large T Taylor et al., 1989, 1990a, (mouse mammary al., 1981; Majorset al., , Antigen 1990b tumorvitus) 1983; Chandler et al., Proliferin Phorbol Ester-TPA Mordacqet al., 1989 1983; Ponta et al., 1985; 60 rumor Necrosis PMA Henselet al., 1989

Sakai et al., 1988 Thyroid Stimulating Thyroid Hormone Chatterjee et al., 1989 §-Interferon poly(@Dx Tavernieret al., 1983 H ormone a Gene poly(re)

Adenovirus 5 E2 EIA Imperiale et al., 1984 Collagenase Phorbol Ester (TPA) Angelet al., 1987a .. .. . Stromelysin Phorbol Ester (TPA) Angel etal., 1987b 65 WhereacDNAinsert is employed, one will typically desire sv4o0 Phorbol Ester (TPA) Angel etal., 1987b to include a polyadenylation signal to effect proper polyadenylation of the genetranscript. The nature of the polyadeny- US 8,940,711 B2 17 18 lation signal is not believed to be crucial to the successful because Adenovirus type 5 is a human adenovirus about practice of the invention, and any such sequence may be which a great deal of biochemical and genetic informationis employed such as human growth hormone and SV40 poly- known, andit has historically been used for most construc- adenylation signals. Also contemplated as an elementof the tions employing adenovirus as a vector. expression cassette is a terminator. These elements can serve Asstated above, the typical vector accordingto the present to enhance message levels and to minimize read through from invention is replication defective and will not have an aden- the cassette into other sequences. ovirus E1 region. Thus, it will be most convenient to intro- In certain embodimentsofthe invention,the cells contain- duce the polynucleotide encoding the geneofinterest at the ing nucleic acid constructs of the present invention may be position from which the El-coding sequences have been identified in vitro or in vivo by including a marker in the 10 removed. However, the position of insertion of the construct expression construct. Such markers would confer an identi- within the adenovirus sequencesis not critical to the inven- fiable changeto the cell permitting easy identification of cells tion. The polynucleotide encoding the gene of interest may containing the expression construct. Usually the inclusion of also be inserted in lieu of the deleted E3 region in E3 replace- a drug selection marker aids in cloning andin the selection of mentvectors, as described by Karlsson et al. (1986), or in the transformants, for example, genes that confer resistance to 15 E4 region where a helpercell line or helper virus comple- neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and ments the E4 defect. histidinol are useful selectable markers. Alternatively, Adenovirus vectors have been used in eukaryotic gene enzymes such as herpes simplex virus thymidine kinase (tk) expression (Levrero et al., 1991; Gomez-Foix et al., 1992) or chloramphenicol acetyltransferase (CAT) may be and vaccine development (Grunhausand Horwitz, 1992; Gra- employed. Immunologic markers also can be employed. The 20 ham and Prevec, 1991). Recently, animal studies suggested selectable marker employed is not believed to be important, that recombinant adenovirus could be used for gene therapy so long as it is capable of being expressed simultaneously (Stratford-Perricaudet and Perricaudet, 1991; Stratford-Per- with the nucleic acid encoding a gene product. Further ricaudetet al., 1990; Rich et al., 1993). Studies in adminis- examples of selectable markers are well known to one of skill tering recombinant adenovirus to different tissues include in the art. 25 trachea instillation (Rosenfeld et al., 1991; Rosenfeld et al., There are a number of ways in which expression vectors 1992), muscle injection (Ragotet al., 1993), peripheral intra- may introduced into cells. In certain embodiments of the venous injections (Herz and Gerard, 1993) and stereotactic invention, the expression construct comprisesa virus or engi- inoculation into the brain (Le Gal La Salle et al., 1993). neered construct derived from a viral genome. Theability of Retroviral vectors are also suitable for expressing the poly- certain viruses to enter cells via receptor-mediated endocyto- 30 nucleotides of the invention in cells. The retroviruses are a sis, to integrate into host cell genomeandexpressviral genes group of single-stranded RNA viruses characterized by an stably and efficiently have made them attractive candidates ability to convert their RNA to double-stranded DNA in for the transfer offoreign genes into mammaliancells (Ridge- infected cells by a process of reverse-transcription (Coffin, way, 1988; Nicolas and Rubenstein, 1988; Baichwal and 1990). The resulting DNA thenstably integrates into cellular Sugden, 1986; Temin, 1986). 35 chromosomes as a provirus and directs synthesis of viral Oneofthe preferred methods for in vivo delivery involves proteins. The integration results in the retention of the viral the use of an adenovirus expression vector. “Adenovirus gene sequencesin the recipient cell and its descendants. The expression vector” is meant to include those constructs con- retroviral genomecontainsthree genes, gag, pol, and env that taining adenovirus sequencessufficient to (a) support pack- code for capsid proteins, polymerase enzyme, and envelope aging ofthe construct and(b) to express a polynucleotide that 40 components, respectively. A sequence found upstream from has been cloned therein. The expression vector comprises a the gag gene contains a signal for packaging of the genome genetically engineered form of adenovirus. Knowledgeofthe into virions. Two long terminal repeat (LTR) sequences are genetic organization of adenovirus, a 36 kB, linear, double- presentat the 5' and 3' ends ofthe viral genome.These contain stranded DNA virus, allows substitution of large pieces of strong promoter and enhancer sequences and are also adenoviral DNA with foreign sequences up to 7 kB (Grun- 45 required for integration in the host cell genome (Coffin, haus and Horwitz, 1992). In contrast to retrovirus, the aden- 1990). oviral infection of host cells does not result in chromosomal In order to construct a retroviral vector, a nucleic acid integration because adenoviral DNAcan replicate in an epi- encoding a geneofinterestis insertedinto the viral genome in somal manner without potential genotoxicity. Also, adenovi- the place of certain viral sequences to produce a virusthatis ruses are structurally stable, and no genomerearrangement 50 replication-defective. In order to produce virions, a packag- has been detected after extensive amplification. Adenovirus ing cell line containing the gag,pol, and env genes but without can infect virtually all epithelial cells regardless of their cell the LTR and packaging components is constructed (Mann et cycle stage. al., 1983). When a recombinant plasmid containing a cDNA, Adenovirusis particularly suitable for use as a gene trans- together with the retroviral LTR and packaging sequencesis fer vector because of its mid-sized genome, ease of manipu- 55 introduced into this cell line (by calctum phosphate precipi- lation, high titer, wide target cell range and high infectivity. tation for example), the packaging sequence allows the RNA Both ends of the viral genome contain 100-200 base pair transcript of the recombinant plasmid to be packaged into inverted repeats (ITRs), which are cis elements necessary for viral particles, which are then secreted into the culture media viral DNA replication and packaging. (Nicolas and Rubinstein, 1988; Temin, 1986; Mann etal., Other than the requirement that the adenovirus vector be 60 1983). The media containing the recombinantretrovirusesis replication defective, or at least conditionally defective, the then collected, optionally concentrated, and used for gene nature of the adenovirus vector1s not believed to be crucial to transfer. Retroviral vectors are able to infect a broad variety of the successful practice of the invention. The adenovirus may cell types. However, integration and stable expression require be of any of the 42 different known serotypes or subgroups the division of host cells (Paskindet al., 1975). A-F. Adenovirus type 5 of subgroup C is the preferred starting 65 Other viral vectors may be employed as expression con- material in order to obtain the conditional replication-defec- structs in the present invention. Vectors derived from viruses tive adenovirus vector for use in the present invention. This is such as vaccinia virus (Ridgeway, 1988; Baichwal and Sug- US 8,940,711 B2 19 20 den, 1986; Coupar et al., 1988) adeno-associated virus (AAV) trical current, which in turn provides the motive force (Yang (Ridgeway, 1988; Baichwal and Sugden, 1986; Hermonat et al., 1990). The microprojectiles used have consisted of and Muzycska, 1984) and herpesviruses may be employed. biologically inert substances such as tungsten or gold beads. They offer several attractive features for various mammalian Selected organs includingtheliver, skin, and muscle tissue cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and Sug- of rats and mice have been bombarded in vivo (Yanget al., den, 1986; Coupar et al., 1988; Horwichetal., 1990). 1990; Zelenin et al., 1991). This may require surgical expo- In order to affect expression of sense or antisense gene sure of the tissue or cells, to eliminate any intervening tissue constructs, the expression construct must be delivered into a between the gun andthe target organ, i.e., ex vivo treatment. cell. This delivery may be accomplishedin vitro, as in labo- Again, DNA encodinga particular gene may be delivered via ratory proceduresfor transformingcells lines, or in vivo or ex 10 this methodandstill be incorporatedby the present invention. vivo, as in the treatment of certain disease states. One mecha- In a further embodimentof the invention, the expression nism for delivery is via viral infection where the expression construct may be entrapped in a liposome. Liposomesare construct is encapsidated in an infectiousviral particle. Several non-viral methods for the transfer of expression vesicular structures characterized by a phospholipid bilayer membraneandan inner aqueous medium. Multilamellarlipo- constructs into cultured mammalian cells also are contem- 15 plated by the present invention. These include calcium phos- somes have multiple lipid layers separated by aqueous phate precipitation (Graham and Van Der Eb, 1973; Chen and medium. They form spontaneously when phospholipids are Okayama, 1987; Rippe et al., 1990) DEAE-dextran (Gopal, suspended in an excess of aqueoussolution. The lipid com- 1985), electroporation (Tur-Kaspaet al., 1986; Potteret al., ponents undergo self-rearrangement before the formation of 1984), direct microinjection (Harland and Weintraub, 1985), 20 closed structures and entrap water and dissolved solutes DNA-loaded liposomes (Nicolau and Sene, 1982; Fraley et between the lipid bilayers (Ghosh and Bachhawat, 1991). al., 1979) and lipofectamine-DNA complexes,cell sonication Also contemplated are lipofectamine-DNA complexes. (Fechheimer et al., 1987), gene bombardment using high Liposome-mediated nucleic acid delivery and expression velocity microprojectiles (Yang et al., 1990), and receptor- offoreign DNAin vitro has been very successful. Wonget al., mediated transfection (Wu and Wu, 1987; Wu and Wu,1988). 25 (1980) demonstrated the feasibility of liposome-mediated Someofthese techniques may be successfully adapted for in delivery and expression of foreign DNA in cultured chick Vivo or ex Vivo use. embryo, HeLa and hepatoma cells. Nicolau et al., (1987) Once the expression construct has been delivered into the accomplished successful liposome-mediated gene transfer in cell the nucleic acid encoding the gene of interest may be rats after intravenousinjection. positioned and expressedatdifferent sites. In certain embodi- 30 In certain embodimentsofthe invention,the liposome may ments, the nucleic acid encoding the gene may be stably be complexed with a hemagglutinating virus (HVJ). This has integrated into the genomeofthe cell. This integration may be been shownto facilitate fusion with the cell membrane and in the cognate location and orientation via homologous promote cell entry of liposome-encapsulated DNA (Kaneda recombination (gene replacement)or it may be integrated in et al., 1989). In other embodiments, the liposome may be a random, non-specific location (gene augmentation). In yet 35 complexed or employed in conjunction with nuclear non- further embodiments, the nucleic acid may be stably main- histone chromosomalproteins (HMG-1) (Kato et al., 1991). tained in the cell as a separate, episomal segment of DNA. In yet further embodiments, the liposome may be complexed Such nucleic acid segments or “episomes” encode sequences or employed in conjunction with both HVJ and HMG-1. In sufficient to permit maintenanceandreplication independent that such expression constructs have been successfully of or in synchronization with the host cell cycle. How the 40 employedin transfer and expression of nucleic acid in vitro expression constructis delivered to a cell and where in the cell and in vivo, then they are applicable for the present invention. the nucleic acid remains is dependent on the type of expres- Where a bacterial promoter is employed in the DNA con- sion construct employed. struct, it also will be desirable to include within the liposome In yet another embodimentofthe invention, the expression an appropriate bacterial polymerase. construct may simply consist of naked recombinant DNA or 45 Other expression constructs which can be employed to plasmids. Transfer of the construct may be performed by any deliver a nucleic acid encoding a particular geneinto cells are of the methods mentioned above which physically or chemi- receptor-mediated delivery vehicles. These take advantage of cally permeabilize the cell membrane. This is particularly the selective uptake ofmacromolecules by receptor-mediated applicable for transfer in vitro but it may be applied to in vivo endocytosis in almostall eukaryotic cells. Because of thecell use as well. Dubensky et al. (1984) successfully injected 50 type-specific distribution of various receptors, the delivery polyomavirus DNAin the form ofcalcium phosphate precipi- can be highly specific (Wu and Wu, 1993). tates into liver and spleen of adult and newborn mice demon- Receptor-mediated gene targeting vehicles generally con- strating active viral replication and acute infection. Ben- sist of two components: a cell receptor-specific ligand and a venisty and Neshif (1986) also demonstrated that direct DNA-binding agent. Several ligands have been used for intraperitoneal injection of calctum phosphate-precipitated 55 receptor-mediated gene transfer. The most extensively char- plasmids results in expression of the transfected genes. It is acterized ligands are asialoorosomucoid (ASOR) (Wu and envisioned that DNA encoding a geneof interest may also be Wu, 1987) and transferrin (Wagneret al., 1990). Recently, a transferred in a similar manner in vivo and express the gene synthetic neoglycoprotein, which recognizes the same recep- product. tor as ASOR,has been used as a gene delivery vehicle (Ferkol In still another embodimentof the invention for transfer- 60 et al., 1993; Perales et al., 1994) and epidermal growth factor ring anaked DNA expression construct into cells may involve (EGF)hasalso been used to deliver genes to squamous car- particle bombardment. This method depends onthe ability to cinoma cells (Myers, EPO 0273085). accelerate DNA-coated microprojectiles to a high velocity In other embodiments, the delivery vehicle may comprise a allowing them to pierce cell membranesandenter cells with- ligand and a liposome. For example, Nicolau et al. (1987) out killing them (Klein et al., 1987). Several devices for 65 employed lactosyl-ceramide, a galactose-terminal asialgan- accelerating small particles have been developed. One such glioside, incorporated into liposomes and observed an device relies on a high voltage discharge to generate an elec- increase in the uptake of the insulin gene by hepatocytes. US 8,940,711 B2 21 22 Thus, it is feasible that a nucleic acid encoding a particular polynucleotide sequence. In other embodiments, the antago- gene also maybespecifically delivered into a cell type by any mirs are 100% complementary to the mature miRNA number of receptor-ligand systems with or without lipo- sequence. somes. For example, epidermal growth factor (EGF) may be In one embodiment, the antagonist of miR-29a-c is an used as the receptor for mediated delivery of a nucleic acid antagomir. The antagomir may comprise a sequencethatis at into cells that exhibit upregulation ofEGF receptor. Mannose least partially complementary to the mature miRNA can be usedto target the mannosereceptoron liver cells. Also, sequence of miR-29a, miR-29b, or miR-29c. In another antibodies to CD5 (CLL), CD22 dymphoma), CD25 (T-cell embodiment, the antagomir comprises a sequencethat is at leukemia) and MAA (melanoma) can similarly be used as least partially complementary to the sequence ofSEQ ID NO: targeting moieties. 10 18, SEQ ID NO:19, or SEQ ID NO:20.In another embodi- Ina particular example, the oligonucleotide may be admin- ment, the antagomir comprises a sequence that is 100% istered in combination with a cationic lipid. Examples of complementary to SEQ ID NO:18, SEQ ID NO: 19, or SEQ cationic lipids include, but are not limited to, lipofectin, ID NO:20. DOTMA, DOPE, and DOTAP. The publication of Inhibition ofmicroRNA function may also be achieved by WO/0071096, which is specifically incorporated by refer- 15 administering antisense oligonucleotides targeting the ence, describes different formulations, such as a DOTAP: mature miR-29a, miR-29b or miR-29c sequences. Theanti- cholesterol or cholesterol derivative formulation that can sense oligonucleotides maybe ribonucleotides or deoxyribo- effectively be used for gene therapy. Other disclosures also nucleotides. Preferably, the antisense oligonucleotides have discuss different lipid or liposomal formulations including at least one chemical modification. Antisense oligonucle- nanoparticles and methods of administration; these include, 20 otides may be comprised of one or more “locked nucleic butare not limited to, U.S. Patent Publication 20030203865, acids”. “Locked nucleic acids” (LNAs) are modified ribo- 20020150626, 20030032615, and 20040048787, which are nucleotides that contain an extra bridge between the 2' and 4' specifically incorporated by reference to the extent they dis- carbons of the ribose sugar moiety resulting in a “locked” close formulations andother related aspects ofadministration conformation that confers enhanced thermalstability to oli- and delivery of nucleic acids. Methods used for forming 25 gonucleotides containing the LNAs. Alternatively, the anti- particles are also disclosed in U.S. Pat. Nos. 5,844,107, 5,877, sense oligonucleotides may comprise peptide nucleic acids 302, 6,008,336, 6,077,835, 5,972,901, 6,200,801, and 5,972, (PNAs), which contain a peptide-based backbonerather than 900, which are incorporated by reference for those aspects. a sugar-phosphate backbone. Other chemical modifications In certain embodiments, gene transfer may moreeasily be that the antisense oligonucleotides may contain include, but performed under ex vivo conditions. Ex vivo gene therapy 30 are not limited to, sugar modifications, such as 2'-O-alkyl refers to the isolation of cells from an animal, the delivery of (e.g. 2'-O-methyl, 2'-O-methoxyethyl), 2'-fluoro, and 4' thio a nucleic acid into the cells in vitro, and then the return of the modifications, and backbone modifications, such as one or modified cells back into an animal. This may involve the more phosphorothioate, morpholino, or phosphonocarboxy- surgical removalof tissue/organs from an animalorthe pri- late linkages (see, for example, U.S. Pat. Nos. 6,693,187 and mary culture of cells andtissues. 35 7,067,641, which are herein incorporated by reference in their In some embodiments of the invention, it is desirable to entireties). In some embodiments, suitable antisense oligo- inhibit the expression or activity of miR-29a-c to increase nucleotides are 2'-O-methoxyethy] “gapmers” which contain collagen deposition. For example, in one embodiment, the 2'-O-methoxyethyl-modified ribonucleotides on both 5' and invention provides a method of inducing collagen deposition 3' ends with at least ten deoxyribonucleotides in the center. in a tissue comprising contacting said tissue with an antago- 40 These “gapmers” are capable of triggering RNase H-depen- nist of miR-29a-c. The antagonist or inhibitor of miR-29a-c dent degradation mechanisms of RNAtargets. Other modifi- function may be directed at miR-29a, miR-29b and/or at cationsof antisense oligonucleotides to enhancestability and miR-29¢c. improve efficacy, such as those described in U.S. Pat. No. The function of miRNAs may be inhibited by the admin- 6,838,283, which is herein incorporated by reference in its istration of antagomirs. Initially described by Kriitzfeldt and 45 entirety, are knownin the art and are suitable for use in the colleagues (Kriitzfeldt et al., 2005), “antagomirs”are single- methods of the invention. Preferable antisense oligonucle- stranded, chemically-modified ribonucleotides that are at otides useful for inhibiting the activity of microRNAsare least partially complementary to the miRNA sequence. about 19 to about 25 nucleotides in length. Antisense oligo- Antagomirs may comprise one or more modified nucleotides, nucleotides may comprise a sequencethatis at least partially such as 2'-O-methyl-sugar modifications. In some embodi- 50 complementary to a mature miRNA sequence,e.g. at least ments, antagomirs comprise only modified nucleotides. about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% Antagomirs may also comprise one or more phosphorothio- complementary to a mature miRNA sequence. In some ate linkages resulting in a partial or full phosphorothioate embodiments,the antisense oligonucleotide may be substan- backbone. To facilitate in vivo delivery and stability, the tially complementary to a mature miRNA sequence,thatis at antagomir maybelinked to a cholesterol moiety at its 3' end. 55 least about 95%, 96%, 97%, 98%, or 99% complementary to Antagomirs suitable for inhibiting miRNAs may be about 15 a target polynucleotide sequence. In one embodiment, the to about 50 nucleotides in length, more preferably about 18 to antisense oligonucleotide comprises a sequencethat is 100% about 30 nucleotides in length, and most preferably about 20 complementary to a mature miRNA sequence. to about 25 nucleotides in length.“Partially complementary” In another embodimentofthe invention, the antagonist of refers to a sequence that is at least about 75%, 80%, 85%, 60 miR-29a-c is a chemically-modified antisense oligonucle- 90%, 95%, 96%, 97%, 98%, or 99% complementary to a otide. The chemically-modified antisense oligonucleotide target polynucleotide sequence. The antagomirs may be at may comprise a sequencethatis at least partially complemen- least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or tary to the mature miRNA sequence ofmiR-29a, miR-29b, or 99% complementary to a mature miRNA sequence. In some miR-29c. In yet another embodiment, the chemically-modi- embodiments, the antagomir may be substantially comple- 65 fied antisense oligonucleotide comprises a sequence thatis at mentary to a mature miRNA sequence, that is at least about least partially complementary to the sequence ofSEQ ID NO: 95%, 96%, 97%, 98%, or 99% complementary to a target 18, SEQ ID NO:19, or SEQ ID NO:20.In another embodi- US 8,940,711 B2 23 24 ment, the chemically-modified antisense oligonucleotide twotypes of drugsinhibitors ofthe renin-angiotensin system, comprises a sequencethat is 100% complementary to SEQ ID and B-adrenergic blocking agents (Bristow, 1999). Therapeu- NO: 18, SEQ ID NO: 19, or SEQ ID NO:20. tic agents to treat pathologic hypertrophy in the setting of Antisense oligonucleotides may comprise a sequence that heart failure include angiotensin II converting enzyme (ACE) is substantially complementary to a precursor miRNA inhibitors and B-adrenergic receptor blocking agents (Eich- sequence (pre-miRNA) for miR-29a-c. In some embodi- horn and Bristow, 1996). Other pharmaceutical agents that ments, the antisense oligonucleotide comprises a sequence have been disclosed for treatment of cardiac hypertrophy that is substantially complementary to a sequence located include angiotensin II receptor antagonists (U.S. Pat. No. outside the stem-loop region of the pre-miR-29a, pre-miR- 5,604,251) and neuropeptide Y antagonists (WO 98/33791). 29b, or pre-miR-29¢ sequence. 10 Despite currently available pharmaceutical compounds,pre- Anotherapproachfor inhibiting the function ofmiR-29a-c vention and treatmentofcardiac hypertrophy, and subsequent is administering an inhibitory RNA molecule havingat least heart failure, continue to present a therapeutic challenge. partial sequenceidentity to the mature miR-29a, miR-29b and Non-pharmacological treatment is primarily used as an miR-29¢ sequences. The inhibitory RNA molecule may be a adjunct to pharmacological treatment. One means of non- double-stranded, small interfering RNA (siRNA)or a short pharmacological treatment involves reducing the sodium in hairpin RNA molecule (shRNA) comprising a stem-loop the diet. In addition, non-pharmacological treatment also structure. The double-stranded regionsof the inhibitory RNA entails the elimination of certain precipitating drugs, includ- molecule may comprise a sequence that is at least partially ing negative inotropic agents (e.g., certain calcium channel identical, e.g. about 75%, 80%, 85%, 90%, 95%, 96%, 97%, blockers and antiarrhythmic drugs like disopyramide), car- 98%, or 99% identical, to the mature miRNA sequence. In 20 diotoxins (e.g., amphetamines), and plasma volume expand- some embodiments, the double-stranded regions of the ers (e.g., nonsteroidal anti-inflammatory agents and gluco- inhibitory RNA comprise a sequencethat is at least substan- corticoids). tially identical to the mature miRNA sequence. “Substan- The present invention provides a methodoftreating car- tially identical” refers to a sequencethat is about 95%, 96%, diac fibrosis, cardiac hypertrophy orheart failure in a subject 97%, 98%, or 99% identical to a target polynucleotide 25 in need thereof comprising identifying a subject having car- sequence.In other embodiments, the double-stranded regions diac fibrosis, cardiac hypertrophyorheart failure; and admin- ofthe inhibitory RNA molecule may be 100% identical to the istering to the subject an agonist of miR-29 expression or target miRNA sequence. function. Preferably, administration of a miR-29 agonist In one embodiment, an antagonist of miR-29a-c is an results in the improvement of one or more symptoms of inhibitory RNA molecule comprising a double-stranded 30 pathologic cardiac fibrosis, hypertrophyorheart failure in the region, wherein the double-stranded region comprises a subject, or in the delay in the transition from cardiac hyper- sequence having 100% identity to the mature miR-29a (SEQ trophy to heart failure. The one or more improved symptoms ID NO:18), miR-29b (SEQ ID NO:19), or miR-29c (SEQ ID maybe increased exercise capacity, increased cardiac ejec- NO: 20) sequence. In some embodiments, antagonists of tion volume, decreased left ventricular end diastolic pressure, miR-29a-c are inhibitory RNA molecules which comprise a decreased pulmonary capillary wedge pressure, increased double-stranded region, wherein said double-stranded region cardiac output, or cardiac index, lowered pulmonary artery comprises a sequence of atleast about 75%, 80%, 85%, 90%, pressures, decreased left ventricular end systolic and diastolic 95%, 96%, 97%, 98%, or 99% identity to the mature miR- dimensions, decreased cardiac fibrosis, decreased collagen 29a, miR-29b, or miR-29c sequence. deposition in cardiac muscle, decreased left and right ven- In another embodiment, an inhibitory RNA molecule may 40 tricular wall stress, decreased wall tension, increased quality bearibozyme. A ribozymeis a catalytic RNA that hydrolyzes of life, and decreased disease related morbidity or mortality. phosphodiester bonds ofRNA molecules. The ribozyme may In addition, use ofagonists ofmiR-29a-c may prevent cardiac be designedto target one or more of miR-29a, miR-29b, and hypertrophy and its associated symptomsfrom arising either miR-29¢ resulting in their hydrolysis. directly or indirectly. In certain embodiments, expression vectors are employed 45 In another embodiment, there is provided a method of to express an antagonist ofmiR-29a-c (e.g., antagomirs, anti- preventing pathologic hypertrophy or heart failure in a sub- sense oligonucleotides, and inhibitory RNA molecules). In ject in need thereofcomprising identifying a subject at risk of one embodiment, an expression vector for expressing an developing pathologic cardiac hypertrophy or heart failure; antagonist of miR-29a-c comprises a promoter operably and promoting the expression or activity of miR-29a-c in linked to a polynucleotide encoding an antisense oligonucle- cardiac cells of the subject. Cardiac cells include cardiac otide, wherein the sequenceof the expressed antisense oligo- myocytes, fibroblasts, smooth muscle cells, endothelialcells, nucleotide is at least partially complementary to the mature and any other cell type normally foundin cardiac tissue. The miR-29a, miR-29b, or miR-29c sequence. In yet another miR-29a-c agonist may be an agonist of miR-29a, miR-29b embodiment, an expression vector for expressing an inhibitor and/or miR-29c. The subjectat risk may exhibit one or more of miR-29a-c comprises one or more promoters operably of a list of risk factors comprising cardiac fibrosis, low linked to a polynucleotide encoding a shRNA or siRNA, expression of miR-29, long-standing uncontrolled hyperten- wherein the expressed shRNA or siRNA comprises a sion, uncorrected valvular disease, chronic angina, recent sequencethatis identical, partially identical, or substantially myocardial infarction, congenital predisposition to heart dis- identical to the mature miR-29a, miR-29b, or miR-29c ease and/or pathological hypertrophy, and/or may be diag- sequence.“Partially identical” refers to a sequence thatis at nosed as having a genetic predisposition to cardiac hypertro- least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or phy, and/or may have a familial history of cardiac 99% identicalto a target polynucleotide sequence. “Substan- hypertrophy. tially identical”refers to a sequencethatis at least about 95%, In another embodiment, there is provided a method of 96%, 97%, 98%, or 99% identical to a target polynucleotide treating myocardial infarction in a subject in need thereof sequence. 65 comprising promoting expression or activity ofmiR-29a-c in Current medical managementof cardiac hypertrophyin the cardiac cells of the subject. In another embodiment, the setting of a cardiovascular disorder includesthe use ofat least invention provides a method of preventing cardiac hypertro- US 8,940,711 B2 25 26 phy and dilated cardiomyopathy in a subject in need thereof Rooij et al., 2007). Since BNP is known to antagonize the comprising promoting expression or activity ofmiR-29a-c in effects of TGF, the inventors suggest that the increased cardiac cells of the subject. In another embodiment, the levels of BNP in these mice might enhancethe expression of invention provides a methodof inhibiting progression of car- miR-29a-c. Indeed, a dose-dependent increase in miR-29a-c diac hypertrophy in a subject in need thereof comprising expression was observed upon removal of miR-208, which promoting expression or activity of miR-29a-c in cardiac coincided with an increasing expression level of BNP (Ex- cells of the subject. Another embodiment is a method of ample 5). These data indicate that TGFB induces the expres- increasing exercise tolerance in a subject with heart failure or sion of collagen related genes in fibroblasts at least partly cardiac hypertrophy comprising promoting expression or through decreasing the level of miR-29a-c, which can be activity of miR-29a-c in cardiac cells of the subject. Another 10 inhibited by BNP secreted by cardiomyocytes. Thus, the embodiment is a method of reducing hospitalization in a present invention provides a methodof increasing miR-29a-c subject with heart failure or cardiac hypertrophy comprising expression and/or activity in a subject by administering at promoting expression or activity of miR-29a-c in cardiac least one TGFB inhibitor. TGFB inhibitors may includeanti- cells of the subject. In some embodiments, the invention TGFf antibodies, TGFantisense molecules, and small mol- provides methodsfor improving quality oflife and decreasing 15 ecules that inhibit TGF6 activity as described in U.S. Pat. No. morbidity or mortality in a subject with heart failure or car- 6,509,318, which is herein incorporated by reference in its diac hypertrophy comprising promoting expression oractiv- entirety. TGF inhibitors may also be used in conjuction with ity of miR-29a-c in cardiac cells of the subject. miR-29a-c agonists as a combination therapy to treat cardiac Treatment regimens would vary depending ontheclinical fibrosis, cardiac hypertrophy, or heart failure in a subject. situation. However, long-term maintenance would appearto 20 TGF inhibitors may also be co-administered with miR- be appropriate in most circumstances. It also may be desirable 29a-c agonists to treat or prevent tissue fibrosis in a subject. to treat hypertrophy with agonists of miR-29a-c intermit- In addition to playing an important role in controlling tently, such as within a brief window during disease progres- fibrosis in the heart, the ubiquitous expression of the miR-29 sion. family suggests that it also may play a role in other fibrotic In addition, the miR-29 family is involved in the regulation 25 indications, such as those involving the kidney, liver and of cardiac fibrosis. Since this miR family is enriched in fibro- lungs. Fibrosis is also observed secondary to diabetes. Type 1 blasts compared to myocytes,itis likely that myocytes secrete and type 2 diabetic patients are at increasedrisk ofcardiomy- a factor, possibly BNP, which upregulates the miR-29 family opathy. Cardiomyopathyin diabetes is associated with a clus- in fibroblast cells and thus protects against the development ter of features, including decreased diastolic compliance, of cardiac fibrosis. This factor is very high in miR-208 KO 30 interstitial fibrosis, and myocyte hypertrophy. mice, which correlates with the upregulation of miR-29a-c The presentinvention also provides a method oftreating or and repression of fibrosis. miR-29a-c levels are elevated in preventing a tissue fibrosis in a subject. In one embodiment, normalheart disease, whichis likey a protective effectto limit the method comprises identifying a subject havingorat risk collagen deposition. Thus, the particular use of miR-29a-c of tissue fibrosis; and increasing the expression and/oractiv- and agonists thereof in repressing cardiac fibrosis and col- 35 ity of miR-29a-c in skeletal muscle or fibroblast cells of the lagen deposition in cardiac tissues is contemplated. A com- subject. In another embodiment, the tissue fibrosis is cardiac parable mechanism for the activation of the miR-29 family fibrosis, scleroderma (localized or systemic), skeletal muscle maybe applicable in skeletal muscle fibrosis as well. miR- fibrosis, hepatic fibrosis, kidney fibrosis, pulmonary fibrosis, 29a-c regulates the expression of a numberof extracellular or diabetic fibrosis. In some embodiments, increasing the matrix genes, such as fibrillin 1 (FBN1), collagen type I, a1 40 expression and/or activity of miR-29a-c comprises adminis- (COL1A1), collagen type I a2 (COL1A2), and collagen type tering an agonist of miR-29a-c to the subject. In other II, «1 (COL3A1) (see Example 4). Accordingly, the present embodiments, increasing the expression and/or activity of invention also provides methods of regulating one or more miR-29a-c comprises administering to the subject an expres- extracellular matrix genes in a cell. sion vector that encodes miR-29a-c. In another embodiment, In one embodiment, the method comprises contacting the 45 the method further comprises administering to the subject a cell with an agonist of miR-29 a-c. In another embodiment, non-miR-29a-c fibrotic therapy. the method comprises contacting the cell with an antagonist The present invention encompasses methods of treating of miR-29a-c. In still another embodiment, the one or more tissue fibrosis associated with one or more conditions or extracellular matrix genes include fibrillin 1 (FBN1), col- disorders in a subject in needthereof. In one embodiment, the lagen type I, a1 (COL1A1), collagen type I a2 (COL1A2), 50 method comprises administering to the subject an agonist of and collagen type HI, a1 (COL3A1). In some embodiments, miR-29a-c. In another embodiment, the method comprises the one or more extracellular matrix genes are upregulated administering to the subject an expression vector that encodes following contact ofthe cell with an antagonist ofmiR-29a-c. miR-29a-c. The one or more conditions or disorders associ- In other embodiments, the one or more extracellular matrix ated with tissue fibrosis may include, but are not limited to, genes are downregulated following contact of the cell with an 55 congenital hepatic fibrosis (CHF); renal tubulointerstitial agonist of miR-29a-c. fibrosis; pulmonary fibrosis associated with an autoimmune The inventors have demonstrated that miR-29a-c expres- disorder (e.g. rheumatoid arthritis, lupus and sarcoidosis); sion was decreased in cardiac fibroblasts exposed to TGF6, interstitial fibrosis associated with diabetic cardiomyopathy; suggesting that the decrease in miR-29a-c following myocar- skeletal musclefibrosis associated with muscular dystrophies dial infarction might be TGFB-regulated (Example 5). Inter- 60 (e.g. Becker muscular dystrophy and Duchenne muscular estingly, natriuretic peptides like B-type natriuretic peptide dystrophy), denervation atrophies, and neuromuscular dis- (BNP) have been shown to inhibit TGFB-regulated gene eases (e.g. acute polyneuritis, poliomyelitis, Werdig/Hoff- expression related to fibrosis and myofibroblast conversion man disease, amyotrophic lateral sclerosis, and progressive (Kapoun et al., 2004). In this regard, the inventors reported bulbar atrophy disease). previously that mice lacking the cardiac-specific miRNA 65 The present invention also contemplates methodsoftreat- miR-208 were resistant to cardiac fibrosis and remodeling ing pathologies/deficiencies that are characterized by the and exhibited increased expression of BNP at baseline (van loss, lack, or underproduction of collagen. Using an antago- US 8,940,711 B2 27 28 nist ofmiR-29a-c,the expression ofcollagen can be increased tissue, or topical application. The topical application may be to replace missing collagen or supplementexisting collagen an ointment, cream, gel, salve, or balm. In another embodi- wherethere is a need. Thus, the present invention provides a ment, the method further comprises use of a pressure bandage methodof inducing collagen deposition in a tissue compris- or dressing. The antagonist of miR-29a-c may be contacted ing contacting said tissue with an antagonist of miR-29a-c. with said tissue more than once. In some embodiments, the The antagonist may be directed at miR-29a, miR-29b and/or antagonist is contacted with said tissue 2, 3, 4, 5, 6, 7, 8, 9, 10, at miR-29c. In one embodiment, the antagonist comprises a 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or 100 times. In sequence that is complementary to SEQ ID NO: 18. In other embodiments, the antagonist is contacted with said another embodiment, the antagonist comprises a sequence tissue over 2, 3, 4, 5, or 6 days, 1, 2,3, or 4 weeks, 1, 2, 3, 4, that is complementary to SEQ ID NO:19. In another embodi- 10 5, 6, 7, 8, 9, or 11 months,or 1, 2, 3, 3, 4, 5, 6, 7, 8, 9, 10, 15, ment, the antagonist comprises a sequence that is comple- 20, or 25 years. mentary to SEQ ID NO:20. The antagonist may be an antago- In still another embodiment, the method further comprises mir of miR-29a-c, an antisense oligonucleotide that targets a contacting said tissue with a second agent. The second agent mature miR-29a-c sequence,or an inhibitory RNA molecule, may include, but is not limited to, topical vitamin A, topical such as a siRNA or a shRNA,that comprises a sequence 15 vitamin C, or vitamin E. In another embodiment, the method identical to a mature miR-29a-c sequence, a ribozymeor any further comprises subjecting said tissue to a second treatment. other inhibitory nucleic acid. The antagonist may be linked or The second treatment may comprise a chemical peel, laser conjugated to agents that facilitate the entry of the antagonist treatment, dermaplaning, or dermabrasion. In another into cells or tissues. Various conditions and disorders in which embodiment, the tissue is in a subject that suffers from an increase in collagen deposition would be beneficial and 20 Ehler’s-Danlos syndrome or Vitamin C deficiency. can be treated by administering an antagonist of miR-29a-c The present invention also contemplates the use of miR- include, but are not limited to, Ehlers-Danlos syndrome 29a-c antagonistsas profibrotic agents to convert soft plaques (EDS); Vitamin C deficiency (a.k.a scurvy); aging of the skin in the vasculature into fibrotic tissue to prevent myocardial (e.g. natural aging and photoaging due to sun damage); and infarction. Soft plaques are a build-up of lipids containing stretch marks(striae). 25 predominantly cholesterolthat lie underneath the endothelial Ehlers-Danlos syndrome (EDS)is a group ofrare genetic lining of the arterial wall. Recently, it was recognized that disorders affecting humans and domestic animals caused by a these soft plaquesare proneto rupture resulting in the forma- defect in collagen synthesis. Depending on the individual tion of a blood clot, which can potentially block blood flow mutation, the severity of the disease can vary from mild to through the artery and cause a heart attack (i.e. myocardial life-threatening. Mutations in the ADAMTS2, COL1A1, 30 infarction). Itis these soft plaquesthat are often responsible in COL1A2, COL3A1, COLSA1, COL5A2, PLOD1 and causing a healthy subject with no symptomsto suffer a seem- TNXB genes cause EDS. Mutations in these genes usually ingly unexpected heart attack. After a soft plaque ruptures, the alter the structure, production, or processing of collagen or vessel wall heals and the soft plaque becomesa hard plaque, proteins that interact with collagen. A defect in collagen can whichrarely cause further problems. Thus, strategies for con- weaken connective tissue in the skin, bones, blood vessels, 35 verting soft plaquesinto fibrotic tissue would preventthe soft and organs, resulting in the features of the disorder. Thus, plaques from rupturing and possibly inducing a myocardial collagen deposition induced by miR-29a-c antagonists of the infarction. invention would actto replenish the level of normal collagen Asdescribedin detail above, inhibition ofmiR-29a-c leads in EDSpatients and alleviate symptomsof the disease. Simi- to an increase in collagen deposition and the formation of larly, administration of an antagonist of miR-29a-c would 40 fibrotic tissue. Accordingly, the present invention provides a benefit subjects suffering from vitamin C deficiency or methodfor increasing fibrotic tissue formation in the wall of scurvy. Vitamin C deficiency is a disease that results from a vessel comprising delivering an antagonist ofmiR-29a-c to insufficient intake ofvitamin C, which is required for normal one or more soft plaque sites in the vessel wall, wherein the collagen synthesis in humans. soft plaque is convertedto fibrotic tissue following delivery of Collagen deposition in tissues resulting from the adminis- 45 the antagonist ofmiR-29a-c. Soft plaques can be identified by tration of an antagonist ofmiR-29a-c would also be useful in methods knowninthe art, including, but not limited to, intra- various cosmetic applications. Effects of aging of the skin vascular ultrasound and computed tomography (Saharaetal. produced by natural aging processes or photodamageresult- (2004) European Heart Journal, Vol. 25: 2026-2033; Budhoff ing from over-exposure to the sun could be reduced by admin- (2006) J. Am. Coll. Cardiol., Vol. 48: 319-321; Hausleiter et istering to a subject in need thereof a miR-29a-c antagonist. 50 al. (2006) J. Am. Coll. Cardiol., Vol. 48: 312-318). Any ofthe Administration of miR-29a-c antagonists may also facilitate miR-29a-c antagonists describedherein are suitable for use in the disappearanceof stretch marks. Stretch marks are a form the method. of scarring on theskinthat are causedbytearing ofthe dermis. The miR-29a-c antagonist may delivered to the one or Stretch marksare the result of the rapid stretching of the skin more soft plaque sites by direct injection or by using a cath- associated with rapid growth (commonin puberty) or weight 55 eter or a device that isolates the coronary circulation. In one gain (e.g., pregnancy). embodiment, the miR-29a-c antagonist is deliveredto the one Thetissue to which the inventive methods may be applied or more soft plaque sites by a medical device used in vascular includefacial tissue, such a foreheadtissue, a lip, a cheek, a surgery, such as a stent or balloon. The miR-29 antagonist chin, an eyebrow,an eyelid, underthe eye, or near the mouth, may be coated on a metalstent to form a drug-eluting stent. A handtissue, neck tissue, arm tissue, leg tissue, stomach tissue 60 drug-eluting stent is a scaffold that holds open narrowed or or breast tissue. In some embodiments, the tissue may com- diseased arteries and releases a compoundto prevent cellular prise a wound,a skin graft, scar tissue, wrinkles, lax skin, sun proliferation and/or inflammation. miR-29a-c antagonists damage, chemical damage, heat damage, cold damage, and/ may be applied to a metal stent imbeddedin a thin polymerfor or stretch marks. release ofthe miR-29a-c over time. Methodsofcoating stents Tn another embodimentof the invention, the contacting of with therapeutic compoundsare knownin theart. See, e.g., the tissue with the miR-29a-c antagonist comprises injection USS. Pat. No. 7,144,422; U.S. Pat. No. 7,055,237; and WO into said tissue, injection into vasculature that feeds said 2004/004602, which are here incorporated by reference in US 8,940,711 B2 29 30 their entireties. In some embodiments, the miR-29a-c may be miR-29a-c is “A” and the other agent is “B,” the following used in combination with other anti-restenosis compoundsto permutations based on 3 and 4 total administrations are exem- produce a formulation for incorporation into drug-eluting plary: stents and balloons. Suitable compoundsfor use in combination with the antagonists of miR-29a-c include, but are not limited to, paclitaxel, rapamycin (sirolimus), tacrolimus, A/B/A B/A/B B/B/A A/A/B- B/A/A_ A/B/B_ B/B/B/A_ B/B/A/B A/A/B/B_ A/B/A/B_ A/B/B/A_ B/B/A/A_ B/A/B/A_ B/A/A/B_ B/B/B/A zotarolimus, everolimus, docetaxel, pimecrolimus, and A/A/A/B B/A/A/A A/B/A/A A/A/B/A A/B/B/B_ B/A/B/B_ B/B/A/B derivatives thereof. Thepresent invention also contemplates methodsfor scav- Other combinationsare likewise contemplated. enging or clearing a miR-29a-c agonist following treatment. Pharmacological therapeutic agents and methods of In one embodiment, the method comprises overexpression of administration, dosages, etc., are well knowntothoseof skill bindingsite regions for miR-29a-c in fibroblasts using a fibro- in the art (see for example, the “Physicians Desk Reference”, blast specific promoter. The binding site regions preferably Klaassen’s “The Pharmacological Basis of Therapeutics”, contain a sequence ofthe seed region for miR-29a-c. In some “Remington’s Pharmaceutical Sciences”, and “The Merck embodiments, the binding site may contain a sequence from Index, Eleventh Edition”, incorporated herein by reference in the 3'UTR of one or more targets of miR-29a-c, such as relevant parts), and may be combined with the invention in COL1AI1, COL1A2, COL1A3 and/or FBN1. In another light of the disclosures herein. Some variation in dosage will embodiment, a miR-29a-c antagonist may be administered necessarily occur depending on the condition of the subject after a miR-29a-c agonistto attenuate or stop the function of being treated. The person responsible for administration will, the microRNA.In another embodiment,the present invention in any event, determine the appropriate dose for the individual provides a method for scavenging or clearing miR-29a-c subject, and such individual determinations are within the antagonists following treatment. The method may comprise skill of those of ordinary skill in the art. overexpressing bindingsites for the miR-20a-c antagonists in Non-limiting examples of a pharmacological therapeutic fibroblasts or other tissue in which a miR-29a-c antagonist agent that may be used in the present invention include an was administered. antihyperlipoproteinemic agent, an antiarteriosclerotic agent, Combined Therapy an antithrombotic/fibrinolytic agent, a blood coagulant, an Tn another embodiment, it is envisioned to use an agonist of antiarrhythmic agent, an antihypertensive agent, a vasopres- miR-29a-c in combination with other therapeutic modalities sor, a treatment agent for congestive heart failure,an antiangi- for treating cardiac hypertrophy, heart failure and myocardial 30 nal agent, an antibacterial agent or a combination thereof. infarction. Thus, one may also provide to the subject more In addition, it should be noted that any ofthe following may “standard” pharmaceutical cardiac therapies in combination be used to develop newsets of cardiac therapy target genes as with the miR-29a-c agonist. Examples of other therapies B-blockers were used in the present examples (see below). include, without limitation, so-called “beta blockers,” anti- While it is expected that many of these genes may overlap, hypertensives, cardiotonics, anti-thrombotics, vasodilators, new genetargets likely can be developed. hormoneantagonists, iontropes, diuretics, endothelin recep- In certain embodiments, administration of an agent that tor antagonists, calcium channel blockers, phosphodiesterase lowers the concentration of one of more blood lipids and/or inhibitors, ACE inhibitors, angiotensin type 2 antagonists and lipoproteins, known herein as an “antihyperlipoproteinemic,” cytokine blockers/inhibitors, and HDAC inhibitors. may be combined with a cardiovascular therapy according to Combinations maybe achieved by contacting cardiac cells 40 the present invention, particularly in treatment of atherscle- with a single composition or pharmacological formulation rosis and thickenings or blockages of vascular tissues. In that includes an agonist of miR-29a-c and a standard phar- certain embodiments, an antihyperlipoproteinemic agent maceutical agent, or by contacting the cell with two distinct may comprise an aryloxyalkanoic/fibric acid derivative, a compositions or formulations, at the same time, wherein one resin/bile acid sequesterant, a HMG CoAreductase inhibitor, composition includes an agonist of miR-29a-c and the other 45 a nicotinic acid derivative, a thyroid hormoneor thyroid hor- includesthe standard pharmaceutical agent. Alternatively, the moneanalog, a miscellaneous agent or a combination thereof. therapy using an agonist ofmiR-29a-c mayprecedeor follow Non-limiting examples of aryloxyalkanoic/fibric acid administration ofthe other agent(s) by intervals ranging from derivatives include beclobrate, enzafibrate, binifibrate, minutes to weeks. In embodiments where the standard phar- ciprofibrate, clinofibrate, clofibrate (atromide-S), clofibric maceutical agent and miR-29a-c agonist are applied sepa- acid, etofibrate, fenofibrate, gemfibrozil (lobid), nicofibrate, rately to the cell, one would generally ensure that a significant pirifibrate, ronifibrate, simfibrate and theofibrate. period of time did not expire between the time of each deliv- Non-limiting examples of resins/bile acid sequesterants ery, such that the pharmaceutical agent and miR-29a-c ago- include cholestyramine (cholybar, questran), colestipol nist wouldstill be able to exert an advantageously combined (colestid) and polidexide. effect on the cell. In such instances, it is contemplated that one Non-limiting examples of HMG CoAreductase inhibitors would typically contact the cell with both modalities within include lovastatin (mevacor), pravastatin (pravochol) or sim- about 12-24 hours of each other and, morepreferably, within vastatin (zocor). about 6-12 hours ofeach other, with a delay time ofonly about Non-limiting examples of nicotinic acid derivatives 12 hours being mostpreferred. In somesituations, it may be include nicotinate, acepimox, niceritrol, nicoclonate, nico- desirable to extend the timeperiodfor treatmentsignificantly, mol and oxiniacic acid. however, where several days (2, 3, 4, 5, 6 or 7) to several Non-limiting examples of thyroid hormonesand analogs weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the respective thereof include etoroxate, thyropropic acid and thyroxine. administrations. Non-limiting examples of miscellaneous antihyperlipo- It also is conceivable that more than one administration of proteinemics include acifran, azacosterol, benfluorex, (f-ben- either an agonist of miR-29a-c, or the other pharmaceutical zalbutyramide, carnitine, chondroitin sulfate, clomestrone, agent will be desired. In this regard, various combinations detaxtran, dextran sulfate sodium, 5, 8, 11, 14, 17-eicosapen- may be employed. By wayofillustration, where the agonist of taenoic acid, eritadenine, furazabol, meglutol, melinamide, US 8,940,711 B2 31 32 mytatrienediol, ornithine, y-oryzanol, pantethine, pentaeryth- labetalol, levobunolol, mepindolol, metipranolol, meto- ritol tetraacetate, a-phenylbutyramide, pirozadil, probucol prolol, moprolol, nadolol, nadoxolol, nifenalol, nipradilol, (orelco), B-sitosterol, sultosilic acid-piperazine salt, tiad- oxprenolol, penbutolol, pindolol, practolol, pronethalol, pro- enol, triparanol and xenbucin. Non-limiting examples of an panolol (inderal), sotalol (betapace), sulfinalol, talinolol, ter- antiarteriosclerotic include pyridinol carbamate. tatolol, timolol, toliprolol and xibinolol. In certain embodi- In certain embodiments, administration of an agent that ments, the beta blocker comprises an aryloxypropanolamine aids in the removal or prevention of blood clots may be derivative. Non-limiting examples of aryloxypropanolamine combined with administration of a modulator, particularly in derivatives include acebutolol, alprenolol, arotinolol, treatment of athersclerosis and vasculature (e.g., arterial) atenolol, betaxolol, bevantolol, bisoprolol, bopindolol, buni- blockages. Non-limiting examples of antithrombotic and/or trolol, butofilolol, carazolol, carteolol, carvedilol, celiprolol, fibrinolytic agents include anticoagulants, anticoagulant cetamolol, epanolol, indenolol, mepindolol, metipranolol, antagonists, antiplatelet agents, thrombolytic agents, throm- metoprolol, moprolol, nadolol, nipradilol, oxprenolol, penb- bolytic agent antagonists or combinations thereof. utolol, pindolol, propanolol, talinolol, tertatolol, timolol and In certain embodiments, antithrombotic agents that can be toliprolol. administered orally, such as, for example, aspirin and wafarin Non-limiting examples of an agent that prolong repolar- (coumadin), are preferred. ization, also known as a Class II antiarrhythmic agent, Non-limiting examples of anticoagulants include aceno- include amiodarone (cordarone) and sotalol (betapace). coumarol, ancrod, anisindione, bromindione, clorindione, Non-limiting examples of a calcium channel blocker, oth- coumetarol, cyclocumarol, dextran sulfate sodium, dicuma- erwise knownas a Class IV antiarrhythmic agent, include an rol, diphenadione, ethyl biscoumacetate, ethylidene dicou- arylalkylamine (e.g., bepridile, diltiazem, fendiline, gallo- marol, fiuindione, heparin, hirudin, lyapolate sodium, pamil, prenylamine, terodiline, verapamil), a dihydropyri- oxazidione, pentosan polysulfate, phenindione, phenprocou- dine derivative (felodipine, isradipine, nicardipine, nife- mon, phosvitin, picotamide, tioclomarol and warfarin. dipine, nimodipine, nisoldipine, nitrendipine) a piperazinde Non-limiting examples of antiplatelet agents include aspi- derivative (e.g., cinnarizine, flunarizine, lidoflazine) or a mis- rin, a dextran, dipyridamole (persantin), heparin, sulfinpyra- cellaneous calcium channel blocker such as bencyclane, none(anturane) andticlopidine (ticlid). etafenone, magnesium, mibefradil or perhexyline. In certain Non-limiting examples ofthrombolytic agents includetis- embodiments a calcium channel blocker comprises a long- sue plaminogen activator (activase), plasmin, pro-urokinase, acting dihydropyridine (nifedipine-type) calcium antagonist. urokinase (abbokinase) streptokinase (streptase), anistre- Non-limiting examples of miscellaneous antiarrhythmic plase/APSAC (eminase). 30 agents include adenosine (adenocard), digoxin (lanoxin), In certain embodiments wherein a subject is suffering from acecainide, ajmaline, amoproxan,aprindine, bretylium tosy- a hemorrhageoran increased likelihood ofhemorrhaging, an late, bunaftine, butobendine, capobenic acid, cifenline, dis- agent that may enhance blood coagulation may be used. Non- opyranide, hydroquinidine, indecainide, ipatropium bro- limiting examples of a blood coagulation promoting agents mide, lidocaine, lorajmine, lorcainide, meobentine, include thrombolytic agent antagonists and anticoagulant 35 moricizine, pirmenol, prajmaline, propafenone, pyrinoline, antagonists. quinidine polygalacturonate, quinidine sulfate and viquidil. Non-limiting examples of anticoagulant antagonists Non-limiting examples of antihypertensive agents include include protamine and vitamine K1. sympatholytic, alpha/beta blockers, alpha blockers, anti-an- Non-limiting examples of thrombolytic agent antagonists giotensin II agents, beta blockers, calctum channel blockers, include amiocaproic acid (amicar) and tranexamic acid (am- 40 vasodilators and miscellaneous antihypertensives. stat). Non-limiting examples of antithrombotics include Non-limiting examples of an a-blocker, also known as an anagrelide, argatroban, cilstazol, daltroban, defibrotide, a-adrenergic blocker or an a-adrenergic antagonist, include enoxaparin, fraxiparine, indobufen, lamoparan, ozagrel, amosulalol, arotinolol, dapiprazole, doxazosin, ergoloid picotamide, plafibride, tedelparin,ticlopidine andtriflusal. mesylates, fenspiride, indoramin, labetalol, nicergoline, pra- Non-limiting examples of antiarrhythmic agents include 45 zosin, terazosin, tolazoline, trimazosin and yohimbine. In Class I antiarrhythmic agents (sodium channel blockers), certain embodiments, an alpha blocker may comprise a Class II antiarrhythmic agents (beta-adrenergic blockers), quinazoline derivative. Non-limiting examples of quinazo- Class III antiarrhythmic agents (repolarization prolonging line derivatives include alfuzosin, bunazosin, doxazosin,pra- drugs), Class IV antiarrhythmic agents (calcium channel zosin, terazosin and trimazosin. blockers) and miscellaneous antiarrhythmic agents. 50 In certain embodiments, an antihypertensive agent is both Non-limiting examples of sodium channel blockers an a- and p-adrenergic antagonist. Non-limiting examples of include Class IA, Class IB and Class IC antiarrhythmic an alpha/beta blocker comprise labetalol (normodyne, tran- agents. Non-limiting examples of Class IA antiarrhythmic date). agents include disppyramide (norpace), procainamide (pron- Non-limiting examples of anti-angiotensin I] agents estyl) and quinidine (quinidex). Non-limiting examples of 55 include angiotensin converting enzymeinhibitors and angio- Class IB antiarrhythmic agents include lidocaine (xylocalne), tensin II receptor antagonists. Non-limiting examples of tocainide (tonocard) and mexiletine (mexitil). Non-limiting angiotensin converting enzyme inhibitors (ACE inhibitors) examples of Class IC antiarrhythmic agents include encain- include alacepril, enalapril (vasotec), captopril, cilazapril, ide (enkaid) and flecainide (tambocor). delapril, enalaprilat, fosinopril, listnopril, moveltopril, perin- Non-limiting examplesofa B-blocker, otherwise known as dopril, quinapril and ramipril. Non-limiting examples of an a B-adrenergic blocker, a B-adrenergic antagonistor a Class IT angiotensin II receptor blocker, also knownas an angiotensin antiarrhythmic agent, include acebutolol(sectral), alprenolol, II receptor antagonist, anANG receptorblocker or anANG-II amosulalol, arotinolol, atenolol, befunolol, betaxolol, bevan- type-1 receptor blocker (ARBS), include angiocandesartan, tolol, bisoprolol, bopindolol, bucumolol, bufetolol, bufuralol, eprosartan, irbesartan, losartan and valsartan. bunitrolol, bupranolol, butidrine hydrochloride, butofilolol, Non-limiting examples of a sympatholytic include a cen- carazolol, carteolol, carvedilol, celiprolol, cetamolol, clo- trally acting sympatholytic or a peripherially acting sym- ranolol, dilevalol, epanolol, esmolol (brevibloc), indenolol, patholytic. Non-limiting examples of a centrally acting sym- US 8,940,711 B2 33 34 patholytic, also known as an central nervous system (CNS) Non-limiting examples of N-carboxyalkyl(peptide/lac- sympatholytic, include clonidine (catapres), guanabenz tam) derivatives include alacepril, captopril, cilazapril, dela- (wytensin) guanfacine (tenex) and methyldopa (aldomet). pri, enalapril, enalaprilat, fosinopril, lisinopril, moveltipril, Non-limiting examples of a peripherally acting sym- perindopril, quinapril and ramipril. patholytic include a ganglion blocking agent, an adrenergic Non-limiting examples of dihydropyridine derivatives neuron blocking agent, a B-adrenergic blocking agent or a include amlodipine, felodipine, isradipine, nicardipine, nife- alpha] -adrenergic blocking agent. Non-limiting examples of dipine, nilvadipine, nisoldipine and nitrendipine. a ganglion blocking agent include mecamylamine(inversine) Non-limiting examples of guanidine derivatives include bethanidine, debrisoquin, guanabenz, guanacline, guanadrel, and trimethaphan (arfonad). Non-limiting examples of an guanazodine, guanethidine, guanfacine, guanochlor, guan- adrenergic neuron blocking agent include guanethidine(is- oxabenz and guanoxan. melin) and reserpine (serpasil). Non-limiting examples of a Non-limiting examples ofhydrazines/phthalazines include B-adrenergic blocker include acenitolol (sectral), atenolol budralazine, cadralazine, dihydralazine, endralazine, hydra- (tenormin), betaxolol (kerlone), carteolol (cartrol), labetalol carbazine, hydralazine, pheniprazine, pildralazine and (normodyne,trandate), metoprolol (lopressor), nadanol(cor- todralazine. gard), penbutolol (levatol), pindolol (visken), propranolol Non-limiting examples of imidazole derivatives include (inderal) and timolol (blocadren). Non-limiting examples of clonidine, lofexidine, phentolamine, tiamenidine andtoloni- alpha] -adrenergic blocker include prazosin (minipress), dox- dine. azocin (cardura) and terazosin (hytrin). Non-limiting examples of quanternary ammonium com- In certain embodiments a cardiovasculator therapeutic pounds include azamethonium bromide, chlorisondamine agent may comprise a vasodilator(e.g., a cerebral vasodilator, chloride, hexamethonium, pentacynium bis(methylsulfate), a coronary vasodilator or a peripheral vasodilator). In certain pentamethonium bromide, pentolinium tartrate, phenactro- preferred embodiments, a vasodilator comprises a coronary pinium chloride and trimethidinium methosulfate. vasodilator. Non-limiting examples of a coronary vasodilator Non-limiting examples of reserpine derivatives include include amotriphene, bendazol, benfurodil hemisuccinate, bietaserpine, deserpidine, rescinnamine, reserpine and syros- benziodarone, chloracizine, chromonar, clobenfurol, cloni- ingopine. trate, dilazep, dipyridamole, droprenilamine, efloxate, eryth- Non-limiting examples of sulfonamide derivatives include rityl tetranitrane, etafenone, fendiline, floredil, ganglefene, ambuside, clopamide, furosemide, indapamide, quineth- herestrol bis(B-diethylaminoethy! ether), hexobendine,itra- azone,tripamide and xipamide. min tosylate, khellin, lidoflanine, mannitol hexanitrane, 30 Vasopressors generally are used to increase blood pressure medibazine, nicorglycerin, pentaerythritol tetranitrate, pen- during shock, which may occur during a surgical procedure. trinitrol, perhexyline, pimethylline, trapidil, tricromyl, tri- Non-limiting examples of a vasopressor, also known as an metazidine, trolnitrate phosphate and visnadine. antihypotensive, include amezinium methyl] sulfate, angio- In certain embodiments, a vasodilator may comprise a tensin amide, dimetofrine, dopamine, etifelmin, etilefrin, chronic therapy vasodilator or a hypertensive emergency gepefrine, metaraminol, midodrine, norepinephrine, vasodilator. Non-limiting examples of a chronic therapy pholedrine and synephrine. vasodilator include hydralazine (apresoline) and minoxidil Non-limiting examples of agents for the treatment of con- (oniten). Non-limiting examples of a hypertensive emer- gestive heart failure include anti-angiotensin II agents, after- gency vasodilator include nitroprusside (nipride), diazoxide load-preload reduction treatment, diuretics and inotropic (hyperstat IV), hydralazine (apresoline), minoxidil (loniten) 40 agents. and verapamil. In certain embodiments, an animal subject that can not Non-limiting examples of miscellaneous antihyperten- tolerate an angiotensin antagonist may be treated with a com- sives include ajmaline, y-aminobutyric acid, bufeniode, cicle- bination therapy. Such therapy may combine administration tainine, ciclosidomine, a cryptenamine tannate, fenoldopam, of hydralazine (apresoline) and isosorbide dinitrate (isordil, flosequinan, ketanserin, mebutamate, mecamylamine, meth- 45 sorbitrate). yldopa, methyl 4-pyridyl ketone thiosemicarbazone, Non-limiting examples of a diuretic include a thiazide or muzolimine, pargyline, pempidine, pinacidil, piperoxan, pri- benzothiadiazine derivative (e.g., althiazide, bendroflumet- maperone, a protoveratrine, raubasine, rescimetol, ril- hazide, benzthiazide, benzylhydrochlorothiazide, buthiazide, menidene, saralasin, sodium nitrorusside, ticrynafen, tri- chlorothiazide, chlorothiazide, chlorthalidone, cyclopenthi- methaphan camsylate, tyrosinase and urapidil. 50 azide, epithiazide, ethiazide, ethiazide, fenquizone, hydro- Incertain embodiments, an antihypertensive may comprise chlorothiazide, hydroflumethiazide, methyclothiazide, meti- an arylethanolamine derivative, a benzothiadiazine deriva- crane, metolazone, paraflutizide, polythizide, tive, a N-carboxyalkyl(peptide/lactam) derivative, a dihydro- tetrachloromethiazide, trichlormethiazide), an organomercu- pyridine derivative, a guanidine derivative, a hydrazines/ph- rial (e.g., chlormerodrin, meralluride, mercamphamide, mer- thalazine, an imidazole derivative, a quanternary ammonium 55 captomerin sodium, mercumallylic acid, mercumatilin compound,a reserpine derivative or a suflonamidederivative. dodium, mercurouschloride, mersaly]), a pteridine(e.g., fur- Non-limiting examples of arylethanolamine derivatives therene, triamterene), purines (e.g., acefylline, 7-morpholi- include amosulalol, bufuralol, dilevalol, labetalol, proneth- nomethyltheophylline, pamobrom, protheobromine, theo- alol, sotalol and sulfinalol. bromine), steroids including aldosterone antagonists (e.g., Non-limiting examples of benzothiadiazine derivatives canrenone,oleandrin, spironolactone), a sulfonamide deriva- include althizide, bendroflumethiazide, benzthiazide, ben- tive (e.g., acetazolamide, ambuside, azosemide, bumetanide, zylhydrochlorothiazide, buthiazide, chlorothiazide, chlortha- butazolamide, chloraminophenamide, clofenamide, clopam- lidone, cyclopenthiazide, cyclothiazide, diazoxide, epithiazide, clorexolone, diphenylmethane-4,4'-disulfonamide, dis- ide, ethiazide, fenquizone, hydrochlorothizide, ulfamide, ethoxzolamide, furosemide, indapamide, mefru- hydroflumethizide, methyclothiazide, meticrane, metola- side, methazolamide, piretanide, quinethazone, torasemide, zone, paraflutizide, polythizide, tetrachlormethiazide and tripamide, xipamide), a uracil (e.g., aminometradine, ami- trichlormethiazide. sometradine), a potassium sparing antagonist (e.g., US 8,940,711 B2 35 36 amiloride, triamterene) or a miscellaneous diuretic such as reperfusion, catheter ablation, providing an implantable car- aminozine, arbutin, chlorazanil, ethacrynic acid, etozolin, dioverter defibrillator to the subject, mechanical circulatory hydracarbazine, isosorbide, mannitol, metochalcone, support or a combination thereof. Non-limiting examples ofa muzolimine, perhexyline, ticrnafen and urea. mechanical circulatory support that may be used in the Non-limiting examples of a positive inotropic agent, also present invention comprise an intra-aortic balloon counter- known as a cardiotonic, include acefylline, an acetyldigi- pulsation, left ventricular assist device or combination toxin, 2-amino-4-picoline, amrinone, benfurodil hemisucci- thereof. nate, bucladesine, cerberosine, camphotamide, convalla- Drug Formulations and Routes forAdministration to Subjects toxin, cymarin, denopamine,deslanoside, digitalin, digitalis, The presentinvention also provides a pharmaceutical com- digitoxin, digoxin, dobutamine, dopamine, dopexamine, 10 position comprising an agonist or antagonist of miR-29a-c. enoximone, erythrophleine, fenalcomine, gitalin, gitoxin, The agonist may be an expression vector comprising a nucleic glycocyamine, heptaminol, hydrastinine, ibopamine,a lana- acid segment encoding miR-29a-c, or a polynucleotide com- toside, metamivam, milrinone, nerifolin, oleandrin, ouabain, prising a mature miR-29a-c sequenceor an effective portion oxyfedrine, prenalterol, proscillaridine, resibufogenin, scil- thereof. The agonist may be comprised in a lipid delivery laren, scillarenin, strphanthin, sulmazole, theobromine and 15 vehicle. The antagonist may be a polynucleotide that hybrid- xamoterol. izes to miR-29a-c or a target thereof. In particular embodiments, an intropic agent is a cardiac Whereclinical applications are contemplated, pharmaceu- glycoside, a beta-adrenergic agonist or a phosphodiesterase tical compositions will be prepared in a form appropriate for inhibitor. Non-limiting examples of a cardiac glycoside the intended application. Generally, this will entail preparing includes digoxin (lanoxin) and digitoxin (crystodigin). Non- 20 compositions that are essentially free of pyrogens, as well as limiting examples ofa B-adrenergic agonistinclude albuterol, other impurities that could be harmful to humansor animals. bambuterol, bitolterol, carbuterol, clenbuterol, clorprenaline, Colloidal dispersion systems, such as macromolecule denopamine,dioxethedrine, dobutamine (dobutrex), dopam- complexes, nanocapsules, microspheres, beads, and lipid- ine (intropin), dopexamine, ephedrine, etafedrine, ethylnore- based systems including oil-in-water emulsions, micelles, pinephrine, fenoterol, formoterol, hexoprenaline, ibopamine, 25 mixed micelles, and liposomes, may be used as delivery isoetharine, isoproterenol, mabuterol, metaproterenol, meth- vehicles for the oligonucleotide inhibitors (e.g. antagonists) oxyphenamine, oxyfedrine, pirbuterol, procaterol, protoky- of microRNA function or constructs expressing particular lol, reproterol, rimiterol, ritodrine, soterenol, terbutaline, tre- microRNAs. Commercially available fat emulsions that are toquinol, tulobuterol and xamoterol. Non-limiting examples suitable for delivering the nucleic acids of the invention to of a phosphodiesterase inhibitor include amrinone(inocor). 30 cardiac and skeletal muscle tissues include Intralipid®, Lipo- Antianginal agents may comprise organonitrates, calcium syn®, Liposyn® II, Liposyn® III, Nutrilipid, and other simi- channel blockers, beta blockers and combinations thereof. lar lipid emulsions. A preferred colloidal system for use as a Non-limiting examples of organonitrates, also known as delivery vehicle in vivo is a liposome(1.e., an artificial mem- nitrovasodilators, include nitroglycerin (nitro-bid,nitrostat), brane vesicle). The preparation and use of such systemsis isosorbide dinitrate (isordil, sorbitrate) and amy]nitrate (as- 35 well known in the art. Exemplary formulations are also dis- pirol, vaporole). closed in U.S. Pat. No. 5,981,505; U.S. Pat. No. 6,217,900; Endothelin (ET) is a 21-aminoacid peptide that has potent US. Pat. No. 6,383,512; U.S. Pat. No. 5,783,565; U.S. Pat. physiologic and pathophysiologic effects that appear to be No. 7,202,227; U.S. Pat. No. 6,379,965; U.S. Pat. No. 6,127, involved in the developmentofheart failure. The effects ofET 170; U.S. Pat. No. 5,837,533; U.S. Pat. No. 6,747,014; and are mediated through interaction with two classes of cell 40 WO003/093449, which are herein incorporated by reference in surface receptors. The type A receptor (ET-A)is associated their entireties. with vasoconstriction and cell growth while the type B recep- One will generally desire to employ appropriate salts and tor (ET-B) is associated with endothelial-cell mediated buffers to render delivery vehicles stable and allow for uptake vasodilation and with the release of other neurohormones, by target cells. Buffers also will be employed when recom- such as aldosterone. Pharmacologic agents that can inhibit 45 binant cells are introduced into a subject. Aqueous composi- either the production of ET orits ability to stimulate relevant tions ofthe present invention comprise an effective amount of cells are known in the art. Inhibiting the production of ET the delivery vehicle comprising the inhibitor polynucleotides involvesthe use ofagents that block an enzyme termed endot- or miRNApolynucleotide sequences(e.g. liposomesor other helin-converting enzymethat is involved in the processing of complexes or expression vectors) or cells, dissolved or dis- the active peptide from its precursor. Inhibiting the ability of 50 persed in a pharmaceutically acceptable carrier or aqueous ETto stimulate cells involves the use of agents that block the medium. The phrases “pharmaceutically acceptable” or interaction ofET withits receptors. Non-limiting examples of “pharmacologically acceptable” refers to molecular entities endothelin receptor antagonists (ERA) include Bosentan, and compositions that do not produce adverse, allergic, or Enrasentan, Ambrisentan, Darusentan, Tezosentan, Atrasen- other untoward reactions when administered to an animal or tan, Avosentan, Clazosentan, Edonentan, sitaxsentan, TBC 55 a human.As used herein, “pharmaceutically acceptable car- 3711, BQ 123, and BQ 788. rier” includes solvents, buffers, solutions, dispersion media, In certain embodiments, the secondary therapeutic agent coatings, antibacterial and antifungal agents, isotonic and may comprise a surgery of some type, which includes, for absorption delaying agents and the like acceptable for use in example, preventative, diagnostic or staging, curative and formulating pharmaceuticals, such as pharmaceuticals suit- palliative surgery. Surgery, and in particular a curative sur- 60 able for administration to humans. The use of such media and gery, may be used in conjunction with other therapies, such as agents for pharmaceutically active substances is well known the present invention and one or more other agents. in the art. Except insofar as any conventional media or agent Such surgical therapeutic agents for vascular and cardio- is incompatible with the active ingredients of the present vascular diseases and disorders are well known to those of invention, its use in therapeutic compositions is contem- skill in the art, and may comprise, but are not limited to, 65 plated. Supplementary active ingredients also can be incor- performing surgery on an organism, providing a cardiovas- porated into the compositions, provided they do not inactivate cular mechanical prostheses, angioplasty, coronary artery the vectors or cells of the compositions. US 8,940,711 B2 37 38 The active compositions of the present invention may drying and freeze-drying techniques which yield a powder of include classic pharmaceutical preparations. Administration the active ingredient(s) plus any additional desired ingredient ofthese compositions accordingto the present invention may from a previously sterile-filtered solution thereof. be via any common route so long as the target tissue is The compositions of the present invention generally may available via that route. This includes oral, nasal, or buccal. be formulated in a neutral or salt form. Pharmaceutically- Alternatively, administration may be by intradermal, subcu- acceptable salts include, for example, acid addition salts taneous, intramuscular, intraperitoneal or intravenousinjec- (formed with the free amino groups ofthe protein) derived tion, or by direct injection into cardiac tissue. Pharmaceutical from inorganic acids (e.g., hydrochloric or phosphoric acids, compositions comprising miRNA antagonists or expression or from organic acids (e.g., acetic, oxalic, tartaric, mandelic, constructs comprising miRNA sequences mayalso be admin- 10 and thelike. Salts formed with the free carboxyl groups ofthe istered by catheter systems or systems that isolate coronary protein can also be derived from inorganic bases (e.g., circulation for delivering therapeutic agents to the heart. Vari- sodium, potassium, ammonium,calcium, or ferric hydrox- ous catheter systems for delivering therapeutic agents to the ides) or from organic bases(e.g., isopropylamine, trimethy- heart and coronary vasculature are known in the art. Some lamine,histidine, procaine andthe like. non-limiting examples of catheter-based delivery methods or 15 Upon formulation, solutionsare preferably administered in coronary isolation methods suitable for use in the present a manner compatible with the dosage formulation and in such invention are disclosed in U.S. Pat. No. 6,416,510; U.S. Pat. amountas is therapeutically effective. The formulations may No. 6,716,196; U.S. Pat. No. 6,953,466, WO 2005/082440, easily be administered in a variety of dosage forms such as WO 2006/089340, U.S. Patent Publication No. 2007/ injectable solutions, drug release capsules and the like. For 0203445, U.S. Patent Publication No. 2006/0148742, and 20 parenteral administration in an aqueous solution, for U.S. Patent Publication No. 2007/0060907, which are all example, the solution generally is suitably buffered and the herein incorporated by reference in their entireties. Such liquid diluentfirst rendered isotonic for example with suffi- compositions would normally be administered as pharmaceu- cient saline or glucose. Such aqueoussolutions may be used, tically acceptable compositions, as described supra. for example, for intravenous, intramuscular, subcutaneous The active compounds mayalso be administered parenter- 25 and intraperitoneal administration. Preferably, sterile aque- ally or intraperitoneally. By way ofillustration, solutions of ous media are employedas is knownto those of skill in theart, the active compounds as free base or pharmacologically particularly in light of the present disclosure. By way of acceptable salts can be prepared in water suitably mixed with illustration, a single dose may be dissolved in 1 ml of isotonic a surfactant, such as hydroxypropylcellulose. Dispersions NaC]solution and either added to 1000 ml ofhypodermocly- can also be preparedin glycerol, liquid polyethylene glycols, 30 sis fluid or injected at the proposedsite of infusion, (see for and mixtures thereofandin oils. Under ordinary conditions of example, “Remington’s Pharmaceutical Sciences” 15th Edi- storage and use, these preparations generally contain a pre- tion, pages 1035-1038 and 1570-1580). Some variation in servative to prevent the growth of microorganisms. dosage will necessarily occur depending on the condition of The pharmaceutical forms suitable for injectable use or the subject being treated. The person responsible for admin- catheter delivery include, for example, sterile aqueous solu- 35 istration will, in any event, determine the appropriate dose for tionsor dispersions andsterile powders for the extemporane- the individual subject. Moreover, for human administration, ous preparation ofsterile injectable solutions or dispersions. preparations should meetsterility, pyrogenicity, general Generally, these preparationsare sterile and fluid to the extent safety and purity standards as required by FDA Office of that easy injectability exists. Preparations should be stable Biologics standards. under the conditions of manufacture and storage and should 40 Cosmetic formulations for increasing collagen deposition be preserved against the contaminating action ofmicroorgan- in tissues may comprise atleast one antagonist ofmiR-29a-c. isms, such as bacteria and fungi. Appropriate solvents or The antagonist may be an antagonist of miR-29a, miR-29b, dispersion media may contain, for example, water, ethanol, miR-29c, or combinations thereof. In some embodiments, the polyol (for example, glycerol, propylene glycol, and liquid antagonist ofmiR-29a-c is an antagomir. The antagonist may polyethylene glycol, and the like), suitable mixtures thereof, 45 be linked or conjugatedto agents that facilitate the entry ofthe and vegetable oils. The properfluidity can be maintained, for antagonist into cell or tissues. Such agents may include cell example, by the use of a coating, such as lecithin, by the internalization transporters, such as antennapedia, TAT, maintenance of the required particle size in the case of dis- Buforin I, Transportan, model amphipathic peptide, K-FGF, persion and by the use of surfactants. The prevention of the Ku70, Prion, pVEC, Pep-1, SynB1, SynB3, SynB5, Pep-7, action of microorganisms can be brought about by various 50 HN-1, Bis-Guanidinium-Spermidine-Cholesterol, Bis- _ antibacterial an antifungal agents, for example, parabens, Guanidinium-Tren-Cholesterol, and polyarginine. The agent chlorobutanol, phenol, sorbic acid, thimerosal, and the like. maybe linked to the miR-29a-c antagonist at its amino or In manycases,it will be preferable to include isotonic agents, carboxy terminus. In one embodiment, the agentis linked to for example, sugars or sodium chloride. Prolonged absorp- the antagonist by a sequencethat is cleaved uponentry to the tion of the injectable compositions can be brought about by 55 cell. Such sequencestypically comprise consensus sequences the use in the compositions ofagents delaying absorption, for for proteases as are known in theart. example, aluminum monostearate and gelatin. The cosmetic compositions can be formulated into all Sterile injectable solutions may be prepared by incorporat- types of vehicles. Non-limiting examples of suitable vehicles ing the active compounds in an appropriate amount into a include emulsions (e.g., water-in-oil, water-in-oil-in-water, solvent along with any other ingredients (for example as 60 oil-in-water, oil-in-water-in-oil, oil-in-water-in-silicone _ enumerated above) as desired, followed byfiltered steriliza- emulsions), creams, lotions, solutions (both aqueous and tion. Generally, dispersions are prepared by incorporating the hydro-alcoholic), anhydrous bases (such as lipsticks and various sterilized active ingredients into a sterile vehicle powders), gels, and ointments or by other method or any which containsthe basic dispersion medium andthe desired combination of the forgoing as would be known to one of other ingredients, e.g., as enumerated above. In the case of ordinary skill in the art (Remington’s, 1990). Variations and sterile powders for the preparation of sterile injectable solu- other appropriate vehicles will be apparent to the skilled tions, the preferred methods of preparation include vacuum- artisan and are appropriate for use in the present invention. In US 8,940,711 B2 39 40 certain embodiments, the concentrations and combinations of mile, cucumber extract, ginkgo biloba, ginseng, and rose- the ingredients are selected in such a way that the combina- mary), anti-microbial agents, antioxidants (e.g., BHT and tions are chemically compatible and do not form complexes tocopherol), chelating agents (e.g., disodium EDTA andtet- which precipitate from the finished product. rasodium EDTA), preservatives (e.g., methylparaben and It is also contemplated that aromatic skin-active ingredi- propylparaben), pH adjusters (e.g., sodium hydroxide and ents and additional ingredients identified throughout this citric acid), absorbents (e.g., aluminum starch octenylsucci- specification can be encapsulatedfor delivery to a target area nate, kaolin, corn starch, oat starch, cyclodextrin, talc, and such as skin. Non-limiting examples of encapsulation tech- zeolite), skin bleaching and lightening agents (e.g., hydro- niques include the use of liposomes, vesicles, and/or nano- quinone andniacinamide lactate), humectants (e.g., glycerin, particles (e.g., biodegradable and non-biodegradable colloi- 10 propyleneglycol, butylene glycol, pentylene glycol, sorbitol, dal particles comprising polymeric materials in which the urea, and manitol), exfoliants (e.g., alpha-hydroxyacids, and ingredient is trapped, encapsulated, and/or absorbed—ex- beta-hydroxyacids suchas lactic acid, glycolic acid,and sali- amples include nanospheres and nanocapsules) that can be used as delivery vehicles to deliver such ingredients to skin cylic acid; andsalts thereof) waterproofing agents (e.g., magnesium/aluminum hydroxide stearate), skin conditioning (see, e.g., U.S. Pat. No. 6,387,398; U.S. Pat. No. 6,203,802; 15 USS. Pat. No. 5,411,744; and Kreuter 1998, which are herein agents (e.g., aloe extracts, allantoin, bisabolol, ceramides, incorporated by reference in their entireties). dimethicone, hyaluronic acid, and dipotassium glycyr- Also contemplated are pharmaceutically-acceptable or rhizate), thickening agents (e.g., substances which that can pharmacologically-acceptable compositions. The phrase increase the viscosity of a composition such as carboxylic “pharmaceutically-acceptable” or “pharmacologically-ac- 20 acid polymers, crosslinked polyacrylate polymers, polyacry- ceptable” includes compositions that do not produce an aller- lamide polymers, polysaccharides, and gums), and silicone gic or similar untoward reaction when administered to a containing compounds(e.g., silicone oils and polyorganosi- human. Typically, such compositions are prepared either as loxanes). topical compositions, liquid solutions or suspensions, solid Pharmaceutical ingredients are also contemplated as being formssuitable for solution in, or suspension in, liquid prior to 25 useful with the emulsion compositions of the present inven- use can also be prepared. Routes of administration can vary tion. Non-limiting examples of pharmaceutical ingredients with the location and nature of the condition to be treated, and include anti-acne agents, agents used to treat rosacea, anal- include, e.g., topical, inhalation, intradermal, transdermal, gesics, anesthetics, anorectals, antihistamines, anti-inflam- parenteral, intravenous, intramuscular, intranasal, subcutane- matory agents including non-steroidal anti-inflammatory ous, percutaneous, intratracheal, intraperitoneal, intratu- 30 drugs, antibiotics, antifungals, antivirals, antimicrobials, moral, perfusion, lavage, direct injection, and oral adminis- anti-cancer actives, scabicides, pediculicides, antineoplas- tration and formulation. tics, antiperspirants, antipruritics, antipsoriatic agents, anti- The compositions of the present invention can be incorpo- seborrheic agents, biologically active proteins and peptides, rated into products. Non-limiting examples of products burn treatment agents, cauterizing agents, depigmenting include cosmetic products, food-based products, pharmaceu- 35 tical products, etc. By way of example only, non-limiting agents, depilatories, diaper rash treatment agents, enzymes, cosmetic products include sunscreen products, sunless skin hair growth stimulants, hair growth retardants including tanning products, hair products, fingernail products, moistur- DFMOandits salts and analogs, hemostatics, kerotolytics, izing creams, skin benefit creams andlotions, softeners, day canker sore treatment agents, cold sore treatment agents, lotions, gels, ointments, foundations, night creams, lipsticks, 40 dental and periodontal treatment agents, photosensitizing mascaras, eyeshadows, eyeliners, cheek colors, cleansers, actives, skin protectant/barrier agents, steroids including hor- toners, masks, or other known cosmetic products or applica- monesand corticosteroids, sunburn treatment agents, sun- tions. Additionally, the cosmetic products can be formulated screens, transdermal actives, nasal actives, vaginal actives, as leave-on or rinse-off products. wart treatment agents, wound treatment agents, woundheal- Compositions of the present invention can include addi- 45 ing agents, etc. tional ingredients. Non-limiting examples of additional Any of the compositions described herein may be com- ingredients include cosmetic ingredients (both active and prised in a kit. In a non-limiting example, an individual non-active) and pharmaceutical ingredients (both active and miRNAis includedin a kit. The kit may further include water non-active). The CTFA International Cosmetic Ingredient and hybridization bufferto facilitate hybridization of the two Dictionary and Handbook (2004) describes a wide variety of 50 strands of the miRNAs. In some embodiments, the kit may non-limiting cosmetic ingredients that can be used in the include one or more oligonucleotides for inhibiting the func- context ofthe present invention. Examplesofthese ingredient tion of a target miRNA.The kit may also include one or more classes include: fragrances (artificial and natural), dyes and transfection reagent(s) to facilitate delivery of the miRNA or color ingredients (e.g., Blue 1, Blue 1 Lake, Red 40,titanium miRNAantagoniststo cells. dioxide, D&C blue no. 4, D&C green no. 5, D&C orange no. 55 The components of the kits may be packaged either in 4, D&C red no. 17, D&C red no. 33, D&C violet no. 2, D&C aqueous media or in lyophilized form. The container means yellow no. 10, and D&C yellow no. 11), adsorbents, emulsi- of the kits will generally include at least one vial, test tube, fiers, stabilizers, lubricants, solvents, moisturizers (includ- flask, bottle, syringe or other container means, into which a ing, e.g., emollients, humectants, film formers, occlusive componentmaybeplaced, and preferably, suitably aliquoted. agents, and agents that affect the natural moisturization 60 Where there is more than one componentin the kit (labeling mechanisms of the skin), water-repellants, UV absorbers reagent and label may be packagedtogether), the kit also will (physical and chemical absorbers such as paraminobenzoic generally contain a second, thirdor other additional container acid (“PABA”) and corresponding PABA derivatives, tita- into which the additional components may be separately nium dioxide, zinc oxide, etc.), essential oils, vitamins(e.g., placed. However, various combinations of components may A, B, C, D, E, and K), trace metals (e.g., zinc, calctum and 65 be comprised in a vial. The kits of the present invention also selenium), anti-irritants (e.g., steroids and non-steroidal anti- will typically include a means for containing the nucleic inflammatories), botanical extracts (e.g., aloe vera, chamo- acids, and any other reagent containers in close confinement US 8,940,711 B2 41 42 for commercial sale. Such containers may include injection or found. The invention provides methodsfor screening for such blow-moldedplastic containers into which the desired vials candidates, not solely methodsoffinding them. are retained. As used herein the term “candidate compound”refers to Whenthe componentsofthe kit are provided in one and/or any molecule that may potentially modulate fibrosis- or col- moreliquid solutions, the liquid solution is an aqueous solu- lagen-regulating aspects of miR-29a-c. One will typically tion, with a sterile aqueous solution being particularly pre- acquire, from various commercial sources, molecular librar- ferred. ies that are believed to meet the basiccriteria for useful drugs However, the components of the kit may be provided as in an effort to “brute force”the identification of useful compounds. Screening of such libraries, including combinatori- dried powder(s). When reagents and/or componentsare pro- 10 ally-generated libraries (e.g., antagomirlibraries), is a rapid vided as a dry powder, the powder can be reconstituted by the and efficient way to screen a large numberofrelated (and addition ofa suitable solvent. It is envisioned that the solvent unrelated) compounds for activity. Combinatorial mayalso be provided in another container means. approachesalso lend themselvesto rapid evolution of poten- The container means will generally include at least one tial drugs by the creation of second, third, and fourth genera- vial, test tube, flask, bottle, syringe and/or other container 15 tion compounds modeled on active, but otherwise undesir- means, into which the nucleic acid formulations are placed, able compounds. preferably, suitably allocated. The kits may also comprise a A quick, inexpensive and easy assay to run is an in vitro second container meansfor containing a sterile, pharmaceu- assay. Such assays generally use isolated molecules, can be tically acceptable buffer and/or other diluent. run quickly and in large numbers, thereby increasing the Thekits ofthe present invention will also typically include 20 amountof information obtainable in a short period of time. A a means for containing the vials in close confinement for variety ofvessels may be usedto run the assays, including test commercial sale, such as, e.g., injection and/or blow-molded tubes, plates, dishes and other surfaces such as dipsticks or plastic containers into which the desired vials are retained. beads. Such kits may also include components that preserve or A technique for high throughput screening of compounds maintain the miRNA or miRNAinhibitory oligonucleotides 25 is described in WO 84/03564, whichis herein incorporated by or that protect against their degradation. Such components reference in its entirety. Large numbers of small antagomir may be RNAse-free or protect against RNAses. Such kits compounds may be synthesized on a solid substrate, such as generally will comprise, in suitable means, distinct containers plastic pins or some other surface. Such molecules can be for each individual reagentor solution. rapidly screening for their ability to inhibit miR-29a-c. A kit will also include instructions for employing the kit 30 The present invention also contemplates the screening of components as well the use of any other reagent not included compounds for their ability to modulate miR-29a-c activity in the kit. Instructions may include variations that can be and expression in cells. Various cell lines, including those implemented. A kit may also include utensils or devices for derived from skeletal muscle cells, can be utilized for such administering the miRNA agonist or antagonist by various screening assays, including cells specifically engineered for administration routes, such as parenteral or catheter admin- 35 this purpose. Primary cardiac cells also may be used, as can istration. the H9C2cell line. Tt is contemplated that such reagents are embodiments of In vivo assays involve the use of various animal models of kits ofthe invention. Such kits, however, are not limited to the heart disease, musculoskeletal disease, fibrosis, or collagen- particular items identified above and may include any reagent loss including transgenic animals, that have been engineered used for the manipulation or characterization of miRNA. 40 to have specific defects, or carry markers that can be used to Methodsfor Identifying Modulators measure the ability of a candidate substance to reach and The present invention further comprises methodsfor iden- affect different cells within the organism. Dueto their size, tifying agonists ofmiR-29a-c that are useful in the prevention ease of handling, and information on their physiology and or treatmentor reversal of cardiac fibrosis, cardiac hypertro- genetic make-up, mice are a preferred embodiment, espe- phy or heart failure. These assays may comprise random 45 cially for transgenics. However, other animals are suitable as screening of large libraries of candidate compounds; alterna- well, including rats, rabbits, hamsters, guinea pigs, gerbils, tively, the assays may be used to focusonparticularclasses of woodchucks, cats, dogs, sheep, goats, pigs, cows, horses and compounds selected with an eye towardsstructural attributes monkeys (including chimps, gibbons and baboons). Assays that are believed to make them more likely to promote the for inhibitors may be conducted using an animal model expression and/or function of miR-29a-c. 50 derived from any of these species. To identify a modulator of miR-29a-c, one generally will Treatment ofanimals with test compoundswill involve the determine the function of a miR-29a-c in the presence and administration of the compound, in an appropriate form, to absenceof the candidate compound. For example, a method the animal. Administration will be by any route that could be generally comprises: utilized for clinical purposes. Determining the effectiveness (a) providing a candidate compound; 55 of a compound in vivo may involve a variety of different (b) admixing the candidate compound with a miR-29; criteria, including but notlimited to alteration ofhypertrophic (c) measuring miR-29a-c activity; and signaling pathways and physical symptoms of hypertrophy. (d) comparing the activity in step (c) with the activity of Also, measuring toxicity and dose responses can be per- miR-29a-c in the absence of the candidate compound, formed in animals in a more meaningful fashion than in in wherein a difference between the measuredactivities of 60 vitro or in cyto assays. miR-29a-c indicates that the candidate compoundis, indeed, Transgenic Animals a modulator of miR-29a-c. A particular embodimentofthe present invention provides Assays also may be conductedin isolated cells, organs, or in transgenic animals that lack one or both functionalalleles of living organisms. miR-29a, miR-29b, and/or miR-29c. Also, transgenic ani- Tt will, of course, be understood that all the screening 65 mals that express miR-29a-c underthe control of an induc- methods of the present invention are useful in themselves ible, tissue selective or a constitutive promoter, recombinant notwithstandingthe fact that effective candidates may not be cell lines derived from such animals, and transgenic embryos US 8,940,711 B2 43 44 may be useful in determining the exact role that miR-29a-c Randomly cycling adult female miceare paired with vasec- plays in the control of fibrosis and in the development of tomized males. C57BL/6 or Swiss mice or other comparable pathologic cardiac hypertrophy and heart failure. Further- strains can be used for this purpose. Recipient females are more, these transgenic animals may provide an insight into mated at the same time as donor females. At the time of heart development. The use of an inducible or repressable embryotransfer, the recipient females are anesthetized with miR-29a-c encoding nucleic acid provides a model for over- an intraperitoneal injection of 0.015 ml of 2.5% avertin per or unregulated expression. Also, transgenic animals that are gram of body weight. The oviducts are exposed bya single “knocked out” for miR-29a-c, in one or both alleles, are midline dorsal incision. An incision is then made through the contemplated. Also, transgenic animals that are “knocked body wall directly over the oviduct. The ovarian bursa is then out” for miR-29a-c, in one or both alleles for one or both torn with watchmakers forceps. Embryosto be transferred are clusters, are contemplated. placed in DPBS (Dulbecco’s phosphate buffered saline) and In a general embodiment, a transgenic animal is produced in the tip of a transfer pipet (about 10 to 12 embryos). The by the integration of a given transgene into the genome in a mannerthat permits the expression of the transgene. Methods pipet tip is inserted into the infundibulum and the embryos for producing transgenic animals are generally described by transferred. After the transfer, the incision is closed by two Wagner and Hoppe (U.S. Pat. No. 4,873,191; incorporated sutures. herein by reference), and Brinsteret al. (1985; incorporated herein by reference). DEFINITIONS Typically, a gene flanked by genomic sequencesis transferred by microinjection into a fertilized egg. The microin- As used herein, the term “heart failure” is broadly used to jected eggs are implantedinto a host female, and the progeny mean any condition that reduces the ability of the heart to are screened for the expression of the transgene. Transgenic pumpblood. Asa result, congestion and edema develop in the animals may be produced from the fertilized eggs from a tissues. Most frequently, heart failure is caused by decreased number of animals including, but not limited to reptiles, contractility ofthe myocardium,resulting from reduced coro- amphibians, birds, mammals, andfish. 25 nary blood flow; however, many other factors may result in DNA clones for microinjection can be prepared by any heart failure, including damage to the heart valves, vitamin meansknowninthe art. For example, DNA clones for micro- deficiency, and primary cardiac muscle disease. Though the injection can be cleaved with enzymesappropriate for remov- precise physiological mechanisms of heart failure are not ing the bacterial plasmid sequences, and the DNA fragments entirely understood, heart failure is generally believed to electrophoresed on 1% agarose gels in TBE buffer, using involve disorders in several cardiac autonomic properties, standard techniques. The DNA bandsare visualized by stain- including sympathetic, parasympathetic, and baroreceptor ing with ethidium bromide, and the band containing the responses. The phrase “manifestations of heart failure” is expression sequences is excised. The excised band is then used broadly to encompassall ofthe sequelae associated with placed in dialysis bags containing 0.3 M sodium acetate, pH heart failure, such as shortness of breath, pitting edema, an 7.0. DNA is electroeluted into the dialysis bags, extracted enlarged tender liver, engorged neck veins, pulmonary rales with a 1:1 phenol:chloroform solution and precipitated by and the like including laboratory findings associated with two volumesof ethanol. The DNAis redissolved in 1 ml of heart failure. low salt buffer (0.2 M NaCl, 20 mM Tris, pH 7.4, and 1 mM The term “treatment” or grammatical equivalents encom- EDTA)andpurified on an Elutip-D™column. The column is passes the improvementand/or reversal of the symptoms of first primed with 3 ml of high salt buffer (1 M NaCl, 20 mM 40 heart failure (i.e., the ability of the heart to pump blood). Tris, pH 7.4, and 1 mM EDTA) followed by washing with 5 “Improvementin the physiologic function” of the heart may mlof low salt buffer. The DNA solutions are passed through be assessed using any of the measurements described herein the column three times to bind DNAto the column matrix. (e.g., measurementof ejectionfraction, fractional shortening, After one wash with 3 mloflow salt buffer, the DNA is eluted left ventricular internal dimension, heart rate, etc.), as well as with 0.4 ml high salt buffer and precipitated by two volumes 45 any effect upon the animal’s survival. In use of animal mod- of ethanol. DNA concentrations are measured by absorption els, the response of treated transgenic animals and untreated at 260 nm in a UV spectrophotometer. For microinjection, transgenic animals is compared using any of the assays DNA concentrations are adjusted to 3 ug/ml in 5 mM Tris, pH described herein (in addition, treated and untreated non- 7.4 and 0.1 mM EDTA. Other methods for purification of transgenic animals may be included as controls). A com- DNA for microinjection are described in Palmiter et al. pound which causes an improvement in any parameter asso- (1982); and in Sambrooket al. (2001). ciated with heart failure used in the screening methodsof the In an exemplary microinjection procedure, female mice six instant invention may thereby be identified as a therapeutic weeksofage are inducedto superovulate with a 5 IU injection compound. (0.1 cc, ip) of pregnant mare serum gonadotropin (PMSG; The term “dilated cardiomyopathy”refers to a type ofheart Sigma) followed 48 hourslater by a 5 IU injection (0.1 cc, ip) failure characterized by the presence of a symmetrically ofhuman chorionic gonadotropin (hCG; Sigma). Females are dilated left ventricle with poor systolic contractile function placed with males immediately after hCG injection. Twenty- and, in addition, frequently involves the right ventricle. one hours after hCG injection, the mated females are sacri- The term “compound”refers to any chemical entity, phar- ficed by C02 asphyxiation or cervical dislocation and maceutical, drug, and the like that can be used to treat or embryos are recovered from excised oviducts and placed in prevent a disease, illness, sickness, or disorder of bodily Dulbecco’s phosphate buffered saline with 0.5% bovine function. Compounds comprise both known and potential serum albumin (BSA; Sigma). Surrounding cumuluscells are therapeutic compounds. A compound can be determinedto be removed with hyaluronidase (1 mg/ml). Pronuclear embryos therapeutic by screening using the screening methods of the are then washed and placed in Earle’s balancedsalt solution present invention. A “known therapeutic compound”refersto containing 0.5% BSA (EBSS) in a 37.5° C. incubator with a a therapeutic compoundthat has been shown(e.g., through humidified atmosphere at 5% CO,, 95% air until the time of animal trials or prior experience with administration to injection. Embryos can be implanted at the two-cell stage. humans)to be effective in such treatment. In other words, a US 8,940,711 B2 45 46 known therapeutic compoundis not limited to a compound cation may mean “one,” but it is also consistent with the efficacious in the treatmentofheart failure. meaning of “one or more,” “at least one,” and “one or more Asused herein, the term “cardiac hypertrophy”refers to than one.” the process in which adult cardiac myocytes respondto stress It is contemplated that any embodimentdiscussed herein through hypertrophic growth. Such growth is characterized can be implemented with respect to any method or composi- by cell size increases without cell division, assembling of tion of the invention, and vice versa. Furthermore, composi- additional sarcomeres within the cell to maximize force gen- tions andkits of the invention can be used to achieve methods eration, and an activation of a fetal cardiac gene program. of the invention. Cardiac hypertrophyis often associated with increased risk of Throughout this application, the term “about” is used to morbidity and mortality, and thus studies aimed at under- indicate that a value includes the standard deviation of error standing the molecular mechanismsof cardiac hypertrophy for the device or method being employed to determine the value. could have a significant impact on humanhealth. The use of the term “or” in the claims is used to mean As used herein, the term “modulate”refers to a change or “and/or” unless explicitly indicated to refer to alternatives an alteration in a biological activity. Modulation may be an only or the alternatives are mutually exclusive, although the increase or a decrease in protein activity, a change in kinase disclosure supportsa definition that refers to only alternatives activity, a change in binding characteristics, or any other and “and/or.” changein the biological, functional, or immunological prop- Asused in this specification and claim(s), the words “com- erties associated with the activity of a protein or other struc- prising” (and any form ofcomprising, suchas “comprise” and ture of interest. The term “modulator” refers to any molecule “comprises”), “having” (and any form of having, such as or compound which is capable of changing oraltering bio- “have” and “has”’), “including” (and any form of including, logical activity as described above. such as “includes” and “include”) or “containing” (and any The term “B-adrenergic receptor antagonist” refers to a form of containing, such as “contains” and “contain’’) are chemical compound or entity that is capable of blocking, inclusive or open-ended and do not exclude additional, unre- either partially or completely, the beta (B) type of adrenore- cited elements or methodsteps. ceptors (1.e., receptors of the adrenergic system that respond Although section headers have been inserted into this to catecholamines, especially norepinephrine). Some (-adr- application to facilitate review, such headers should not be energic receptor antagonists exhibit a degree of specificity for construed as a division of embodiments. one receptor subtype (generally 6,); such antagonists are The following examples are included to further illustrate termed “B,-specific adrenergic receptor antagonists” and 30 various aspects of the invention. It should be appreciated by “B.,-specific adrenergic receptor antagonists.” The term those of skill in the art that the techniques disclosed in the B-adrenergic receptor antagonist” refers to chemical com- examples which follow represent techniques and/or compo- pounds that are selective and non-selective antagonists. sitions discovered by the inventor to function well in the Examples of f-adrenergic receptor antagonists include, but practice of the invention, and thus can be considered to con- are not limited to, acebutolol, atenolol, butoxamine,carteolol, stitute preferred modes for its practice. However, those of esmolol, labetolol, metoprolol, nadolol, penbutolol, pro- skill in the art should, in light of the present disclosure, panolol, and timolol. The use of derivatives of known (-adr- appreciate that many changes can be made in the specific energic receptor antagonists is encompassed by the methods embodiments which are disclosed andstill obtain a like or of the present invention. Indeed any compound, which func- similar result without departing from the spirit and scope of tionally behaves as a B-adrenergic receptor antagonist is 40 the invention. encompassed by the methods of the present invention. The terms “angiotensin-converting enzyme inhibitor” or EXAMPLES “ACEinhibitor”refer to a chemical compoundorentity that is capable of inhibiting, either partially or completely, the Encoded within an intron of the a-MHCgene is miR-208 enzyme involved in the conversion of the relatively inactive 45 (FIG. 1A). Like a-MHC, miR-208 is expressed specifically in angiotensin I to the active angiotensin IJ in the renin-angio- the heart with trace expression in the lung (FIG. 1B). miR-208 tensin system. In addition, the ACE inhibitors concomitantly is processed out of the a-MHC pre-mRNArather than being inhibit the degradation of bradykinin, which likely signifi- transcribed as a separate transcript. Intriguingly, however, cantly enhances the antihypertensive effect ofthe ACE inhibi- miR-208 displays a remarkably long half-life of at least 14 tors. Examples ofACE inhibitors include, but are not limited days, and can thereby exert functions even when a-MHC to, benazepril, captopril, enalopril, fosinopril, lisinopril, qui- mRNA expression has been down-regulated. Although april and ramipril. The use of derivatives of known ACE genetic deletion ofmiR-208 in micefailed to induce an overt inhibitors is encompassed by the methods of the present phenotype, microarray analysis on hearts from wild-type and invention. Indeed any compound, which functionally behaves miR-208~~ animals at 2 months of age revealed removal of as an ACE inhibitor, is encompassed by the methods of the miR-208to result in pronounced expression ofnumerousfast present invention. skeletal muscle contractile protein genes, which are normally As used herein, the term “genotypes”refers to the actual not expressed in the heart. Thus, these results suggest that genetic make-up of an organism, while “phenotype”refers to under normal conditions miR-208 is co-expressed with the physical traits displayed by an individual. In addition, the sole cardiac-specific MHC geneto maintain cardiomyocyte “phenotype” is the result of selective expression of the identity by repressing the expression of skeletal muscle genes genome(1.e., it is an expression of the cell history and its in the heart. response to the extracellular environment). Indeed, the The most remarkable function ofmiR-208 wasrevealed by human genomecontains an estimated 30,000-35,000 genes. the aberrant response of miR-208-null miceto cardiac stress In each cell type, only a small (1.e., 10-15%)fraction ofthese (van Rooijj et al., 2007). In response to pressure overload by genes are expressed. 65 thoracic aortic constriction or signaling by calcineurin,a cal- The use of the word “a”or “an” when used in conjunction cium/calmodulin-dependent phosphatase that drives patho- with the term “comprising” in the claims and/or the specifi- logical remodeling of the heart, miR-208-null mice showed US 8,940,711 B2 47 48 virtually no hypertrophy of cardiomyocytes or fibrosis and probed with a cDNA fragment of a-MHCcovering a part of were unable to up-regulate B-MHCexpression (FIGS. 6-8). the 5'UTRregion andfirst exon. In contrast, other stress responsive genes, such as those PTU Treatment. encoding ANF and BNP, werestrongly induced in miR-208 Thyroid hormone deficiency was induced by feeding ani- mutant animals, demonstrating that miR-208 is dedicated mals for the indicated durations with iodine-free chow specifically to the control of B-MHC expression, which can supplemented with 0.15% PTU purchased from Harlan Tek- be uncoupled from other facets ofthe cardiac stress response. lad Co. (TD 97061) (Madison, Wis.). B-MHCexpression is repressed by thyroid hormonesig- Microarray and Real-Time PCR Analysis. naling and is up-regulated in the hypothyroid state (Leung et Total RNA from cardiac tissue wasisolated using Trizol al., 2006). miR-208-" animals were also resistant to up- (Invitrogen). Microarray analysis was performed using regulation of }-MHCexpression following treatment with the Mouse Genome 430 2.0 array (Affymetrix). To detect the T3 inhibitor propylthiouracil (PTU), which induces hypothy- level of miRNA, RT-PCR wasperformed using the Taqman roidism.Intriguingly, however, expression of B-MHCbefore MicroRNA reverse Transcriptase kit (Applied Biosystems, birth was normal in miR-208 mutant mice, indicating that ABI) according to the manufacturer’s recommendations. miR-208is dedicated specifically to the post-natal regulation Five ng of RNA wasused to generate cDNA with a miRNA of B-MHCexpression, which coincides with the acquisition specific primer, after which a miRNAspecific Taqman probe ofthyroid hormone responsiveness ofthe B-MHCgene(FIG. served to detect the expression level ofthe miRNAofinterest. 5). Following RT-PCR with random hexamer primers (Invitro- A clue to the mechanism of action ofmiR-208 comes from gen)on RNA samples, the expression of a subset ofgenes was the resemblance ofmiR-208~~ hearts to hyperthyroid hearts, analyzed by either PCR or quantitative real time PCR using both of which display a block to B-MHC expression, up- Taqman probes purchased from ABI. regulation of stress-response genes and protection against Generation of miR-208 Mutant Mice. pathological hypertrophy andfibrosis (FIGS. 6-10). The up- To generate the miR-208 targeting vector, a 0.4 kb frag- regulation of fast skeletal muscle genes in miR-208-” hearts ment (5' arm) extending upstream of the miR-208 coding also mimics the inductionof fast skeletal muscle fibers in the region was digested with SaclII and Not] andligated into the hyperthyroid state (Weiet al., 2005). pGKneoF2L2dta targeting plasmid upstream of the loxP sites These findings suggest that miR-208acts, at least in part, and the Frt-flanked neomycin cassette. A 3.3 kb fragment (3' by repressing expression of a common componentofstress- arm) was digested with SalI and HindIII andligated into the response and thyroid hormone signaling pathways in the vector between the neomycin resistance and Dta negative heart. Amongthe strongest predicted targets of miR-208 is 30 selection cassettes. Targeted ES-cells carrying the disrupted the thyroid hormone receptor (TR) co-regulator THRAP1, allele were identified by Southern blot analysis with 5' and 3' which can exert positive and negative effects on transcription probes. Three miR-208 targeted ES clones were identified (Pantoset al., 2006; Yao and Eghbali, 1992; FIG. 12). The TR and usedfor blastocyst injection. The resulting chimeric mice acts through a negative thyroid hormoneresponse element were bred to C57BL/6to obtain germline transmission of the (TRE)to repress B-MHCexpression in the adult heart (Zhao mutantallele. etal., 2005). Thus, the increase in THRAP1 expression in the Generation of Transgenic Mice. absence of miR-208 would be predicted to enhance the A mouse genomic fragmentflanking the miRNA of interest repressive activity of the TR toward B}-MHCexpression, con- was subcloned into a cardiac-specific expression plasmid sistent with the blockade to B-MHCexpression in miR-208-~ containing the a-MHCand human GH poly(A)+ signal (Kiri- hearts. However, although THRAP1 appearsto be a bonefide 40 azis and Kranias, 2000). Genomic DNA wasisolated from target for miR-208, these data do not exclude the potential mousetail biopsies and analyzed by PCRusing primers spe- involvementof additional targets in the regulation of B-MHC cific for the human GH poly(A)+ signal. expression. Western Blotting. Since even a subtle shift towards B-MHCreduces mechani- Myosin was extracted from cardiac tissue as described cal performance andefficiency of the adult heart, it would be 45 (Morkin, 2000). MHC isoforms were separated by SDS of therapeutic value to exploit miR-208 regulation to prevent PAGE and Western blotting was performed with mouse an increase in B-MHCexpression during cardiac disease. The monoclonal a-MHC (BA-G5) (ATCC, Rockville, Md.) and cardiac specificity and dedication of miR-208 to the cardiac mouse monoclonal antimyosin (slow, skeletal M8421) stress response, but not to normalcardiac development, make (Sigma, Mo.), which is highly specific for B-MHC.To detect miR-208 (and its down-stream effectors) an attractive thera- all striated myosin a pan specific antibody (mouse mono- peutic target for manipulating B-MHClevels (FIG. 13). clonal 3-48; Accurate Chemical & Scientific Corporation, Materials and Methods NY) was used. THRAP1 was detected by immunoprecipita- Northern Blot Analysis. tion from 400 pg of cardiac protein lysate. After pre-clearing Cardiac tissue samples of left ventricles of anonymous the samples for 1 hour at 4° C., the supernatant was incubated humans diagnosed as having non-failing or failing hearts 55 overnightat 4° C. with 1 wl rabbit polyclonal anti-THRAP1 (a were obtained from Gilead Colorado (Westminster, Colo.). kind gift of R. Roeder, Rockefeller University) and 15 ul of Cardiac tissue samples ofborder zone regions of anonymous protein A beads. The beads were washedthree times with humansdiagnosedas having suffered a myocardialinfarction lysis buffer and boiled in SDS sample buffer. Immunoprecipi- were obtained. Total RNA wasisolated from cells, mouse,rat tated THRAP1 protein was resolved by SDS-PAGEand ana- and human cardiac tissue samples or isolated myocytes by lyzed using rabbit polyclonal anti-THRAP!1at a dilution of using Trizol reagent (Gibco/BRL). Equal loading was con- 1:3000 andanti-rabbit IgG conjugated to horseradish peroxi- firmed by staining Northern gels with ethidium bromide. dase at a dilution of 1:5000 with detection by Luminol Northern blots to detect microRNAs were performed as Reagent (Santa Cruz). described previously (van rooij et al., 2006). A U6 probe Histological Analysis and RNA In Situ Hybridization. served as a loading control. To detect a-MHC expression, a Tissues used for histology were incubated in Krebs- Northern blot containing 10 ug ofRNA from cardiac tissue of Henselheit solution, fixed in 4% paraformaldehyde, sec- both adult wild-type and miR-208 mutant animals was tioned, and processed for hematoxylin and eosin (H&E) and US 8,940,711 B2 49 50 Masson’s Trichromestaining or in situ hybridization by stan- oligonucleotides was conjugated to cholesterol. Eight week- dard techniques (Krenz and Robbins, 2004). *°5-labeled old C57BL/6 male micereceived either anti-miR-29b (AsAs- RNA probes were generated using Maxiscript kit (Amer- CACUGAUUUCAAAUGGUsGsCsUsAs-Cholesterol) or sham). Signals were pseudocolored in red using Adobe Pho- mismatch miR-29b (AsAsAACUGAUGUCACAUGGUSG- toshop. sAsUsAs-Cholesterol) at a dose of 80 mg/kg body weight or Transthoracic Echocardiography. a comparable volumeof saline through tail vein injection. Cardiac function and heart dimensions were evaluated by Tissues were collected either 3 days or 3 weeksafter treat- two-dimensional echocardiography in conscious mice using ment. a Vingmed System (GE Vingmed Ultrasound, Horten, Nor- way) and a 11.5-MHzlinear array transducer. M-modetrac- 10 Example 1 ings were used to measure anterior and posterior wall thick- nesses at end diastole and endsystole. Left ventricular (LV) Regulation of Cardiac Hypertrophy and Heart internal diameter (LVID) was measuredasthe largest antero- Failure by Stress-Responsive miRNAs posterior diameter in either diastole (LVIDd) or systole (LVIDs). The data were analyzed by a single observer blinded In light of their involvement in modulating cellular pheno- to mouse genotype. LV fractional shortening (FS) wascalcu- types, the inventors hypothesized that miRNAs mayplay a lated according to the following formula: FS (%)=[(LVIDd- role in regulating the response of the heart to cardiacstress, LVIDs)/LVIDd]x100. which is knownto result in transcriptional andtranslational Plasmids and Transfection Assays. changes in gene expression. To investigate the potential A 305 bp genomic fragment encompassing the miR-208 20 involvement of miRNAsin cardiac hypertrophy, they per- coding region was amplified by PCR and ligated into formed side-by-side miRNA microarray analysis in 2 estab- a pCMV6. A 1 kb fragment encompassing the entire murine lished mouse models of cardiac hypertrophy, using a microar- THRAP1-UTR was PCR-amplified and ligated into an HA- ray that represented 186 different miRNAs (Babak et al., tagged pCMV6expression construct and thefirefly luciferase 2004). Mice that were subjected to thoracic aortic banding (fluc) reporter construct (pMIR-REPORT™, Ambion). A 25 (TAB), which induces hypertrophy by increased afterload on mutation of the UCGUCUUA miR-208 seed binding the heart (Hill et al., 2000), were compared to sham operated sequence was constructed through PCR-based mutagenesis. animals. In a second model, transgenic mice expressing acti- Cell Culture, Transfection and Luciferase Assays. vated calcineurin (CnA)in the heart, which results ina severe, A 1793-bp genomic fragment encompassing miR-29b-1 well-characterized form of hypertrophy (Molkentin et al., and miR-29a coding region was amplified by PCR andligated 30 1998), were compared to wild-type littermates (FIG. 14A). into pCMV6. Genomic fragments of the murine 3'UTR RNAisolated from hearts of mice subjected to TAB showed encompassing the miR-29a-c binding site(s) were PCR-am- increased expression of 27 miRNAs compared to sham-op- plified and ligated into the firefly luciferase (f-luc) reporter erated controls, and CnA Tg mice showedincreased expres- construct (pMIR-REPORT™, Ambion). COS cells were sion of 33 miRNAs compared with non-transgenic littermate transfected with Fugene 6 (Stratagene) according to manu- 35 controls, of which 21 were up-regulated in both models. facturer’s instructions. The total amount ofDNA per well was Similarly, TAB and CnA-induced hypertrophy were accom- kept constant by adding the corresponding amountof expres- panied by reduced expression of 15 and 14 miRNAs,respec- sion vector without a cDNAinsert. 48 hours after transfec- tively, of which 7 miRNAs were down-regulated in common tion, cell extracts were assayed for luciferase expression (FIG. 14B). Northern analysis ofthese miRNAs (unpublished using the luciferase assay kit (Promega). Relative promoter 40 data) and previous microarray analyses (Baradet al., 2004; activities are expressed as luminescence relative units nor- Sempereet al., 2004; Shingara et al., 2005; Liu et al., 2004) malized for $-galactosidase expression in the cell extracts. indicate that they are expressed in a wide range of tissues. Cardiac fibroblasts (CFs) were isolated as described pre- Based on their relative expression levels, conservation of viously (Simpson and Savion, 1982). Briefly, hearts were human, rat and mouse sequences, and levels of expression excised from anesthetized neonatal 1-2 day-old Sprague- 45 during hypertrophy, the inventors focused on 11 up- and 5 Dawley rats (Harlan Sprague Dawley, Indianapolis, Ind.), down-regulated miRNAs(FIG. 14C). minced, and digested with pancreatin 0.1%. Cells were plated Northern blot analysis of cardiac RNA from WT and CnA on primaria plates for 2 h, and the medium which contained Tg animals confirmed an increased expression of miRs-21, the cardiomyocyte fraction of the digested tissue was -23, -24, -125b, -195, -199a, and -214, and decreased expres- removed. Cardiac fibroblasts attached andproliferated much sion ofmiRs-29,-93, -150 and -181b (FIG. 14C and FIG.15). morerapidly than cardiac myocytes; this produced virtually Collectively, these data indicate that distinct miRNAs are pure fibroblast cultures after the first passage, which was regulated during cardiac hypertrophy, suggesting the possi- confirmed by repeated differential plating and microscopic bility that they function as modulators of this process. evaluation. Cells were detached with 0.05% trypsin for pas- saging, and culture studies were performedat passages 2 to 4. 55 Example 2 Cells were grown in high glucose (4.5 gm/It) Dulbecco’s modified Eagle’s medium (DMEM) containing 10% heat- Discovery of the miR-29 Family as Down-Stream inactivated FBS andantibiotics (Penicillin and streptomy- Targets for Regulation by miR-208 cin). Myofibroblast differentiation was induced by changing the medium to low serum (2% FBS) with L-ascorbic acid (10 60 The inventors performed a miRNA microarray on hearts ug/ul) and administration of 10 ng/ml TGF£1 for 48 hours. from wild-type and miR-208-null micein an effort to identify In Vivo miR-29b Silencing by Anti-miR Treatment. downstream miRNAsthat might mediate the actions ofmiR- Chemically modified antisense oligonucleotides compris- 208 (FIG. 16). They discovered that multiple members of the ing a sequence complementary to miR-29b (anti-miR-29b) miR-29 family were up-regulated in miR-208-null mice were used to inhibit miR-29b expression. All bases were 65 (FIG. 17). Target prediction indicated that miR-29 family 2'-OMe modified, the first two and last four bases contained a members targeted mRNAsencoding multiple collagens and phosphorothioate internucleoside bond andthe 3' end of the other componentsofthe extracellular matrix (FIG. 18). Thus, US 8,940,711 B2 51 52 the up-regulation of miR-29 family members in miR-208- broblasts (Border and Noble, 1994). Real-time PCR analysis null mice is likely to account for the blockto fibrosis seen in on cardiac fibroblasts exposed to TGF revealed a decrease in these animals (FIG. 19). miR-29a-c expression, suggesting that the decrease in miR- The discovery that miR-29a-c is down-regulated in the 29a-c following MI might be TGFB-regulated (FIG. 21A). diseased heart and targets mRNAsencoding collagens and Interestingly, natriuretic peptides like B-type natriuretic pep- extracellular matrix proteins suggests that strategies to tide (BNP) have been shownto inhibit TGFB-regulated gene enhance expression of miR-29a-c or its association with tar- expression related to fibrosis and myofibroblast conversion get mRNAscan have beneficial effects on the heart in the (Kapoun et al., 2004). In this regard, the inventors reported settings of pathological cardiac remodeling and fibrosis. previously that mice lacking the cardiac-specific miRNA Moreover, elevation of miR-29a-c expression or function 10 miR-208 were resistant to cardiac fibrosis and remodeling mayprevent fibrosis associated with many diseases in tissues and exhibited increased expression of BNP at baseline (van such as skeletal muscle, liver, lung, kidney and others. In Rooij et al., 2007). Since BNP is known to antagonize the addition, the discovery that miR-208 represses miR-29a-c effects of TGF, the inventors speculated that the increased expression, andthat loss of miR-208 upregulates miR-29a-c levels of BNP in these mice might enhancethe expression of expression, indicates that miR-29a-c is a downstream media- 15 miR-29a-c. Indeed, Northern analysis showed a dose-depen- tor of the actions of miR-208 on the heart. dent increase in miR-29a-c expression upon removal ofmiR- Example 3 208, which coincided with an increasing expression level of BNP (FIG. 21B). These data indicate that TGF6 induces the MiR-29a-c Regulates the Expression of Fibrotic 20 expression of collagen related genes in fibroblasts at least Genes partly through decreasing the level of miR-29a-c, which can be inhibited by BNPsecreted by cardiomyocytes. To begin to define the possible functions for miR-29a-c in the heart following MI, the inventors made use of computa- Example 5 tional predictionsto identify possible miR-29a-c targets. The 25 Targetscan prediction website indicated an unexpectedly high In Vivo Knockdown of miR-29a-c Induces Fibrosis numberoffibrosis-related mRNAs encoding collagens, met- and Expression of Collagen Genes allopeptidases, and integrins as possible targets for miR- 29a-c (word-wide web at targetscan.org). To determine To further explore the potential role of miR-29a-c as a whether the downregulation of miR-29a-c might regulate 30 negative regulator of collagen expression, the inventors cardiac fibrosis, the inventors focused on predicted targets knocked down miR-29b in vivo using cholesterol-modified implicated in ECM productionin heart. Elastin (ELN),fibril- oligonucleotides complementary to the mature miRNA lin 1 (FBN1), collagen type I, al and a2 (COLIAI, sequence of miR-29b (anti-miR-29b) andeither saline or an COL1A2) and collagen type I, al (COL3A1) all contain oligonucleotide containing a four-base mismatch (mm miR- 35 one or more conserved potential seed sequences for miR- 29b) as a negative control (FIG. 22A). Three days after a 29a-c (FIG. 20A). single tail vein injection of anti-miR-29b (80 mg/kg), the Because miRNAs down-regulate the steady state levels, as inventors observed a dramatic diminution ofmiR-29b expres- well as the translation, of their target mRNAs,the inventors sion in all tissues examined (FIG. 22B). In contrast, a com- analyzed the expression of predicted miR-29a-c mRNAtar- parable dose of the mm miR-29b antisense oligonucleotide gets. Real-time RI-PCR analysis of these key regulatory 40 genesfor cardiac fibrosis in cardiac samples 3 days after MI had no effect on the expression level ofmiR-29b compared to indicated that the specific downregulation ofmiR-29a-c in the the saline control. Knockdown by anti-miR-29b appeared to infarcted region correlates with the increase in expression of be specific to the mature miRNA, since the level of pre- COL1A1, COL1A2, COL3A1, and FBN1. In contrast, ELN miRNA remained comparable between anti-miR and mm appeared unchangedin the border zone, and even showed an 45 treated animals. While the knockdownin theliver and kidney increase in the remote myocardium (FIG. 20B). appeared to be complete, a low level of miR-29b remained Using a CMV-driven expression plasmid, the inventors detectable in the heart and lung (FIG. 22B). overexpressed miR-29b-1 and miR-29a in COScells (FIG. Since the other miR-29 members share high sequence 20C) with luciferase expression plasmids containing the homology with miR-29b, the expression ofmiR-29a and-c in 3'-UTRs of the predicted miR-29a-c targets. Increasing 50 responseto anti-miR-29b wasalso examined. While signifi- a amounts of CMV-driven miR-29b-1/miR-29a resulted in a cant knockdownin liver and kidney (especially for miR-29c), dose-dependent decrease in luciferase activity, while compa- was detected, cardiac expression did not appear to change rable amounts ofmiR-206, as a control, had no effect (FIGS. (FIG. 23). Real-time PCR analysis indicated that miR-29b 20C-D), substantiating these mRNAsas targets for repression knockdown was sufficient to induce the expression of col- by miR-29a-c. 55 lagen genes in the liver specifically, while this effect was absent in the mismatch controls (FIG. 22C). Example 4 To enhancecardiac knockdown of miR-29b,the inventors Regulation of miR-29a-c in Cardiac Fibroblasts injected 80 mg/kg of oligonucleotide intravenously on two consecutive days and collected material 3 weeks later. North- 60 Cardiac fibrosis is a major aspect ofthe remodeling process ern analysis indicated complete knockdown of miR-29b in typically seen in the failing heart. The proliferation of fibro- kidney and liver in responseto anti-miR-29b comparedto the blasts and increased deposition of ECM componentsresults expression level seen after mm miR-29b injection. Cardiac in myocardial stiffness and diastolic dysfunction. Transform- levels of miR-29b were also dramatically reduced, while the ing growth factor B (TGFB) has been shownto play a domi- 65 expression of miR-29b in lung appeared unaffected by anti- nantrole in the production and deposition of collagens in the miR-29b (FIG. 22D). Collagen expression in the heart was heart and induces a transformation of fibroblasts into myofi- increased in response to miR-29b inhibition (FIG. 22E). US 8,940,711 B2 53 54 Taken together, these data indicate that miR-29b functions as Babaket al., RNA 10:1813-1819, 2004. a negative regulator of collagen gene expression in vivo and Baichwal and Sugden, Jn: Gene Transfer, Kucherlapati (Ed.), thereby influences collagen deposition and fibrosis in the Plenum Press, NY, 117-148, 1986. heart andliver. Banerji et al., Ce//, 27(2 Pt 1):299-308, 1981. Banerji et al., Ce//, 33(3):729-740, 1983. Example 6 Barad et al., Genome Res. 14:2486-2494, 1997. Barneset al., J. Biol. Chem., 272(17):11510-11517, 1997. Down-Regulation of Collagen Expression with a Bartel, Ce//, 116:281-297, 2004. miR-29a-c Mimic Benvenisty and Neshif, Proc. Natl. Acad. Sci. USA, 83(24): 10 9551-9555, 1986. To determine whether overexpression of miR-29a-c was Berket al., J. Clin. Invest. 117:568-575, 2007. capable of reducing collagen expression, the inventors Berkhoutet al., Ce//, 59:273-282, 1989. exposed fibroblasts to a miR-29b mimic. The level of miR- Bhavsar et al., Genomics, 35(1):11-23, 1996. 29b expressionin fibroblasts cultures increased by as much as Blanar et al., EMBO J, 8:1139, 1989. 400-fold after 3 days of exposure to miR-29b mimic (FIG. 15 Bodine and Ley, EMBO J., 6:2997, 1987. 22F). miR-29a expression was unaffected and miR-29c Border and Noble, NV. Engl. J. Med., 331:1286-1292, 1994. expression was increased only slightly by miR-29b mimic Boshart et al., Cell, 41:521, 1985. (FIG. 22F). Real-time PCRanalysis indicatedthatthe expres- Bosze et al., EMBO J.,, 5(7):1615-1623, 1986. sion of collagen genes was diminished in response to miR- Braddock et al., Ce//, 58:269, 1989. 29b mimic (FIG. 22G). However, the magnitude of the 20 Brenneckeet al., Ce//, 113:25-36, 2003. decrease in collagen expression was modest comparedto the Brinsteret al., Proc. Natl. Acad. Sci. USA, 82(13):4438-4442, increase in expression ofmiR-29b,indicating that miR-29a-c 1985. levels are not the sole determinantof collagenlevels. Bristow, Cardiology, 92:3-6, 1999. All publications, patents and patent applications discussed Bulla and Siddiqui, J. Virol., 62:1437, 1986. and cited herein are incorporated herein by reference in their 25 Calin et al., Proc. Natl. Acd. Sci. USA, 99:15524-15529, entireties. All ofthe compositions and methodsdisclosed and 2002. claimed herein can be made and executed without undue Campbell and Villarreal, Mo/. Cell. Biol., 8:1993, 1988. experimentation in light of the present disclosure. While the Campere and Tilghman, Genes and Dev., 3:537, 1989. compositions and methods of this invention have been Campoet al., Nature, 303:77, 1983. described in terms ofpreferred embodiments,it will be appar- 30 Careet al., Nat. Med. 13:613-618, 2007. ent to those of skill in the art that variations maybe applied to Carrington et al. Science, 301(5631):336-338, 2003. the compositions and methods, and in the steps or in the Celander and Haseltine, J. Virology, 61:269, 1987. sequence of steps of the methods described herein without Celanderet al., J. Virology, 62:1314, 1988. departing from the concept, spirit and scope of the invention. Chandleret al., Cell, 33:489, 1983. Morespecifically, it will be apparentthat certain agents which 35 Chang and Karin, Nature, 410(6824):37-40, 2001. are both chemically and physiologically related may be sub- Chang etal., Biochim. Biophys. Acta, 1092(2):153-160, 1991. stituted for the agents described herein while the same or Changet al., Mol. Cell. Biol., 9:2153, 1989. similar results would be achieved.All such similar substitutes Changet al., Nature, 430(7001):785-789, 2004. and modifications apparent to those skilled in the art are Chatterjeeet al., Proc. Natl. Acad. Sci. USA, 86:9114, 1989. deemed to be within the spirit, scope and concept of the 40 Chen and Okayama, Mol. Cell. Biol., 7(8):2745-2752, 1987. invention as defined by the appended claims. Chenetal., Science, 303(5654):83-86, 2004. Choiet al., Cell, 53:519, 1988. REFERENCES Coffin, In: Virology, Fields et al. (Eds.), Raven Press, NY, 1437-1500, 1990. The following references, to the extent that they provide 45 Cohenet al., J. Cell. Physiol., 5:75, 1987. exemplary procedural or other details supplementary to those Costa et al., Mol. Cell. Biol., 8:81, 1988. set forth herein, are specifically incorporated herein byrefer- Couchet al., Am. Rev. Resp. Dis., 88:394-403, 1963. ence. Couparet al., Gene, 68:1-10, 1988. . Pat. No. 4,873,191 Cripe et al., EMBO J, 6:3745, 1987. . Pat. No. 5,604,251 50 Culotta and Hamer, Mol. Cell. Biol., 9:1376, 1989. . Pat. No. 5,844,107 Dandoloet al., J Virology, 47:55-64, 1983. . Pat. No. 5,877,302 De Villiers et al., Nature, 312(5991):242-246, 1984. . Pat. No. 5,972,900 Deschampsetal., Science, 230:1174-1177, 1985. . Pat. No. 5,972,901 Dubensky et al., Proc. Natl. Acad. Sci. USA, 81:7529-7533, . Pat. No. 6,008,336 55 1984. . Pat. No. 6,077,835 Durandet al., Ann. Med., 27:311-317, 1995. . Pat. No. 6,200,801 Edbrookeet al., Mol. Cell. Biol., 9:1908, 1989. . Publn. 20020150626 Edgerton and Roy, J. Appl. Physiol., 89:1224-1231, 2000. . Publn. 20030032615 Edlundet al., Science, 230:912-916, 1985. . Publn. 20030203865 60 Eichhorn and Bristow, Circulation, 94:2285-2296, 1996. USS. Publn. 20040048787 EPO 0273085 Abraham etal., Mol. Med., 8:750-760, 2002. Fatkin et al., J. Clin. Invest., 106(11):1351-1359, 2000. Ambros, Cell, 113(6):673-676, 2003. Fechheimer, et al., Proc Natl. Acad. Sci. USA, 84:8463-8467, Angel et al., Cell, 49:729, 1987b. 1987. Angel et al., Mol. Cell. Biol., 7:2256, 1987a. 65 Feng and Holland, Nature, 334:6178, 1988. Atchison and Perry, Ce//, 46:253, 1986. Ferkolet al., FASEB J, 7:1081-1091, 1993. Atchison and Perry, Ce//, 48:121, 1987. Firak and Subramanian, Mol. Cell. Biol., 6:3667, 1986. US 8,940,711 B2 55 56 Foecking and Hofstetter, Gene, 45(1):101-105, 1986. Kanedaet al., Science, 243:375-378, 1989. Fraley et al., Proc. Natl. Acad. Sci. USA, 76:3348-3352, 1979. Kapounet al., Circ. Res., 94:453-461, 2004. Franzet al., Cardioscience, 5(4):235-43, 1994. Karin et al., Mol. Cell. Biol., 7:606, 1987. Freyet al., Circulation 109:1580-1589, 2004. Karin et al., Mol. Cell. Biol., 7:606, 1987. Friedmanet al., Genes Devel., 3:1314, 1989. Karlsson et al., EMBO J., 5:2377-2385, 1986. Fujita et al., Ced/, 49:357, 1987. Katinkaet al., Ce//, 20:393, 1980. Ghosh and Bachhawat,In: Liver Diseases, Targeted Diagno- Katinkaet al., Nature, 290:720, 1981. sis and Therapy Using Specific Receptors andLigands, Wu Kato et al, J. Biol. Chem., 266:3361-3364, 1991. et al. (Eds.), Marcel Dekker, NY, 87-104, 1991. Kawamotoet al., Mol. Cell. Biol., 8:267, 1988. Ghosh-Choudhury et al., EMBO J, 6:1733-1739, 1987. 10 Kelly et al., . Cell Biol., 129(2):383-396, 1995. Gilles et al., Cell, 33:717, 1983. Kiledjian et al., Mol. Cell. Biol., 8:145, 1988. Gloss et al., EMBO J, 6:3735, 1987. Kimuraet al., Dev. Growth Differ. 39(3):257-265, 1997. Godboutet al., Mol. Cell. Biol., 8:1169, 1988. Kinugawaet al., Circ. Res., 89:591-598, 2001. Gomez-Foix et al., J. Biol. Chem., 267:25129-25134, 1992. Kinugawaet al., J. Clin. Endocrinol. Metab., 86:5089-5090, Goodbourn and Maniatis, Proc. Natl. Acad. Sci. USA, 15 2001. 85:1447, 1988. Kiriazis and Kranias, Annu. Rev. Physiol., 62:321-351, 2000. Goodbournet al., Cell, 45:601, 1986. Klaassen’s The Pharmacological Basis of Therapeutics Gopal, Mol. Cell. Biol., 5:1188-1190, 1985. Klamutet al., Mol. Cell. Biol., 10:193, 1990. Gopal-Srivastavaet al., J. Mol. Cell. Biol. 15(12):7081-7090, Klein et al., Nature, 327:70-73, 1987. 1995. 20 Kochet al., Mol. Cell. Biol., 9:303, 1989. Graham andPrevec, In: Methods in MolecularBiology: Gene Kreket al., Nature Genetics, 37:495-500, 2005. Transfer and Expression Protocol, Murray (Ed.), Humana Krenz and Robbins, J Am. Coll. Cardiol., 44:2390-2397, Press, Clifton, N.J., 7:109-128, 1991. 2004. Graham and Van Der Eb, Virology, 52:456-467, 1973. Kriegler and Botchan, In: Eukaryotic Viral Vectors, Glazman Grahametal., J. Gen. Virl., 36(1):59-74, 1977. 25 (Ed.), Cold Spring Harbor: Cold Spring Harbor Labora- Greeneet al., Immunology Today, 10:272, 1989 tory, NY, 1982. Grishoket al., Ce//, 106:23-34, 2001. Kriegler and Botchan, Mol. Cell. Biol., 3:325, 1983a. Grossched] and Baltimore, Ce//, 41:885, 1985. Kriegler et al., Cell, 38:483, 1984. Grunhaus and Horwitz, Seminar in Virology, 3:237-252, Kriegler et al., Ce//, 53:45, 1988. 1992. 30 Kriegler et al., In: Gene Expression, Alan Liss (Ed.), Hamer Harland and Weintraub, J. Cell Biol., 101(3):1094-1099, and Rosenberg, New York, 1983b. 1985. Kriitzfeldt et al., Nature, 438:685-689, 2005. Haslinger and Karin, Proc. Natl. Acad. Sci. USA, 82:8572, Kuhlet al., Ce//, 50:1057, 1987. 1985. Kunz et al., Nucl. Acids Res., 17:1121, 1989. Hauber and Cullen, J. Virology, 62:673, 1988. 35 Lagos-Quintanaet al., Science, 294(5543):853-858, 2001. Heineke and Molkentin, Nat. Rev. Mol. Cell Biol. 7:589-600, LaPointeet al., Hypertension 273 Pt 2):715-22, 1996. 2006. LaPointeet al., J. Biol. Chem., 263(19):9075-8, 1988. Henet al., Nature, 321:249, 1986. Larsenet al., Proc Natl. Acad. Sci. USA., 83:8283, 1986. Hensel etal., Lymphokine Res., 8:347, 1989. Laspiaet al., Ce//, 59:283, 1989. Hermonat and Muzycska, Proc. Natl. Acad. Sci. USA, 40 Latimeret al., Mol. Cell. Biol., 10:760, 1990. 81:6466-6470, 1984. Lau et al., Science, 294(5543):858-862, 2001. Herr and Clarke, Ce//, 45:461, 1986. Le Gal La Salle et al., Science, 259:988-990, 1993. Hersdorffer et al., DNA Cell Biol., 9:713-723, 1990. Lee and Ambros, Science, 294(5543):862-864, 2001. Herz and Gerard, Proc. Natl. Acad. Sci. USA, 90:2812-2816, Lee et al., Nature, 294:228, 1981. 1993. 45 Leunget al., Proc. Natl. Acad. Sci. USA, 48:18125-18130, Hill et al., Circulation, 101:2863-2869, 2000. 2006. Hirochikaet al., J Virol, 61:2599, 1987. Levinsonet al., Nature, 295:79, 1982. Hirschet al., Mol. Cell. Biol., 10:1959, 1990. Levrero et al., Gene, 101:195-202, 1991. Holbrooket al., Virology, 157:211, 1987. Lin et al., Mol. Cell. Biol., 10:850, 1990. Horlick and Benfield, Mol. Cell. Biol., 9:2396, 1989. 50 Liu et al., Proc Natl Acad Sci USA 101:9740-9744, 2004. Horwichet al. J Virol, 64:642-650, 1990. Loweset al., J. Clin. Invest., 100(9):2315-2324, 1997. Huanget al., Ce//, 27:245, 1981. Luria et al., EMBO J, 6:3307, 1987. Huget al., Mol. Cell. Biol., 8:3065, 1988. Lusky and Botchan, Proc. Natl. Acad. Sci. USA, 83:3609, Hutvagneret al., PLoS Biol., 2(4):E98, 2004. 1986. Hwanget al., Mol. Cell. Biol., 10:585, 1990. 55 Lusky et al., Mo/. Cell. Biol., 3:1108, 1983. Imagawaet al., Ce//, 51:251, 1987. Macejak and Samow, Nature, 353:90-94, 1991. Imbra and Karin, Nature, 323:555, 1986. Majors and Varmus, Proc. Natl. Acad. Sci. USA, 80:5866, Imleret al., Mol. Cell. Biol., 7:2558, 1987. 1983. Imperiale and Nevins, Mol. Cell. Biol., 4:875, 1984. Mann etal., Ce//, 33:153-159, 1983. Ito and Roeder, Trends Endocrinol. Metab., 12:127-134, 60 Markowitz et al., J. Virol., 62:1120-1124, 1988. 2001. McKinseyand Olson, J. Clin. Invest., 115(3):538-546, 2005. Jakobovits et al., Mol. Cell. Biol., 8:2555, 1988. McNeall et al., Gene, 76:81, 1989. Jameel and Siddiqui, Mo/. Cell. Biol., 6:710, 1986. Meister and Tuschl, Nature, 431:343-9, 2004. Jayneset al., Mol. Cell. Biol., 8:62, 1988. Miksiceket al., Cell, 46:203, 1986. Johnsonet al., Mol. Cell. Biol., 9:3393, 1989. 65 Miyata et al., Circ. Res., 86(4):386-390, 2000. Jones and Shenk, Ce//, 13:181-188, 1978. Molkentin et al., Ce// 93:215-228, 1998. Kadesch and Berg, Mol. Cell. Biol., 6:2593, 1986. Mordacq and Linzer, Genes and Dev., 3:760, 1989. US 8,940,711 B2 57 58 Moreauet al., Nucl. Acids Res., 9:6047, 1981. Shingaraet al., RNA 11:1461-1470, 2005. Morkin, Microsc. Res. Tech., 50:522-531, 2000. Simpson and Savion, Circ. Res., 50:101-116, 1982. Mosset al., Biol. Chem., 271(49):31688-31694, 1996. Sleigh and Lockett, J EMBO, 4:3831, 1985. Muesinget al., Cell, 48:691, 1987. Spalholz et al., Ce//, 42:183, 1985. Nakaoetal., Clin. Invest., 100(9):2362-2370, 1997. Spandau and Lee, J. Virology, 62:427, 1988. Nget al., Nuc. Acids Res., 17:601, 1989. Spandidos and Wilkie, EMBO J. 2:1193, 1983. Nicolas and Rubinstein, In: Vectors: A survey of molecular Stephens and Hentschel, Biochem. J., 248:1, 1987. cloning vectors and their uses, Rodriguez and Denhardt Stratford-Perricaudet and Perricaudet, In: Human Gene (Eds), Stoneham: Butterworth, 494-513, 1988. Transfer, Eds, Cohen-Haguenauer and Boiron, John Nicolau and Sene, Biochim. Biophys. Acta, 721:185-190, 10 Libbey Eurotext, France, 51-61, 1991. 1982. Stratford-Perricaudet et al., Hum. Gene. Ther, 1:241-256, Nicolau et al., Methods Enzymol., 149:157-176, 1987. 1990. Ondeket al., EMBO J, 6:1017, 1987. Ornitz et al., Mol. Cell. Biol., 7:3466, 1987. Stuart et al., Nature, 317:828, 1985. Sullivan and Peterlin, Mol. Cell. Biol., 7:3315, 1987. Palmiteret al., Nature, 300:611, 1982. 15 Pantos et al., Horm. Metab. Res., 38:308-313, 2006. Swartzendruber and Lehman, / Cell. Physiology, 85:179, Paskindet al., Virology, 67:242-248, 1975. 1975. Pasquinelli and Ruvkun, Ann. Rev. Cell Dev. Biol., 18:495- Takebe et al., Mol. Cell. Biol., 8:466, 1988. 513, 2002. Tavernieret al., Nature, 301:634, 1983. PCT Appin. WO 0071096 20 Taylor and Kingston, Mol. Cell. Biol., 10:165, 1990a. PCT Appin. WO 84/03564 Taylor and Kingston, Mol. Cell. Biol., 10:176, 1990b. PCT Appln. WO 98/33791 Taylor et al., J Biol, Chem., 264:15160, 1989. Pechet al., Mol. Cell. Biol., 9:396, 1989. Temin, In: Gene Transfer, Kucherlapati (Ed.), NY, Plenum Pelletier and Sonenberg, Nature, 334(6180):320-325, 1988. Press, 149-188, 1986. Perales et al., Proc. Natl. Acad. Sci. USA, 91:4086-4090, 25 The Merck Index, Eleventh Edition 1994, Thiesenet al., J. Virology, 62:614, 1988. Perez-Stable and Constantini, Mo/. Cell. Biol., 10:1116, Top et al., J. Infect. Dis., 124:155-160, 1971. 1990. Treisman, Cell, 46(4):567-174, 1986 Physicians Desk Reference Troncheet al., Mol. Biol. Med., 7:173, 1990. Picard and Schaffner, Nature, 307:83, 1984. 30 Troncheet al., Mol. Cell. Biol., 9(11):4759-4766, 1989. Pinkert et al., Genes and Dev., 1:268, 1987. Trudel and Constantini, Genes and Dev., 6:954, 1987. Ponta et al., Proc. Natl. Acad. Sci. USA, 82:1020, 1985. Tur-Kaspaet al., Mol. Cell. Biol., 6:716-718, 1986. Porton et al., Mol. Cell. Biol., 10:1076, 1990. Tyndell et al., Nuc. Acids. Res., 9:6231, 1981. Potter et al., Proc. Natl. Acad. Sci. USA, 81:7161-7165, 1984. van Rooij et al., Proc. Natl. Acad. Sci. USA, 103(48):18255- Queen and Baltimore, Ce//, 35:741, 1983. 35 18260, 2006. Quinn et al., Mol. Cell. Biol., 9:4713, 1989. van Rooij et al., Science 316(5824):575-579. 2007 Racheret al., Biotechnology Techniques, 9:169-174, 1995. Vannice and Levinson, J. Virology, 62:1305, 1988. Ragotet al., Nature, 361:647-650, 1993. Varmuset al., Ce//, 25:23-36, 1981. Redondoet al., Science, 247:1225, 1990. Vasseuret al., Proc Natl. Acad. Sci. USA, 77:1068, 1980. Reisman and Rotter, Mol. Cell. Biol., 9:3571, 1989. 40 Wagneret al., Proc. Natl. Acad. Sci. USA 87(9):3410-3414, Remington’s Pharmaceutical Sciences, 15” ed., pages 1035- 1990. 1038 and 1570-1580, Mack Publishing Company, Easton, Wang, and Calame, Ce//, 47:241, 1986. Pa., 1980. Weberet al., Cell, 36:983, 1984. Renan, Radiother. Oncol., 19:197-218, 1990. Weiet al., J. Endocrinol. Invest., 28:8-11, 2005. ResendezJr. et al., Mo/. Cell. Biol., 8:4579, 1988. 45 Weinbergeret al. Mol. Cell. Biol., 8:988, 1984. Rich et al., Hum. Gene Ther. 4:461-476, 1993. Winoto and Baltimore, Cel/, 59:649, 1989. Ridgeway, In: Vectors: A Survey ofMolecular Cloning Vec- Wonget al., Gene, 10:87-94, 1980. tors and Their Uses, Rodriguez et al. (Eds.), Stoneham: Wuand Wu, Adv. Drug Delivery Rev., 12:159-167, 1993. Butterworth, 467-492, 1988. Wuand Wu,Biochemistry, 27: 887-892, 1988. Ripe et al., Mol. Cell. Biol., 9:2224, 1989. 50 Wu and Wu, / Biol. Chem., 262:4429-4432, 1987. Rippe, et al., Mol. Cell. Biol., 10:689-695, 1990. Xu et al., Curr, Biol., 13:790-795, 2003. Rittling et al., Nuc. Acids Res., 17:1619, 1989. Yamauchi-Takihara et. al., Proc. Natl. Acad. Sci. USA, Rosenet al., Ce//, 41:813, 1988. 86(10):3504-3508, 1989. Rosenfeldet al., Science, 252:431-434, 1991. Yang and Russell, Proc. Natl. Acad. Sci. USA, 87:4144-4148, Rosenfeld, et al., Ce//, 68:143-155, 1992. 55 1990. Rouxet al., Proc. Natl. Acad. Sci. USA, 86:9079-9083, 1989. Yanget al., Nat. Med. 13:486-491, 2007. Sakai et al., Genes and Dev., 2:1144, 1988. Yao and Eghbali, Circ. Res. 71:831-839, 1992. Sambrook and Russell, Molecular Cloning: A Laboratory Younget al., In: Handbook ofApplied Therapeutics, 7.1-7.12 Manual 3’ Ed., Cold Spring Harbor Laboratory Press, and 9.1-9.10, 1989. 2001. 60 Yu et al., Biochem. Biophys. Res. Commun. 349(1):59-68. Satake et al., J. Virology, 62:970, 1988. Epub Aug. 11, 2006. Schaffneret al., 4 Mol. Biol., 201:81, 1988. Yutzey et al. Mol. Cell. Biol., 9:1397, 1989. Searle et al., Mol. Cell. Biol., 5:1480, 1985. Zelenin et al., FEBS Lett., 287(1-2):118-120, 1991. Sempereet al., Genome Biol 5:R13, 2004. Zeng et al., Mol. Cell., 9(6):1327-33, 2002. Sharp and Marciniak, Ce//, 59:229, 1989. 65 Zhaoet al., Proc. Natl. Acad. Sci. USA, 102(13):4890-4895, Shaul and Ben-Levy, EMBO J., 6:1913, 1987. 2005. Sherman etal., Mol. Cell. Biol., 9:50, 1989. Ziober and Kramer, J. Bio. Chem., 271(37):22915-22, 1996 US 8,940,711 B2 59 60

SEQUENCE LISTING

<160> NUMBER OF SEQ ID NOS: 22

<210> SEQ ID NO 1 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Homo sapiens

<400> SEQUENCE: 1 tgacgggega gettttggcee cgggttatac ctgatgetca cgtataagac gagcaaaaag 60 ettgttggte a 71

<210> SEQ ID NO 2 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Mus sp.

<400> SEQUENCE: 2 tgacgggtga gettttggce cgggttatac ctgactctca cgtataagac gagcaaaaag 60 ettgttggte a 71

<210> SEQ ID NO 3 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Rattus sp.

<400> SEQUENCE: 3 tgacgggtga gettttggce cgggttatac ctgactctca cgtataagac gagcaaaaag 60 ettgttggte a 71

<210> SEQ ID NO 4 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Canis sp.

<400> SEQUENCE: 4 tgacgeatga gcettttggct cgggttatac ctgatgetca cgtataagac gagcaaaaag 60 ettgttggte a 71

<210> SEQ ID NO 5 <211> LENGTH: 22 <212> TYPE: RNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: miR-208 sequence

<400> SEQUENCE: 5 auaagacgag caaaaagecuu gu 22

<210> SEQ ID NO 6 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Homo sapiens

<400> SEQUENCE: 6

uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aaaguugcag 60 uaggguuge 69

<210> SEQ ID NO 7 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Pan sp. US 8,940,711 B2 61 62 -continued

<400> SEQUENCE: 7 uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aacguugcag 60 uaggguuge 69

<210> SEQ ID NO 8 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Mus sp.

<400> SEQUENCE: 8 uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aacguugcag 60 uaggguuge 69

<210> SEQ ID NO 9 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Rattus sp.

<400> SEQUENCE: 9 uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aacguugcag 60 uaggguuge 69

<210> SEQ ID NO 10 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Canis sp.

<400> SEQUENCE: 10

uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aacguugcag 60 uaggguuge 69

<210> SEQ ID NO 11 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Gallus sp.

<400> SEQUENCE: 11

uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aacguugcag 60 uaggguuge 69

<210> SEQ ID NO 12 <211> LENGTH: 72 <212> TYPE: RNA <213> ORGANISM: Takifugu

<400> SEQUENCE: 12 uuccugcuuu aagcaauugg uugaaaauau auguauguaa uggucuuaau uaaaaaaaca 60

aacuaagaca aa 72

<210> SEQ ID NO 13 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Danio sp.

<400> SEQUENCE: 13

uuccugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuucauuac aaaaacgaac 60

caucaaacg 69 US 8,940,711 B2 63 64 -continued

<210> SEQ ID NO 14 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Homo sapiens

<400> SEQUENCE: 14 acegggegage ttttggeccg ggttatacct gatgetcacg tataagacga gcaaaaaget 60 tgttggtcag a 71

<210> SEQ ID NO 15 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Mus sp.

<400> SEQUENCE: 15 acgggtgage ttttggceccg ggttatacct gactctcacg tataagacga gcaaaaaget 60 tgttggtcag a 71

<210> SEQ ID NO 16 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Rattus sp.

<400> SEQUENCE: 16 acgggtgage ttttggceccg ggttatacct gactctcacg tataagacga gcaaaaaget 60 tgttggtcag a 71

<210> SEQ ID NO 17 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Canis sp.

<400> SEQUENCE: 17 acgcatgage ttttggctcg ggttatacct gatgetcacg tataagacga gcaaaaaget 60 tgttggtcag a 71

<210> SEQ ID NO 18 <211> LENGTH: 22 <212> TYPE: RNA <213> ORGANISM: Homo sapiens

<400> SEQUENCE: 18 uageaccauc ugaaaucggu ua 22

<210> SEQ ID NO 19 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Homo sapiens

<400> SEQUENCE: 19 uageaccauu ugaaaucagu guu 23

<210> SEQ ID NO 20 <211> LENGTH: 22 <212> TYPE: RNA <213> ORGANISM: Homo sapiens

<400> SEQUENCE: 20 uageaccauu ugaaaucggu ua 22 US 8,940,711 B2 65 66 -continued

<210> SEQ ID NO 21 <211> LENGTH: 71 <212> TYPE: RNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: Pre miR-208 sequence

<400> SEQUENCE: 21 ugacgggega gcuuuuggee cggguuauac cugaugcuca cguauaagac gagcaaaaag 60 cuuguugguc a 71

<210> SEQ ID NO 22 <211> LENGTH: 27 <212> TYPE: RNA <213> ORGANISM: Homo sapiens

<400> SEQUENCE: 22 uageaccauu ugaaagaaau caguguu 27

The invention claimedis: 10. The methodof claim 9, wherein the sugar modification 1. A methodof inducing collagen deposition in a tissue of is a modification selected from the group consisting of 2'-O- a subject in need thereof comprising contacting said tissue 25 alkyl, 2'-O-methyl, 2'-O-methoxyethyl, 2'-fluoro, and a with an antisense oligonucleotide comprising a sequence that locked nucleic acid. 11. The method of claim 9, wherein the backbone modifi- is at least partially complementary to a miR-29a, miR-29b, cation is a phosphorothioate linkage. and/or miR-29¢ sequence. 12. The method of claim 1, wherein the antisense oligo- 2. The method of claim 1, wherein the antisense oligonucleotide is conjugated to cholesterolat its 3' terminus. 30 nucleotide comprises a sequence that is at least partially 13. The method of claim 1, wherein said tissue is facial complementary to SEQ ID NO: 18, SEQ ID NO: 19, and/or tissue. SEQ ID NO:20. 14. The methodof claim 13, wherein said facialtissueis a 3. The method of claim 2, wherein the antisense oligo- forehead, a lip, a cheek, a chin, an eyebrow, an eyelid, under nucleotide comprises a sequencethatis at least 85% comple- the eye, or near the mouth. 35 mentary to SEQ ID NO: 18, SEQ ID NO:19, and/or SEQ ID 15. The method of claim 1, wherein said tissue is skin, NO:20. bone,or blood vessels. 16. The method of claim 1, wherein said tissue comprises 4. The method of claim 2, wherein the antisense oligo- a wound, a skin graft, scar tissue, wrinkles, lax skin, sun nucleotide comprises a sequencethat is at least 95% comple- damage, chemical damage, heat damage, cold damage, and/ mentary to SEQ ID NO: 18, SEQ ID NO:19, and/or SEQ ID 40 or stretch marks. NO:20. 17. The method of claim 1, wherein said contacting com- 5. The method of claim 2, wherein the antisense oligo- prises injection of the antisense oligonucleotide into said nucleotide comprises a sequence that is 100% complemen- tissue or vasculature that feeds said tissue. tary to SEQ ID NO:18, SEQ ID NO:19, and/or SEQ ID NO: 18. The method of claim 1, wherein said contacting com- 20. 45 prises applying a topical formulation comprising the anti- 6. The method of claim 1, wherein the antisense oligo- sense oligonucleotide. nucleotide comprises a sequencethat is substantially comple- 19. The method of claim 18, wherein said topical formu- mentary to a pre-miR-29a, pre-miR-29b, or pre-miR-29¢ lation is an ointment, cream, gel, salve, or balm. sequence. 20. The method of claim 1, further comprising administer- 7. The method of claim 1, wherein the antisense oligo- 50 ing a second agent or second treatmentto the subject. 21. The methodof claim 20, wherein said second agentis nucleotide is about 15 to about 50 nucleotides in length. 8. The method of claim 1, wherein the antisense oligo- topical vitamin A, topical vitamin C, or vitamin E. 22. The method ofclaim 20, wherein said second treatment nucleotide is about 19 to about 25 nucleotides in length. comprises a chemical peel, laser treatment, dermaplaning, or 9. The method of claim 1, wherein the antisense oligonucleotide comprises at least one sugar and/or backbone 55 dermabrasion. modification.